Type the following honor code below: “On my honor, I promise that this work is my own”
Type here:
akira
CSI: GALA
Background:
1. Describe the difference between the process of transcription and the process of
translation.
a. Transcription is when DNA is copied into mRNA in the nucleus, and translation is
when the ribosome reads the mRNA to make a protein. Basically, transcription
copies the code and translation builds the protein.
2. What is the base pairing rule between DNA and RNA? List the DNA base first.
a. The base pairing rules are: A pairs with U, T pairs with A, C pairs with G, and G
pairs with C.
3. Describe the difference between a substitution, deletion, and insertion mutation.
a. A substitution is when one base is switched for another, a deletion is when a
base is taken out, and an insertion is when an extra base is added.
4. Describe why a substitution mutation can sometimes not affect the primary structure of
the protein
a. A substitution sometimes doesn’t affect the protein because some different
codons still code for the same amino acid, so the protein stays the same.
Results of Gene Expression:
1. What was the primary protein structure for Sample #1?
a. Hair Trait: Met Val Ala Ser Cys Arg Ile
b. Eye Color Trait: Met Thr Leu Ser His Cys Tyr
c. Sex Trait: Met Val Asn Arg Glu His
2. What was the phenotype for Sample #1?
a. Hair Trait: Dark Brown / Light Brown Hair
b. Eye Color Trait: Hazel eyes
c. Sex Trait: Female (XX)
3. What was the primary protein structure for Sample #2?
a. Hair Trait: Met Ala Phe Ser Trp Arg Ile
b. Eye Color Trait: Met Thr Leu Pro His Trp Tyr
c. Sex Trait: Met Val Lys Arg Asp Gln
4. What was the phenotype for Sample #2?
a. Hair Trait: Blonde Hair
b. Eye Color Trait: Brown Eyes
c. Sex Trait: Female (XX)
Argumentation of the Data (SP 6):
1. Make a claim about who were not suspects after you analyzed the DNA? Explain why
the DNA eliminated them as suspects.
a. We eliminated everybody with blue eyes, all males, and everybody without brown
or blonde hair because they didn't match up with any of the protein structures
that we translated.
2. Make a claim about who the thief was. Support your prediction with evidence from the
DNA data as well as evidence from the observations by the detectives (alibi reports)
a. We called it out as Ms. Barajas because her protein structure matched the first
suspect and for the second suspect, everybody ended up being alibi’s or
nobody’s phenotype matched up. We translated the structure to rna and found
out the new protein structure and we sectioned them and found out their
phenotype based on the Forensics.
3. Before the suspect is put on trial for stealing the golden volleyballs, it was discovered
that DNA Sample #1 had been contaminated by a chemical that caused a mutation in
DNA that turns adenine into guanine, and guanine into cytosine. The forensic data you
analyzed in class showed this already mutated DNA. This mutation only affected the
highlighted bases in Sample #2. Here is that gene sequence from your lab that was
affected: TACTGGAACGGTGTGACCATGATC
a. Determine what was the original amino acid sequence for the trait before the
chemical contamination caused the mutation.
TACTGGAACGGTGTGACCATGATC
Reverse the mutation: G to A, C to G
Og dna turns into:
TATTAAAGAGATATGA GGATATGATG
grouped into codons:
TAT TAA AGA GAT ATG AGG ATA TGA
transcribe to mRNA (DNA to RNA)
AUA AUU UCU CUA UAC UCC UAU ACU
translate:
AUA – Ile
AUU – Ile
UCU – Ser
CUA – Leu
UAC – Tyr
UCC – Ser
UAU – Tyr
ACU – The
So the original amino acid sequence was Ile Ile Ser Leu Tyr Ser Tyr Thr
b. With what you know now about the original DNA (before contamination) for
Sample #1, identify who is now a suspect for the stolen golden volleyballs.
Explain why they are now a suspect according to the DNA data.
i. I don’t remember the full list of suspects but since the original amino acid
sequence is different from the mutated one, Sample #1’s traits would
actually match the person whose traits line up with this corrected protein
sequence. Now, the suspect would be the person whose hair/eye/sex
traits match the corrected (original) DNA results, not the mutated version.
That’s why they are now a suspect because the contamination changed
the protein sequence and made it look like it matched someone else
before.
