summaryrefslogtreecommitdiff
diff options
context:
space:
mode:
-rw-r--r--.gitignore1
-rw-r--r--Makefile.in5
-rw-r--r--benchmark/bm_require.rb7
-rw-r--r--benchmark/bm_require_thread.rb15
-rw-r--r--benchmark/bm_so_count_words.rb19
-rw-r--r--benchmark/bm_so_k_nucleotide.rb48
-rw-r--r--benchmark/bm_so_reverse_complement.rb30
-rwxr-xr-xbenchmark/driver.rb397
-rw-r--r--benchmark/make_fasta_output.rb19
-rw-r--r--benchmark/prepare_require.rb25
-rw-r--r--benchmark/prepare_require_thread.rb2
-rw-r--r--benchmark/prepare_so_count_words.rb15
-rw-r--r--benchmark/prepare_so_k_nucleotide.rb2
-rw-r--r--benchmark/prepare_so_reverse_complement.rb2
-rw-r--r--benchmark/require.yml36
-rw-r--r--benchmark/require_thread.yml44
-rw-r--r--benchmark/so_count_words.yml (renamed from benchmark/wc.input.base)91
-rw-r--r--benchmark/so_k_nucleotide.yml155
-rw-r--r--benchmark/so_reverse_complement.yml137
-rw-r--r--common.mk16
-rw-r--r--win32/Makefile.sub4
21 files changed, 506 insertions, 564 deletions
diff --git a/.gitignore b/.gitignore
index 6184ec3995..5adf6ccf52 100644
--- a/.gitignore
+++ b/.gitignore
@@ -60,6 +60,7 @@ lcov*.info
/archive
/autom4te*.cache
/automake
+/benchmark/benchmark-driver
/beos
/bmlog-*
/breakpoints.gdb
diff --git a/Makefile.in b/Makefile.in
index 8a1271c7ab..863e573baa 100644
--- a/Makefile.in
+++ b/Makefile.in
@@ -515,6 +515,11 @@ gcov:
lcov:
$(Q) $(BASERUBY) $(srcdir)/tool/run-lcov.rb
+update-benchmark-driver:
+ $(Q) $(srcdir)/tool/git-refresh -C $(srcdir)/benchmark $(Q1:0=-q) \
+ --branch $(BENCHMARK_DRIVER_GIT_REF) \
+ $(BENCHMARK_DRIVER_GIT_URL) benchmark-driver $(GIT_OPTS)
+
update-doclie:
$(Q) $(srcdir)/tool/git-refresh -C $(srcdir)/coverage $(Q1:0=-q) \
--branch $(DOCLIE_GIT_REF) \
diff --git a/benchmark/bm_require.rb b/benchmark/bm_require.rb
deleted file mode 100644
index b8abc88f41..0000000000
--- a/benchmark/bm_require.rb
+++ /dev/null
@@ -1,7 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-1.upto(10000) do |i|
- require "c#{i}"
-end
-
-$:.pop
diff --git a/benchmark/bm_require_thread.rb b/benchmark/bm_require_thread.rb
deleted file mode 100644
index e54db6c6e5..0000000000
--- a/benchmark/bm_require_thread.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-$:.push File.join(File.dirname(__FILE__), "bm_require.data")
-
-i=0
-t = Thread.new do
- while true
- i = i+1 # dummy loop
- end
-end
-
-1.upto(100) do |i|
- require "c#{i}"
-end
-
-$:.pop
-t.kill
diff --git a/benchmark/bm_so_count_words.rb b/benchmark/bm_so_count_words.rb
deleted file mode 100644
index 65f6337a4a..0000000000
--- a/benchmark/bm_so_count_words.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-#!/usr/bin/ruby
-# -*- mode: ruby -*-
-# $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
-# http://www.bagley.org/~doug/shootout/
-# with help from Paul Brannan
-
-input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
-
-nl = nw = nc = 0
-while true
- tmp = input.read(4096) or break
- data = tmp << (input.gets || "")
- nc += data.length
- nl += data.count("\n")
- ((data.strip! || data).tr!("\n", " ") || data).squeeze!
- nw += data.count(" ") + 1
-end
-# STDERR.puts "#{nl} #{nw} #{nc}"
-
diff --git a/benchmark/bm_so_k_nucleotide.rb b/benchmark/bm_so_k_nucleotide.rb
deleted file mode 100644
index dadab3e79c..0000000000
--- a/benchmark/bm_so_k_nucleotide.rb
+++ /dev/null
@@ -1,48 +0,0 @@
-# The Computer Language Shootout
-# http://shootout.alioth.debian.org
-#
-# contributed by jose fco. gonzalez
-# modified by Sokolov Yura
-
-seq = String.new
-
-def frecuency( seq,length )
- n, table = seq.length - length + 1, Hash.new(0)
- f, i = nil, nil
- (0 ... length).each do |f|
- (f ... n).step(length) do |i|
- table[seq[i,length]] += 1
- end
- end
- [n,table]
-
-end
-
-def sort_by_freq( seq,length )
- n,table = frecuency( seq,length )
- a, b, v = nil, nil, nil
- table.sort{|a,b| b[1] <=> a[1]}.each do |v|
- puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
- end
- puts
-end
-
-def find_seq( seq,s )
- n,table = frecuency( seq,s.length )
- puts "#{table[s].to_s}\t#{s.upcase}"
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
-
-line = input.gets while line !~ /^>THREE/
-line = input.gets
-
-while (line !~ /^>/) & line do
- seq << line.chomp
- line = input.gets
-end
-
-[1,2].each {|i| sort_by_freq( seq,i ) }
-
-%w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
-
diff --git a/benchmark/bm_so_reverse_complement.rb b/benchmark/bm_so_reverse_complement.rb
deleted file mode 100644
index 82ea666994..0000000000
--- a/benchmark/bm_so_reverse_complement.rb
+++ /dev/null
@@ -1,30 +0,0 @@
-#!/usr/bin/ruby
-# The Great Computer Language Shootout
-# http://shootout.alioth.debian.org/
-#
-# Contributed by Peter Bjarke Olsen
-# Modified by Doug King
-
-seq=Array.new
-
-def revcomp(seq)
- seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
- stringlen=seq.length
- 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
-end
-
-input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
-
-while input.gets
- if $_ =~ />/
- if seq.length != 0
- revcomp(seq.join)
- seq=Array.new
- end
- puts $_
- else
- $_.sub(/\n/,'')
- seq.push $_
- end
-end
-revcomp(seq.join)
diff --git a/benchmark/driver.rb b/benchmark/driver.rb
index c166c80edb..3536d9abd4 100755
--- a/benchmark/driver.rb
+++ b/benchmark/driver.rb
@@ -10,256 +10,66 @@ rescue LoadError
require 'optparse'
end
-require 'benchmark'
-require 'pp'
+require 'shellwords'
require 'tempfile'
class BenchmarkDriver
- def self.benchmark(opt)
- driver = self.new(opt[:execs], opt[:dir], opt)
- begin
- driver.run
- ensure
- driver.show_results
+ # Run benchmark-driver prepared by `make update-benchmark-driver`
+ def self.run(*args)
+ benchmark_driver = File.expand_path('./benchmark-driver/exe/benchmark-driver', __dir__)
+ command = [benchmark_driver, *args]
+ unless system(command.shelljoin)
+ abort "Failed to execute: #{command.shelljoin}"
end
end
- def self.load(input, type, opt)
- case type
- when 'yaml'
- require 'yaml'
- h = YAML.load(input)
- when 'json'
- require 'json'
- h = JSON.load(input)
- else
- h = eval(input.read)
- end
- results = h[:results] || h["results"]
- obj = allocate
- obj.instance_variable_set("@execs", h[:executables] || h["executables"])
- obj.instance_variable_set("@results", results)
- obj.instance_variable_set("@opt", opt)
- [1, 2].each do |i|
- loop = results.assoc((n = "loop_whileloop#{i}").intern) || results.assoc(n)
- obj.instance_variable_set("@loop_wl#{i}", loop ? loop[1].map {|t,*|t} : nil)
- end
- obj.instance_variable_set("@measure_target", opt[:measure_target] || opt["measure_target"])
- obj
- end
-
- def output *args
- puts(*args)
- @output and @output.puts(*args)
- end
-
- def message *args
- output(*args) if @verbose
- end
-
- def message_print *args
- if @verbose
- print(*args)
- STDOUT.flush
- @output and @output.print(*args)
- end
- end
-
- def progress_message *args
- unless STDOUT.tty?
- STDERR.print(*args)
- STDERR.flush
- end
- end
-
- def initialize execs, dir, opt = {}
- @execs = execs.map{|e|
- e.strip!
- next if e.empty?
-
- if /(.+)::(.+)/ =~ e
- # ex) ruby-a::/path/to/ruby-a
- label = $1.strip
- path = $2
- version = `#{path} --version`.chomp
- else
- path = e
- version = label = `#{path} --version`.chomp
- end
- [path, label, version]
- }.compact
-
+ def initialize(dir, opt = {})
@dir = dir
- @repeat = opt[:repeat] || 1
- @repeat = 1 if @repeat < 1
@pattern = opt[:pattern] || nil
@exclude = opt[:exclude] || nil
- @verbose = opt[:quiet] ? false : (opt[:verbose] || false)
- @output = opt[:output] ? open(opt[:output], 'w') : nil
- @loop_wl1 = @loop_wl2 = nil
- @ruby_arg = opt[:ruby_arg] || nil
- @measure_target = opt[:measure_target]
- @opt = opt
-
- # [[name, [[r-1-1, r-1-2, ...], [r-2-1, r-2-2, ...]]], ...]
- @results = []
-
- if @verbose
- @start_time = Time.now
- message @start_time
- @execs.each_with_index{|(path, label, version), i|
- message "target #{i}: " + (label == version ? "#{label}" : "#{label} (#{version})") + " at \"#{path}\""
- }
- message "measure target: #{@measure_target}"
- end
end
- def adjusted_results name, results
- s = nil
- results.each_with_index{|e, i|
- r = e.min
- case name
- when /^vm1_/
- if @loop_wl1
- r -= @loop_wl1[i]
- r = 0 if r < 0
- s = '*'
+ def with_yamls(&block)
+ ios = files.map do |file|
+ Tempfile.open.tap do |io|
+ if file.end_with?('.yml')
+ io.write(File.read(file))
+ else
+ io.write(build_yaml(file))
end
- when /^vm2_/
- if @loop_wl2
- r -= @loop_wl2[i]
- r = 0 if r < 0
- s = '*'
- end
- end
- yield r
- }
- s
- end
-
- def show_results
- case @opt[:format]
- when :tsv
- strformat = "\t%1$s"
- numformat = "\t%1$*2$.3f"
- minwidth = 0
- name_width = 0
- when :markdown
- markdown = true
- strformat = "|%1$-*2$s"
- numformat = "|%1$*2$.3f"
- when :plain
- strformat = " %1$-*2$s"
- numformat = " %1$*2$.3f"
- end
-
- name_width ||= @results.map {|v, result|
- v.size + (case v; when /^vm1_/; @loop_wl1; when /^vm2_/; @loop_wl2; end ? 1 : 0)
- }.max
- minwidth ||= 7
- width = @execs.map{|(_, v)| [v.size, minwidth].max}
-
- output
-
- if @verbose
- message '-----------------------------------------------------------'
- message 'raw data:'
- message
- message PP.pp(@results, "", 79)
- message
- message "Elapsed time: #{Time.now - @start_time} (sec)"
- end
-
- if rawdata_output = @opt[:rawdata_output]
- h = {}
- h[:cpuinfo] = File.read('/proc/cpuinfo') if File.exist?('/proc/cpuinfo')
- h[:executables] = @execs
- h[:results] = @results
- if (type = File.extname(rawdata_output)).empty?
- type = rawdata_output
- rawdata_output = @output.path.sub(/\.[^.\/]+\z/, '') << '.' << rawdata_output
+ io.close
end
- case type
- when 'yaml'
- require 'yaml'
- h = YAML.dump(h)
- when 'json'
- require 'json'
- h = JSON.pretty_generate(h)
- else
- require 'pp'
- h = h.pretty_inspect
- end
- open(rawdata_output, 'w') {|f| f.puts h}
- end
-
- output '-----------------------------------------------------------'
- output 'benchmark results:'
-
- if @verbose and @repeat > 1
- output "minimum results in each #{@repeat} measurements."
end
+ block.call(ios.map(&:path))
+ ensure
+ ios.each(&:close)
+ end
- output({
- real: "Execution time (sec)",
- utime: "user CPU time",
- stime: "system CPU time",
- cutime: "user CPU time of children",
- cstime: "system CPU time of children",
- total: "all CPU time",
- peak: "Memory usage (peak) (B)",
- size: "Memory usage (last size) (B)",
- }[@measure_target])
- output if markdown
- output ["name".ljust(name_width), @execs.map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
- output ["-"*name_width, width.map{|n|":".rjust(n, "-")}].join("|") if markdown
- @results.each{|v, result|
- rets = []
- s = adjusted_results(v, result){|r|
- rets << sprintf(numformat, r, width[rets.size])
- }
- v += s if s
- output [v.ljust(name_width), rets].join("")
- }
+ private
- if @execs.size > 1
- output
- output({
- real: "Speedup ratio: compare with the result of `#{@execs[0][1]}' (greater is better)",
- peak: "Memory consuming ratio (peak) with the result of `#{@execs[0][1]}' (greater is better)",
- size: "Memory consuming ratio (size) with the result of `#{@execs[0][1]}' (greater is better)",
- }[@measure_target])
- output if markdown
- output ["name".ljust(name_width), @execs[1..-1].map.with_index{|(_, v), i| sprintf(strformat, v, width[i])}].join("").rstrip
- output ["-"*name_width, width[1..-1].map{|n|":".rjust(n, "-")}].join("|") if markdown
- @results.each{|v, result|
- rets = []
- first_value = nil
- s = adjusted_results(v, result){|r|
- if first_value
- if r == 0
- rets << "Error"
- else
- rets << sprintf(numformat, first_value/Float(r), width[rets.size+1])
- end
- else
- first_value = r
- end
- }
- v += s if s
- output [v.ljust(name_width), rets].join("")
- }
+ def build_yaml(file)
+ magic_comment = '# prelude' # bm_so_nsieve_bits hangs without magic comment
+ name = File.basename(file).sub(/\Abm_/, '').sub(/\.rb\z/, '')
+ script = File.read(file).sub(/^__END__\n(.+\n)*/m, '').sub(/\A(^#.+\n)+/m) do |comment|
+ magic_comment = comment
+ ''
end
- if @opt[:output]
- output
- output "Log file: #{@opt[:output]}"
- end
+ <<-YAML
+prelude: |
+#{magic_comment.gsub(/^/, ' ')}
+benchmark:
+ #{name}: |
+#{script.gsub(/^/, ' ')}
+loop_count: 1
+ YAML
end
def files
flag = {}
- @files = Dir.glob(File.join(@dir, 'bm*.rb')).map{|file|
+ legacy_files = Dir.glob(File.join(@dir, 'bm*.rb'))
+ yaml_files = Dir.glob(File.join(@dir, '*.yml'))
+ files = (legacy_files + yaml_files).map{|file|
next if @pattern && /#{@pattern}/ !~ File.basename(file)
next if @exclude && /#{@exclude}/ =~ File.basename(file)
case file
@@ -270,90 +80,13 @@ class BenchmarkDriver
}.compact
if flag['vm1'] && !flag['whileloop']
- @files << File.join(@dir, 'bm_loop_whileloop.rb')
+ files << File.join(@dir, 'bm_loop_whileloop.rb')
elsif flag['vm2'] && !flag['whileloop2']
- @files << File.join(@dir, 'bm_loop_whileloop2.rb')
- end
-
- @files.sort!
- progress_message "total: #{@files.size * @repeat} trial(s) (#{@repeat} trial(s) for #{@files.size} benchmark(s))\n"
- @files
- end
-
- def run
- files.each_with_index{|file, i|
- @i = i
- r = measure_file(file)
-
- if /bm_loop_whileloop.rb/ =~ file
- @loop_wl1 = r[1].map{|e| e.min}
- elsif /bm_loop_whileloop2.rb/ =~ file
- @loop_wl2 = r[1].map{|e| e.min}
- end
- }
- end
-
- def measure_file file
- name = File.basename(file, '.rb').sub(/^bm_/, '')
- prepare_file = File.join(File.dirname(file), "prepare_#{name}.rb")
- load prepare_file if FileTest.exist?(prepare_file)
-
- if @verbose
- output
- output '-----------------------------------------------------------'
- output name
- output
- output File.read(file)
- output
- end
-
- result = [name]
- result << @execs.map{|(e, v)|
- (0...@repeat).map{
- message_print "#{v}\t"
- progress_message '.'
-
- m = measure(e, file)
- message "#{m}"
- m
- }
- }
- @results << result
- result
- end
-
- unless defined?(File::NULL)
- if File.exist?('/dev/null')
- File::NULL = '/dev/null'
+ files << File.join(@dir, 'bm_loop_whileloop2.rb')
end
- end
- def measure executable, file
- case @measure_target
- when :real, :utime, :stime, :cutime, :cstime, :total
- cmd = "#{executable} #{@ruby_arg} #{file}"
- m = Benchmark.measure{
- system(cmd, out: File::NULL)
- }
- result = m.__send__(@measure_target)
- when :peak, :size
- tmp = Tempfile.new("benchmark-memory-wrapper-data")
- wrapper = "#{File.join(__dir__, 'memory_wrapper.rb')} #{tmp.path} #{@measure_target}"
- cmd = "#{executable} #{@ruby_arg} #{wrapper} #{file}"
- system(cmd, out: File::NULL)
- result = tmp.read.to_i
- tmp.close
- else
- raise "unknown measure target"
- end
-
- if $? != 0
- raise $?.inspect if $? && $?.signaled?
- output "\`#{cmd}\' exited with abnormal status (#{$?})"
- 0
- else
- result
- end
+ files.sort!
+ files
end
end
@@ -362,15 +95,7 @@ if __FILE__ == $0
:execs => [],
:dir => File.dirname(__FILE__),
:repeat => 1,
- :measure_target => :real,
- :output => nil,
- :raw_output => nil,
- :format => :tsv,
- }
- formats = {
- :tsv => ".tsv",
- :markdown => ".md",
- :plain => ".txt",
+ :verbose => 1,
}
parser = OptionParser.new{|o|
@@ -397,44 +122,18 @@ if __FILE__ == $0
o.on('-r', '--repeat-count [NUM]', "Repeat count"){|n|
opt[:repeat] = n.to_i
}
- o.on('-o', '--output-file [FILE]', "Output file"){|f|
- opt[:output] = f
- }
- o.on('--ruby-arg [ARG]', "Optional argument for ruby"){|a|
- opt[:ruby_arg] = a
- }
- o.on('--measure-target [TARGET]',
- 'real (execution time), peak, size (memory), total'){|mt|
- opt[:measure_target] = mt.to_sym
- }
- o.on('--rawdata-output [FILE]', 'output rawdata'){|r|
- opt[:rawdata_output] = r
- }
- o.on('--load-rawdata=FILE', 'input rawdata'){|r|
- opt[:rawdata_input] = r
- }
- o.on('-f', "--format=FORMAT", "output format (#{formats.keys.join(",")})", formats.keys){|r|
- opt[:format] = r
- }
o.on('-v', '--verbose'){|v|
- opt[:verbose] = v
+ opt[:verbose] = 2
}
o.on('-q', '--quiet', "Run without notify information except result table."){|q|
- opt[:quiet] = q
- opt[:verbose] = false
+ opt[:verbose] = 0
}
}
parser.parse!(ARGV)
- if input = opt[:rawdata_input]
- b = open(input) {|f|
- BenchmarkDriver.load(f, File.extname(input)[1..-1], opt)
- }
- b.show_results
- else
- opt[:output] ||= "bmlog-#{Time.now.strftime('%Y%m%d-%H%M%S')}.#{$$}#{formats[opt[:format]]}"
- BenchmarkDriver.benchmark(opt)
+ execs = opt[:execs].map { |exec| ['--executables', exec.shellsplit.join(',')] }.flatten
+ BenchmarkDriver.new(opt[:dir], opt).with_yamls do |yamls|
+ BenchmarkDriver.run(*yamls, *execs, "--verbose=#{opt[:verbose]}", "--repeat-count=#{opt[:repeat]}")
end
end
-
diff --git a/benchmark/make_fasta_output.rb b/benchmark/make_fasta_output.rb
deleted file mode 100644
index b6d787ae27..0000000000
--- a/benchmark/make_fasta_output.rb
+++ /dev/null
@@ -1,19 +0,0 @@
-# prepare 'fasta.output'
-
-def prepare_fasta_output n
- filebase = File.join(File.dirname($0), 'fasta.output')
- script = File.join(File.dirname($0), 'bm_so_fasta.rb')
- file = "#{filebase}.#{n}"
-
- unless FileTest.exist?(file)
- STDERR.puts "preparing #{file}"
-
- open(file, 'w'){|f|
- ARGV[0] = n
- $stdout = f
- load script
- $stdout = STDOUT
- }
- end
-end
-
diff --git a/benchmark/prepare_require.rb b/benchmark/prepare_require.rb
deleted file mode 100644
index c4786f04ad..0000000000
--- a/benchmark/prepare_require.rb
+++ /dev/null
@@ -1,25 +0,0 @@
-require "fileutils"
-
-def prepare
- num_files = 10000
-
- basename = File.dirname($0)
- data_dir = File.join(basename, "bm_require.data")
-
- # skip if all of files exists
- if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
- return
- end
-
- FileUtils.mkdir_p(data_dir)
-
- 1.upto(num_files) do |i|
- f = File.open("#{data_dir}/c#{i}.rb", "w")
- f.puts <<-END
- class C#{i}
- end
- END
- end
-end
-
-prepare
diff --git a/benchmark/prepare_require_thread.rb b/benchmark/prepare_require_thread.rb
deleted file mode 100644
index 339ecb8b39..0000000000
--- a/benchmark/prepare_require_thread.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-load File.join(File.dirname(__FILE__), "prepare_require.rb")
-
diff --git a/benchmark/prepare_so_count_words.rb b/benchmark/prepare_so_count_words.rb
deleted file mode 100644
index ee2138cdb2..0000000000
--- a/benchmark/prepare_so_count_words.rb
+++ /dev/null
@@ -1,15 +0,0 @@
-# prepare 'wc.input'
-
-def prepare_wc_input
- wcinput = File.join(File.dirname($0), 'wc.input')
- wcbase = File.join(File.dirname($0), 'wc.input.base')
- unless FileTest.exist?(wcinput)
- data = File.read(wcbase)
- 13.times{
- data << data
- }
- open(wcinput, 'w'){|f| f.write data}
- end
-end
-
-prepare_wc_input
diff --git a/benchmark/prepare_so_k_nucleotide.rb b/benchmark/prepare_so_k_nucleotide.rb
deleted file mode 100644
index d83aeb7a7e..0000000000
--- a/benchmark/prepare_so_k_nucleotide.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(100_000)
diff --git a/benchmark/prepare_so_reverse_complement.rb b/benchmark/prepare_so_reverse_complement.rb
deleted file mode 100644
index da3ec2df14..0000000000
--- a/benchmark/prepare_so_reverse_complement.rb
+++ /dev/null
@@ -1,2 +0,0 @@
-require_relative 'make_fasta_output'
-prepare_fasta_output(2_500_000)
diff --git a/benchmark/require.yml b/benchmark/require.yml
new file mode 100644
index 0000000000..711d8e11e9
--- /dev/null
+++ b/benchmark/require.yml
@@ -0,0 +1,36 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ f = File.open("#{data_dir}/c#{i}.rb", "w")
+ f.puts <<-END
+ class C#{i}
+ end
+ END
+ end
+ end
+
+ prepare
+benchmark:
+ require: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ 1.upto(10000) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+loop_count: 1
diff --git a/benchmark/require_thread.yml b/benchmark/require_thread.yml
new file mode 100644
index 0000000000..87e0ba888b
--- /dev/null
+++ b/benchmark/require_thread.yml
@@ -0,0 +1,44 @@
+prelude: |
+ require "fileutils"
+
+ def prepare
+ num_files = 10000
+
+ basename = File.dirname($0)
+ data_dir = File.join(basename, "bm_require.data")
+
+ # skip if all of files exists
+ if File.exist?(File.join(data_dir, "c#{num_files}.rb"))
+ return
+ end
+
+ FileUtils.mkdir_p(data_dir)
+
+ 1.upto(num_files) do |i|
+ f = File.open("#{data_dir}/c#{i}.rb", "w")
+ f.puts <<-END
+ class C#{i}
+ end
+ END
+ end
+ end
+
+ prepare
+benchmark:
+ require_thread: |
+ $:.push File.join(File.dirname(__FILE__), "bm_require.data")
+
+ i=0
+ t = Thread.new do
+ while true
+ i = i+1 # dummy loop
+ end
+ end
+
+ 1.upto(100) do |i|
+ require "c#{i}"
+ end
+
+ $:.pop
+ t.kill
+loop_count: 1
diff --git a/benchmark/wc.input.base b/benchmark/so_count_words.yml
index 41143fbac0..d0a6c8dd3e 100644
--- a/benchmark/wc.input.base
+++ b/benchmark/so_count_words.yml
@@ -1,25 +1,66 @@
-Subject: Re: Who was Izchak Miller?
-From: "Jane D. Anonymous" <[email protected]>
-Date: 1996/04/28
-Message-Id: <[email protected]>
-Content-Type: text/plain; charset=us-ascii
-Organization: Yale University
-X-Url: news:[email protected]
-Mime-Version: 1.0
-Newsgroups: rec.games.roguelike.nethack
-X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)
-
-Hello there, Izchak Miller was my father. When I was younger I spent
-many a night, hunched over the keyboard with a cup of tea, playing
-nethack with him and my brother. my dad was a philosopher with a strong
-weakness for fantasy/sci fi. I remember when he started to get involved
-with the Nethack team- my brother's Dungeons and Dragons monster book
-found a regular place beside my dad's desk. it's nice to see him living
-on in the game he loved so much :-).
- Tamar Miller
-
-The following is a really long word of 5000 characters:
-
-wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+prelude: |
+ #!/usr/bin/ruby
+ # -*- mode: ruby -*-
+
+ wc_input_base = <<EOS
+ Subject: Re: Who was Izchak Miller?
+ From: "Jane D. Anonymous" <[email protected]>
+ Date: 1996/04/28
+ Message-Id: <[email protected]>
+ Content-Type: text/plain; charset=us-ascii
+ Organization: Yale University
+ X-Url: news:[email protected]
+ Mime-Version: 1.0
+ Newsgroups: rec.games.roguelike.nethack
+ X-Mailer: Mozilla 1.1N (Macintosh; I; 68K)
+
+ Hello there, Izchak Miller was my father. When I was younger I spent
+ many a night, hunched over the keyboard with a cup of tea, playing
+ nethack with him and my brother. my dad was a philosopher with a strong
+ weakness for fantasy/sci fi. I remember when he started to get involved
+ with the Nethack team- my brother's Dungeons and Dragons monster book
+ found a regular place beside my dad's desk. it's nice to see him living
+ on in the game he loved so much :-).
+ Tamar Miller
+
+ The following is a really long word of 5000 characters:
+
+ wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
+ EOS
+
+ # prepare 'wc.input'
+
+ def prepare_wc_input(wcbase)
+ wcinput = File.join(File.dirname($0), 'wc.input')
+ unless FileTest.exist?(wcinput)
+ data = wcbase.dup
+ 13.times{
+ data << data
+ }
+ open(wcinput, 'w'){|f| f.write data}
+ end
+ end
+
+ prepare_wc_input(wc_input_base)
+
+benchmark:
+ so_count_words: |
+ # $Id: wc-ruby.code,v 1.4 2004/11/13 07:43:32 bfulgham Exp $
+ # http://www.bagley.org/~doug/shootout/
+ # with help from Paul Brannan
+ input = open(File.join(File.dirname($0), 'wc.input'), 'rb')
+
+ nl = nw = nc = 0
+ while true
+ tmp = input.read(4096) or break
+ data = tmp << (input.gets || "")
+ nc += data.length
+ nl += data.count("\n")
+ ((data.strip! || data).tr!("\n", " ") || data).squeeze!
+ nw += data.count(" ") + 1
+ end
+ # STDERR.puts "#{nl} #{nw} #{nc}"
+
+loop_count: 1
diff --git a/benchmark/so_k_nucleotide.yml b/benchmark/so_k_nucleotide.yml
new file mode 100644
index 0000000000..d7df086c39
--- /dev/null
+++ b/benchmark/so_k_nucleotide.yml
@@ -0,0 +1,155 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_k_nucleotide
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(100_000)
+ script: |
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org
+ #
+ # contributed by jose fco. gonzalez
+ # modified by Sokolov Yura
+
+ seq = String.new
+
+ def frecuency( seq,length )
+ n, table = seq.length - length + 1, Hash.new(0)
+ f, i = nil, nil
+ (0 ... length).each do |f|
+ (f ... n).step(length) do |i|
+ table[seq[i,length]] += 1
+ end
+ end
+ [n,table]
+
+ end
+
+ def sort_by_freq( seq,length )
+ n,table = frecuency( seq,length )
+ a, b, v = nil, nil, nil
+ table.sort{|a,b| b[1] <=> a[1]}.each do |v|
+ puts "%s %.3f" % [v[0].upcase,((v[1]*100).to_f/n)]
+ end
+ puts
+ end
+
+ def find_seq( seq,s )
+ n,table = frecuency( seq,s.length )
+ puts "#{table[s].to_s}\t#{s.upcase}"
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.100000'), 'rb')
+
+ line = input.gets while line !~ /^>THREE/
+ line = input.gets
+
+ while (line !~ /^>/) & line do
+ seq << line.chomp
+ line = input.gets
+ end
+
+ [1,2].each {|i| sort_by_freq( seq,i ) }
+
+ %w(ggt ggta ggtatt ggtattttaatt ggtattttaatttatagt).each{|s| find_seq( seq,s) }
+ loop_count: 1
diff --git a/benchmark/so_reverse_complement.yml b/benchmark/so_reverse_complement.yml
new file mode 100644
index 0000000000..de05eedfc4
--- /dev/null
+++ b/benchmark/so_reverse_complement.yml
@@ -0,0 +1,137 @@
+prelude: |
+ bm_so_fasta = <<'EOS'
+ # The Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ # Contributed by Sokolov Yura
+
+ $last = 42.0
+ def gen_random(max, im=139968, ia=3877, ic=29573)
+ (max * ($last = ($last * ia + ic) % im)) / im
+ end
+
+ alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"+
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"+
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"+
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"+
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"+
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"+
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+ iub = [
+ ["a", 0.27],
+ ["c", 0.12],
+ ["g", 0.12],
+ ["t", 0.27],
+
+ ["B", 0.02],
+ ["D", 0.02],
+ ["H", 0.02],
+ ["K", 0.02],
+ ["M", 0.02],
+ ["N", 0.02],
+ ["R", 0.02],
+ ["S", 0.02],
+ ["V", 0.02],
+ ["W", 0.02],
+ ["Y", 0.02],
+ ]
+ homosapiens = [
+ ["a", 0.3029549426680],
+ ["c", 0.1979883004921],
+ ["g", 0.1975473066391],
+ ["t", 0.3015094502008],
+ ]
+
+ def make_repeat_fasta(id, desc, src, n)
+ puts ">#{id} #{desc}"
+ v = nil
+ width = 60
+ l = src.length
+ s = src * ((n / l) + 1)
+ s.slice!(n, l)
+ puts(s.scan(/.{1,#{width}}/).join("\n"))
+ end
+
+ def make_random_fasta(id, desc, table, n)
+ puts ">#{id} #{desc}"
+ rand, v = nil,nil
+ width = 60
+ chunk = 1 * width
+ prob = 0.0
+ table.each{|v| v[1]= (prob += v[1])}
+ for i in 1..(n/width)
+ puts((1..width).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ if n%width != 0
+ puts((1..(n%width)).collect{
+ rand = gen_random(1.0)
+ table.find{|v| v[1]>rand}[0]
+ }.join)
+ end
+ end
+
+
+ n = (ARGV[0] or 250_000).to_i
+
+ make_repeat_fasta('ONE', 'Homo sapiens alu', alu, n*2)
+ make_random_fasta('TWO', 'IUB ambiguity codes', iub, n*3)
+ make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, n*5)
+ EOS
+benchmark:
+ - name: so_reverse_complement
+ prelude: |
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ File.write(script, bm_so_fasta)
+
+ def prepare_fasta_output n
+ filebase = File.join(File.dirname($0), 'fasta.output')
+ script = File.join(File.dirname($0), 'bm_so_fasta.rb')
+ file = "#{filebase}.#{n}"
+
+ unless FileTest.exist?(file)
+ STDERR.puts "preparing #{file}"
+
+ open(file, 'w'){|f|
+ ARGV[0] = n
+ $stdout = f
+ load script
+ $stdout = STDOUT
+ }
+ end
+ end
+ prepare_fasta_output(2_500_000)
+ script: |
+ # The Great Computer Language Shootout
+ # http://shootout.alioth.debian.org/
+ #
+ # Contributed by Peter Bjarke Olsen
+ # Modified by Doug King
+
+ seq=Array.new
+
+ def revcomp(seq)
+ seq.reverse!.tr!('wsatugcyrkmbdhvnATUGCYRKMBDHVN','WSTAACGRYMKVHDBNTAACGRYMKVHDBN')
+ stringlen=seq.length
+ 0.step(stringlen-1,60) {|x| print seq.slice(x,60) , "\n"}
+ end
+
+ input = open(File.join(File.dirname($0), 'fasta.output.2500000'), 'rb')
+
+ while input.gets
+ if $_ =~ />/
+ if seq.length != 0
+ revcomp(seq.join)
+ seq=Array.new
+ end
+ puts $_
+ else
+ $_.sub(/\n/,'')
+ seq.push $_
+ end
+ end
+ revcomp(seq.join)
+ loop_count: 1
diff --git a/common.mk b/common.mk
index 07e03bd2d5..dd1f7a7102 100644
--- a/common.mk
+++ b/common.mk
@@ -41,6 +41,8 @@ GEM_HOME =
GEM_PATH =
GEM_VENDOR =
+BENCHMARK_DRIVER_GIT_URL = https://github.com/benchmark-driver/benchmark-driver
+BENCHMARK_DRIVER_GIT_REF = v0.13.2
SIMPLECOV_GIT_URL = git://github.com/colszowka/simplecov.git
SIMPLECOV_GIT_REF = v0.15.0
SIMPLECOV_HTML_GIT_URL = git://github.com/colszowka/simplecov-html.git
@@ -1117,14 +1119,16 @@ OPTS =
# for example,
# $ make benchmark COMPARE_RUBY="ruby-trunk" OPTS="-e ruby-2.2.2"
# This command compares trunk and built-ruby and 2.2.2
-benchmark: miniruby$(EXEEXT) PHONY
- $(BASERUBY) $(srcdir)/benchmark/driver.rb -v \
- --executables="$(COMPARE_RUBY) -I$(srcdir)/lib -I. -I$(EXTOUT)/common --disable-gem; built-ruby::$(MINIRUBY) -r$(srcdir)/prelude --disable-gem" \
+benchmark: miniruby$(EXEEXT) update-benchmark-driver PHONY
+ $(BASERUBY) $(srcdir)/benchmark/driver.rb \
+ --executables="compare-ruby::$(COMPARE_RUBY) -I$(EXTOUT)/common --disable-gem" \
+ --executables="built-ruby::$(MINIRUBY) -r$(srcdir)/prelude --disable-gem" \
--pattern='bm_' --directory=$(srcdir)/benchmark $(OPTS)
-benchmark-each: miniruby$(EXEEXT) PHONY
- $(BASERUBY) $(srcdir)/benchmark/driver.rb -v \
- --executables="$(COMPARE_RUBY) -I$(srcdir)/lib -I. -I$(EXTOUT)/common --disable-gem; built-ruby::$(MINIRUBY) -r$(srcdir)/prelude --disable-gem" \
+benchmark-each: miniruby$(EXEEXT) update-benchmark-driver PHONY
+ $(BASERUBY) $(srcdir)/benchmark/driver.rb \
+ --executables="compare-ruby::$(COMPARE_RUBY) -I$(EXTOUT)/common --disable-gem" \
+ --executables="built-ruby::$(MINIRUBY) -r$(srcdir)/prelude --disable-gem" \
--pattern=$(ITEM) --directory=$(srcdir)/benchmark $(OPTS)
run.gdb:
diff --git a/win32/Makefile.sub b/win32/Makefile.sub
index 20b47a581a..3c9fc07648 100644
--- a/win32/Makefile.sub
+++ b/win32/Makefile.sub
@@ -1182,6 +1182,10 @@ test-bundled-gems-run:
exit /b %STATUS% \
)
+update-benchmark-driver:
+ $(GIT) clone https://github.com/benchmark-driver/benchmark-driver $(srcdir)/benchmark/benchmark-driver || \
+ $(GIT) -C $(srcdir)/benchmark/benchmark-driver pull origin master
+
$(ruby_pc): $(RBCONFIG)
@$(BOOTSTRAPRUBY) $(srcdir)/tool/expand-config.rb \
-output=$@ -mode=$(INSTALL_DATA_MODE) -config=rbconfig.rb \