Handbook For Azospirillum
Handbook For Azospirillum
Handbook for
Azospirillum
Technical Issues and Protocols
Editors
Fabricio Dario Cassn
Universidad Nacional de Rio Cuarto
Rio Cuarto, Argentina
Yaacov Okon
The Hebrew University of Jerusalem
Rehovot, Israel
Cecilia M. Creus
Universidad Nacional de Mar del Plata
Balcarce, Argentina
ISBN 978-3-319-06541-0
ISBN 978-3-319-06542-7
DOI 10.1007/978-3-319-06542-7
(eBook)
Preface
The genus Azospirillum is one of the most widely studied and commercially used
plant growth-promoting rhizobacteria (PGPR) in agriculture, especially in South
America (MERCOSUR). It belongs to the class Alphaproteobacteria and comprises
free-living, nitrogen-fixing, vibrio- or spirillum-shaped rods that exert beneficial
effects on plant growth and on the yield of many agronomically important crops.
Following inoculation of several grasses, cereals, and legumes with azospirilla,
there are pronounced morphological effects on the roots, beginning with the proliferation of root hairs. The morphological effects are generally dependent on inoculum concentration and are consistent with the exogenous indole acetic acid (IAA)
levels secreted by bacteria. The IAA/cytokinin ratio and nitric oxide (NO), a key
signaling molecule involved in a wide range of functions in plants, are also important. One of the most important achievements obtained from research is the utilization of commercial azospirilla inoculants (the bacteria in a suitable carrier), mainly
in Argentina, Brazil, Uruguay, Paraguay, Mexico, and South Africa. About 3.5 million ha of wheat, maize, sorghum, and legumes have been inoculated (as of 2014),
and the use continues to increase.
The following research developments have been important to understand how
these bacteria promote plant growth. The controversy on the potential contribution
of biological nitrogen fixation to the system was clarified in 19771985. It is generally agreed today that the association of Azospirillum with plants such as maize,
wheat, and sorghum could contribute only a few kilograms (kg) of fixed N per hectare (ha), whereas in modern cereal production fields are fertilized with 150
250 kg N/ha. The effect of inoculation on root proliferation resulted in yield
increases of the order of 1030 %. Field experiments in Israel in 19771985 very
clearly demonstrated the improvement in crop yield. These early observations were
extensively confirmed by continuous field experimentation and interest in the
MERCOSUR and Mexico (1980 to present). Results from field experiments became
more consistent with the commercial use of successful liquid inoculants containing
osmoregulators for maintaining 109 viable cells/ml inoculant after 1 year of storage.
The regulation of products (see Chap. 27 on development of protocols for the quality control of inoculants) in the past decade has contributed to system success.
v
vi
Preface
Contents
Part I
1
27
45
65
83
vii
viii
Contents
Part II
10
11
12
13
14
15
16
17
Contents
18
ix
Part III
19
20
21
22
23
Part IV
24
25
26
27
Contents
Protocol for the Quality Control of Azospirillum spp. Inoculants ...... 487
Fabricio Dario Cassn, Claudio Penna, Cecilia M. Creus,
Dbora Radovancich, Emilia Monteleone, Ins Garca de Salamone,
Luciana Di Salvo, Isabel Mentel, Julia Garca, Mara del Carmen
Pasarello Mayans, Lina Lett, Mariana Puente, Olga Correa,
Karina Punschke Valerio, Rosana Massa, Melina Catafesta,
Alejandro Rossi, Marisa Daz, Silvia Righes, Susana Carletti,
and Enrique Rodrguez Cceres
Contributors
xi
xii
Contributors
Contributors
xiii
xiv
Contributors
Contributors
xv
xvi
Contributors
Contributors
xvii
Michael Schmid Department of Environmental Sciences, Research Unit MicrobePlant Interactions, Helmholtz Zentrum Mnchen, German Research Center for
Environmental Health (GmbH), Neuherberg, Germany
Stefan Schwab EMBRAPA-Agrobiologia, Seropdica, Rio de Janeiro, Brazil
Fo-Ting Shen Department of Soil and Environmental Sciences, College of
Agriculture and Natural Resources, National Chung Hsing University, Taichung,
Taiwan
Agricultural Biotechnology Center, National Chung Hsing University, Taichung,
Taiwan
Emanuel Maltempi de Souza Biological Nitrogen Fixation Laboratory,
Department of Biochemistry and Molecular Biology, Federal State University of
Paran, Curitiba, PR, Brazil
Jordan Vacheron Universit de Lyon, Lyon, France
Universit Lyon 1, Villeurbanne, France
CNRS, UMR5557, Ecologie Microbienne, Villeurbanne, France
Karina Punschke Valerio Direccin General de Servicios Agrcolas, Ministerio
de Ganadera Agricultura y Pesca, Montevideo, Uruguay
Claudio Valverde Laboratorio de Bioqumica, Microbiologa e Interacciones
Biolgicas en el Suelo, Departamento de Ciencia y Tecnologa, Universidad
Nacional de Quilmes, Bernal, Argentina
Ludovic Vial Universit de Lyon, UMR 5557 CNRS, Ecologie Microbienne,
Villeurbanne, France
Julio Csar Vicario Laboratorio 17, Departamento de Biologa Molecular,
Facultad de Ciencias Exactas, Fsico-Qumicas y Naturales, Universidad Nacional
de Ro Cuarto, Ro Cuarto, Crdoba, Argentina
Ana Vigliocco Laboratorio de Fisiologa Vegetal y de la, Facultad de Ciencias
Exactas, Fsico-Qumicas y Naturales, Universidad Nacional de Ro Cuarto, Ro
Cuarto, Crdoba, Argentina
Florence Wisniewski-Dy Universit de Lyon, UMR 5557 CNRS, Ecologie
Microbienne, Villeurbanne, France
Chiu-Chung Young Department of Soil and Environmental Sciences, College of
Agriculture and Natural Resources, National Chung Hsing University, Taichung,
Taiwan
Agricultural Biotechnology Center, National Chung Hsing University, Taichung,
Taiwan
Part I
Chapter 1
1.1
1.1.1
Introduction
Azospirillum spp.
collaborators to isolate this organism. Several strains were later isolated from plants
collected in several countries, including Peru, Nigeria, Colombia and Senegal, and
also from other researchers, such as Shank (USA), Milam (Ecuador, Venezuela) and
Eskew (USA), as described in the publication by Tarrand et al. (1978). A group of
61 isolates from several plants and locations was then analysed in a detailed taxonomic study, and based on DNA homology, the Azospirillum genus was described
with two species: A. lipoferum (old group II) and A. brasilense (old group I). The
medium used to obtain these isolates was a semi-solid nitrogen (N)-free medium
containing 0.005 % of yeast extract, as described by Day and Dbereiner in 1976.
This medium was later named NFb (Dobereiner et al. 1976); the small amount of
yeast extract was omitted and a vitamin solution was added to benefit some strains
that require biotin to grow.
Initially, the N-free NFb medium, with neutralized malic acid as a carbon source,
pH near 7.0 and prepared with a low concentration of agar (1.75 g L1) to produce a
semi-solid condition in tubes or vials, was the key to discover that plants from different soils, regions and plant parts possess diazotrophs. This semi-solid condition
was important to produce the microaerophilic environment that allowed the organism to synthesize the nitrogenase complex and initiate N-fixation.
The description of Azospirillum species increased exponentially over the years
and other groups adopted the NFb medium recipe and discovered many new species, genus and, consequently, interactions with several plants. This procedure, recognized as an enrichment medium, helps separate diazotrophs from a complex plant
and environmental soil samples. From 1980 to 2014, 14 more Azospirillum species
were described, but the N-free semi-solid medium was not used by all authors
(Table 1.1). The importance of the recently described species is not yet known.
The use of semi-solid N-free medium with some modification, such as carbon
source, phosphate buffer and final pH, allowed Magalhes et al. (1983) to describe
the species A. amazonense isolated from palm trees collected in Amazonia and also
from cereal tissues grown in Seropdica, RJ. Four years later, A. halopraeferens
(Reinhold et al. 1987) was isolated from a Kallar grass (Leptochloa fusca) planted
in saline soils in Pakistan using the semi-solid medium modified by increasing the
NaCl concentration and final pH (Table 1.1). Conglomeromonas largimobilis subsp.
largomobilis showed high phylogenetic similarity to A. lipoferum and therefore was
renamed as a new Azospirillum species called A. largomobilis, which was later
changed to A. largimobile (Dekhil et al. 1997).
In 2001, a new group of N-fixing bacteria was isolated from Miscanthus using
the traditional NFb medium recipe and named A. dobereinerae in honour of the
famous scientist Johanna Dbereiner (Eckert et al. 2001). A. oryzae was isolated
from rice samples grown in China (Xie and Yokota 2005). Similarly, A. melinis was
isolated from roots and stem of Melinis minutiflora grown in China after inoculation
into semi-solid N-free NFb or LGI media (Peng et al. 2006). A modification of the
N-free NFb semi-solid medium by increasing the pH contributed to the discovery of
A. canadense (Mehnaz et al. 2007a) and A. zeae (Mehnaz et al. 2007b).
Other species of the genus Azospirillum were also described, but the N-free
semi-solid medium or serial dilution technique (Dbereiner 1995) was not applied.
Table 1.1 List of Azospirillum species isolated from plant samples using different solid and semisolid media
Carbon
source
Media
Azospirillum
Semi-solid
NFb
A. lipoferum
A. brasilense
A. doebereinerae
A. melinis
A. formosense
NFb
A. irakense
Malatea
Malate
Malate
Malate
Malate
Malate
SM
A. halopraeferens
Malate
LGI
FAM
A. amazonense
A. melinis
A. amazonense
Sucrose
Sucrose
Sucrose
A. oryzae
Malate
NFG
M
A. oryzae
A. zeae
Glucose
Malate
A. canadense
Malate
NFB or
LGI
MPSS
A. melinis
Malate
A. thiophilum
Sodium
succinate
Solid
TYB
A. palatum
TSA
A. picis
NB
A. humicireducens
NB
A. fermentarium
Rich
medium
Rich
medium
Rich
medium
Rich
medium
Conditions
Reference
pH 6.56.8 + biotin
pH 6.56.8 + biotin
pH 6.56.8 + biotin
pH 6.56.8 + biotin
pH 6.56.8 + biotin
pH 7.08.5 + 0.3 %
NaCl
pH 8.5 + 1.5 % NaCl.
Incubation at 41 C
pH 6.06.2
pH 6.06.2
pH 6.0 + NaCl,
100 mg L1
pH 6.8 + yeast extract
and NaCl 100 mg
each
pH 7.3 + CaCO3 5 g
pH 7.27.4 without
biotin
pH 7.27.4 without
biotin
Depending on the
recipe
pH 7.5 + FeS
suspension
Yeastbeeftryptone
extract
Tryptone soya agar
pH 7.2
The procedure used plates containing different rich media to obtain single colonies
followed by molecular characterization to identify new species. For example,
A. rugosum was isolated from discarded road tar soil collected in Taiwan using
brain-heat infusion (BHI) agar and trypsoy soy agar plates (Young et al. 2008).
In 2009, two new species were described using solid medium: A. palatum (Zhou
et al. 2009) and A. picis (Lin et al. 2009). A. picis was also isolated from oil-contaminated
soil samples. Even though the N-free semi-solid media were not used by these
authors, they also observed that the bacteria could fix nitrogen and exhibited nitrate
reduction activity, differing from A. palatum. A. thiophilum was isolated from a
sulfide spring sample collected in Russia (Lavrinenko et al. 2010). This new species
was isolated using an old recipe of medium called MPSS, described by Caraway
and Krieg (1974), with a freshly prepared solution of FeS described previously by
Kucera and Wolfe (1957) with sodium succinate and hydrolysed casein. A. formosense
was isolated from agricultural soil collected in Taiwan (Lin et al. 2012) using the
N-free medium recipe used by Reinhold et al. (1987) to describe A. halopraeferens.
The N-fixing A. humicireducens was isolated from microbial fuel cells (Zhou et al.
2012) using a complete new medium, and A. fermentarium was isolated from a
fermentative tank in Taiwan using the standard tenfold dilution plating technique
(Lin et al. 2013).
Most of the studies involving the interactions of Azospirillum with plants are
based on the species A. brasilense. The other Azospirillum species described in the
last century, such as A. lipoferum, A. irakense and A. amazonense, are known to
predominantly colonize the root surface, and only a few strains of A. brasilense,
A. lipoferum and A. amazonense are detected inside plant tissues after inoculation
(Patriquin and Dbereiner 1978; Patriquin et al. 1983; Assmus et al. 1997; Oliveira
et al. 2009). The physiological basis for the observed invasiveness of A. brasilense
is unknown. Even for species such as A. irakense that possesses enzymes that
degrade the host cells, this model is not established (Khammas et al. 1989). Normally
the bacteria enter the inner part of the plant using opportunities such as disrupted
cortical tissues at the lateral root junction, lysed root hairs or natural cracks on the
plant tissues (Steenhoudt and Vanderleyden 2000).
1.1.2
Many diazotrophic bacteria including new genera were described using the semisolid medium modified by the addition of plant macerates or extracts (Table 1.2).
For example, in 1988, the group of Johanna Dbereiner modified the LGI medium,
traditionally used to isolate A. amazonense, by the addition of cane juice to isolate
the first species of the Acetobacteraceae family that could fix nitrogen (Cavalcante
and Dobereiner 1988). Reis et al. (1994) later reduced the amount of cane juice from
250 to 5 mL and adjusted the final pH to 5.7 with acetic acid. The initial name of the
bacterium described with this new medium was Saccharobacter nitrocaptans
(Cavalcante and Dobereiner 1988) and was later modified to Acetobacter diazotrophicus (Gillis et al. 1989) and finally to Gluconacetobacter diazotrophicus (Yamada
et al. 1997, 1998).
The root has been traditionally used as the target plant tissue to isolate diazotrophs. This assumption was based on the fact that rhizobia fix nitrogen in nodules
Bacterial species
Gluconacetobacter
diazotrophicus
Carbon source
Cristal sugar
Conditions
pH 5.7 + cane
juice for
isolation
pH 4.5 or 5.5
pH 5.7
JMV
Baz
Diazotrophic Burkholderia
Diazotrophic Burkholderia
Manitol
Azelaic acid
Bac
Diazotrophic Burkholderia
Azelaic
acid + L-citrulline
pH 6.0
SM
Azoarcus
Malate
pH 7.0
JNFb
H. seropedicae
Malic acid
pH 5.8
H. rubrisubalbicans
Malic acid
pH 5.8
H. frisingense
Malic acid
pH 5.8
Sphingomonas
Malic acid
pH 5.8
Reference
Reis et al. (1994))
localized mostly in this plant part. However, sugarcane possesses unlimited carbon
sources, especially in the aerial plant tissues, and therefore the entire sugarcane
plant, including the xylem sap, has been used to isolate several strains of
Gluconacetobacter diazotrophicus using the new recipe of LGI-Pc medium (Reis
et al. 1994). Based on these new findings, another type of plant relationship was
established. These microorganisms localized in plant tissues were called endophytes, as they live inside the plant without causing disease symptoms. The more
simplistic, but clearly more accurate, definition for bacterial endophytes was proposed by Kado (1991), describing endophytes as bacterial living in plant tissues
without causing any substantive harm or gaining benefit other than residency. This
definition excludes bacteria that cause disease symptoms or detrimental effects on
host plants. G. diazotrophicus was one of the first true endophytes described at that
time, since its survival outside of plant tissue is low (Reis et al. 1994).
After this description, several bacterial species and genera joined the list of endophytes that can improve plant growth. Good examples of this group are the two
species of Herbaspirillum, H. seropedicae (Baldani et al. 1986) and H. rubrisubalbicans (Gillis et al. 1991; Baldani et al. 1996), that were isolated using the semisolid JNFb medium, which is a very similar recipe to NFb medium (Table 1.2). One
aspect that differentiates the two species is the infection of sugar cane leaves. H.
seropedicae has never been isolated from naturally occurring cane leaves, although
roots and stems are often highly infested. Olivares et al. (1997) and James and
Olivares (1998) compared the inoculation of sorghum and sugarcane leaves with
(Baldani et al. 1996). The LGI medium, used for the enrichment of A. amazonense,
can also be applied to isolate species of N-fixing Burkholderia. Burkholderia tropica, which includes strains from sugarcane plants collected from Pernambuco
(Brazil), can be isolated using LGI or LGI-P medium with 10 % sucrose (routinely
used for the isolation of G. diazotrophicus) (Table 1.2). B. unammae (CaballeroMellado et al. 2004), B. silvatlantica (Perin et al. 2006) and others also use semisolid medium with recipes based on azelaic acid and a mixture of three carbon
sources (Estrada-de-los-Santos et al. 2001) (Table 1.2).
The common aspect of all these finding is the strategy used to separate bacteria
with a special feature. In the case of diazotrophs, the use of media without addition
of nitrogen is one strategy that easily allowed the isolation of these bacteria from
soil and plant samples. The use of tubes or vials containing semi-solid media is
another strategy when part of the population does not grow in this condition, such
as some strains of the genus Rhizobium (Perin et al. 2006). For this genus, the
approach is based on the nodule as a source of the bacterium, and therefore a classic
solid medium is the base of the strategy (Vincent 1970). For anaerobic bacteria, a
chamber that reduces the oxygen gradient is another strategy. This chapter will not
include all these recipes and steps. It will focus on the experience of isolating diazotrophs from plants using semi-solid medium and basic methodologies used to isolate, identify and store Azospirillum species.
1.2
Methods
1.2.1
1.2.1.1
Roots of harvested field plants should be washed in tap water to clean off rhizosphere soil, and then cut into 10 cm pieces, dried on a paper towel and weighed
(10 g per sample or less when the amount of tissue is insufficient). The samples are
then ready for the serial dilution procedure.
Usually, rhizosphere soil (10 g) is also homogenized for 3060 min in 90 mL of
saline solution (eg. salts of NFb medium) or sucrose solution (4 %), using a rotary
shaker at 150 rpm. In this case, it is used directly in the serial dilution procedure.
1.2.1.2
Surface Sterilization
In the case of surface-sterilized tissue (roots), the roots are immersed into 1 % chloramine T solution (CH3C6H4SO2NNaCl3H2O). The time in this solution is determined by age and type of plant: roots from maize and sorghum at the flowering
stage are usually immersed for 30 min to 1 h, while rice and wheat are immersed
only for 515 min in the same solution. After the surface sterilization, roots are
10
placed in sterile distilled water for 1/3 of the time that they were in the sterilization
solution. This procedure is repeated for the same amount of time in phosphate buffer (50 mM, pH 7.0) and again in distilled water, with the total time equal to the
Chloramine T sterilization step. Roots that are not to be sterilized should be soaked
in distilled water for the same amount of time as used in the sterilization procedure
(Baldani et al. 1986). For aerial plant tissue, another method of sterilization is recommended depending on the tissue. For sugarcane stems, the stem piece is flamed
using alcohol. Sodium or calcium hypochlorite is also better adapted for aerial
plant tissue.
1.2.2
Sterilized or washed roots, stems and leaves (10 g) are blended in one of the above
solutions for 12 min. After 1 h of incubation, aliquots of 1 mL are used for serial
dilutions (102107) in 9 mL saline or sucrose solution. The addition of Tween 80
(0.02 %) to this saline solution improves the dilution efficiency.
1.2.2.1
In most cases, the numbers of N-fixing bacteria (free living, associative and endophytic) are estimated by the most probable number (MPN) method using McCradys
probability tables (Okon et al. 1977). Counts are made on N-free semi-solid medium
by inoculating 0.1 mL of each dilution in three tubes (or five tubes, not presented
here) containing the medium specific for the target organism, placing the inoculum
from the bottom to the centre of the tube, as these bacteria are sensitive to O2. These
tubes are then incubated at 3034 C, without shaking, from 5 to 7 days, to allow
pellicles to form. The method used to quantify the MPN is based on the presence or
absence of pellicles in the semi-solid medium and the approximate numbers computed using McCradys MPN Tables (Table 1.3see example).
For example, the number 321 in the Table 1.3 corresponds to the positive dilutions. In this case, diazotrophic number is 15.0. This is multiplied by the first dilution on counting and then by 10 (for the 0.1 mL for inoculation):
MPN (cells mL1) = 15.0 105 10 = 1.5 107.
1.2.2.2
When dealing with pure cultures, it is possible to determine the number of cells by
homogenizing 1 mL of the culture in 9 mL of saline solution, sterile water or sucrose
solution (4 %) and proceeding to serial dilutions up to 109 as previously described.
It is also possible to use Tween 80 detergent to disperse the organisms. By using
11
Table 1.3 McCradys table for most probable number (MPN) bacterial counting using three tubes
per dilution
Dilution with Diazotrophic
Dilution
Diazotrophic
Dilution
Diazotrophic
growth
number
with growth number
with growth number
000
0.0
201
1.4
302
6.5
001
0.3
202
2.0
310
4.5
010
0.3
210
1.5
311
7.5
011
0.6
211
2.0
312
11.5
020
0.6
212
3.0
313
16.0
100
0.4
220
2.0
320
9.5
101
0.7
221
3.0
321
15.0
102
1.1
222
3.5
322
20.0
110
0.7
223
4.0
323
30.0
111
1.1
230
3.0
330
25.0
120
1.1
231
3.5
331
45.0
121
1.4
232
4.0
332
110.0
130
1.6
300
2.5
333
140.0
200
0.9
301
4.0
Example of counting: take the three highest dilutions with growth (105, 106, 107)
105: 3 positive tubes
106: 2 positive tubes
107: 1 positive tube
Drigalskys loop, aliquots of 0.1 mL are spread onto petri dishes containing the
specific medium amended with a nitrogen source in very low amounts, usually
50 mg yeast extract per litre. If using rich medium (potato agar, DYGS, Nutrient
Broth or other synthetic media), the nitrogen source is not required. Calculation of
the number of cells is obtained by multiplying the number of colonies formed on the
plate by the corresponding dilution factor and the sample volume (in the case of
0.1 mL, this equals 10).
Example: Inoculated plate inoculated with 0.1 mL of 107 dilution shows 60 individual colonies. The number of cells per millitre will be 60 107 10 = 6.0 109
1.2.2.2.1
Different media are used to isolate different bacterial species. For isolation of A.
brasilense and A. lipoferum, the semi-solid NFb medium is inoculated with 0.1 mL
of soil or root suspension and incubated at 3034 C. Pellicles will form within 47
days, and the veil pellicles should be transferred to new semi-solid NFb medium
and incubated again for 47 days.
The culture is streaked on solid NFb medium supplemented with 50 mg yeast
extract and incubated 35 days when colonies from both species are white, dry and
small. Individual colonies should be transferred to semi-solid NFb medium and
12
incubated again for 47 days. After pellicle formation, cultures should be streaked
on solid potato medium. Colonies formed in this medium are initially yellowish-white,
and eventually becoming pinkish. These are transferred to new semi-solid NFb
medium from which the bacteria can be identified in wet mounts under the microscope. A. brasilense cells are medium sized (1 35 m), very motile, curved rods
with spirilloid movement. A. lipoferum cells initially are indistinguishable from the
former, but once the medium turns alkaline (blue colour), the cells change into large
pleomorphic forms.
Purified colonies of A. lipoferum and A. brasilense should be incubated in semisolid NFb medium in the same conditions cited above (48 h at 3034 C). A. brasilense cells are curved rods at 1 35 m even after the medium becomes alkaline.
A. lipoferum cells are identical, but when the medium turns alkaline, cells grow
large, pleomorphic and immotile (size may grow up to 10 m in length and 35 m
thick). These species may also be differentiated using medium containing glucose,
as A. lipoferum, but not A. brasilense, is capable of metabolizing glucose as the sole
carbon source (Table 1.6).
For other Azospirillum species, the recipe of NFb medium can be modified.
A. irakense is characterized by growing in semi-solid NFb with up to 0.3 % NaCl
and alkaline pH (7.08.5). When growing on Nutrient Broth, cells can be as large as
20 m. A. halopraeferans is identified by its growth at high temperature (41 C) and
salt tolerance. Cells may grow to 1.2 m length and 0.71.4 m thick if the pH turns
alkaline.
A. amazonense is characterized by its capability to use sucrose as the sole carbon
source (some A. lipoferum strains also grow in presence of sucrose). In LGI medium,
its cell size is 0.9 1.4 m. In potato medium, colonies of A. amazonense are typically cream, light brown and the edges are wrinkled.
A. largomobile colonies grown on peptone yeast extract agar are 2 mm in diameter after 72 h of incubation at 28 C, and cream to buff coloured, opaque, low,
convex and round with an entire edge and smooth surface.
Azospirillum species may be distinguished phenotypically as they show several
physiological and morphological differences (Table 1.6).
1.2.2.2.2
13
colonies are initially moist and clear and change to chocolate-brown 710 days after
incubation at 30 C. They are stored as described above. Cultivation under liquid
LGI-P medium requires addition of 50 mg yeast extract. To isolate Gluconacetobacter
species from coffee plants, Jimenez-Salgado et al. (1997) used LGI medium supplemented with sugarcane juice containing cycloheximide (150 mg L1) to control
fungi growth and a final pH 4.7. It can also be helpful for isolation of diazotrophic
bacteria from sugarcane.
Another recipe based on NFb medium, named JNFB, was modified by Baldani
et al. (1986) to improve the isolation of the Herbaspirillum genus. Herbaspirillum
seropedicae, H. rubrisubalbicans and H. frisingense (Baldani et al. 1986, 1996;
Kirchhof et al. 2001) form a veil-like pellicle in JNFb semi-solid medium similar to
that of Azospirillum spp. These bacterial pellicles are generally streaked onto JNFb
or NFb agar plates containing yeast extract (50 mg L1), on which colonies become
small and white with a central blue point after 1 week incubation. This colour is
more evident in NFb medium with three times the normal concentration of bromothymol blue (denoted NFb 3), mainly for strains of H. seropedicae and H.
rubrisubalbicans (for details, see Baldani et al. 2005). Purification on potato
medium with sucrose and malate yields small wet raised colonies that become
brownish in the centre, while they remain white and wet on BDA. This medium also
can be used to isolate strains of the Sphingomonas genus (Videira et al. 2009).
However, in contrast to Herbaspirillum species, white pellicles are initially formed,
which later become yellow with loss of the blue colour of the JNFb medium.
Bacteria belonging to the Burkholderia genus and associated with grasses such
as rice, maize and sugarcane can be easily isolated using JMV medium (Baldani
1996). Roots, leaves and stems are surface sterilized and macerated as previously
described. The serial dilutions are inoculated into the JMV semi-solid medium and
incubated for 47 days at 32 C. On the fourth day, thick pellicles begin to form.
Once these pellicles have migrated to the surface of the medium, they are streaked
onto plates of JMV solid media containing 60 mg yeast extract and again incubated
for 47 days at 32 C. Another recipe described by Estrada-de-los-Santos et al.
(2001) used a medium with azelaic acid as a carbon source and pH 5.7 and Bac
medium containing two carbon sources, azelaic acid and L-citrulline, to isolate
Burkholderia associated with several grasses.
1.2.3
Media
The isolation of Azospirillum spp. is based on the use of N-free semi-solid media,
containing low concentration of agar. NFb medium for A. lipoferum, A. brasilense,
and later with some minor modifications, was useful to isolate A. irakense and
A. halopraeferans. The recipes are described in Table 1.4.
A. irakense (Khammas et al. 1989) can be isolated in semi-solid NFb medium
containing up to 0.3 % NaCl with pH adjusted to 7.08.5 and incubation at 33 C.
A. doebereinerae (Eckert et al. 2001) can be isolated in NFb semi-solid medium
14
Table 1.4 Five semi-solid media used for enrichment and cultivation of some Azospirillum
species
Ingredient (per litre)
NFb
LGI
D,L-malic acid
5g
Cristal sugar
5g
0.5 g
0.2 g
K2HPO4
0.6 g
KH2PO4
0.2 g
0.2 g
MgSO47H2O
NaCl
0.1 g
CaCl22H2O
0.02 g
0.02 g
0.002 g
Na2MoO42H2O
Na2SO4
NaHCO3
Na2CO3
K2SO4
FeEDTA, solution 1.64 %
4 mL
4 mL
FeCl3
KOHcontrol pH:
4.5 g
v
Bromothymol blue (0.5 % in 0.2 N 2 mL
5 mL
KOH)pH indicator
Microelements solution
2 mL
CuCl22H2O
a
a
Vitamin solution
1 mL
1 mL
a
Biotin
Yeast extract
Final pH
6.8
6.06.2
Agarsemi-solid
1.75 g
1.75 g
Agar solid media + yeast extract
17 g
15 g
Solution prepared separated from the medium recipe
Microelements (sol.1,000 mL)
0.04 g
CuSO45H2O
0.12 g
ZnSO47H2O
1.4 g
H3BO3
1.0 g
Na2MoO42H2O
MnSO4H2O
1.175 g
Vitamin (solution 100 mL)a
10 mg
Biotina
20 mg
Pyridoxal-HCla
Vitamin solution (sol. 1,000 mL)b
D-biotinb
Calcium pantothenateb
Myo-inositolb
Niacinamideb
p-Aminobenzoic acidb
FAM
5g
0.12 g
0.03 g
0.2 g
0.1 g
0.02 g
0.002 g
4 mL
SM
5g
0.13 g
0.17 g
0.25 g
1.2 g
0.22 g
2.4 g
0.5 g
0.09 g
0.17 g
4 mL
4.8 g
M
5g
0.1 g
0.4 g
0.2
0.1 g
0.02
10 mg
4.8 g
AD
a
1 mL
6.0
1.75 g
15 g
AC
0.002 mg
b
10 mL
0.1 mg
8.5
1.75 g
15 g
AE
AD
0.08 mg
0.24 mg
2.8 mg
2 mg
2.35 mg
AC
AE
2 mg
0.15 mg
2 mg
0.2 mg
2 g
0.1 g
6.8
N.D.
15 g
40 mg
40 mg
200 mg
40 mg
20 mg
(continued)
15
Riboflavinb
Thiamine hydrochlorideb
Incubation at (C)
30
30
30
vadjust the pH with a KOH solution 10 %
N.D. = Not described (Xie and Yokota 2005)
LGI and FAM medium (Magalhes et al. 1983)
a
Vitamin solution described by Tarrand et al. (1978) for NFb medium
b
Vitamin solution described by Reinhold et al. (1987)
SM
40 mg
20 mg
4 mg
41
30
after incubation for 35 days at 30 C. Further purification is done on NFb (supplemented with yeast extract 50 mg L1). A. halopraeferans (Reinhold et al. 1987) cells
grown in SM medium can reach 1.2 m length and 0.71.4 m thick if the pH turns
alkaline. Another medium was also used, containing malic acid and 1.2 g of NaCl
and biotin as a sole source of vitamins.
A. oryzae can be isolated using the M medium (Table 1.4). The other medium
used was NFG medium composed of the following (g L1): glucose, 10.0;
CaCl22H2O, 0.020; MgSO47H2O, 0.2; K2HPO4, 1.0; CaCO3, 5.0; FeSO47H2O,
0.050; Na2MoO42H2O, 0.001. The medium is completed to 1,000 mL with distilled
water and the pH adjusted to 7.3. A. zeae and A. canadense can be isolated on M
medium by omitting biotin and adjusting the pH to 7.27.4 (Xie and Yokota 2005).
A. melinis (Peng et al. 2006) is isolated using semi-solid LGI medium or semi-solid
NFB medium after incubation at 28 C for 35 days. Purification can be done by
repeatedly streaking the isolates on plates of solid LGI or NFb medium.
A. palatum (Zhou et al. 2009) did not use the minimal medium, and instead to
obtain new species, TYB medium was used, containing 0.3 % yeast extract, 0.2 %
beef extract, 0.6 % tryptone, 0.3 % NaCl and 0.001 % FeCl3, pH 7.0.
Azospirilla do not harbour powerful oxygen-protective mechanisms for the
oxygen-sensitive N-fixing system and are unable to grow on nitrogen as the sole
nitrogen source in N-free agar plates or liquid media. Microaerobic diazotrophs are
aerotactic and as a result the N-fixing population collects in zones of reduced oxygen concentration, where they form a thin pellicle or veil that moves upwards as it
becomes thicker. After characteristic pellicles have formed, N-fixation can be
checked by acetylene reduction activity, and active cultures are transferred to new
vials containing the same medium. As soon as a new pellicle is visible, the cultures
are streaked out on agar plates containing the same medium with yeast extract
(20 mg L1) added. The small amount of yeast extract permits the growth of small
colonies on the surface of plates. Characteristic individual colonies are then transferred again to N-free semi-solid media, and those that grow well are streaked out
on potato agar for final purification.
16
Other N-free semi-solid media used for isolation of diazotrophs from plant samples are listed in Table 1.1 and described in detail below.
JNFb medium (Herbaspirillum spp.). Developed by J. Dbereiner from the NFb medium.
Composition (in g L1): malic acid, 5.0; K2HPO4, 0.6; KH2PO4, 1.8; MgSO47H2O, 0.2;
NaCl, 0.1; CaCl22H2O, 0.02; micronutrient solution (above), 2 mL; bromothymol blue
(0.5 % in 0.2 N KOH), 2 mL; FeEDTA (1.64 %), 4 mL; vitamin solution (above), 1 mL;
KOH, 4.5. Complete to 1,000 mL with distilled water. Adjust pH to 5.8 with KOH. For
semi-solid and solid medium, add 1.8 and 17 g agar L1, respectively.
LGI-P medium (G. diazotrophicus). P stands for Pernambuco, the first location that
G. diazotrophicus was isolated (Cavalcante and Dobereiner 1988). Particularly
when used to isolate from plant tissue, 5 mL L1 of sugarcane juice is necessary
(medium called LGI-Pc described by Reis et al. 1994). Composition (in g L1):
crystal sugar, 100; K2HPO4, 0.2; KH2PO4, 0.6; MgSO47H2O, 0.2; CaCl22H2O,
0.02; Na2MoO42H2O, 0.002; bromothymol blue (0.5 % in 0.2 N KOH), 5 mL;
FeCl36H2O, 0.01. Complete volume to 1,000 mL with distilled water. Adjust pH to
5.55.7 using acetic acid. Add 1.8 and 17 g agar L1 for semi-solid and solid medium,
respectively. LGI final pH 4.5 and cycloheximide (150 mg L1) can be used to isolate other diazotrophs, such as Gluconacetobacter (Jimenez-Salgado et al. 1997).
JMV medium (Burkholderia spp.). Developed by Baldani (1996) from the NFb
medium. Composition (in g L1): mannitol, 5.0; K2HPO4, 0.6; KH2PO4, 1.8;
MgSO47H2O, 0.2; NaCl, 0.1; CaCl22H2O, 0.2; micronutrient solution (above), 2 mL;
bromothymol blue (0.5 % in 0.2 N KOH), 2 mL; FeEDTA (1.64 %), 4 mL; vitamin
solution, 1 mL. Complete to 1,000 mL with distilled water. Adjust pH to 4.5 or 5.5
with KOH. For semi-solid and solid medium, add 1.8 and 25 g agar L1, respectively.
BAz medium and BAc agar plates as described previously (Estrada-de-los-Santos
et al. 2001). BAz medium had the following composition (in g L1): azelaic acid,
2.0; K2HPO4, 0.4; KH2PO4, 0.4; MgSO47H2O, 0.2; CaCl2, 0.02; Na2MoO4H2O,
0.002; FeCl3, 0.01; bromothymol blue, 0.075; and agar, 2.3. The medium was
adjusted with KOH to pH 5.7. Media. BAc medium (0.2 % azelaic acid, 0.02 %
L-citrulline, 0.04 % K2HPO4, 0.04 % KH2PO4, and 0.02 % MgSO47H2O) was also
used for isolation and culture of Burkholderia species.
1.2.3.1
Rich Media
17
1.3
1.3.1
Physiological Tests
Carbon Source Utilization
The ability of the isolates to use different carbon sources for growth dependent on
nitrogen fixation is one analysis necessary to describe new species, identify better
medium for growth and nitrogenase activity, or even bacterial storage. Several commercial kits are used, such as API (bioMrieux), Biolog (Table 1.5) or medium
prepared by changing the carbon source. In this case, the main carbon source is
omitted and the carbon sources of interest are tested. Initially, the isolates are grown
in rich media that can be prepared in the laboratory, as for example, DYGS media
(Rodrigues Neto et al. 1986) and SYP liquid medium (Caballero-Melado and
Martinez-Romero 1994), or sold by companies, such as Nutrient Broth. A smaller
amount of bacterial cells (1020 L) is inoculated into the semi-solid medium
Azospirillum
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
A. lipoferum
+
+
+
v
+
v
+
+
v
+
v
+
+
A. brasilense
+
v
+
A. amazonense
v
+
+
+
+
+
+
+
v
+
+
v
+
+
+
A. halopraeferens
nd
v
nd
+
nd
nd
nd
+
nd
nd
nd
+
+
nd
+
nd
A. irakense
+
+
+
v
+
+
+
+
+
+
+
v
+
+
A. largimobile
+
+
+
+
+
+
+
+
nd
A. dobereinerae
nd
+
nd
v
v
v
+
A. oryzae
nd
+
+
nd
+
nd
nd
+
nd
nd
+
+
nd
A. melinis
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
nd
+
+
+
A. canadense
nd
nd
A. zeae
v
+
+
+
+
nd
v
+
nd
+
A. rugosum
nd
+
nd
nd
nd
+
+
nd
nd
nd
nd
nd
nd
nd
nd
A. palatum
v
v
+
+
nd
nd
nd
nd
+
nd
nd
+
+
nd
nd
nd
+
+
A. picis
+
+
nd
+
+
nd
nd
nd
+
+
A. thiophilum
nd
+
nd
+
nd
+
nd
nd
+
+
nd
nd
+
nd
+
A. humicireducens
+
+
nd
nd
+
nd
nd
nd
nd
nd
+
nd
+
+
W
+
+
+
+
nd
A. formosense
nd
+
nd
+
nd
+
nd
nd
+
+
nd
nd
nd
nd
nd
A. fermentarium
nd
nd
nd
nd
+
+
nd
nd
nd
nd
+
nd
+
nd
nd
+
nd
+
+
nd
Data from Eckert et al. (2001), Sly and Stackebrandt (1999), Ben Dekhil et al. (1997), Khammas et al. (1989), Reinhold et al. (1987), Xie and Yokota (2005),
Peng et al. (2006), Mehnaz et al. (2007a, b), and Lavrinenko et al. (2010)
Carbon sources: (1) N-acetylglucosamine, (2) L-arabinose, (3) D-cellobiose, (4) D-fructose, (5) L-fucose, (6) D-galactose, (7) Gentiobiose, (8) D-gluconate,
(9) D-glucose, (10) Glycerol, (11) Myo-inositol, (12) Lactose, (13) Maltose, (14) D-mannitol, (15) D-mannose, (16) L-rhamnose, (17) D-ribose, (18) D-sorbitol,
(19) Sucrose, (20) D-trehalose
Symbols: +, positive; , negative; v, variable or inconsistent; nd, not determined
Table 1.5 Azospirillum species and their pattern of carbon sources using Biolog or API systems
18
V.M. Reis et al.
19
1.3.2
20
diluted (100 L cell suspension to 400 L water). This cell suspension (500 L) is
mixed with NaOH 1 M (500 L) and boiled (100 C, 5 min) to disrupt the membranes and release the total cellular contents. Next, 2.5 mL of fresh solution
(100:1:1) of Na2CO3 (5 %):CuSO4 (1 %):KNaC4H4O64H2O (2 %) is added. After
10 min of reaction, 500 L Folin-Ciocalteu reagent (1 M) is added. After 30 min of
incubation in the dark, the protein content of each sample is measured at 750 nm
using a spectrophotometer (PE Lambda Bio, Model 11). A standard curve of serum
albumin is used for calibration of the protein method and protein quantification.
By dividing the amount of acetylene reduced by the amount of protein in one
vial, the specific activity is obtained. Using this procedure, it is possible to compare
strains and species in a quantitative way. If the protein measurement is not performed, the ARA activity can be considered a qualitative assessment (positive or
negative). In some strains/species, it is not possible to perform the acetylene reduction activity, as the growth on the semi-solid medium is not characteristic (pellicle
formation).
It is also possible to measure acetylene reduction activity in plates (Wilcockson
and Werner 1978; Pan and Vessey 2001) or liquid medium (Reis and Dbereiner
1998), but normally the activity is very low. Wilcockson and Werner (1978) used
26 h of incubation to measure ARA activity of Bradyrhizobium japonicum. Pan
and Vessey (2001) used a modified atmosphere to measure nitrogenase activity in
plates. They utilized the same method to measure nitrogenase activity and respiration rate in G. diazotrophicus; colonies grown 56 days on solid LGI-P medium
were transferred to a chamber, in which various atmospheric pO2 were applied. Gas
mixtures fed into an assay chamber were composed of various partial pressures of
O2 in N2 (N2-O2) or in Ar (Ar-O2). Respiration rate was measured as the rate of CO2
evolved from the colonies with N2-O2 as the input gas. Nitrogenase activity was
measured as H2 evolution in N2-O2 and in Ar-O2
Reis and Dbereiner (1998) measured nitrogenase activity in liquid cultures of
G. diazotrophicus by acetylene reduction in closed batch assays and found that
activity was maximal when the culture was at equilibrium with 0.2 kPa of O2 in the
gas phase.
1.3.3
Bacteria belonging to the genus Azospirillum are Gram-negative, motile and generally vibroid in shape and contain poly--hydroxybutyrate (PHB) granules. Three
species were classified as facultative anaerobic: A. melinis, A. thiophilum and
A. humicireducens. Almost all strains were classified with one single polar flagellum and only A. palatum was not described as a N-fixing species (Table 1.6). Based
on several new species obtained from soil and other unusual environments, it could
be affirmed that this genus is widespread in nature. Azospirilla have a typically
aerobic metabolism, with O2 as the terminal electron acceptor. In A. brasilense and
A. lipoferum, NO3 can replace O2 in respiration and under alkaline conditions N2O
Cell size
1.0 1.7
1.0 1.2
0.9 1.0
0.7 2.4
nd
0.7 3.0
1.0 2.0
1.0 1.5
0.7 1.0
0.9 1.8
0.9 1.9
nd
0.6 2.0
nd
nd
2.5 1.2
2.5 0.8
2.4 1.0
PC
+
+
+
+
+
+
nd
nd
nd
nd
+
nd
nd
+
nd
nd
Biotin use
+
nd
nd
Optimal T (C)
37
37
35
41
3033
28
30
30
2033
2530
30
2237
3047
37
37
30
30
30
pH range
5.76.8
6.08.0
nd
6.88.0
5.58.5
nd
6.07.0
6.07.0
4.08.0
5.07.0
5.07.0
nd
6.08.0
6.59.0
6.58.5
5.58.5
5.09.0
6.08.0
NaCl 3 %
+
+
nd
Denitr
+
+
+
+
nd
nd
+
nd
nd
nd
nd
nd
nd
nd
+
+
Indole
production
+
+
+
+
+
+
+
nd
Nitrate
reduction
+
+
v
+
v
+
+
+
+
+
+
+
(1) Sizeminor number in long and wide (m); (2) PC = pleomorphic cells; (3) biotin requirement; (4) optimal T = optimal temperature of growth; (5) pH
range; (6) growth with 3 % NaCl; (7) denitrification; (8) nitrate reduction; (9) indole production. nd not determined
Azospirillum species
A. lipoferum
A. brasilense
A. amazonense
A. halopraeferens
A. irakense
A. largimobile
A. dobereinerae
A. oryzae
A. melinis
A. canadense
A. zeae
A. rugosum
A. palatum
A. picis
A. thiophilum
A. humicireducens
A. formosense
A. fermentarium
22
and N2 are formed (Stephan et al. 1984). Under these conditions, anaerobic growth
and N2 fixation have been shown to occur (Nelson and Knowles 1978; Scott et al.
1979). Weak fermentative ability has been observed with A. lipoferum grown on
glucose or fructose (Tarrand et al. 1978).
1.3.4
Preservation
23
References
Assmus B, Schloter M, Kirchhof G et al (1997) Improved in situ tracking of rhizosphere bacteria
using dual staining with fluorescence-labeled antibodies and rRNA-targeted oligonucleotides.
Microb Ecol 33:10131019
Baldani J (1984) Ocorrncia e caracterizao de Azospirillum amazonense em comparao com
outras espcies deste gnero, em razes de milho, sorgo e arroz. MSc Thesis, Federal Rural
University of Rio de Janeiro, Seropdica, RJ, Brazil
Baldani V (1996) Efeito da inoculao de Herbaspirillum spp. no processo de colonizao e
infeco de plantas de arroz e ocorrncia e caracterizao parcial de uma nova bactria diazotrfica. PhD Thesis, Federal Rural University of Rio de Janeiro, Seropdica, RJ, Brazil
Baldani J, Baldani V, Seldin L et al (1986) Characterization of Herbaspirillum seropedicae gen.
nov. sp. nov. a root associated nitrogen fixing bacterium. Int J Syst Bacteriol 36:8693
Baldani J, Pot B, Kirchhof G et al (1996) Emended description of Herbaspirillum; inclusion of
(Pseudomonas) rubrisubalbicans, a mild plant pathogen, as Herbaspirillum rubrisubalbicans
comb. nov. and classification of a group of clinical isolates (EF group 1) as Herbaspirillum
species 3. Int J Syst Bacteriol 46:802810
Baldani J, Baldani V, Dbereiner J (2005) Genus III. Herbaspirillum. In: Brenner DJ, Krieg NR,
Staley JT, Garrity GM (eds) Bergeys manual of systemic bacteriologythe protobacteria, vol
2, 2nd edn. Springer, New York, pp 629636; part C
Beijerinck M (1922) Azotobacter chroococcum als indikator van de vruchtbarrheid van den
ground. K Ned Akab Wet Versl Gewone Vergad Afd Natuurkd 30:431438
Beijerinck M (1925) ber ein Spirillum, welches freien Stickstoff binden kann? Zentrabl Bakteriol
Parasitenkd Infektionskr Hyg Abt 2(63):353359
Boddey R (1987) Methods for quantification of nitrogen fixation associated with gramineae. Crit
Rev Plant Sci 6:209266
Caballero-Melado J, Martinez-Romero E (1994) Limited genetic diversity in the endophytic sugarcane bacteria Acetobacter diazotrophicus. Appl Environ Microbiol 60:15321537
Caballero-Mellado J, Martinez-Aguilar L, Paredes-Valdez, G et al (2004) Burkholderia unamae
sp. nov., in N2-fixing rhizospheric and endophytic species. Int. J Syst Evol Microbiol 54:
11651172
Caraway B, Krieg N (1974) Aerotaxis in Spirillum volutans. Can J Microbiol 20:13671377
Cavalcante V, Dobereiner J (1988) A new acid-tolerant nitrogen-fixing bacterium associated with
sugarcane. Plant Soil 108:2331
Chen M, Sheu S, James E et al (2013) Azoarcus olearius sp. nov., a nitrogen-fixing bacterium
isolated from oil-contaminated soil. Int J Syst Evol Microbiol 63:37553761
Day J, Dbereiner J (1976) Physiological aspects of N2-fixation by Spirillum from Digitaria roots.
Soil Biol Biochem 8:4550
Dekhil S, Cahill M, Stackebrandt E et al (1997) Transfer of Conglomeromonas largomobilis subsp.
largomobilis to the genus Azospirillum as Azospirillum largomobile comb. nov., and elevation
of Conglomeromonas largomobilis subsp. parooensis to the new type species of
Conglomeromonas, Conglomeromonas parooensis sp. nov. system. Appl Microbiol 20:7277
Dbereiner J (1995) Isolation and identification of aerobic nitrogen-fixing bacteria from soil and
plants. In: Alef K, Nannipieri P (eds) Methods in applied soil microbiology and biochemistry.
Academic, San Diego, pp 134141
Dobereiner J, Marriel IE, Nery M (1976) Ecological distribution of Spirillum lipoferum Beijerinck.
Can J Microbiol 22:14641473
24
25
Oliveira A, Stoffels M, Schmid M et al (2009) Colonization of sugarcane plantlets by mixed inoculations with diazotrophic bacteria. Eur J Soil Biol 45:106113
Paganin P, Tabacchioni S, Chiarini L (2011) Pathogenicity and biotechnological applications of the
genus Burkholderia. Cent Eur J Biol 6:9971005
Pan B, Vessey J (2001) Response of the endophytic diazotroph Gluconacetobacter diazotrophicus
on solid media to changes in atmospheric partial O(2) pressure. Appl Environ Microbiol
67:46944700
Patriquin D, Dbereiner J (1978) Light microscopy observations of tetrazolium-reducing bacteria
in the endorhizosphere of maize and other grasses in Brazil. Can J Microbiol 24:734742
Patriquin D, Dbereiner J, Jain D (1983) Sites and processes of association between diazotrophs
and grasses. Can J Microbiol 29:900915
Peng G, Wang H, Zhang G et al (2006) Azospirillum melinis sp. nov., a group of diazotrophs isolated from tropical molasses grass. Int J Syst Evol Microbiol 56:12631271
Perin L, Martinez-Aguilar L, Paredes-Valdez G et al (2006) Burkholderia silvatlantica sp. nov., a
diazotrophic bacterium associated with sugarcane and maize. Int J Syst Evol Microbiol
56:19311937
Reinhold B, Hurek T, Niemann EG et al (1986) Close association of Azospirillum and diazotrophic
rods with different root zones of Kallar grass. Appl Environ Microbiol 52:520526
Reinhold B, Hurek T, Fendrik I et al (1987) Azospirillum halopraeferens sp. nov., a nitrogen-fixing
organism associated with roots of Kallar grass (Leptochloa fusca (L.) Kunth). Int J Syst
Bacteriol 37:4351
Reinhold-Hurek B, Hurek T, Gillis M et al (1993) Azoarcus gen. nov., nitrogen-fixing proteobacteria associated with roots of Kallar grass (Leptochloa fusca (L.) Kunth), and description of
two species, Azoarcus indigens sp. nov. and Azoarcus communis sp. nov. Int J Syst Bacteriol
43:574584
Reinhold-Hurek B, Hurek T (2000) Reassessment of the taxonomic structure of the diazotrophic
genus Azoarcus sensu lato and description of three new genera and new species, Azovibrio
restrictus gen. nov., sp nov., Azospira oryzae gen. nov., sp nov and Azonexus fungiphilus gen.
nov., sp nov. Int J Syst Evol Microbiol 50:649659
Reis V, Dbereiner J (1998) Effect of high sugar concentration on nitrogenase activity of
Acetobacter diazotrophicus. Arch Microbiol 171:1318
Reis V, Olivares F, Dobereiner J (1994) Improved methodology for isolation of Acetobacter diazotrophicus and confirmation of its endophytic habitat. World J Microbiol Biotechnol 10:
401405
Reis V, Estrada-de los Santos S, Tenorio-Salgado J et al (2004) Burkholderia tropica sp nov., a
novel nitrogen-fixing, plant-associated bacterium. Int J Syst Evol Microbiol 54:21552162
Rodrigues Neto, J.; Malavolta Jr.; V.A. Victor, O. (1986) Meio simples para o isolamento e cultivo
de Xanthomonas campestris pv. citri TIPO B. Summa Phytopathol 12, 16.
Scott D, Scott C, Dbereiner J (1979) Nitrogenase activity and nitrate respiration in Azospirillum
spp. Arch Microbiol 121:141145
Sly LI, Stackebrandt E (1999) Description of Skermanella parooensis gen. nov., sp. nov. to accommodate Conglomeromonas largomobilis subsp. parooensis following the transfer of
Conglomeromonas largomobilis subsp. largomobilis to the genus Azospirillum. Int J Syst
Bacteriol 49:541544
Steenhoudt O, Vanderleyden J (2000) Azospirillum, a free-living nitrogen-fixing bacterium closely
associated with grasses: genetic, biochemical and ecological aspects. FEMS Microbiol Rev
24:487506
Stephan M, Zimmer W, Bothe H (1984) Denitrification by Azospirillum brasilense Sp7 II: growth
with nitrous oxide as respiratory electron acceptor. Arch Microbiol 138:212216
Surez-Moreno Z, Caballero-Mellado J, Coutinho B et al (2012) Common features of environmental and potentially beneficial plant-associated Burkholderia. Microb Ecol 63:249266
Tarrand J, Krieg N, Dbereiner J (1978) A taxonomic study of the Spirillum lipoferum group, with
descriptions of a new genus, Azospirillum gen. nov., and two species, Azospirillum lipoferum
(Beijerinck) comb. nov. and Azospirillum brasilense sp. nov. Can J Microbiol 24:967980
26
Vial L, Chapalain A, Groleau M-C, Dziel E (2011) The various lifestyles of the Burkholderia
cepacia complex species: a tribute to adaptation. Environ Microbiol 13:112
Videira S, Arajo J, Rodrigues L, Baldani V, Baldani J (2009) Occurrence and diversity of nitrogenfixing Sphingomonas bacteria associated with rice plants grown in Brazil. FEMS Microbiol
Lett 293:1119
Vincent J (1970) A manual for the practical study of root-nodule bacteria. Blackwell Scientific,
Oxford, p 164 (IBP Handbook, 15)
Wilcockson J, Werner D (1978) Nitrogenase activity of Rhizobium japonicum growing on agar
surfaces in relation to slime production, growth and survival. J Gen Microbiol 108:151160
Xie C, Yokota A (2005) Azospirillum oryzae sp. nov., a nitrogen-fixing bacterium isolated from the
roots of the rice plant Oryza sativa. Int J Syst Evol Microbiol 55:14351438
Yabuuchi E, Kosako Y, Oyaizu H et al (1992) Proposal of Burkholderia gen. nov. and transfer of 7
species of the genus Pseudomonas homology group-II to the new genus, with the type species
Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiol Immunol 36:
12511275
Yamada Y, Hoshino K, Ishikawa T (1997) The phylogeny of acetic acid bacteria based on the
partial sequence pf 16S ribossomal RNA: the elevation of the subgenus Gluconoacetobacter to
the generic level. Biosci Biotechnol Biochem 61:12441251
Yamada Y, Hoshino K, Ishikawa T (1998) Gluconacetobacter corrig. (Glucono acetobacter [sic]).
In validation of publication of new names and new combinations previously effectively published outside the IJSB, list no 64. Int J Syst Bacteriol 48:327328
Young C-C, Hupfer H, Siering C et al (2008) Azospirillum rugosum sp. nov., isolated from oilcontaminated soil. Int J Syst Evol Microbiol 58:959963
Zhang, H.; Hanada, S.; Shigematsu, T. et al. (2000) Burkholderia kururiensis sp. Nov., a tricloroethylene (TCE)-dgrading bacterium isolated from na aquifer polluted with TCE. Int J Syst Evol
Bacteriol 50:743749.
Zhou Y, Wei W, Wang X (2009) Azospirillum palatum sp. nov. isolated from forest soil in Zhejiang
province, China. J Gen Appl Microbiol 55:17
Zhou S, Han L, Wang Y et al (2012) Azospirillum humicireducens sp. nov., a nitrogen-fixing bacterium isolated from a microbial fuel cell. Int J Syst Evol Microbiol 63(pt 7):26182624.
doi:10.1099/ijs. 0.046813-0
Chapter 2
27
28
2.1
Introduction
29
84
95
71
51
91
96
100
92
98
99
99
99
60
Nitrospirillum amazonense
57
99
92
87
100
99
Fig. 2.1 Phylogenetic analysis of Azospirillum spp. and other representatives of the family
Rhodospirillaceae based on 16S rRNA gene sequences (Lin et al. 2014). Distances and clustering
were performed by using Neighbor-Joining method with the software package MEGA 6. Filled
circles indicate that the corresponding nodes were also recovered in the tree constructed based on
Maximum Likelihood and Maximum Parsimony algorithm. Bootstrap values (>50 %) based on
1,000 replications are shown at the branching points. Rhizobium alkalisoli LMG 24763T and
Burkholderia sabiae LMG 24235T were used as outgroups. Bar, 0.02 substitutions per nucleotide
position
and unidentified aminolipid (AL) and phospholipids (PL) (Table 2.3). The common
major respiratory quinone was ubiquinone Q-10 and predominant polyamines were
sym-homospermidine and putrescine.
On the other hand, the introduction of rRNA-targeted oligonucleotide probes is
a milestone for microbial ecological studies (Stahl et al. 1988). Molecular markers
such as 16S, 23S rRNA sequences or intergenic sequences are useful for distinguishing microorganisms among various genera, species and even to differentiate
among strains (Woese et al. 1990; Shen and Young 2005). By using the PCR-based
techniques the detection, identification and quantification of microorganisms can be
performed and complemented with culture-dependent and biochemical methods.
The development of Azospirillum species-specific probes labelled with fluorescence
has been worked out by Stoffels et al. (2001) and used in fluorescence in situ
30
Azospirillum
fermentarium
(fermentative broth,
Taiwan)
Azospirillum formosense
(agricultural soil,
Taiwan)
Azospirillum
halopraeferens (roots of
kallar grass, Pakistan)
Azospirillum
humicireducens (humic
substances, China)
Azospirillum irakense
(rhizosphere of rice,
Iraq)
Azospirillum largimobile
(fresh lake water,
Australia)
Azospirillum lipoferum
(root of wheat)
Azospirillum melinis
(molasses grass, China)
Etymology
N.L. neut. adj. amazonense, pertaining to the
Amazon region of Brazil, South America
N.L. neut. adj. brasilense, pertaining to the
country of Brazil, South America
N.L. neut. adj. canadense, pertaining to
Canada, the region of isolation, referring to
its isolation from Canadian soil
N.L. gen. fem. n. doebereinerae, of
Dbereiner, in honour of Johanna
Dbereiner, who isolated and characterized
many Azospirillum spp., and other
diazotrophic plant-associated bacteria
L. neut. adj. fermentarium pertaining to
fermentation, reflecting the fact that the type
strain was isolated from a fermentative tank
References
Magalhes et al.
(1983), Falk et al.
(1985, 1986)
Tarrand et al.
(1978), Falk et al.
(1985, 1986)
Mehnaz et al.
(2007a)
Eckert et al. (2001)
Reinhold et al.
(1987)
Khammas et al.
(1989)
Ben Dekhil et al.
(1997)
(continued)
31
Etymology
L. gen. n. oryzae, of rice, from where the
type strain was isolated
L. gen. fem. n. picis, of pitch, tar
References
Xie and Yokota
(2005)
Lin et al. (2009)
Lavrinenko et al.
(2010)
Mehnaz et al.
(2007b)
Table 2.2 Fatty acid profiles of Azospirillum spp. and other closely related species
Fatty acid
Saturated
C10:0
C12:0
C14:0
C15:0
C16:0
C18:0
Unsaturated
C16:1 5c
C17:0 cyclo
C17:1 6c
C17:1 8c
C18:1 5c
C19:0 cyclo
8c
Hydroxy
C14:0 2-OH
C15:0 iso
3-OH
C16:0 2-OH
C16:0 3-OH
C18:1 2-OH
Summed
feature 2
10
11
12
4.1
3.6
1.4
13.6
4.4
tr
1.4
4.3
tr
5.2
tr
1.6
7.7
tr
1.1
5.7
tr
6.2
tr
6.2
tr
1.9
7.3
tr
1.2
4.2
1.2
2.1
3.5
2.4
10.0
1.5
5.8
7.1
3.4
1.6
tr
6.8
1.5
tr
7.4
8.6
1.5
tr
14.8
5.2
tr
1.3
6.2
2.6
tr
14.1
1.3
3.4
2.3
4.8
4.8
3.8
4.5
5.9
4.8
3.7
5.9
4.8
4.2
1.4
5.5
4.2
6.9
5.8
4.3
5.5
5.9
7.6
9.4
10.6
9.6
1.0
10.9
6.6
7.9
8.3
5.4
1.3
4.9
4.7
7.0
5.6
tr
7.3
6.5
1.0
11.6
11.6
10.4
1.5
15.5
8.5
2.1
(continued)
32
2.7
1.1
feature 5
Summed
60.2 46.7 56.4 53.4 44.5 51.83 45.3 42.3 53.4 36.4 31.3 27.6
feature 8
Taxa: (1) A. brasilense BCRC 12270T; (2) A. fermentarium BCRC 80505T; (3) A. formosense
BCRC 80273T; (4) A. lipoferum BCRC 12213T; (5) A. oryzae JCM 21588T; (6) A. picis DSM
19922T; (7) A. rugosum DSM 19657T; (8) A. thiophilum DSM 21654T; (9) A. zeae LMG 23989T;
(10) Niveispirillum fermenti BCRC 80504T; (11) Niveispirillum irakense BCRC 15764T; (12)
Nitrospirillum amazonense BCRC 14279T
tr <1 %, not detected
Summed features represent groups of two or three fatty acids that cannot be separated by GLC
with the MIDI system. Summed feature 2: C14:0 3-OH/C16:1 iso I; Summed feature 3: C16:1 7c/C16:1
6c; Summed feature 5: C18:0 ante/C18:2 6,9c; Summed feature 8: C18:1 7c/C18:1 6c
Table 2.3 Comparison of polar lipid profiles of Azospirillum strains and other representatives
of the family Rhodospirillaceae (Lin et al. 2014)
Polar lipid
Organism
PC PE PG DPG PME PDE APL AL PL GL L
Azospirillum brasilense
+
+
+
+
+
+
BCRC 12270T
Azospirillum picis DSM
+
+
+
+
+
+
+
+
19922T
Azospirillum rugosum
+
+
+
+
DSM 19657T
Azospirillum formosense
+
+
+
+
+
BCRC 80273T
Azospirillum oryzae JCM
+
+
+
+
+
+
21588T
Niveispirillum fermenti
+
+
+
+
+
+
+
+
+
+
BCRC 80504T
Niveispirillum irakense
+
+
+
+
+
+
+
+
+
BCRC 15764T
Nitrospirillum amazonense
+
+
BCRC 14279T
Rhodocista pekingensis
+
+
+
+
+
+
+
+
JCM 11669T
Rhodocista centenaria
+
+
+
+
+
+
+
+
JCM 21060T
Skermanella aerolata
+
+
+
+
+
+
+
DSM 18479T
Symbol: + positive, negative
PC phosphatidylcholine, PE phosphatidylethanolamine, PG phosphatidylglycerol, DPG diphosphatidylglycerol, PME phosphatidylmethylethanolamine, PDE phosphatidyldimethylethanolamine, AL aminolipid, GL glycolipid, APL unidentified aminophospholipid, PL unidentified
phospholipid, L unidentified lipid
33
2.2
Methodology
Approaches used in the study of Azospirillum spp. from pure cultures or environmental samples are illustrated in Fig. 2.2. The traditional approaches include bacterial enumeration, biomass or activity determination. In polyphasic approaches,
Fig. 2.2 Approaches used in the study of Azospirillum spp. from pure cultures or environmental
samples
34
genotypic or phenotypic traits were demonstrated. The nucleic acid analyses part
encompass technologies such as DNA extraction, DNADNA hybridization, G + C
content determination and PCR amplification. Primers specific to genus, functional
gene or housekeeping gene were useful in the identification, studies of functional
traits or phylogeny of bacteria. Further, the genus-specific primers can be used
along with PCR-DGGE or qPCR to resolve the community structure regarding
Azospirillum in a variety of environments such as rhizosphere. The details of the
methodologies mentioned in this chapter are given below.
2.2.1
Bacterial genomic DNA was isolated using UltraClean Microbial Genomic DNA
Isolation Kits (MO BIO, USA) according manufacturers instructions. Briefly, the
collected microorganisms were stabilized and homogeneously dispersed to lysis
(detergent solution SDS and heat). Then, thought the protein precipitation, bind DNA
to the silica filter membrane and wash with an ethanol-based solution. DNA was
released and recovered with centrifugation. DNA from various soil samples (250 mg)
was extracted using a bead beating method with the PowerSoil DNA Isolation Kits
(MO BIO, USA). It is important to remove contaminating organic and inorganic matter that may reduce DNA purity and inhibit downstream DNA applications. It should
be noted that when protocols fail, the phenol/chloroform prep will usually work on
any remainder of the sample. Briefly, add one volume of phenol/chloroform/isoamyl
alcohol (25:24:1) to the lysed sample (with 10 % SDS, lysozyme and proteinase K)
and shake by hand thoroughly for approximately 20 s. Centrifuge at 4 C for 1 h at
16,000g. Transfer the upper aqueous phase to a fresh tube. Be sure not to carry over
any phenol during pipetting. Then, proceed to ethanol precipitation, below: add 3 M
NaOAc (1/10 volume of sample) and homogeneous mixing, add 100 % ethanol (2
volume of sample) or isopropanol (1 volume of sample) and keep at 4 C for hours,
the genomic DNA will be precipitated after mixing well. Seventy percent ethanol
was used to wash and the DNA was finally resuspend in appropriate volume of Tris
EDTA buffer (20 mM Tris, 0.5 mM EDTA, pH 8.0). The quality of the extracted
DNA was checked by agarose gel electrophoresis (0.8 % (w/v)) after staining with
ethidium bromide (EtBr). DNA quantity was measured according to the absorbance
of a sample at 260 nm in a spectrophotometer.
2.2.2
An almost full length of 16S rRNA gene was amplified by using bacterial universal
primers 1F (5-GAG TTT GAT CAT GGC TCA GA-3) and 9R (5-AAG GAG
GTG ATC CAA CCG CA-3); the related primers 3 (5-CCT ACG GGA GGC AGC
35
AG-3), 5F (5-AAA CTC AAA TGA ATT GAC GGG G-3) and 4R (5-TTA CCG
CGG CTG CTG GCA C-3) were used for sequencing reaction (Edwards et al.
1989). DNA extracted by the above methods was used as template for PCR amplification. The PCR reactions were performed in a final volume of 25 L containing
0.2 mM each of the four dNTPs, 20 pmol of each primer, 50 ng of DNA and 1 unit
of Taq DNA polymerase with appropriate reaction buffer. The PCR conditions were
as follows: initial denaturation for 2 min at 95 C followed by 35 cycles of 30 s at
95 C, 30 s at 55 C and 1.5 min at 72 C, with a final extension of 7 min at
72 C. The expected size of the product was about 1,500 bp. Gene sequencing was
performed by using the Bigdye terminator kit (Heiner et al. 1998) and nucleotide
sequence of PCR product was determined by a genetic analyser (ABI 3730, Applied
Biosystems, CA, USA). The DNA fragments were assembled using the Vector NTI
9.0 software (IBI, USA). Subsequently, closely related 16S rRNA gene sequences
were retrieved and aligned by using the CLUSTAL_X (1.83) program (Thompson
et al. 1997). The phylogenetic analysis was performed using MEGA 6 software
(Molecular Evolutionary Genetics Analysis, version 6.0) (Tamura et al. 2013) and
the topology of the resultant trees was evaluated by Neighbor-Joining (Saitou and
Nei 1987), Maximum Likelihood (Felsenstein 1981) and Maximum Parsimony
(Fitch 1971) methods. The bootstrap values (Felsenstein 1985) were computed after
1,000 replications.
2.2.3
36
2.2.4
2.2.5
In the screening of Azospirillum isolates, bacteria were isolated by using the standard tenfold dilution plating technique. After 3 days of aerobic incubation on nutrient agar, R2A or nitrogen-free agar plate (Reinhold et al. 1987) at 30 C, the colony
PCR was adopted. Briefly, colonies were picked and suspended in PBS buffer
(pH 6.8). After treating with 200 L lysozyme buffer (100 mM Tris, 50 mM EDTA,
pH 8.0; lysozyme final concentration is 4 mg mL1) at 37 C for 30 min, colony
PCR was carried out by using 3 L of bacterial suspensions as templates. Polymerase
chain reaction was carried out using primer set Azo494-F/Azo756-R and followed
the further described conditions.
2.2.6
37
DNA from various soil samples (250 mg) was extracted using a bead beating method
with the PowerSoil DNA Isolation Kits (MO BIO, USA) according to manufacturers instructions. Briefly, soil sample was loaded into a tube containing a buffer
that will help disperse the soil particles, begin to dissolve humic acids and protect
nucleic acids from degradation. SDS and other disruption agents were added for
complete cell lysis using vortex and/or 70 C water bath. Non-DNA organic and
inorganic materials (humic substances, cell debris and proteins) were precipitated to
remove. Then, bind DNA to the silica filter membrane and wash with an ethanolbased solution. DNA was released and recovered with centrifugation. Genusspecific primer pair GC-Azo494-F/Azo756-R was used to downstream PCR
reaction. The forward primer used in the PCR-DGGE is clamped with 40 mer GC
at the 5 end (5-CGC CCG CCG CGC GCG GCG GGC GGG GCG GGG GCG
CGG GGG G-3). PCR was conducted using an annealing temperature of 68 C to
improve the detection of this group from environmental samples and to minimize
sample contaminant interference (Lin et al. 2011).
The PCR amplicons obtained from the above reactions were purified from agarose gel using the QIA quick gel extraction kit (Qiagen, Inc., Chatsworth, California,
USA) and further used for DGGE analysis. The PCR-generated amplicons were
separated on a DCode universal mutation detection system (Bio-Rad Laboratories
Inc., USA); 10 % (w/v) polyacrylamide gel with a 4060 % parallel denaturing gradient was prepared with a Hoefer SG100 gradient maker. Denaturant (100 %) contained 7 mol L1 urea and 40 % (v/v) deionized formamide. Approximately 30 L
of PCR products of the expected size was loaded in each well. The gel was run for
17 h at 60 V in 1 TAE buffer (20 mM Tris, 10 mM acetic acid, 0.5 mM EDTA,
pH 8.0) at 60 C, stained with EtBr or SYBR Green, visualized under UV radiation
and photographed. Selected bands were cut from the gel and recovered by using
electro-elutor and sent for sequencing (Lin et al. 2011).
2.2.7
Bacterial culture with known cell number (CFU L1) was seeded into the nonsterile soil, mixed thoroughly and further used for DNA extraction. Soil DNA was
extracted using the bead beating method with the PowerSoil DNA Isolation Kits
(MO BIO, USA). The DNAs after serially diluted were used as templates in realtime PCR detection; meanwhile DNA concentrations were determined by using
spectrophotometer and OD260 value was calculated to obtain the actual DNA concentration. The PCR reactions were performed in a final volume of 25 L containing
38
2.2.8
(a) Cell morphology was determined by placing the cells (12 days old) on a
carbon-coated copper grid followed by staining with aqueous solution of 0.2 %
(w/v) uranyl acetate for 510 s, brief air-drying and observation under a transmission electron microscope (JEOL JEM-1400). For thin sections, the cells
were prefixed with 2 % (v/v) glutaraldehyde and 3 % paraformaldehyde in
0.1 M sodium phosphate buffer (pH 7.2) for 2 h at room temperature and washed
three times in the same buffer. Thin sections were prepared and examined. For
scanning electron microscopy, 50200 L of culture was placed onto a Millipore
filter (0.45 m) and fixed with 2.5 % (v/v) glutaraldehyde in 0.1 M phosphate
buffer (pH 7.2) for 2 h. Then the samples were rinsed with buffer, dehydrated in
a graded series of ethanol and critical-point-dried. The filters were coated with
gold palladium and observed with field emission scanning electron microscope
(JEOL JSM-7401F, Japan) (Lin et al. 2012).
(b) Gram staining was performed as described by Murray et al. (1994). Briefly, fix
the fresh culture to the slide by heat or by exposure to methanol. Heat fix the
slide by passing it through a flame to warm the glass. Crystal violet (a basic
dye) is then added by covering the heat-fixed cells with a prepared solution.
Allow to stain for approximately 1 min. Briefly rinse the slide with water (the
heat-fixed cells should look purple at this stage). Add iodine (Grams iodine)
solution (1 % iodine, 2 % potassium iodide in water) for 1 min. After briefly
rinse with water, decolorize the sample by applying 95 % ethanol or a mixture
of acetone and alcohol (the important aspect is to ensure that all the color has
come out that will do so easily). Rinse with water to stop decolorization. Then,
rinse the slide with safranin reagent which stains all cells red. Blot gently and
allow the slide to dry. Observe the samples using a light microscopy.
(c) Catalase activity was determined by assessing bubble production by cells in
3 % (v/v) H2O2 and oxidase activity was determined by using 1 % (w/v)
N,N,N,N,-tetramethyl-1,4-phenylenediamine reagent (bioMrieux, France).
Intracellular PHB granules were detected with different methods, including
Sudan Black staining (Schlegel et al. 1970) and Nile blue A staining (Ostle and
Holt 1982), which result in dark blue or fluorescent granules.
39
(d) Carbon source utilization pattern was determined by using Biolog GN2
MicroPlate (bioMrieux, France). Nitrate reduction, indole production, activity
of -galactosidase and urease, hydrolysis of esculin and gelatin and assimilation of 12 substrates were tested with API 20 NE strips (bioMrieux, France).
The activities of various enzymes were determined by using API ZYM system
(bioMrieux, France).
2.2.9
(a) Fatty acid methyl esters (FAME) were prepared, separated and identified
according to the standard protocol (Paisley 1996) of the Microbial Identification
System (MIDI) (Sasser 1990) by gas chromatograph (Agilent 7890A) fitted
with a flame ionization detector. The cultures were grown under the same condition on R2A plates at 30 C. After 48 h cells were harvested from the plate
and subjected to saponification (reagent 1 contains: NaOH 45 g, methanol
150 mL and d.d. H2O 150 mL), methylation (6.0 N HCl 325 mL and methanol
275 mL) and extraction (hexane 200 mL and methyl-tert-butyl ether 200 mL)
as described by Miller (1982). Identification and comparison were made by
using the Aerobe (TSBA6/RTSBA6) database of the MIDI System (Sherlock
version 6.0).
(b) Polyamines were extracted as described by Scherer and Kneifel (1983), analysed by high performance liquid chromatography (HPLC). Bacterial cells were
hydrolysed in 0.2 M perchloric acid (HClO4) at 100 C (30 min) with shaking
once after 15 min. After centrifugation, 200 L of the supernatant was incubated with 300 L of Na2CO3 solution (100 mg mL1 in water) and 800 L of
dansyl chloride solution (7.5 mg mL1 in dry acetone) in 0.5-dram vials with
Teflon-lined caps (20 min at 60 C). One hundred microlitres of a proline
solution (50 mg mL1 in water) was added to bind excess dansyl chloride
(10 min at 60 C). After cooling in a refrigerator (to 5 C), the mixture was
shaken with 100 L of toluene. Ten microlitre of the extracted sample was
applied on TLC plate (Silica gel 60 F254, 20 20 cm, Merck 5554, Germany)
and running solvent was used by ethyl acetate/cyclohexane (2:3 v/v). The dansyl derivatives were separated by using a Hitachi L-2130 chromatograph
equipped with a Hitachi AS-4000 injector, Hitachi L-2485 fluorescence detector (excitation at 360 nm and emission at 520 nm) and a reverse-phase C18
column (Phenomenex Synergi 4 Fusion-RP80 250 4.60 mm). A linear gradient (4080 %) of acetonitrile-water at 40 C with the flow rate of 1 mL min1
was used.
(c) Polar lipids were extracted and analysed by two-dimensional thin layer chromatography (TLC), the method was described by Minnikin et al. (1984). Briefly,
approximately 50 mg of dried biomass was placed into an 8.5 mL tube with a
PTFE-lined cap. Add 2 mL of aqueous methanol (10 mL of 0.3 % aqueous
NaCl added to 100 mL of methanol) followed by 2 mL of hexane and shake in
40
a tube rotator for 15 min. Centrifuge at low speed to break the emulsion and
remove the upper layer to a small vial (this contains non-polar lipids). Repeat
the extraction with a further 1 mL of hexane and add the second supernatant to
the first. The pooled supernatants contain menaquinones which can be further
purified and analysed. Heat the remaining biomass and aqueous methanol in a
boiling bath for 5 min and cool to 37 C in a water bath. Add 2.3 mL of chloroform
methanolaqueous 0.3 % (w/v) NaCl (90: 100: 30, v/v) to the biomass lower
layer and mix on a tube rotator for 1 h. Centrifuge at low speed to pellet
biomass, remove supernatant (monolayer) to a clean tube. Add 0.75 mL of
chloroform-methanol-0.3 % (w/v) NaCl (50:100: 40, v/v) to the cell residue and
mix for 30 min. Centrifuge to pellet cells, remove supernatant and add to previous supernatant; repeat last step. Add 1.3 mL of chloroform and 1.3 mL of
aqueous NaCl to the pooled supernatants and mix thoroughly; centrifuge;
remove top layer and dry lower layer (contains polar lipids) using a flow of
nitrogen while heating at 37 C.
(d) For the analysis of DNA G + C content, DNA samples were prepared and
degraded enzymatically into nucleosides as described by Mesbah et al. (1989).
In the standard method, 25 L of a solution containing 225 g of DNA in a
1.5 mL eppendorf tube was heated in a boiling water bath for 2 min and rapidly
cooled in an ice water bath. Then 50 L of 30 mM sodium acetate buffer, 5 L
of 20 mM ZnSO4 and 3 L of P1 nuclease were added. The sample was incubated for 2 h at 37 C. Five microlitres of 0.1 M glycine hydrochloride buffer
(pH 10.4) and 5 L of bovine intestinal mucosa alkaline phosphatase (200 U/
mL in glycine buffer) were added. With these additions, the pH of the sample
was between 7.5 and 8.5. The sample was incubated for 6 h at 37 C, centrifuged at 10,000g for 4 min and stored at 20 C until it was chromatographed.
The nucleoside mixtures obtained were then separated and analysed via HPLC
(Hitachi L-2130 chromatograph equipped with Hitachi L-2200 autosampler,
Hitachi L-2455 Diode array detector and a reverse-phase C18 column
(Phenomenex Synergi 4 Fusion-RP80 250 4.60 mm)).
(e) DNADNA hybridization assay was conducted (when 16S rRNA gene similarity more than 97.0 % was considered) using DIG DNA labelling and detection
kit (Roche Diagnostics; Cat. No.11 093 657 910) according to the manufacturers protocol. Briefly, chromosomal DNA (200 ng per L) was used to construct
hybridization probes by labelling with digoxigenin-11-dUTP (DIG) using a
mixture of random hexamers, a dNTP mix containing alkali-labile DIG and
labelling grade Klenow enzyme. DIG-labelled DNA probes are generated
according to the random primed labelling technique and used for hybridization
to membrane blotted nucleic acid to standard methods. DNA samples from different strains were loaded on to positively charged membranes as described by
Seldin and Dubnau (1985). Fix the nucleic acid to the membrane by cross linking with UV light (1,200 100 J/cm2) for 2 min. Preheat an appropriate volume
of hybridization buffer to hybridization temperature. Pre-hybridize filter for
30 min with gentle agitation in an appropriate container. Denature DIG-lablled
DNA probe (25 ng mL1) by boiling for 5 min and rapidly cooling in ice/water.
41
Add denature DIG-lablled DNA probe to preheated buffer and mix well but
avoid foaming. Incubate at least 6 h to overnight with gentle agitation at hybridization temperature. After hybridization, the blots were subjected to stringent
washing steps (wash 2 5 min in ample 2 SSC, 0.1 % SDS at room temperature under constant agitation; then wash 2 15 min in ample 0.5 SSC, 0.1 %
SDS at 6568 temperature under constant agitation) and incubated for 30 min in
blocking solution (dissolve blocking reagent in maleic acid buffer: 0.1 M maleic
acid, 0.15 M NaCl; adjust with NaOH to pH 7.5). Antibody solution was added
and incubated for 30 min, then wash 2 15 min in washing buffer (0.1 M maleic
acid, 0.15 M NaCl; pH 7.5; 0.3 % (v/v) Tween 20). Equilibrate 25 min in
detection buffer (0.1 M TrisHCl, 0.1 M NaCl, pH 9.5). The nylon membrane is
subjected to immunological detection with anti-digoxigeninAP conjugate and
the freshly prepared colour substrate solution. When desired spot is achieved,
stop the reaction by washing the membrane for 5 min with sterile double dist.
water or with TE buffer (10 mM TrisHCl, 1 mM EDTA, pH 8.0). Levels of
relatedness were determined by scanning the X-ray membranes and slot intensities were determined by using the UVP Vision Acquisition and Analysis
Software version 6.8 (BioSpectrumR imaging system). Self-hybridization values were considered to represent 100 % of the maximal achievable signal and
values obtained with the other strains were compared with this standard. The
experiments were carried out in triplicate for each sample.
References
Aziz A, Martin-Tanguy J, Larher F (1997) Plasticity of polyamine metabolism associated with
high osmotic stress in rape leaf discs and with ethylene treatment. Plant Growth Regul 21:
153163
Bashan Y, Holguin G, de-Bashan L (2004) Azospirillumplant relationships: physiological, molecular, agricultural, and environmental advances (19972003). Can J Microbiol 50:521577
Ben Dekhil S, Cahill M, Stackebrandt E, Sly LI (1997) Transfer of Conglomeromonas largomobilis subsp. largomobilis to the genus Azospirillum as Azospirillum largomobile comb. nov., and
elevation of Conglomeromonas largomobilis subsp. parooensis to the new type species of
Conglomeromonas, Conglomeromonas parooensis sp. nov. Syst Appl Microbiol 20:7277
Dbereiner J, Day JM (1976) Associative symbioses in tropical grasses: characterization of microorganisms and dinitrogen-fixing sites. In: Newton WE, Nyman CJ (eds) Proceedings of the
first international symposium on N2 fixation, Washington State University Press, Pullman,
pp 518538
Eckert B, Weber OB, Kirchhof G, Halbritter A, Stoffels M, Hartmann A (2001) Azospirillum doebereinerae sp. nov., a nitrogen-fixing bacterium associated with the C(4)-grass Miscanthus. Int
J Syst Evol Microbiol 51:1726
Edwards U, Rogall T, Blocker H, Emde M, Bottger EC (1989) Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal
RNA. Nucleic Acids Res 17:78437853
Falk EC, Dbereiner J, Johnson JL, Krieg NR (1985) Deoxyribonucleic acid homology of
Azospirillum amazonense Magalhes et al. 1984 and emendation of the description of the
genus Azospirillum. Int J Syst Bacteriol 35:117118
42
Falk EC, Johnson JL, Baldani VLD, Dbereiner J, Krieg NR (1986) Deoxyribonucleic and
ribonucleic acid homology studies of the genera Azospirillum and Conglomeromonas. Int J
Syst Bacteriol 36:8085
Felsenstein J (1981) Evolutionary trees from DNA sequences: a maximum likelihood approach.
J Mol Evol 17:368376
Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution
39:783791
Fitch W (1971) Toward defining the course of evolution: minimum change for a specific tree topology. Syst Zool 20:406416
Hartmann A, Baldani J (2003) The genus Azospirillum. In: Dworkin M, Falkow S, Rosenberg E,
Schleifer K-H, Stackebrandt E (eds) The prokaryotes. Wiley, New York, pp 114140
Heiner C, Hunkapiller L, Chen S, Glass J, Chen E (1998) Sequencing multimegabase-template
DNA using BigDye terminator chemistry. Genome Res 8:557561
Khammas K, Ageron E, Grimont P, Kaiser P (1989) Azospirillum irakense sp. nov., a new nitrogenfixing bacterium associated with rice roots and rhizosphere soil. Res Microbiol 140:679693
Kirchhof G, Reis V, Baldan J, Eckert B, Dbereiner J, Hartmann A (1997) Occurrence, physiological and molecular analysis of endophytic diazotrophic bacteria in gramineous energy plants.
Plant Soil 194:4555
Ladha J, So R, Watanabe I (1987) Composition of Azospirillum species associated with wetland
rice plants grown in different soils. Plant Soil 102:127129
Lavrinenko K, Chernousova E, Gridneva E, Dubinina G, Akimov V, Kuever J, Lysenko A,
Grabovich M (2010) Azospirillum thiophilum sp. nov., a novel diazotrophic bacterium isolated
from a sulfide spring. Int J Syst Evol Microbiol 60:28322837
Lin S-Y, Young C-C, Hupfer H, Siering C, Arun AB, Chen W-M, Lai W-A, Shen F-T, Rekha PD,
Yassin AF (2009) Azospirillum picis sp. nov., isolated from discarded tar. Int J Syst Evol
Microbiol 59:761765
Lin S-Y, Shen F-T, Young C-C (2011) Rapid detection and identification of the free-living nitrogen
fixing genus Azospirillum by 16S rRNA-gene-targeted genus-specific primers. Antonie Van
Leeuwenhoek 99:837844
Lin S-Y, Shen F-T, Young L-S, Zhu Z-L, Chen W-M, Young C-C (2012) Azospirillum formosense
sp. nov., a novel diazotrophic bacterium isolated from agricultural soil. Int J Syst Evol Microbiol
62:11851190
Lin S-Y, Liu Y-C, Hameed A, Hsu Y-H, Lai W-A, Shen F-T, Young C-C (2013) Azospirillum fermentarium sp. nov., a nitrogen-fixing species isolated from a fermenter. Int J Syst Evol
Microbiol 63:37623768
Lin S-Y, Hameed A, Shen F-T, Liu Y-C, Hsu Y-H, Shahina M, Lai W-A, Young C-C (2014)
Description of Niveispirillum fermenti gen. nov., sp. nov., isolated from a fermentor in Taiwan,
transfer of Azospirillum irakense (1989) as Niveispirillum irakense comb. nov., and reclassification of Azospirillum amazonense (1983) as Nitrospirillum amazonense gen. nov. Antonie
Van Leeuwenhoek 105:11491162
Magalhes F, Baldani J, Souto S, Kuykendall J, Dbereiner J (1983) A new acid-tolerant
Azospirillum species. An Acad Bras Cien 55:417430
Mehnaz S, Weselowski B, Lazarovits G (2007a) Azospirillum canadense sp. nov., a nitrogen-fixing
bacterium isolated from corn rhizosphere. Int J Syst Evol Microbiol 57:620624
Mehnaz S, Weselowski B, Lazarovits G (2007b) Azospirillum zeae sp. nov., a diazotrophic bacterium isolated from rhizosphere soil of Zea mays. Int J Syst Evol Microbiol 57:28052809
Mesbah M, Premachandran U, Whitman W (1989) Precise measurement of the G + C content of
deoxyribonucleic acid by high-performance liquid chromatography. Int J Syst Bacteriol
39:159167
Miller L (1982) Single derivatization method for routine analysis of bacterial whole-cell fatty acid
methyl esters, including hydroxyl acids. J Clin Microbiol 16:584586
Minnikin D, ODonnell A, Goodfellow M, Alderson G, Athalye M, Schaal K, Parlett J (1984) An
integrated procedure for the extraction of bacterial isoprenoid quinones and polar lipids.
J Microbiol Methods 2:233241
43
Murray R, Doetsch R, Robinow C (1994) Methods for general and molecular bacteriology. In:
Gerhardt P, Murray RGE, Wood WA, Krieg NR (eds) Determination and cytological light
microscopy. American Society for Microbiology, Washington, DC, pp 3132
Okon Y, Itzigsohn R (1992) Poly--hydroxybutyrate metabolism in Azospirillum brasilense and
the ecological role of PHB in the rhizosphere. FEMS Microbiol Lett 103:131139
Okon Y, Vanderleyden J (1997) Root-associated Azospirillum species can stimulate plants. ASM
News 63:366370
Ostle A, Holt J (1982) Nile blue A as a fluorescent stain for poly--hydroxybutyrate. Appl Environ
Microbiol 44:238241
Paisley R (1996) MIS whole cell fatty acid analysis by gas chromatography training manual.
MIDI, Newark
Peng G, Wang H, Zhang G, Hou W, Liu Y, Wang ET, Tan Z (2006) Azospirillum melinis sp. nov.,
a group of diazotrophs isolated from tropical molasses grass. Int J Syst Evol Microbiol
56:12631271
Poly F, Monrozier L, Bally R (2001) Improvement in the RFLP procedure for studying the diversity of nifH genes in communities of nitrogen fixers in soil. Res Microbiol 152:95103
Reinhold B, Hurek T, Fendrik I, Pot B, Gillis M, Kersters K, Thielemans S, Ley J (1987)
Azospirillum halopraeferens sp. nov., a nitrogen-fixing organism associated with roots of
Kallar grass (Leptochloa fusca (L.) Kunth). Int J Syst Bacteriol 37:4351
Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406425
Sasser M (1990) Identification of bacteria by gas chromatography of cellular fatty acids. MIDI
Technical Note 101. MIDI Inc, Newark
Saxena B, Modi M, Modi V (1986) Isolation and characterization of siderophores from Azospirillum
lipoferum D-2. J Gen Microbiol 132:22192224
Scherer P, Kneifel H (1983) Distribution of polyamines in methanogenic bacteria. J Bacteriol
154:13151322
Schlegel H, Lafferty R, Krauss I (1970) The isolation of mutants not accumulating poly-hydroxybutyric acid. Arch Microbiol 71:283294
Seldin L, Dubnau D (1985) Deoxyribonucleic acid homology among Bacillus polymyxa, Bacillus
macerans, Bacillus azotofixans, and other nitrogen-fixing Bacillus strains. Int Syst Bacteriol
35:151154
Seshadri S, Muthukumarasamy R, Lakshinarasimhan C, Ignacimuthu S (2000) Solubilization of
inorganic phosphates by Azospirillum halopraeferans. Curr Sci 79:565567
Shen F-T, Young C-C (2005) Rapid detection and identification of the metabolically diverse genus
Gordonia by 16S rRNA-gene-targeted genus-specific primers. FEMS Microbiol Lett
250:221227
Stahl D, Flesher B, Mansfield H, Montgomery L (1988) Use of phylogenetically based hybridization probes for studies of ruminal microbial ecology. Appl Environ Microbiol 54:10791084
Steenhoudt O, Vanderleyden J (2000) Azospirillum, a free-living nitrogen-fixing bacterium closely
associated with grasses: genetic, biochemical and ecological aspects. FEMS Microbiol Rev
24:487506
Stoffels M, Castellanos T, Hartmann A (2001) Design and application of new 16S rRNA-targeted
oligonucleotide probes for the Azospirillum-Skermanella-Rhodocista-cluster. Syst Appl
Microbiol 24:8397
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary
genetics analysis version 6.0. Mol Biol Evol 30:27252729
Tarrand J, Krieg N, Dbereiner J (1978) A taxonomic study of the Spirillum lipoferum group, with
descriptions of a new genus, Azospirillum gen. nov., and two species, Azospirillum lipoferum
(Beijerinck) comb. nov. and Azospirillum brasilense sp. nov. Can J Microbiol 24:967980
Thompson J, Gibson TJ, Plewniak F, Jeanmougin F, Higgins D (1997) The CLUSTAL_X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res 25:48764882
44
Thuler D, Flosh E, Handro W, Barbosa M (2003) Plant growth regulators and amino acids released
by Azospirillum sp. in chemically defined medium. Lett Appl Microbiol 37:174178
Tien TM, Gaskins M, Hubbell D (1979) Plant growth substances produced by Azospirillum brasilense and their effect on the growth of pearl millet (Pennisetum americanum L.). Appl Environ
Microbiol 37:10161024
Woese C, Kandler O, Wheelis M (1990) Towards a natural system of organisms: proposal for the
domains Archaea, Bacteria, and Eucarya. Proc Natl Acad Sci 87:45764579
Xie C, Yokota A (2005) Azospirillum oryzae sp. nov., a nitrogen-fixing bacterium isolated from the
roots of the rice plant Oryza sativa. Int J Syst Evol Microbiol 55:14351438
Young C-C, Hupfer H, Siering C, Ho M-J, Arun AB, Lai W-A, Rekha PD, Shen F-T, Hung M-H,
Chen W-M, Yassin AF (2008) Azospirillum rugosum sp. nov., isolated from oil-contaminated
soil. Int J Syst Evol Microbiol 58:959963
Zehr J, McReynolds L (1989) Use of degenerate oligonucleotides for amplification of the nifH
gene from the marine cyanobacterium Trichodesmium thiebautii. Appl Environ Microbiol
55:25222526
Zhou S, Han L, Wang Y, Yang G, Zhuang L, Hu P (2013) Azospirillum humicireducens sp. nov., a
nitrogen-fixing bacterium isolated from a microbial fuel cell. Int J Syst Evol Microbiol
63:26182624
Chapter 3
45
46
A. Hartmann et al.
3.1
Introduction
The challenge of high resolution in situ analysis of plant growth promoting diazotrophic bacteria in non-leguminous plants was successfully confronted by the combined application of molecular genetic and immunochemical methods together with
high resolution microscopical techniques. These allow for resolutions at or below
the dimension of individual bacteria in the micrometer, and in the case of transmission electron microscopy (TEM), the nanometer range. The clear aim of these techniques is to use methods which allow for the identification and specific labeling of
the bacteria of interest at the species and even at the strain level. While the identification of bacteria at the species or higher phylogenetic level is possible by applying
phylogenetic probes derived from 16- or 23S rRNA sequences of the bacteria of
interest coupled to fluorescent dyes, which can be used in the fluorescence in situ
hybridization (FISH) technique (see protocol below), the identification of bacteria
at the strain-specific level needs other approaches. Two such examples are (a) it has
been demonstrated in several cases (see below) that antibodies can be raised that
allow for a strain-specific identification and (b) the introduction of marker genes,
such as gfp, gus and lux into the bacterium under study by genetic transformation
(see protocol below). As microscopical tools, confocal laser scanning microscopy
(CLSM) is frequently used, as it can detect and resolve specific fluorescence against
an autofluorescence background, which is often quite strong in plants. To resolve
details of the localization of bacteria and their subcellular resolution below the
micrometer range, electron microscope-based approaches such as TEM, often combined with immunocytochemistry, have been successfully applied (see protocol
below). Finally, in order to monitor the success of inoculations, strain-specific quantification has been developed using sequence characterized amplified regions
(SCARs) or other strain-specific genomic marker sequences in real time quantitative PCR measurements.
3.2
In the case of Azospirillum, a variety of A. brasilense isolates were studied concerning their colonization of different plants. While the type strain of A. brasilense
strain Sp7was isolated from rhizosphere soil, the strain Sp245 was derived from
47
Fig. 3.1 Azospirillum brasilense Sp245 colonizing a wheat root. FISH staining using the speciesspecific probe Abras-1420-Cy5 (blue) and the general bacterial probe Eub-Mix-Cy3 (red) (image
taken from Rothballer et al., Symbiosis 34, 261279 (2003) with kind permission of Springer
Science + Business Media)
surface disinfected wheat (Triticum aestivum) roots (Baldani et al. 1987). Upon
inoculation of wheat plants, strain Sp245 was isolated in high numbers from surface
disinfected roots, while Sp7 was more frequently recovered from rhizosphere soil
(Baldani et al. 1987). Therefore, detailed localization studies were performed to
identify unambiguously the different colonization properties of these two strains
(Sp7 vs. Sp245) on wheat. Consequently, species-specific oligonucleotide probes
were developed for A. brasilense to localize different A. brasilense strains after
inoculation of wheat roots using FISH in combination with CLSM (Amann et al.
1990; Amus et al. 1995). It could be clearly shown in these studies that both strains
(Sp7 and Sp245) colonized efficiently the root surface and that they produced pleomorphic forms. However, the strain Sp245 was able to colonize intercellular spaces
in the epidermal layer and even occasionally the interior of root hairs or root cortical
cells more frequently than strain Sp7, which was mostly found on the root surface
(Figs. 3.1, 3.2 and 3.3).
48
A. Hartmann et al.
49
Fig. 3.4 A. brasilense Sp7 on the surface of wheat roots (TEM-immunogold image) (images taken
from Schloter and Hartmann, Symbiosis 25, 159179 (1998); with kind permission of Springer
Science + Business Media)
beneficial/diazotrophic bacteria and their plant hosts. Of particular use over the last
30 years has been the combination of TEM with immunogold labeling (Levanony
et al. 1989; Hurek et al. 1994; James et al. 1994, 1997, 2001, 2002; Gyaneshwar et al.
2001, 2002; Schloter and Hartmann 1998; Rothballer et al. 2008; Olivares and James
2008a, b) (Figs. 3.4, 3.5 and 3.6). In these cases, antibodies (monoclonal or polyclonal) that have been raised against specific bacterial species or even strains have
been instrumental in confirming that they were genuinely endophytic within their
economically important crop hosts, which were mainly grasses such as wheat, rice
(Oryza sativa), sugarcane (Saccharum sp.), and sorghum (Sorghum bicolor). Other
studies have used antibodies raised against particular bacterial proteins, such as nitrogenase (Hurek et al. 1994; Olivares et al. 1997; James et al. 2002; Gyaneshwar et al.
2002) and surface components (Schloter et al. 1994) to demonstrate specific gene
expression in their specific plant habitat (Figs. 3.7 and 3.8).
3.2.1
3.2.1.1
All samples need to be fixed for FISH analysis. Currently two different methods are
widely applied: fixation with aldehydes (e.g., paraformaldehyde [PFA]) or with
alcohols (e.g., ethanol). Paraformaldehyde (4 %) is best used to fix Gram-negative
50
A. Hartmann et al.
Fig. 3.5 A. brasilense Sp245 within intercellular spaces (apoplast) of a wheat root (TEMimmunogold image) (images taken from Schloter and Hartmann, Symbiosis 25, 159179 (1998);
with kind permission of Springer Science + Business Media)
51
Fig. 3.7 Herbaspirillum seropedicae in a rice leaf (TEM-immunogold image) (image taken by Dr.
Euan James, The James Hutton Institute, Dundee, UK)
Fig. 3.8 Herbaspirillum seropedicae in rice roots (labeled with nifH-antiserum; TEM immunogold image) (image taken by Dr. Euan James, The James Hutton Institute, Dundee, UK)
bacterial cells because it causes cross-linking of the murein layer. The bacterial cell
wall becomes denser and the shape of the cells is retained. The cell wall of Gram
positive cells often becomes too dense for probe penetration during hybridization
after they have been fixed using PFA, and therefore fixation with ethanol (50 %) is
usually applied for successful FISH analysis of these bacteria.
A. Hartmann et al.
52
3.2.1.2
3.2.1.3
Fixation of Roots
3.2.1.4
Formamide
(deionized) [L]
0
100
200
300
400
500
% Formamide
30
35
40
45
50
55
60
65
70
75
80
Formamide
(deionized) [L]
600
700
800
900
1,000
1,100
1,200
1,300
1,400
1,500
1,600
[NaCl] in
mol
0.900
0.636
0.450
0.318
0.225
0.159
0.112
0.080
0.056
0.040
0.028
0.020
0.014
0.010
0.007
0.005
0.0035
53
54
A. Hartmann et al.
3.2.1.5
Place or drop fixed sample onto an epoxy resin-coated slide, dry it in an oven
(about 58 min at 60 C)
Fix samples by treating them in an increasing ethanol series (3 min each in 50,
80, and 100 % ethanol)
Drip 9 L of hybridization buffer into each well
Add 1 L of probe without scratching the surface of the slide
Prepare a hybridization tube (50 mL Falcon Tube) by folding a piece of tissue,
putting it into the tube and pouring the rest of hybridization buffer onto it
Transfer the slide into the hybridization tube and perform the hybridization in a
hybridization oven (46 C) for 1.5 h
Remove the hybridization solution and incubate the slide within the washing buffer for 20 min in a preheated water bath (48 C)
Remove the washing buffer with distilled water and dry the slide in an air stream
Embed the sample on the slide within an embedding media (e.g., Citifluor) and
seal the slide with a cover slip
3.2.1.6
Treat roots in an increasing ethanol series (3 min each in 50, 80 and 100 %
ethanol)
Place dehydrated root pieces in a 2 mL Eppendorf cap
Add hybridization buffer until the fixed roots are covered
Add probes (add one-tenth of the hybridization buffer volume of each probe)
Incubate for at least 1.5 h at 46 C
Discard hybridization buffer and add 2 mL washing buffer. Incubate for 15 min
at 48 C (water bath)
Discard washing buffer, wash with distilled water, and place root pieces on a slide.
Embed the samples on the slide with Citifluor and seal them with a cover slip
3.2.2
The immunogold labeling method can be performed at both the light microscopy
(>0.5 m) and TEM levels, even on the same samples. However, it is necessary for
this technique that the biological samples (e.g., plant roots) be sectioned on an
55
ultramicrotome; typically these sections are of the order of 0.52.0 m thickness for
light microscopy and 50100 nm for TEM. In order to achieve uniform sections at
these thicknesses the samples must be immobilized, either by freezing them or by
chemical fixation and subsequent embedding in plastic/resin. Methods have been
described in detail for freezing (i.e., cryo) techniques by Olivares and James (2008a, b),
and so they will not be covered here. Chemical fixation of roots for immunogold
labeling is similar to that described for FISH, but always involves aldehydes, usually PFA or glutaraldehyde, either singly or in combinations, as these allow for good
ultrastructural preservation, with glutaraldehyde being particularly effective, as it
very strongly cross-links proteins. The exact choice of fixative depends upon the
antigen being detected; if it is a single epitope (e.g., for probing with a monoclonal
antibody), or is delicate and/or easily damaged by cross-linking, then PFA should be
used, but if there are multiple antigens, as is often the case with polyclonal antibodies raised against whole bacterial cells, then it may be possible to fix using glutaraldehyde only. Often, however, a fixative composed of a mixture is used, e.g., 4 %
PFA to preserve antigenicity and a small concentration of glutaraldehyde to improve
the ultrastructure. Further fixation for classical TEM, particularly in osmium
tetroxide, should generally be avoided, as should embedding in epoxy resins, such
as Spurrs, Araldite, and EPON, as although these treatments beautifully preserve
ultrastructure they have a very deleterious effect on antigenicity. After dehydrating
the samples in ethanol, the resin of choice for embedding of samples for immunogold labeling is normally an acrylic resin, such as LR White. After infiltration in the
liquid resin, the samples can be solidified in the resin for sectioning by placing the
sample + fresh resin in gelatin capsules and then curing them in an oven at 55 C;
this will allow the resin to polymerise and harden, and the sample can then be sectioned on an ultramicrotome.
3.2.2.1
Cut fresh pieces of root into small pieces (23 mm in length) and immediately
immerse them in a fixative solution, e.g., 2.5 % glutaraldehyde in 0.05 M potassium phosphate buffer (pH 7.0)
Fix the samples for at least 24 h at 4 C. If the samples are still floating after this
period subject them to a weak vacuum for 5 s, release the vacuum, and then
repeat the cycle until all the samples have sunk
Dehydrate the roots in an ethanol series: 10 min each at 50, 70, 90, and 100 %
(2)
Place the roots into a mixture (1:1, v/v) of ethanol and LR White acrylic resin for
2h
Place the roots into 100 % LR White for 24 h on a specimen rotator
Place roots individually into gelatin capsules (Agar Scientific), cover them with
fresh LR White resin, and seal the capsule with a cap
Place the gelatin capsules into an oven at 5560 C for 48 h
Remove the hardened capsules and allow them to cool in a fume hood
56
A. Hartmann et al.
3.2.2.2
57
Remove the grids from the secondary antibody and wash them with IGL buffer
by placing them onto two sequential drops of buffer for 5 min each, and then ten
drops of sterile dH2O for 30 s each. Dry the grids by placing them onto filter
paper
For light microscopy perform the above, but instead of grids place drops of the
various reagents onto the slides with fresh sections
After washing off the secondary antibody incubate the sections in a silverenhancement kit (BBI Solutions) for 1020 min or until the black silver precipitate is visible under a compound microscope
Stop the reaction by washing off the silver solution with dH2O. Dry on a hot plate
Negative controls for the immunogold labeling must be included in parallel with
the test samples. These typically include sections and grids that have been incubated as above, but with the primary antibody omitted or replaced by pre-immune
serum from the same animal as the primary antibody was raised in
Evaluation of the results: View and photograph the light microscopy sections, with
and without immunogold silver-enhancement (IGL-SE), under a high quality photomicrograph system and determine the presence and location of the bacteria on and
within the roots; the bacteria will appear as purple-blue points (12 m long) in the
toluidine blue sections and as black points against a light blue background in the
IGL-SE sections (also often seen as a ring of black around the perimeter of the
bacterium, as the antibodies often bind to bacterial surface polysaccharides). Stain
the TEM sections with 2 % aqueous uranyl acetate for 5 min, dry on filter paper, and
view under a transmission electron microscope, with and without immunogold
labeling; the location of the bacteria and their ultrastructure will be clear, and if they
have been successfully immunogold labeled the gold particles will appear as uniform electron-dense spots on the surface of the bacteria.
3.2.3
A. Hartmann et al.
58
In the case of A. brasilense gfp- and gusA-labeling were achieved and the colonization of wheat roots by the strain FP2 could be followed at the single cell level
(Ramos et al. 2002). To use gfp as a biosensor for expression analysis of a specific
operon to follow in situ gene expression with fluorescence monitoring at the single
cell level, Rothballer et al. had to apply the stable variant gfpmut3 to get sufficient
brightness of the fluorescence labeling in cells induced for the ipdC-expression as a
key step of IAA-biosynthesis (Rothballer et al. 2005). Endophytic colonization of
sugarcane as well as of sorghum and wheat by Gluconacetobacter diazotrophicus
was successfully followed using GUS- and GFP-labeled bacteria (Fuentes-Ramirez
et al. 1999; Luna et al. 2010; Rouws et al. 2010), as was the endophytic colonization
of wheat by Klebsiella pneumoniae 342 and Herbaspirillum frisingense GSF30
using GFP-labeled strains (Iniguez et al. 2004; Rothballer et al. 2008). In terms of
specific gene expression, the endophytic colonization of rice plants and the in situ
expression of nitrogenase genes were convincingly evaluated on a single cell level
via gfp-labeled bacteria that were fluorescing simultaneously with the fluorescence
of Td-Tomato from a transcriptional nifH::tdTomato fusion (Reinhold-Hurek and
Hurek 2011). The most recent developments in CLSM to reveal microbeplant
interactions in situ at single cell resolution have been recently reviewed by
M. Cardinale (2014).
Name
pKmobGII
Basic
replicon
R6K
pEX18
R6K
pUT-miniTn5,
pUT-miniTn7
R6K
pME6010
pVS1,
p15A
pBBR1-MCS
ColE1
pHC60
pSW213
pHRGFPGUS
pBBR1,
pHR
pCHR
pUT
pCHRGFP1/2
TnMod-OGm
Application
Delivery suicide vector for
chromosomal gene replacements
Delivery suicide vector for
chromosomal gene replacements
Delivery suicide vector containing
mini-Tn5/mini-Tn7 transposon
for chromosomal tagging
Shuttle vector for stable, plasmidbased labeling in Gram-negative,
plant-associated bacteria
Shuttle vector for stable, plasmid
based labeling with broad
host range
gfp-gene labeling
Reference
Katzen et al. (1999)
Hoang et al. (1998)
de Lorenzo et al.
(1990), Choi et al.
(2005)
Heeb et al. (2000)
Kovach et al.
(1995), Obranic
et al. (2013)
Cheng and Walker
(1998)
Ramos et al. (2002)
Gfp-bioreporter
Modular mini-transposon for
rapid cloning and mapping
Two protocols for transferring the vector pHRGFPGUS into PGPR are presented
in the following subsections. Before, preliminary tests are described to determine
resistance/sensitivity of the recipient strain to antibiotics to choose the adequate
selection marker and vector.
59
3.2.3.2
A number of vectors available have an origin of transfer, oriT or mob, and then
can be mobilized to diverse Gram-negative bacteria, if trans-acting tra- and trbencoded proteins are provided by a helper plasmid such as pRK2013 or an E. coli
strain such as S17-1. As an illustrative procedure, Nitrospirillum (formerly
Azospirillum) amazonense CBAmc (=BR11145) can be recipient of the mobilizable
vector pHRGFPGUS:
Grow donor (e.g., S17-1 bearing the vector) and recipient strains to an
O.D.600 0.2 in LB and DYGS (2.0 gL1 glucose, 1.5 gL1 peptone, 2.0 gL1
yeast extract, 0.5 gL1 K2HPO4, 0.5 gL1 MgSO47H2O, 1.5 gL1 glutamic acid,
pH 6.0) media, respectively
Centrifuge both cultures (1 mL) at 3,000 g, 5 min, and discard the supernatant
Wash the cell pellets once in sterile saline solution (0.9 % NaCl) and resuspend
in the same solution
Mix 5 L of the donor strain with 50 L of the recipient and plate (do not scatter)
the mixture on DYGS:LB 3:1; prepare also appropriate controls (without donor,
recipient, or both)
60
A. Hartmann et al.
After growth, scrape the (mixed) colony and resuspend in 1 mL of saline, and
then plate (by scattering) 0.1 mL of this suspension on DYGS in the presence of
10 g/mL kanamicin (the vector selection marker), 1020 g/mL tetracycline
(the strain selection marker), and 40 g/mL 5-bromo-4-chloro-3-indolyl--Dglucuronic acid (or X-Gluc, for the vector enzymatic marker glucuronidase,
gusA gene). The other vector selection marker, ampicillin, is not adequate for
selection of N. amazonense CBAmc conjugates, as this strain is quite resistant to
that antibiotic (CMI 1 mg/mL)
3.2.3.3
Another method for transferring the vector containing the gene marker into cells of
a bacterial strain is through electroporation, in which an electrical field is applied to
increase the permeability of the cell membrane, allowing the uptake of the vector.
For example, Gluconacetobacter diazotrophicus PAL5 (=BR11281) can be
transformed through electroporation with vector pHRGFPGUS. For that, electrocompetent cells must be prepared:
Grow G. diazotrophicus PAL5 in C2 (10 gL1 peptone, 15 gL1 glucose, 5 gL1
NaCl, 5 gL1 yeast extract, pH 6.0) medium up to an O.D.600 0.60.7
Incubate the culture flask for ~30 min in ice bath; all the remaining procedure is
conducted in ice or at 4 C
Centrifuge the culture at 4 C, 10 min, 3,000 g
Wash cells twice with ultrapure cold water and once with cold 10 % glycerol,
using the same centrifugation conditions, except that in the presence of glycerol
time is 25 min
Resuspend the final cell pellet in 1 mL of cold 10 % glycerol, prepare aliquots of
100 L and store at 80 C until the electroporation step
The electroporation of G. diazotrophicus PAL5 has been executed in a Gene
Pulser Xcell Electroporation System (Bio-Rad):
Mix 2 L of the vector solution prep, lets say 4 g, with the 100-L aliquot of
PAL5 cells in ice bath
Transfer the mixture into a 2-mm electroporation cuvette
Apply an electrical pulse of exponential decay, 25 F capacitance, 200 resistance, 2.5 kV
Add 1 mL of DYGS medium into the cuvette, transfer the suspension into a
microtube and incubate at 30 C, >200 rpm, 2 h
Plate 0.1 mL of the suspension on DYGS in the presence of 400 g/mL kanamicin (the vector selection marker), and 40 g/mL 5-bromo-4-chloro-3-indolyl-D-glucuronic acid (or X-Gluc, for the vector enzymatic marker glucuronidase,
gusA gene)
3.2.4
61
The availability of techniques to quantify inoculated diazotrophic PGPR in a strainspecific way in the rhizosphere or even within plant tissues is very important to be
able to estimate how efficiently and pertinently an inoculant strain is established
within the plant. Recently, two molecular approaches have appeared which use
stretches of strain-specific sequences in the bacteria to be monitored using the realtime qPCR technique. One method uses SCAR markers to develop strain-specific,
real-time PCR primers for strain-specific quantification (Couillerot et al. 2010a, b)
on the basis of unique REP-amplificates, while the other method derives the strainspecific sequences from comparative whole genome sequence data of the inoculant
and closely related bacteria (Stets et al. personal communication). Quantitative PCR
approaches to detect individual strains in complex environments such as the rhizosphere were first developed as MPN-PCR or competition-PCR (for a review see
Sorensen et al. 2009), but real time PCR (RT-PCR) has recently become the method
of choice for quantifying bacterial populations in the rhizosphere (Sorensen et al.
2009). This method is based on the quantitative measurement of SYBR Green
which binds to double-stranded DNA after each PCR cycle. The PCR cycle at which
the fluorescence crosses the threshold line (the CT value) is directly proportional to
the amount of DNA present in the sample.
This technique was applied to the detection and quantification of two A. brasilense and A. lipoferum strains (Couillerot et al. 2010a, b).
Protocol of basic methodology (for details see Couillerot et al. 2010a):
Molecular comparison of Azospirillum strains by REP-PCR genomic fingerprinting (Rademaker et al. 2000) to distinguish trains and to identify SCAR
bands
Excise, clone, and sequence strain-specific bands
Compare the sequences to those on the web by BlastN and select unique
sequences
Based on these unique sequences primers are designed and checked against other
Azospirillum strains from the same species, other Azospirillum species as well as
other prominent rhizosphere and soil bacteria
Based on the selected primers, qualitative and quantitative PCR reactions should
be performed and the PCR products then need to be checked on agarose gels
Carry out RT-PCR reactions with the selected primers and generate standard
curves with genomic DNA
Generate standard curves for RT-PCR quantification with DNA isolated from the
rhizosphere by inoculating tubes containing the desired soil sample with the
strain of interest in different densities per tube (103108). Incubate and extract
DNA to carry out RT-PCR and generate standard curves for each replicate by
plotting CT numbers vs. log CFU added per gram of soil
62
A. Hartmann et al.
References
Alqueres S, Meneses C, Rouws L, Rothballer M, Baldani JI, Schmid M, Hartmann A (2013) The
bacterial superoxide dismutase and glutathione reductase are crucial for endophytic colonization of rice roots by Gluconacetobacter diazotrophicus strain PAL5. Mol Plant Microbe
Interact 26:937945
Amann RI, Krumholz L, Stahl DA (1990) Fluorescent-oligonucleotide probing of whole cells for
determinative, phylogenetic and environmental studies in microbiology. J Bacteriol
172:762770
Amus B, Hutzler P, Kirchhof G, Amann RI, Lawrence JR, Hartmann A (1995) In situ localization
of Azospirillum brasilense in the rhizosphere of wheat with fluorescently labeled, rRNAtargeted oligonucleotide probes and scanning confocal laser microscopy. Appl Environ
Microbiol 61:10131019
Amus B, Schloter M, Kirchhof G, Hutzler P, Hartmann A (1997) Improved in situ tracking of
rhizosphere bacteria using dual staining with fluorescence-labeled antibodies and rRNAtargeted oligonucleotide probes. Microb Ecol 33:3240
Baldani VLD, Baldani JI, Dbereiner J (1987) Inoculation of field-grown wheat with Azospirillum
spp. in Brazil. Biol Fertil Soils 4:3740
Branco R, Cristvao A, Morais PV (2013) Highly sensitive, highly specific whole-cell bioreporters
for the detection of chromate in environmental samples. PLoS One 8:e54005
Cardinale M (2014) Scanning a microhabitat: plant-microbe interactions revealed by confocal
laser scanning microscopy. Front Microbiol 5:94. doi:10.3389/fmicb.2014.00094
Cheng HP, Walker GC (1998) Succinoglycan is required for initiation and elongation of infection
threads during nodulation of alfalfa by Rhizobium meliloti. J Bacteriol 180:51835191
Choi KH, Gaynor JB, White KG, Lopez C, Bosio CM, Karkhoff-Schweizer RR, Schweizer HP
(2005) A Tn7-based broad-range bacterial cloning and expression system. Nat Methods
2:443448
Couillerot O, Bouffaud ML, Baudoin E, Muller D, Caballero-Mellado J, Moenne-Loccoz Y
(2010a) Development of a real-time PCR method to quantify the PGPR-strain Azospirillum
lipoferum CRT1 on maize seedlings. Soil Biol Biochem 42:22982305
63
64
A. Hartmann et al.
Olivares FL, James EK (2008a) Localization of diazotrophic bacteria on and within Gramineous
plants. In: Sorvari S, Pirttil AM (eds) Prospects and applications for plant-associated microbes:
a laboratory manual part A: bacteria. BBi, Piikki, pp 18
Olivares FL, James EK (2008b) Electron microscopy of plant growth-promoting bacteria using
cryotechniques. In: Sorvari S, Pirttil AM (eds) Prospects and applications for plant-associated
microbes: a laboratory manual part A: bacteria. BBi, Piikki, pp 176183
Olivares FL, James EK, Baldani JI, Dbereiner J (1997) Infection of mottled stripe diseasesusceptible and resistant sugar cane varieties by the endophytic diazotroph Herbaspirillum.
New Phytol 135:723737
Rademaker JLW, Hoste B, Louws FJ, Kersters K, Swings J, Vauterin L, Vauterin P, de Bruijn FJ
(2000) Comparison of AFLP and rep-PCR genomic fingerprinting with DNA-DNA homology
studies: Xanthomonas as a model system. Int J Syst Evol Microbiol 50:665667
Ramos HJO, Roncato-Maccari LDB, Souza EM, Soares-Ramos JRL, Hungria M, Pedrosa FO
(2002) Monitoring Azospirillum-wheat interactions using the gfp and gusA genes constitutively expressed from a new broad-host range vector. J Biotechnol 97:243252
Reinhold-Hurek B, Hurek T (2011) Living inside plants: bacterial endophytes. Curr Opin Plant
Biol 14:435443
Rothballer M, Schmid M, Fekete A, Hartmann A (2005) Comparative in situ analysis of ipdCgfpmut3 promoter fusions of Azospirillum brasilense strains Sp7 and Sp245. Environ Microbiol
7:18391846
Rothballer M, Eckert B, Schmid M, Fekete A, Schloter M, Lehner A, Pollmann S, Hartmann A
(2008) Endophytic root colonization of gramineous plants by Herbaspirillum frisingense.
FEMS Microbiol Ecol 66:8595
Rouws LFM, Meneses CHSG, Guedes HV, Vidal MS, Baldani JI, Schwab S (2010) Monitoring the
colonization of sugarcane and rice plants by the endophytic diazotrophic bacterium
Gluconacetobacter diazotrophicus PAL5 marked with gfp and gusA reporter genes. Lett Appl
Microbiol 51:325330
Schloter M, Hartmann A (1998) Endophytic and surface colonization of wheat roots (Triticum
aestivum) by different Azospirillum brasilense strains studied with strain-specific monoclonal
antibodies. Symbiosis 25:159179
Schloter M, Borlinghaus R, Bode W, Hartmann A (1993) Direct identification and localization of
Azospirillum in the rhizosphere of wheat using fluorescence-labelled monoclonal antibodies
and confocal scanning laser microscopy. J Microsc 171:171177
Schloter M, Moens S, Croes C, Reidel G, Esquenet M, De Mot R, Hartmann A, Michiels K (1994)
Characterization of cell surface components of Azospirillum brasilense Sp7 as antigenic determinants for strain-specific monoclonal antibodies. Microbiology 140:823828
Sorensen J, Nicolaisen MH, Ron E, Simonet P (2009) Molecular tools in the rhizosphere microbiologyfrom single-cell to whole-community analysis. Plant Soil 321:483512
Chapter 4
Abstract Molecular methods have been used in the study of Azospirillum and
other related PGPRs to carry out gene functional analysis, create gene knockouts,
generate genetically engineered strains, and carry out gene expression studies.
Genetic transformation has routinely been carried out using conjugation, while
chromosomal modifications have been performed using unstable, suicide plasmids,
or more stable, broad host-range vectors. Gene expression studies are often carried
out using promoter-bound reporter genes; however, quantitative methods such as
reverse transcribed polymerase chain reaction can now be used to directly study
gene expression. In this chapter we describe the common types of vectors used in
Azospirillum, as well as methods for transformation and mutagenesis. We also
describe the use of promoter-bound reporter genes and the applications of quantitative RT-PCR for Azospirillum gene expression studies. Methods for the isolation of
DNA and RNA from Azospirillum for use in molecular and gene expression studies
are also described.
4.1
Genetic transformation has been used in Azospirillum for gene functional analysis
employing random and site-directed transposon-induced mutagenesis, gene knockout and genetic exchange, gene expression studies using promoterless reporter gene
translation cassettes, genetic engineering by introducing new genes/traits, and for
genetic labelling by inserting constitutively expressed reporter genes.
Genetic transformation in Azospirillum spp. has been mainly performed by conjugation using various groups of plasmid vectors. Generally, chromosomal modifications
have been performed using unstable, suicide plasmids, while stable broad host-range
vectors have been used in applications requiring the maintenance of plasmids.
65
66
In this section we discuss the main vectors used with Azospirillum, transformation
by conjugation, gene replacement, and transposon mutagenesis. The analysis that
follows mutagenesis requires the extraction of genomic DNA, and while nowadays
there are commercial kits suitable for this purpose, a cost-effective method for the
isolation of large amounts of Azospirillum DNA is described.
4.1.1
Vectors
Among other vehicles, such as the cosmid pLAFR3, used for the construction of
Azospirillum genomic libraries (Revers et al. 2000), DNA elements can be transformed into recipient cells on plasmid vectors. The selection of a vector depends on
the intended use, method of genetic transformation, and user preference/tool availability. Vectors available for Azospirillum can be divided into stable, broad hostrange vectors, and unstable suicide vectors.
4.1.1.1
Until the early 1980s genetic tools for Azospirillum chromosome mobilization
included the IncP1 plasmid R68-45 (Haas and Holloway 1976), adopted from use
with P. aeruginosa (Elmerich and Franche 1982). Michiels et al. (1985) tested plasmids belonging to the incompatibility groups (Inc) P1, Q, and W, but only IncP1
plasmids pRK290, pRK252, and BIN19 were stable in Azospirillum (all derivatives
of RP4). The most widely used stable vectors in Azospirillum have been pRK290
(Ditta et al. 1980) and its derivatives the cosmid pVK100 (Fig. 4.1) (Knauf and
Nester 1982) and pLA2917 (Fig. 4.2) (Allen and Hanson 1985). These low copy,
broad-host range vectors, from the IncP1 group with RK2 replication factors, are
not self-transmissible but can be mobilized if supplied with the plasmid transfer
elements in trans (see Sect. 4.1.2). They can be transferred to Azospirillum recipients by conjugation and are stably maintained. These vectors contain a number of
unique restriction sites (Figs. 4.1 and 4.2) to enable selection and analysis following
cloning. Such restriction sites exist within either the kanamycin or tetracycline
resistance markers, which will be inactivated if disrupted with cloned DNA. Other
vectors stable in Azospirillum include the cosmid pLAFR1, originally used with
Rhizobium, and its derivative pLAFR3 (Milcamps et al. 1996; Kadouri et al. 2002);
a pRAJ275 derivative, namely, pFAJ21 (Revers et al. 2000) as well as pBBR1MCS-2
vector (Kovach et al. 1995), which was shown to be stable even without selective
pressure (Rothballer et al. 2003).
Stable vectors can be used to clone genes for complementation (Pedrosa and
Yates 1984; Pereg Gerk et al. 1998), create genomic libraries (Fogher et al. 1985),
study gene expression (Fani et al. 1988; Liang et al. 1991; Vieille and Elmerich
1992; Pereg Gerk et al. 2000; Pereg Gerk 2004; Revers et al. 2000), and carry
reporter genes for cell visualization (Arsne et al. 1994; Pereg Gerk et al. 1998).
4 Molecular Tools to Study Azospirillum sp. and Other Related Plant Growth
67
Fig. 4.1 Map of the plasmid vector pVK100. This plasmid is a derivative of pRK290 with a SalIEcoRI fragment of the cosmid pHK17. It contains the cos site of phage and it is a broad host
vector, stable in Azospirillum. Unique restriction sites: (H) HindIII (S) SalI (R) EcoRI (Hp) HpaI
(X) XhoI. Numbers are given in kb. There are neither PstI nor BamHI sites in the vector. The plasmid codes for tetracycline (Tc) and kanamycin (Km) resistance (Knauf and Nester 1982)
Fig. 4.2 Map of the plasmid vector pLA29.17. It contains the cos site of phage and it is a broad
host vector, stable in azospirilla. Unique restriction sites: (H) HindIII (S) SalI (Bg) BglII (P) PstI
(Hp) HpaI. Numbers are given in kb. There are neither XhoI nor BamHI sites in the vector. The
plasmid codes for tetracycline (Tc) and kanamycin (Km) resistance (Allen and Hanson 1985)
68
They have been used in gene discovery, analysis of genetic regulation, and in studying Azospirillumplant association. Table 4.1 summarizes the most common stable
vectors used in Azospirillum transformation.
pRK290
pVK100
References
Haas and
Holloway
(1976)
Ditta et al.
(1980),
Michiels et al.
(1985)
Knauf and
Nester (1982)
pLA2917
Allen and
Hanson (1985)
pGD926 (pRK290
derivative, lacYZ)
Liang et al.
(1991)
pLAFR1
Milcamps et al.
(1996)
Milcamps et al.
(1996)
Revers et al.
(2000)
Kovach et al.
(1995)
pLAFR3
pFAJ21 (pRAJ275
derivative)
pBBR1MCS-2
Suicide vectors
pGS9
pSUP2021
pSUP202
pCIB100
Selvaraj and
Iyer (1983)
Simon et al.
(1983)
Simon et al.
(1983)
4 Molecular Tools to Study Azospirillum sp. and Other Related Plant Growth
4.1.1.2
69
Suicide vectors are useful for transposon mutagenesis, gene knockout, and chromosomal
exchanges since they allow mobilization of DNA into Azospirillum without stable integration of the whole vector. Instead, double recombination events replace host DNA
with vector-borne DNA. Suicide vectors for gene replacement in Gram-negative bacteria may carry a conditional lethal gene that can discriminate between the integration
of the entire vector and double recombination events. The suicide vectors pJQ200 and
pJQ210, carrying P15A origin of replication, have been used successfully with
Rhizobium (Quandt and Hynes 1993). The plasmid pGS9, originally developed as a
suicide plasmid for insertional mutagenesis in R. meliloti (Selvaraj and Iyer 1983), is
composed of p15A-type replicon and N-type bacterial mating system.
The suicide vector pSUP2021 is a derivative of pSUP202 carrying a Tn5 mobilizable transposon (Simon et al. 1983). The plasmid pSUP202 (Fig. 4.3) is derived
from the commonly used E. coli vector pBR325, with a ColE1 replicon and a IncPtype Mob region, which is unable to replicate outside the enteric bacteriait can
be mobilized into, but not stably maintained, in Azospirillum. Therefore pSUP202
and pSUP2021 are good transposon carriers for random or site-directed transposon
insertion. However, note that not all other derivatives of pBR325 can be used
Fig. 4.3 Map of the vector pSUP202. It is a pBR325 (E. coli vector) derivative carrying the IncPtype transfer genes (Mob site from plasmid RP4) and can be mobilised with high frequency from
the donor strains. It is unable to replicate in strains outside the enteric bacterial group thus, it is not
stable in Azospirillum and can be used as transposon carrier replicon for random transposon insertion mutagenesis. This vector and members of its family, such as pSUP101, 201, 203, are especially useful for site-directed transposon mutagenesis and for site-specific gene transfer in a wide
variety of Gram-negative organisms in any strain into which they can be mobilised but not maintained (Simon et al. 1983). Unique restriction sites shown: (H) HindIII (S) SalI (B) BamHI (P) PstI
(R) EcoRI. Numbers are given in kb. The plasmid codes for tetracycline (Tc), chloramphenicol
(Cm) and ampicillin (Amp) resistance
70
4.1.2
4.1.2.1
Conjugation Protocol
In a typical conjugation protocol, overnight liquid cultures of donor and recipient strains
(and helper strain if required) are mixed on nonselective nutrient agar (NA) plates.
These can be mixed prior to applying, or applied to plates in stages, beginning with the
donor, then the recipient on top, with drying in between. The mixture is allowed to dry
and incubated overnight at 2830 C. A quantity of the mating mix can be spread on
selective medium and incubated for 48 h or longer at 30 C to observe for transformants
(Pereg Gerk et al. 1998). In some cases 10 mM MgSO4 is used in the donor and recipient
cell cultures and added to the selective medium (Vanstockem et al. 1987).
The selective medium is a medium on which only the transformed or mutated
recipients should grow; control cultures of the parent donor, recipient, and helper
4 Molecular Tools to Study Azospirillum sp. and Other Related Plant Growth
71
strains should not grow. Other selective pressure in addition to antibiotics can be
applied for the elimination of some parent strains. For example, the E. coli S17.1
donor is an auxotroph for proline and thus cannot grow in proline-free minimal lactate
medium (Table 4.2, Dreyfus et al. 1983) or Nitrogen-free medium (Nfb, Table 4.2,
Katupitiya et al. 1995). While proline-free minimal media can be used to select against
Table 4.2 Proline-free minimal medium for Azospirillum transformation
Minimal lactate mediuma
Prepare minimal medium supplemented with 6.3 mL/L of
sodium lactate
Before use add 10 mL of CaCl2 solution (7 g/L), 10 mL of
trace element solution, 1 mL of FeCl36H2O solution
(10 g/L), 1 mL of Na2MoO42H2O solution (0.8 g/L), and
1 mL of vitamin solution
Each of the solutions should be autoclaved separately
Minimal medium supplemented with 6.3 mL/L of sodium
lactate
100 mL phosphate solution
10 mL MgSO4/NaCl solution
500 mL DW
Malic acid 5 g
K2HPO43H2O 0.5 g
MgSO47H2O 0.2 g
NaCl 0.1 g
4 mL Fe-EDTA (1.64 % aqueous,
w/v); 2 mL of trace element
solution
Adjust pH to 6.8 with KOH and
make up to 1 L with DW
Sterilized by autoclaving at 120 C
for 20 min
Add 1 mL vitamin solution per
liter medium (after autoclaving)
Trace element solution
In 1 L:
MnSO4H2O 250 mg
ZnSO47H2O 70 mg
CoSO47H2O 14 mg
CuSO45H2O 12.5 mg
H3BO3 3 mg
Na2MoO42H2O 200 mg
Vitamin solution
In 100 mL:
Biotin 1 mg
Pyridoxine 2 mg
Filter sterilize
72
the donor and helper strains, antibiotics are often used to select against the parent
Azospirillum recipient strain.
When selecting for recipients transformed with a stable plasmid antibiotic resistance encoded by the plasmid, and not by the recipient parent, will be used for
selection. In the case of suicide vectors the selection pressure will be dependent on
the marker integrated into the recipient chromosome; for example, Tn5 often
encodes for antibiotic resistance (often kanamycin), GFP for green fluorescence, or
lacZ for -galactosidase activity (blue-white selection on X-gal). Other morphological traits can be used in the selection of transformants, for example, Pereg Gerk
et al. (1998) selected for white, nonencapsulating Tn5-induced mutants, against a
background of red colonies on minimal medium containing kanamycin and CongoRed. In the case of suicide vectors, it is important to check that a double and not
single recombination event has occurred, to avoid the integration of the entire plasmid (Simon et al. 1983).
4 Molecular Tools to Study Azospirillum sp. and Other Related Plant Growth
73
The development of the pSUP family of suicide plasmids (Simon et al. 1983)
also promoted the possibility of site-directed Tn5 mutagenesis. This is based on
homologous recombination between vector-borne and specific genomic DNA
sequences. Site-directed mutagenesis is achieved by cloning the gene of interest,
disrupted by a transposon (e.g., Tn5 derivative), onto a suicide plasmid and inserting the plasmid by conjugation into Azospirillum. To increase the chance of double
homologous recombination between the chromosome and the plasmid it is important to ensure that there are sufficiently long Azospirillum gene sequences bracketing the Tn5 carried on the plasmid (Pereg Gerk et al. 1998). It is recommended to
include at least 500 bp of chromosome-homologous sequences on each side of the
plasmid-borne Tn5 for optimal results in Azospirillum (Pereg, unpublished).
Similarly to random transposon mutagenesis, the selection stage is important in the
generation of specific mutants. Pereg Gerk et al. (1998) directly selected for mutants
that cannot undergo morphological transformation to cyst-like cells by identifying
white colonies on selective medium containing kanamycin (selected for Tn5) and
Congo-red (binds to exopolysaccharides, wild-type appears red). White, kanamycin
resistant colonies were then tested for chloramphenicol sensitivity, indicative of
double homologous recombination and the elimination of the pSUP202 vector
(Pereg Gerk et al. 1998). Kadouri et al. (2003) used a derivative of pSUP202 for
site-directed mutagenesis and characterization of Azospirillum phaZ.
De Lorenzo et al. (1990) and Herrero et al. (1990) constructed a selection of miniTn5 and Tn10 transposon delivery, R6K-based, suicide plasmids with antibiotic
resistance and nonantibiotic selection markers for chromosomal insertion of DNA
into Gram-negative bacteria. The system was used successfully with Rhizobium for
insertion mutagenesis and gene expression studies using the gusA and lacZ reporter
genes (Reeve et al. 1999). Elements from these plasmids have been used in mutagenesis of specific Azospirillum genes in IAA synthesis (Carreno-Lopez et al. 2000) and
genetic labelling of Azospirillum with a fluorescence marker (Rodriguez et al. 2006).
Gene knockout and other chromosomal gene replacements can be achieved by
double homologous recombination in a similar manner to site-directed Tn5 mutagenesis. In these cases no transposon is used, and either a truncated gene or gene
sequences bracketing a marker gene, such as antibiotic resistance, are cloned into
the suicide plasmid (Hou et al. 2014). Other Azospirillum mutants isolated globally
using gene replacement with a marker include nif, nodPQ, glnB, DraT, DraG, rpoN,
NtrBC, recA gene mutants, and others (summarized in Holguin et al. 1999).
4.1.4
74
4.1.4.1
Freeze-Boil Method
4.1.4.2
(As used by Pereg Gerk et al. (1998) The protocol was provided to L Pereg by
C. Elmerich.)
Prepare 5 mL of a late logarithmic phase culture of A. brasilense in nutrient
broth. Centrifuge for 10 min and wash the pellet twice with 1.5 mL of T50E20 buffer
(Tris 50 mM, EDTA 20 mM, pH 8). Resuspend in 400 L of T50E20 buffer. Lyse cells
by adding 7 L of Pronase E (50 mg/mL) and 50 L of 10 % SDS, and incubate at
37 C for 1 h. Gently pump the clear lysate several times up and down with a 1-mL
syringe equipped with a wide needle (18G1.5, 1.2 40) to physically disrupt the
DNA. Extract the DNA by adding 300 L of phenol and 300 L of chloroform.
Repeat the phenolchloroform extraction until the supernatant is clear. RNA can be
eliminated from the solution by the addition of 3 L of RNase (0.5 g/L) and incubation at 37 C for 3060 min. Perform a final extraction with one volume of chloroform and transfer the supernatant containing the DNA into a clean tube. Solubilize
the DNA by adding 1:10 volumes of sodium acetate (3 M, pH 5.5) and 2 volumes
of 100 % ethanol. Incubate the solution at 20 C for 2 h or overnight. Precipitate
the DNA by centrifugation for 15 min at 4 C, then wash the pellet with cold 70 %
ethanol. Allow pellet to dry then dissolve in 200 L of TE buffer. The DNA can be
examined by gel electrophoresis (0.8 % agarose mini gel) and stored at 20 C for
further use.
4.2
4 Molecular Tools to Study Azospirillum sp. and Other Related Plant Growth
4.2.1
75
4.2.1.1
Harvest cells from liquid culture by centrifugation. Resuspend cell pellet in 0.5 mL
Z buffer supplemented with 5 L of -mercaptoethanol. Add 20 L of 0.1 % sodium
dodecyl sulphate (SDS) and 40 L of chloroform and mix vigorously to lyse cells.
Preincubate tubes in a water bath at 28 C for 510 min, then add 100 L of fresh
ONPG solution (Table 4.3) and mix well (start time). Continue incubation at 28 C
until the samples start turning yellow. Stop the reaction by adding 250 L of 1 M
ONPG solution
In 10 mL phosphate buffer or in 10 mL Z
buffer (pH 7.0) dissolve 40 mg of ONPG
76
Na2CO3. Record the start and stop times. Centrifuge for 510 min at 14,000 rpm and
measure the absorbance of the supernatant at 420 and 550 nm, against a Z buffer
blank (treated in the same way as bacterial samples). Express the results as Miller
units/min/mg bacterial protein (Miller 1972). This assay can also be carried out on
Azospirillum growing in association with plant roots, as described in Chap. 10.
4.2.2
RNA Extraction
Extraction of total RNA for downstream applications such as qRT-PCR can be carried
out using a Trizol extraction protocol. Up to 1 108 cells for RNA extraction should
be harvested from liquid culture by centrifugation at 6,000 g for 5 min at 4 C. Cells
may be used immediately or stored in an RNA preservation solution for later use.
Resuspend the cell pellet in 1 mL Trizol reagent and incubate for 5 min at room temperature. Add 0.2 mL cold chloroform and shake vigorously, then incubate for 23 min
at room temperature. Centrifuge at 12,000 g for 15 min. Transfer the colorless upper
aqueous phase (~0.4 mL) to a fresh tube. Precipitate RNA by adding 0.5 mL cold
isopropanol and mixing. Incubate for 10 min at room temperature. Centrifuge at
15,000 g for 10 min and carefully remove the supernatant. Resuspend the RNA pellet in 1 mL 75 % ethanol and vortex. Centrifuge at 7,500 g for 5 min. Discard the
supernatant and allow RNA pellet to air-dry. Resuspend RNA pellet in 50 L RNasefree water. Agarose gel electrophoresis of RNA should show clear 16S and 23S ribosomal bands. RNA concentration may be determined by spectrophotometry. Extracted
RNA should be stored at 80 C in aliquots to avoid repeated freeze-thawing.
4.2.3
qRT-PCR
4.2.3.1
One important consideration in the application of qRT-PCR is the selection of internal reference (housekeeping) genes for the normalization of data. As no standard set
of reference genes has been determined for prokaryotic cells such as Azospirillum,
it is important to identify stable reference genes prior to undertaking qRT-PCR
4 Molecular Tools to Study Azospirillum sp. and Other Related Plant Growth
77
Table 4.4 Reference genes identified in different bacterial species for qRT-PCR data normalization
Bacterial species
Azospirillum brasilense
Clostridium ljungdahlii
Lactobacillus casei
Xanthomonas citri
Pectobacterium atrosepticum
Staphylococcus aureus
Actinobacillus pleuropneumoniae
Pseudomonas aeruginosa
Reference genes
gyrA, glyA
gyrA, rho, fotl
gyrB, GAPB
atpD, rpoB, gyrA, gyrB
recA, ffh
Pyk, proC
glyA, recF
proC, rpoD
Reference
McMillan and Pereg (2014)
Liu et al. (2013)
Zhao et al. (2011)
Jacob et al. (2010)
Takle et al. (2007)
Theis et al. (2007)
Nielsen and Boye (2005)
Savli et al. (2003)
analysis (McMillan and Pereg 2014). Appropriate reference genes can be selected
from a set of potential reference genes by analyzing expression of each gene in the
target species under all different experimental treatments. Free software packages
such as BestKeeper (Pfaffl et al. 2004), Normfinder (Andersen et al. 2004), and
GeNorm (Vandesompele et al. 2002) can then be used to identify the most stable
reference genes. Some reference genes identified for different bacterial species,
including A. brasilense, are shown in Table 4.4.
4.2.3.2
Primer Design
qRT-PCR primers should be designed against the specific sequence of the gene of
interest. For Azospirillum spp. these sequences may not always be available; however, the complete genome sequences of Azospirillum sp. B510 (Kaneko et al.
2010), A. brasilense Sp245 and A. lipoferum 4B (Wisniewski-Dye et al. 2011), are
available and may be used to design specific primers for closely related species.
Ideally, for optimal PCR efficiency, the amplicon length should be between 50 and
150 bases. Longer amplicons can lead to poor amplification efficiency. Primers
should be between 18 and 25 bases (20 bases is standard). The primer melting temperature (Tm) of each PCR primer should be between 58 and 60 C, and the Tm of
both primers should be within 4 C of each other. The GC content of primers should
be within 4060 %. To avoid the formation of primer dimers in the PCR reaction
complementarities between primers should be avoided. Primer design software can
be used to simplify the primer design process and select the optimal primer pair for
a given sequence.
4.2.3.3
One-Step qRT-PCR
In one-step PCR the reverse transcription step is carried out in the same reaction
tube as the PCR reaction. This has the advantage of being quicker, involving less
pipetting than a two-step protocol, and eliminates the possibility of contamination
between reverse transcriptase and PCR steps. Commercial one-step RT-PCR kits
78
Step
Temperature (C)
Reverse transcription
50
Enzyme activation
95
Two-step cycling (3540 cycles)
Denaturation
95
Annealing/extension
60a
Time
10 min
5 min
1015 s
30 s
Step
Temperature (C)
Time
Reverse transcription
50
10 min
Enzyme activation
95
5 min
Three-step cycling (3540 cycles)
Denaturation
95
1015 s
30 s
Annealing
5560a
Extension
72
30 s
a
Annealing temperature can be altered based on the Tm of primers
used
include a mastermix containing Taq DNA polymerase, fluorescent dye (most commonly SYBR), dNTPs, and MgCl2, to which reverse transcriptase and template
RNA is added. A typical 25 L reaction mix consists of 12.5 L RT-PCR master
mix, 1 M each forward and reverse primer, 0.25 L reverse transcriptase, 10100 ng
template RNA.
Most commercial qRT-PCR kits have been optimized for use in a two-step
cycling protocol, with a combined annealing/extension step. Typical two-step
cycling conditions are shown in Table 4.5. A no-template control (to test for primer
dimer formation or contamination of reagents), a positive control, and a minus
reverse transcriptase control (to test for genomic DNA contamination) should
always be included.
A three-step cycling protocol may be used as an alternative to the two-step
cycling protocol. Typical three-step cycling conditions are shown in Table 4.6.
4.2.3.4
Two-Step qRT-PCR
Two-step qRT-PCR is carried out with separate reverse transcriptase and PCR
cycling steps. A two-step protocol may be more sensitive and allows for individual
optimization of the reverse transcriptase and PCR steps. cDNA synthesis can be
carried out using a commercial kit, and the composition of buffers and amounts of
reagents used will vary with supplier. For Azospirillum, a typical reaction combines
0.1 ng5 g total RNA with 50 ng random hexamers in annealing buffer and is
incubated at 6570 C for 5 min to denature RNA. The reaction is then chilled for
25 min to allow annealing of primers. Other components are added to the reaction
including dNTPs (0.51 mM), reverse transcriptase (15200 U/reaction depending
on enzyme used), RNase inhibitor (4050 U/L), and MgCl2 (5 mM). The reaction
4 Molecular Tools to Study Azospirillum sp. and Other Related Plant Growth
79
is incubated for 510 min at 25 C, followed by 50 min at 50 C to allow for extension. The reaction is terminated by heating to 85 C for 5 min. The cDNA can then
be used as template for a qPCR assay.
The reaction mix and cycling conditions for the qPCR reaction are similar to
those described for one-step qRT-PCR, with the omission of reverse transcriptase
from the reaction mix, and the initial 50 C reverse transcriptase step is eliminated
from the PCR cycle.
References
Allen NL, Hanson RS (1985) Construction of broad-host-range cosmid cloning vectors: identification of genes necessary for growth of Methylobacterium organophilum on methanol. J Bacteriol
161:955962
Andersen CL, Jensen JL, Orntoft TF (2004) Normalization of real-time quantitative reverse
transcription-PCR data: a model-based variance estimation approach to identify genes suited
for normalization, applied to bladder and colon cancer data sets. Cancer Res 64:52455250
Arsne F, Katupitiya S, Kennedy IR, Elmerich C (1994) Use of lacZ fusions to study the expression of nif genes of Azospirillum brasilense in association with plants. Mol Plant Microbe
Interact 7:748757
Biondi EG, Marini F, Altieri F, Bonzi L, Bazzicalupo M, del Gallo M (2004) Extended phenotype
of an mreB-like mutant in Azospirillum brasilense. Microbiology 150:24652474
Carreno-Lopez R, Campos-Reales N, Elmerich C, Baca BE (2000) Physiological evidence for differentially regulated tryptophan-dependent pathways for indole-3-acetic acid synthesis in
Azospirillum brasilense. Mol Gen Genet 264:521530
de Lorenzo V, Herrero M, Jakubzik U, Timmis KN (1990) Mini-Tn5 transposon derivatives for
insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gramnegative eubacteria. J Bacteriol 172:65686572
De Zamaroczy M, Paquelin A, Elmerich C (1993) Functional organization of the glnB-glnA cluster
of Azospirillum brasilense. J Bacteriol 175:25072515
Del Gallo MM, Gratani L, Morpurgo G (1985) Mutation in Azospirillum brasilense. In: Klingmuller
W (ed) Azospirillum III: genetics, physiology, ecology. Springer, Berlin, pp 8597
Ditta G, Stanfield S, Corbin D, Helinski DR (1980) Broad host range DNA cloning system for
gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc Natl Acad Sci
U S A 77:73477351
Dreyfus BL, Elmerich C, Dommergues YR (1983) Free living Rhizobium strain able to grow on
N2 as the sole nitrogen source. Appl Environ Microbiol 45:711713
Elmerich C (1983) Azospirillum genetics. In: Puhler A (ed) Molecular genetics of the bacteriaplant interaction. Springer, Berlin, pp 367372
Elmerich C, Franche C (1982) Azospirillum genetics: plasmids, bacteriophages and chromosome
mobilization. In: Klingmuller W (ed) Azospirillum genetics, physiology, ecology. Birkhuser,
Basel, pp 917
Fani R, Bazzicalupo M, Coianiz P, Polsinelli M (1986) Plasmid transformation of Azospirillum
brasilense. FEMS Microbiol Lett 35:2327
Fani R, Bazzicalupo M, Ricci F, Schipani C, Polsinelli M (1988) A plasmid vector for the selection
and study of transcription promoters in Azospirillum brasilense. FEMS Microbiol Lett
50:271276
Fogher C, Bozouklian H, Bandhari SK, Elmerich C (1985) Constructing of a genomic library of
Azospirillum brasilense Sp7 and cloning of the glutamine synthetase gene. In: Klingmuller W
(ed) Azospirillum III: genetics, physiology, ecology. Springer, Berlin
80
Haas D, Holloway BW (1976) R factor variants with enhanced sex factor activity in Pseudomonas
aeruginosa. Mol Gen Genet 144:243251
Herrero M, de Lorenzo V, Timmis KN (1990) Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gramnegative bacteria. J Bacteriol 172:65576567
Holguin G, Patten CL, Glick BR (1999) Genetics and molecular biology of Azospirillum. Biol
Fertil Soils 29:1023
Hou X, McMillan M, Coumans JVF, Poljak A, Raftery MJ, Pereg L (2014) Cellular responses during morphological transformation in Azospirillum brasilense and its flcA knockout mutant.
PLoS One 9(12):e114435. doi:10.1371/journal.pone.0114435
Jacob T, Laia M, Ferro J, Ferro MT (2010) Selection and validation of reference genes for gene
expression studies by reverse transcription quantitative PCR in Xanthomonas citri subsp. citri
during infection of Citrus sinensis. Biotechnol Lett 33:11771184
Kadouri D, Burdman S, Jurkevitch E, Okon Y (2002) Identification and isolation of genes involved
in poly(beta-Hydroxybutyrate) biosynthesis in Azospirillum brasilense and characterization of
a phbC mutant. Appl Environ Microbiol 68:29432949
Kadouri D, Jurkevitch E, Okon Y (2003) Poly -hydroxybutyrate depolymerase (PhaZ) in
Azospirillum brasilense and characterization of a phaZ mutant. Arch Microbiol 180:309318
Kaneko T, Minamisawa K, Isawa T et al (2010) Complete genomic structure of the cultivated rice
endophyte Azospirillum sp. B510. DNA Res 17(1):3750
Katupitiya S, New PB, Elmerich C, Kennedy IR (1995) Improved N2 fixation in 2,4-D treated
wheat roots associated with Azospirillum lipoferum: studies of colonization using reporter
genes. Soil Biol Biochem 27:447452
Kaur S, Mishra M, Tripathi A (2009) Regulation of expression and biochemical characterization of
a b-class carbonic anhydrase from the plant growth promoting rhizobacterium, Azospirillum
brasilense Sp7. FEMS Microbiol Lett 299:149158
Knauf VC, Nester EW (1982) Wide host range cloning vectors: a cosmid clone bank of an
Agrobacterium Ti plasmid. Plasmid 8:4554
Kokotek W, Lotz W (1989) Construction of a lacZ-kanamycin-resistance cassette, useful for sitedirected mutagenesis and as a promoter probe. Gene 84:467471
Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, Peterson KM (1995) Four
new derivatives of the broad-host-range vector pBBR1MCS carrying different antibioticresistance cassettes. Gene 166:175176
Kumar S, Rai A, Mishra M, Shukla M, Singh P, Tripathi A (2012) RpoH2 sigma factor controls the
photooxidative stress response in a non-photosynthetic rhizobacterium, Azospirillum brasilense Sp7. Microbiology 158:28912902
Liang YY, Kaminski PA, Elmerich C (1991) Identification of a nifA-like regulatory gene of
Azospirillum brasilense Sp7 expressed under conditions of nitrogen fixation and in the presence of air and ammonia. Mol Microbiol 5:27352744
Liu J, Tan Y, Yang X, Chen X, Li F (2013) Evaluation of Clostridium ljungdahlii DSM 13528 reference genes in gene expression studies by qRT-PCR. J Biosci Bioeng 116(4):460464
McMillan M, Pereg L (2014) Evaluation of reference genes for gene expression analysis using
quantitative RT-PCR in Azospirillum brasilense. PLoS One 9(5):e98162. doi:10.1371/journal.
pone.0098162
Michiels K, Vanstockem M, Vanderleyden J, Van Gool A (1985) Stability of broad host range
plasmids in Azospirillum. Cloning of a 5.9 KBP plasmid from A. brasilense RO7. In:
Klingmller W (ed) Azospirillum III: genetics, physiology, ecology. Springer, Berlin, pp 6373
Milcamps A, Van Dommelen A, Stigter J, Vanderleyden J, de Bruijn FJ (1996) The Azospirillum
brasilense rpoN gene is involved in nitrogen fixation, nitrate assimilation, ammonium uptake,
and flagellar biosynthesis. Can J Microbiol 42:467478
Miller J (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratory, New York
Nielsen K, Boye M (2005) Real-time quantitative reverse transcription-PCR analysis of expression
stability of Actinobacillus pleuropneumoniae housekeeping genes during in vitro growth under
iron-depleted conditions. Appl Environ Microbiol 71:29492954
4 Molecular Tools to Study Azospirillum sp. and Other Related Plant Growth
81
Pedrosa FO, Yates MG (1984) Regulation of nitrogen fixation (nif) genes of Azospirillum brasilense by nifA and ntr (gln) type gene products. FEMS Microbiol Lett 23:95101
Pereg Gerk L (2004) Expression of flcA, a gene regulating differentiation and plant interaction in
Azospirillum. Soil Biol Biochem 36:12451252
Pereg Gerk L, Paquelin A, Gounon P, Kennedy IR, Elmerich C (1998) A transcriptional regulator
of the LuxR-UhpA family, FlcA, controls flocculation and wheat root surface colonisation by
Azospirillum brasilense Sp7. Mol Plant Microbe Interact 11:177187
Pereg Gerk L, Gilchrist K, Kennedy IR (2000) Mutants with enhanced nitrogenase activity in
hydroponic Azospirillum brasilense-wheat associations. Appl Environ Microbiol 66:
21752184
Pfaffl M, Tichopad A, Prgomet C, Neuvians T (2004) Determination of stable housekeeping genes,
differentially regulated target genes and sample integrity: BestKeeperExcel-based tool using
pair-wise correlations. Biotechnol Lett 26:509515
Quandt J, Hynes MF (1993) Versatile suicide vectors which allow direct selection for gene replacement in Gram-negative bacteria. Gene 127:1521
Reeve WG, Tiwari RP, Worsley PS, Dilworth MJ, Glenn AR, Howieson JG (1999) Constructs for
insertional mutagenesis, transcriptional signal localization and gene regulation studies in root
nodule and other bacteria. Microbiology 145:13071316
Revers LF, Pereira Passaglia LM, Marchal K, Frazzon J, Blaha CG, Vanderleyden J, Schrank IS
(2000) Characterization of an Azospirillum brasilense Tn5 mutant with enhanced N2 fixation:
the effect of ORF280 on nifH expression. FEMS Microbiol Lett 183:2329
Reznikoff WS (1982) Tn5 transposition and its regulation. Cell 31:307308
Rodriguez H, Mendoza A, Cruz MA, Holguin G, Glick BR, Bashan Y (2006) Pleiotropic physiological effects in the plant growth-promoting bacterium Azospirillum brasilense following
chromosomal labeling in the clpX gene. FEMS Microbiol Ecol 57:217225
Rothballer M, Schmid M, Hartmann A (2003) In situ localization and PGPR-effect of Azospirillum
brasilense strains colonizing roots of different wheat varieties. Symbiosis 34:261279
Rothballer M, Schmid M, Fekete A, Hartmann A (2005) Comparative in situ analysis of ipdCgfp
mut3 promoter fusions of Azospirillum brasilense strains Sp7 and Sp245. Environ Microbiol
7:18391846
Savli H, Karadenizli A, Kolayli F, Gundes S, Ozbek U, Vahaboglu H (2003) Expression stability
of six housekeeping genes: a proposal for resistance gene quantification studies of Pseudomonas
aeruginosa by real-time quantitative RT-PCR. J Med Microbiol 52:403408
Selvaraj G, Iyer VN (1983) Suicide plasmid vehicles for insertion mutagenesis in Rhizobium meliloti and related bacteria. J Bacteriol 156:12921300
Simon R, Priefer U, Phler A (1983) A broad host range mobilization system for in vivo genetic
engineering: transposon mutagenesis in Gram-negative bacteria. Nat Biotechnol 1:784791
Takle G, Toth I, Brurberg M (2007) Evaluation of reference genes for real-time RT-PCR expression
studies in the plant pathogen Pectobacterium atrosepticum. BMC Plant Biol 7:50
Theis T, Skurray RA, Brown MH (2007) Identification of suitable internal controls to study expression of a Staphylococcus aureus multidrug resistance system by quantitative real-time PCR.
J Microbiol Methods 70:355362
Valverde A, Okon Y, Burdman S (2006) cDNA-AFLP reveals differentially expressed genes related
to cell aggregation of Azospirillum brasilense. FEMS Microbiol Lett 265:186194
Van Rhijn P, Vanstockem M, Vanderleyden J, De Mot R (1990) Isolation of behavioural mutants of
Azospirillum brasilense by using Tn5 lacZ. Appl Environ Microbiol 56:990996
Vande Brock A, Keijers V, Vanderleyden J (1996) Effect of oxygen on the free-living nitrogen fixation activity and expression of the Azospirillum brasilense nifH gene in various plant-associated
diazotrophs. Symbiosis 21:2540
Vande Broek A, van Gool A, Vanderleyden J (1989) Electroporation of Azospirillum brasilense
with plasmid DNA. FEMS Microbiol Lett 61:177182
Vande Broek A, Michiels J, DeFaria SM, Milcamps A, Vanderleyden J (1992) Transcription of the
Azospirillum brasilense nifH gene is positively regulated by NifA and NtrA and is negatively
controlled by the cellular nitrogen status. Mol Gen Genet 232(2):279283
82
Vandesompele J, De Preter K, Pattyn F et al (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol
3(7):RESEARCH0034
Vanstockem M, Michiels K, Vanderleyden J, Van Gool A (1987) Transposon mutagenesis of
Azospirillum brasilense and Azospirillum lipoferum: physical analysis of Tn5 and Tn5-Mob
insertion mutants. Appl Environ Microbiol 53:410415
Vial L, Cuny C, Gluchoff-Fiasson K, Comte G et al (2006) N-acyl-homoserine lactone-mediated
quorum-sensing in Azospirillum: an exception rather than a rule. FEMS Microbiol Ecol
58:155168
Vieille C, Elmerich C (1992) Characterization of an Azospirillum brasilense Sp7 gene homologous
to Alcaligenes eutrophus phbB and to Rhizobium meliloti nodG. Mol Gen Genet 231:375384
Wisniewski-Dye F, Borziak K, Khalsa-Moyers G et al (2011) Azospirillum genomes reveal transition of bacteria from aquatic to terrestrial environments. PLoS Genet 7:e1002430
Zhao W, Li Y, Gao P et al (2011) Validation of reference genes for real-time quantitative PCR
studies in gene expression levels of Lactobacillus casei Zhang. J Ind Microbiol Biotechnol
38:12791286
Chapter 5
5.1
Introduction
83
84
5.2
V. Gonzlez et al.
Genome Sequencing
Nowadays, bacterial genome sequencing has become affordable for small research
laboratories worldwide. Since Sanger sequencing, new technologies collectively
called Next Generation Sequencing (NGS) have improved the field lowering the
cost per sequenced base (and per genome as a whole), and increasing the accuracy
of the readings. A review of the current NGS technologies from a decades perspective has been published by Mardis (Mardis 2011). Even Sanger capillary sequencing is still in use because its accuracy and long reads; pyrosequencing (454 Life
Sciences-Roche) and sequencing by synthesis (Illumina) have dominated the field
last years. Emerging technologies that produce very long reads, PacBio (Pacific
Biosciences) (Eid et al. 2009), and Nanopore (Oxford Nanopore Technology)
(Schneider and Dekker 2012) are not extensively used even their promissory future.
To choose the most appropriate sequencing platform, it should be done through a
careful balance of their performance: data amount, speed, flexibility, read length,
and cost (Table 5.1) according to the genome it is working on.
Critical for any genomic project is to set up if genome sequences of reference
organisms are available; if not, an experimental design for de novo sequencing
should be devised. When the reference genome sequence of the microorganism to
study is already in databases, a first effort should be to choose the NGS technology
that allows for high coverage of the genomes (about 50 or more). Most used
technologies include Illumina and 454 pyrosequencing; in both cases they produce
short readings of about 100300 and 400500 bases, respectively, that can be easily
mapped onto the reference genome with bioinformatics tools as MAQ, MUMmer
(Kurtz et al. 2004), BOWTIE (Langmead et al. 2009), BWA, and TopHat (Fonseca
et al. 2012). Before mapping, readings could be assembled in contigs but ordinarily
Table 5.1 Relevant features of selected NGS technologies
NGS
technologya
3730 l
(Sanger)
ABI/Solid
Illumina
/Solexa
IonTorrent
Read
length (bp)
650
Running
time
2h
Reads/runs
(millions)
0.000096
Error rate
Low (<1 %)
Reference
Mardis (2013)
75 + 35
250 + 250
8 days
2h
>1,410
48
Low (<2 %)
Low (<2 %)
Mardis (2013)
Loman et al. (2012)
200
2h
Roche/454
400600
1020 h
PacBio
Up to
15,000
0.52 h
0.01
Medium
(<4 %)
Medium
(<4 %)
High (<18 %)
Actually, NGS technologies run a variety of platforms from relative small scale to very great scale.
For instance, Illumina have versions like MySeq for small genomes and HiSeq for human genome
scale, and a variety of intermediate apparatus and multiplex strategies to lower the costs and the
time of running. Other companies have also diverse sequencing options
85
it is not necessary to invest computing time in assemblies since this strategy works
well for re-sequencing of very related genomes. A good sequencing run, whatever
technology employed, recovers more than 99 % of the gene content of a bacterial
genome allowing for identification of single nucleotide mutations (SNPs) (Royce
et al. 2013), or to map disrupted genes by the insertion of antibiotic cassettes or
transposons in mutagenesis experiments (Held et al. 2012).
The de novo sequencing requires a variation in the experimental design as well
as to include extensive bioinformatics processing for the assembly. It has been
proved that the best strategy to de novo assembly is to combine the results of two
classes of genome sequence readings. One is short-paired end readings from small
fragment libraries (300500 bp) to achieve high coverage, and the other from
mate-pair readings from large insert libraries (38 kb) to solve the repeats and
misassemblies (Ribeiro et al. 2012). Taken together, they give highly accurate
assemblies even for the complex multi-replicon bacterial genomes of Azospirillum.
5.3
86
V. Gonzlez et al.
programs that use the de Bruin graphs. It is not easy to decide what is the best
assembler for a bacterial genome, but it is clear that the best should be one that cope
very well with the repeats, combine short and large reads from different sequencing
platforms, and be bioinformatically affordable in computing time and memory consuming (Koren et al. 2014; Lee and Tang 2012; Miller et al. 2010; Ren et al. 2012).
To understand and use the genome sequences, it is necessary to identify and
assign functions to protein-coding genes, non-coding RNAs, regulatory sequences,
repeats, and others features that make the genome more comprehensive for scientist.
First step consists in predicting Open Reading Frames (ORFs) with computer
programs that generally use statistical procedures like Markov chains. GeneMarkS
and a training set of known ORFs, or long ORFs predicted from the genome itself
(Borodovsky and Lomsadze 2014) and Glimmer (Delcher et al. 1999) are earlier
programs used to predict ORFs; they are still among the most popular because they
are easy and accurate. They can predict almost the complete gene content of a bacterial genome with about 8898 % of accuracy. Among the problems commonly
found with these programs is the prediction of very small ORFs, overlapping and
missing ORFs, and the incorrect identification of the translation start site. There are
other gene prediction programs available that improve the accuracy at expense of
the sensitivity. For instance, Prodigal make more accurate translation site predictions
based on the strength of the translation binding site (Hyatt et al. 2009).
ORFs can be represented in graphic interfaces with their associated features by
genome browsers like Artemis Comparison Tool (ACT) (Carver et al. 2012) and
mVISTA (Frazer et al. 2004; Nielsen et al. 2010). Artemis can be used to perform
manual annotation since it can also function as editor of the sequences and ORFs,
allow to write directly into the features, correct start codons, add or remove ORFs,
send BLAST searches to databases, and generate the Genbank file; all in a friendly
platform.
5.4
All the annotation procedures are based on the comparison with genomes and genes
already annotated in databases, with previous predictions or with experimental
evidence of the gene function. BLAST searches are the most used bioinformatic
tools to compare the predicted protein-coding genes with databases of the
International Nucleotide Sequence Database: GenBank-RefSeq (Benson et al.
2014), DDBJ (DNA Data Bank of Japan) (Kosuge et al. 2014), and EMBLEBI
(Kulikova et al. 2007). These databases provide the complete genome sequences in
FASTA format or in other format (GenBank, DDBJ, EMBL) both in nucleotides
and proteins together with the submitted annotations that can be downloaded by
FTP. Additional resources in these databases include the taxonomic distribution of
orthologs, links to Pubmed, summary tables of the annotation, COGs, and BLAST
resources to look for homologs in other organisms, and structural domains in the
Conserved Domain Database (NCBI-CCD). Another resource database widely used
87
due to the quality of its annotations and minimal redundancy is UniProt (Dimmer
et al. 2012; Magrane and Consortium 2011). This consortium formed by the SwissProt, TrEMBL, and PIR (Protein Information Resource) provide manually curated
annotations and experimental information extracted from the scientific literature;
therefore, annotations are enriched in aspects like subcellular location, protein
interactions, alternative products, cross-reference databases, and more (UniProt
Consortium 2014).
Additional resources to investigate for protein domains in protein family databases
give strong support to the functional annotation of the predicted genes. The InterPro
(Hunter et al. 2012) is the most used resource of protein families, domains and
motifs, which can be accessed by web server or downloaded by anonymous FTP.
Several protein family databases are joined in InterPro so with a single query using
the InterProScan (Jones et al. 2014) could analyze the PFAM (Protein Families and
Domains), TIGRfam, and COG (Clusters of Orthologous Genes) (Chen et al. 2013).
There are automatic annotation pipelines that alleviate much of the annotation
work as SEEDRAST (Overbeek et al. 2014), xBASE (Chaudhuri et al. 2008), or
integrated databases with annotation pipelines like IMG (Markowitz et al. 2014),
Microscope (Vallenet et al. 2013), and KEEG (Kyoto Encyclopedy of Genes and
Genomes). The Integrated Microbial Genomes (IMG) at JGI records primary
genome information, finished or draft genomes, with functional annotation, provided from other databases (GenBank) or produced by the JGI itself. The complete
pipeline, once the complete sequence of the organisms is submitted to IMG include
the annotation of ribosomal and tRNA as well as protein-coding genes. The proteincoding genes are compared with protein families in the COG database with Blast,
and TIGRfams with HMMER. They are also mapped to the KEGG database with
KO (Kegg Orthology) terms and MetaCyc by EC (enzyme commission numbers) to
associate them to metabolic pathways. One interesting feature at IMG is the design
of biosynthetic clusters of genes associated to metabolic pathways involved in the
production of secondary metabolites. Access to IMG is provided under request as
user or submitter, providing agreement with the policies of the institution.
The KEGG database (Kanehisa et al. 2012) is one of the most complete references on metabolic pathways and cellular process that organize experimental
knowledge and predictions. KEGG integrate 15 main databases divided into four
categories: genomic, systems, chemical, and health information. KEGG has three
main reference knowledge databases that consist of KEGG PATHWAY, BRITE, and
MODULE. These databases are in close relation with the KEGG Orthology (KO)
system, which defines sequence similarity groups that facilitate the identification of
pathways in new sequenced genomes. To do this, KEGG has implemented genome
analysis tools as KAAS (Moriya et al. 2007), an Automatic Annotation Server
(KAAS) uses BLAST comparisons against the manually curated KEGG GENES
database to generate functional annotation of genes for complete or partial genomes.
The KAAS output contains KO assignments for the genes and automatically generated KEGG pathways list for the genome under study.
88
V. Gonzlez et al.
The genome sequences of Azospirillum are available from different public databases. For instance, in Genoscope it can be do diverse comparative analysis, metabolic reconstruction, and phylogenomics, using single-site web resources for
AzospirilumScope through the MicroScope platform. Users get access as a guest
with read rights or by an account created by petition to the project leader that give
rights to explore the database deeply and participate directly in the annotation process. MicroScope allows setting up one of the Azospirillum genomes as your reference organism. This action will upload the web page that displays the data for the
genome that the user has selected. Using the MaGe (Magnifying Genomes Tool) by
clicking at the navigation bar it can be displayed the genetic map of the reference
genome, the synteny map with respect to other Azospirillum genomes, and the
expert annotation summary if available. Most of the analysis described in this chapter
can be done at MicroScope since it integrates most of these applications.
At the end of the annotation process, a variable percentage of genes (about 30 %
or less) remain described as hypotheticals of unknown function. To give important
insight into the function of those hypothetical genes, context techniques that use
the occurrence of genes in the same context (operon, synteny), or the phyletic
co-occurrence of several genes are used. Databases like STRING (Search Tool for
the Retrieval of Interacting Genes/Proteins) (Franceschini et al. 2013) and KEGG
(Kyoto Encyclopedia of Genes and Genomes) (Kanehisa et al. 2012) use these
approaches to infer the functional association among genes and provide deep
genome annotations.
5.5
Complete genomes allow deep analysis of structural variations and the degree of
chromosome conservation among related bacterial species and strains. There are
computer programs to perform alignments of whole genomes like MUMmer (Kurtz
et al. 2004), VISTA (Frazer et al. 2004), and MAUVE (Darling et al. 2004). The first
allow pairwise alignment both in terms of nucleotides and proteins to estimate
synteny, rearrangements, and inversions. MAUVE permits alignment of multiple
genomes, estimation of structural variations, and synteny blocks. In addition,
MAUVE provides the basis for recombination analysis with ClonalFrame and
Clonalorigin (Didelot and Falush 2007; Didelot et al. 2010) and losses and gains of
genes with Genoplast (Didelot et al. 2009).
5.6
Bacterial genomes contain clusters of genes, called Genomic Islands (GIs), that
were acquired by horizontal gene transfer. The presence of GIs can be addressed with
computational programs which take advantage of the differential compositional
89
GENOME
SEQUENCE
TECHNOLOGIES
Illumina, Roche/454,
ABI/Solid, Ion Torrent,
Pacific Bioscience,
Nanopore, Sanger
ASSEMBLY
Velvet, Newbler, SPAdes,
SSPACE, SOAPdenovo,
CONSED-Phrap
GENE
PREDICTION
Glimmer, Genemark,
PRODIGAL
ANNOTATION
Artemis, VISTA,
SEEDRAST, xBASE,
Blast, IprScan,
RNAmmer, tRNAScan,
ISfinder
ALIGNING
TOOLS
MUMmer, CONSED,
MAQ, BOWTIE.
DATABASES
EMBL, GenBank, DDJB,
PIR INTERPRO and
SwissProt, eggNOG
COMPARATIVE
GENOME
ClustalW, Muscle,
MAUVE, ClonalFrame,
Genoplast
INTEGRATIVE
DATA BASES
KEGG, IMG, GENOSCOPE
PAN GENOME
PGAP, PanGP,
OrthoMCL,
Get_Homologues
Fig. 5.1 Flow chart of genomic strategies, bioinformatics tools, and databases
90
V. Gonzlez et al.
the presence of phages integrated in the genome. The annotation of ORFs identified
in phages is difficult because a great percentage of them (about 70 % in average)
encode for hypothetical proteins, without homologs in the databases. One effort to
systematize and cluster the phage proteins is the creation of Phage Orthologous
Groups (POGs). This is composed by protein families involved in different phage
processes like lysis, attachment-integration, replication, structure and assembly of
the virion, and others (Kristensen et al. 2011a). The POG database also has concern
for identifying phage genes as remnant of old infections, as well as active prophages
in the bacterial genomes. In pathogenic E. coli, the percentage of POG-related
genes are about 10 % whereas in the soil bacteria, such R. etli is about 5 %
(Santamaria et al. 2014), and 2 % in Azospirillum .
A third class of mobile elements commonly found in the genomes is the insertion
sequences. As more complete genomes become available reconstruction of their
evolutionary history could be helped by tracing the evolution of the IS (Lozano
et al. 2010). The most thorough compilation of IS families is the ISfinder (Siguier
et al. 2006) that represent the reference database for the bacterial and archaea
insertion sequences. Searches are exclusively done via comparative BlastN or
BlastX under certain e-value that returns the best hit of candidate IS as well as the
family features as repeats, ORFs number, and original host. However, IS are poorly
annotated in the genomes providing limited information about the transposase and
the inverted repeats. One effort to facilitate the annotation of IS in genomes has
been done by Wagner et al. (2007), that survey bacterial insertion sequences in multiple genomes using the ISscan with a curated version of the ISfinder.
5.7
Underlying to all comparative genomic tools are the biological concepts of homology, orthology, and paralogy (for review, see (Kristensen et al. 2011b)). Homology
means a gene that is related to other by descent from a common ancestral gene.
Homologous genes of different species that diverge by speciation are called orthologs. Generally, orthologs retain the same function in the course of the evolution;
therefore, orthologs identification is critical for reliable functional annotation, comparative genomics, and phylogenomic analyses. When homologous genes are duplicated within a genome or an evolutionary branch, they are named paralogs. They
constitute gene families within the same genome, and they might have diverse
functions.
To identify orthologs in genomes, there are two general methods: phylogenetic
(tree-based) and bioinformatic (graph-based) (Kuzniar et al. 2008). Owing to the
biological roots of the concept, phylogenetic methods are more accurate to get
homologs. There are databases of orthologous genes used as reference to annotate
the orthologs of a new genome by BLAST comparison. Among the phylogenetic
91
5.8
V. Gonzlez et al.
92
(Koonin and Wolf 2008), as well as the impact of the horizontal gene transfer in the
ecological adaptation and species differentiation (Wisniewski-Dye et al. 2011). One
aspect of the bacterial phylogenomics is the determination of the pangenome of the
species. Comparison of multiple genomes of the same bacterial species led to discover a large reservoir of genes present only in individual strains, and a common
core of genes shared by all the individuals. The primordial housekeeping functions
are encoded by the core genome, whereas the dispensable functions often represent
adaptations to particular ecological niche (Wisniewski-Dye et al. 2012). This component is the variable or accessory genome that together with the core constitutes
the pangenome of the species. Since Azospirillum is free-living organisms with a
high number of genes, it could be expected a large pangenome. Insights on the
pangenome of Azospirillum with a limited set of genomes have been published
(Wisniewski-Dye et al. 2012).
There are several programs implemented to model the pangenome. For instance,
Pan-Genome Analysis Pipeline (PGAP) (Zhao et al. 2012), PanGP (Zhao et al.
2014), and GET_HOMOLOGUES (Contreras-Moreira and Vinuesa 2013) can
perform different analytic functions: cluster all the genes, generate pan-genome
profile, detect genetic variation in each gene cluster, and construct phylogenetic
trees. In particular, GET_HOMOLOGUES is very flexible customizable and robust
pipeline that calculate the pangenome from dozens bacterial species at different
phylogenetic distances. It performs well in relative modest computing time and is
accessible for non-trained people in bioinformatics. The design allows download
the genome sequence and annotations, running BLAST and HMMER to find
homologous genes and domains, including three distinct clustering procedures
(OrthoMCL, COGs, and BDBH). The same program produces phylogenetic trees of
the pangenome based on loss and gain of genes, as well as core phylogenies. Graphic
representations of the pangenome components and phylogenetic trees can be
obtained given the appropriate command lines.
5.9
Concluding Remarks
Along with the ease to obtain genome sequences, bioinformatics resources have
also grown exponentially. A summary or resources and methods cited in this chapter
are provided in the Fig. 5.2. Critical bottlenecks remains in the bioinformatic analysis concerning to search for significant biological meaning to that plethora of data.
Experimental biologist needs friendly programs and computer interfaces to interact
with most of the data generated by genomic procedures. Learning basic programing
languages (PERL, PHYTON, R) could contribute to integrate the better of two
worlds: genomic big data and experimental findings.
93
Azospirillum lipoferum 4B
References
Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS et al (2012) SPAdes: a
new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol
19:455477
Benson DA, Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW (2014) GenBank.
Nucleic Acids Res 42:D32D37
Borodovsky M, Lomsadze A (2014) Gene identification in prokaryotic genomes, phages, metagenomes, and EST sequences with GeneMarkS suite. Curr Protoc Microbiol 32:Unit 1E 7
Bose M, Barber RD (2006) Prophage Finder: a prophage loci prediction tool for prokaryotic
genome sequences. In Silico Biol 6:223227
Butler J, MacCallum I, Kleber M, Shlyakhter IA, Belmonte MK, Lander ES et al (2008)
ALLPATHS: de novo assembly of whole-genome shotgun microreads. Genome Res
18:810820
Carver T, Harris SR, Berriman M, Parkhill J, McQuillan JA (2012) Artemis: an integrated platform
for visualization and analysis of high-throughput sequence-based experimental data.
Bioinformatics 28:464469
94
V. Gonzlez et al.
Chaudhuri RR, Loman NJ, Snyder LA, Bailey CM, Stekel DJ, Pallen MJ (2008) xBASE2: a comprehensive resource for comparative bacterial genomics. Nucleic Acids Res 36:D543D546
Chen F, Mackey AJ, Stoeckert CJ Jr, Roos DS (2006) OrthoMCL-DB: querying a comprehensive
multi-species collection of ortholog groups. Nucleic Acids Res 34:D363D368
Chen IM, Markowitz VM, Chu K, Anderson I, Mavromatis K, Kyrpides NC et al (2013) Improving
microbial genome annotations in an integrated database context. PLoS One 8:e54859
Contreras-Moreira B, Vinuesa P (2013) GET_HOMOLOGUES, a versatile software package for
scalable and robust microbial pangenome analysis. Appl Environ Microbiol 79:76967701
Darling AC, Mau B, Blattner FR, Perna NT (2004) Mauve: multiple alignment of conserved
genomic sequence with rearrangements. Genome Res 14:13941403
Datta RS, Meacham C, Samad B, Neyer C, Sjolander K (2009) Berkeley PHOG: PhyloFacts
orthology group prediction web server. Nucleic Acids Res 37:W84W89
Delcher AL, Harmon D, Kasif S, White O, Salzberg SL (1999) Improved microbial gene identification with GLIMMER. Nucleic Acids Res 27:46364641
Didelot X, Falush D (2007) Inference of bacterial microevolution using multilocus sequence data.
Genetics 175:12511266
Didelot X, Darling A, Falush D (2009) Inferring genomic flux in bacteria. Genome Res 19:
306317
Didelot X, Lawson D, Darling A, Falush D (2010) Inference of homologous recombination in
bacteria using whole-genome sequences. Genetics 186:14351449
Dimmer EC, Huntley RP, Alam-Faruque Y, Sawford T, ODonovan C, Martin MJ et al (2012) The
UniProt-GO Annotation database in 2011. Nucleic Acids Res 40:D565D570
Dufayard JF, Duret L, Penel S, Gouy M, Rechenmann F, Perriere G (2005) Tree pattern matching
in phylogenetic trees: automatic search for orthologs or paralogs in homologous gene sequence
databases. Bioinformatics 21:25962603
Eid J, Fehr A, Gray J, Luong K, Lyle J, Otto G et al (2009) Real-time DNA sequencing from single
polymerase molecules. Science 323:133138
Fonseca NA, Rung J, Brazma A, Marioni JC (2012) Tools for mapping high-throughput sequencing data. Bioinformatics 28:31693177
Fouts DE (2006) Phage_Finder: automated identification and classification of prophage regions in
complete bacterial genome sequences. Nucleic Acids Res 34:58395851
Franceschini A, Szklarczyk D, Frankild S, Kuhn M, Simonovic M, Roth A et al (2013) STRING
v9.1: protein-protein interaction networks, with increased coverage and integration. Nucleic
Acids Res 41:D808D815
Frazer KA, Pachter L, Poliakov A, Rubin EM, Dubchak I (2004) VISTA: computational tools for
comparative genomics. Nucleic Acids Res 32:W273W279
Gordon D, Green P (2013) Consed: a graphical editor for next-generation sequencing.
Bioinformatics 29:29362937
Held K, Ramage E, Jacobs M, Gallagher L, Manoil C (2012) Sequence-verified two-allele transposon mutant library for Pseudomonas aeruginosa PAO1. J Bacteriol 194:63876389
Huerta-Cepas J, Bueno A, Dopazo J, Gabaldon T (2008) PhylomeDB: a database for genome-wide
collections of gene phylogenies. Nucleic Acids Res 36:D491D496
Hunter S, Jones P, Mitchell A, Apweiler R, Attwood TK, Bateman A et al (2012) InterPro in 2011:
new developments in the family and domain prediction database. Nucleic Acids Res 40:
D306D312
Hyatt D, Chen GL, Locascio PF, Land ML, Larimer FW, Hauser LJ (2010) Prodigal: prokaryotic
gene recognition and translation initiation site identification. BMC Bioinformatics 11:19
Jeck WR, Reinhardt JA, Baltrus DA, Hickenbotham MT, Magrini V, Mardis ER et al (2007)
Extending assembly of short DNA sequences to handle error. Bioinformatics 23:29422944
Jones P, Binns D, Chang HY, Fraser M, Li W, McAnulla C et al (2014) InterProScan 5: genomescale protein function classification. Bioinformatics 30:12361240
Kanehisa M, Goto S, Sato Y, Furumichi M, Tanabe M (2012) KEGG for integration and interpretation
of large-scale molecular data sets. Nucleic Acids Res 40:D109D114
95
96
V. Gonzlez et al.
Miller JR, Koren S, Sutton G (2010) Assembly algorithms for next-generation sequencing data.
Genomics 95:315327
Moriya Y, Itoh M, Okuda S, Yoshizawa AC, Kanehisa M (2007) KAAS: an automatic genome
annotation and pathway reconstruction server. Nucleic Acids Res 35:W182W185
Nielsen CB, Cantor M, Dubchak I, Gordon D, Wang T (2010) Visualizing genomes: techniques
and challenges. Nat Methods 7:S5S15
Ostlund G, Schmitt T, Forslund K, Kostler T, Messina DN, Roopra S et al (2010) InParanoid 7: new
algorithms and tools for eukaryotic orthology analysis. Nucleic Acids Res 38: D196D203
Overbeek R, Olson R, Pusch GD, Olsen GJ, Davis JJ, Disz T et al (2014) The SEED and the Rapid
Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res
42:D206D214
Pop M, Kosack D (2004) Using the TIGR assembler in shotgun sequencing projects. Methods Mol
Biol 255:279294
Powell S, Forslund K, Szklarczyk D, Trachana K, Roth A, Huerta-Cepas J et al (2014) eggNOG
v4.0: nested orthology inference across 3686 organisms. Nucleic Acids Res 42:D231D239
Pruitt KD, Tatusova T, Brown GR, Maglott DR (2012) NCBI Reference Sequences (RefSeq): current status, new features and genome annotation policy. Nucleic Acids Res 40:D130D135
Ren X, Liu T, Dong J, Sun L, Yang J, Zhu Y et al (2012) Evaluating de Bruijn graph assemblers on
454 transcriptomic data. PLoS One 7:e51188
Ribeiro FJ, Przybylski D, Yin S, Sharpe T, Gnerre S, Abouelleil A et al (2012) Finished bacterial
genomes from shotgun sequence data. Genome Res 22:22702277
Rivera D, Revale S, Molina R, Gualpa J, Puente M, Maroniche G et al (2014) Complete genome
sequence of the model rhizosphere strain Azospirillum brasilense Az39, successfully applied
in agriculture. Genome Announc 2(4), pii: e00683-14
Royce L, Boggess E, Jin T, Dickerson J, Jarboe L (2013) Identification of mutations in evolved
bacterial genomes. Methods Mol Biol 985:249267
Santamaria RI, Bustos P, Sepulveda-Robles O, Lozano L, Rodriguez C, Fernandez JL et al (2014)
Narrow-host-range bacteriophages that infect Rhizobium etli associate with distinct genomic
types. Appl Environ Microbiol 80:446454
Schneider GF, Dekker C (2012) DNA sequencing with nanopores. Nat Biotechnol 30:326328
Siguier P, Perochon J, Lestrade L, Mahillon J, Chandler M (2006) ISfinder: the reference centre for
bacterial insertion sequences. Nucleic Acids Res 34:D32D36
Simpson JT, Wong K, Jackman SD, Schein JE, Jones SJ, Birol I (2009) ABySS: a parallel assembler for short read sequence data. Genome Res 19:11171123
Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV et al (2003) The COG
database: an updated version includes eukaryotes. BMC Bioinformatics 4:41
UniPort Consortium (2014) Activities at the Universal Protein Resource (UniProt). Nucleic Acids
Res 42:D191D198
Vacheron J, Desbrosses G, Bouffaud ML, Touraine B, Moenne-Loccoz Y, Muller D et al (2013)
Plant growth-promoting rhizobacteria and root system functioning. Front Plant Sci 4:356
Vallenet D, Belda E, Calteau A, Cruveiller S, Engelen S, Lajus A et al (2013) MicroScopean
integrated microbial resource for the curation and comparative analysis of genomic and metabolic data. Nucleic Acids Res 41:D636D647
Vilella AJ, Severin J, Ureta-Vidal A, Heng L, Durbin R, Birney E (2009) EnsemblCompara
GeneTrees: Complete, duplication-aware phylogenetic trees in vertebrates. Genome Res
19(2):32735
Wagner A, Lewis C, Bichsel M (2007) A survey of bacterial insertion sequences using IScan.
Nucleic Acids Res 35:52845293
Waterhouse RM, Tegenfeldt F, Li J, Zdobnov EM, Kriventseva EV (2013) OrthoDB: a hierarchical
catalog of animal, fungal and bacterial orthologs. Nucleic Acids Res 41:D358D365
Wisniewski-Dye F, Borziak K, Khalsa-Moyers G, Alexandre G, Sukharnikov LO, Wuichet K et al
(2011) Azospirillum genomes reveal transition of bacteria from aquatic to terrestrial environments. PLoS Genet 7:e1002430
97
Part II
Chapter 6
Chemotaxis in Azospirillum
Gladys Alexandre
6.1
Microorganisms have evolved a plethora of strategies to adapt to spatial and temporal changes in the environment. Some of these strategies involve changes in patterns
of gene expression, and thus the implementation of long-term adaptive responses.
In addition, many bacteria are able to rapidly and transiently respond to changes in
the environment. In motile bacteria, these transient adaptive responses include the
ability to navigate toward more favorable conditions or away from deleterious ones.
This behavior is referred to as chemotaxis when motile bacteria respond to gradients
of chemical effectors, aerotaxis when they respond to gradients of oxygen,
G. Alexandre (*)
Department of Biochemistry, Cellular and Molecular Biology,
The University of Tennessee, Knoxville, TN 37996, USA
e-mail: [email protected]
Springer International Publishing Switzerland 2015
F.D. Cassn et al. (eds.), Handbook for Azospirillum,
DOI 10.1007/978-3-319-06542-7_6
101
102
G. Alexandre
phototaxis when they respond to gradients of light, pH taxis when they respond to
gradients of pH, etc. (Wadhams and Armitage 2004). Because of their small sizes,
bacteria experience low Reynolds number environments, where inertia is negligible
and where viscosity is a major force that constrains movement of particles and
bacterial cells. As a result, motile bacteria use an undulatory behavior via helical
flagella that rotate as propellers to move the cell forward or backward. Furthermore,
bacteria behave as particles in a solution and they are subjected to physical forces,
such as Brownian motion, that do not impact the behavior of larger organisms
(Berg 1993). Brownian motion is essential to randomly reorient swimming bacteria
in new directions, and this physical force is particularly significant for the reorientation of singly polarly flagellated bacteria (Mitchell 2002), such as bacteria of the
genus Azospirillum. Furthermore, because of their small size, motile bacteria do not
detect gradients spatially. Instead, they use temporal sensing in which current conditions are compared with the ones encountered a few milliseconds before. In the
absence of a gradient, motile bacteria move about randomly and thus not in any
particular direction. When moving up a gradient of an attractant, motile bacteria
suppress the changes in swimming direction in the direction of the attractant and
swim longer toward the attractant. As a result, their net movement is up the attractant gradient. Conversely, in a gradient of a repellent, bacteria tend to change
swimming directions more frequently in the direction of the repellent but less when
moving away from it. This behavior allows them to run longer away from the repellent (Sourjik and Wingreen 2012).
The molecular mechanism of bacterial chemotaxis has been studied in great
detail in the model organism Escherichia coli, a peritrichously flagellated bacterium
(Wadhams and Armitage 2004; Sourjik and Wingreen 2012). The E. coli proteins
that comprise the chemotaxis signal transduction pathway are encoded within a
single operon, with additional chemotaxis receptors located elsewhere on the
genome. Environmental signals are detected by chemotaxis receptors (chemoreceptors or the so-called methyl accepting chemotaxis proteins or MCP) that are arranged
in large arrays of allosterically coupled proteins located at the cell poles (Hazelbauer
et al. 2008). E. coli possesses five different chemotaxis receptors: Tar, Tsr, Trg, Tap,
and Aer. Trimers of receptor dimers are bound on their cytoplasmic side by a ring of
CheA-CheW proteins (Briegel et al. 2012). CheA is the dedicated histidine kinase,
while CheW is a docking protein that anchors CheA and the chemoreceptors within
the array. Reception of a signal triggers a conformational change in chemoreceptors, thought of as a piston-like movement, that in turn modulates the activity of the
CheA histidine kinase. Upon receiving a repellent signal, CheA becomes phosphorylated on a conserved histidine residue. Phospho-CheA then phosphorylates two
response regulators: CheY and CheB. Phospho-CheY, but not unphosphorylated
CheY, is able to bind to the flagellar motors with high affinity to trigger a change in
the swimming direction. CheB is a methylesterase, which demethylates conserved
residues in the cytoplasmic domains of receptors and counteracts the methylation of
these residues by a constitutively expressed CheR methyltransferase. Changes in
the methylation status of receptors reset them in a sensing mode. Because methylation
and demethylation are catalytically slower than phosphorylation, CheB and CheR
Chemotaxis in Azospirillum
103
6.2
Bacteria of the genus Azospirillum are motile by means of a single polar flagellum
in liquid media (swimming) and several lateral flagella when moving across
surfaces (swarming). The polar and lateral flagella are not only functionally different, but they also comprise a distinct set of structural proteins (Moens et al. 1995,
1996). While chemotaxis has been described to regulate polar flagellum mediated
motility, i.e., swimming, in liquid environments, experimental evidence for chemotaxis regulating swarming motility has yet to be obtained.
Taxis behaviors have long been suggested to contribute to the ability of
Azospirillum spp. to colonize the roots of plants, and experimental evidence in
support of this assumption has been obtained (Reinhold et al. 1985; Bashan and
Holguin 1994; Vande Broek et al. 1998; Greer-Phillips et al. 2004). Motility and
chemotaxis have been best described in A. brasilense strain Sp7, which is thus the
model for understanding taxis behaviors in this bacterial genus.
6.2.1
Chemotaxis
104
G. Alexandre
6.2.2
Aerotaxis
Chemotaxis in Azospirillum
105
6.2.3
In the absence of oxygen, Azospirillum spp. are able to use alternative terminal
electron acceptors, including nitrate, nitrite, and DMSO, for respiration. It is thus
not surprising that chemotaxis in gradients of alternative electron acceptors has also
been described in A. brasilense (Alexandre et al. 2000). These taxis responses are
much weaker than the aerotaxis response. Consistent with the bacteria sensing
nitrate, nitrite, or DMSO as terminal electron acceptors and not to fulfill other nutritional needs, taxis responses toward these compounds is only observed under
anaerobic conditions and they are abolished when cells are incubated with oxygen.
The taxis response is also not observed if cells are not provided with an electron
donor in a form of a carbon substrate for growth.
6.2.4
Redox Taxis
Redox taxis is a motility behavior first described in E. coli (Bespalov et al. 1996)
and it corresponds to the ability of bacteria to navigate gradients of redox active
compounds. During redox taxis, bacteria monitor changes in redox, instead of
change in the concentration of a specific compound. Redox taxis is determined by
using substituted quinones, which are small lipophilic compounds able to diffuse
through the membrane. Redox taxis can be convincingly established by analyzing
the taxis responses of cells in gradients of quinones with different redox potentials
(Bespalov et al. 1996; Alexandre et al. 2000). In order to be redox active, the quinones are maintained in an oxidized state using potassium ferricyanide. Redox taxis
is best established using oxidized quinones which have redox potential values
within the range of redox potentials that permit electron transfer in the electron
transport chain. One such example is 1,4-benzoquinone (Bespalov et al. 1996).
Quinones differ in chemical structure as well as redox potential; the lower the redox
106
G. Alexandre
potential of the quinone tested, the greater the affinity of the oxidized quinone for
electrons, and thus the more likely it is this oxidized quinone will effectively
compete for electrons. A. brasilense motile cells demonstrate a repellent response
to oxidized quinones: the repellent response increases with the decreasing redox
potential of the quinone tested (Alexandre et al. 2000). Redox taxis can be inferred
when the repellent response displayed by motile Azospirillum cells correlates with
the redox potential, rather than the chemical structure of the quinones tested.
6.2.5
Most but not all chemotaxis and other taxis responses in A. brasilense require a
functional electron transport system, and these responses are enhanced when cells
are starved (Alexandre et al. 2000). Further, the strength of the taxis response
correlates with the extent to which chemoeffectors affect the integrity and efficiency of the electron transport system. Electron donors and electron acceptors are
excellent attractants for A. brasilense while chemicals that block electron transport
within the electron respiratory chain, such as quinones or myxothiazol trigger
repellent responses. Taxis responses toward particular chemicals are also abolished
if structural analogs of these chemicals, that cannot be metabolized, are used. Most
taxis responses of motile A. brasilense cells appear to originate within the electron
transport system, an observation that has led to the proposition that energy taxis
dominates motile behavioral responses in this species (Alexandre et al. 2000).
Energy taxis refers to the ability of motile cells to navigate in gradients of physicochemical parameters that affect the energy-generating cellular processes such as the
electron transport chain (Alexandre 2010). Dedicated chemotaxis receptors proposed (Tlp1; (Greer-Phillips et al. 2004)) or demonstrated (AerC; (Xie et al. 2010))
to sense redox-related parameters have indeed been characterized in A. brasilense
Sp7. While most taxis responses are related to energy taxis in A. brasilense,
metabolism-independent taxis also functions in this species as suggested by the role
of the periplasmic binding protein SbpA in chemotaxis toward galactose (Van
Bastelaere et al. 1999)
6.3
Several quantitative and qualitative assays to monitor all forms of taxis responses
have been developed and optimized in A. brasilense and can be used in any of the
Azospirillum spp. (Fig. 6.1).
Chemotaxis in Azospirillum
107
Fig. 6.1 Spatial and temporal gradient assays used to analyze taxis responses in Azospirillum spp.
(a) Soft-agar plate assay; (b) mini-plug assay; (c) spatial gradient assay for aerotaxis; (d) temporal
gradient assay. Top: example of a still image of a video captured to analyze by computational
motion analysis. Bottom: example of tracks of individual cells detected by a computerized motion
analysis system. See text for details
Regardless of the taxis response measured, using cell populations where at least
90 % of cells are motile and preferably grown in minimal medium to low density, is
preferred to ensure homogenous results and avoid the potential interfering effect of
the accumulation of intracellular granules of polyhydroxybutyrate (Alexandre et al.
2000). In addition, some taxis responses are inducible in A. brasilense. When testing taxis to compounds for which no previous experimental record exists, it is best
to measure the taxis responses toward this compound in parallel assays that use cells
induced with the compound to be tested as well as without the compound to be
tested to ensure an accurate interpretation of the results.
Assays suitable for measuring taxis responses in Azospirillum spp. include spatial gradient assays (soft-agar plate, chemical-in-plug, aerotaxis assays) and temporal gradient assays. In spatial gradient assays, cells metabolism interferes with the
responses observed and thus, controls must be included to insure that taxis responses
per se are measured. The most sensitive chemotaxis assays for Azospirillum, i.e.,
those able to detect the weakest behavioral responses are the temporal gradient
assays while the least sensitive is the soft agar plate assay. Regardless of whether a
spatial or temporal gradient assay is used, taxis responses are dose dependent and
108
G. Alexandre
6.3.1
The soft agar plate assay is carried out in media solidified with a low concentration
of agar to allow cells swimming. This assay is often erroneously called a swarm
plate assay. Swarming is a form of motility across a surface and it requires different flagella and cell surface characteristics. The soft agar plate assay measures the
ability of motile cells to swim down attractant gradients created via cellular metabolism. In this assay, cells from an overnight culture or a colony are inoculated in the
center of a soft agar plate containing 0.3 % agar and a single carbon and nitrogen
source that the cells can use for growth (Fig. 6.1, panel A). For this assay to be
successful, the soft agar medium prepared with 0.3 % agar (w/v) must be boiled
before autoclaving or pouring the plates to ensure uniform distribution and consistent results. Due to the sensitivity of Azospirillum spp. to oxygen gradients, it is
also recommended that separate plates contain equivalent volumes of medium
(e.g., 25 mL molten medium/plate).
Cells growing at the point of inoculation deplete the local environment of carbon
and nitrogen sources. If these cells are motile and able to navigate chemical gradients (i.e., able of chemo-taxis responses), they will move away from this inoculation
zone toward higher concentrations of nutrients and thus will spread outward. The
presence of a chemotaxis ring, seen as a dense zone of cells with the cell density
dropping before and after this zone, is indicative of chemotaxis or taxis to alternative electron acceptors, when performed under anaerobic conditions.
A variation of this assay consists of inoculating the cells in a soft agar plate made
with a minimum buffer, and providing chemoeffectors spots, distant to the inoculation point. The gradient of the chemoeffector tested will be established by diffusion, and the cells will preferentially move in the direction of the chemoeffector if
it functions as an attractant. This latter assay has been used to demonstrate chemotaxis of Azospirillum toward the root exudates of various plants (Okon et al. 1980).
6.3.2
Chemical-in-Plug Assay
The chemical-in-plug assay is a spatial gradient assay that was first developed by
Tso and Adler to detect chemotaxis responses toward repellents (Adler and Tso
1974). In Azospirillum spp., this assay can be used to measure chemotaxis, and it is
also particularly well suited to analyze taxis responses to alternative electron
Chemotaxis in Azospirillum
109
Fig. 6.2 Mini-plug assay used to detect repellent responses (a) and attractant responses (b). The
observations were photographed after 1 h incubation at 28 C. (a) Plugs contain the following
described in clockwise direction from the mark on the plate: 1,4-benzoquinone (10 mM) and
ferricyanide (2 mM), 1,4-benzoquinone (1 mM) and ferricyanide (2 mM), 1,4-benzoquinone
(0.1 mM) and ferricyanide (2 mM), ferricyanide (2 mM) alone, acetate (10 mM), chemotaxis
buffer. Note the clearing zone around the plugs in the repellents (1,4 benzoquinone and acetate).
The size of the clearing zone depends on the concentration of the effector tested as seen with
1,4-benzoquinone. (b) Plugs contain the following described in clockwise direction from the mark
on the plate: Malate (10 mM), Fructose (10 mM), Galactose (10 mM), Aspartate (10 mM), Proline
(10 mM); Isoleucine (10 mM). Note the accumulation of cells around the plugs. The zone of
accumulation is faint around Aspartate and Proline, and there is no accumulation around Isoleucine
or Galactose. Cells were not induced with galactose prior to this assay
acceptors and to assess redox taxis (Figs. 6.1, panel B and 6.2). In this assay, the
gradient of the chemoeffector to be tested is established spatially by diffusion from
a plug of agar solidified with 2 % agar (w/v) placed into a soft agar (0.3 % agar)
medium that also contains motile cells. The cells will form a ring around the plug if
they respond tactically to it (Fig. 6.2). In the case of a repellent response, the ring
will form around the plug but a clearing zone will be seen between the plug and the
ring of cells. Confirmation of a taxis response and exclusion of growth as being
responsible for the formation of the ring can include performing the assay in the
presence of chloramphenicol or tetracycline to inhibit growth and by omitting
essential nutrients (e.g., a carbon source) to prevent growth. The latter conditions
may be achieved by using plugs and soft agar plates prepared in chemotaxis buffer
(10 mM phosphate, 0.1 mM EDTA). Typically, a very dense cell suspension is
mixed with an equal volume of 0.6 % agar in chemotaxis buffer to yield a soft agar
at a final concentration of 0.3 %. Plugs of 2 % agar also prepared in chemotaxis
buffer are cut out using large pipette tips as tools and placed in the still molten soft
agar medium. Results are usually obtained between 1 and 4 h post-inoculation.
A key parameter to consider in this assay is to use a dense suspension of motile cells
which may be prepared from cultures grown to low density and concentrated
110
G. Alexandre
6.3.3
Mini-Plug Assay
A variation on the chemical-in-plug assay for use with a light microscope is the
mini-plug assay. In this version of the assay, a small plug of 1.5 % low melting point
agarose in chemotaxis buffer containing the chemical to be tested as a chemoeffector
is placed in a microchamber. The microchamber is constructed using silicon grease
to delineate a small volume the size of the coverslip to be used. A 100 L aliquot of
motile cell suspension, washed prior to being placed in chemotaxis buffer, is introduced into the microchamber and covered with a coverslip. A control plug containing only chemotaxis buffer must also be prepared. The formation of a chemotactic
band away from (repellent effect) or near (attractant effect) the plug can be observed
in real time. Chemoeffectors are tested in a wide concentration range, typically from
1 M to 1 mM. Compared to the chemical-in-plug assay, the mini-plug yields results
within a few minutes and there is no possible confounding effect of growth.
6.3.4
Aerotaxis Assay
Aerotaxis in Azospirillum can be analyzed using a spatial gradient assay where the
oxygen gradient is established by diffusion of from air inside a suspension of highly
motile cells. This assay is performed in optically flat microcapillaries (e.g., inner
dimensions, 0.1 by 2 by 50 mm; Vitro Dynamics Inc., Rockaway, N.J.) and a light
microscope. The microcapillaries are filled by capillarity by dipping them into a
suspension of motile cells prepared by gentle washes and centrifugation at low
speed and resuspension into fresh medium containing a carbon source and possibly,
a nitrogen source. The formation of the aerotactic band is exclusively observed at
the end of the microcapillary that was dipped into the cell suspension and not at the
opposite end since conditions there are not controlled and consistent. Under these
conditions, microscopic observations indicate that motile cells move from locations
within the microcapillaries of higher and lower concentrations of oxygen toward a
zone of preferred low oxygen concentration, forming an aerotactic band (Fig. 6.3).
This aerotactic band forms within 2 min and remains stable over at least 30 min. The
area or distance between the aerotactic band and the air-liquid meniscus can be
measured for a semiquantitative use of this technique. However, the exact location
of the aerotactic band with respect to the meniscus depends on cell motility, cell
density, carbon source used as a substrate under these conditions, the respiration
rate, and the stage of growth. Experimental conditions must therefore be calibrated
to ensure reproducibility.
Chemotaxis in Azospirillum
111
Fig. 6.3 Temporal gradient assay for aerotaxis in Azospirillum spp. using an optically flat capillary tube. This is a typical image taken 2 min after the capillary tube was filled with the cell
suspension
6.3.5
The temporal gradient assay is the most direct assay to measure taxis responses in
Azospirillum or any other motile bacterium because the ability of cells to temporally
adjust their swimming motility bias (number of changes in swimming direction or
reversals per unit of time) upon stimulation with an effector is measured (Fig. 6.1;
panel D). Both attractant (transient suppression of reversals) and repellent (transient
increase in the number of swimming reversals) responses can be measured.
Furthermore, the response time (the time it takes for 50 % of the cell population to
respond to the stimulus imposed) and adaptation time (the time it takes for the population to return to the pre-stimulus swimming bias) can also be measured using this
method. Adaptation is the hallmark of bacterial taxis behaviors, and it cannot be
measured in any of the other assay. In the temporal gradient assay, the chemoeffector
(oxygen, air, or any chemicals) to be tested is directly added to a suspension of
motile cells. Changes in the motility bias upon addition of the effector is recorded in
real time and analyzed using a computerized motion analysis system (e.g., CellTrack,
Hobson Tracker) to determine the reversal frequency or average number of changes
in swimming direction per unit of time (Fig. 6.1; panel D). Video recording of the
entire assay is required. A 9-L drop of a diluted bacterial suspension (~107 cells/ml
to facilitate tracking and downstream computerized motion analysis) in chemotaxis
buffer is first placed on a microscope slide and equilibrated for at least 5 min. Next,
the chemical compound to be tested (1 L) is added to the suspension and video
recording must be allowed for at least 5 min post-stimulation. Temporal assays can
be performed under fully aerated conditions or under anaerobic conditions in a
112
G. Alexandre
microchamber (Zhulin et al. 1996; Alexandre et al. 2000), which allows the response
in a temporal gradient of alternative electron acceptors or oxygen to be measured.
6.4
In contrast to the model organism E. coli which possesses a single chemotaxis pathway encoded within a single operon and only five different chemotaxis receptors,
the genomes of Azospirillum species sequenced thus far indicate the presence of
several chemotaxis signal transduction pathways encoded in operons and a very
large number of receptors (Kaneko et al. 2010; SantAnna et al. 2011; WisniewskiDye et al. 2011, 2012).
The genome of A. amazonense Y2 encodes three chemotaxis pathways and 40
chemotaxis receptors, that of A. brasilense Sp245 encodes four chemotaxis pathways and 51 chemotaxis receptors, that of A. lipoferum 4B encodes five chemotaxis
pathways and 63 chemotaxis receptors and the genome of Azospirillum sp. B510
codes for six chemotaxis pathways and 89 chemotaxis receptors. While most soil
bacteria possess a large number of chemotaxis receptors, the average number is
around 2530. Bacteria of the genus Azospirillum have thus an extremely large
repertoire of chemotaxis receptors, which further complicates the identification of
their sensory abilities. Indeed, the sensory specificity of most chemotaxis receptors
is not known (Krell et al. 2011). This complexity also suggests that chemotaxis
signal transduction provides Azospirillum with a competitive advantage in the soil
and the rhizosphere. Such a large repertoire of putative chemotaxis receptors suggests that Azospirillum spp. can monitor diverse environmental cues. This ability is
likely contributing to explaining their ubiquitous distribution. However, the exact
advantage that possessing multiple pathways provides cells with is not yet clear.
Of the multiple chemotaxis pathways encoded within the Azospirillum spp.
genomes, most are predicted to control flagellar-based motility and thus probably
direct swimming and/or swarming. One of the chemotaxis operons found in all
Azospirillum spp. is not predicted to control flagellar motility but rather another cellular function (belonging to a larger group of ACF (Alternative Cellular Function)like pathways) (Wuichet and Zhulin 2010). In A. brasilense Sp7, chemo- and
aerotaxis are characterized by a transient change in swimming speed as well as a
transient change in the swimming motility bias. Each of these behaviors is controlled
by at least two different chemotaxis pathways (Stephens et al. 2006; Bible et al.
2008, 2012); one pathway controls transient changes in swimming speed during
chemo- and aerotaxis (named Che1 (Bible et al. 2012)) and a second one (or perhaps more?), not yet identified, is implicated in controlling transient changes in
swimming directions (Russell et al. 2013). In addition, signaling cross talk between
Che1 and another chemotaxis pathway has been identified but is yet to be characterized at the molecular level (Stephens et al. 2006).
Chemotaxis in Azospirillum
6.5
113
Several genome sequences and a suite of quantitative and qualitative assays are
available to study taxis behaviors in Azospirillum spp. The extended tool kit to
assess taxis responses in this species provides an opportunity to use Azospirillum
chemotaxis signal transduction as a model system for understanding how sensing
and signaling are coordinated and integrated by multiple chemotaxis pathways.
The complexity of chemotaxis signal transduction and the large number of chemotaxis receptors challenges the notion that chemotaxis could be manipulated to
enhance the ability of bacteria to colonize the roots of plants and thus benefit plant
health. However, deciphering the role of taxis responses in maintenance of
Azospirillum spp. in the rhizosphere as well as the soil and in competing with other
organisms could suggest avenues in which chemotaxis could be used in agricultural
applications.
References
Adler J, Tso WW (1974) Decision-making in bacteria: chemotactic response of Escherichia coli
to conflicting stimuli. Science 184:12921294
Alexandre G (2010) Coupling metabolism and chemotaxis-dependent behaviours by energy taxis
receptors. Microbiology 156:22832293
Alexandre G, Greer SE, Zhulin IB (2000) Energy taxis is the dominant behavior in Azospirillum
brasilense. J Bacteriol 182:60426048
Barak R, Nur I, Okon Y, Henis Y (1982) Aerotactic response of Azospirillum brasilense. J Bacteriol
152:643649
Bashan Y, Holguin G (1994) Root-to-root travel of the beneficial bacterium Azospirillum brasilense. Appl Environ Microbiol 60:21202131
Berg HC (1993) Random walks in biology. Princeton University Press, Princeton
Bespalov VA, Zhulin IB, Taylor BL (1996) Behavioral responses of Escherichia coli to changes in
redox potential. Proc Natl Acad Sci U S A 93:1008410089
Bible AN, Stephens BB, Ortega DR, Xie Z, Alexandre G (2008) Function of a chemotaxis-like
signal transduction pathway in modulating motility, cell clumping, and cell length in the alphaproteobacterium Azospirillum brasilense. J Bacteriol 190:63656375
Bible A, Russell MH, Alexandre G (2012) The Azospirillum brasilense Che1 chemotaxis pathway
controls swimming velocity, which affects transient cell-to-cell clumping. J Bacteriol
194:33433355
Briegel A, Ortega DR, Tocheva EI, Wuichet K, Li Z, Chen S, Muller A, Iancu CV, Murphy GE,
Dobro MJ, Zhulin IB, Jensen GJ (2009) Universal architecture of bacterial chemoreceptor
arrays. Proc Natl Acad Sci U S A 106:1718117186
Briegel A, Li X, Bilwes AM, Hughes KT, Jensen GJ, Crane BR (2012) Bacterial chemoreceptor
arrays are hexagonally packed trimers of receptor dimers networked by rings of kinase and
coupling proteins. Proc Natl Acad Sci U S A 109:37663771
Greer-Phillips SE, Stephens BB, Alexandre G (2004) An energy taxis transducer promotes root
colonization by Azospirillum brasilense. J Bacteriol 186:65956604
Hazelbauer GL, Falke JJ, Parkinson JS (2008) Bacterial chemoreceptors: high-performance signaling in networked arrays. Trends Biochem Sci 33:919
114
G. Alexandre
Chapter 7
Abstract One of the first mechanisms proposed to explain the plant growth promotion due to bacterial inoculation has been the nitrogen biological fixation; however,
this mechanism has been of less agronomic significance than was initially expected.
In counterpart, other mechanisms have been proposed to explain these inoculation
effects, such as production of phytohormones and other plant growth regulators.
Nowadays, we know that benefic effect of inoculation with rhizobacteria can be correlated with production and metabolism of chemically defined compounds such as
auxins, cytokinins, gibberellins, and other plant growth regulators, such as abscisic
acid and nitric oxide. In this chapter, we highlight the analytical and biological methods used to identify and quantify the most relevant phytohormones and plant growth
regulators produced by Azospirillum sp. and other benefic rhizobacteria.
7.1
Introduction
115
116
P. Castillo et al.
developmental events throughout the plant life cycle ranging from patterning, cell
identity, and differentiation as well as coordinated growth. Also, the hormones act
as regulators of plant responses to biotic or abiotic stress conditions (Feussner and
Wasternack 2002). The hormone activity is determined by its availability, which is
controlled at the level of metabolism and distribution, and by the efficiency of the
hormonal signal perception and transduction, which could be an impact in gene
expression or protein activity control. Furthermore, an additional level of complexity
in the regulation of developmental process took place when interactions occur
between hormones or between hormone producer organisms. Many genera of bacteria, including Azospirillum, Bacillus, Achromobacter, Acetobacter, Azotobacter,
Burkholderia, Herbaspirillum, Pseudomonas, Serratia, Xanthomonas, Klebsiella,
Agrobacterium Enterococcus, and Enterobacter (Tsavkelova et al. 2006), are
producers of diverse phytohormones as auxins, CKs, GAs, ABA, and JA among
others (Ping and Boland 2004). The aim of this chapter is to present the current
knowledge on phytohormone metabolism and production as well as different extraction, purification, and quantification protocols in bacteria, particularly those belonging to genus Azospirillum.
7.1.1
Auxins
Auxin is the generic name that represents a group of chemical compounds characterized by their ability to induce cell elongation in the subapical region of the stem
and to reproduce the physiological effect of the most abundant, naturally occurring
auxin molecule, indole-3-acetic acid (IAA). These compounds have been associated
with different plant processes such as (a) gravitropism and phototropism, (b) vascular
tissue differentiation, (c) apical dominance, (d) lateral and adventitious root initiation,
(e) stimulation of cell division, and (f) stem and root elongation (Tale et al. 2006).
7.1.1.1
IAA is structurally related to the amino acid tryptophan (Trp), and the first studies
on auxin biosynthesis hundreds of species proposed this compound as the main
precursor in nature. However, this fact has proved difficult to demonstrate in plants.
Nevertheless four pathways have been postulated in plant convert Trp to IAA
including the indole-3-pyruvic acid (IPA), the tryptamine (TAM), and the indole3-acetonitrile (IAN) pathway, but there is an amino acid-independent pathway from
indole or indole-3-glycerol phosphate. In the case of bacteria, at least six metabolic
routes for IAA biosynthesis have been proposed and most of them use Trp as a precursor, as the IPA, TAM, IAN, indole acetamide (IAM), and Trp side-chain oxidase
(TSO) pathways. In addition, a tryptophan-independent pathway has been suggested. Despite this diversity of pathways to produce the active phytohormone, prokaryotic IAA biosynthesis seems to follow predominantly two major routes: the
117
IAM and the IPA (Lambrecht et al. 2000). Until now, at least four different pathways
have been proposed/described for Azospirillum sp. three Trp-dependent pathways
(via IPyA, IAM, and TAM) and one Trp-independent pathway (Cassn et al. 2014).
A. brasilense Sp245 is one of the most studied strains world-wide and is considered
as a type strain for this species, especially for its auxins biosynthesis. IAA production by A. brasilense Sp245 has extensively been studied with the IPA pathway, the
main route for IAA biosynthesis. All genes involved in this pathway are found in the
genome sequence of A. brasilense Sp245. Additionally, a nitrilase was also identified in the Sp245 genome sequence, which can catalyze the conversion of IAN
to IAA.
7.1.2
GAs, a large family of tetracyclic diterpenoid plant hormone, regulate many aspects
of both vegetative and reproductive growth in plants, including seed germination,
stem elongation, and leaf expansion; transitions from meristematic to shoot growth,
and from vegetative growth to flowering, promotion of fruit set and subsequent
growth, diseased resistance in rice and in response to different abiotic stress (Seo
et al. 2009; Yang et al. 2013; Colebrook et al. 2014). Currently, approximately >130
GAs have been identified in plants, fungi, and bacteria, but only a small number are
biologically active: GA1, GA3, GA4, and GA7. Many of the other GAs are biosynthetic intermediate or catabolites of bioactive GAs. They are biosynthesized from
geranylgeranyl diphosphate (GGDP), a common C-20 precursor for diterpenoids
and the plant biosynthesis can be divided into three steps according to the characteristics of the biosynthetic enzymes. In the first step, ent-kaurene, a tetracyclic hydrocarbon intermediate, is synthesized from GGDP by the ent-copalyl diphosphate
synthase (CPS) and ent-kaurene synthase (KS) in proplastid. In the second step,
ent-kaurene is converted to GA12 by two microsomal cytochrome P450 monooxygenase in the endoplasmic reticulum. The ent-kaurene oxidase (KO) catalyzes the
sequential oxidation on C-19 to produce ent-kaurenoic acid, which is subsequently
converted to GA12 by the ent kaurenoic acid oxidase (KAO). The reactions in the
final step involved the formation of C-20 and C-19 GAs in the cytoplasm. Thereby,
GA12 is converted to GA4 (13 non-hydroxylated pathway), through oxidations on
C-20 and C-3 by GA 20-oxidase (GA20ox) and GA 3-oxidase (GA3ox), respectively. GA12 is also a substrate for GA13ox for the production of GA53, which is a
precursor for GA1 in the 13 hydroxylated pathways. GA20ox catalyzes the sequential oxidation of C-20, including the loss of C-20 as CO2 and the formation of
-lactone and thereby, C19-GAs are produced. The bioactive GAs are formed by the
introduction of a 3-hydroxyl group in the inactive precursors. On the other hand,
GAs are metabolically deactivated in several diversity of mechanisms; being the
best-characterized deactivation reaction catalyzed by GA 2-oxidases (GA2ox)
(Yamaguchi 2008). Also, the GAs can be converted into conjugates by conjugation
with glucose through a hydroxyl group of GA to give a GA-O-glucosyl ether or via
118
P. Castillo et al.
the 6-carboxyl group to give a GA-glucosyl ester. Recently, two novel deactivation
mechanisms were identified: epoxidation of non-13-hydroxylated GAs in rice and
methylation of GAs in Arabidopsis.
7.1.2.1
Morrone et al. (2009) demonstrated that Bradyrhizobium japonicum encodes separate ent-copalyl diphosphate and ent-kaurene synthases. Thus, they provide the first
evidence that this operon might indeed be involved in GAs biosynthesis in bacteria.
Bottini et al. (1989) were the first to confirm the ability of Azospirillum sp. to produce GAs in chemically defined culture medium. They report the production of GA1
and GA3 on culture medium-free nitrogen of A. lipoferum Op33 by gas chromatographymass spectrometry (GC-MS). Similar results were reported in A. brasilense
by Janzen et al. (1992) and A. lipoferum AZm5 and A. brasilense VS9 by EsquivelCote et al. (2010). Additionally, it has been reported production of GA19 and GA9 in
chemically defined medium of A. lipoferum Op33, suggesting the existence of different routes of synthesis in those bacteria. The first pathways presumably include
the metabolism of GA19 (and its metabolite, GA20) to GA1. On the other hand, the
second path where GA9 is (presumably) precursor of GA3. These pathways were
confirmed in subsequent reports for A. lipoferum Op33 by using minimal medium
supplemented with deuterated precursors GA20 and GA9 and subsequent identification as GA1 and GA3 by GC-MS. On the other hand, A. lipoferum Op33 can produce
GA20 and GA5 which suggest the existence of a second 13-hydroxylation pathway
for the metabolism of GA20 to GA5 and GA3 3-hydroxylation; however, this route
has not been confirmed unequivocally. GAs production, metabolism, and hydrolysis
of conjugates by Azospirillum sp. were summarized by Bottini et al. (2004).
7.1.3
CKs play an important role at all phases of plant development from seed germination to senescence such as maintenance of stem cell systems in shoots and roots,
nodule organogenesis, leaf senescence, root vascular development, control of shoot
branching in interaction with auxin and in the response to abiotic and biotic stress
(Kouchi et al. 2010; OBrien and Benkov 2013). Structurally, CKs are adenine
derivatives substituted in the N6-position and they can be divided into two groups
based on their side chain: those with isoprene derived side chains, which are predominant in plants; and those with aromatic side chains that are found in plants at a
lower abundance. In higher plants, the predominant CKs are isopentenyladenine
(iP), trans-zeatin (tZ)-, cis-zeatin (cZ), or dihydrozeatin-type derivatives and they
can exist as free bases and also in the form of nucleosides and nucleotides. In the
past decade, CKs biosynthesis has greatly progressed due in large part to the identification of key pathway. A key enzyme in isoprenoid CKs biosynthesis in plants is
119
7.1.3.1
CKs can be produced by bacteria, and they are used mainly as chemical signal either
for communicating with the plant or as a tool for invading the plant host. In fact,
CKs are also synthesized by phytopathogenic bacteria, such as Agrobacterium
tumefaciens and Pseudomonas savastanoi, and is as a key factor in the formation of
plant tumors. Barea et al. (1976) found that at least 90 % of the bacteria isolated
from the rhizosphere of crops of agricultural interest were able to produce compounds type-CKs in defined culture medium. Horemans et al. (1986) modified the
analytical procedure and were able to demonstrate that A. brasilense produces isopentenyl adenine (iP), isopentenyl adenine riboside (iPR), and zeatin (Z) in chemically defined culture medium. The most significant references CKs production by
Azospirillum sp. was published by Strzelczyk et al. (1994), using a culture medium
supplemented with different sources of carbon. They reported the production of
isopentenyl adenine (iP), isopentenyl adenine riboside (iPR), trans-zeatin riboside
(trans-Z), and zeatin (Z) in three strains of Azospirillum sp. isolated from sporocarps of ectomycorrhizal fungi Rhizopogon vinicolor, Laccaria laccata y Hebeloma
crustuliniforme; however, they could just confirm iPR production in one of the three
strains by gas chromatography (GC). An interesting case of synergism has been
described for a mixed culture of A. brasilense and Arthrobacter giacomelloi showing a higher content of CKs, compared to those found in individual cultures of each
microorganism (Cacciari et al. 1989). Tien et al. (1979) using different types of
chromatography (HPLC and TLC) and a bioassay inoculation of pearl millet (Pearl
millet) were the first to demonstrate the ability of A. brasilense to produce molecules of type-CKs; however, the partially purified compounds were not characterized. They reported that inoculation caused significant changes in the morphology
of the root by increasing the number of lateral roots and root hairs density were
similar to those obtained by the exogenous application of CKs. Similar results were
found by Muralidhara and Rai (1986) in A. lipoferum.
120
7.1.4
P. Castillo et al.
121
7.1.4.1
JAs have not been extensively investigated in bacteria. The presence of JA was identified in culture medium of the bacterium E. coli RC424 and RC-7 strains (Abdala
et al. 1999). Also, JA was reported as produced by isolated endophytic bacteria from
roots of Prosopis strombulifera (Piccoli et al. 2011). Achromobacter xylosoxidans
(SF2) and Bacillus pumilus (SF3 and SF4) were selected as PGPR, among other
characteristics, by the production of JA and OPDA (Forchetti et al. 2007).
7.1.5
122
7.1.5.1
P. Castillo et al.
7.1.6
123
7.1.6.1
7.2
Methods
In the first part of the chapter, we offer several methods for the assessment (extraction and purification) of different hormones from bacterial cultures and plant tissues, with the aim that users can choose the most appropriate according to the
availability of equipments and chemical reagents in their laboratories. The following section of the chapter describes analytical and biological methods for phytohormones identification and quantification. In addition, an introduction to Mass
Spectrometry methodology is included as final remark.
124
7.2.1
P. Castillo et al.
The methods described here are: (a) Ion exchange chromatography, which employs
Mini-column Sephadex A-25; (b) Anion exchange chromatography including Minicolumn Amino (NH2); (c) Liquid-liquid partition which employs double partition
with ethyl ether; and (d) Direct use of the sample by centrifugation and filtering of
supernatants.
7.2.1.1
This methodology is described by Gidda et al. (2003) and Andrade et al. (2005). For
that, homogenize the lyophilized culture medium [approximately 0.2 g dry weight
(DW)] with 10 mL 100 % methanol and add 50 ng (5 L) of the corresponding
deuterated standard (JA, OPDA, JA-Ile, 11 and 12-OH-JA). Filter the homogenate
under vacuum through a column with a cellulose filter and collect the eluate and dry
at 40 C under vacuum in rotary evaporator. For the acetylation of endogenous
hydroxylated-JAs, add a 400 L of pyridine and acetic acid (2:1) and incubate overnight at 20 C. Dry the extract at 40 C under vacuum in rotary evaporator and
prepare each cartridge of the column with a wash of 3 mL 100 % methanol. Discard
this fraction and dissolve the dried extract in 10 mL of 100 % methanol and to load
on columns filled with 3 mL Diethyl-aminoethyl (DEAE) Sephadex A25 or similar.
Wash with 3 mL 0.1 M acetic acid in methanol and discard the eluate. Wash with
3 mL 1 M acetic acid in methanol and discard the eluate. Wash with 3 mL 1.5 M
acetic acid in methanol and collect and evaporate the eluate under vacuum.
Reconstitute the dried extract in 50 L 100 % methanol (HPLC grade) and vortex
briefly. For further jasmonates identification and quantification, inject 15 L into
LC-MS-MS.
Note: This methodology can be used for simultaneous determination of JA from
bacterial culture medium or inoculated plant tissues. In the second case, approximately of 200 mg dry weight plant material must be ground in a mortar with liquid
nitrogen and add 10 mL 100 % methanol.
7.2.1.2
This methodology is described by Luna et al. (1993). For that, homogenize the
lyophilized culture medium (approximately 0.2 g dry weight, DW) with 20 mL
imidazole buffer (pH 7) plus 2,6-di-tert-butyl-p-cresol as antioxidant and add 50 ng
(5 L) of the corresponding deuterated standard (ABA). Incubate each sample
overnight at 4 C to allow extraction and standard equilibration. Centrifuge the
sample for 15 min at 1,530 g, then collect the supernatant and evaporate it under
vacuum until to eliminate the isopropanol. An amino anion exchange minicolumn
or similar is conditioned with 100 % methanol, deionized water, and imidazole
125
buffer 0.02 M. The aqueous fraction from step 4 is loaded onto the minicolumn.
Wash sequentially the minicolumn with 6 mL each of hexane, ethyl acetate, and
acetonitrile and discard these fractions. ABA is eluated with 6 mL of methanol:acetic
acid (95:5, v/v) and the eluate fraction is evaporated to dryness under vacuum in
rotary evaporator. For further ABA identification and quantification, inject 15 L
into high-performance liquid chromatography coupled to mass spectrometers
(LC-MS-MS).
Note: This methodology can be used for simultaneous determination of ABA
from bacterial culture medium or inoculated plant tissues. In the second case,
approximately of 200 mg dry weight plant material must be ground in a mortar with
liquid nitrogen and add 20 mL imidazole buffer (pH 7) plus 2,6-di-tert-butyl-pcresol as antioxidant to the ground.
7.2.1.3
126
P. Castillo et al.
for GA3. Inject into a reverse phase octadecyl carbon chain (C18) column
(300 3.9 mm) in an HPLC system coupled to a UVVis diode-array spectrometer.
Note: This methodology can be used for simultaneous determination of IAA,
ABA, GA3, and Z from bacterial culture medium or inoculated plant tissues. In the
second case, approximately of 200 mg dry weight plant material must be ground in
a mortar with liquid nitrogen, then add 5 mL ultra-pure water to the ground
material.
7.2.2
7.2.2.1
Biological Methods
127
sterile distilled water, and once a week fertilized with 50 % of Hoaglands solution
(Hoagland and Boyer 1936). Plants (three plants per pot, five replicates per treatment) are cultured in a growth chamber with daily cycles of 16 h at 2530 C with
a light intensity of 450 mol m2 s1 and 8 h at 20 C in darkness for 7 days. Plants
are grouped in the following treatments: (a) cell inoculated: each seedling is inoculated with 1 mL of bacterial culture medium with up to 109 cells mL1; (b) supernatant inoculated: each seedling is inoculated with 1 mL of supernatant of culture
medium (10,000 rpm 10 min at room temperature); (c) GA3 treated: GA3 is dissolved in pure ethanol to obtain 0.1, 0.5, 1.0, 5.0, and 10.0 g mL1 solutions and
then 10 L are applied individually at the first leaf with microsyringe for every
seedling for the same treatment; (d) Control: seedlings individually treated with
pure ethanol. At the end of the experiment the plants are carefully pulled out from
the pots and rinsed for 5 s in the potassium phosphate buffer. The following parameters are measured as per plant basis: first internodes length and total shoot length.
Note: There are some dwarf mutants deficient in the production of physiologically active gibberellins, like the dwarf-1 (d1) described in maize (Zea mays L.) by
Fujioka et al. (1988) and the dwarf-x (dx or cv. Tan-ginbozu) described in rice
(Oryza sativa L.) by Kobayashi et al. (1989). These mutants express the dwarf phenotype since young seedling stage, but the exogenous application of gibberellic acid
(GA3) or the inoculation with gibberellins-producer bacteria, allows expression of
the normal phenotype. For this reason, the use of the described dwarf mutants is
strongly recommended.
128
P. Castillo et al.
precision (typical weight, about 250 mg) and placed in glass scintillation vials
containing 3 mL standard growth medium (pH 7.0) containing 2 mM KCl, 0.1 mM
CaCl and 10 mg L1 chloramphenicol. IAA solutions are added individually into
scintillation vials to produce a typical doseresponse calibration curve. These solutions should contain a concentration of pure IAA between 0.1 and 100 g mL1. The
bacterial supernatants are also added in specific vials as problem treatment. After
the treatment, the covered vials are gently shaken (80 rpm min1) at 30 C between
3 and 12 h (linearity increases with the time of exposition) and sections removed,
blotted, and grouped weighed. Each point should represent three replicates of 1012
sections each. The growth response of IAA solutions is expressed as percentage of
increase in weight [%] vs. log g mL1 IAA. The supernatant IAA concentration
calculation is derived of that doseresponse curve.
Determination of Cytokinins
The cucumber cotyledon greening bioassay reported by Fletcher et al. (1981) with
modifications is used for detecting cytokinins from several natural sources, including
bacterial cultures. The sensitivity of the methodology is extremely low and useful to
detect a minimal of 0.0001 mg L1 of N-benzyladenine, zeatin, kinetin, or zeatin
riboside in solution. Of the more frequent cytokinins tested, kinetin appeared to be
the least active. Cucumber (Cucumus sativus L.) seeds are planted in vermiculite, in
peat flats (20 15 7 cm) and germinated in the dark at 28 C. The cotyledons from
5-days old plants are excised in the absence of green light, making certain that the
hypocotyl hook is removed. The cotyledons are placed in 5-cm Petri dishes containing 3 mL of test solution which consisted of distilled H2O, cytokinins at various
concentrations to generate a doseresponse curve or bacterial supernatant, and
40 mM KCl. The dishes are returned to the dark at 28 C for 20 h. After incubation
period, they are exposed to fluorescent light with an intensity of 12.9 W m2. After
3.5 h, cotyledons are homogenized, and the chlorophyll extracted in 8 mL 80 %
acetone solution. The volume is brought up to 10 mL with acetone and then centrifuged
at 2,500 g for 10 min. The absorbance of the supernatants is read at 663 (chlorophyll A) and 645 nm (chlorophyll B) to obtain the partial and total concentrations
according to Arnon (1949).
7.2.2.2
Analytical Methods
129
derived from that of Salkowski (1885) for indole detection. This method has been
used for years because it is simple, rapid, and cheap and allows the daily analysis of
numerous bacterial supernatants. Glickman and Dessaux (1995) examined the
sensitivity and the specificity of three versions of the Salkowski colorimetric technique. Two of these allowed the detection of indoleacetic acid over a low range of
concentrations (0.520 mg mL1), while the third permitted the detection of IAA
over a range of higher concentrations (5200 mg mL1). These methodologies are
shown to be specific for IAA, IPA, and IAM. The first colorimetric technique was
performed according to Pilet and Chollet (1970), using reagent R1, which consisted
of 12 g of FeCl3 per liter in 7.9 M H2SO4. One milliliter of reagent R1 will be added
to 1 mL of the sample solution, well mixed, deposited in a 3 mL spectrophotometer
cuvette, and will be kept in the darkness conditions for 30 min at room temperature.
The second and third colorimetric methods termed were derived from that of Tang
and Bonner (1947). They used reagent R2, which consisted of 4.5 g of FeCl3 per
liter in 10.8 M H2SO4. An aliquot of 1 or 2 mL of reagent R2 will be added to 1 mL
of sample solution, and the mixture will be processed as indicated for first technique. In all cases, mixtures will be examined at OD530 for determination of indolic
compounds. The quantification of IAA will be performed by the use of a calibration
curve of pure IAA solution.
130
P. Castillo et al.
Mass Spectrometry
This technique works by ionization of compounds to generate charged molecules or
molecule fragments. The mixture of electrically charged molecules is accelerated
by a magnetic field, all in a high vacuum, this in order to prevent reactions occurring
with other particles. The fragments of molecules which are obtained by mass
spectrometry are the fingerprint of each analyte being tested; it can obtain identification with a very high precision. Compounds are separated by chromatographic
methods prior to entering the mass spectrometer when hormones are determined.
The gas chromatograph (GC) is a common combination with mass spectrometry
(MS), where the molecules must be volatile and tolerate high temperatures. The
ionization of molecules associated with gaseous chromatographer generally is produced by electron impact, where electrons are generated by through thermionic
emission. The disadvantage of this technique of ionization is that they produce a
substantial fragmentation of the molecules of the compound in evaluation. In general,
the organic molecules are labile at high temperatures and in many cases non-volatile,
by which such molecules must be modified by derivatization to improve their
volatility, which not only is annoying to perform but also it is different according to
family of plant hormones. The solution to such problem occurred after the appearance of high-performance liquid chromatography coupled to mass spectrometers
(LC-MS), which allowed the separation of organic compounds without prior modification of such molecules at the entrance of the mass spectrometer (Fig. 7.1), and
also the use of electrospray ionization (ESI), developed by Fenn et al. (1989).
Micro-volume of solvent are required for the ESI technique. The HPLCs used
possess flows in the order of microliters of solvent per minute (L min1) or nano
liter (nL m1) in the case of liquid chromatographs ultra performance (UPLC),
which improves the definition of chromatographic peaks and ESI ionization. ESI is
Fig. 7.1 Schematic representation of the electrospray ionization published by Banerjee and
Mazumdar (2012)
131
a soft ionization with very little fragmentation. The solvent with the molecules of
interest pass through a capillary in an electric potential of 34 kV is applied. As a
result highly charged droplets are produced, which are dried by the interface temperature and the gas stream nitrogen. The droplets are electrically overloaded and
suffer a coulomb explosion and individual molecules charged ionic form positively or negatively, depending on the filler used in the ionization, are generated
(Fig. 7.1). Analysis of these charged molecules is performed by different analyzers,
for example, quadrupole (Q), ion trap (ionic tramp), or time of flight (TOF) and/or
the combination of them (Fig. 7.2). Analyzers perform the separation of each molecule or fragment analysis by mass/charge ratio (m/z). When more than one analyzer is used, this is called tandem mass spectrometry MS/MS or MSn. In mass
spectrometers in tandem, the parent ions with a specific m/z are selected in the first
analyzer, after they are fragmented in the collision cell and the daughter ions with a
specific m/z are selected in the second analyzer. A parent/daughter ions pair is often
called to as a transition for example in salicylic acid: m/z 137/93. The identification and quantification in this case is performed by fragment molecular compound
in the operating mode of Multiple Reaction Monitoring (MRM). In the mass spectrum, we can observe the relative abundance of ionized fragments and the m/z,
where we can identify the molecular ion which is the molecular weight of the
molecule in ionic form, and the other peak is called Peak base, which is the analytes relative abundance (100 %) and then find the different fragments obtained.
Quantification is performed from areas that generate each of the molecules or fragments in a chromatogram that appear in the retention time (RT) for each compound.
Such areas are associated with different concentrations generated by the endogenous and the internal standard (deuterated compounds), which have the same structure and different weight that the analyte being evaluated. These areas are associated
with different concentrations generated by the synthetic and the internal standard
(deuterated compound). For example, in the chromatogram of the ABA (Fig. 7.3)
and (2H6)-ABA (Fig. 7.4) and their RT and related areas are observed. Such quantification of the endogenous compound can be done by direct relation: (peak area of
endogenous compound/peak area of the deuterated compound) amount of deuterated compound or through the use of a calibration curve between the area of the
endogenous and deuterated compound and their concentrations.
132
P. Castillo et al.
133
134
P. Castillo et al.
135
ion mode with the following settings for each hormone: capillary voltage 3,000 V,
energy cone 35 V, RF Lens 1 (20), RF Lens 2 (0.3), source temperature 100 C,
solvation temperature 380 C, gas cone 100 L h1, collision (50), and multiplier
(650). Optimize the MS/MS parameters in infusion experiments using individual
standard solutions of each hormone at a 50 ng L1 diluted in mobile phase A/B
(40:60 v/v). MS/MS product ions are produced by collision-activated dissociation
of selected precursor ions in the collision cell of the double quadrupole mass
spectrometer, and mass is analyzed using the second analyzer of the instrument.
For quantifying, inject the samples in MRM modes, since many compounds could
present the same nominal molecular mass. The combination of parent mass and
unique daughter fragment ions is used to selectively monitor hormones in plants
extracts. MRM acquisition is performed using the 137/93 and 141/97 transitions for
SA and (2H4)-SA; 263/153 and 269/159 for ABA and (2H6)-ABA; 209/59 and 215/59
for JA and (2H6-JA); and 174/130 and 179/135 for IAA and (2H5)-AIA, respectively,
with dwell 1,000 ms for each transition. Acquire and analyze data using software,
for example, MassLynx 4.1 and QuanLynx 4.1. For quantification, obtain the
values from a calibration curve previously constructed using known amounts of
each hormone and their pure standard/deuterated internal standard ratio.
References
Abdala G, Miersch O, Correa N, Rosas S (1999) Detection of jasmonic acid in cultures of
Escherichia coli and Saccharomyces cerevisiae. Nat Prod Lett 14(1):5563
Abreu M, Munn-Bosch S (2009) Salicylic acid deficiency in NahG transgenic lines and sid2 mutants
increases seed yield in the annual plant Arabidopsis thaliana. J Exp Bot 60(4):12611271
Andrade A, Vigliocco A, Alemano S, Miersch O, Botella M, Abdala G (2005) Endogenous jasmonates and octadecanoids in hypersensitive tomato mutants during germination and seedling
development in response to abiotic stress. Seed Sci Res 15(4):309318
Arnon D (1949) Copper enzymes in isolated chloroplasts. Polyphenoloxidase in vulgaris. Plant
Physiol 24:115
Banerjee S, Mazumdar S (2012) Electrospray ionization mass spectrometry: a technique to access
the information beyond the molecular weight of the analyte. Int J Anal Chem. doi:
10.1155/2012/282574
Barea J, Navarro E, Montoya E (1976) Production of plant growth regulators by rhizosphere
phosphate-solubilizing bacteria. J Appl Bacteriol 40:129134
Bottini R, Fulchieri M, Pearce D, Pharis RP (1989) Identification of gibberellins A1, A3 and iso-A3
in culture of Azospirillum lipoferum. Plant Physiol 89:13
Bottini R, Cassn F, Piccoli P (2004) Gibberellin production by bacteria and its involvement in
plant growth promotion and yield increase. Appl Microbiol Biotechnol 65(5):497503
Cacciari I, Lippi D, Pietrosanti T (1989) Phytohormone-like substances produced by single and
mixed diazotrophic cultures of Azospirillum spp. and Arthrobacter. Plant Soil 115:151153
Cassn F, Perrig D, Sgroy V, Masciarelli O, Penna C, Luna V (2009a) Azospirillum brasilense
Az39 and Bradyrhizobium japonicum E 109 promote seed germination and early seedling
growth, independently or co-inoculated in maize (Zea mays L.) and soybean (Glycine max L.).
Eur J Soil Biol 45:2835
Cassn F, Masciarelli O, Luna V (2009b) Plant growth promoting Rhizobacteria assays. In: Narwal
SS, Cataln CA, Sanprieto DA, Vattuone MA, Polyticka B (eds) Plant bioassays. Studium
Press LLC, Houston, pp 157186
136
P. Castillo et al.
Cassn F, Vanderleyden J, Spaepen S (2014) Physiological and agronomical aspects of phytohormone production by model plant growth promoting rhizobacteria (PGPR) belonging to the
genus Azospirillum. J Plant Growth Regul 33:440459
Cohen A, Bottini R, Piccoli P (2008) Azospirillum brasilense Sp 245 produces ABA in chemicallydefined culture medium and increases ABA content in Arabidopsis plants. Plant Growth Regul
54:97103
Colebrook E, Thomas S, Phillips A, Hedden P (2014) The role of gibberellin signalling in plant
responses to abiotic stress. J Exp Biol 217:6775
Durgbanshi A, Arbona V, Pozo O, Miersch O, Sancho J, Gomez-Cardenas A (2005) Simultaneous
determination of multiple phytohormones in plants extracts by liquid chromatographyelectrospray tandem mass spectrometry. J Agric Food Chem 53:84378442
Epel B, Erlanger M, Yahalom A (1987) The etiolated cucumber hypocotyl weight-growth test: a
sensitive, easy and ultrafast bioassay for IAA. Plant Growth Regul 5(1):314
Esquivel-Cote R, Ramrez-Gama R, Tsuzuki-Reyes G, Orozco-Segovia A, Huante P (2010)
Azospirillum lipoferum strain AZm5 containing 1-aminocyclopropane-1-carboxylic acid
deaminase improves early growth of tomato seedlings under nitrogen deficiency. Plant Soil
337:6575
Fenn J, Mann M, Meng C, Wong S, Whitehouse C (1989) Electrospray ionization for mass spectrometry of large biomolecules. Science 246(4926):6471
Feussner I, Wasternack C (2002) The lipoxygenase pathway. Annu Rev Plant Biol 53:275297
Fletcher A, Kallidumbil V, Steele P (1981) An improved bioassay for cytokinins using cucumber
cotyledons. Plant Physiol 69:675677
Forchetti G, Masciarelli O, Alemano S, Alvarez D, Abdala G (2007) Endophytic bacteria in sunflower (Helianthus annuus L.): isolation, characterization, production of jasmonates and
abscisic acid in culture medium. Appl Microbiol Biotechnol 76(5):11451152
Fujioka S, Yamame H, Spray S, Phinney B, Gaskin P, Mac Millan J, Takahashi N (1988) Qualitative
and quantitative analyses of gibberellins in vegetative shoots of normal, dwarf1, dwarf2,
dwarf3 and dwarf5 seedlings of Zea mays L. Plant Physiol 88:13671372
Gidda S, Miersch O, Levitin A, Schmidt J, Wasternack C, Varin L (2003) Biochemical and molecular characterization of a hydroxyjasmonate sulfotransferase from Arabidopsis thaliana. J Biol
Chem 278:1789517900
Glauser G, Dubugnon L, Mousavi SAR, Rudaz S, Wolfender J-L, Farmer E (2009) Velocity estimates for signal propagation leading to systemic jasmonic acid accumulation in wounded
Arabidopsis. J Biol Chem 284:3450634513
Glickman E, Dessaux Y (1995) A critical examination of the specificity of the Salkowski reagent
for indolic compounds produced by phytopathogenic bacteria. Appl Environ Microbiol
61:793796
Harrison A, Yu M, Grdenborg T, Middleditch M, Ramsay J, Baker E, Lott J (2006) The structure
of Mbtl from Mycobacterium tuberculosis, the first enzyme in the biosynthesis of the siderophore mycobactin, reveals it to be a salicylate synthase. J Bacteriol 188:60816091
Hayat Q, Hayat S, Irfan M, Ahmad A (2010) Effect of exogenous salicylic acid under changing
environment: a review. Environ Exp Bot 68:1425
Hoagland D, Boyer T (1936) General nature and process of salt accumulation by roots with
description of experimental methods. Plant Physiol 11:471507
Horemans S, Koninck K, Neuray J, Hermans R, Vlassak K (1986) Production of plant growth
substances by Azospirillum sp. and other rhizosphere bacteria. Symbiosis 2:341346
Janzen R, Rood S, Dormar J, McGill W (1992) Azospirillum brasilense produces gibberellins in
pure culture and chemically-medium and in co-culture on straw. Soil Biol Biochem
24:10611064
Jiang F, Hartung W (2008) Long-distance signalling of abscisic acid (ABA): the factors regulating
the intensity of the ABA signal. J Exp Bot 59:3743
137
Kelen M, Demiralay E, Sen S, Ozkan G (2004) Separation of abscisic acid, indole-3-acetic acid,
gibberellic acid in 99 R (Vitis berlandieri x Vitis rupestris) and rose oil (Rosa damascena Mill.)
by reversed phase liquid chromatography. Turk J Chem 28:603610
Kobayashi M, Sakurai A, Saka A, Takahashi N (1989) Quantitative analysis of endogenous gibberellins in normal and dwarf cultivars of rice. Plant Cell Physiol 30:963969
Kolb W, Martin P (1985) Response of plant roots to inoculation with Azospirillum brasilense and
to application of indoleacetic acid. In: Klingmller W (ed) Azospirillum III: genetics, physiology, ecology. Springer, Berlin, pp 215221
Kombrink E (2012) Chemical and genetic exploration of jasmonate biosynthesis and signaling
paths. Planta 236:13511366
Kouchi H, Imaizumi-Anraku H, Hayashi M, Hakoyama T, Nakagawa T, Umehara Y, Suganuma N,
Kawaguchi M (2010) How many peas in a pod? Legume genes responsible for mutualistic
symbioses underground. Plant Cell Physiol 51:13811397
Kovac K (1993) Alkylation. In: Blau K, Halket JM (eds) Handbook of derivatives for
Chromatography. Jhon Wiley. New York
Kovats E (1958) Gas chromatographische charakteriserung organischer verbindungen I. Retentions
indices aliphatischer halogenide, alkohole, aldehyde und ketone. Helv Chim Acta
41:19151932
Kuroha T, Tokunaga H, Kojima M, Ueda N, Ishida T, Nagawa S, Fukuda H, Sugimoto K,
Sakakibara H (2009) Functional analyses of LONELY GUY cytokinin-activating enzymes
reveal the importance of the direct activation pathway in Arabidopsis. Plant Cell 21:
31523169
Lambrecht M, Okon Y, Vande Broek A, Vanderleyden J (2000) Indole-3-acetic acid: a reciprocal
signalling molecule in bacteria-plant interactions. Trends Microbiol 8:298300
Luna V, Soriano M, Bottini R, Sheng C, Pharis R (1993) Levels of endogenous gibberellins,
abscisic acid, indol 3 acetic acid and naringenin during dormancy of peach flower buds. Acta
Horticult 329:265267
Mercado-Blanco J, Rodrguez-Jurado D, Prez-Arts E, Jimnez-Daz R (2001) Detection of the
nondefoliating pathotype of Verticillium dahliae in infected olive plants by nested PCR. Eur J
Plant Pathol 50:609619
Morrone D, Chambers J, Lowry L, Kim G, Anterola A, Bender K, Peters R (2009) Gibberellin
biosynthesis in bacteria: separate ent-copalyl diphosphate and ent-kaurene synthases in
Bradyrhizobium japonicum. FEBS Lett 583:475480
Muralidhara R, Rai P (1986) Plant growth regulators produced by diazotrophic bacteria. In:
National seminar on microbial ecology, pp 1823
Ng G, Seabolt S, Zhang C, Salimian S, Watkins TA, Lu H (2011) Genetic dissection of salicylic
acid-mediated defense signaling networks in Arabidopsis. Genetics 189:851859
OBrien JA, Benkov E (2013) Cytokinin cross-talking during biotic and abiotic stress responses.
Front Plant Sci 4:451
Pedraza R, Motok J, Salazar S, Ragout A, Mentel M, Tortora M, Guerrero Molina M, Winik B,
Daz Ricci J (2010) Growth-promotion of strawberry plants inoculated with Azospirillum
brasilense. World J Microbiol Biotechnol 26(2):265272
Perrig D, Boiero M, Masciarelli O, Penna C, Ruiz O, Cassan F, Luna V (2007) Plant-growthpromoting compounds produced by two agronomically important strains of Azospirillum brasilense, and implications for inoculant formulation. Appl Microbiol Biotechnol 75:11431150
Piccoli P, Travaglia C, Cohen A, Sosa L, Cornejo P, Masuelli R, Bottini R (2011) An endophytic
bacterium isolated from roots of the halophyte Prosopis strombulifera produces ABA, IAA,
gibberellins A1 and A3 and jasmonic acid in chemically-defined culture medium. Plant Growth
Regul 64:207210
Pilet P, Chollet R (1970) Sur le dosage colorimtrique de lacide indolylactique. C R Acad Sci Ser
D 271:16751678
Ping L, Boland W (2004) Signals from the underground: bacterial volatiles promote growth in
Arabidopsis. Trends Plant Sci 9(6):263266
138
P. Castillo et al.
Rivas-San Vicente M, Plasencia J (2011) Salicylic acid beyond defense: its role in plant growth and
development. J Exp Bot 26:33213338
Salkowski E (1885) Ueber das Verhalten der Skatolcarbonsaure im Organismus. Z Physiol Chem
9:2333
Santner A, Estelle M (2009) Recent advances and emerging trends in plant hormone signalling.
Nature 459:10711078
Seo M, Nambara E, Choi G, Yamaguchi S (2009) Interaction of light and hormone signals in germinating seeds. Plant Mol Biol 69:463472
Shah S, Karkhanis V, Desai A (1992) Isolation and characterization of siderophore, with antimicrobial
activity, from Azospirillum lipoferum. Curr Microbiol 25:347351
Sreenivasulu N, Radchuk V, Alawady A, Borisjuk L, Weier D, Staroske N, Fuchs J, Miersch O,
Strickert M, Usadel B, Wobus U, Grimm B, Weber H, Weschke W (2010) De-regulation of
abscisic acid contents causes abnormal endosperm development in the barley mutant seg8.
Plant J 64:589603
Strzelczyk E, Kamper M, Li C (1994) Cytocinin-like-substances and ethylene production by
Azospirillum in media with different carbon sources. Microbiol Res 149:5560
Tale W, Paponov I, Palme K (2006) Auxin in action: signalling, transport and the control of plant
growth and development. Nat Rev Mol Cell Biol 7:847859
Tang Y, Bonner J (1947) The enzymatic inactivation of indoleacetic acid. I. Some characteristics of
the enzyme contained in pea seedlings. Arch Biochem 13:1125
Tien T, Gaskins M, Hubbell D (1979) Plant growth substances produced by Azsopirillum brasilense and their effect on the growth of pearl millet (Pennisetum americanum L.). Appl Environ
Microbiol 37:10161024
Timmusk S, Nicander B, Granhall U, Tillberg E (1999) Cytokinin production by Paenibacillus
polymyxa. Soil Biol Biochem 31:18471852
Tortora M, Diaz Ricci J, Pedraza R (2011) Azospirillum brasilense siderophores with antifungal
activity against Colletotrichum acutatum. Arch Microbiol 193:275286
Tsavkelova E, Klimova S, Cherdyntseva T, Netrusov A (2006) Microbial producers of plant growth
stimulators and their practical use: a review. Appl Biochem Microbiol 42:117126
Wasternack C, Kombrink E (2010) Jasmonates: structural requirements for lipid-derived signals
active in plant stress responses and development. ACS Chem Biol 5:6377
Yamaguchi S (2008) Gibberellin metabolism and its regulation. Annu Rev Plant Biol 59:225251
Yang D, Dong W, Zhang Y, He Z (2013) Gibberellins modulate abiotic stress tolerance in plants.
Sci Sinica Vitae 43:11191126
Zeevaart JAD, Creelman RA (1988) Metabolism and physiology of abscisic acid. Annu Rev Plant
Physiol Plant Mol Biol 39:439473
Chapter 8
8.1 Introduction
Currently, the genus Azospirillum comprises 15 recognized species (http://www.
bacterio.net/-allnamesac.html; July 9th, 2014). Two new species have been recently
described in the Int J Syst Evol Microbiol. A third candidate species Azospirillum
massiliensis was isolated from water using co-culture with Acanthamoeba
polyphaga.
Most species have scarce metabolic characterization. The best-studied species
are A. brasilense, A. lipoferum, and A. amazonense. All pathways of the nitrogen
cycle, with the exception of nitrification, have been described in these species.
The following species had their genome sequenced completely or partially:
A. brasilense strains Sp245, Azospirillum sp. B510, A. brasilense FP2 (Sp7
NalR,SmR), Azospirillum lipoferum 4B, Azospirillum irakense DSM 11586,
Azospirillum halopraeferens DSM 3675, and Azospirillum amazonense Y2
(Wisniewski-Dy etal. 2011; SantAnna etal. 2011; Kaneko etal. 2010; http://
www.ncbi.nlm.nih.gov/genome/).
A. brasilense Sp245 was used to identify the pathways of nitrogen cycle since its
genome has been completely sequenced and this strain has been characterized physiologically. The genes for nitrate/nitrite transport of the ABC-type (nasFED) and
those for the assimilatory nitrite (nirBD), nitrate reductase (nasA), and uroporphyrin
139
140
III C-methyltransferase (nasG or cysG) are in plasmid 1. Similar genes are also
found in the genomes of A. lipoferum, A. halopraeferens, and A. irakense.
Downstream from nasFED, the nasT gene encoding an antitermination protein is
found. In the draft sequence of A. amazonense only nasA and nasD genes are found;
this species was described as having only the assimilatory nitrate reductase.
In plasmid 2 of A. brasilense Sp245 genes for the periplasmic nitrate reductase,
napEFDABC are present. Another set of nap genes are found in plasmid 4 which
comprises napEDABC. The copper containing nitrite reductase gene nirK (aniA) is
located in plasmid 3. These genes are also present in A. lipoferum, A. halopraeferens, and A. irakense.
Genes for nitric oxide reductase norBCQD and nitrous oxide reductase nosZ
were found. Transport and regulatory genes are also present. Regulation of
nitrate metabolism genes is complex and seems to be dependent on the interaction of several factors such as nitrate, nitrite, and oxygen levels (Dbereiner and
Pedrosa 1987).
The nif gene cluster is present in all sequenced species. In plasmid 3 of the
genome of A. brasilense Sp245, a second nif gene cluster is present, probably coding for an alternative iron or vanadium nitrogenase. However, the gene for alternative dinitrogenase reductase (anfH or vnfH) is not present in this cluster or elsewhere
in the genome.
Ammonia assimilation in Azospirillum spp. occurs via two pathways, one
involving glutamate dehydrogenase (gdhA) under high NH4+ concentration and the
other involving glutamine synthetase (glnA) and glutamate synthase (gltBgltD)
under limiting NH4+. Genes for these pathways are present in all species so far
analyzed.
The protocols for studying inorganic nitrogen metabolism in Azospirillum spp.
are described in the next section. These tools were developed mainly for the study
of A. brasilense, A. lipoferum, and A. amazonense, but they can be applied to the
other species.
141
8.2.1 D
etermination ofNitrogenase Activity
inSemi-Solid Medium
All Azospirillum are aerobic, but will only fix nitrogen in the presence of a constant
supply of low oxygen (micro-aerobic) concentrations to prevent nitrogenase inactivation and nif genes repression. Johanna Dbereiners group introduced the N-free
semi-solid media for the study of nitrogen fixation in Azospirillum and other motile
aero-tactic diazotrophs in the mid 1970s. This is the simplest approach to measure
invivo nitrogenase activity in Azospirillum. The bacteria is inoculated in N-free
minimum growth media containing low agar concentration (usually 1.75g/L) and
incubated under static conditions. As the bacteria population increases, it forms a
veil-like pellicle that continuously migrates to regions where the oxygen concentration allows the expression and activity of nitrogenase.
In order to detect maximum nitrogenase activity during semi-solid growth, time
course measurements should be performed since at the early stages of growth the
bacterial population is low for nitrogenase detection. At late stages, the bacterial
population is too large and oxygen supply is too low to sustain energy production
and full nitrogen fixation. The time point where nitrogenase activity is maximum
depends on the initial inoculum concentration, growth medium conditions, and temperature. It is essential to determine the maximum nitrogenase activity when comparing different species, strains, and physiological conditions.
8.2.1.1 Time Course
Nitrogenase activity in semi-solid medium is determined by the reduction of acetylene, which is also a substrate for nitrogenase. The strains are grown in minimal
liquid medium such as NFbHP (Machado etal. 1991) containing ammonium
chloride (5mM) as N source overnight at 30C in a rotary shaker (120rpm). Ten
microliters of the saturated culture are inoculated in bijou or penicillin bottles of
10mL containing 4mL of N-free NFbHP semi-solid medium. Inoculation is carried
out with a micropipette and the inoculum is deposited in the semi-solid medium.
The cultures are incubated 12, 24, 36, and 48h at 30C.A veil-like bacterial growth
should be visible just below the medium surface. For nitrogenase measurement at
each time point, the bottles are tightly sealed with subaseals or rubber stopper with
aluminum seals, and 0.6mL of acetylene (10% of gas phase) is injected in each
bottle. The cultures are further incubated at the same temperature for 60min and
0.5mL of the gas phase is analyzed by gas chromatography to determine the amount
of ethylene formed. The gas chromatograph is equipped with FID detector and a
Porapak N (100200mesh) column (2m, 1mm diameter) operated at
110C.Ethylene (100ppm in N2) is used as standard and 0.5mL contains 2.232nmol
of ethylene at 25C and 1atm.
To calculate the specific activity of nitrogenase is necessary to determine the
culture protein concentration. For this, the cultures in semi-solid medium are
142
quickly heated in boiling water to melt the agar and vigorously vortexed. Melted
culture samples are then lysed in NaOH 0.1 M (final concentration) for 30 min at
room temperature and protein concentration determined by standard Bradford
procedure. The same procedure is used for liquid cultures.
Nitrogenase-specific activity is calculated by the following equation:
N 2 ase = ( nmol C2 H 4 in 0.5 ml ) 12 / ( mg protein 60 min )
Where 12 is the correction factor for the gas volume and mg protein is the total
protein content of the culture in milligrams.
8.2.1.2 Effect ofInoculum Size
It is possible to determine the maximum nitrogenase activity using a different strategy, namely varying the inoculum concentration and measuring the activity at a
fixed time point. The Azospirilla inocula are grown as described above and inoculated in increasing amounts (e.g., 1, 2, 4, 8, 16, 32, and 64L) into 4mL of N-free
semi-solid medium in 10mL bijou or penicillin bottles. The cultures are incubated
statically at 30C for 1624h and assayed for nitrogenase activity. A veil-like
bacterial growth should be visible just below the medium surface. For nitrogenase
measurement at each time point, the bottles are tightly sealed with subaseals or
rubber stopper with aluminum seals, and 0.6mL of acetylene (10% of gas phase)
is injected in each bottle. The cultures are further incubated at the same temperature
for 60min and the ethylene formed determined by gas chromatography as before.
143
8.2.2.1 E
ffect ofOxygen Concentration inGas Phase ontheNitrogenase
Synthesis andActivity inLiquid Medium
In order to determine nitrogenase activity in liquid medium culture, the experiment
is carried out under different oxygen tensions and absence of ammonium ions.
In the present experiment, nitrogenase is de-repressed in the presence of acetylene
under increasing oxygen concentrations. A time course of nitrogenase synthesis and
activity is obtained. The same type of experiment can be performed in cells actively
fixing nitrogen.
The strains are first grown in 200mL minimal liquid medium such as NFbHP
containing ammonium chloride (10mM) as N source in 500mL erlenmeyer flask at
30 C in a rotary shaker (120 rpm) until an OD at 600 nm of 1.52.0. The cells are
collected by centrifugation (5,000g, 10min, 4C) and re-suspended in N-free
NFbHP medium to an OD600 1.0. Since these cells were grown in the presence of
high NH4+, they are devoid of nitrogenase. The cell suspension (10mL) is distributed
in 60mL penicillin bottles capped with subaseals or rubber stopper with aluminum
seals. The gas phase of the sealed flasks is flushed with pure N2 for 30min using a
gas manifold equipped with hypodermic needles. Hypodermic needles are inserted
in each rubber seal to allow the gas phase to be exchanged. Air (20.1% oxygen) or
pure oxygen is then injected in flask to give zero, 0.5, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 8.0,
and 10 % of oxygen in the gas phase, and a flask under air (20.1 % O2). The oxygen
concentration can be verified in a gas chromatograph equipped with Molecular Sieve
5A column (stainless steel; 2m, 1mm diameter) and a thermo-conductivity detector
(TCD). Acetylene is injected to a final concentration in the gas phase of 10% (5mL
of pure acetylene), and the flasks are incubated at 30C in a rotary shaker at 120rpm.
Two gas samples of 0.5mL are collected with insulin-type hypodermic syringes after
1, 2, and 3h and kept till the time of analysis by inserting them in a manifold of rubber corks. Samples of 0.5mL of the gas phase are taken every 30min and the ethylene produced is analyzed as described above. Since multiple gas samples are taken
from the same flask, it is mandatory to normalize the amount of ethylene produced
by the average acetylene peak. To calculate the specific activity of nitrogenase, it is
necessary to determine the culture protein concentration. Protein concentration is
determined by standard Bradford procedure as described above.
Nitrogenase-specific activity is calculated using the equation:
N 2 ase = ( ( nmol C2 H 4 in 0.5 mL ) 100 ) / ( mg protein T )
Where 100 is the correction factor for the gas volume, mg protein is the total protein
content of the culture in milligrams, and T is the incubation time in minutes.
Physiological studies with intact cells can be performed with A. brasilense grown
in larger scale and kept in liquid nitrogen. Growth, harvesting, and maintenance of
bacterial cells are described as follows. A 10mL saturated Azospirillum culture is
inoculated in 1,000mL of NFbHP medium containing 10mM NH4Cl in a 2,000mL
erlenmeyer flask. Larger cultures can be set up as needed. The flasks are incubated
at 30 C, 120 rpm in a rotary shaker until OD600 1.52.0 (about 24h). The cells are
harvested by centrifugation in a refrigerated centrifuge (5,000g, 15min, 4C).
144
145
source, the respiratory rate of the culture decreases the dissolved oxygen concentrations
to levels compatible with nitrogen fixation. It is worth noting that glutamate represses
nitrogenase activity completely in A. lipoferum and partially in A. amazonense. Similarly
to glutamate, histidine and serine are good non-repressible nitrogen source in semisolid and may substitute glutamate under air (Hartmann etal. 1988).
In this experiment, nitrogenase is de-repressed under air and in the presence of
different concentrations of sodium glutamate or ammonium chloride. The strains
are grown in minimal liquid medium such as NFbHP-containing ammonium chloride
(5mM) as N source overnight at 30C in a rotary shaker (120rpm).
One milliliter of the inoculum is inoculated in 20 mL NFbHP liquid medium
containing increasing concentrations of ammonium chloride or sodium glutamate
(0.1, 0.5, 1.0, 2.0, 3.0, 4.0, and 5.0mM) as N source in 60mL penicillin flasks.
The cultures are incubated at 30C in a rotary shaker (120rpm) overnight (1624h).
The penicillin bottles are then capped with subaseals or rubber stopper with aluminum seals, acetylene is injected to a final concentration in the gas phase of 10%
(5mL of pure acetylene), and the flasks are incubated at 30C in a rotary shaker at
120rpm. Gas samples (0.5mL) are taken after 60min to determine the amount of
ethylene produced by gas chromatography as described before. The expected results
are: (a) For the cultures in ammonium chloride, the nitrogenase activity will be
detected in cultures containing ammonium enough to reach high cell density, no
residual ammonium ions, and a dissolved oxygen concentration compatible with
nitrogenase de-repression and activity. Cultures with lower or higher NH4Cl than
this optimum will not reach those conditions; (b) For cultures in sodium glutamate
nitrogenase will be detected in the cultures containing enough glutamate to reach a
cell density where the dissolved oxygen concentration allows nitrogen fixation.
8.2.2.4 Effect ofInoculum Size onNitrogenase De-Repression
It is possible to determine the maximum nitrogenase activity in liquid culture in the
presence of 5mM sodium glutamate by varying the inoculum concentration and
measuring the activity at a fixed time point. Azospirilla inocula is grown in NFbHP
containing 5mM glutamate under the conditions described above and inoculated in
increasing amounts (100, 200, 500, 1,000L) in 10mL (final volume) of NFbHP
medium containing 5mM sodium glutamate in 60mL penicillin bottles. The cultures are incubated at 30C in a rotary shaker (120rpm) for 1624h. For nitrogenase measurement, the bottles are tightly sealed with subaseals or rubber stopper
with aluminum seals, and 5mL of acetylene (10% of gas phase) is injected in each
bottle. The cultures are further incubated at the same temperature for 60min and the
ethylene formed determined by gas chromatography and specific nitrogenase activity calculated as before. Alternatively, a time course of nitrogenase activity can be
followed collecting samples at every 30min. A switch-off/on experiment can be
performed on the active cultures (see below).
146
147
and mixed with 50L 3 SDS-PAGE loading buffer. The samples are immediately
frozen in liquid nitrogen and stored at 80C.Nitrogenase activity is usually in the
range of 10 and 25nmol of ethylene produced per min per mg of total protein for
A. brasilense strains.
The collected samples are lysed in a boiling water bath for 1min, centrifuged at
13,000g for 3min, and 68L of the supernatant are loaded on a 12% low cross-
linked SDS-polyacrylamide gel (acrylamide:bisacrylamide of 172:1) in Tris-
Glycine buffer pH8.3 (Kanemoto and Ludden 1984). Electrophoresis is run at 150V
in a mini gel electrophoretic system for 6080min. Protein spots in the gel are
transferred to a PVDF membrane activated with methanol using a semi-dry electrophoresis transfer system. This is set up as follows: four layers of filter paper soaked
in anode buffer (1) (300mM Tris pH10, 20%v/v methanol), (2) layers of filter
paper soaked in anode buffer 2 (25mM Tris pH10, 20%v/v methanol), PVDF
membrane, polyacrylamide gel, six layers of filter paper soaked in cathode buffer
(25mM Tris pH10, 40mM caproic acid, 20%v/v methanol). The system is closed
and run at 80mA for 1h. After this, the membrane is washed briefly in TBST
(25mM Tris pH7.6, 150mM NaCl, 0.05%w/v Tween 20) and blocked with 20mL
solution containing 5%w/v nonfat dry milk in TBST for 16h at 4C.The membrane
is then washed twice for 5min with TBST and incubated with 10mL primary rabbit
antibody against A. brasilense dinitrogenase reductase (NifH) in TBST containing
1% nonfat dry milk at the at the desired dilution (usually 1:5,000) for 90min at
room temperature. The membrane is washed once for 15min and three times for
5min with TBST and then incubated with 10mL the secondary antibody anti-rabbit
IgG coupled to horseradish peroxidase (1:5,000) in TBST containing 1% nonfat
dry milk for 90min at room temperature. Again, the membrane is washed once for
15min and three times for 5min with TBST prior to the detection. For dinitrogenase
reductase detection by chemiluminescence, the ECL Reagent is used as per the
manufacturers instructions. Excess substrate is removed, the membrane is covered
with cling film, and the emitted light detected by exposing to X-rays film for
1.55min or cooled CCD camera. As control, 1g of purified A. brasilense His-
NifH can be used.
Expected results: The ADP-ribosylated dinitrogenase reductase is slower than
the unmodified protein in this low cross-linking SDS-PAGE.When 100% of the
dinitrogenase is modified and inactivated, two bands of equal intensity are visualized, since only one subunit of the NifH homodimer is ADP-ribosylated.
8.2.3 D
etermination ofAmmonium/Methylamonium Ions
Transport
In A. brasilense, the transport of ammonium ions is dependent on energy and
repressed by ammonium (Hartmann and Kleiner 1982). The same transport system
is also capable of transporting methylammonium with low affinity. Ammonium,
148
149
150
8.3 Appendices
8.3.1 NFbHP Growth Medium
The NFb growth medium was originally described by Dbereiner etal. (1976). This
medium has been modified along the years (Okon et al. 1977a) and the formulation
that we use in our laboratory, named NFbHP (Machado etal. 1991), has the following composition per liter: KH2PO4 4g, K2HPO4 6 g, MgSO47H2O 0.2 g, NaCl 0.1 g,
CaCl2 0.02 g, nitrilotriacetic acid (NTA) 0.056 g, FeSO47H2O 0.02 g, biotin 100 g,
Trace Elements Solution 10mL, sodium lactate 5g.
The Trace Elements Solution contains per liter: NaMoO42H2O 200 mg,
MnSO4H2O 235 mg, H3BO3, 280 mg, CuSO45 H2O 8 mg, ZnSO47H2O 24 mg. The
final is adjusted to 6.87.0, with 1 M KOH.
Concentrated solutions of 1M NH4Cl or 1M sodium glutamate are autoclaved
separately and added at the moment of use to give a final concentration of 5 or
20mM.
151
V2C2 = (V1 + V2 ) C1
V2 = (V1C1 ) / ( C2 C1 )
Where,
V1=volume of the gas phase of the flask.
V2 = volume of pure O2 (100%) or Air (20.8%).
C1 = desire O2 concentration in the gas phase.
C2 = O2 concentration of the injected gas.
After injecting oxygen, the gas phase internal pressure is equilibrated with the
environmental pressure by puncturing the rubber cap with a hypodermic needle to
release the pressure.
8.3.3 D
iazotrophic Growth ofAzospirillum spp. Under
Controlled Oxygen Concentrations intheCulture
Diazotrophic growth and nitrogenase de-repression of Azospirillum can be obtained
by growing in N-free medium using an O2-stat system to control the dissolved
oxygen concentration. In this system, a saturated culture of Azospirilum in inoculated in fresh N-free medium. A Borkowski-Johnson- type O2 electrode measures
the dissolved O2 and the culture is sparged with sterile air or N2 as needed to give
optimum concentration of dissolved O2 for nitrogenase de-repression.
The optimum dissolved oxygen concentration for diazotrophic growth of
Azospirillum brasilense was determined to be in the range of 0.0050.0075atm
(Okon et al. 1977b; Nelson and Knowles 1978).
152
References
Baldani JI, Reis VM, Videira SS etal (2014) The art of isolating nitrogen-fixing bacteria from nonleguminous plants using N-free semi-solid media: a practical guide for microbiologists. Plant
and Soil 384(12):413431. doi:10.1007/s11104-014-2186-6
Chaney AL, Marbach, EP (1962) Modified reagents for determination of urea and ammonia. Clin
Chem 8:130132
Dbereiner J, Pedrosa FO (1987) Nitrogen-fixing bacteria in Nonleguminous crop plants. New
York: Sci. Tech. Publishers/Springer-Verlag, 155 p.
Dbereiner J, Marriel I, Nery M (1976) Ecologicaldistribution of Spirillum lipoferum Beijerinck.
Can J Microbiol 22: 14641473
Hartmann A, Kleiner D (1982) Ammonium (methylammonium) transport by Azospirillum spp.
FEMS Microbiol Letts15:6567
Hartmann A, Fu H, Burris RH (1988) Influence of amino acids on nitrogen fixation ability and
growth of Azospirillum spp. Appl Environ Microbiol 54:8793
Huergo LF, Pedrosa FO, Muller-Santos M et al (2012) PII signal transduction proteins: pivotal
players in post-translational control of nitrogenase activity. Microbiology 158:176190
Kaneko T, Minamisawa K, Isawa T etal (2010) Complete genomic structure of the cultivated rice
endophyte Azospirillum sp. B510. DNA Res 17:3750
Kanemoto RH, Ludden PW (1984) Effect of ammonia, darkness, and phenazine methosulfate on
whole-cell nitrogenase activity and Fe protein modification in Rhodospirillum rubrum. J
Bacteriol 158:713720
Machado HB, Funayama S, Rigo LU, Pedrosa FO (1991) Excretion of ammonium by Azospirillum
brasilense. Can J Microbiol 37:549553
Magalhes LMS, Neyra CA, Dbereiner J (1978) Nitrate and nitrite reductase negative mutants of
N2-fixing Azospirillum spp. Arch Microbiol 117:247252
Molina-Favero C, Creus CM, Simontacchi M etal (2008) Aerobic nitric oxide production by
Azospirillum brasilense Sp245 and its influence on root architecture in tomato. Mol Plant
Microbe Interact 21:10011009
Nelson LM, Knowles R (1978) Effect of oxygen and nitrate on nitrogen fixation and denitrification
by Azospirillum brasilense grown in continuous culture. Can J Microbiol 24:13951403
Neyra CA, van Berkum P (1977) Nitrate reduction and nitrogenase activity in Spirillum lipoferum.
Can J Microbiol 23:306310
Neyra CA, Dbereiner J, Lalande R, Knowles R (1977) Denitrification by N2-fixing Spirillum
lipoferum. Can J Microbiol 23:300305
Okon Y, Albrecht SL, Burris RH (1977a) Methods for growing Spirillum lipoferum and for counting it in pure culture and in association with plants. Appl Environ Microbiol 33:8588
Okon Y, Houchins JP, Albrecht SL, Burris RH (1977b) Growth of Spirillum lipoferum at constant
partial pressures of oxygen, and the properties of its nitrogenase in cell-free extracts. J Gen
Microbiol 98:8793
Pedrosa FO, Yates MG (1984) Regulation of nitrogen fixation (nif) genes of Azospirillum brasilense by nifA and ntrC (gln) type genes. FEMS Microbiol Letts 23:95101
Pedrosa FO, Elmerich C (2007) Regulation of nitrogen fixation and ammonium assimilation in
associative and endophytic nitrogen fixing bacteria. In: Elmerich C, Newton WE (eds)
Associative and endophytic nitrogen-fixing bacteria and cyanobacterial associations. Springer,
Dordrecht, pp4171
SantAnna FH, Almeida LG, Cecagno R etal (2011) Genomic insights into the versatility of the
plant growth-promoting bacterium Azospirillum amazonense. BMC Genomics 12:409.
doi:10.1186/1471-2164-12-409
Steenhoudt O, Keijers V, Okon Y, Vanderleyden J (2001) Identification and characterization of a
periplasmic nitrate reductase in Azospirillum brasilense Sp245. Arch Microbiol 175:344352
Udenfriend S, Stein S, Bhlen P etal (1972) Fluorescamine: a reagent for assay of amino acids,
peptides, proteins, and primary amines in the picomole range. Science 178:871872
153
Van Dommelen A, Keijers V, de Vanderleyden J, Zamaroczy M (1998) (Methyl)ammonium transport in the nitrogen-fixing bacterium Azospirillum brasilense. J Bacteriol 180:26522659
Wisniewski-Dy F, Borziak K, Khalsa-Moyers G etal (2011) Azospirillum genomes reveal transition of bacteria from aquatic to terrestrial environments. PLoS Genet 7(12):e1002430.
doi:10.1371/journal.pgen.1002430
Wood WA (1981) Physical methods. In: Gerhardt P (ed) Manual of methods for general bacteriology. American Society for Microbiology, Washington, pp286327
Zimmer W, Roeben K, Bothe H (1988) An altenative explanation for plant growth promotion by
bacteria of the genus Azospirillum. Planta 176:333342
Chapter 9
155
156
9.1
M. Amenta et al.
Introduction
Rhizobacteria secrete metabolites into the rhizosphere which can act as signaling
compounds perceived by neighboring cells within the same microcolony, by other
bacterial species present in the rhizosphere, or by root cells of the host plant. Signals
derived from changes in the soil environment trigger selective root and shoot
responses. The mechanisms by which rhizobacteria elicit plant growth promotion,
from the viewpoint of signal transduction pathways is a matter of debate. In this
scenario, the interrelationships established between roots and the biotic components
of the rhizosphere would have a strong impact not only on plant growth, but also on
microorganisms. Nitric oxide (NO) is a small bioactive molecule produced either by
eukaryotic and prokaryotic cells which in plants has a central role in the signaling
pathway for growth and development of roots. The plant growth-promoting rhizobacteria (PGPR) Azospirillum brasilense has been proved to produce NO that participates in the signaling cascades inducing lateral and adventitious root formation
in tomato (Creus et al. 2005; Molina-Favero et al. 2008) and also in the induction of
bacterial biofilm formation (Arruebarrena Di Palma et al. 2013). Therefore, it would
be useful and desirable to handle different approaches and techniques that deal with
NO metabolism in PGPR and their interaction with plants.
The chemical properties of NO make it a versatile signal molecule that functions
through interactions with cellular targets via either redox or additive chemistry. Its
small Stokes radius and neutral charge allows rapid membrane diffusion and,
together with its short half-life, makes NO ideal as a near real-time signal between
cells (Lamattina et al. 2003). In cells, NO can exist in the form of three interconverting compounds: a free radical nitric oxide (NO), a nitrosonium cation (NO+),
and a nitroxyl anion (NO), each one with different chemical reactivities and properties. Furthermore, the existence of an unpaired electron makes NO highly reactive with oxygen (O2), superoxide (O2), N derivatives, and transition metals
(Lamattina et al. 2003).
Nitric oxide can be produced by several pathways in bacteria: (1) Denitrification:
is the stepwise dissimilative reduction of nitrate (NO3) to nitrite (NO2), NO,
nitrous oxide (N2O), and dinitrogen (N2) by the corresponding N-oxide reductases.
This pathway allows denitrifiers to grow under low-oxygen or anaerobic conditions,
since NO3 is used instead of O2 as a final electron acceptor in respiration (Cutruzzol
1999). In addition to anaerobic denitrification, it is accepted that denitrification can
also occur under fully aerobic conditions (Jetten et al. 1997); (2) Nitrification: is an
aerobic ammonium (NH4+) oxidation pathway yielding hydroxylamine (NH2OH),
NO2, and finally, NO3 (Wrage et al. 2001) in autotrophic conditions. NO is generated as an intermediary in the reduction of NO2 to N2. This process can also be
performed by heterotrophic microorganisms but without energy generation; (3) NO
synthase: NO is produced by the oxidation of L-arginine to L-citrulline, in the presence of O2 by a bacterial NOS-like enzyme (bNOS) harbored mainly by Grampositive microorganisms (Stuehr 1997).
157
9.2
9.2.1
9.2.1.1
Griess Assay
Nitric oxide production is often measured indirectly by quantifying the stable end
products of its metabolism since NO is not stable and persistent in stored biological
samples. Two of the more stable oxidation products of NO metabolism are inorganic nitrite and nitrate (Archer 1993). In 1879, the German organic chemist Johan
Peter Griess described a colorimetric protocol for nitrite measurement, which is to
date one of the most widely used assays for NO measurement because of its simplicity and commercial availability. In this method, nitrite is first treated with a
diazotizing reagent, e.g., sulfanilamide (SA), in acidic media to form a transient
diazonium salt. This intermediate is then allowed to react with a coupling reagent,
N-naphthyl-ethylenediamine (NED), to form a stable azo compound. The intense
purple color of the product allows assaying nitrite with high sensitivity and can be
used to measure nitrite concentration as low as ~0.5 M. The absorbance at 540 nm
of the formed adduct is linearly proportional to the nitrite concentration in the sample (Xu et al. 2000). Through the years, many variations on the original reaction
have been described. The most popular version seems to be the sequential method
in which nitrite is mixed with SA first, immediately followed by the addition of
NED. This method seems to give highest yield of the chromophore, and therefore,
it is the most sensitive way to perform Griess Reaction assay (Verdon et al. 1995;
Guevara et al. 1998). This approach is adopted in most commercial kits.
For a more accurate measurement of NO produced in a sample, the nitrate formed
via oxidation of nitrite must also be measured. This is often accomplished by reducing
nitrate to nitrite immediately prior to the addition of the Griess reagents to the initial
158
M. Amenta et al.
sample (Arita et al. 2007). The available kits use either cadmium or nitrate reductase
to reduce nitrate into nitrite (Sun et al. 2003).
This approach was widely employed to identify denitrifying rhizobacteria in
soil communities (Braker et al. 2010; Mora-Ravelo et al. 2013; Vercellino and
Gmez 2013).
Griess Assay
Add 100 L of the cell-free culture or standard nitrite solution to a well of a
microtiter plate in triplicate.
Transfer 50 L of reagent A to each well.
Incubate 510 min at room temperature, protected from light.
Add 50 L of reagent B to the wells.
Incubate at room temperature for 510 min, protected from light. A purple/
magenta color will begin to form immediately.
Record the absorbance at 540 nm with the microtiter plate reader.
Compare the obtained values with the standard curve prepared with sodium
nitrite (linear between 0 and 100 M).
159
background (Arita et al. 2007), thus it is important to know minutely nitrite and
nitrate concentration in the media broth used and also to minimize as much as
possible the content of these compounds from water in the solutions.
9.2.1.2
160
M. Amenta et al.
EPR Assay
Add 220 L MGD solution to 150 mg of bacterial sample.
Transfer the sample with the spin trap to a bottom-sealed Pasteur pipette and
introduce in the spectrometer cavity for measurements.
Record the spectra at room temperature (~18 C) in the EPR spectrometer
operating at 9.5 GHz (X-band). Set the instrument at 200 G field scan, 83.886 s
sweep time, 327.68 ms time constant, 5.983 G modulation amplitude, 50 kHz
modulation frequency, and 20 mW microwave power. Different modulation
amplitude and/or microwave power can be selected to improve the resolution of
spectra depending on the spectrometer used.
Record the spectra of the TEMPOL solution with the same spectrometer
setting.
NO concentration is quantified by double integration of the three-line spectra
(Fig. 9.1a) and is referenced to the TEMPOL spectra, which have a known area
to concentration ratio.
9.2.1.3
Diamine derivatives of fluorescein (DAF) are the most widely used NO fluorescent
probes (Namin et al. 2013) and are one of the best options for NO detection due to
their high sensitivity and simple procedure. Diaminofluorescein-2 (DAF-2) was the
first product in the DAF series to become commercially available. It reacts with NO,
in presence of oxygen, resulting in the formation of a triazolo-fluorescein analogue
(DAF-2T) that exhibits a strong green fluorescence (Kojima et al. 1998a, b). DAF-2
DA, a diacetate analogue of DAF-2, was designed in particular for imaging of NO
produced in living cells (Kojima et al. 1998a). The diacetate group is removed by
cellular esterases, allowing the DAF-2 form to react with intracellular NO (Planchet
and Kaiser 2006; Mur et al. 2011). Because of the membrane permeability
161
Fig. 9.1 Nitric oxide detection in A. brasilense cultures. (a) Three-line EPR spectra characteristic
of the NO-MGD adduct recorded in pellets of A. brasilense Sp245 grown in liquid OAB medium
with NO3 or NH4+ and in cultures boiled for 5 min. The readout resulting from the detector is a
first derivative of the absorption spectrum, whose area is proportional to the concentration of
unpaired electrons (in this case NO) and the intensity is measured in an arbitrary scale, so the y
axis is omitted. (b) Kinetics of NO production by A. brasilense Sp245 determined with the fluorescent probe DAF-2 DA. Kinetics of controls without probe, non-inoculated OAB medium, and
culture plus the scavenger cPTIO (0.5 mM) are indicated. The fluorescence is showed as arbitrary
units (AU)
162
M. Amenta et al.
Fig. 9.2 A. brasilense Sp245 cells showing NO production examined by epifluorescence microscopy. The bacteria was resuspended in HEPES-NaOH with or without the scavenger cPTIO for
30 min. Bacteria was further incubated for 2 h with DAF-2 DA and examined at 1,000 magnification (Creus et al. 2005; with kind permission from Springer Science and Business Media)
Reagent Preparation
Prepare a 1 working solution of DAF-probe immediately prior to use; a 1:500 dilution in water or in 0.1 M phosphate buffer pH 7.4 is generally required. Do not store
1 solution for later use.
Observations: DAF-probes are very light-sensitive; protect the reagent and the
stained samples from direct light. Bovine Serum Albumin (BSA) and phenol red in
culture media may affect fluorescence.
Probe Assay
Transfer 100 L of the Azospirillum culture of each treatment to a 96-well
microtiter plate. Do at least three replicates per measurement.
Add 1 working solution of DAF-probe at 10 M final concentration.
Incubate 20 min at room temperature, in dark and with gentle agitation.
Place the 96-well microtiter plate into a fluorescence plate reader. The fluorescence intensity must be measured every 24 min over a period of at least 2 h.
Determinate NO concentration by comparison with the DAF-2T (or DAF-FMT)
reference curve (linear between 0 and 1,000 nmol).
163
(2) non-inoculated media with DAF-probe to establish if the media cause any
interference with the reaction, and (3) inoculated media with DAF-probe plus an
NO scavenger (e.g., cPTIO, see Sect. 9.3.1. below) for NO specificity. Figure 9.1b
shows kinetics of NO production by A. brasilense Sp245 in different conditions
using DAF-2 DA and the controls described above.
It is now established that simultaneous presence of a NO source and hydrogen
peroxide (H2O2) augments the fluorescence (Balcerczyk et al. 2005), therefore it
is important to determine if the treatment applied produces H2O2 by cellular
lysis. Check this possibility using an inverted fluorescence microscope to visualize potential increases in background fluorescence.
Only NO production kinetics can be measured with these probes because the
reaction is cumulative. For NO consumption, other method must be used.
9.2.1.4
Electrochemical Sensors
Electrochemical methods are the most practical in measuring NO in biological samples due to small electrode size, in vivo capability, nondestructive properties, minimal or no reagents requirements, high sensitivity, simplicity, and the possibility to
be operated with limited electrochemistry knowledge (Taha 2003).
Nitric oxide can be detected amperometrically using an NO-specific electrode,
typically carbon- or platinum-coated, where the voltage of the electrode is held
constant above the oxidation potential of NO (+900 mV against an AgCl reference
electrode). The current generated is a linear function of NO concentration at the
electrode surface. The available sensors are integrated, which means that there is no
need for additional reference or counter electrode. They employ a gas permeable
membrane for selectivity assurance, coupled with a controlled instrumental parameter. Membranes can be made from different compounds such as chloroprene rubber, cellulose acetate, collodion/polystyrene, polytetrafluoroethylene (PTFE), and
phenylenediamine (Davies and Zhang 2008). These sensors are very sensitive and
specific to NO because the gas permeable membrane eliminates all ions and other
compounds except gases, and the applied electrical potential and electrode material
eliminate interferences from other gases such as oxygen, carbon monoxide, carbon
dioxide, etc. Detection levels are as low as 0.30.5 nM and a linear range can be
achieved up to 25 M NO (Taha 2003; Arita et al. 2007). Being electrochemical
sensors, NO sensors are sensitive to temperature fluctuations (Taha 2003), but
newer models are available with a temperature compensation option.
Electrochemical sensors have been extensively used in Escherichia coli (Gardner
et al. 1998; Pathania et al. 2002; Bang et al. 2006) and in many other pathogenic
bacteria (Ouellet et al. 2002; Arai et al. 2005; Lama et al. 2006; Avila-Ramirez et al.
2013) to study real-time NO consumption related to hemoglobin activity. In rhizobacteria, Arruebarrena Di Palma et al. (2013) demonstrated NO production in
A. brasilense Sp245 biofilm formation employing this method.
164
M. Amenta et al.
Sensor Calibration
Before calibrating and using the sensor, it should have been polarized for few
hours, preferably overnight and immersed in calibration solution or water.
Prepare calibration solution adding 18 mL of water, 2 mL of 1 M sulfuric acid,
and approximately 20 mg of potassium iodide to a 20 mL vial. A small stirring
bar should be used for mixing and obtaining a uniform solution. When this solution becomes light yellow, due to the formation of iodine, prepare a new
solution.
Immerse the tip of the sensor in calibration solution. For the amiNO-2000,
submerge 23 mm from the tip.
Wait for the background to decrease to stable value and then zero the
background.
The in situ generation of NO is achieved by the addition of standard nitrite solution to an acidified solution in the presence of a reducing agent such as iodide
ion. In this reaction the molar ratio of nitrite to nitric oxide is 1:1 and consequently, the amount of NO generated equals the amount of nitrite added.
Add 10 L of 100 M nitrite standard solution to a 20 mL stirred calibration
solution; this result in 50 nM NO.
Before the second addition, wait until the current reaches its maximum potential
and begins to decline. This normally takes a few seconds.
Add 20 L of nitrite standard solution. A final NO concentration of 100 nM will
be obtained. Include more additions if you will. It is recommendable using calibration concentrations in the range of the test solution.
Measure the peak height of the additions. Plot current vs concentration to make
a reference curve.
Notes
Calibration should be done at the same temperature of the sample to be tested.
Other procedures can be chosen for calibration. For example, NO gas dissolved
in aqueous solution or a NO-producing agent like S-nitroso-N-acetylpenicillamine
(SNAP) can be used.
165
9.2.2
9.2.2.1
166
M. Amenta et al.
for NH4+ containing media (4.2 nmol NO per gram of bacteria) (Molina-Favero
et al. 2008).
If one suspects that the major source of NO production in the studied bacteria is
heterotrophic nitrification, that possibility must be tested by incubating in media
with NH4+ as N source. In this media, the addition of hydroxylamine or nitrite
should enhance NO production. A four-time increase in the NO production rate was
observed when A. brasilense Sp245 was incubated in the presence of 0.1 mM
hydroxylamine (concentrations up to 0.5 mM had no effect or were inhibitory;
Molina-Favero 2014).
If the bacteria produce NO by the action of a bNOS, L-arginine, the substrate of
this enzyme, must be provided in the media in concentrations about 1015 mM.
9.2.2.2
167
9.3
9.3.1
168
M. Amenta et al.
suited to either mimic an endogenous NO-related response or substitute an endogenous NO deficiency (Feelisch 1998). The pathways leading to enzymatic and/or
non-enzymatic formation of NO differ significantly among individual compound
classes, as well as their chemical reactivities and kinetics of NO release.
Several chemical NO donors are currently being used in experimental studies.
The most commonly used donor is sodium nitroprusside (SNP), a transition metal
NO complex that generates mainly NO+. Other donors frequently employed in NO
research include S-nitrosothiols, being the main members within this group
S-nitrosoglutathione (GSNO) and SNAP. The utilization of these compounds, along
with other NO donors, allowed investigators to make a remarkable progress in the
field of NO physiology. In bacteria, SNP and GSNO have been extensively used to
produce nitrossative stress (Poole and Hughes 2000; Brandes et al. 2007; AvilaRamirez et al. 2013), to mimic NO activity as signal molecule in biofilm formation
(Barraud et al. 2006; Arruebarrena Di Palma et al. 2013; Barnes et al. 2013) and in
plant biotic interactions (Creus et al. 2005; Molina-Favero et al. 2007; Scheler et al.
2013; Puppo et al. 2013), and also to complement mutations in NO production pathways (Arruebarrena Di Palma et al. 2013).
On the other hand, the use of different types, concentrations, and ways of application of the NO-releasing compounds has turned out into discrepancies between
experimental results obtained with different NO donors. Hence, in order to make the
obtained data reliable, it is necessary to complement with experiments using different inhibitors of NO synthesis or NO-scavengers and to monitor precisely the current concentration of NO in the biological sample (Neill et al. 2003).
There are several compounds available that can act as NO scavengers which differ in specificity and in their ability to gain access to the site of NO action. One of
the first compounds used as NO scavenger is oxygenated hemoglobin, which in
reaction with NO produces methemoglobin and nitrate (Doyle and Hoekstra 1984).
This reaction is fast and stoichiometric, but with low specificity for NO (Arita et al.
2007) and non-suitable for intracellular scavenging (Feelisch 1998). Another class
of compounds used as NO scavengers are the nitronyl nitroxides, which were introduced earlier for the quantification of NO by EPR (Yoshida et al. 1994). Among
them, 2-(4-carboxyphenyl)-4,5-dihydro-4,4,5,5-tetramethyl-1H-imidazolyl-1-oxy-3-oxide
(cPTIO) developed by Akaike and coworkers has proved to be very effective for
NO scavenging because of its high specificity and stoichiometric reaction with NO
(Akaike and Maeda 1996). The combination of DAF and cPTIO, although arguably
(see Arita et al. 2007 for more information), has been frequently applied for proving
in vivo NO production in animals (Pittner et al. 2003; Uruno et al. 2005; Negri et al.
2013), plants (Arita et al. 2007; Corpas et al. 2011; Tossi et al. 2012; Verma et al.
2014), and bacteria (Creus et al. 2005; Baudouin et al. 2006; Horchani et al. 2011).
Additionally, the combined action of SNP and cPTIO treatments has been used to
set up the participation of NO in several biological systems including the
Azospirillum-promoted lateral root formation in tomato seedlings (Creus et al.
2005; Molina-Favero et al. 2007).
In order to make a proper experimental design using this methodology, the investigator should be aware of the key properties and differences between NO donor
169
classes, including the mechanism and kinetics of NO release from the donor,
dependence on the external factors, toxicity of accumulated products, etc. Here are
some considerations to take into account when using either SNP or GSNO as NO
donors.
In a biological system, the redox form/s of NO (NO+, NO or NO) that is/are
actually released makes a substantial difference to the NO donors reactivity
towards other biomolecules, the profile of by-products, and the bioresponse. For
example, depending on the reaction conditions, GSNO can act as donors of NO,
NO, or NO+ (Singh et al. 1996).
It is important to know the appropriate information about the susceptibility of a
given NO donor to, e.g., oxygen, light, temperature, and changes in pH, in order
to set appropriate conditions of the experiment and also to prevent decomposition occurring in the stock solution. In this regard, the release of NO from SNP
has been shown to be caused by photochemical reactions (Leeuwenkamp et al.
1984). In contrast, GSNO was shown to release NO in the dark, even though
light seems to be necessary to initiate the decomposition process (FloryszakWieczorek et al. 2006). In general, stock solutions should be made up fresh
before use, kept on ice, and protected from light (SNP solution is prepared in
water; for GSNO preparation see Hart (1985)). Final dilutions should preferably
be prepared in assay buffer immediately before application and checked for pH.
Formation of compound-specific by-products may arise during decomposition
or metabolism, sometimes in amounts far exceeding those of NO released and
even toxic. In the case of SNP, the reduction and subsequent decomposition of
the nitrosyl complex is accompanied by cyanide release (Feelisch 1998), therefore controls with this anion should be included. Another negative control to
check reactivity of the SNP degradation by-products can be made using an old
SNP solution. On the other hand, photolytic and transition metal ion-mediated
decomposition of GSNO can lead to GSH generation (Singh et al. 1996), a molecule with an important activity as antioxidant. Controls with this molecule
should be included.
Because of the duality nature of the NO (signal molecule vs. stressing agent), the
effect of its action will depend to a large extent on its concentration. Hence, at
too high NO donor concentrationinstead of stimulationan inhibition of the
process may be observed. For instance, in Azospirillum Sp245 growing with
nitrate as N-source, the addition of GSNO induces biofilm formation in a dosedependent manner up to 50 M GSNO, but higher concentrations produce in turn
biofilm disaggregation (see Chap. 11 in this book; Arruebarrena Di Palma et al.
2013). Concentrations above 2 mM GSNO affect Azospirillum viability (own
data not published). In addition, the efficiency of NO release by SNP is better
than GSNO (Ederli et al. 2009) and consequently lower concentrations of SNP
than GSNO are required to obtain similar biological effect.
The temporal signatures of NO release differ significantly among NO donor
classes. It is rapid and transient (between 30 and 60 min) for GSNO, while for
SNP, a slow and sustained release of NO was registered, with a maximum peak
at 24 h (Simontacchi et al. 2012; Grossi and DAngelo 2005).
170
M. Amenta et al.
The product of exposure time and concentration of the NO donor determines the
quality and magnitude of the biological response to exogenously applied
NO. Thus, short-lived NO donors may have to be administered as continuous
infusions rather than in a bolus form in order to avoid the delivery of only a short
burst of NO. In most cases, NO will have to be delivered continuously over the
entire period of incubation in order to best mimic its biological activity.
9.3.2
Genetic Approach
171
Screening a random promoter library of Azospirillum, these authors found that the
NO-associated nirK gene is up-regulated by wheat seed extracts.
The post-genetic omics strategies can also be useful to understand NO function in PGPRplant interactions. Boscari et al. (2013) showed the transcriptomic
profiles during nodule development in M. truncatula-S. meliloti symbiosis and how
the expression pattern is modulated by NO. In a similar manner, Van Puyvelde et al.
(2011) studied the transcriptomic response of A. brasilense wt and Faj009 to exogenous and endogenous auxin. They found evidence of a putative connection between
the IAA and NO biosynthetic pathways since the Nap operon was up-regulated in
the ipdC mutant.
Considering that genomes of A. brasilense Sp245 (Wisniewski-Dy et al. 2011)
and Azospirillum sp. B510 (Kaneko et al. 2010), and in a close future also the Az39
genome (Cassn 2014), are published and annotated, bioinformatics tools are now
available. Using these tools and a PCR-based strategy, Arruebarrena Di Palma
(2008) failed to show the presence of a bacterial NOS-like gene in A. brasilense
Sp245, but he was able to show the presence of a putative ammonium monooxigenase gene possibly involved in NO synthesis. This gene is expressed during the
growth of A. brasilense Sp245 wt and the mutant Faj164 (Molina-Favero 2014).
The following considerations should be kept in mind when a genetic approach
is used:
The conditions needed for a mutation to be expressed. As examples, NO production in M. truncatula-S. meliloti nodules rapidly increases in hypoxia and it is in
this condition when the differences in NO levels between wt and mutants (both
rhizobia and plant) are noticed (Horchani et al. 2011). Also, the knockout mutation of A. brasilense Sp245 Faj164 in the napA gene is only relevant when nitrate
is present. Therefore, differences in NO synthesis and root growth-promoting
effects due to inoculation are only recorded in incubation media with 210 mM
nitrate (Molina-Favero et al. 2008).
Mutations can have pleiotropic effects. As a case, some A. brasilense mutated in
NR are reported to have a reduced colonization capacity (Steenhoudt et al.
2001b). For this reason, in inoculated tomato seedlings an obligated control is to
check that the number of wt and Nap mutant Faj164 cells in roots are not
significantly different (Molina-Favero et al. 2008). Specific controls must be performer in each case.
The degree in which a single mutation affects a metabolic pathway and/or the
number of genes which must to be mutated to completely knock out an activity.
Analogous to IAA, several different NO biosynthetic pathways exist in bacteria
(Schreiber et al. 2012) and in plants (Gupta et al. 2011). In the latter, NO null
mutants has not been obtained so far (Gupta et al. 2011). In A. brasilense
Sp245, there are also redundancies in metabolic pathways leading to NO production (Molina-Favero et al. 2007). As well, some compensation or a complementation can exist between plant and microorganism to produce NO (Horchani
et al. 2011).
172
9.3.3
M. Amenta et al.
Histochemical Approach
Materials
1 dye solution: 15 M DAF-2 DA in 20 mM HEPES-NaOH pH 7.5.
20 mM HEPES-NaOH buffer pH 7.5.
Bright-field and epi-fluorescence microscope with appropriate filters (e.g.,
Eclipse E 200, Nikon, Tokyo).
173
174
M. Amenta et al.
Note
Since increased NO accumulation in inoculated plants could be the consequence
of NO production by PGPR itself and/or by the plant (Creus et al. 2005), it is
recommended to use this methodology with genetically modified plants or PGPR
strains displaying diminished NO generation in order to discriminate the origin
of NO between both organisms.
9.4
With the beginning of the twenty-first century, we have faced an impressive advancement of the knowledge in the field of the diversity, biochemistry, and influence of
the rhizosphere in plant growth determination.
The results of improving our understanding of how the interactome works in
the diversity of species inhabiting the microbiota in rhizosphere should help us in
learning about the consequences of greatly disturbing the soil homeostasis. It is a
challenge nowadays identifying significant plantmicrobe interactions at the rhizosphere at individual level. Knowing the genomes composition of the association
could lead to the incorporation of plantmicrobiome interaction as a trait to be considered into plant breeding programmes (Lundberg et al. 2012; Peiffer et al. 2013;
Wagner et al. 2014).
Soils contribute with almost 20 % of the global atmospheric NO budget (Conrad
1995). Nitric oxide is a product of denitrification, nitrification, and reduction of
nitrate to ammonia through microbial activity in soils (Zumft 1997). On the other
hand, there is a significant increase in the emission of NO from soils fertilized with
either biological or inorganic products (IPCC 1995; Ruser et al. 1998), but, remarkably, no studies have been conducted to distinguish between the effects of NO emission from soils and the effect of N fertilization per se on the crops yield. Besides,
NO emission appears to be also dependent on crop species (Roelle et al. 2001), soil
temperature, and water content, in addition to the level of total extractable nitrogen
from soils (Davidson and Kingerlee 1997).
175
References
Adak S, Bilwes KS, Panda K et al (2002) Cloning, expression, and characterization of a nitric oxide
synthase protein from Deinococcus radiodurans. Proc Natl Acad Sci U S A 99:107112
Adamakis I-DS, Eleftheriou EP, Rost TL (2008) Effects of sodium tungstate on the ultrastructure
and growth of pea (Pisum sativum) and cotton (Gossypium hirsutum) seedlings. Environ Exp
Bot 63:416425
Akaike T, Maeda H (1996) Quantitation of nitric oxide using 2-phenyl-4,4,5,5tetramethylimidazoline-1-oxyl 3-oxide (PTIO). Method Enzymol 268:211221
Arai H, Hayashi M, Kuroi A et al (2005) Transcriptional regulation of the flavohemoglobin gene
for aerobic nitric oxide detoxification by the second nitric oxide-responsive regulator of
Pseudomonas aeruginosa. J Bacteriol 187(12):39603968
Archer S (1993) Measurement of nitric oxide in biological models. FASEB J 7(2):349360
Arita NO, Cohen MF, Tokuda G et al (2007) Fluorometric detection of nitric oxide with diaminofluoresceins (DAFs): applications and limitations for plant NO research. In: Polaco JC,
Lamattina L (eds) Nitric oxide in plant growth, development and stress physiology. Springer,
Berlin, pp 269280
Arruebarrena Di Palma A (2008) Produccin de xido ntrico por nitrificacin heterotrfica en
Azospirillum. Graduate Thesis Dissertation, Universidad Nacional de Mar del Plata
Arruebarrena Di Palma A, Pereyra CM, Moreno Ramirez L et al (2013) Denitrification-derived
nitric oxide modulates biofilm formation in Azospirillum brasilense. FEMS Microbiol Lett
338(1):7785
Avila-Ramirez C, Tinajero-Trejo M, Davidge KS et al (2013) Do globins in microaerophilic
Campylobacter jejuni confer nitrosative stress tolerance under oxygen limitation? Antioxid
Redox Signal 18(4):424431
Balcerczyk A, Soszynski M, Bartosz G (2005) On the specificity of 4-amino-5-methylamino-2,
7-difluorofluorescein as a probe for nitric oxide. Free Radic Bio Med 39(3):327335
Bang IS, Liu L, Vazquez-Torres A, Crouch ML et al (2006) Maintenance of nitric oxide and redox
homeostasis by the Salmonella flavohemoglobin Hmp. J Biol Chem 281(38):2803928047
Barnes RJ, Bandi RR, Wong WS et al (2013) Optimal dosing regimen of nitric oxide donor compounds for the reduction of Pseudomonas aeruginosa biofilm and isolates from wastewater
membranes. Biofouling 29(2):203212
Barraud N, Hassett DJ, Hwang SH et al (2006) Involvement of nitric oxide in biofilm dispersal of
Pseudomonas aeruginosa. J Bacteriol 188(21):73447353
176
M. Amenta et al.
Baudouin E, Pieuchot L, Engler G et al (2006) Nitric oxide is formed in Medicago truncatulaSinorhizobium meliloti functional nodules. Mol Plant Microbe Interact 19:970975
Beligni MV, Lamattina L (1999) Is nitric oxide toxic or protective? Trends Plant Sci 4:299300
Betlach M, Tiedje J (1981) Kinetic explanation for accumulation of nitrite, nitric oxide, and nitrous
oxide during bacterial denitrification. Appl Environ Microbiol 42(6):10741084
Boscari A, del Giudice J, Ferrarini A et al (2013) Expression dynamics of the Medicago truncatula
transcriptome during the symbiotic interaction with Sinorhizobium meliloti: which role for
nitric oxide? Plant Physiol 161:425439
Braker G, Schwarz J, Conrad R (2010) Influence of temperature on the composition and activity of
denitrifying soil communities. FEMS Microbiol Ecol 73(1):134148
Brandes N, Rinck A, Leichert L et al (2007) Nitrosative stress treatment of E. coli targets distinct
set of thiol-containing proteins. Mol Microbiol 66(4):901914
Cassn F (2014) Mecanismos de promocin del crecimiento en rizobacterias de inters agronmico.
El gnero Azospirillum. Actas de las IV Jornadas Bonaerenses de Microbiologa de Suelos para
una Agricultura Sustentable. Argentina. pp 1213
Chen Y, Rosazza PN (1994) A bacterial nitric oxide synthase from a Nocardia species. Biochem
Biophys Res Commun 203:12511258
Choi W, Chang M, Han J et al (1997) Identification of nitric oxide synthase in Staphylococcus
aureus. Biochem Biophys Res Commun 237:554558
IPCC Intergovernmental Panel on Climate Change (1995) Climate change 1995. The science of
climate change. Contribution of Working Group I to the Second Assessment Report of the
Intergovernmental Panel on Climate Change. London: Cambridge University Press, pp. 588
Cohen MF, Lamattina L, Yamasaki H (2010) Nitric oxide signaling by plant-associated bacteria.
In: Hayat S, Mori M, Pichtel J, Ahmad A (eds) Nitric oxide in plant physiology. Wiley,
Weinheim, pp 161172
Conrad R (1995) Soil microbial processes involved in production and consumption of atmospheric
trace gases. Adv Microb Ecol 14:207250
Corpas FJ, Leterrier M, Valderrama R et al (2011) Nitric oxide imbalance provokes a nitrosative
response in plants under abiotic stress. Plant Sci 181(5):604611
Costacurta A, Keijers V, Vanderleyden J (1994) Molecular cloning and sequence analysis of an
Azospirillum brasilense indole-3-pyruvate decarboxylase gene. Mol Gen Genet 243:463472
Creus CM, Graziano M, Casanovas EM et al (2005) Nitric oxide is involved in the Azospirillum
brasilense-induced lateral root formation in tomato. Planta 221:297303
Cutruzzol F (1999) Bacterial nitric oxide synthesis. Biochem Biophys Acta 1411:231249
Davidson EA, Kingerlee W (1997) A global inventory of nitric oxide emissions from soils. Nutr
Cycl Agroecosyst 48:3750
Davies IR, Zhang X (2008) Nitric oxide selective electrodes. Method Enzymol 436:6395
Davydov R, Sudhamsu J, Lees NS et al (2009) EPR and ENDOR characterization of the reactive
intermediates in the generation of NO by cryoreduced oxy-nitric oxide synthase from
Geobacillus stearothermophilus. J Am Chem Soc 131:1449314507
del Giudice J, Cam Y, Damiani I et al (2011) Nitric oxide is required for an optimal establishment
of the Medicago truncatula-Sinorhizobium meliloti symbiosis. New Phytol 191:405417
Delledonne M (2005) NO news is good news for plants. Curr Opin Plant Biol 8:390396
Doyle MP, Hoekstra JW (1984) Oxidation of nitrogen oxides by bound dioxygen in hemoproteins.
J Inorg Chem 14:351358
Ederli L, Reale L, Madeo L et al (2009) NO release by nitric oxide donors in vitro and in planta.
Plant Physiol Biochem 47(1):4248
Feelisch M (1998) The use of nitric oxide donors in pharmacological studies. Naunyn
Schmiedebergs Arch Pharmacol 358(1):113122
Ferroni FM, Guerrero SA, Rizzi AC et al (2012) Overexpression, purification, and biochemical
and spectroscopic characterization of copper-containing nitrite reductase from Sinorhizobium
meliloti, 2011. Study of the interaction of the catalytic copper center with nitrite and NO.
J Inorg Biochem 114:814
177
Fiddler RM (1977) Collaborative study of modified AOAC method of analysis for nitrite in meat
and meat products. J Assoc Off Anal Chem 60:594599
Field SJ, Thorndycroft FH, Matorin AD et al (2008) The respiratory nitric oxide reductase (norBC)
from Paracoccus denitrificans. Method Enzymol 437:79101
Floryszak-Wieczorek J, Milczarek G, Arasimowicz M et al (2006) Do nitric oxide donors mimic
endogenous NO-related response in plants? Planta 224(6):13631372
Garca Rubio I (2004) Aplicaciones Biolgicas de la EPR. Cuarta Escuela de Resonancia
Paramagntica Electrnica. Universidad de Alicante, Alicante, pp 151183
Gardner PR, Gardner AM, Martin LA et al (1998) Nitric oxide dioxygenase: an enzymic function
for flavohemoglobin. Proc Natl Acad Sci U S A 95(18):1037810383
Griess PJ (1879) Bemerkungen zu der abhandlung der H.H. Weselsky und Benedikt Ueber einige
azoverbindungen. Ber Dtsch Chem Ges 12:426428
Grossi L, DAngelo S (2005) Sodium nitroprusside: mechanism of NO release mediated by
sulfhydryl-containing molecules. J Med Chem 48:26222626
Guevara I, Iwanejko J, Dembiska-Kie A et al (1998) Determination of nitrite/nitrate in human
biological material by the simple Griess reaction. Clin Chim Acta 274(2):177188
Gupta KJ, Fernie AR, Kaiser WM et al (2011) On the origins of nitric oxide. Trends Plant Sci
16:160168
Harper JE, Nicholas JC (1978) Nitrogen metabolism of soybeans I. Effect of tungstate on nitrate
utilization, nodulation, and growth. Plant Physiol 62:662664
Hart TW (1985) Some observations concerning the S-nitroso and S-phenylsulphonyl derivatives of
L-cysteine and glutathione. Tetrahedron Lett 26:20132016
Hille R (2002) Molybdenum and tungsten in biology. Trends Biochem Sci 27:360367
Hogg N (2010) Detection of nitric oxide by electron paramagnetic resonance spectroscopy. Free
Radic Bio Med 49:122129
Horchani F, Prvot M, Boscari A et al (2011) Both plant and bacterial nitrate reductases contribute
to nitric oxide production in Medicago truncatula nitrogen-fixing nodules. Plant Physiol
155:10231036
Jetten MSM, Logemann S, Muyzer G et al (1997) Novel principles in the microbial conversion of
nitrogen compounds. Anton Leeuw 71:7593
Kakutani T, Watanabe H, Arima K et al (1981) Purification and properties of a copper-containing
nitrite reductase from a denitrifying bacterium, Alcaligenes faecalis strain S-6. J Biochem
89(2):453461
Kaneko T, Minamisawa K, Isawa T et al (2010) Complete genomic structure of the cultivated rice
endophyte Azospirillum sp. B510. DNA Res 17:3750
Kleschyov AL, Wenzel P, Munzel T (2007) Electron paramagnetic resonance (EPR) spin trapping
of biological nitric oxide. J Chromatogr B 851:1220
Kletzin A, Adams M (1996) Tungsten in biological systems. FEMS Microbiol Lett 18(1):563
Kojima H, Nakatsubo N, Kikuchi K et al (1998a) Detection and imaging of nitric oxide with novel
fluorescent indicators: diaminofluoresceins. Anal Chem 70:24462453
Kojima H, Sakurai K, Kikuchi K et al (1998b) Development of a fluorescent indicator for nitric
oxide based on the fluorescein chromophore. Chem Pharm Bull 46:373375
Lama A, Pawaria S, Dikshit KL (2006) Oxygen binding and NO scavenging properties of truncated hemoglobin, HbN, of Mycobacterium smegmatis. FEBS Lett 580(17):40314041
Lamattina L, Garca-Mata C, Graziano M et al (2003) Nitric oxide: the versatility of an extensive
signal molecule. Annu Rev Plant Biol 54:109136
Leeuwenkamp OR, Van Bennekom WP, Van der Mark EJ et al (1984) Nitroprusside, antihypertensive drug and analytical reagent. Review of (photo)stability, pharmacology and analytical properties. Pharm Weekbl Sci 6:129140
Lundberg DS, Lebeis SL, Paredes SH et al (2012) Defining the core Arabidopsis thaliana root
microbiome. Nature 488:8690
Meakin GE, Bueno E, Jepson B et al (2007) The contribution of bacteroidal nitrate and nitrite
reduction to the formation of nitrosylleghaemoglobin complexes in soybean root nodules.
Microbiology 153:411419
Mendel RR (2007) Biology of the molybdenum cofactor. J Exp Bot 58:22892296
178
M. Amenta et al.
Molina-Favero C (2014) Rol del xido ntrico (NO) en la asociacin de Azospirillum con races de
plantas superiores. Doctoral dissertation, Universidad Nacional de Mar del Plata
Molina-Favero C, Creus MC, Lanteri ML et al (2007) Nitric oxide and plant growth promoting
rhizobacteria: common features influencing root growth and development. Adv Bot Res
46:133
Molina-Favero C, Creus CM, Simontacchi M et al (2008) Aerobic nitric oxide production by
Azospirillum brasilense Sp245 and its influence on root architecture in tomato. Mol Plant
Microbe Interact 21:10011009
Mora-Ravelo SG, Reyes FG, Moreno JP et al (2013) Dinamic of bacteria desnitrificants and nitrificants in the rizospheric of wheat with slow release of fertilizer, irrigated with waste or well
water. Adv Microbiol 3(04):343
Mur LAJ, Mandon J, Cristescu SM et al (2011) Methods of nitric oxide detection in plants: a commentary. Plant Sci 181:509519
Murad F (1999) Discovery of some of the biological effects of nitric oxide and its role in cell signaling (Nobel lecture). Biosci Rep 38(1314):18561868
Nagata M, Murakami E, Shimoda Y et al (2008) Expression of a class 1 hemoglobin gene and
production of nitric oxide in response to symbiotic and pathogenic bacteria in Lotus japonicus.
Mol Plant Microbe Interact 21:11751183
Namin SM, Nofallah S, Joshi MS et al (2013) Kinetic analysis of DAF-FM activation by NO:
toward calibration of a NO-sensitive fluorescent dye. Nitric Oxide 28:3946
Negri P, Maggi M, Correa-Aragunde N et al (2013) Nitric oxide participates at the first steps of
Apis mellifera cellular immune activation in response to non-self recognition. Apidologie
44(5):575585
Neill SJ, Desikan R, Hancock JT (2003) Nitric oxide signalling in plants. New Phytol 159:1135
Ouellet H, Ouellet Y, Richard C et al (2002) Truncated hemoglobin HbN protects Mycobacterium
bovis from nitric oxide. Proc Natl Acad Sci U S A 99(9):59025907
Pathania R, Navani NK, Gardner AM et al (2002) Nitric oxide scavenging and detoxification by
the Mycobacterium tuberculosis haemoglobin, HbN in Escherichia coli. Mol Microbiol
45(5):13031314
Peiffer JA, Spor A, Koren O, Jin Z et al (2013) Diversity and heritability of the maize rhizosphere
microbiome under field conditions. Proc Natl Acad Sci U S A 110:65486553
Pittner J, Liu R, Brown R et al (2003) Visualization of nitric oxide production and intracellular
calcium in juxtamedullary afferent arteriolar endothelial cells. Acta Physiol Scand 179(3):
309317
Planchet E, Kaiser WM (2006) Nitric oxide (NO) detection by DAF fluorescence and chemiluminescence: a comparison using abiotic and biotic NO sources. J Exp Bot 57:30433055
Poole RK, Hughes MN (2000) New functions for the ancient globin family: bacterial responses to
nitric oxide and nitrosative stress. Mol Microbiol 36:775783
Pothier JF, Wisniewski-Dy F, Weiss-Gayet M et al (2007) Promoter-trap identification of wheat
seed extract-induced genes in the plant-growth-promoting rhizobacterium Azospirillum brasilense Sp245. Microbiology 153:36083622
Puntarulo S, Jasid S, Boveris AD et al (2009) Electron paramagnetic resonance as a tool to study
nitric oxide generation in plants. In: Hayat S, Mori M, Pichtel J, Ahmad A (eds) Nitric oxide in
plant physiology. Wiley, Weinheim, pp 1730
Puppo A, Pauly N, Boscari A et al (2013) Hydrogen peroxide and nitric oxide: key regulators of
the legume-Rhizobium and mycorrhizal symbioses. Antioxid Redox Signal 18(16):
22022219
Radoul M, Barak Y, Rinaldo S et al (2012) Solvent accessibility in the distal heme pocket of the
nitrosyl d1-heme complex of Pseudomonas stutzeri cd1 nitrite reductase. Biochemistry
51:91929201
Roelle PA, Aneja VP, Gay B, Geron C, Pierce T (2001) Biogenic nitric oxide emissions from cropland soils. Atmos Environ 35:115124
179
Ruser R, Flessa H, Schilling R, Steindl H, Beese F (1998) Soil compactation and fertilization
effects on nitrous oxide and methane fluxes in potato fields. Soil Sci Soc Am J 62:15871595
Sari MA, Moali C, Boucher JL et al (1998) Detection of a nitric oxide synthase possibly involved
in the regulation of the Rhodococcus sp R312 nitrite hydratase. Biochem Biophys Res Commun
250:364368
Scheler C, Durner J, Astier J (2013) Nitric oxide and reactive oxygen species in plant biotic interactions. Curr Opin Plant Biol 16(4):534539
Schreiber F (2006) Detection and function of nitric oxide in microbial communities. Doctoral dissertation, University of Bremen
Schreiber F, Wunderlin P, Udert KM et al (2012) Nitric oxide and nitrous oxide turnover in natural
and engineered microbial communities: biological pathways, chemical reactions, and novel
technologies. Front Microbiol 23:372. doi:10.3389/fmicb.2012.00372
Shimoda Y, Nagata M, Suzuki A et al (2005) Symbiotic rhizobium and nitric oxide induce gene
expression of non-symbiotic hemoglobin in Lotus japonicus. Plant Cell Physiol 46:99107
Simontacchi M, Buet A, Lamattina L, Puntarulo S (2012) Exposure to nitric oxide increases the
nitrosyl-iron complexes content in sorghum embryonic axes. Plant Sci 183:159166
Singh RJ, Hogg N, Joseph J et al (1996) Mechanism of nitric oxide release from S-nitrosothiols.
J Biol Chem 271(31):1859618603
Stamler JS (1994) Redox signaling: nitrosylation and related target interactions of nitric oxide.
Cell 78:931936
Steenhoudt O, Keijers V, Okon Y et al (2001a) Identification and characterization of a periplasmic
nitrate reductase in Azospirillum brasilense Sp245. Arch Microbiol 175:344352
Steenhoudt O, Ping Z, Vande Broek A et al (2001b) A spontaneous chlorate-resistant mutant of
Azospirillum brasilense Sp245 displays defects in nitrate reduction and plant root colonization.
Biol Fertil Soils 33:317322
Stuehr DJ (1997) Structure-function aspects in the nitric oxide synthases. Annu Rev Pharmacol
37:339359
Sun J, Zhang X, Broderick M et al (2003) Measurement of nitric oxide production in biological
systems by using Griess reaction assay. Sensors 3(8):276284
Taha ZH (2003) Nitric oxide measurements in biological samples. Talanta 61(1):310
Tossi V, Lombardo C, Cassia R et al (2012) Nitric oxide and flavonoids are systemically induced
by UV-B in maize leaves. Plant Sci 193:103109
Uruno A, Sugawara A, Kanatsuka H et al (2005) Upregulation of nitric oxide production in vascular endothelial cells by all-trans retinoic acid through the phosphoinositide 3-kinase/Akt pathway. Circulation 112(5):727736
Van Puyvelde S, Cloots L, Engelen K et al (2011) Transcriptome analysis of the rhizosphere bacterium Azospirillum brasilense reveals an extensive auxin response. Microb Ecol 61:723728
Vanoni MA, Edmondson DE, Zanetti G et al (1992) Characterization of the flavins and the ironsulfur centers of glutamate synthase from Azospirillum brasilense by absorption, circular
dichroism, and electron paramagnetic resonance spectroscopies. Biochemistry 31:46134623
Venkataraman S, Martin SM, Schafer FQ et al (2002) Detailed methods for the quantification of
nitric oxide in aqueous solutions using either an oxygen monitor or EPR. Free Radic Bio Med
29:580585
Vercellino M, Gmez MA (2013) Denitrifying capacity of rhizobial strains of Argentine soils and
herbicide sensitivity. Ann Microbiol 63(4):15631570
Verdon CP, Burton BA, Prior RL (1995) Sample pretreatment with nitrate reductase and glucose6-phosphate dehydrogenase quantitatively reduces nitrate while avoiding interference by
NADP+ when the Griess reaction is used to assay for nitrite. Anal Biochem 224:502508
Verma A, Malik CP, Gupta VK (2014) Sodium nitroprusside-mediated modulation of growth and
antioxidant defense in the in vitro raised plantlets of peanut genotypes. Peanut Sci 41(1): 2531
Wagner MR, Lundberg DS, Coleman-Derr D et al (2014) Natural soil microbes alter flowering
phenology and the intensity of selection on flowering time in a wild Arabidopsis relative. Ecol
Lett 17:717726
180
M. Amenta et al.
Chapter 10
10.1
181
182
L. Pereg
A. lipoferum
+
+
+
A. brasilense
A. amazonense
+
A. halopraeferens
+
+
A. irakense
+
10
183
184
L. Pereg
Tn5-induced flcA mutants do not flocculate, do not transform from motile vibriod
cells into non-motile cyst-like forms, and lack the exopolysaccharide material on
the cell surface under all conditions (Pereg Gerk et al. 1998). This has strong effects
on the colonisation efficiency of plant roots by Azospirillum, as they depend on the
production of exopolysaccharides to firmly attach to the root surface (Katupitiya
et al. 1995; Pereg Gerk et al. 1998, 2000; Pereg Gerk 2004).
Stress conditions induce aggregation, or flocculation, in broth cultures of
Azospirillum. Phase-contrast microscopy was first used to show a transition from
motile, vibriod cells to non-motile encystic forms during the formation of flocs,
which also show higher resistance to desiccation than the vegetative cells (Sadasivan
and Neyra 1985a, b). The extent of flocculation varies among species, and various
strains of the same species differ in their extent of flocculation, e.g., A. brasilense
Cd forms smaller and lesser flocs than Sp7 under several conditions tested (Burdman
et al. 2000a). Some spontaneous flocculation mutants were isolated from the free
cells suspension of a flocculating culture (Pereg Gerk et al. 2000) and by transposon
mutagenesis of the flcA gene (Pereg Gerk et al. 1998). Interestingly, while flagella
were shown to be involved in attachment to plants (Moens et al. 1995), nonflagelated mutants were not affected in their ability to aggregate (Burdman et al.
1998; Pereg Gerk et al. 2000).
The terms aggregation and flocculation are being used to describe the same phenomenon: the attachment of cells to one another in liquid cultures to form clumps
(aggregates). These aggregates grow into macroscopic flocs, making flocculation
observable by the naked eye. While aggregation has been considered to be a synonymous word for flocculation by some authors (Burdman et al. 2000b), there is a
difference in the way they are measured experimentally and the way they are
referred to in numerous publications: flocculation assays measure flocs that are left
to occur spontaneously in specialised liquid media under agitation. Aggregation is
often measured quantitatively using spectroscopy and a bioassay for aggregation
has been developed with further processing of the cultures. Typical protocols for
flocculation and aggregation assays are given below.
10.1.1
Flocculation
10
185
10.1.2
Aggregation
10.1.2.1
This assay was modified by Burdman et al. (1999) from the method of Madi and
Henis (1989). In this assay suspensions containing aggregates are transferred to
conical tubes and allowed to stand for 20 min at 24 C. During that time, aggregates
sink to the bottom of the tube and the free cells still float in the suspension. The
turbidity of the suspension is then being measured at A540 (OD1). The culture is
then homogenised (for 1 min) and the total turbidity measured immediately (OD2).
The percentage aggregation (PA) is calculated according to the formula:
PA = (OD2 OD1) 100/OD2.
10.1.2.2
In this bioassay, cultures are being grown in high or low C:N medium (Burdman
et al. 1999) and then centrifuged twice (4,000 g, 10 min) to yield approximately
0.3 g total bacterial dry weight. Harvested cells from high C:N medium are resuspended in 10 mM potassium phosphate buffer (pH 6.8) and then sonicated for 20 s
on ice to temporarily disrupt the cell aggregates. The sonicated suspension is then
centrifuged (5,000 g, 15 min) and the supernatant further filtered through 0.45 m
and made to 60 mL with phosphate buffer (designated sonicate extract). The pelleted cells from both high and low C:N media are also kept and resuspended in
10 mL of clean phosphate buffer (bacterial suspensions). Each bacterial suspension
(0.5 mL) is then being treated with 10 mL of sonicate extract (or clean phosphate
186
L. Pereg
buffer as control) and 4.5 mL of clean phosphate buffer and incubated under agitation (150 rpm) at 30 C for 23 h. The extent of aggregation is then measured as
described above.
Aggregation and flocculation in Azospirillum were found to be affected by a
range of chemical and physical factors such as the sources of C and N, the ratio of
C:N, pH, oxygen levels, and agitation (reviewed in Burdman et al. 2000a, b).
Aggregation involves extracellular compounds such as fimbriae and pili (reviewed
in Burdman et al. 2000b), proteins, including major outer membrane protein,
A. brasilense Cd MOMP (Burdman et al. 2001), and polysaccharides, with arabinose content of exopolysaccharides playing a role in the ability of A. brasilense Sp7
cells to aggregate (Bahat-Samet et al. 2004).
10.2
10
187
Rhizobium led to a great interest in the role of plasmid DNA in Azospirillum. The
most studied is the p90 megaplasmid of Azospirillum, which carries genes involved
in plant-bacterial interaction, such as: (1) exoBC, encoding for EPS production, (2)
nodPQ, homologous to nodulation genes in Rhizobium, (3) mot1,2,3 genes, involved
in the production of the polar and lateral flagella, and (4) genes involved in IAA
synthesis and in chemotaxis (Michiels et al. 1989; Katsy et al. 1990; Onyeocha et al.
1990; Van Rhijn et al. 1990; Vieille and Elmerich 1990; Elmerich 1991; De Troch
et al. 1994). Croes et al. 1991, proposed to denote the p90 plasmid as a rhizocoenotic plasmid, pRhico. In contrast to p90, the plasmid p115 is easily lost in A. brasilense and its loss affects neither IAA production, free-living nitrogen fixation,
motility, and chemotaxis, nor the attachment to plant roots (Vande Broek and
Vanderleyden 1995).
Specific labelling of Azospirillum strains with fluorescently labelled phylogenetic oligonucleotide probes (Assmus et al. 1995) and with fluorescently labelled
monoclonal antibodies (Schloter et al. 1993), using the confocal laser scanning
microscope, was proved to be a useful tool for detection of endophytic as well as
rhizospheric bacteria. Washing wheat roots colonised by A. brasilense Cd removed
most of the root-external bacteria and revealed a smaller internal root population
(Bashan et al. 1986). A. brasilense Cd was also detected internally, within the cortex, using the immuno-gold labelling (Levanony et al. 1989). Schloter et al. (1994b)
examined colonisation of wheat by A. brasilense strains Sp7 and Sp245 using
strain-specific monoclonal antibodies and found that both under axenic and field
conditions, strain Sp245 colonised the root xylem, while Sp7 could only be detected
on the root surface. Gough et al. (1997) have showed colonisation of the root interior of the dicot Arabidopsis thaliana by Azorhizobium caulinodans, following
attachment to cracks at the lateral root emergence sites. A. brasilense Sp245 was
also found at the sites of lateral root emergence, as well as at the root hair zone, during the first few days of association (Vande Broek et al. 1993). Although strain Sp7
was not found internally, it initially colonised the sites of lateral root emergence and
the root hair zone (Katupitiya et al. 1995).
Detection of Azospirillum on plant roots lost its complexity with the recent
development of genetic tools, such as the lacZ (Casadaban et al. 1980, 1983; Drahos
et al. 1986; Pardy 1994) and the gusA labelled strains (Wilson et al. 1995). The lacZ
fusion encodes the enzyme -galactosidase, which hydrolyses -galactoside bonds
and can use both o-nitrophenol--D-galactoside (ONPG) and 5-bromo-4-chloro-3indolyl--D-galactosidase (X-Gal) as substrates, to give coloured products (yellow
or blue, respectively). GusA encodes for the enzyme -glucuronidase, which hydrolyses a variety of glucuronide substrates to give coloured or fluorescent products
(Wilson 1995). Using simple and fast procedures, it is possible to follow the pattern
of colonisation and to estimate the quantity of bacteria on roots inoculated with
strains carrying a constitutive lacZ or gusA fusion (Arsne et al. 1994; Wilson 1995;
Wilson et al. 1995). Since the lacZ and gusA fusions lack their own promoters, they
can also be fused to the promoters of other genes (such as nifH-lacZ fusion), estimating their expression in cultures and in association with plants (Arsne et al. 1994;
Vande Broek et al. 1993). A protocol typically used to observe and quantify root
colonisation in vitro using a constitutively expressed lacZ fusion is described below.
L. Pereg
188
10.2.1
10.2.1.1
Sterilised seeds are individually transferred with sterile forceps onto YMA agar
plates for germination and incubated at the appropriate temperature (depending on
the plant) until germinated. Germinated seeds, from uncontaminated plates only, are
transferred into sterile glass tubes (e.g., size 20 150 mm) pre-washed by ethanol
and DW. The tubes contain a piece of folded filter paper (about 100 10 mm) to
support the seedlings and nitrogen-free hydroponic solution (in the above tube size,
typically 15 mL) and are covered by additional test tubes slightly larger in diameter
(25 mm) as shown in Fig. 10.1a. The plants are grown in a controlled environment
under light/dark cycle at the appropriate temperature for each plant species.
HOCH2
HO
O O
OH
OH
H2O
ONPG
orthonitrophenylgalactozide
NO2
- Galactosidase
cover
tube
HOCH2
HO
O OH
OH
OH
plant growth
tube
support
paper
orthonitrophenol
HO
NO2
10
189
Several days old seedlings (when root system is submerged in the solution, or as
desired) are inoculated with 0.1 mL of Azospirillum culture (about 5 106 cells per mL
of hydroponic solution). The Azospirillum cells contain pLA-lacZ, a constitutive
lacZ fusion, which is expressed in all physiological conditions. The cultures are at
late logarithmic phase and, in the case of A. brasilense, grown in minimal lactate
medium supplemented with 10 mM of ammonium chloride, as described by Arsne
et al. (1994). Periodically after inoculation, the plants are assayed for -galactosidase
activity (quantitative assay) or by X-gal in situ staining of bacteria (qualitative assay).
10.2.1.2
The pattern of colonisation is studied by in situ staining of roots with 5-bromo-4chloro-3-indolyl--D-galactosidase (X-Gal), which allows examination of the spatial distribution of the bacteria (Fig. 10.2).
The extent of colonisation is estimated using the -galactosidase activity assay,
which is indicative of the number of bacteria associated with the root system (Arsne
et al. 1994; Pereg Gerk et al. 1998). This assay is based on the ability of the enzyme
to hydrolyse the -galactoside bond of the o-nitrophenol--D-galactoside (ONPG)
substrate (Fig. 10.1b), to yield a yellow product, orthonitrophenol, which can be
quantified using absorption spectrometry.
Fig. 10.2 Light micrograph of A. brasilense Sp7 [pLA-lacZ] cells on the surface of wheat roots.
The Azospirillum cells contain pLA-lacZ, a constitutive lacZ fusion, which is expressed in all
physiological conditions. They appear in shades of green to blue following X-Gal staining. Bar
size is 5 m
190
10.2.1.3
L. Pereg
10.2.1.4
Intact roots are grinded in 2 mL of Z buffer (pH 7.0) and the solution incubated in
small vials at 50 C for 15 min to repress the background -galactosidase enzyme
produced by the plants. After cooling, each sample is supplemented with: 5 L of
-mercaptoethenol (to stabilise the bacterial enzyme), as well as 20 L of 0.1 %
sodium dodecyl sulfate (SDS) and 40 L of chloroform (to lyse the bacterial cells).
The tubes are vigorously vortexed and duplicate portions of 500 L transferred into
clean tubes. Another portion of 200 L is transferred into a separate tube for protein
determination. The samples can be stored at 4 C for a maximum of 48 h if they are
not used immediately.
10.2.1.5
Freshly made 1 N NaOH solution (200 L) is mixed well in a microfuge tube with
200 L of the grinded roots in Z buffer (pH 7) prepared above. The samples are
incubated for 5 min in a boiling water bath and, after cooling, neutralised with
400 L of 0.5 N HCl. The tubes are centrifuged for 5 min (14,000 g) to eliminate
cell debris. A sample of the supernatant (200 L) is mixed with 200 L of Bio-rad
reagent and 600 L of DW and the A measured at 595 nm. For the preparation of a
protein calibration curve, 200 L of Z buffer (pH 7.0) containing -mercaptoethanol
(0.5 L) and SDS (2 L of 0.1 % solution) are supplemented with 030 g of BSA
and assayed in the same way as described above.
Table 10.2 Z buffers and X-Gal solution
Z buffer pH 7.4
In DW:
Na2HPO47H2O, 70 mM
Z buffer pH 7.0
In DW:
Na2HPO47H2O, 60 mM
NaH2PO4H2O, 30 mM
KCl, 10 mM
NaH2PO4H2O, 40 mM
KCl, 10 mM
MgSO47H2O, 1 mM
MgSO47H2O, 1 mM
X-Gal solution
Add:
20 L X-Gal (20 mg/mL in
dimethyl-formamide)
25 L K4[Fe(CN)6], 100 mM
25 L K3[Fe(CN)6] 3H2O,
100 mM
400 L Z buffer (pH 7.4)
10
191
10.2.1.6
ONPG solution
In 10 mL phosphate buffer or in 10 mL Z buffer
(pH 7.0) dissolve 40 mg of ONPG
-Galactosidase Activity
The tubes containing 500 L samples are pre-incubated at 28 C for 510 min and
then each tube is supplemented with 100 L of freshly made ONPG solution
(Table 10.3, Fig. 10.1b), mixed well by vortexing, and the time of the ONPG addition is recorded (start time).
The tubes are continuously incubated at 28 C until yellow colouration is
observed and then the reaction is stopped with 250 L of 1 M Na2CO3 (stop time).
The duplicate control samples should be treated in a similar way and incubated for
the same period of time as the reaction tubes, except that the stop solution (Na2CO3)
is added at the same time as the ONPG solution.
The plant debris in the reaction and in the control tubes are spun down by centrifugation for 10 min (14,000 g). The absorbance of the supernatant is measured
at 420 nm and at 550 nm, using the supernatant of the control sample as a blank for
each reaction. The results are presented as Miller Units/mg plant protein/min.
10.3
A. brasilense Cd attaches to soil and peat by means of surface fibrillar material and
could not be desorbed by washing (Bashan and Levanony 1988a, b; Bashan et al.
1991b), a factor which can assist the bacteria from being washed by soil flooding into
deeper soil areas unfavourable for survival (Elmerich et al. 1992). The question may
arise whether this feature could be a disadvantage in regard to plant root colonisation.
However, adsorption to soil particles was decreased in the presence of plant exudates
(Bashan and Levanony 1988a). The assays to examine Azospirillum attachment to
soil, sand, and peat particles are described in Bashan and Levanony (1988a, b).
10.4
192
L. Pereg
and bacterial leaf and vascular diseases of tomato (Romero et al. 2003; Bashan and
de Bashan 2002a, b). A. brasilense Sp245 protects plants of Prunus cerasifera L.
clone Mr. S 2/5 against Rhizoctonia spp., which caused total loss of plants, with a
plant survival rate of nearly 100 % (Russo et al. 2008). However, the exact mechanisms involved in Azospirillum pathogen and disease suppression are not yet established and it is suggested that the protective mechanism may be explained by the
plant growth promotion effects that are often associated with Azospirillum inoculation or by the mechanisms used by Azospirillum to outcompete other rhizospheric
bacteria (Romero et al. 2003; Bashan and de Bashan 2002a; Pereg Gerk 2004).
Plant-associated A. brasilense strains enhance the growth of field crops via the
production of plant growth factors, the promotion of root proliferation, and by
improving water uptake (Sarig et al. 1988; Bashan and Levanony 1990). Azospirillum
species have a highly versatile metabolism that allows them to survive under the
widely variable conditions often occurring in soil. For example, several Azospirillum
strains are equipped with a very efficient iron uptake system (Hartmann and Zimmer
1994; Shah et al. 1992). They produce low-molecular-weight chelating substrates,
mainly phenolate compounds called siderophores with high affinity for Fe3+
(Vazquez-Cruz et al. 1992; Tapia-Hernandez et al. 1990). In principle, they can thus
selectively deprive other microorganisms, including pathogens, of this essential element. A. brasilense strains REC2 and REC3 produce catechol-type siderophores,
including salicylic acid (detected by thin layer chromatography coupled with fluorescence spectroscopy and gas chromatographymass spectrometry analysis), with
antifungal activity against Colletotrichum acutatum M11 and a reduction of anthracnose symptoms on strawberry plants (Tortora et al. 2011). In addition, many strains
of A. brasilense and A. lipoferum have the capacity to produce bacteriocins, which
inhibit closely related bacteria in vitro (Oliveira and Drozdowicz 1988). Somers
et al. (2005) isolated antimicrobial compound from A. brasilense culture extracts,
which was identified as the auxin-like molecule, phenylacetic acid (PAA).
A. brasilense Sp7 colonizes the root surface of cotton seedlings and protects
them against the soilborne disease black root rot, with almost 100 % protection
when the seedlings are first inoculated with the bacteria before planting into
pathogen-infested soil (Lily Pereg and Jason Molynoux, unpublished). The fungal
pathogen causing black root rot, Thielaviopsis basicola, has to come into contact
with the root surface to progress to the biotrophic phase of the infection cycle (Mauk
and Hine 1988; Hood and Shew 1997). Therefore, we suggest that, in addition to the
mechanisms listed above, Azospirillum strains that colonize the root exterior may
also mask the fungalplant interaction zones on the root surface, creating a physical
barrier between the pathogen and its host.
References
Arsne F, Katupitiya S, Kennedy IR, Elmerich C (1994) Use of lacZ fusions to study the expression of nif genes of Azospirillum brasilense in association with plants. Mol Plant Microbe
Interact 7:748757
Assmus B, Hutzler P, Kirchhof G, Amann R, Lawrence JR, Hertmann A (1995) In situ localization
of Azospirillum brasilense in the rhizosphere of wheat with fluorescently labeled, rRNA-targeted
193
oligonucleotide probes and scanning confocal laser microscopy. Appl Environ Microbiol
61:10131019
Bahat-Samet E, Castro-Sowinski S, Okon Y (2004) Arabinose content of extracellular polysaccharide plays a role in cell aggregation of Azospirillum brasilense. FEMS Microbiol Lett
237:195203
Bakanchikova TI, Lobanok EV, Pavlova-Ivanova LK, Redkina TV, Nagapetyan ZA, Majsuryan
AN (1993) Inhibition of tumor formation process in dicotyledonous plants by Azospirillum
brasilense strains. Mikrobiologija 62:515523
Barak R, Nur I, Okon Y (1983) Detection of chemotaxis in Azospirillum brasilense. J Appl
Bacteriol 53:399403
Bashan Y, de Bashan LE (2002a) Protection of tomato seedlings against infection by Pseudomonas
syringae pv. tomato by using the plant growth-promoting bacterium Azospirillum brasilense.
Appl Environ Microbiol 68:26372643
Bashan Y, de Bashan LE (2002b) Reduction of bacterial speck (Pseudomonas syringae pv. tomato)
of tomato by combined treatments of plant growth-promoting bacterium, Azospirillum brasilense, streptomycin sulfate, and chemo-thermal seed treatment. Eur J Plant Pathol 108:
821829
Bashan Y, Levanony H (1988a) Active attachment of Azospirillum brasilense Cd to quartz sand and
to a light-textured soil by protein bridging. J Gen Microbiol 134:22692279
Bashan Y, Levanony H (1988b) Adsorption of the rhizosphere bacterium Azospirillum brasilense
Cd to soil, sand and peat particles. J Gen Microbiol 134:18111820
Bashan Y, Levanony H (1990) Current status of Azospirillum inoculation technology: Azospirillum
as a challenge for agriculture. Can J Microbiol 36:591608
Bashan Y, Levanony H, Klein E (1986) Evidence for a weak active external adsorption of
Azospirillum brasilense Cd to wheat roots. J Gen Microbiol 132:30693073
Bashan Y, Levanony H, Whitmoyer RE (1991a) Root surface colonization of non-cereal crop
plants by pleomorphic Azospirillum brasilense Cd. J Gen Microbiol 137:187196
Bashan Y, Mitiku G, Whitmoyer RE, Levanony H (1991b) Evidence that fibrillar anchoring is
essential for Azospirillum brasilense Cd attachment to sand. Plant and Soil 132:7383
Bastarrachea F, Zamudio M, Rivas R (1988) Non-encapsulated mutants of Azospirillum brasilense
and Azospirillum lipoferum. Can J Microbiol 34:2429
Becking JH (1985) Pleomorphism in Azospirillum. In: Klingmller W (ed) Azospirillum III:
genetics, physiology, ecology. Springer, Berlin, pp 243263
Bleakley BH, Gaskins MH, Hubbell DH, Zam SG (1988) Floc formation by Azospirillum lipoferum
grown on poly--hydroxybutyrate. Appl Environ Microbiol 54:29862995
Burdman S, Jurkevitch E, Schwartsburd B, Hampel M, Okon Y (1998) Aggregation in Azospirillum
brasilense: effects of chemical and physical factors and involvement of extracellular components. Microbiology 144:19891999
Burdman S, Jurkevitch E, Schwartsburd B, Okon Y (1999) Involvement of outer-membrane proteins in the aggregation of Azospirillum brasilense. Microbiology 145:11451152
Burdman S, Jurkevitch E, Soria-Diaz ME, Serrano AMG, Okon Y (2000a) Extracellular polysaccharide composition of Azospirillum brasilense and its relation with cell aggregation. FEMS
Microbiol Lett 189:259264
Burdman S, Okon Y, Jurkevitch E (2000b) Surface characteristics of Azospirillum brasilense in
relation to cell aggregation and attachment to plant roots. Crit Rev Microbiol 26:91110
Burdman S, Dulguerova G, Okon Y, Jurkevitch E (2001) Purification of the major outer membrane
protein of Azospirillum brasilense, its affinity to plant roots, and its involvement in cell aggregation. Mol Plant Microbe Interact 14:555561
Cangelosi GA, Hung L, Puvanesarajah V, Stacey G, Ozga DA, Leigh JA, Nester EW (1987)
Common loci for Agrobacterium tumefaciens and Rhizobium meliloti exopolysaccharide synthesis and their roles in plant interactions. J Bacteriol 169:20862091
Casadaban MJ, Chou J, Cohen SN (1980) In vitro gene fusions that join an enzymatically active
-galactosidase segment to amino-terminal fragments of exogenous proteins: Escherichia coli
194
L. Pereg
plasmid vectors for the detection and cloning of translational initiation signals. J Bacteriol
143:971980
Casadaban MJ, Martinez-Arias A, Shapira SK, Chou J (1983) -Galactosidase gene fusions for
analysing gene expression in Escherichia coli and yeast. Methods Enzymol 100:293308
Coplin DL, Majerczak DR (1990) Extracellular polysaccharide genes in Erwinia stewartii:
directed mutagenesis and complementation analysis. Mol Plant Microbe Interact 3:286292
Croes C, van Bastelaere E, De Clercq E, Eyers M, Vanderleyden J, Michiels K (1991) Identification
and mapping of loci involved in motility, adsorption to wheat roots, colony morphology, and
growth in minimal medium on the Azospirillum brasilense Sp7 90-MDa-plasmid. Plasmid
26:8393
Croes C, Moens S, van Bastelaere E, Vanderleyden J, Michiels K (1993) The polar flagellum mediates Azospirillum brasilense adsorption to wheat roots. J Gen Microbiol 139:22612269
Danneberg G, Zimmer W, Bothe H (1985) Some physiological and biochemical properties of
denitrification by Azospirillum brasilense. In: Klingmller W (ed) Azospirillum III: genetics,
physiology, ecology. Springer, Berlin
Danneberg A, Kronenberg A, Neuer G, Bothe H (1986) Aspects of nitrogen fixation and denitrification by Azospirillum. Plant and Soil 90:193202
Day JM, Dbereiner J (1976) Physiological aspects of N2 fixation by a Spirillum from Digitaria
roots. Soil Biol Biochem 8:4550
De Troch P, Keijers V, Vanderleyden J (1994) Sequence analysis of the Azospirillum brasilense
exoB gene, encoding UDP-glucose 4'-epimerase. Gene 144:143144
Del Gallo MM, Fendrik I (1994) The rhizosphere and Azospirillum. In: Okon Y (ed) Azospirillumplant associations. CRC, Boca Raton, pp 5775
Dbereiner J, Pedrosa FO (1987) Nitrogen-fixing bacteria in nonleguminous crop plants. Science
Tech Publishers, Madison
Dolph PJ, Majerczak DR, Coplin DL (1988) Characterization of a gene cluster for exopolysaccharide biosynthesis and virulence in Erwinia stewartii. J Bacteriol 170:865871
Drahos DJ, Hemming BC, McPherson S (1986) Tracking recombinant organisms in the environment: -Galactosidase as a selective non-antibiotic marker for fluorescent pseudomonads.
Biotechnology 4:439444
Dylan T, Ielpi L, Stanfield S, Kashyap L, Douglas C, Yanovski M, Nester E, Helinski DR, Ditta G
(1986) Rhizobium meliloti genes required for nodule development are related to chromosomal
virulence genes in Agrobacterium tumefaciens. Proc Natl Acad Sci U S A 83:44034407
Elmerich C (1991) Genetics and regulation of Mo-nitrogenase. In: Dilworth MJ, Glenn AR (eds)
Biology and biochemistry of nitrogen fixation. Elsevier, Amsterdam, pp 103141
Elmerich C, Zimmer W, Vieille C (1992) Associative nitrogen-fixing bacteria. In: Evans H, Burris
RH, Stacey G (eds) Biological nitrogen fixation. Chapman & Hall, New York, pp 211257
Eskew DL, Focht DD, Ting IP (1977) Nitrogen fixation, denitrification and pleomorphic growth in
a highly pigmented Spirillum lipoferum. Appl Environ Microbiol 34:582585
Gough C, Vasse J, Galera C, Webster G, Cocking E, Dnari J (1997) Interactions between bacterial diazotrophs and non-legume dicots: Arabidopsis thaliana as a model plant. Plant and Soil
194:123130
Hall PG, Krieg NR (1983) Swarming of Azospirillum brasilense on solid media. Can J Microbiol
29:15921594
Hartmann A, Hurek T (1988) Effect of carotenoid overproduction on oxygen tolerance of nitrogen
fixation in Azospirillum brasilense Sp7. J Gen Microbiol 134:24492455
Hartmann A, Zimmer W (1994) Physiology of Azospirillum. In: Okon Y (ed) Azospirillum-plant
associations. CRC, Boca Raton, pp 1539
Hood ME, Shew HD (1997) Initial cellular interactions between Thielaviopsis basicola and
tobacco root hairs. Phytopathology 87:228235
Hynes MF, Simon R, Mller P, Niehaus K, Labes M, Phler A (1986) The two megaplasmids of
Rhizobium meliloti are involved in the effective nodulation of alfalfa. Mol Gen Genet
202:356362
195
Katsy EI, Iosipenko AD, Egorenkov DA, Zhuravleva EA, Panasenko VI, Ignatov VV (1990)
Involvement of Azospirillum brasilense plasmid DNA in the production of indole acetic acid.
FEMS Microbiol Lett 60:14
Katupitiya S, Millet J, Vesk M, Viccars L, Zeman A, Lidong Z, Elmerich C, Kennedy IR (1995) A
mutant of Azospirillum brasilense Sp7 impaired in flocculation with a modified colonization
pattern and superior nitrogen fixation in association with wheat. Appl Environ Microbiol
61:19871995
Lamm RB, Neyra CA (1981) Characterization and cyst production of azospirilla isolated from
selected grass growing in New Jersey and New York. Can J Microbiol 27:13201325
Levanony H, Bashan Y, Romano B, Klein E (1989) Ultrastructural localization and identification
of Azospirillum brasilense Cd on and within wheat root by immuno-gold labeling. Plant and
Soil 117:207218
Madi L, Henis Y (1989) Aggregation in Azospirillum brasilense Cd: conditions and factors
involved in cell-to-cell adhesion. Plant and Soil 115:8998
Matthysse AG, Holmes KV, Gurlitz RHG (1981) Elaboration of cellulose fibrils by Agrobacterium
tumefaciens during attachment to carrot cells. J Bacteriol 145:583595
Mauk PA, Hine RB (1988) Infection, colonization of Gossypium hirsutum and G. barbadense, and
development of black root rot caused by Thielaviopsis basicola. Phytopathology 78:
16621667
Michiels K, Vanderleyden J, Van Gool A, Signer ER (1988) Isolation and characterization of
Azospirillum brasilense loci that correct Rhizobium meliloti exoB and exoC mutations.
J Bacteriol 170:54015404
Michiels K, De Troch P, Onyeocha I, Van Gool A, Elmerich C, Vanderleyden J (1989) Plasmid
localization and mapping of two Azospirillum brasilense loci that affect exopolysaccharides
synthesis. Plasmid 21:142146
Michiels K, Croes CL, Vanderleyden J (1991) Two different modes of attachment of Azospirillum
brasilense Sp7 to wheat roots. J Gen Microbiol 137:22412246
Moens S, Michiels K, Keijers V, Van Leuven F, Vanderleyden J (1995) Cloning, sequencing and
phenotypic analysis of laf1, encoding the flagellin of the lateral flagella of Azospirillum brasilense Sp7. J Bacteriol 177:54195426
Moens S, Schloter M, Vanderleyden J (1996) Expression of the structural gene, laf1, encoding the
flagellin of the lateral flagella in Azospirillum brasilense Sp7. J Bacteriol 178:50175019
Okon Y (1985) Azospirillum as a potential inoculant for agriculture. Trends Biotechnol 3:
223228
Okon Y, Itzigsohn R (1992) Poly--hydroxybutyrate metabolism in Azospirillum brasilense and
the ecological role of PHB in the rhizosphere. FEMS Microbiol Rev 103:131140
Okon Y, Cakmakci L, Nur I, Chet I (1980) Aerotaxis and chemotaxis of Azospirillum brasilense: a
note. Microb Ecol 6:277280
Oliveira RGB, Drozdowicz A (1988) Are Azospirillum bacteriocins produced and active in soil?
In: Klingmller W (ed) Azospirillum IV: genetics, physiology, ecology. Springer, Berlin,
pp 101108
Onyeocha I, Vieille C, Zimmer W, Baca BE, Flores M, Palacios R, Elmerich C (1990) Physical
map and properties of a 90-MDa plasmid of Azospirillum brasilense Sp7. Plasmid 23:
169182
Papen H, Werner D (1982) Organic acid utilization, succinate excretion, encystation and oscillating nitrogenase activity in Azospirillum brasilense under microaerobic conditions. Arch
Microbiol 132:5761
Pardy K (1994) Reporter enzymes for the study of promoter activity. Mol Biotechnol 2:2327
Pereg Gerk L (2004) Expression of flcA, a gene regulating differentiation and plant interaction in
Azospirillum. Soil Biol Biochem 36:12451252
Pereg Gerk L, Paquelin A, Gounon P, Kennedy IR, Elmerich C (1998) A transcriptional regulator
of the LuxR-UhpA family, FlcA, controls flocculation and wheat root surface colonisation by
Azospirillum brasilense Sp7. Mol Plant Microbe Interact 11:177187
196
L. Pereg
Pereg Gerk L, Gilchrist K, Kennedy IR (2000) Mutants with enhanced nitrogenase activity in
hydroponic Azospirillum brasilense-wheat associations. Appl Environ Microbiol 66:
21752184
Petersen DJ, Eyers M, De Troch P, Michiels K, Vandeleyden J (1992) Differential complementation of Rhizobium meliloti 7027: isolation of a second ExoC locus from Azospirillum brasilense
Sp7. Symbiosis 13:139145
Puvanesarajah V, Schell FM, Stacey G, Douglas CJ, Nester EW (1985) Role for 2-linked--glucan
in the virulence of Agrobacterium tumefaciens. J Bacteriol 164:102106
Puvanesarajah V, Schell FM, Gerhold D, Stacey G (1987) Cell surface polysaccharides from
Bradyrhizobium japonicum and a nonnodulating mutant. J Bacteriol 169:137141
Rodrguez-Cceres EA (1982) Improved medium for isolation of Azospirillum spp. Appl Environ
Microbiol 44:990991
Romero AM, Correa O, Moccia S, Rivas JG (2003) Effect of Azospirillum-mediated plant growth
promotion on the development of bacterial diseases on fresh-market and cherry tomato. J Appl
Microbiol 95:832838
Russo A, Vettori L, Felici C, Fiaschi G, Morini S, Toffanin A (2008) Enhanced micropropagation
response and biocontrol effect of Azospirillum brasilense Sp245 on Prunus cerasifera L. clone
Mr.S 2/5 plants. J Biotechnol 134:312319
Sadasivan L, Neyra CA (1985a) Cysts of Azospirilla under various cultural conditions. In:
Klingmller W (ed) Azospirillum III: genetics, physiology, ecology. Springer, Berlin,
pp 230242
Sadasivan L, Neyra CA (1985b) Flocculation in Azospirillum brasilense and Azospirillum
lipoferum: exopolysaccharides and cyst formation. J Bacteriol 163:716723
Sadasivan L, Neyra CA (1987) Cyst production and brown pigment formation in aging cultures of
Azospirillum brasilense ATCC 29145. J Bacteriol 169:16701677
Sarig S, Blum A, Okon Y (1988) Improvement of the water status and yield of field-grown grain
sorghum (Sorghum bicolor) by inoculation with Azospirillum brasilense. J Agric Sci
110:271277
Schloter M, Borlinghaus R, Bode W, Hartmann A (1993) Direct identification, and localization of
Azospirillum in the rhizosphere of wheat using fluorescence-labeled monoclonal antibodies
and confocal scanning laser microscopy. J Microsc 171:173177
Schloter M, Kirchhof G, Heinzmann U, Doebereiner J, Hartmann A. (1994b) Immunological studies of the wheat-root-colonization by the Azospirillum brasilense strains Sp7 and Sp245 using
strain-specific monoclonal antibodies. The 6th International Symposium on Nitrogen Fixation
with Non-Legumes, Ismailia/Egypt, The American University in Cairo Press
Shah S, Karkhanis V, Desai A (1992) Isolation and characterization of siderophore, with antimicrobial activity, from Azospirillum lipoferum. Curr Opin Microbiol 25:3435
Somers E, Ptacek D, Gysegom P, Srinivasan M, Vanderleyden J (2005) Azospirillum brasilense
produces the auxin-like phenylacetic acid by using the key enzyme for indole-3-acetic acid
biosynthesis. Appl Environ Microbiol 71:18031810
Stevenson LH, Socolofsky MD (1966) Cyst formation and poly--hydroxybutyric acid accumulation in Azotobacter. J Bacteriol 91:304310
Sudhakar P, Gangwar SK, Satpathy B, Sahu PK, Ghosh JK, Saratchandra B (2000) Evaluation of
some nitrogen fixing bacteria for control of foliar diseases of mulberry (Morus alba). Indian J
Seric 39:911
Tal S, Smirnoff P, Okon Y (1990) The regulation of poly--hydroxybutyrate metabolism in
Azospirillum brasilense during balanced growth and starvation. J Gen Microbiol 136:
11911196
Tapia-Hernandez A, Mascarua-Esparza MA, Caballero-Mellado J (1990) Production of bacteriocins and siderophore-like activity in Azospirillum brasilense. Microbios 64:7383
Tarrand JJ, Krieg NR, Dbereiner J (1978) A taxonomic study of the Spirillum lipoferum group,
with descriptions of a new genus, Azospirillum gen. nov. and two species, Azospirillum
lipoferum (Beijerinck) comb. nov. and Azospirillum brasilense sp. nov. Can J Microbiol
24:967980
197
Tortora ML, Daz-Ricci JC, Pedraza RO (2011) Azospirillum brasilense siderophores with antifungal activity against Colletotrichum acutatum. Arch Microbiol 193:275286
Van Rhijn P, Vanstockem M, Vanderleyden J, De Mot R (1990) Isolation of behavioral mutants of
Azospirillum brasilense by using Tn5 lacZ. Appl Environ Microbiol 56:990996
Vande Broek A, Vanderleyden J (1995) Review: genetics of the Azospirillum-plant root association. Crit Rev Plant Sci 14:445466
Vande Broek A, Michiels J, Van Gool A, Vanderleyden J (1993) Spatial-temporal colonization patterns of Azospirillum brasilense on the wheat root surface and expression of the bacterial nifH
gene during association. Mol Plant Microbe Interact 6:592600
Vazquez-Cruz C, Tapia-Hernandez A, Mascarua-Esparza MA, Caballero-Mellado J (1992)
Plasmid profile modification after elimination of bacteriocin activity in some Azospirillum
brasilense strains. Microbios 69:195204
Vieille C, Elmerich C (1990) Characterization of two Azospirillum brasilense Sp7 plasmid genes
homologous to R. meliloti nodPQ. Mol Plant Microbe Interact 3:389400
Wilson KJ (1995) Molecular techniques for the study of rhizobial ecology in the field. Soil Biol
Biochem 27:501514
Wilson KJ, Sessitsch A, Corbo JC, Giller KE, Akkermans ADL, Jefferson RA (1995)
-Glucuronidase (GUS) transposons for ecological and genetic studies of rhizobia and other
Gram-negative bacteria. Microbiology 141:16911705
Yasuda M, Isawa T, Minamisawa K, Shinozaki S, Nakashita H (2010) Effects of colonization of
bacterial endophyte, Azospirillum sp. B510 on disease resistance in rice. Biosci Biotechnol
Biochem 73:25952599
Zimmer W, Stephan MP, Bothe H (1984) Denitrification by A. brasilense Sp7. I. Growth with
nitrite as respiratory electron acceptor. Arch Microbiol 138:206211
Chapter 11
11.1 Introduction
The most frequent microbial lifestyle in natural environments is the occurrence of
organized structures associated with surfaces known as biofilms (Watnick and
Kolter 2000). Plant growth promoting rhizobacteria (PGPR) are not the exception to
this rule. To produce beneficial effects, PGPR have to interact with the plant surface
to form those complex multicellular assemblies (Bolwerk etal. 2003; Danhorn and
Fuqua 2007; Bogino etal. 2013).
F. Salcedo C.M. Pereyra A. Arruebarrena Di Palma C.M. Creus (*)
Unidad Integrada Balcarce: Facultad de Ciencias Agrarias, Universidad Nacional de
Mar del Plata-EEA Balcarce INTA, Ruta 226, Km 73, Balcarce 7620, Argentina
e-mail: [email protected]
L. Lamattina
Facultad de Ciencias Exactas y Naturales, Instituto de Investigaciones Biolgicas,
Universidad Nacional de Mar del Plata, Consejo Nacional de Investigaciones Cientificas y
Tcnicas (CONICET), Funes 3250 4to nivel, Mar del Plata 7600, Argentina
Springer International Publishing Switzerland 2015
F.D. Cassn et al. (eds.), Handbook for Azospirillum,
DOI10.1007/978-3-319-06542-7_11
199
200
F. Salcedo et al.
201
Fig. 11.1 Cells of Azospirillum brasilense attached to polystyrene surface visualized by SEM.
(a) One day cultures of A. brasilense Sp245 in NO3 -Nfb media. Fimbrias (F) can be seen joining
cells together and to the inert support. (b) Exopolymeric material (EPM) excreted by cells can be
visualized. (c) Static cultured cells forming microcolonies some of them growing perpendicularly
to the surface (arrow) and presumably will form structured biofilms
the host surface (Robertson etal. 1988). In contrast to these data, other reports did
not demonstrate specific lectin-mediated binding of homologous rhizobia to legume
root hairs (Smit etal. 1986; Vesper and Bauer 1986).
The attachment of Azospirillum brasilense cells to wheat roots also can be
divided into two different steps (Michiels etal. 1991). The first phase is a weak,
reversible, and unspecific binding governed by bacterial surface proteins, capsular
polysaccharides, and flagella. Polar flagella of A. brasilense contain an adhesin
202
F. Salcedo et al.
Biofilm
development
SEM
m
m
m
m
m
biofilm
(CV/Growth)
CSLM
10
8
6
4
2
0
m
CV
. cm
Time (d)
Fig. 11.2 Schematic representation of the different stages of biofilm (top part) paralleled with
A. brasilense Sp245 tagged with gfp biofilm development as seen by SEM and CLSM (second and
third lines of the scheme). The graph on the last line shows the timing of each stage that in
A. brasilense corresponds to 1, 3, and 5 days of growth. The well in the inferior corner shows a
crystal violet (CV)-stained biofilm after 5 days of growing A. brasilense Sp245 cells in multiwell
plate in static conditions with Nfb-NO3 amended media
203
204
F. Salcedo et al.
11.2 G
eneral Information About theConditions toStudy
Biofilm Formation
11.2.1 Growth Conditions andCulture Media
The prevailing condition to form biofilm is the static growth. Nevertheless, some
species can also form biofilm in agitated cultures but in less quantity.
Nutritional conditions were shown to be powerful modulators of the attachment
of various bacteria species to surfaces (OToole etal. 2000; Rinaudi etal. 2006;
Danhorn and Fuqua 2007). Siuti etal. (2011) studied the attachment of A. brasilense
Sp7 and found that it was increased when the experiments were conducted under
low aeration (i.e., nonshaking) conditions with cells transferred from culture in a
rich medium (TY: 10g Bacto-tryptone, 5g yeast extract, 10g NaCl per L of distilled H2O) to a minimal media (MMAB, on 1L base: 3g K2HPO4, 1g NaH2PO4,
1g NH4Cl, 0.3g MgSO47H2O, 0.15g KCl, 0.01g CaCl22H2O, 0.0025g
FeSO47H2O, 5g Na-malate, 0.005g Biotin, and microelements). The type and ratio
of Carbon (C) and Nitrogen (N) sources also affect the formation of biofilm. In an
early report Burdman etal. (1998) showed that the strains Cd and Sp7 of A. brasi
lense cultivated in a media with high C:N ratio was induced to form aggregates,
mainly if the C source is fructose. They demonstrated that both exopolysaccharides
(EPS) and capsular polysaccharides (CPS) showed a positive correlation between
aggregation and the relative amount of arabinose. When they were grown in a noninducing aggregation media with low C:N ratio the extent of aggregation and arabinose in EPS was much lesser. Changes in adhesive cell surface properties that, in
turn, affect cell-to-cell aggregation and flocculation could also be affecting biofilm
formation. In this sense components of the media must be taken into account to
induce biofilm. In general terms, nutritionally limited environment promotes the
transition from a planktonic to a sessile mode of life. Biofilm formation may
therefore represent a strategy for survival. In contrast, nutrient abundance in the
medium seems to favor biofilm formation in Pseudomonas (Yousef-Coronado etal.
2008), possibly by increasing bacterial population size and accumulation of AHL,
which promote biofilm formation (Rinaudi and Giordano 2009).
Arruebarrena Di Palma etal. (2013) reported that NO3 induced a higher and
earlier biofilm formation in A. brasilense Sp245 than growing cells with NH4+ as N
source. Also Siuti etal. (2011) found that biofilm formation in A. brasilense Sp7
was greater in media containing NaNO3 compared to NH4Cl or N-lacking media.
205
206
F. Salcedo et al.
207
208
F. Salcedo et al.
Harvest the cells by centrifugation, 5,000rpm for 10min, wash the pellet with
phosphate buffer (66mM), and resuspend to a final DO540nm=2.
Dilute bacteria cultures 1/100in fresh Nfb-NO3 malic medium. As control use
fresh medium without bacteria. NOTE: the amount of fresh medium to be used
depends on the type of plated used: for 24-well plate place 2mL of medium per
well, in the case of 96-well plate, 200L of medium per well.
Incubate it at 30C without agitation for desired amount of time. NOTE: the
incubation time depends of the objective of the experiment (hours to days).
Determine total growth and biofilm formation (see the Sect.11.4.4 detection
and quantification of biofilm in this same chapter). NOTE: use four wells for
growth determination and four wells for staining or quantification for each treatment, at least as repetitions of the same biological sample.
Considerations
Controls must be placed in the same plate of the treatments.
To avoid evaporation close the plate with its lid and seal with parafilm. Place the
plate in a humidity chamber.
Before putting the media with the bacteria in a well it is very important to homogenize with a low vortexing.
209
Dilute overnight cultures to an OD600=0.05in the same medium used for biofilm
growth and spot 5L of culture in the center of each polycarbonate membrane
(up to six membranes per plate).
Incubate at 30C for 24h.
Transfer the membranes (colony biofilm) to a fresh agar plate. Incubate for 24h
at 30C.
After 48h of growth, biofilm susceptibility can be assessed transferring the
membrane to a fresh agar plate with or without antibiotics or another stressful
agent.
After incubation, remove the membrane from the agar plate with sterile forceps
and transfer it to a tube containing 10mL of dilution buffer or saline solution.
Vortex the tube for 2 min at least, for removing and disaggregating the biofilm
from the membrane.
Serially dilute and plate the bacterial suspensions.
Count bacteria as described in Sect.11.4.1.1 in this chapter.
Considerations
Bacterial strains that differ in surface motility will spread across the filter at
variable rates.
If bacterial biofilm completely covers the membranes, the membranes are
difficult to handle, becoming flimsy and periodically folding on top of them, thus
destroying the biofilm (Peterson etal. 2011).
The number of membranes needed depends on the experimental design. Consider
to use at least two membranes for each treatment (Merritt etal. 2005).
210
F. Salcedo et al.
211
completely separated and dispersed in the buffer or saline solution. Especially the
latter could be difficult to accomplish, since there could be a tendency of the biofilm to get lumpy when it is scraped off the surface. This could result in that a lump
of several microorganisms would be counted as one CFU.Despite the roughness
of this method it is one of few methods that can estimate the amount of viable
bacteria in biofilm (Nilsson and Otendal 2001).
11.4.1.2 V
iable Cell Quantification by Using Staining
Techniques: XTTAssay
Principle: This method is based on the use of 2,3-bis (2-methoxy-4-nitro-5-
sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide (XTT) as substrate which is reduced in the biofilm by cells. The intracellular XTT reduction
releases a formazan compound that can be quantified by colorimetric estimation.
Some authors question if really XTT reduction activity is proportional to biofilm
biomass (Kuhn etal. 2003) as it is based on biofilm biological activity and not on
biofilm biomass. In this context, it is suggested that this technique could be used
on young biofilms because the most of biofilm cells will be biologically actives. By the
contrary, the metabolism of some cell groups inside old biofilms will have less
activity and could generate problems in the determination.
Procedure
Fresh XTT solution 0.04% (w:v) must be prepared in prewarmed (37C) physiological solution (NaCl 0.8%; w:v).
Add 100L of menadione solution (0.55mgmL1 in acetone) to 10mL of XTT
solution.
Add 50%v/v of XTT-menadione:PS in the wells.
Incubate the plates in dark during 5h at 37C.
Supernatants obtained must be transferred to new eppendorf tubes; centrifugate
at maximal speed for 5min to remove residual cells.
Use free cell supernatants to determine absorbance at 486nm corresponding to
the formazan compound that is a measure of viable cell quantification in biofilm
(Peeters etal. 2008).
212
F. Salcedo et al.
Procedure
Add 1% (w:v) crystal violet on biofilm formed in each microtiter plate well, the
final concentration of CV must be 0.1% (v:v).
Plates are incubated for 30min at room temperature, and then washed carefully
three times with tap water to remove the excess of CV.
Dye attached to the wells is extracted with 200L of 33% (v:v) acetic acid in
water.
Determine the absorbance at 590nm using a micro plate reader.
Data must be normalized by total growth estimated by measuring the absorbance
at 540nm as follows:
Calculations fortheAssessment ofBiofilm Formation
The following formulas can be used to assess the proportion of cells in the biofilm
relative to total culture growth.
Total cell number (planktonic and biofilm bacteria) can be estimated by measuring the optical density at 540nm (OD540) or at 600nm.
Adhesion can be calculated as the ratio between bacteria in biofilm and total
bacteria:
( O.D.590 nm ) ( O.D.540 nm ) .
213
214
F. Salcedo et al.
215
216
F. Salcedo et al.
11.4.4 T
echniques toDetermine Components
oftheBiofilm Matrix
Matrix quantification assays are based on the specific staining of each matrix
component.
11.4.4.1 Calcofluor Assay
Principle: Calcofluor binds to ,1-3 and ,1-4 polysaccharides, such as those found
in cellulose and chitin, and when excited with ultraviolet or violet radiation, will
fluoresce with an intense bluish/white color (Harrington and Hageage 2003).
Members of the genus Azospirillum are characterized by the production of surface polysaccharides that bind calcofluor. The calcofluor-binding polysaccharides
of A. brasilense are represented by EPS and CPS (Sheludko etal. 2008).
Procedure
A concentrated stock of calcofluor must be prepared as a 0.2% (w:v) solution in
1M Tris HCl, pH9.0, which is autoclaved to dissolve the reagent.
Wash softly the biofilm formed to eliminate planktonic cells.
Biofilm matrix is visualized by the addition of 200L of 0.2% (w:v) calcofluor
and incubation for 30min at room temperature, followed by rinsing with deionized water.
Determine the calcofluor-EPS binding fluorescence exciting the sample to
360nm and measuring the emission to 460nm (Bassis and Visick 2010).
11.4.4.2 The 1,9-Dimethyl Methylene Blue Assay
Principle: The dye 1,9-Dimethyl Methylene Blue (DMMB) forms an insoluble
complexation product with sulphated polysaccharides in the biofilm matrix. The
amount of dye released by adding a decomplexation solution is spectrophotometrically measured and reflects the amount of sulphated polysaccharides present in the
biofilm matrix (Barbosa etal. 2003; Hannig etal. 2010).
Procedure
Prepare a complexation solution containing 32mg DMMB dissolved in 50mL
ethanol, and then add 200mL 1M guanidine HCl solution, 2g sodium formate,
and 2mL formic acid (98%; v:v) to the volume adjusted with MQ water to
1L.This complexation solution (pH3.0) is stable for 4 months when stored in
the dark.
Prepare a decomplexation solution to final volume of 400mL: 1.64g sodium
acetate, 152.85g guanidine HCl, and 40mL propanol, adjust pH6.8.
217
First rinse softly the biofilm formed in the plate, add 200L complexation
solution to each well.
Incubate the plate in the dark on a rocking table (450rpm, 25C, 30min).
Plates are rinsed to remove unbound DMMB.
Add 200L decomplexation solution to each well and incubate in the dark for
30min on a rocking table (450rpm, 25C).
The absorbance is measured at 620nm (Peeters etal. 2008; Tote etal. 2008).
11.4.4.3 Lectins Assay
Principle: Lectins are proteins with sugar binding specificity. Some of the most
known lectins are Concanavalin A with specificity for mannose and glucose r esidues,
and wheat germ agglutinin (WGA) specific for N-acetylglucosamine (Sharon 2007).
Other types of lectins are commercially available with different sugar-binding specificity. These lectins are covalent linked to fluorescence dye that allows the observation
of biofilm matrix. The most used are Concanavalin A-Texas Red conjugate (ConA)
(Villa etal. 2012), lentil lectin (LcH) conjugated to Fluorescein Isothiocyanat (FITC)
that has affinity for -mannose and -glucose (ex=492nm, em=517nm) lima bean
lectin (LBL) with affinity for N-acetyl galactosamine (Edwards etal. 2011), and
lectin probe conjugated to tetramethyl rhodamine isothiocyanate (Triticum vulgarisTRITC ex=568 nm, em=605/32nm) (Lawrence etal. 1998).
Procedure
Wash the biofilm with buffer PBS (7mM Na2HPO4, 3mM NaHPO4 and 130mM
NaCl, pH7.2).
Dilute Fluorescent Labeled Lectin to desired concentration (between 50 and
100mg/mL depending on fluorescent dye) using buffer PBS.
Incubate tissue section with Fluorescent Labeled Lectin for 30min in a moist
chamber in dark.
Wash biofilm with buffer three times.
Examine biofilm with Fluorescent microscope. Use appropriate filter. For instance,
to ConA-Texas Red conjugate the excitation wavelength is 592nm, and emission
at 615nm (Villa etal. 2012).
218
F. Salcedo et al.
219
220
F. Salcedo et al.
221
222
F. Salcedo et al.
223
224
F. Salcedo et al.
References
Allison DG, Ruiz B, SanJose C, Jaspe A, Gilbert P (1998) Extracellular products as mediators of
the formation and detachment of Pseudomonas fluorescens biofilms. FEMS Microbiol Lett
167(2):179184
Amann R, Fuchs BM, Behrens S (2001) The identification of microorganisms by fluorescence in
situ hybridisation. Curr Opin Biotechnol 12(3):231236
Arruebarrena Di Palma A, Pereyra C, Moreno Ramirez L, Vzquez X, Mara L, Baca BE, Pereyra
MA, Lamattina L, Creus CM (2013) Denitrification-derived nitric oxide modulates biofilm
formation in Azospirillum brasilense. FEMS Microbiol Lett 338(1):7785
Bacilio-Jimenez M, Aguilar-Flores S, Del Valle M, Prez A, Zepeda A, Zenteno E (2001)
Endophytic bacteria in rice seeds inhibit early colonization of roots by Azospirillum brasilense.
Soil Biol Biochem 33(2):167172
Bacilio M, Rodriguez H, Moreno M, Hernandez J-P, Bashan Y (2004) Mitigation of salt stress in
wheat seedlings by a gfp-tagged Azospirillum lipoferum. Biol Fert Soils 40(3):188193
Barbosa I, Garcia S, Barbier-Chassefire V, Caruelle J-P, Martelly I, Papy-Garca D (2003)
Improved and simple micro assay for sulfated glycosaminoglycans quantification in biological
extracts and its use in skin and muscle tissue studies. Glycobiology 13(9):647653
Barraud N, Hassett DJ, Hwang S-H, Rice SA, Kjelleberg S, Webb JS (2006) Involvement of nitric
oxide in biofilm dispersal of Pseudomonas aeruginosa. J Bacteriol 188(21):73447353
Barraud N, Schleheck D, Klebensberger J, Webb JS, Hassett DJ, Rice SA, Kjelleberg S (2009)
Nitric oxide signaling in Pseudomonas aeruginosa biofilms mediates phosphodiesterase activity, decreased cyclic di-GMP levels, and enhanced dispersal. J Bacteriol 191(23):73337342
Bashan Y, Holguin G (1993) Anchoring of Azospirillum brasilense to hydrophobic polystyrene
and wheat roots. J Gen Microbiol 139(2):379385
Bashan Y, Levanony H, Whitmoyer RE (1991) Root surface colonization of non-cereal crop plants
by pleomorphic Azospirillum brasilense Cd. J Gen Microbiol 137(1):187196
Bassis CM, Visick KL (2010) The cyclic-di-GMP phosphodiesterase BinA negatively regulates
cellulose-containing biofilms in Vibrio fischeri. J Bacteriol 192(5):12691278
Bergmans L, Moisiadis P, Van Meerbeek B, Quirynen M, Lambrechts P (2005) Microscopic observation of bacteria: review highlighting the use of environmental SEM.Int Endod J 38(11):
775788
Beyhan S, Tischler AD, Camilli A, Yildiz FH (2006) Transcriptome and phenotypic responses of
Vibrio cholerae to increased cyclic di-GMP level. J Bacteriol 188(10):36003613
Boehm A, Kaiser M, Li H, Spangler C, Kasper CA, Ackermann M, Kaever V, Sourjik V, Roth V,
Jenal U (2010) Second messenger-mediated adjustment of bacterial swimming velocity. Cell
141(1):107116
225
Bogino PC, Oliva MM, Sorroche FG, Giordano W (2013) The role of bacterial biofilms and
surface components in plant-bacterial associations. Int J Mol Sci 14(8):1583815859
Bolwerk A, Lagopodi AL, Wijfjes AH, Lamers GE, Chin-A-Woeng TF, Lugtenberg BJ, Bloemberg
GV (2003) Interactions in the tomato rhizosphere of two Pseudomonas biocontrol strains with
the phytopathogenic fungus Fusarium oxysporum f. sp. radicis-lycopersici. Mol Plant Microbe
Interact 16(11):983993
Burdman S, Jurkevitch E, Schwartsburd B, Hampel M, Okon Y (1998) Aggregation in Azospirillum
brasilense: effects of chemical and physical factors and involvement of extracellular components. Microbiology 144(7):19891999
Cardinale M (2014) Scanning a microhabitat: plant-microbe interactions revealed by confocal
laser microscopy. Front Microbiol 5:94
Ceri H, Olson M, Stremick C, Read R, Morck D, Buret A (1999) The Calgary biofilm device: new
technology for rapid determination of antibiotic susceptibilities of bacterial biofilms. J Clin
Microbiol 37(6):17711776
Coenye T, Nelis HJ (2010) In vitro and invivo model systems to study microbial biofilm formation. J Microbiol Method 83(2):89105
Combes-Meynet E, Pothier JF, Monne-Loccoz Y, Prigent-Combaret C (2011) The Pseudomonas
secondary metabolite 2, 4-diacetylphloroglucinol is a signal inducing rhizoplane expression
of Azospirillum genes involved in plant-growth promotion. Mol Plant Microbe Interact
24(2):271284
Compant S, Clment C, Sessitsch A (2010) Plant growth-promoting bacteria in the rhizo-and
endosphere of plants: their role, colonization, mechanisms involved and prospects for utilization. Soil Biol Biochem 42(5):669678
Costerton JW, Lewandowski Z, Caldwell DE, Korber DR, Lappin-Scott HM (1995) Microbial
biofilms. Annu Rev Microbiol 49(1):711745
Creus CM, Graziano M, Casanovas EM, Pereyra MA, Simontacchi M, Puntarulo S, Barassi CA,
Lamattina L (2005) Nitric oxide is involved in the Azospirillum brasilense-induced lateral root
formation in tomato. Planta 221(2):297303
Christensen BB, Sternberg C, Andersen JB, Palmer RJ Jr, Toftgaard Nielsen A, Givskov M, Molin
S (1999) Molecular tools for study of biofilm physiology. Method Enzymol 310:2042
Christensen GD, Simpson W, Younger J, Baddour L, Barrett F, Melton D, Beachey E (1985)
Adherence of coagulase-negative staphylococci to plastic tissue culture plates: a quantitative
model for the adherence of staphylococci to medical devices. J Clin Microbiol 22(6):9961006
Danilatos GD (2012) Velocity and ejector-jet assisted differential pumping: novel design stages for
environmental SEM.Micron 43:600611
Danhorn T, Fuqua C (2007) Biofilm formation by plant-associated bacteria. Annu Rev Microbiol
61:401422
Davies DG, Parsek MR, Pearson JP, Iglewski BH, Costerton J, Greenberg E (1998) The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science 280(5361):
295298
Decker EM (2001) The ability of direct fluorescence-based, two-colour assays to detect different
physiological states of oral streptococci. Lett Appl Microbiol 33(3):188192
Donlan RM (2002) Biofilms: microbial life on surfaces. Emerg Infect Dis 8(9):881890
Dufrne YF, Vermeiren H, Vanderleyden J, Rouxhet PG (1996) Direct evidence for the involvement of extracellular proteins in the adhesion of Azospirillum brasilense. Microbiology
142(4):855865
Dufrne YF (2008) Towards nanomicrobiology using atomic force microscopy. Nature Rev
Microbiol 6(9):674680
Edwards AN, Siuti P, Bible AN, Alexandre G, Retterer ST, Doktycz MJ, MorrellFalvey JL (2011)
Characterization of cell surface and extracellular matrix remodeling of Azospirillum brasilense
chemotaxis-like 1 signal transduction pathway mutants by atomic force microscopy. FEMS
Microbiol Lett 314(2):131139
Fahs A, Quils F, Jamal D, Humbert F, Francius G (2014) In situ analysis of bacterial extracellular
polymeric substances from a Pseudomonas fluorescens biofilm by combined vibrational
226
F. Salcedo et al.
227
228
F. Salcedo et al.
Rodrguez-Cceres EA (1982) Improved medium for isolation of Azospirillum spp. Appl Environ
Microbiol 44(4):990
Rodrguez-Navarro DN, Dardanelli MS, Ruz-Sanz JE (2007) Attachment of bacteria to the roots
of higher plants. FEMS Microbiol Lett 272(2):127136
Rothballer M, Schmid M, Hartmann A (2003) In situ localization and PGPR-effect of Azospirillum
brasilense strains colonizing roots of different wheat varieties. Symbiosis 34(3):261279
Sandt C, Smith-Palmer T, Pink J, Brennan L, Pink D (2007) Confocal Raman microspectroscopy
as a tool for studying the chemical heterogeneities of biofilms in situ. J Appl Microbiol
103(5):18081820
Schmidt I, Steenbakkers PJ, op den Camp HJ, Schmidt K, Jetten MS (2004) Physiologic and
proteomic evidence for a role of nitric oxide in biofilm formation by Nitrosomonas europaea
and other ammonia oxidizers. J Bacteriol 186(9):27812788
Schwartz T, Hoffmann S, Obst U (2003) Formation of natural biofilms during chlorine dioxide
and uv disinfection in a public drinking water distribution system. J Appl Microbiol 95(3):
591601
Sharon N (2007) Lectins: carbohydrate-specific reagents and biological recognition molecules.
J Biol Chem 282(5):27532764
Sheludko AV, Kulibyakina OV, Shirokov AA, Petrova P, Matora LY, Katsy EI (2008) The effect of
mutations affecting synthesis of lipopolysaccharides and calcofluor-binding polysaccharides
on biofilm formation by Azospirillum brasilense. Microbiology 77:313317
Siuti P, Green C, Edwards AN, Doktycz MJ, Alexandre G (2011) The chemotaxis-like Che1
pathway has an indirect role in adhesive cell properties of Azospirillum brasilense. FEMS
Microbiol Lett 323(2):105112
Skvortsov IM, Ignatov VV (1998) Extracellular polysaccharides and polysaccharide-containing
biopolymers from Azospirillum species: properties and the possible role in interaction with
plant roots. FEMS Microbiol Lett 165(2):223229
Smit G, Kijne J, Lugtenberg B (1986) Correlation between extracellular fibrils and attachment of
Rhizobium leguminosarum to pea root hair tips. J Bacteriol 168(2):821827
Sorroche FG, Spesia MB, Zorreguieta , Giordano W (2012) A positive correlation between
bacterial autoaggregation and biofilm formation in native Sinorhizobium meliloti isolates from
Argentina. Appl Environ Microbiol 78(12):40924101
Soto MJ, Sanjun J, Olivares J (2006) Rhizobia and plant-pathogenic bacteria: common infection
weapons. Microbiology 152(11):31673174
Stepanovi S, Vukovi D, Hola V, Bonaventure G, Djuki S, irkovi I, Ruzicka F (2007)
Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 115(8):891899
Sternberg C, TolkerNielsen T (2006) Growing and analyzing biofilms in flow cells. Curr protoc
Microbiol:1B. 2.11B. 2.15
Stoffels M, Castellanos T, Hartmann A (2001) Design and application of new 16S rRNA-targeted
oligonucleotide probes for the Azospirillum-Skermanella-Rhodocista cluster. Syst Appl Micro
biol 24(1):8397
Thormann KM, Duttler S, Saville RM, Hyodo M, Shukla S, Hayakawa Y, Spormann AM (2006)
Control of formation and cellular detachment from Shewanella oneidensis MR-1 biofilms by
cyclic di-GMP.J Bacteriol 188(7):26812691
Tote K, Berghe DV, Maes L, Cos P (2008) A new colorimetric microtitre model for the detection
of Staphylococcus aureus biofilms. Lett Appl Microbiol 46(2):249254
Vesper SJ, Bauer WD (1986) Role of pili (fimbriae) in attachment of Bradyrhizobium japonicum
to soybean roots. Appl Environ Microbiol 52(1):134141
Villa F, Remelli W, Forlani F, Gambino M, Landini P, Cappitelli F (2012) Effects of chronic sub-
lethal oxidative stress on biofilm formation by Azotobacter vinelandii. Biofouling 28(8):
823833
Wagner M, Ivleva NP, Haisch C, Niessner R, Horn H (2009) Combined use of confocal laser scanning microscopy (CLSM) and Raman microscopy (RM): investigations on EPSmatrix. Water
Res 43(1):6376
229
Chapter 12
12.1
231
232
G. Reem et al.
12
233
undergo major changes, since genetic rearrangements may occur at high frequency.
In laboratory mass production of inoculants for agriculture, genome plasticity
should be taken into account and kept under control as much as possible. On the
other hand, the genome plasticity could also be considered as a chance to preselect
for strains optimized for specific niches and a possible way for strain improvement
to specific plant and soil requirements (Wisniewski-Dy et al. 2014). Extensive
comparative genome-sequencing experiments of parental and phenotypic variants
will bring much more insights into the underlying molecular and genetic mechanisms associated with phenotypic variation in Azospirillum species.
Here we review methodologies for studying phenotypic variation occurring
mainly in plant growth-promoting bacteria of the genus Azospirillum, but could be
relevant also in other associated rhizosphere bacteria.
12.2
12.2.1
234
G. Reem et al.
a key enzyme in indole-3-acetic acid (IAA) synthesis. This gene, and the corresponding
PCR primers, has been suggested as a reliable and specific indicator for A. brasilense
(Shime-Hattori et al. 2011). As an example, each 25 L PCR reaction contains
12.5 mL of Taq Master MIX (Lambda Biotech), MgCl2 (1 mM), BSA (0.04 mg mL1),
and 1.6 mM of each ipdC primer: A32f (forward), 50-CCCCTCCACAATTTCCG
GCGCAT-30, and A42r (reverse), 50-CGCCACCCCTAGAGTGGAGCTGTA-30
(Shime-Hattori et al. 2011).
PCR amplifications are performed in an automated thermal cycler (Eppendorf
Mastercycler Gradient Machine) with an initial denaturation (94 C, 2 min) followed by 30 cycles of denaturation (94 C,30 s), annealing (60 C, 30 s) and extension (72 C, 1 min), and a single final extension (72 C, 5 min). PCR products are
then electrophoresed directly on 1 % agarose gels, visualized by ethidiumbromide
staining, excised from the gel with the HiYield Gel/PCR DNA Fragment Extraction
Kit (RBC Bioscience) and sequenced.
12.2.2
12
235
performed on an automated Eppendorf Mastercycler. Sequence analyses are performed using the BLAST network service (Altschul et al. 1997) and Pfam (http://
pfam.sanger.ac.uk/). Oligonucleotide primers are synthesized using the Primer3
program http://www.es.embnet.org/cgi-bin/primer3_www.cgi.
12.2.3
Extracellular polysaccharides are involved in the A. brasilenseplant root interactions and in survival to environmental stresses (Lerner et al. 2009a, b). Therefore,
comparison of LPS and EPS of the variants with those of the parental strain is
recommended.
Azospirillum cultures either non-treated or exposed to starvation, high temperature (55 C) or other stresses, or isolated from inoculated plants (Lerner et al. 2010;
Volfson et al. 2013) are grown and colonies are randomly collected after these treatments and assessed for phenotypic alterations. For recognition of variants, emphasis
is put on change in pigmentation, gain of cell aggregation ability, and EPS overproduction. These phenotypes have been often associated with increased survival to
different stresses in A. brasilense and in other bacterial species (Hartmann and
Hurek 1988; Burdman et al. 2000b; Lerner et al. 2009a, b).
EPS, CPS and LPS extraction and determination are performed according to
Lerner et al. (2009a, b). Briefly for LPS, 1 mL of overnight-grown cultures are centrifuged (13,000g, 1 min, twice), and the resulting pellets are resuspended in 130 mL
SDS sample buffer and then boiled for 5 min at 100 C, and following removal of cell
debris, proteinase K is added to a final concentration of 0.5 mg/mL. The samples are
incubated at 37 C for 1 h; afterwards, 20 mL aliquots are loaded onto SDS-PAGE
gels containing 3 and 15 % polyacrylamide concentrations in the stacking and
resolving gels, respectively. The samples are electrophoresed at 15 mA for 3.5 h,
and following electroblotting (70 V, 1 h) to a nylon membrane (Rosch) to remove
residual proteins, the gels are then silver-stained (Lerner et al. 2009a). LPSs are
extracted also with an LPS extraction kit (Intron Biotechnology), and samples are run
on a deoxycholic acid (DOC)-polyacrylamide gel according to Reuhs et al. (1998).
12.2.3.1
Sugar amount is evaluated by the anthrone method (Dische 1962). Microbial mass
is determined by measuring the dry cell mass of pelleted cells at 80 C until a constant weight is reached.
Identification of EPS monosaccharide composition is performed according to
Albersheim et al. (1967), with minor modifications. Sugar composition of modified
alditols is determined in a Hewlett Packard HP 5890 Series II gas chromatograph,
236
G. Reem et al.
equipped with a DB-225 capillary column (30 m 6 0.25 mm) from J&W Scientific
and a flame-ionization detector (FID) at 250 C. Samples (1 mL) of mixed alditols
are separated at 220 C with helium as the carrier gas. Congo red and calcofluor
staining, indicating polysaccharide composition in the cells, is performed for each
strain, as described by Croes et al. (1991), respectively. Calcofluor binds predominantly to 14- and 13-linked glucans, congo red binds preferentially polysaccharides of certain bacterial species such as Azospirilla.
EPS is extracted from minimal medium liquid cultures, by fractionation with
cold ethanol as described by del Gallo et al. (1989) and modifications by Lerner
et al. (2009a). Briefly, following growth, bacterial cultures are centrifuged at
7,000g for 10 min at 10 C. The supernatant is collected and left to stand in three
volumes of cold ethanol for 72 h at 4 C, resulting in EPS precipitation. After ethanol evaporation, precipitated polysaccharides are suspended in and dialyzed against
distilled water for 72 h at 4 C, using a dialysis membrane with a molecular mass
cutoff of 1214 kDa, and lyophilized. Absence of proteins in the extracted EPS is
confirmed by the Bradford method, following manufacturer conditions (BioRad).
Evaluation of the sugar amount is done by weighing or by the Anthrone method
using glucose as a standard (Dische 1962). For determination of EPS monosaccharide composition, EPS is hydrolyzed following lyophilization according to Lerner
et al. (2009a). Briefly, sugar composition of modified alditols is determined in
Hewlett Packard HP 5890 Series II gas cromatograph, equipped with a DB-225
capillary column (30 m 0.25 mm) from J&W Scientific and a flame ionization
detector (FID) at 250 C. Samples (1 L) of mixed alditols are separated at 220 C
with helium as the carrier gas.
Pigment extraction and separation: Cells are resuspended in phosphate buffer and
disrupted in an ice bath with an ultrasonic disintegrator and then centrifuged. Cells
are extracted in acetone/methanol, after drying; the red pigment obtained is partitioned between methanol and chloroform and purified in chloroform. For details,
see Nur et al. 1981. Bacterial carotenoids are determined using an absorption coefficient of 2,500 at 500 nm for 1.0 % W/V solution (Nur et al. 1981).
As an alternative, pigment extraction is carried out at room temperature, and all
glassware is covered with aluminium foil to protect the pigments from light. UV
visible absorption spectra between 300 and 600 nm of the pigments dissolved in
methanol are recorded with a Hitachi U-2000 spectrophotometer.
12.2.4
Starvation experiments: Aliquots (10 mL) of overnight, high C:N medium cultures
of wild-type and mutant strains at approximately 6 108 c.f.u. mL1 are washed
twice by centrifugation (4,000g, 10 min). Cells are resuspended in 0.06 M
12
237
potassium phosphate buffer (pH 6.8) and incubated on a shaker at 200 rpm, 30 C
for 12 days under starvation, as described by Kadouri et al. (2002).
Bacterial viability is determined by dilution plating at the beginning and end of
the incubation period. This experiment is repeated three times.
Stress endurance: In all experiments, 0.5 mL aliquots of LB-grown overnight cultures of wild-type and PV strains are used to inoculate 100 mL Erlenmeyer flasks
containing 30 mL high C:N medium, for example, containing D-fructose 6.67 g L1
and NH4Cl 0.214 g L1, (low C:N contain the same components but 0.963 g L1
NH4Cl) and grown for 24 h at 30 C with agitation at 250 rpm.
The resulting cultures are used to assess bacterial survival under various
stresses. The percentage of viable cells is determined following dilution plating at
the beginning and end of each experiment, and/or during the course of the experiment.
In all experiments, the initial number of cells is approximately 5.0 108 c.f.u. mL1.
All experiments are conducted three times as described by Kadouri et al. (2003)
with the following modifications: in the heat resistance experiments, 10 mL of
culture is incubated in a water bath at 55 C for 60 min. Bacterial viability is determined every 15 min.
Bacteria are grown in D-fructose minimal liquid medium. The resulting cultures
are used to assess bacterial survival under UV and heat stresses. In all experiments,
the initial cell concentration are of approximately 5 108 CFU mL1 (OD590 ~0.8).
In heat resistance experiments, 10 mL of cultures are incubated in a water bath at
55 C for 60 min. Bacterial viability is determined every 15 min. In experiments
performed to assess resistance to UV radiation, 20 mL of cells in 90-mm Petri
dishes are exposed to UV radiation (254 nm) using a VL-6LC ultraviolet lamp
(Vilber-Lourmat) for 120 s, and bacterial viability is determined every 30 s. The
percentage of viable cells is determined following dilution plating at the beginning
and during the course of the experiment. In addition, the A. brasilense Sp7 variants
are assessed for biofilm formation ability by the microplate method according to
Lerner et al. (2010) and cell aggregation according to Burdman et al. (1998).
12.2.5
238
G. Reem et al.
References
Albersheim P, Nevins DJ, English PD, Karr A (1967) A method for the analysis of sugars in plant
cell-wall polysaccharides by gas-liquid chromatography. Carbohydr Res 5:340345
Alexandre G, Bally R (1999) Emergence of a laccase-positive variant of Azospirillum lipoferum
occurs via a two-step phenotypic switching process. FEMS Microbiol Lett 174:371378
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic
Acids Res 25:33893402
Bahat-Samet E, Castro-Sowinski S, Okon Y (2004) Arabinose content of extracellular polysaccharide plays a role in cell aggregation of Azospirillum brasilense. FEMS Microbiol Lett 237:
195203
Burdman S, Jurkevitch E, Schwartsburd B, Hampel M, Okon Y (1998) Aggregation in Azospirillum
brasilense: effects of chemical and physical factors and involvement of extracellular components. Microbiology 144:19891999
Burdman S, Jurkevitch E, Okon Y (2000a) Surface characteristics of Azospirillum brasilense in
relation to cell aggregation and attachment to plant roots. Crit Rev Microbiol 26:91110
Burdman S, Jurkevitch E, Soria-Daz ME, Gil Serrano AM, Okon Y (2000b) Extracellular polysaccharide composition of Azospirillum brasilense and its relation with cell aggregation. FEMS
Microbiol Lett 189:259264
Croes C, Van Bastelaere E, DeClercq E, Eyers M, Vanderleyden J, Michiels K (1991) Identification
and mapping of loci involved in motility, adsorption to wheat roots, colony morphology, and
growth in minimal medium on the Azospirillum brasilense Sp7 90-MDa plasmid. Plasmid
26:8393
del Gallo M, Negi M, Neyra CA (1989) Calcofluor- and lectin-binding exocellular polysaccharides
of Azospirillum brasilense and Azospirillum lipoferum. J Bacteriol 171:35043510
12
239
Dische Z (1962) General color reactions. In: Whistler RL (ed) Methods in carbohydrate chemistry.
Academic, New York, pp 478480
Hartmann A, Hurek T (1988) Effect of carotenoid overproduction on oxygen tolerance of nitrogen
fixation in Azospirillum brasilense Sp7. J Gen Microbiol 134:24492455
Hartmann A, Gndisch C, Bode W (1992) Azospirillum mutants improved in iron acquisition and
osmotolerance as tools for the investigation of environmental fitness traits. Symbiosis 13:
271279
Henderson IR, Owen P, Nataro JP (1999) Molecular switches-the ON and OFF of bacterial phase
variation. Mol Microbiol 33:919932
Kadouri D, Burdman S, Jurkevitch E, Okon Y (2002) Identification and isolation of genes involved
in poly -hydroxybutyrate (PHB) biosynthesis in Azospirillum brasilense and characterization
of a phbC mutant. Appl Environ Microbiol 68:29432949
Kadouri D, Jurkevitch E, Okon Y (2003) Involvement of the reserve material poly--hydroxybutyrate
in Azospirillum brasilense stress endurance and root colonization. Appl Environ Microbiol
69:32443250
Lerner A, Castro-Sowinski S, Valverde A, Lerner H, Dror R, Okon Y, Burdman S (2009a) The
Azospirillum brasilense Sp7 noeJ and noeL genes are involved in extracellular polysaccharide
biosynthesis. Microbiology 155:40584068
Lerner A, Okon Y, Burdman S (2009b) The wzm gene located in the pRhico plasmid of Azospirillum
brasilense Sp7 is involved in lipopolysaccharide synthesis. Microbiology 155:791804
Lerner A, Valverde A, Castro-Sowinski S, Lerner H, Okon Y, Burdman S (2010) Phenotypic variation in Azospirillum brasilense exposed to starvation. Environ Microbiol Rep 2:577586
Louws FJ, Fulbright DW, Stephens CT, de Bruijn FJ (1994) Specific genomic fingerprintings of
phytopathogenic Xanthomonas and Pseudomonas pathovars and strains generated with repetitive sequences and PCR. Appl Environ Microbiol 60:22862295
Nur I, Steinitz YL, Okon Y, Henis Y (1981) Carotenoid composition and function in nitrogen fixing
bacteria of the genus Azospirillum. J Gen Microbiol 122:2732
Okon Y, Albrecht SL, Burris RH (1977) Methods for growing Spirillum lipoferum and for counting
it in pure culture and in association with plants. Appl Environ Microbiol 33:8588
Reuhs BL, Geller DP, Kim JS, Fox JE, Kolli VSK, Pueppke SG (1998) Sinorhizobium fredii and
Sinorhizobium meliloti produce structurally conserved lipopolysaccharides and strain-specific
K antigens. Appl Environ Microbiol 64:49304938
Shime-Hattori A, Kobayashi S, Ikeda S, Asano R, Shime H, Shinano T (2011) A rapid and simple
PCR method for identifying isolates of the genus Azospirillum within populations of rhizosphere bacteria. J Appl Microbiol 111:915924
Van der Woude MW, Baumler AJ (2004) Phase and antigenic variation in bacteria. Clin Microbiol
Rev 17:581611
Vial L, Lavire C, Mavingui P, Blaha D, Haurat J, Monne-Loccoz Y, Bally R, Wisniewski-Dye F
(2006) Phase variation and genomic architecture changes in Azospirillum. J Bacteriol
188:53645373
Volfson V, Fibach-Paldi S, Paulucci NS, Dardanelli MS, Matan O, Burdman S, Okon Y (2013)
Phenotypic variation in Azospirillum brasilense does not influence plant growth promotion
effects. FEMS Microbiol Lett 67:255262
Wisniewski-Dy F, Vial L (2008) Phase and antigenic variation mediated by genome modifications. Antonie Van Leeuwenhoek 94:493515
Wisniewski-Dy F, Vial L, Burdman S, Okon Y, Hartmann A (2015) Biological Nitrogen Fixation
Volume 2. John Wiley and Sons, Inc. pp 921932
Chapter 13
Polyhydroxybutyrate inAzospirillum
brasilense
MarceloMller-Santos, EmanuelMaltempi de Souza,
FabiodeOliveira Pedrosa, andLedaSatieChubatsu
Abstract Polyhydroxybutyrate (PHB) is a polyhydroxyalkanoate produced by
several bacteria as carbon storage and reductive equivalents sink. The production of
PHB has been reported for several plant-associated bacteria, and especially in
Azospirillum brasilense, the production of PHB has been associated as a factor for
stress endurance. In addition, bacterial cells colonizing plants are often shown to
contain PHB granules, suggesting that both PHB production and accumulation may
be an important factor for plantbacteria association. Based on that, this chapter will
present experimental protocols for screening of PHB-producer bacteria and quantification. Basically, the protocols address the bacteria growth conditions for PHB
production, as well as different methodologies for PHB quantification using
GC-FID, HPLC, and FT-IR.This information may be useful for researchers interested on PHB metabolism investigation, and additionally, for those interested in
biotechnological applications concerning A. brasilense.
13.1 Introduction
Polyhydroxybutyrate, or poly-3-hydroxybutyrate (PHB), is an important polyhydroxyalkanoate produced and accumulated by several bacteria in conditions of carbon oversupply and low concentration of other nutrient, such as nitrogen (Madison
and Huisman 1999). The PHB polymer is stored as intracellular-insoluble granules
coated with proteins which may reach about 0.52% of the granule weight (Grage
etal. 2009; Jendrossek 2009). Previous reports have also indicated the presence of
lipids-coating PHB granules (Grage etal. 2009); however, a recent report analyzing the granules by electron cryotomography suggested that they may be coated
exclusively by proteins (Beeby etal. 2012). In addition to carbon storage, the accumulation of PHB has been related as a sinker for reducing equivalents, since the
M. Mller-Santos (*) E. Maltempi de Souza F. de Oliveira Pedrosa L.S. Chubatsu
Biological Nitrogen Fixation Laboratory, Department of Biochemistry
and Molecular Biology, Federal State University of Paran, Curitiba, PR, Brazil
e-mail: [email protected]
Springer International Publishing Switzerland 2015
F.D. Cassn et al. (eds.), Handbook for Azospirillum,
DOI10.1007/978-3-319-06542-7_13
241
242
M. Mller-Santos et al.
243
Thus, PHB screening and quantification methods may be useful for characterization
of new isolates of Azospirillum and other PGPRs. This chapter aims to bring to the
readers common protocols to screen for PHB-producing bacteria and quantify PHB
production.
244
M. Mller-Santos et al.
13.2.2 Q
uantification ofPHB inWhole Cells
by Gas Chromatography
The following protocol was modified from previous works describing methanolysis
of lyophilized cells and gas chromatographyflame ionization detector (GC-FID)
to determine the amount of the methyl-3-hydroxybutyrate ester produced (Braunegg
etal. 1978; Huijberts etal. 1994). The Me3HB amount measured is used indirectly
as the PHB amount of the sample.
Grow bacteria in a PHB production permissive condition until the culture reaches
the stationary phase. The maximum PHB accumulation is frequently achieved at
this point of the growth. It is worthy to notice that an extended incubation after
this point may lead to PHB degradation, especially if the carbon source in the
medium is exhausted.
Harvest cells from 10mL of culture by centrifugation in 15mL conical Falcon-
type tubes (5,000g, 4C, 10min).
Discard medium and add 1.5mL of distilled water.
245
246
M. Mller-Santos et al.
247
13.2.5 Q
uantification ofPHB by Fourier Transform
Infrared Spectroscopy
Recently, Kamnev and coworkers (2012) have applied the Fourier transform infrared (FTIR) spectroscopy to determine the PHB content in cultures of A. brasilense
Sp7 and Sp245. The FTIR has been described to be a sensitive and convenient tool
248
M. Mller-Santos et al.
for analyzing bacterial biomass samples, including PHB (Kamnev etal. 1996, 1997,
2006; Kansiz etal. 2000; Pistorius etal. 2009; Mayet etal. 2010, 2013; Hermelink
etal. 2011). Although this technique is very simple and practical, because it requires
only dried cells, a specific equipment to collect infrared spectra is imperative. The
following protocol was adapted from the information previously described by
Kamnev and coworkers (2012).
Harvest cells by centrifugation using 10mL of culture in 15mL conical Falcon-
type tube (5,000g, 4C, 10min).
Discard medium and wash the cell pellet with 1.5mL of phosphate-buffered
saline (pH7.1).
Dry cells at room temperature (25C) up to constant mass.
Powder the resulting dry biomass and place 0.5mg in a sampling cup.
Record DRIFT (Diffuse Reflectance Infrared Fourier Transform) spectra with a
4cm1 resolution in triplicate on a FTIR spectrometer. The methodology
described by Kamnev etal. (2012) has not employed KBr in sample preparation.
The percentage of PHB in the dry biomass samples is determined from the spectra by calculating the intensity ratio of the (CO) band of PHB around
1,730cm1 to that of the amide II band at ca. 1,550cm1, which is due mostly to
NH bending vibrations (Thi and Naumann 2007; Hermelink etal. 2011). For
calibration, it is suggested to use a recombinant PHB-accumulating Escherichia
coli, or other PHB-accumulating bacteria as A. brasilense Sp7 cultivated in high
carbon-to-nitrogen ratio, and correlated the data of FTIR spectra with gas-
chromatography or HPLC analysis.
Acknowledgment We are grateful to CNPq, INCT-Fixao Biolgica de Nitrognio, CAPES,
and Fundao Araucria for financial support.
References
Anderson AJ, Dawes EA (1990) Occurrence, metabolism, metabolic role, and industrial uses of
bacterial polyhydroxyalkanoates. Microbiol Rev 54:450472
Beeby M, Cho M, Stubbe J etal (2012) Growth and localization of polyhydroxybutyrate granules
in Ralstonia eutropha. J Bacteriol 194:10921099
Braunegg G, Sonnleitner B, Lafferty RM (1978) Rapid gas-chromatographic method for determination of poly-beta-hydroxybutyric acid in microbial biomass. Eur J Appl Microbiol Biotechnol
6:2937
Grage K, Jahns AC, Parlane N etal (2009) Bacterial polyhydroxyalkanoate granules: biogenesis,
structure, and potential use as nano-/micro-beads in biotechnological and biomedical applications. Biomacromolecules 10:660669
Hauf W, Schlebusch M, Huge J etal (2013) Metabolic changes in synechocystis PCC6803 upon
nitrogen-starvation: excess NADPH sustains polyhydroxybutyrate accumulation. Metabolites
3:101118
Hermelink A, Stammler M, Naumann D (2011) Observation of content and heterogeneity of
poly-beta-hydroxybutyric acid (PHB) in Legionella bozemanii by vibrational spectroscopy.
Analyst 136:11291133
249
250
M. Mller-Santos et al.
Schlegel HG, Lafferty R, Krauss I (1970) The isolation of mutants not accumulating poly-beta-
hydroxybutyric acid. Arch Mikrobiol 71:283294
Slepecky RA, Law JH (1960) A rapid spectrophotometric assay of alpha, beta-unsaturated acids
and beta-hydroxy acids. Anal Chem 32:16971699
Spiekermann P, Rehm BH, Kalscheuer R etal (1999) A sensitive, viable-colony staining method
using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and
other lipid storage compounds. Arch Microbiol 171:7380
Sun J, Peng X, Van Impe J etal (2000) The ntrB and ntrC genes are involved in the regulation of
poly-3-hydroxybutyrate biosynthesis by ammonia in Azospirillum brasilense Sp7. Appl
Environ Microbiol 66:113117
Sun J, Van Dommelen A, Van Impe J et al (2002) Involvement of glnB, glnZ, and glnD genes in the
regulation of poly-3-hydroxybutyrate biosynthesis by ammonia in Azospirillum brasilense
Sp7. Appl Environ Microbiol 68:985988
Tal S, Okon Y (1985) Production of the reserve material poly-beta-hydroxybutyrate and its function in azospirillum-brasilense Cd. Can J Microbiol 31:608613
Tal S, Smirnoff P, Okon Y (1990a) Purification and characterization of D(-)-beta-hydroxybutyrate
dehydrogenase from azospirillum-brasilense Cd. J Gen Microbiol 136:645649
Tal S, Smirnoff P, Okon Y (1990b) The regulation of poly-beta-hydroxybutyrate metabolism in
azospirillum-brasilense during balanced growth and starvation. J Gen Microbiol 136:
11911196
Thi NAN, Naumann D (2007) Investigating the heterogeneity of cell growth in microbial colonies
by FTIR microspectroscopy. Anal Bioanal Chem 387:17691777
Trainer MA, Charles TC (2006) The role of PHB metabolism in the symbiosis of rhizobia with
legumes. Appl Microbiol Biotechnol 71:377386
Trainer MA, Capstick D, Zachertowska A et al (2010) Identification and characterization of the
intracellular poly-3-hydroxybutyrate depolymerase enzyme PhaZ of Sinorhizobium meliloti.
BMC Microbiol 10:92
Tribelli PM, Lopez NI (2011) Poly(3-hydroxybutyrate) influences biofilm formation and motility
in the novel Antarctic species Pseudomonas extremaustralis under cold conditions. Extre
mophiles 15:541547
Wang C, Sheng X, Equi RC et al (2007) Influence of the poly-3-hydroxybutyrate (PHB) granuleassociated proteins (PhaP1 and PhaP2) on PHB accumulation and symbiotic nitrogen fixation
in Sinorhizobium meliloti Rm1021. J Bacteriol 189:90509056
Willis LB, Walker GC (1998) The phbC (poly-beta-hydroxybutyrate synthase) gene of Rhizobium
(Sinorhizobium) meliloti and characterization of phbC mutants. Can J Microbiol 44:554564
Chapter 14
14.1
Introduction
Siderophores (from the Greek: iron carriers) are defined as relatively low molecular weight, ferric ion-specific chelating agents produced by bacteria and fungi
growing under limited availability of iron (Neilands 1995). Iron is the fourth most
abundant element in the earths crust and in most types of soil it is in excess. This
element can exist in aqueous solution in two states: Fe2+ and Fe3+; however, Fe3+
forms are not readily utilizable by plants and microorganisms because they frequently form insoluble oxides or hydroxides which limit its bioavailability (Desai
and Archana 2011; Zuo and Zhang 2011). Siderophores form high-spin, kinetically
251
252
R.O. Pedraza
labile chelates with ferric ion which are characterized by exceptional thermodynamic
stability. The formation constant for typical molecules containing three bidentate
ligands is 1030, or greater. The affinity for gallium is also high, but the attraction for
aluminum and for all divalent ions is substantially less. Therefore, the siderophore
ligand can be specific for Fe3+ among the naturally occurring metal ions of abundance (Neilands 1995).
The function of siderophores is to scavenge iron from the environment and to
make the mineral available to the microbial cell (Neilands 1995). However, not all
microorganisms have need for iron, and siderophores; for example, some lactic acid
bacteria are not stimulated to greater growth with iron as they have no heme
enzymes, and the crucial iron-containing ribotide reductase has been replaced with
an enzyme using adenosylcobalamin as the radical generator (Reichard 1993).
In the other side, it was observed that many uncultured bacteria are chemically
dependent on siderophores produced by other microorganisms, which enabled the
isolation of rare bacteria (DOnofrio et al. 2010).
14.2
Iron is an essential element for the growth of most bacteria because it is a component of enzymes with important roles in electron transfer, RNA synthesis, and
resistance to reactive oxygen intermediates (Braun 1997; Cornelis and Matthijs
2002). To maintain growth, bacteria have developed different strategies to obtain
iron from the iron-limited environment, but siderophores-mediated iron uptake is
probably the most common form of iron acquisition (Braun and Winkelmann 1987).
In Gram-negative bacteria, the ferric siderophores are taken up in an energy-coupled
process across the outer and cytoplasmic membranes (Braun 1985; Braun et al. 1991).
Transport across the outer membrane requires receptor proteins that specifically
recognize the diverse ferric siderophores. Outer membrane translocation of the ferric siderophores depends on TonB-ExbB-ExbD, a cytoplasmic membrane-localized
complex that transduces energy from the proton motive force to receptors in the
outer membrane (Braun 1995; Occhino et al. 1998).
More than 100 enzymes involved in primary and secondary metabolism have
iron-containing cofactors, for instance, ironsulfur cluster or heme groups. The
reversible Fe2+/Fe3+ redox pair is best suited to catalyze a wide spectrum of redox
reactions and to mediate electron chain transfer (Miethke and Marahiel 2007). These
enzymes and cofactors participate in diverse processes such as: respiration, activation of oxygen, degradation of hydrogen peroxide and hydroxyl radicals, amino-acid
and pyrimidine biosynthesis, the citric acid cycle, DNA synthesis, nitrogen fixation,
carbon fixation metabolism, photosynthesis, and oxygen binding (Andrews 1998).
Additionally, several transcriptional and posttranscriptional regulators interact with
iron to sense its intracellular level or the current status of oxidative stress to efficiently control the expression of a broad array of genes implicated mainly in iron
acquisition or in the reactive oxygen species protection (Hantke 2001).
14
253
14.3
Two strategies have been developed by plants to obtain iron from the soil. Strategy
I involves acidification of the rhizosphere (the surrounding area of the root) followed by reduction of Fe3+ ions by membrane-bound Fe3+-chelate reductase and
subsequent uptake of Fe2+ into root cells. Strategy II refers to the plants which
secrete low molecular weight phytosiderophores in order to solubilize and bind iron
which is then transported into root cells via membrane proteins (Altomare and
Tringovska 2011; Guerinot 2010). However, regardless these two strategies, extensive research have been addressed to correct chlorosis in plants (iron deficiency) by
the application of available iron compounds to the soil and by selective plant breeding to produce Fe-chlorosis-resistant cultivars. In addition, the probable implication
of siderophores produced by PGPB has been considered as a potential way to
improve plant growth, nodulation, and N2-fixation in iron-deficient conditions
(Fernndez-Scavino and Pedraza 2013).
254
R.O. Pedraza
Hence, siderophores can be also a competitive advantage for plant growth. It was
reported that specific strains o the Pseudomonas fluorescens-putida group enhanced
growth and yields when used as seed inoculants via siderophores production
(Kloepper et al. 1980). Sharma and Johri (2003) reported that maize seeds inoculated with siderophore-producing pseudomonads positively influenced the crop
productivity in calcareous soil system. Also, Pandey et al. (2005) observed that
Pseudomonas aeruginosa GRC1, a prolific producer of hydroxamate siderophores
in iron-deficient conditions enhanced the growth of Brassica campestris var Pusa
Gold (Indian mustard) in field trials. Recently, Radzki et al. (2013) showed that
siderophores produced by Chryseobacterium C138 efficiently provided iron to ironstarved tomato plants in hydroponics culture. There are some more examples on the
contribution of bacterial siderophores to the plant growth, but at present, there is not
information about the direct participation of Azospirillum siderophores as PGPB
in iron nutrition. As a particular case, it was reported that the community of endophytic siderophore-producing bacteria associated to rice (Oryza sativa) cultivated at
field conditions is dynamic and diverse (Loaces et al. 2011). These bacteria were
present in grains, roots, and leaves and their density fluctuated between log10 3.44
and log10 5.52 cfu g1 fresh weight during the plant growth. Less than 10 % of the
heterotrophic bacteria produced siderophores in roots and leaves of young plants,
but most of the heterotrophic bacteria were siderophore producers in mature
plants. Although siderophores production cannot be discarded as a mechanism that
contributes to this constant association, other mechanisms may be involved since
different bacteria able to sequester Fe3+ alternate in rice tissues (Loaces et al. 2011).
14.4
14.4.1
The method is based on the universal Chrome Azurol Sulphonate (CAS) assay,
according to Schwyn and Neilands (1987). This detects color change of CAS-iron
complex (from blue to orange) after the iron chelation by siderophores.
14
14.4.1.1
255
CAS 10 Preparation
14.4.2
The CAS solution prepared in 4.1 can be used to quantify siderophores activity in
culture supernatant extracts by measuring the decrease in the absorbance of blue
color at 630 nm (Schwyn and Neilands 1987). For that, mix 6 mL of HDTMA
256
R.O. Pedraza
Fig. 14.1 Different steps of the CAS assay to determine siderophores production in Azospirillum.
(a) Solution A, (b) Solution B, (c) CAS 10 solution, (d) NFb medium with PIPES, (e) mixture of
CAS 10 solution and NFb medium, (f) Petri dish containing agar-CAS medium, (g) A. brasilense
colonies showing siderophores production
10 mM diluted with water and mixed with 1.5 mL of Fe3+ solution (1 mM FeCl36H2O
in HCl 10 mM) and 7.5 mL 2 mM aqueous CAS solution under stirring conditions.
Separately, dissolve 4.307 g of PIPES in water and add 6.75 mL of 12 M HCl. Then,
mix slowly this buffer solution (pH 5.6) with CAS solution and complete up to
100 mL with bidistilled water. A solution of 5-sulfosalicylic acid 0.2 M (SigmaAldrich, USA) has to be prepared to use as CAS shuttle solution to facilitate transfer
of iron from the CAS complex to bacterial siderophores.
For quantitative assay, 150 L of an overnight culture of Azospirillum in NFb
liquid medium is adjusted to a final concentration of 106 CFU mL1 and inoculated in
14
257
150 mL of the same medium and incubated 7 days at 30 C. To increase the sensitivity
of the CAS assay, the cell-free medium is concentrated 30-fold by lyophilization,
resuspended in 5 mL of distilled water and desalted by using a Sephadex G-25
column (Sigma-Aldrich, USA) (Tortora et al. 2011).
The fraction containing siderophores is added to CAS assay solution (1:1) and
mixed with shuttle solution (100:1). After 1 h at room temperature the absorbance
(A630 nm) is measured. The percentage of siderophore units is estimated as the proportion of CAS color shift using the formula [(Ar As)/Ar] 100, where Ar is the A630 nm of
the reference sample (medium plus CAS assay solution plus shuttle solution) and As is
the A630 nm of the sample (supernatant plus CAS assay solution plus shuttle solution).
14.4.3
Although siderophores vary greatly in chemical structure they are classified into two
main groups: catechol and hydroxamate, according to the chemical group involved
in iron Fe3+ chelation.
The chemical nature of siderophores can be investigated by analyzing the absorption
spectra in a spectrophotometer. A peak between 420 and 450 nm and another at 495 nm
after the addition of 1 mL of 2 % aqueous FeCl3 to 1 mL of cell-free culture filtrate
indicates the presence of ferric hydroxamates and ferric catecholate, respectively
(Neilands 1981). The presence of catechol and hydroxamate type phenolates are assayed
on ethyl acetate extracts of the culture supernatants. For that, the extracts are prepared
by extracting 150 mL of supernatant twice with an equal volume of solvent at pH 2.0.
Catechol siderophores can also be assayed according to Arnow (1937). Briefly,
1 mL of each bacterial supernatant is mixed with 1 mL of HCl 0.5 N and 1 mL of
nitrite molybdate reagent (10 g NaNO2 and 10 g NaMoO4, dissolved in 100 mL
of distilled H2O), and then mixed with 1 mL NaOH 1 N. After 15 min at room temperature the absorbance (A510 nm) is measured.
Hydroxamate siderophores can also be analyzed in culture supernatants according
to the ferric perchlorate assay (Atkin et al. 1970). Catechin and hydroxylamine hydrochloride may be used as the standards. Perform each assay at least by triplicate.
For further analyses, the fraction containing siderophores is prepared by extraction of acidified (pH 2.0) supernatants with an equal volume of ethyl acetate;
the solvent is eliminated by vacuum rotary evaporator at 37 C and the residue
is then resuspended in methanol for TLC analysis and in ethyl acetate for Gas
chromatographymass spectrometry (GC-MS) assay (explained below).
14.4.4
The methanol-soluble siderophores fraction is analyzed by TLC using silica gel plates
(e.g., Merck, SiO2H2O 20; 20 cm; G 60 F254nm), and a mobile phase consisting in a
solvent mixture of butanol/acetic acid/water [4: 0.5: 5.5 (v/v/v)]. The plate is dried at
258
R.O. Pedraza
room temperature and observed under long-wave UV light (365 nm) and short-wave
UV (254 nm). For instance, salicylic acid PA grade or any other compound of reference can be used as standard. Then, bands with the same Rf as the standard can be
scrapped out from the plate, dissolved in methanol 100 % (v/v), centrifuged, and
concentrated by lyophilization. The residue is resuspended in methanol 20 % (v/v)
and analyzed by fluorescence spectroscopy. Samples emission spectra are evaluated
at excitation of 296 nm.
14.4.5
Following the method employed by Tortora et al. (2011), to confirm the presence of
salicylic acid (SA) in bacterial supernatants, cultures were analyzed by GC-MS
using a Thermo Electron equipment Polaris Q model associated to an electronimpact ionization source and an Ion Trap Mass Analyzer (Thermo Finnigan, USA).
Separations were carried out on a DB-5 column (Agilent JW, USA) using He as
carrier gas at 0.3 mL min1 and an injection volume of 0.1 L. The ion source is
maintained at 200 C; the GC oven is programmed with a temperature gradient
starting at 50 C for 1 min to 350 C at 10 min1. Then MS analysis is carried out
in the electron-impact mode at an ionizing potential of 70 eV. SA PA grade
(1 g mL1) was used as standard.
14.5
14
259
According to this information, Tortora et al. (2011) showed that under iron-limiting
conditions, different strains of A. brasilense can produce siderophores, exhibiting
different yields and rates of production according to their origin (isolated from root
surface or inner tissues of stolons and roots). Chemical assays revealed that strains
REC2 and REC3 secrete catechol-type siderophores, including salicylic acid,
detected by thin layer chromatography coupled with fluorescence spectroscopy and
gas chromatographymass spectrometry analysis. Siderophores produced by them
showed in vitro antifungal activity against Colletotrichum acutatum M11, the causal
agent of anthracnose disease in strawberry plants. Furthermore, this latter coincided
with results obtained from phytopathological tests carried out in planta, where a
reduction of anthracnose symptoms on strawberry plants previously inoculated with
A. brasilense was observed (Tortora et al. 2011). These results imply that some
strains of A. brasilense could act as biocontrol agent, besides promoting plant
growth (Pedraza et al. 2007, 2010; Tortora et al. 2011). Furthermore, Tortora et al.
(2012) provided evidences that endophytic root colonization of strawberry plants
with A. brasilense REC3 strain conferred systemic protection against C. acutatum
M11 by the direct activation of some plant defense reactions, and also primed the
plant for stronger elicitation of these defense responses following infection. The
defense mechanisms induced by A. brasilense REC3 included the reinforcement of
plant cell wall by increasing the content of total phenolic compounds and callose
depositions, and the activation of a SA-mediated signaling pathway that concluded
in the overexpression of defense-related genes, such as those encoding pathogenesisrelated proteins like PR1, chitinases and glucanase. Based on these outcomes, it is
proposed that the activation of systemic mechanisms for disease suppression
together with the plant growth-promoting effect exerted by A. brasilense REC3
strain (Pedraza et al. 2010) and its capacity to inhibit in vitro fungal growth, via
siderophores, could explain, in part, the increase of strawberry plants tolerance
to anthracnose disease caused by C. acutatum M11. On these assumptions, some
strains of A. brasilense could be considered as Biocontrol PGPB and raises the opportunity of using them as an alternative in the strawberry anthracnose disease management. However, further studies are necessary to obtain practical information for
extending the spectrum of potential biocontrol strains of A. brasilense on different
phytopathogen agents and agronomical important crops.
References
Andrews SC (1998) Iron storage in bacteria. Adv Microb Physiol 40:281351
Altomare C, Tringovska I (2011) Beneficial soil microorganisms, an ecological alternative for soil
fertility management. In: Lichtfouse E (ed) Genetics, biofuels and local farming systems, vol
7, Sustainable agriculture reviews. Springer, Netherlands, pp 161214
Arnow LE (1937) Colorimetric determination of the components of 3,4 dihydroxyphenylalaninetyrosine mixtures. J Biol Chem 118:531537
Atkin C, Neilands J, Phaff H (1970) Rhodotorulic acid from species of Leucosporidium,
Rhodosporidium, Rhodotorula, Sporodiobolus, and Sporobolomyces and a new alanine containing ferrichrome from Criptcoccus melibiosum. J Bacteriol 103:722733
260
R.O. Pedraza
14
261
Leeman M, den Ouden FM, van Pelt JA, Dirkx FPM, Steijl H, Bakker PAHM, Schippers B (1996)
Iron availability affects induction of systemic resistance to Fusarium wilt of radish by
Pseudomonas fluorescens. Phytopathology 86:149155
Leong SA, Winkelmann G (1998) Molecular biology of iron transport in fungi. In: Sigel A, Sigel
H (eds) Metal ions in biological systems, vol 35, Iron transport and storage in microorganisms,
plants, and animals. Marcel Dekker, New York, pp 147186
Loaces I, Ferrando L, Fernndez-Scavino A (2011) Dynamics, diversity and function of endophytic siderophore-producing bacteria in rice. Microb Ecol 61:606618
Maurhofer M, Reimmann C, Schmidli-Sacherer P, Heeb S, Haas D, Defago G (1998) Salicylic acid
biosynthetic genes expressed in Pseudomonas fluorescens P3 improve the induction of systemic
resistance in tobacco against tobacco necrosis virus. Phytopathology 88:678684
Meyer JM, Azelvandre P, Georges C (1992) Iron metabolism in Pseudomonas: salicylic acid, a
siderophore of Pseudomuna fluorescens CHAO. Biofactors 4:2327
Miethke M, Marahiel MA (2007) Siderophore-based iron acquisition and pathogen control.
Microbiol Mol Biol Rev 71:413451
Neilands JB (1981) Microbial iron compounds. Annu Rev Biochem 50:715773
Neilands JB (1995) Siderophores: structure and function of microbial iron transport compounds.
J Biol Chem 270:2672326726
Occhino DA, Wyckoff EE, Henderson DP, Wrona TJ, Shelley M (1998) Vibrio cholerae iron transport: haem transport genes are linked to one of two sets of tonB, exbB, exbD genes. Mol
Microbiol 29:14931507
Pandey P, Kang SC, Gupta CP, Maheshwari DK (2005) Rhizosphere competent pseudomonas
aeruginosa GRC1 produces characteristic siderophore and enhances growth of Indian mustard
(Brassica campestris). Curr Microbiol 51:303309
Pedraza RO, Motok J, Salazar SM, Ragout AL, Mentel MI, Tortora ML, Guerrero-Molina MF,
Winik BC, Daz-Ricci JC (2010) Growth-promotion of strawberry plants inoculated with
Azospirillum brasilense. World J Microbiol Biotechnol 26:265272
Pedraza RO, Motok J, Totora ML, Salazar SM, Daz-Ricci JC (2007) Natural occurrence of
Azospirillum brasilense in strawberry plants. Plant and Soil 295:169178
Perrig D, Boiero ML, Masciarelli OA, Penna C, Ruiz OA, Cassn FD, Luna MV (2007) Plantgrowth-promoting compounds produced by two agronomically important strains of Azospirillum
brasilense, and implications for inoculant formulation. Appl Microbiol Biotechnol 75:
11431150
Press CM, Wilson M, Tuzun S, Kloepper JW (1997) Salicylic acid produced by Serratia marcescens 90-166 is not the primary determinant of induced systemic resistance in cucumber or
tobacco. Mol Plant Microbe Interact 10:761768
Radzki W, Gutirrez-Maero FJ, Algar E, Lucas-Garca JA, Garca-Villaraco A, Ramos-Solano B
(2013) Bacterial siderophores efficiently provide iron to iron-starved tomato plants in hydroponics culture. Antonie Van Leeuwenhoek 104:321330
Reichard P (1993) The anaerobic ribonucleotide reductase from Escherichia coli. J Biol Chem
268:83838386
Reis VM, Teixeira KRS, Pedraza RO (2011) What is expected from the genus Azospirillum as plant
growth promoting bacteria? In: Maheshwari DK (ed) Bacteria in agrobiology: plant growth
responses. Springer, Berlin, pp 123138
Saxena B, Modi M, Modi VV (1986) Isolation and characterization of siderophores from
Azospirillum lipoferum D-2. J Gen Microbiol 132:22192224
Schwyn B, Neilands JB (1987) Universal chemical assay for the detection and determination of
siderophores. Anal Biochem 160:4756
Serino L, Reimmann C, Baur H, Beyeler M, Visca P, Haas D (1995) Structural genes for salicylate
biosynthesis from chorismate in Pseudomonas aeruginosa. Mol Gen Genet 249:217228
Shah S, Karkhanis V, Desai A (1992) Isolation and characterization of siderophore, with antimicrobial activity from Azospirillum lipoferum M. Curr Microbiol 25:3435
262
R.O. Pedraza
Chapter 15
15.1
Introduction
Diverse bacteria, especially bacteria interacting with eukaryotes, possess the ability
to regulate functions in a cell-density manner. In proteobacteria, this regulation
involves the synthesis of signal compounds termed autoinducers, usually belonging
to the family of N-acyl-L-homoserine lactones (AHLs) that differ in the length (from
4 to 18 carbons), saturation and substitution characteristics of the acyl chain
(Fig. 15.1). The first AHL to be characterized was that of Vibrio fischeri, a bioluminescent marine bacterium living in symbiosis with the squid Euprymna scolopes,
emitting bioluminescence only at high cell density; regulation of bioluminescence
was shown to rely on a bacterial extracellular compound accumulating during growth
263
264
15
265
QS regulation based on AHLs is used to control various phenotypes that are often
essential for interaction with a eukaryotic host (Williams et al. 2007). Among plantassociated bacteria, QS regulates production of virulence factors (Erwinia, Pantoea),
production of antifungal compounds (Pseudomonas), conjugative transfer of
plasmids (Agrobacterium, Rhizobium), efficacy of nodulation (Rhizobium), etc.
(Barnard et al. 2007; White and Winans 2007; Sanchez-Contreras et al. 2007; Pierson
and Pierson 2007).
This chapter aims at presenting the technical methodologies currently used to
highlight autoinducer production in a specific strain and to decipher phenotypes that
are under QS regulation. Analyses conducted by our team on the genus Azospirillum
will be used to illustrate the different steps of the approach.
15.2
15.2.1
15.2.1.1
Detection of AHLs
The discovery that numerous unrelated bacteria have the ability to produce AHL
molecules in response to a high cell density has been achieved by using bacterial
biosensors (Steindler and Venturi 2007). These biosensors have a functional regulator protein (LuxR homologue) but lack the AHL synthase enzyme and consequently
do not produce AHLs. Promoter activity of a gene or operon under QS regulation
can be induced by the presence of exogenous AHLs. These biosensors have easily
detectable phenotypes such as production of pigments, expression of -galactosidase
activity, light emission, or fluorescence (Table 15.1). Biosensors are either derivative of strains that naturally produce AHLs, or are entirely engineered plasmids that
can be used in several bacterial backgrounds.
Among derivatives of natural strains, two are easy to implement and are widely
used for AHL detection. The first, Chromobacterium violaceum CVO26, harbors a
transposon into the cviI AHL-synthase gene; exposure of this strain to exogenous
AHLs able to interact with CviR (the cognate LuxR) results in production of the
pigment violacein. This biosensor is able to detect rather short acyl chain AHLs
(48 carbons), the most active AHL being C6-HSL, the natural C. violaceum AHL
(McClean et al. 1997). It is noteworthy that C. violaceum CVO26 can also be used
to detect long acyl chain AHLs or QS antagonists, by including C6-HSL in the bioassay reaction mixture and screening for the inhibition of pigment production
(McLean et al. 2004). The second is a derivative Agrobacterium tumefaciens strain
NT1(pZLR4) that no longer produces its own signal molecule; this strain harbors a
traG-lacZ fusion plasmid that can be induced when a cognate AHL is recognized by
TraR. This second biosensor has the ability to detect a wide range of AHLs, including 3-oxo-HSLs and 3-hydroxy-HSLs (Luo et al. 2003).
-Galactosidase
Ice nucleation
activity
-Galactosidase
C8 to C14
Phenotype
triggered by AHL
Production of
violacein
-Galactosidase
Reference
McClean et al. (1997)
Strain or plasmid
Chromobacterium violaceum
CVO26
Agrobacterium tumefaciens
NTL1(pZLR4)
Agrobacterium tumefaciens
KYC55(pJZ372)(pJZ384)(pJZ410)
Agrobacterium tumefaciens
(pAHL-Ice)
Sinorhizobium meliloti Rm41
sinI::lacZ(pJNSinR)
15
Acetonitrile
(2 L)
C6-HSL
(100 pmol)
C7-HSL
(100 pmol)
C8-HSL
(450 pmol)
A. lipoferum 4B
(eq. 50 mL)
3-oxo-C6-HSL
(400 pmol)
3-oxo-C8-HSL
(400 pmol)
C10-HSL
(800 pmol)
b
*
*
A. lipoferum TVV3
(eq. 50 mL)
A. lipoferum TVV3
(eq. 20 mL)
267
C6-HSL
(100 pmol)
Fig. 15.2 Use of the biosensor Chromobacterium violaceum CVO26 to detect AHLs spotted on a
plate assay. (a) Detection of synthetic AHLs standards showing the sensitivity of this biosensor to
various AHLs; (b) Detection of AHLs present in extracts obtained from supernatants of some
Azospirillum strains. White stars show the location of spotting. Note the quantity of extracts needed
to trigger a positive response of the biosensor, that is correlated to the nature and quantity of AHLs
produced by each strain. LC-MS and quantification using TLC revealed that Azospirillum lipoferum
TVV3 produces 3-oxo-C8-HSL (5 pM), C8-HSL (1 nM), 3-oxo-C10-HSL, 3-OH-C10-HSL, and C10HSL (20 nM), whereas A. lipoferum B518 produced 3-oxo-C6-HSL (50 nM), C6-HSL, 3-oxo-C8HSL, 3-OH-C8-HSL, and C8-HSL (500 nM) (Vial et al. 2006). Consequently, only a tiny amount
of A. lipoferum B518 extract that is enriched in C8-HSL is needed to activate CVO26
268
AHLs from one bacterium. Sensitivity of the biosensor can be affected by the
medium used (Llamas et al. 2004). For plasmid-based biosensors, the range of
AHLs detected may depend on the bacterial strain hosting the plasmid (Riedel et al.
2001; Lumjiaktase et al. 2010).
Biosensors are a convenient, fast, and effective tool for detecting the presence of
AHLs. However, they cannot determine the structure, the number, and the concentration of AHLs, and most AHL-producing bacteria produce a set of AHLs in various proportions (Lithgow et al. 2001; Vial et al. 2006). In addition, biosensors are
not always effective when used directly with a strain to be tested; indeed, several
bacterial strains have been shown to produce AHL molecules, while normal biosensors yield negative results (Laue et al. 2000).
Using two different biosensors in a cross-streak assay, 40 Azospirillum strains
were tested for their ability to synthesize AHLs. AHL production was detected for
four strains belonging to the lipoferum species (TVV3, B52, B518) and to a closely
related species (B510), all isolated from the rice rhizosphere (Vial et al. 2006).
15.2.1.2
Extractions of AHLs
In order to elucidate their structure, AHLs have to be isolated and purified from
other molecules. To obtain enough material to perform characterization studies, signal molecules should be extracted from bacterial culture supernatants that contain
numerous other components. Stationary cell growth phase is recommended for
extraction as AHL accumulation is usually maximal at this growth stage. It is important to monitor the pH of the culture fluid as the lactone ring hydrolyzes at pH above
8; acidification of the culture fluid might be contemplated before extraction (Vial
et al. 2006). Liquidliquid extraction is the most common method used to isolate
AHLs, but more recently the use of solid-phase extraction has been reported.
Liquidliquid extraction uses organic solvents as extraction reagents. The solvents commonly used include dichloromethane, chloroform, acidified ethyl acetate
(0.1 mL glacial acetic acid per liter of ethyl acetate), ethyl ether, and hexane.
Previous studies show that the first two solvents produce the best extraction results
with nearly the same yields, and that the extraction yield decreases with the polarity
of the extracted AHLs (Morin et al. 2003). Samples are usually extracted twice with
half or one third a volume of dichloromethane (Winson et al. 1995). The two organic
phases are pooled and evaporated to dryness using a Rotavapor. The residue is then
dissolved in a small volume of acetonitrile (usually 1/1,000th of the initial volume)
and stored at 20 C until analysis.
Use of solid-phase extraction has also been reported for AHLs (Frommberger
et al. 2005; Schupp et al. 2005; Li et al. 2006), in combination or in replacement of
liquidliquid extraction. An improvement of the sensitivity by twofold to tenfold
was reported compared with liquidliquid extraction (Li et al. 2006). An optimized
protocol has been proposed (Li et al. 2006): the sample (with 25 %, v/v ACN) is
applied onto a Mega Bond Elut cartridge, which has previously been conditioned by
2 mL of water and 2 mL of methanol sequentially. The loaded column is then
washed with 15/85 (v/v) methanol/water and the analytes are eluted with 25/75
15
269
(v/v) hexane/isopropanol. The elute is then dried and lately resuspended in the
appropriate solvent for HPLC (high performance liquid chromatography) or UPLC
(ultra-high-pressure liquid chromatography). For the washing step, applying methanol to the washing solvent (at a content lower to 15 % (v/v)) was shown to be useful
to remove the highly polar solutes present in liquid culture media, especially in
complex media like LB or NB. For elution, the presence of hexane favors the recoveries of long side chain AHLs (>C12) while maintaining the recoveries of shorter
side chain AHLs (Li et al. 2006).
15.2.1.3
TLC coupled with biosensors produces a straightforward visual index of the AHLs
synthetized by the tested bacteria. AHLs extracted from supernatants (see
Sect. 15.2.1.2) and standards are loaded on a C18 reverse phase TLC plate. Once the
solvent of the samples is evaporated, the plate is runned upright in a glass chamber
containing a developing liquid solvent (usually a mixture of methanol and water).
The AHLs migrate at different rates due to their difference in polarity (correlated to
the length of acyl chain and the substitution at C-3). After migration and drying, the
TLC plate is overlaid with soft agar containing the biosensor, and incubated overnight at 30 C (Shaw et al. 1997). The color/light/fluorescence is emitted at the
location to which the AHL has migrated onto the plate. The 3-oxo derivatives characteristically produce tailing spots with diffuse edges, whereas the 3-unsubstituted
forms produce circular spots with sharp edges. The 3-hydroxy-substituted compounds migrate with the same mobility as their 3-oxo analogues, but the spots do
not tail (Shaw et al. 1997). Quantification can be achieved by converting the area of
spots into residual concentration of a given AHL via a calibration curve obtained
from the standard synthetic AHL.
Although reasonably simple and fast, the TLC-biosensor assay must be used
with caution. The signal molecule(s) must be recognized by the biosensor used and
must be present at a level detectable by this biosensor. This implies that the absence
of a positive response might be due to a concentration of signal molecules below
the threshold of sensitivity of the biosensor, or to the presence of a specific acyl
chain length or substitution that prevents the detection by the biosensor (Schaefer
et al. 2008). It is noteworthy that the medium used for growing the strain to be
tested may influence AHL production (Brelles-Marino and Bedmar 2001; Lithgow
et al. 2001; Li et al. 2006).
Conversely, compounds present in the supernatant and co-extracted with AHLs
can lead to false positive spots (Wisniewski-Dy et al. 2002). Finally, if TLC provides a good index of the set of AHLs produced by a bacterium, one cannot ascertain the chemical structure of the molecules detected and other more precise and
sensitive methods are required to provide definitive confirmation of their presence
and allow formal structural confirmation and accurate quantification.
In the case of a low concentration of signalling molecules, an alternative method
based on a radioactive incorporation of 14C-carboxy-methionine assay has been
developed (Singh et al. 2000). This assay allowed the detection of small amounts of
270
AHLs in complex matrices such as sputum or biofilms (Singh et al. 2000; Schaefer
et al. 2001) or specific long-chain AHL, such as C16-HSL identified in supernatants
of Rhodobacter capsulatus and Paracoccus denitrificans (Schaefer et al. 2002).
15.2.1.4
Most procedures of AHLs characterization have been carried out by using a combination of reverse phase HPLC and mass spectrometry (MS). Because of the very large
number of structurally related signalling molecules and the fact that other by-products
present in the supernatant are co-extracted, a preliminary separation is indeed required
using HPLC. Separation of AHLs by HPLC is performed on a C8 or C18 reverse phase
silica column using an isocratic or linear gradient elution of methanol-water or
acetonitrile-water as the mobile phase, with a flow of usually 0.40.5 mL/min and a
monitoring by UV at 200 or 210 nm (the only wavelength where AHLs can be hardly
traced). Fractions eluting from the HPLC column with retention times identical to
AHL standards or that are able to trigger activation of a biosensor can be rechromatographed; once a single active peak is obtained, it can be further analyzed for structural identification. Alternatively, a single active compound can be obtained via
preparative thin-layer chromatography (TLC) and the active spot can be scraped off
and extracted with dichloromethane, ethyl acetate, or acetone. After concentration,
the active spot can be further analyzed (Shaw et al. 1997; Vial et al. 2006).
Mass spectrometry can make a record of charge/mass ratio of ionized compound.
According to the molecular ion peaks and fragments, the molecular mass and structural features can be estimated. MS detects even picomoles of samples and can be
combined with HPLC (Winson et al. 1995), gas chromatography (GC) (Zhang et al.
1993; Wagner-Dobler et al. 2005), UPLC (Li et al. 2006; Fekete et al. 2007), nanoLC (Fekete et al. 2007), and capillary zone electrophoresis (CZE-MS) (Frommberger
et al. 2005). There are many types of ionization available, the most commonly used
for AHLs being (reviewed in Wang et al. 2010) electron ionization (EI-MS) (Bainton
et al. 1992), fast atom bombardment (FAB-MS) (Pearson et al. 1995; Winson et al.
1995), chemical ionization (CI-MS) (Gray et al. 1996), electrospray ionization
(ESI-MS) (Morin et al. 2003), and atmospheric pressure chemical ionization
(APCI-MS) (Vial et al. 2006). For quantification, the m/z 102 ion, specific for the
lactone ring and detected with a good signal-to-noise ratio, allows low detection
limits even in complex matrix samples (Morin et al. 2003; Ortori et al. 2007).
AHL molecules were structurally identified for two Azospirillum strains, using
LC-MS (with the APCI mode of ionization on an Agilent Technologies 1100 MSD
mass spectrometer): Azospirillum lipoferum TVV3 produces 3-oxo-C8-HSL, C8HSL, 3-oxo-C10-HSL, 3-OH-C10-HSL, and C10-HSL, whereas A. lipoferum B518
produces 3-oxo-C6-HSL, C6-HSL, 3-oxo-C8-HSL, 3-OH-C8-HSL, and C8-HSL
(Vial et al. 2006).
The structure of AHLs can be finally determined by nuclear magnetic resonance
(NMR); elucidation of the structure of 3-oxo-C6-HSL, which regulates carbapenem
antibiotic production in E. carotovora, was achieved mainly by NMR (Bainton
et al. 1992).
15
15.2.2
15.2.2.1
Transposon Mutagenesis
271
15.2.2.2
272
to TraR and activate the transcription of the traG-lacZ fusion. Thus, on a medium
containing X-gal (5-bromo-4-chloro-3-indolyl--D-galactopyranoside), only AHLproducing clones appear as blue colonies (-galactosidase activity) on plates.
Complete sequencing of the clone of interest is possible, and gene(s) involved in the
production of AHL are generally identified by Blast homology search against
Genbank database. An alternative to localize the AHL synthase encoding gene is to
perform an in vitro transposition of the relevant cosmid (the biosensor is then no
longer activated if the transposon insertion is located in the AHL synthase gene);
once the transposon mutants of interest are isolated, sequencing of regions flanking
the transposon allows the identification of the gene of interest. Thus, an ORF homologous to several genes encoding AHL synthases, and named alpI (for Azospirillum
lipoferum) was detected and characterized in A. lipoferum TVV3 (Vial et al. 2006).
To identify the gene(s) responsible for AHL production in plant-associated
Pseudomonas, similar approaches were undertaken, using other biosensors as recipient for the cosmid libraries, such as C. violaceum CV026 (Elasri et al. 2001) or the
bioluminescent AHL biosensor pSB403 (Table 15.1) (Steidle et al. 2002).
Interestingly, the gene hdtS encoding another family of AHL synthases was also
revealed using this strategy (Laue et al. 2000). This type of approach has the major
limitation of only being able to characterize synthases but not the transcriptional
regulator. However, the regulator associated with the synthase is often easily characterized, as in most QS systems, the luxI and luxR-type genes are in close genetic
proximity. Hence in A. lipoferum TVV3, the alpR gene encoding a luxR-type transcriptional regulator is located adjacently and in the same orientation than the alpI
gene (Vial et al. 2006). However, it is not a rule, as traI and traR present on the
tumor-inducing plasmid of A. tumefaciens are separated by approximatively 100 kb
(Fuqua and Winans 1994).
15.2.2.3
Genome Analyses
15
273
Aminotransferase
Transposase
LuxI
Thiosterase
Polyketide synthetase
Peptide synthetase
30 kb
DNA invertase
MetA
Polyketide synthase
PheT
Fmt LuxR
Transposase
Rhizobiocin/RTX toxin
A. lipoferum TVV3
Lrp
Methyl-accepting
chemotaxis protein
Ogr
HlyB-like
protein
Ner
AlpR AlpI
1 kb
GpD GpU
GpT
GpFII
GpE
GpFI
GpI
GpJ
similar to phage P2
Fig. 15.3 Genetic organization of quorum-sensing genes in Azospirillum. The length of each
arrow represents the relative ORF size and indicates the direction of transcription. The black
arrows indicate luxI and luxR genes. The dashed arrows indicate ORF sharing sequence homology
with transposase in the case of Azospirillum sp. B510 and with phage proteins for A. lipoferum
TVV3. The gray and black arrow indicate, respectively, ORFs sharing sequence homology with
genes in the databases and OFR encoding putative or unknown proteins
274
15
275
Fig. 15.4 Multiple alignment of LuxI and LuxR proteins from Azospirillum. Alignments were
performed using ClustalW program. Asteriks indicate conserved residues, two dots residues with
high similarity, and one dot residues with low similarity. Residues usually conserved in LuxI or
LuxR protein are indicated in bold (Watson et al. 2002; Whitehead et al. 2001)
276
Table 15.2 Closest matches to the LuxI and LuxR homologues identified in Azospirillum
Protein
A. lipoferum
TVV3 AlpI
Azospirillum
sp. B510 LuxI
A. amazonense
Y2 LuxI
A. lipoferum
TVV3 AlpR
Azospirillum
sp. B510 LuxR
% Identity
of closest
match
43
Closest match
Putative AHL synthase of
Bradyrhizobium sp. ORS 285
54
Putative AHL synthase of
Rhodobacterales
Ruegeria sp. PR1B
39
Putative autoinducer synthase
Burkholderiales
of Acidovorax radicis
46
Hypothetical protein of
Rhodospirillales
Novispirillum itersonii
39
Autoinducer-binding
Rhodobacterales
transcriptional regulator LuxR
of Sulfitobacter sp. NAS-14.1
A. amazonense
39
Hypothetical protein of
Rhizobiales
Y2 LuxR1
Aureimonas ureilytica
A. amazonense Y2
31
Hypothetical protein of
Rhizobiales
LuxR2 (orphan LuxR)
Methylocystis sp. SB2
The closest match was obtained from NCBI nonredundant protein sequence database (BLASTP search)
As for A. amazonense Y2, the genetic environment of the luxI-luxR genes displays
no striking figures (data not shown). Surprisingly, a second protein containing the
InterPro domain IPR005143 was detected in the genome of A. amazonense Y2
(AZOY2_6130003). This potential LuxR shows 46 % identity (61 % similarity)
with the other LuxR of A. amazonense Y2 and contains also several residues conserved in all LuxR homologues (Fig. 15.4); however, it is not associated with a gene
encoding an AHL synthase and may be considered an orphan LuxR or LuxR solo
(Case et al. 2008). Many bacterial species harbor multiple LuxI and or LuxR homologues for the production or detection of multiple signal molecules and the presence
of orphan LuxR has been widely described in the recent years (Case et al. 2008).
Investigations are necessary to decipher the QS regulation in the A. amazonense Y2
strain, and to precise the role of this potential orphan LuxR.
15.3
15.3.1
15
277
approach, i.e., reverse genetic, consists on allelic exchange. A suicide plasmid that
is unable to replicate in the studied strain is used to deliver an inactivated allele of
the gene into the genome; a double crossing-over event leads to replacement of the
wild-type copy of the gene with the disrupted copy carried by the plasmid. Although
allelic exchange is easy to perform with several PGPR bacteria (Pseudomonas,
Bacillus), it remains tricky with Azospirillum probably due to the low frequency
of double crossing-over events in several strains. However, a series of genetic tools
was recently developed for A. amazonense (SantAnna et al. 2011). An alternative
approach is to insert a suicide vector into the gene of interest (only one crossingover event is needed). Several insertional mutants using the pKNOCK mutagenesis
plasmids were successfully obtained in several Azospirillum strains but this technique was not applied for generating luxI or luxR mutants (Acosta-Cruz et al. 2012).
Several AHL-degradation enzymes (including lactonases, acylases, oxidoreductases, and paraoxonases) have been identified in a range of living organisms (Chen
et al. 2013). Expression of these enzymes in AHL-producing strains efficiently
quenches the microbial QS signalling. For example, lactonases cleave the lactone
ring of AHLs which are no longer recognized as a signal and incapable of binding
to the target transcriptional regulator.
Quorum quenching enzymes can be used as alternative tools to obtain strains
impaired in AHL production, notably when genetic approaches are not available or
when several genes encoding synthases are present in the studied strain. The quorum quenching strategy was for the first time reported in Erwinia carotovora where
AiiA, a lactonase from Bacillus, inactivates AHL production and strongly attenuates the virulence of this phytopathogen (Dong et al. 2000). However, introduction
of the aiiA gene from Bacillus in A. lipoferum TVV3 or B518 did not allow AHL
inactivation, probably due to a high divergence in codon usage between Azospirillum
and Bacillus (Boyer et al. 2008). In order to quench AHL accumulation in
Azospirillum, a plasmid (pBBR1 with a constitutive promoter PntpII) with the attM
gene encoding a lactonase from A. tumefaciens was introduced by conjugation in
the two producing strains A. lipoferum TVV3 and B518 (Boyer et al. 2008). In these
modified strains, AHL levels were undetectable (Boyer et al. 2008).
15.3.2
278
15.3.3
15
279
Even if several genes were identified by these methods, these are rather time
consuming, fastidious, and above all, only a portion of QS regulated genes is
revealed by these approaches.
15.3.4
280
kDa
B518(pBBR1)
B518(attM)
4
transport (the major outer membrane protein OmaA) and chemotaxis (ChvE),
suggesting that QS in A. lipoferum B518 is dedicated to control functions linked
to root colonization (Boyer et al. 2008).
15.4
Conclusion
15
281
References
Acosta-Cruz E, Wisniewski-Dy F, Rouy Z, Barbe V, Valdes M, Mavingui P (2012) Insights into
the 1.59-Mbp largest plasmid of Azospirillum brasilense CBG497. Arch Microbiol
194:725736
Aguilar C, Friscina A, Devescovi G, Kojic M, Venturi V (2003) Identification of quorum-sensingregulated genes of Burkholderia cepacia. J Bacteriol 185:64566462
Alavi P, Muller H, Cardinale M, Zachow C, Sanchez MB, Martinez JL, Berg G (2013) The DSF
quorum sensing system controls the positive influence of Stenotrophomonas maltophilia on
plants. PLoS One 8:e67103
Andersen JB, Heydorn A, Hentzer M et al (2001) gfp-Based N-acyl homoserine-lactone sensor
systems for detection of bacterial communication. Appl Environ Microbiol 67:575585
Arevalo-Ferro C, Reil G, Gorg A, Eberl L, Riedel K (2005) Biofilm formation of Pseudomonas
putida IsoF: the role of quorum sensing as assessed by proteomics. Syst Appl Microbiol
28:87114
Bainton NJ, Stead P, Chhabra SR, Bycroft BW, Salmond GP, Stewart GS, Williams P (1992) N-(3Oxohexanoyl)-L-homoserine lactone regulates carbapenem antibiotic production in Erwinia
carotovora. Biochem J 288:9971004
Bally R, Givaudan A (1988) Mobilization and transfer of Azospirillum lipoferum plasmid by the
Tn5-Mob transposon into a plasmid-free Agrobacterium tumefaciens strain. Can J Microbiol
34:13541357
Barnard AM, Bowden SD, Burr T, Coulthurst SJ, Monson RE, Salmond GP (2007) Quorum sensing, virulence and secondary metabolite production in plant soft-rotting bacteria. Philos Trans
R Soc Lond B Biol Sci 362:11651183
Birkeland NK, Lindqvist BH, Christie GE (1991) Control of bacteriophage P2 gene expression:
analysis of transcription of the ogr gene. J Bacteriol 173:69276934
282
15
283
284
Pierson LS III, Keppenne VD, Wood DW (1994) Phenazine antibiotic biosynthesis in Pseudomonas
aureofaciens 3084 is regulated by PhzR in response to cell density. J Bacteriol
176:39663974
Quiones B, Dulla G, Lindow SE (2005) Quorum sensing regulates exopolysaccharide production,
motility, and virulence in Pseudomonas syringae. Mol Plant Microbe Interact 18:682693
Riedel K, Hentzer M, Geisenberger O et al (2001) N-acylhomoserine-lactone-mediated communication between Pseudomonas aeruginosa and Burkholderia cepacia in mixed biofilms.
Microbiology 147:32493262
Rivera D, Revale S, Molina R et al (2014) Complete genome sequence of the model rhizosphere
strain Azospirillum brasilense Az39, successfully applied in agriculture. Genome Announc 2:4
Sanchez-Contreras M, Bauer WD, Gao M, Robinson JB, Allan Downie J (2007) Quorum-sensing
regulation in rhizobia and its role in symbiotic interactions with legumes. Philos Trans R Soc
Lond B Biol Sci 362:11491163
SantAnna FH, Almeida LG, Cecagno R et al (2011) Genomic insights into the versatility of the
plant growth-promoting bacterium Azospirillum amazonense. BMC Genomics 12:409
Schaefer AL, Greenberg EP, Parsek MR (2001) Acylated homoserine lactone detection in
Pseudomonas aeruginosa biofilms by radiolabel assay. Methods Enzymol 336:4147
Schaefer AL, Taylor TA, Beatty JT, Greenberg EP (2002) Long-chain acyl-homoserine lactone
quorum-sensing regulation of Rhodobacter capsulatus gene transfer agent production. J
Bacteriol 184:65156521
Schaefer AL, Greenberg EP, Oliver CM et al (2008) A new class of homoserine lactone quorumsensing signals. Nature 454:595599
Schikora A, Schenk ST, Stein E, Molitor A, Zuccaro A, Kogel KH (2011) N-acyl-homoserine lactone confers resistance toward biotrophic and hemibiotrophic pathogens via altered activation
of AtMPK6. Plant Physiol 157:14071418
Schuhegger R, Ihring A, Gantner S et al (2006) Induction of systemic resistance in tomato by
N-acyl-L-homoserine lactone-producing rhizosphere bacteria. Plant Cell Environ 29:909918
Schupp PJ, Charlton TS, Taylor MW, Kjelleberg S, Steinberg PD (2005) Use of solid-phase extraction to enable enhanced detection of acyl homoserine lactones (AHLs) in environmental samples. Anal Bioanal Chem 383:132137
Shaw PD, Ping G, Daly SL, Cha C, Cronan JE Jr, Rinehart KL, Farrand SK (1997) Detecting and
characterizing N-acyl-homoserine lactone signal molecules by thin-layer chromatography.
Proc Natl Acad Sci U S A 94:60366041
Singh PK, Schaefer AL, Parsek MR, Moninger TO, Welsh MJ, Greenberg EP (2000) Quorumsensing signals indicate that cystic fibrosis lungs are infected with bacterial biofilms. Nature
407:762764
Steidle A, Allesen-Holm M, Riedel K, Berg G, Givskov M, Molin S, Eberl L (2002) Identification
and characterization of an N-acylhomoserine lactone-dependent quorum-sensing system in
Pseudomonas putida strain IsoF. Appl Environ Microbiol 68:63716382
Steindler L, Venturi V (2007) Detection of quorum-sensing N-acyl homoserine lactone signal molecules by bacterial biosensors. FEMS Microbiol Lett 266:19
Steindler L, Devescovi G, Subramoni S, Venturi V (2008) A versatile plasmid biosensor useful to
identify quorum sensing LuxR-family orphans in bacterial strains. J Microbiol Methods
73:273275
Suarez-Moreno ZR, Devescovi G, Myers M, Hallack L, Mendonca-Previato L, Caballero-Mellado
J, Venturi V (2010) Commonalities and differences in regulation of N-acyl homoserine lactone
quorum sensing in the beneficial plant-associated Burkholderia species cluster. Appl Environ
Microbiol 76:43024317
Subsin B, Chambers CE, Visser MB, Sokol PA (2007) Identification of genes regulated by the
cepIR quorum-sensing system in Burkholderia cenocepacia by high-throughput screening of a
random promoter library. J Bacteriol 189:968979
Vial L, Cuny C, Gluchoff-Fiasson K et al (2006) N-acyl-homoserine lactone-mediated quorumsensing in Azospirillum: an exception rather than a rule. FEMS Microbiol Ecol 58:155168
15
285
von Bodman SB, Majerczak DR, Coplin DL (1998) A negative regulator mediates quorum-sensing
control of exopolysaccharide production in Pantoea stewartii subsp. stewartii. Proc Natl Acad
Sci U S A 95:76877692
Wagner-Dobler I, Thiel V, Eberl L et al (2005) Discovery of complex mixtures of novel long-chain
quorum sensing signals in free-living and host-associated marine alphaproteobacteria.
Chembiochem 6:21952206
Wang J, Quan C, Wang X, Zhao P, Fan S (2010) Extraction, purification and identification of bacterial signal molecules based on N-acyl homoserine lactones. Microb Biotechnol 4:479490
Watson WT, Minogue TD, Val DL, von Bodman SB, Churchill ME (2002) Structural basis and
specificity of acyl-homoserine lactone signal production in bacterial quorum sensing. Mol Cell
9:685694
White CE, Winans SC (2007) Cell-cell communication in the plant pathogen Agrobacterium tumefaciens. Philos Trans R Soc Lond B Biol Sci 362:11351148
Whitehead NA, Barnard AM, Slater H, Simpson NJ, Salmond GP (2001) Quorum-sensing in
Gram-negative bacteria. FEMS Microbiol Rev 25:365404
Williams P, Winzer K, Chan WC, Camara M (2007) Look whos talking: communication and
quorum sensing in the bacterial world. Philos Trans R Soc Lond B Biol Sci 362:11191134
Winson MK, Camara M, Latifi A et al (1995) Multiple N-acyl-L-homoserine lactone signal molecules regulate production of virulence determinants and secondary metabolites in Pseudomonas
aeruginosa. Proc Natl Acad Sci U S A 92:94279431
Winson MK, Swift S, Fish L et al (1998) Construction and analysis of luxCDABE-based plasmid
sensors for investigating N-acyl homoserine lactone-mediated quorum sensing. FEMS
Microbiol Lett 163:185192
Wisniewski-Dy F, Jones J, Chhabra SR, Downie JA (2002) raiIR genes are part of a quorumsensing network controlled by cinI and cinR in Rhizobium leguminosarum. J Bacteriol
184:15971606
Wisniewski-Dy F, Borziak K, Khalsa-Moyers G et al (2011) Azospirillum genomes reveal transition of bacteria from aquatic to terrestrial environments. PLoS Genet 7:e1002430
Wisniewski-Dy F, Lozano L, Acosta-Cruz E et al (2012) Genome sequence of Azospirillum brasilense CBG497 and comparative analyses of Azospirillum core and accessory genomes provide
insight into niche adaptation. Genes (Basel) 3:576602
Zhang Z, Pierson LS III (2001) A second quorum-sensing system regulates cell surface properties
but not phenazine antibiotic production in Pseudomonas aureofaciens. Appl Environ Microbiol
67:43054315
Zhang L, Murphy PJ, Kerr A, Tate ME (1993) Agrobacterium conjugation and gene regulation by
N-acyl-L-homoserine lactones. Nature 362:446448
Zhu J, Chai Y, Zhong Z, Li S, Winans SC (2003) Agrobacterium bioassay strain for ultrasensitive
detection of N-acylhomoserine lactone-type quorum-sensing molecules: detection of autoinducers in Mesorhizobium huakuii. Appl Environ Microbiol 69:69496953
Chapter 16
Abstract The lowering of plant ethylene levels by the enzyme 1-aminocyclopropane1-carboxylate (ACC) deaminase is one of the key mechanisms employed by plant
growth-promoting bacteria (PGPB) to facilitate plant growth. Since its discovery, it
has been detected in both fungi and bacteria. It has been shown by a large number of
workers in a wide range of bacteria that the activity of this enzyme in PGPB is important during normal plant development and also protects plants from the deleterious
effects of a wide range of environmental stresses. ACC deaminase-containing PGPB
bound to a plant act as a sink for ACC, thereby lowering ethylene levels in plant tissues. The result of the functioning of this enzyme is an increase in the growth of plant
roots and shoots and a reduction of the inhibitory effects of ethylene synthesis especially during stressful conditions. This chapter briefly summarizes the current knowledge of various ACC deaminases emphasizing the use of ACC deaminase-containing
bacteria in promoting plant growth under diverse biotic and abiotic stresses, and
describes methods for the isolation and study of ACC deaminase-containing bacteria.
16.1
PGPB can help plants to grow by alleviating or avoiding the negative effects of both
biotic and abiotic stresses on plant growth (Glick 1995a, 2012). PGPB exert beneficial effects on plant development by either direct or indirect mechanisms or by a
combination of the two (Glick 1995a). The enzyme ACC deaminase (encoded by
the acdS gene) is thought to be a key trait in the arsenal that PGPB use to promote
plant growth. There are numerous literature reports describing this enzyme in
C. Brgido (*)
ICAAMInstituto de Cincias Agrrias e Ambientais Mediterrnicas,
Universidade de vora, Plo da Mitra, Ap. 94, vora 7002-554, Portugal
e-mail: [email protected]
J. Duan B.R. Glick
Department of Biology, University of Waterloo, Waterloo, ON, Canada, N21 3G1
Springer International Publishing Switzerland 2015
F.D. Cassn et al. (eds.), Handbook for Azospirillum,
DOI 10.1007/978-3-319-06542-7_16
287
288
C. Brgido et al.
16.1.1
Biochemistry
16
289
substrate ACC (Glick et al. 2007a). This has been interpreted as indicating that in
order to compete with ACC oxidase for ACC, ACC deaminase must be present in
much greater amounts, i.e., from 100- to 1,000-fold (Glick et al. 1998). Moreover,
since plant ACC levels are usually in the micromolar range, the amount of substrate
will nearly always be lower than the Km, and for every increase in the ACC concentration there will be a parallel increase in the rate of ACC cleavage (Glick 2005).
The optimum temperature for the activity of ACC deaminase is typically around
2535 C and the optimum pH is 8.5 (Honma and Shimomura 1978; Jacobson et al.
1994; Jia et al. 1999).
Where it has been examined, bacterial ACC deaminase activity is localized only in
the cytoplasm (Jacobson et al. 1994); it is not a secreted enzyme. The enzyme activity
has been induced in both Pseudomonas sp. strain ACP and P. putida GR12-2 by ACC,
at levels as low as 100 nM (Honma and Shimomura 1978; Jacobson et al. 1994); both
bacterial strains were grown on a rich medium and then switched to a minimal medium
containing ACC as its sole nitrogen source. The rate of induction of enzyme activity is
relatively slow in that complete induction requires 810 h (Jacobson et al. 1994).
X-ray crystallographic analysis reveals that ACC deaminase folds into two
domains, each of which has an open twisted / structure that is similar to the
-subunit of the enzyme tryptophan synthase (Yao et al. 2000). ACC deaminase is
unique amongst PLP-dependent enzymes, since the ring cleavage catalyzed by ACC
deaminase cannot precede through an -carbanionic intermediate due to the lack of
an abstractable -hydrogen atom from the substrate ACC (Hontzeas et al. 2006).
Despite the mechanism being not completely understood, the enzyme contains two
key amino acid residues: a reactive thiol group at cysteine 162, located in the gap
between the two domains of the molecule, and the PLP binding site at lysine 51
(Glick 2005). Notwithstanding the fact that the major activity of this enzyme is the
cleavage of ACC, D-serine and D-cysteine can also act as substrates, although less
efficiently than ACC. On the other hand, L-serine and L-alanine are effective competitive inhibitors of the enzyme (Glick 2005).
16.1.2
Ethylene, which is produced in almost all plants, mediates a range of plant responses
and developmental stages (McKeon and Yang 1987). Moreover, ethylene levels in
plant tissues increase as part of a plants response to different types of stresses, such
as extreme temperatures, water stress, ultraviolet light, insect damage, disease, and
mechanical wounding (Abeles et al. 1992). Although ethylene is essential for normal growth and development in plants, at high concentration it can be harmful causing some stress symptoms as well as inducing defense responses in the plant, which
may lead to reduced crop performance.
ACC deaminase activity is a key trait in PGPB because bacteria containing ACC
deaminase can lower plant ethylene levels when the plants are exposed to different
environmental stresses, thereby facilitating plant growth (Glick et al. 1998).
Ethylene has long been recognized as a hormone that controls plant responses under
290
C. Brgido et al.
Fig. 16.1 A schematic model of how plant growth-promoting bacteria that both produce ACC
deaminase and synthesize IAA may facilitate plant growth. The grey rectangle shows ethylene
biosynthesis, where S-adenosyl-L-methionine (SAM) is converted to 1-aminocyclopropane-1carboxylate (ACC) by the enzyme ACC synthase (ACS), ACC can then be converted to either the
storage compound 1-(malonylamino)cyclopropane-1-carboxylic acid (MACC) by ACC N-Malonyl
transferase, or to the end product, ethylene, by 1-aminocyclopropane-1-carboxylate oxidase.
Indole-3-acetic acid (IAA) biosynthesis, both in bacteria and in plants is a complex multi-enzyme/
protein process as is IAA signal transduction (modified from Glick 2014)
growth-limiting conditions (Abeles et al. 1992; Morgan and Drew 1997). It has
been proposed that ethylene is produced in two peaks in response to environmental
stresses (Stearns and Glick 2003; Pierik et al. 2006). The first peak is small and usually occurs a few hours after the onset of the stress. This small peak is thought to be
beneficial to the plant because it may turn on the transcription of genes that are
responsible for plant protection (Van Loon and Glick 2004; Van Loon et al. 1997;
Glick 2004). The second ethylene peak is much larger and occurs 13 days after the
stress. This second peak typically causes visible damage to the plant, such as senescence, chlorosis, and abscission (Glick et al. 2007a).
A model (Fig. 16.1) has been proposed to explain the mechanism of action of
ACC deaminase in plant growth promotion (Glick et al. 1998, 2007a; Glick 2014).
Generally, rhizobacteria attached to the seeds or roots of a developing plant can
synthesize and secrete IAA in response to tryptophan and other small molecules in
plant exudates (Patten and Glick 1996, 2002; Bayliss et al. 1997; Penrose et al.
2001). The IAA produced by the PGPB (some of which is taken up by the plant)
together with plant IAA can stimulate plant growth and development or it can
induce the transcription of the gene encoding the enzyme ACC synthase, which
converts S-adenosyl-methionine (SAM) to ACC. The ACC can subsequently be
converted to ethylene by the enzyme ACC oxidase but it can also be exuded to the
rhizosphere and taken up by PGPB. Bacteria that produce ACC deaminase can
16
291
cleave the exuded ACC to -ketobutyrate and ammonia. Since bacterial IAA induces
the plant to synthesize more ACC, it also stimulates the exudation of ACC from the
plant (as a consequence of plant cell wall loosening). Because the amount of ACC
outside the roots or seeds is reduced, to maintain the equilibrium between internal
and external levels, more ACC will be secreted, resulting in a lower amount of ACC
available inside of plant tissues that is available for oxidation to ethylene. By
decreasing the level of ACC inside the plant cells, the inhibitory effect of stress
ethylene on root elongation (and plant growth in general) is reduced (Glick 1995a).
Additionally, IAA can activate the transcription of ACC synthase, leading to more
ethylene production (Kim et al. 1992; Kende 1993; Kende and Zeevaart 1997).
However, it has been demonstrated that ethylene inhibits IAA transport and signal
transduction (Stearns et al. 2012); therefore this feedback loop will eventually limit
the ethylene levels when a plant is under environmental stress (Burg and Burg 1966;
Morgan and Gausman 1966; Suttle 1988; Prayitno et al. 2006). With the presence of
ACC deaminase-containing PGPB, the feedback loop breaks because a significant
portion of the ACC that is produced is degraded in the bacteria, thus the repression
of auxin response factor synthesis by ethylene is relieved, resulting in more IAA
flux and more plant growth promotion (Glick et al. 2007b; Glick 2014).
ACC deaminase is usually present in bacteria at a constitutive but low level
before it is induced, and the induction of enzyme activity is a slow and complex
process (Li and Glick 2001; Glick et al. 2007a). Therefore, the first (small) peak of
ethylene occurs right after an environmental stress, inducing a defense response in
the plant, with very little impact on the ethylene peak from the presence of an ACC
deaminase-containing PGPB. As the concentration of ACC increases, bacterial
ACC deaminase is concomitantly induced, thus the second, deleterious, ethylene
peak is reduced significantly by ACC deaminase activity (Glick et al. 2007a).
Many studies have shown that bacteria containing ACC deaminase promote
plant growth when the plants are subjected to different environmental stresses
including the presence of phytopathogens (Wang et al. 2000; Toklikishvili et al.
2010; Nascimento et al. 2013), high concentrations of salt (Saravanakumar and
Samiyappan 2007; Cheng et al. 2007; Nadeem et al. 2007; Yue et al. 2007;
Egamberdieva et al. 2008; Jalili et al. 2009; Siddikee et al. 2011; Ali et al. 2014),
drought (Mayak et al. 2004; Belimov et al. 2009), flooding and anoxia (Grichko and
Glick 2001; Barnawal et al. 2012; Li et al. 2012, 2013), heavy metals (Burd et al.
2000; Nie et al. 2002; Zhang et al. 2011), and organic compounds (Glick et al.
2007a, b; Glick 2014). Moreover, the acdS gene (encoding ACC deaminase) has
become a widely used genetic marker for screening for PGPB functions. Here, we
present a number of detailed methods to study ACC deaminase in PGPB.
Similar to the effects on plant growth by ACC deaminase-containing bacteria,
the plant growth-promoting fungus Trichoderma asperellum T203 also induces beneficial effects on plant growth through the use of ACC deaminase (Viterbo et al.
2010). Additionally, transformation of bacterial strains lacking ACC deaminase
activity with isolated acdS genes and their regulatory regions has been shown to
improve their effectiveness. For example, the expression of an exogenous ACC
deaminase gene increases the usefulness of Azospirillum strains that lack this
enzyme (Holguin and Glick 2001, 2003).
292
16.2
C. Brgido et al.
16
16.3
293
ACC deaminase activity is measured based on the amount of -ketobutyrate produced as a function of time (Honma and Shimomura 1978; Penrose and Glick 2003).
16.3.1
Free-Living PGPB
Day 1:
After isolation of the ACC deaminase-containing PGPB, the bacterial culture is
streaked onto solid rich medium, such as tryptic soy agar (TSA; Difco Laboratories,
Detroit, Michigan, USA) and incubated overnight at its optimal growth temperature
until colonies form.
Day 2:
A single colony from the agar plate is inoculated into 15 mL of liquid rich medium,
such as tryptic soy broth (TSB; Difco Laboratories, Detroit, Michigan, USA) and
incubated overnight with shaking (200 rpm) at its optimal growth temperature.
Day 3:
The bacterial culture is collected by centrifugation at ~5,000g for 10 min at 4 C
and washed twice with 10 mL DF salts minimum medium (without a N source). The
cell pellet is resuspended in 15 mL of DF salts minimum medium with 3 mM
ACC. The culture is incubated for an additional 24 h with shaking at its optimal
growth temperature.
Day 4:
The bacterial culture is collected by centrifugation at ~5,000g for 10 min and
washed twice with 5 mL 0.1 M TrisHCl (pH 7.6). Then the cell suspension is transferred to a 1.5 mL microcentrifuge tube. All of the supernatant is removed after
centrifugation at ~10,000g for 1 min and the cell pellet is used for the enzyme
activity assay.
The pellet is resuspended in 400 L 0.1 M TrisHCl (pH 8.0) with 20 L of toluene. The suspension is vortexed at maximum speed for 30 s. Then, 50 L of cell
lysate is dispensed into each of three 1.5 microcentrifuge tubes. In two tubes, 5 L
of 0.5 M ACC is added whereas the third tube is a negative control (lysate without
ACC). Another negative control is also prepared containing 50 L of 0.1 M Tris
HCl (pH 8.0) and 5 L of 0.5 M ACC. After adding ACC, the cell suspension is
vortexed for about 5 s and all of the tubes are incubated at 30 C for 30 min. After
incubation, 500 L of 0.56 M HCl is added into each tube and then vortexed for
about 5 s. The cells are centrifuged for 5 min at ~10,000g at room temperature.
Meanwhile, -ketobutyrate standards are prepared as follows. First, a 100 mM
-ketobutyrate stock solution is diluted 10 with 0.1 M TrisHCl (pH 8.0). Second,
standards (in moles) including 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 are prepared in
duplicate in 0.1 M TrisHCl (pH 8.0).
Next, 500 L of cell supernatant or -ketobutyrate standards are added into each
13 100 mm glass test tube. After adding another 400 L of 0.56 M HCl, 150 L
294
C. Brgido et al.
16.3.2
Rhizobia
High concentrations of ACC or ethylene in root tissues negatively affect the nodulation process in legume plants (Ma et al. 2004; Middleton et al. 2007). Inhibitors of
ethylene synthesis or its physiological activity enhance nodulation (Tirichine et al.
2006) demonstrating that ethylene acts as a negative regulator of nodulation, and a
reduction in ethylene concentration has a stimulatory effect on the formation and
development of nodules in legumes (Ding and Oldroyd 2009). Thus, rhizobial
strains that express ACC deaminase are up to 40 % more efficient at forming
nitrogen-fixing nodules than strains that lack this activity (Ma et al. 2003, 2004).
Thus, a potential target root growth is to regulate or limit the biosynthesis of ethylene. This can be achieved by the use of rhizobia with the ability to reduce ethylene
levels in plant roots through the cleavage of ACC by ACC deaminase enzyme.
The measurement of ACC deaminase activity for rhizobial strains was determined for the first time by Ma et al. (2003), using the methodology described above
with some minor modifications. The level of ACC deaminase activity that is found
in various rhizobial species is typically around 210 % of the level that is found in
free-living bacteria. Therefore, the assay conditions must be adjusted accordingly.
This generally means employing either a higher concentration of ACC or a longer
incubation time or both.
16.3.3
Mesorhizobia
16
16.4
295
The growth pouch assay is a quick and easy way to assess the effect of various bacterial strains on the growth of plant seedlings. The protocol described below
(Penrose and Glick 2003) is used to measure the elongation of canola roots from
seeds treated with different strains of bacteria or chemical ethylene inhibitors.
Notwithstanding, the fact that the growth pouch assay has been largely performed
with canola seeds, other seeds such as tomato are also effective as long as the different growth rate of each plant is considered.
Day 1:
The bacterial strain is inoculated into 15 mL of rich medium, such as TSB. The
culture is incubated at its optimal growth temperature with shaking at 200 rpm until
it reaches late log phase.
Day 2:
The bacterial culture is collected by centrifugation at ~5,000g for 10 min at 4 C
and washed twice with 10 mL DF salts minimum medium (without a N source). The
cell pellet is resuspended in 15 mL of DF salts minimum medium with 3 mM ACC
and then incubated for an additional 24 h with shaking at 200 rpm at its optimal
growth temperature.
Day 3 and so on:
The bacterial culture is collected by centrifugation at ~5,000g for 10 min at 4 C
and washed twice with 0.03 M MgSO4. Then, the cells are resuspended in 0.5 mL
0.03 M MgSO4 in a microcentrifuge tube and subsequently diluted 810 times with
0.03 M MgSO4 to a final OD600 of 0.15. The diluted cells are kept on ice until they
are used to inoculate seeds.
The Seed-pack growth pouches (Northrup King Co., Minneapolis, MN, USA)
are prepared as following. A clean plastic bin is used to hold three racks (Northrup
King Co., Minneapolis, MN, USA). The growth pouches are placed upright in a
rack and two empty pouches are placed at each end of the rack since plants at the
end of a rack are usually subjected to extremes of light or air circulation. Then,
12 mL of sterile water are added to each pouch to prevent water loss. The plastic bin
with three racks of pouches inside is wrapped with aluminum foil and autoclaved at
121 C for 15 min.
Canola seeds should be disinfected immediately before use. The seeds are soaked
in 70 % ethanol for 1 min. After removing the liquid by suction, the seeds are soaked
in 1 % sodium hypochlorite for 10 min. Sodium hypochlorite is washed off by rinsing the seeds with sterile water at least five times. The seeds are incubated at room
temperature for 1 h with the appropriate treatment including a negative control
(sterile 0.03 M MgSO4 only) and bacterial suspensions (in sterile 0.03 M MgSO4).
Sterilized forceps are used to place six seeds in each growth pouch, and nine to
ten pouches are typically used for each treatment.
296
C. Brgido et al.
Sterile water is added into the plastic bin to a depth of approximately 3 cm. Then,
the bin is covered loosely with aluminum foil to prevent dehydration. After the
seeds germinate, the aluminum foil is changed to plastic wrap.
The pouches are incubated in a growth chamber (Conviron CMP 3244: Controlled
Environments Ltd, Winnipeg, MB, Canada) maintained at 20 1 C with a cycle
beginning with 12 h of dark followed by 12 h of light (~18 mol m2 s1).
On the fifth day of growth the primary root lengths are measured. Typically, the
root lengths of treated plant seedlings are 4060 % greater than the lengths of
untreated seedlings, with standard errors generally around 5 % of the length of the
untreated seedling root. About 3060 seeds are used for each treatment.
Seeds that fail to germinate two days after they are sown are marked and the
roots that subsequently develop from these seeds are not measured.
16.5
In order to measure ACC levels in plant tissue, the Waters AccQTag Method,
which is designed to measure amino acids, may be utilized. This procedure involves
the derivatization of ACC with the Waters AccQFluor reagent, and then the stable
derivatives are separated by reversed phase HPLC and quantitated by fluorescence
(Penrose et al. 2001).
16.5.1
Sixty canola seedling roots (4~5 days old) grown for the growth pouch assay are
excised at the juncture between roots and shoots, immediately frozen in liquid nitrogen, and then stored at 80 C until use. On the day of extraction, the frozen tissue
samples are ground in 2.5 mL of 0.1 M sodium acetate (pH 5.5) in a prechilled
mortar and pestle, then kept on ice for 15 min. The suspension is centrifuged at
17,500g for 15 min at 4 C. The supernatant is clarified by centrifugation at
100,000g for 1 h at 4 C. Next, the clarified supernatant is transferred into glass
vials and stored at 80 C. Since ACC degrades ~5 % per day at 4 C, precautions
should be taken to avoid prolonged storage other than at 80 C during the preparation of the extracts. Although this method is routinely conducted for canola seedlings in our lab, it can readily be adapted for use with other plant tissues.
16.5.2
Standard solutions are prepared as stock solutions at 2.5 mM in 0.1N HCl. The
components of the standards include ACC, -aminobutyric acid, -aminobutyric
acid, -aminobutyric acid, cysteine, isoleucine, leucine, lysine, methionine, proline,
tyrosine, valine, and a protein hydrolysate containing a mixture of 17 amino acids.
16
297
Time (min)
0
0.5
3.0
13.0
14.0
16.0a
18.0
23.0
Flow rate
(mL/min)
1.0
1.0
1.0
1.0
1.0
1.0
1.0
1.0
%A
100.0
99/0
91.0
88.0
83.0
0
100.0
100.0
%B
0
1.0
9.0
12.0
17.0
60
0
0
%C
0
0
0
0
0
40
0
0
These solutions are diluted with sterile distilled water to a final concentration of
0.1 mM. Then, the 0.1 mM solutions are further diluted to generate concentration
ranges from 5 to 25 pmol20 L1 injection. The standard solutions are divided into
0.5 mL aliquots and frozen at 20 C; they are used only once then discarded.
Derivatization of the standard solutions and plant tissue extracts are prepared based
on the Waters AccQFluor reagent Kit manual (Waters Chromatography Inc.).
16.5.3
HPLC
16.6
Once the ACC deaminase activity is known to exist in a bacterial strain, the ACC
deaminase gene (acdS) can be isolated using the polymerase chain reaction (PCR).
Examples of primers that have been used to PCR amplify acdS genes are shown in
Table 16.2. In general, a practical strategy for identifying acdS genes in a strain can
be described as following:
If the genus of the strain has been determined, a search of known acdS genes
(Nascimento et al. 2014) in the same genus may help with designing a pair of
specific primers for this particular strain.
298
C. Brgido et al.
Table 16.2 Primers that have been used to PCR amplify acdS genes
Species
Pseudomonas
Achromobacter, Acidovorax,
Enterobacter, Pseudomonas,
Rhizobium, Rhodococcus,
Serratia, Variovorax
Rhizobium
Burkholderia
Bacillus
Sequences
F1: TGAAQQTNCAPJGNTTQCCNJG
R1: KNMLCATQTGKATPTTNCCNAC
F: GGBGGVAAYAARMYVMGSAAGCTYGA
R: TTDCCHKYRTANACBGGRTC
References
Sheehy
et al. (1991)
F1: GGCAAGGTCGACATCTATGC
R1: GGCTTGCCATTCAGCTATG
F2: GCGAAACGCCCGAAACTG
R2: ATCGGGATTGTCCGTTGC
F1: ATGAAYCTSCARCGHTTY
R1: TYARCCGTYSCGRAARRT
F2: ATGAAYCTSCARMRHTTY
R2: TYARCCGTYGCGRAARATV
F: GGBGGVAAYAARMYVMGSAAGCTYGA
R: TTDCCHKYRTANACBGGRTC
Duan
et al. (2009)
Hontzeas
et al. (2005)
OnofreLemus
et al. (2009)
Kumar
et al. (2014)
If the specific primers fail to amplify an acdS gene or no acdS genes have previously been found in that genus, a pair of degenerate primers that target the conserved region of the acdS gene may be used.
It is important to mention that another enzyme, D-cysteine desulfhydrase, which
is closely related to ACC deaminase, based on DNA sequence data alone, is often
annotated as a putative ACC deaminase. In fact, it has been demonstrated that the
two enzymes can be interconverted by altering only two amino acid residues
(Todorovic and Glick 2008). However, D-cysteine desulfhydrase uses D-cysteine as
a substrate rather than ACC. An amino acid sequence alignment between ACC
deaminase and D-cysteine desulfhydrase genes indicated that there are several conserved residues that are only present in ACC deaminase (Nascimento et al. 2014),
therefore degenerate primers that are designed for amplifying acdS gene should
include those conserved residues to facilitate isolation of true acdS gene.
16
299
is less likely than other antibiotic resistance genes to create a debilitating metabolic
load in the mutant strain (Glick 1995b). In either case, a replacement vector containing the disrupted ACC deaminase gene needs to be constructed first.
16.7.1
Strategy 1
The PCR product of the acdS gene is cloned into a cloning vector, such as
pGEM-T Easy vector (Promega, Madison, WI, USA), to generate pGEMACC. To
interrupt the acdS gene on pGEMACC, a tetracycline resistance gene is obtained
from the vector pBR322 and inserted within the acdS coding region to make
pGEMACC.
The fragment that contains the acdS gene with the tetracycline resistance gene
insertion is either digested with restriction enzymes or PCR amplified, and then
cloned into a broad host range mobilizable vector, such as pK19mobsacB
(Schfer et al. 1994). The sacB gene on the vector codes for levansucrase and
confers sucrose sensitivity to Gram-negative bacteria, and is used as a conditional lethal gene to help to select for double cross-over events.
16.7.2
Strategy 2
If there are appropriate restriction enzyme sites within the acdS coding sequence,
a fragment of DNA can be removed from the acdS gene and then rejoined by T4
DNA ligase (Promega, Madison, WI, USA).
If there are no ideal restriction enzyme sites within the acdS coding sequence,
two primers can be designed to amplify a fragment containing the entire pGMET easy vector backbone and the N- and C-terminal ends of the acdS gene (without the center region of the sequences). Then the fragment is rejoined by T4
DNA ligase (Promega, Madison, WI, USA).
Next, the fragment containing the mutant acdS gene is cloned into pK19mobsacB for subsequent transfer by conjugation.
After the replacement vectors are constructed, they are transferred into the wildtype strain by conjugation, using a helper strain such as E. coli MT616 containing pRK600 (Finan et al. 1986).
16.8
Besides the gnotobiotic root elongation assay, where plant seedlings are grown in
growth pouches, ACC deaminase-containing PGPB may also be used to treat plants
grown in pots or in the field (Ali et al. 2014; Farwell et al. 2006).
300
C. Brgido et al.
Plant seeds, such as tomato seeds, are surface sterilized with 70 % ethanol for
1 min, then with 1 % commercial bleach for 10 min, and subsequently washed with
sterile Milli-Q water. Bacteria that contain ACC deaminase are grown in a rich
medium until the OD600 reaches ~0.25 0.01. The seeds are then incubated with the
bacterial cell suspension at room temperature for 1.5 h. For a negative control, sterile Milli-Q water, rather then the bacterial culture is used to treat the seeds.
For a 9.5 cm 11 cm plastic pot, four tomato seeds preinoculated either with ACC
deaminase-containing bacteria, ACC deaminase mutant bacteria, or Milli-Q water
are planted in wet peat-based Sunshine4 mix aggregate general-purpose growth
medium (Premier Horticulture, St. Catharines, Ontario, Canada). After the seeds are
placed on the soil, 1 mL of bacterial suspension is added on the top of each seed, and
then the seeds are covered with the soil. All of the pots are placed in a green house
for up to several months without fertilizer applications. Typically, a total of 24 pots
(96 plants) are set for each treatment and the experiment is repeated at least twice.
The (tomato) plants are watered with tap water as needed. At week 7, the plants
are transferred to 25 cm 30 cm pots containing the same growth medium. At week
11 (or whenever it is appropriate for the particular experiment in question), plants
are harvested and the fresh biomass is measured. Next, the plants are dried in an
oven at 85 C until there is no further decrease in the plant weight, and the amount
of the dried biomass is recorded (Ali et al. 2014).
16.9
In the last two decades, the interaction between ACC deaminase-containing bacteria
and plants has been studied in considerable detail. However, in order to effectively
utilize these organisms in the field, it is necessary to develop an even greater understanding of the relationship between plants and ACC deaminase-containing bacteria
at a basic level. The gaps in our knowledge notwithstanding, soil bacteria expressing the enzyme ACC deaminase are able to provide a significant measure of protection to a wide range of plants from many different biotic and abiotic stresses, so
many researchers have become interested in using the activity of this enzyme as an
adjunct to agricultural and horticultural practice as well as in phytoremediation protocols. In this sense, the procedures described herein are an important starting point
in these endeavors.
References
Abeles FB, Morgan PW, Saltveit ME Jr (1992) Ethylene in plant biology, 2nd edn. Academic,
New York, pp 147154
Ali A, Charles TC, Glick BR (2014) Amelioration of high salinity stress damage by plant growthpromoting bacterial endophytes that contain ACC deaminase. Plant Physiol Biochem
80:160167
16
301
302
C. Brgido et al.
Glick BR, Cheng Z, Czarny J, Duan J (2007a) Promotion of plant growth by ACC deaminasecontaining soil bacteria. Eur J Plant Pathol 119:329339
Glick BR, Todorovic B, Czarny J, Cheng Z, Duan J, McConkey B (2007b) Promotion of plant
growth by bacterial ACC deaminase. Crit Rev Plant Sci 26:227242
Grichko VP, Glick BR (2001) Amelioration of flooding stress by ACC deaminase-containing plant
growth-promoting bacteria. Plant Physiol Biochem 39:1117
Holguin G, Glick BR (2001) Expression of the ACC deaminase gene from Enterobacter cloacae
UW4 in Azospirillum brasilense. Microb Ecol 41:281288
Holguin G, Glick BR (2003) Transformation of Azospirillum brasilense Cd with an ACC deaminase gene from Enterobacter cloacae UW4 fused to the Tetr gene promoter improves its fitness
and plant growth promoting ability. Microb Ecol 46:122133
Honma M (1985) Chemically reactive sulfhydryl groups of 1-aminocyclopropane-1-carboxylate
deaminase. Agric Biol Chem 49:567571
Honma M, Shimomura T (1978) Metabolism of 1-aminocyclopropane-1-carboxylic acid. Agric
Biol Chem 42:18251831
Honma M, Kawai J, Yamada M (1993a) Identification of the reactive sulfhydryl-group of
1-aminocyclopropane-1-carboxylate deaminase. Biosci Biotechnol Biochem 57:20902093
Honma M, Kirihata M, Uchimura Y et al (1993b) Enzymatic deamination of (+/-)-2-dimethyl-1aminocyclopropane-1-carboxylic acid. Biosci Biotechnol Biochem 57:659661
Hontzeas N, Zoidakis J, Glick BR et al (2004) Expression and characterization of
1-aminocyclopropane-1-carboxylate deaminase from the rhizobacterium Pseudomonas putida
UW4: a key enzyme in bacterial plant growth promotion. Biochim Biophys Acta 1703:1119
Hontzeas N, Richardson AO, Belimov AA, Safranova V, Abu-Omar MM, Glick BR (2005)
Evidence for horizontal gene transfer of 1-aminocyclopropane-1-carboxylate deaminase genes.
Appl Environ Microbiol 71:75567558
Hontzeas N, Hontzeas CE, Glick BR (2006) Reaction mechanisms of the bacterial enzyme
1-aminocyclopropane-1-carboxylate deaminase. Biotechnol Adv 24:420426
Jacobson CB, Pasternak JJ, Glick BR (1994) Partial purification and characterization of
1-aminocyclopropane-1-carboxylate deaminase from the plant growth promoting rhizobacterium Pseudomonas putida GR12-2. Can J Microbiol 40:10191025
Jalili F, Khavazi K, Pazira E et al (2009) Isolation and characterization of ACC deaminaseproducing fluorescent pseudomonads, to alleviate salinity stress on canola (Brassica napus L.)
growth. J Plant Physiol 166:667674
Jia YJ, Kakuta Y, Sugawara M, Igarashi T, Oki N, Kisaki M, Shoji T, Kanetuna Y, Horita T, Matsui
H, Honma M (1999) Synthesis and degradation of 1-aminocyclopropane-1-carboxylic acid by
Penicillium citrinum. Biosci Biotechnol Biochem 63:542549
Jia YJ, Ito H, Matsui H et al (2000) 1-Aminocyclopropane-1-carboxylate (ACC) deaminase
induced by ACC synthesized and accumulated in Penicillium citrinum intracellular spaces.
Biosci Biotechnol Biochem 64:299305
Kaneko T, Nakamura Y, Sato S et al (2000) Complete genome structure of the nitrogen-fixing
symbiotic bacterium Mesorhizobium loti (supplement). DNA Res 7:381406
Kende H (1993) Ethylene biosynthesis. Annu Rev Plant Physiol Plant Mol Biol 44:283307
Kende H, Zeevaart JAD (1997) The five classical plant hormones. Plant Cell 9:11971210
Kim WT, Silverstone A, Yip WK, Dong JG, Yang SF (1992) Induction of 1-aminocyclopropane-1carboxylate synthase mRNA by auxin in mung bean hypocotyls and cultured apple shoots.
Plant Physiol 98:465471
Kumar A, Kumar A, Pratush A (2014) Molecular diversity and functional variability of environmental isolates of Bacillus species. Springerplus 3:312
Li J, Glick BR (2001) Transcriptional regulation of the Enterobacter cloacae UW4
1-aminocyclopropane-1-carboxylate (ACC) deaminase gene (acdS). Can J Microbiol
47:359367
Li KQ, Du WS, Que NLS et al (1996) Mechanistic studies of 1-aminocyclopropane-1-carboxylate
deaminase: unique covalent catalysis by coenzyme B-6. J Am Chem Soc 118:87638764
16
303
Li J, Ovakim DH, Charles TC, Glick BR (2000) An ACC deaminase minus mutant of Enterobacter
cloacae UW4 no longer promotes root elongation. Curr Microbiol 41:101105
Li J, Sun J, Yanf Y et al (2012) Identification of hypoxic responsive proteins in cucumber roots
using a proteomic approach. Plant Physiol Biochem 51:7480
Li J, McConkey B, Cheng Z et al (2013) Identification of plant growth-promoting bacteriaresponsive proteins in cucumber roots under hypoxic stress using a proteomics approach.
J Proteomics 84:119131
Liu HW, Auchus R, Walsh CT (1984) Stereochemical studies on the reactions catalyzed by the
PLP-dependent enzyme 1-aminocyclopropane-1-carboxylate deaminase. J Am Chem Soc
106:53355348
Ma W, Guinel FC, Glick BR (2003) The Rhizobium leguminosarum bv. viciae ACC deaminase
protein promotes the nodulation of pea plants. Appl Environ Microbiol 69:43964402
Ma WB, Charles TC, Glick BR (2004) Expression of an exogenous 1-aminocyclopropane-1carboxylate deaminase gene in Sinorhizobium meliloti increases its ability to nodulate alfalfa.
Appl Environ Microbiol 70:58915897
Mayak S, Tirosh T, Glick BR (2004) Plant growth-promoting bacteria that confer resistance to
water stress in tomatoes and peppers. Plant Sci 166:525530
McKeon T, Yang SF (1987) Biosynthesis and metabolism of ethylene. In: Davies P (ed) Plant
hormones and their role in plant growth and development. Martinus Nijhoff, Boston, pp 94112
Middleton PH, Jakab J, Penmetsa RV et al (2007) An ERF transcription factor in Medicago truncatula that is essential for nod factor signal transduction. Plant Cell 19:12211234
Minami R, Uchiyama K, Murakami T, Kawai J, Mikami K, Yamada T, Yokoi D, Ito H, Matsui H,
Honma M (1998) Properties, sequence, and synthesis in Escherichia coli of 1-aminocyclopropane1-carboxylate deaminase from Hansenula saturnus. J Biol Chem 123:11121118
Morgan PW, Drew MC (1997) Ethylene and plant response to stress. Physiol Plant 100:620630
Morgan PW, Gausman HW (1966) Effects of ethylene on auxin transport. Plant Physiol
41:4552
Nadeem SM, Zahair ZA, Naveed M, Arshad M (2007) Preliminary investigations on inducing salt
tolerance in maize through inoculation with rhizobacteria containing ACC deaminase activity.
Can J Microbiol 53:11411149
Nascimento FX, Brgido C, Glick BR et al (2012) ACC deaminase genes are conserved among
Mesorhizobium species able to nodulate the same host plant. FEMS Microbiol Lett
336:2637
Nascimento FX, Vicente CSL, Barbosa P et al (2013) Evidence for the involvement of ACC deaminase from Pseudomonas putida UW4 in the biocontrol of pine wilt disease caused by
Bursaphelenchus xylophilus. BioControl 58:427433
Nascimento FX, Rossi MJ, Soares CR, McConkey BJ, Glick BR (2014) New insights into
1-aminocyclopropane-1-carboxylate (ACC) deaminase phylogeny, evolution and ecological
significance. PLoS One 9:e99168
Nie L, Shah S, Rashid A et al (2002) Phytoremediation of arsenate contaminated soil by transgenic
canola and the plant growth-promoting bacterium Enterobacter cloacae CAL2. Plant Physiol
Biochem 40:355361
Nukui N, Minamisawa K, Ayabe S-I et al (2006) Expression of the 1-aminocyclopropane-1carboxylic acid deaminase gene requires symbiotic nitrogen-fixing regulator gene nifA2 in
Mesorhizobium loti MAFF303099. Appl Environ Microbiol 72:49644969.
Onofre-Lemus J, Hernndez-Lucas I, Girard L, Caballero-Mellado J (2009) ACC
(1-aminocyclopropane-1-carboxylate) deaminase activity, a widespread trait in Burkholderia
species, and its growth-promoting effect on tomato plants. Appl Environ Microbiol 75:
65816590
Ose T, Fujino A, Yao M et al (2003) Reaction intermediate structures of 1-aminocyclopropane-1carboxylate deaminaseinsight into PLP-dependent cyclopropane ring-opening reaction.
J Biol Chem 278:4106941076
Patten CL, Glick BR (1996) Bacterial biosynthesis of indole-3-acetic acid. Can J Microbiol
42:207220
304
C. Brgido et al.
Patten CL, Glick BR (2002) Role of Pseudomonas putida indoleacetic acid in development of the
host plant root system. Appl Environ Microbiol 68:37953801
Penrose DM, Moffatt BA, Glick BR (2001) Determination of 1-aminocycopropane-1-carboxylic
acid (ACC) to assess the effects of ACC deaminase-containing bacteria on roots of canola
seedlings. Can J Microbiol 47:7780
Penrose DM, Glick BR (2003) Methods for isolating and characterizing ACC deaminasecontaining plant growth-promoting rhizobacteria. Physiol Plant 118:1015
Pierik R, Tholen D, Poorter H, Visser EJW, Voesenek LACJ (2006) The Janus face of ethylene:
growth inhibition and stimulation. Trends Plant Sci 11:176183
Prayitno J, Rolfe BG, Mathesius U (2006) The ethylene-insensitive sickle mutant of Medicago truncatula shows altered auxin transport regulation during nodulation. Plant Physiol 142:168180
Rosenblueth M, Martinez-Romero E (2006) Bacterial endophytes and their interactions with hosts.
Mol Plant Microbe Interact 19:827837
Saravanakumar D, Samiyappan R (2007) ACC deaminase from Pseudomonas fluorescens mediated
saline resistance in groundnut (Arachis hypogea) plants. J Appl Microbiol 102:12831292
Schfer A, Tauch A, Jger W, Kalinowski J, Thierbach G, Phler A (1994) Small mobilizable multipurpose cloning vector derived rom the Escherichia coli plasmid pK18 and pK19: selection of
defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145:6973
Sheehy RE, Honma M, Yamada M, Sasaki T, Martineau B, Hiatt WR (1991) Isolation, sequence,
and expression in Escherichia coli of the Pseudomonas sp. strain ACP gene encoding
1-aminocyclopropane-1-carboxylate deaminase. J Bacteriol 173:52605265
Siddikee MA, Glick BR, Chauhan PS et al (2011) Enhancement of growth and salt tolerance of red
pepper seedlings (Capsicum annuum L.) by regulating stress ethylene synthesis with halotolerant bacteria containing 1-aminocyclopropane-1-carboxylic acid deaminase activity. Plant
Physiol Biochem 49:427434
Singh N, Kashyap S (2012) In silico identification and characterization of 1-aminocyclopropane1-carboxylate deaminase from Phytophthora sojae. J Mol Model 18:41014111
Stearns J, Glick BR (2003) Transgenic plants with altered ethylene biosynthesis or perception.
Biotechnol Adv 21:193210
Stearns JC, Woody OZ, McConkey BJ, Glick BR (2012) Effects of bacterial ACC deaminase on
Brassica napus gene expression. Mol Plant Microbe Interact 25:668676
Sullivan JT, Trzebiatowski JR, Cruickshank RW et al (2002) Comparative sequence analy-sis of
the symbiosis island of Mesorhizobium loti strain R7A. J Bacteriol 184:30863095
Sun Y, Cheng Z, Glick BR (2009) The presence of a 1-aminocyclopropane-1-carboxylate (ACC)
deaminase deletion mutation alters the physiology of the endophytic plant growth-promoting
bacterium Burkholderia phytofirmans PsJN. FEMS Microbiol Lett 296:131136
Suttle JC (1988) Effect of ethylene treatment on polar IAA transport, net IAA uptake and specific
binding of N-1-naphthylphthalamic acid in tissues and microsomes isolated from etiolated pea
epicotyls. Plant Physiol 88:795799
Tirichine L, James EK, Sandal N et al (2006) Spontaneous root-nodule formation in the model
legume Lotus japonicus: a novel class of mutants nodulates in the absence of rhizobia.
Mol Plant Microbe Interact 19:373382
Tittabutr P, Awaya JD, Li QX et al (2008) The cloned 1-aminocyclopropane-1-carboxylate (ACC)
deaminase gene from Sinorhizobium sp strain BL3 in Rhizobium sp strain TAL1145 promotes
nodulation and growth of Leucaena leucocephala. Syst Appl Microbiol 31:141150
Todorovic B, Glick BR (2008) The interconversion of ACC deaminase and D-cysteine desulfhydrase by directed mutagenesis. Planta 229:193205
Toklikishvili N, Dandurishvili N, Vainstein A et al (2010) Inhibitory effect of ACC deaminaseproducing bacteria on crown gall formation in tomato plants infected by Agrobacterium
tumefaciens or A. vitis. Plant Pathol 59:10231030
Uchiumi T, Ohwada T, Itakura M et al (2004) Expression islands clustered on the symbiosis island
of the Mesorhizobium loti genome. J Bacteriol 186:24392448
Van Loon LC, Glick BR (2004) Increased plant fitness by rhizobacteria. In: Sandermann H (ed)
Molecular ecotoxicology of plants. Springer, Berlin, pp 177207
16
305
Van Loon LC, Bakker PAHM, Pieterse CMJ (1997) Mechanisms of PGPR-induced resistance against
pathogens. In: Ogoshi A, Kobayashi K, Homma Y, Kodama F, Kondo N, Akino S (eds) Plant
growth-promoting rhizobacteria: present status and future prospects. OECD, Paris, pp 5057
Viterbo A, Landau U, Kim S et al (2010) Characterization of ACC deaminase from the biocontrol and
plant growth-promoting agent Trichoderma asperellum T203. FEMS Microbiol Lett 305:4248
Walsh C, Pascal RA, Johnston M et al (1981) Mechanistic studies on the pyridoxal-phosphate
enzyme 1-aminocyclopropane-1-carboxylate deaminase from Pseudomonas sp. Biochemistry
20:75097519
Wang CX, Knill E, Glick BR et al (2000) Effect of transferring 1-aminocyclopropane-1-carboxylic
acid (ACC) deaminase genes into Pseudomonas fluorescens strain CHAO and its gacA derivative CHA96 on their growth-promoting and disease-suppressive capacities. Can J Microbiol
46:898907
Yao M, Ose T, Sugimoto H et al (2000) Crystal structure of 1-aminocyclopropane-1-carboxylate
deaminase from Hartsenula saturnus. J Biol Chem 275:3455734565
Yue HT, Mo WP, Li C et al (2007) The salt stress relief and growth promotion effect of Rs-5 on
cotton. Plant Soil 297:139145
Zhang Y, He L, Chen Z et al (2011) Characterization of lead-resistant and ACC deaminaseproducing endophytic bacteria and their potential in promoting lead accumulation of rape.
J Hazard Mater 186:17201725
Zhao ZB, Chen HW, Li KQ et al (2003) Reaction of 1-amino-2-methylenecyclopropane-1carboxylate with 1-aminocyclopropane-1-carboxylate deaminase: analysis and mechanistic
implications. Biochemistry 42:20892103
Chapter 17
17.1
Introduction
Bacteria interact with host plants in many ways. These interactions have positive
effects that vary depending on the participating species. The chemical compounds
(constitutive or induced molecules) synthesized by soil microorganism are either
nonvolatile (e.g., phytohormones, siderophores) or gases that diffuse through gaps
between soil particles. The latter group is collectively termed microbial volatile
organic compounds (mVOCs) (Kai et al. 2009). Microorganisms may also produce
inorganic volatile compounds that play roles in the microbial food chain by being
assimilated and incorporated into organic matter (bioconversion), or functioning as
electron acceptors or donors in metabolic reactions. Such compounds include carbon dioxide, carbon monoxide, hydrogen, ammonia, hydrogen sulfide, and hydrogen cyanide. Their functions in general metabolism are well established but there is
not clear proof to date that they participate in communication mechanisms or plant
physiological process (Effmert et al. 2012).
307
308
M. Santoro et al.
17
309
17.2
17.2.1
Technical Methodologies
Functional Analysis of mVOCs
mVOCs can act over a wide range of distance because their ability to diffuse in
aqueous solutions and permeate through the atmosphere. Thereby, they are able to
exert physiological effects on other organisms in the absence of physical contact and
play important roles both above ground and below ground. In the last years, several
studies have documented mVOCs produced by many bacterial species as bacterial
metabolite capable of plant growth-promoting rhizobacteria (PGPR) activity.
A variety of methodologies, briefly described below, have been developed to study
the function of these VOCs.
17.2.1.1
Divided plates method. Generally Petri plates (diameter 90100 mm) with a central
partition are used to avoid contact, because they share only the head space above the
culture medium. Bacteria are inoculated on one side and plants on the other side of
the partition. Prior to exposure of plants to bacterial VOCs, bacterial strains are
cultured on rich liquid medium until reaching stationary phase. After repetitive
washes with distilled water of bacterial cultures, 20 L of the suspension (OD600 = 1)
are applied dropwise on one side of the partition conditioned with mineral solid
medium for bacteria growth. The other side of the plate, conditioned with solid
medium for plant growthHoagland (Hoagland and Arnold 1938) or more commonly MS solid medium (Murashige and Skoog 1962)is inoculated with seeds,
pre-germinated plantlets, or micropropagated plant nodes. Plates are sealed with
Parafilm to minimize air and VOC exchange with the environment and finally
incubated in growth cabinets under controlled conditions of light, temperature, and
310
M. Santoro et al.
relative humidity (Ryu et al. 2004; Zhang et al. 2007, 2008a, b, 2009; Radruppa
et al. 2010; Blom et al. 2011; Santoro et al. 2011; Lee et al. 2012; Park et al. 2013).
Ring method. To evaluate the effects of bacterial VOCs on plant growth and development, an autoclaved stainless steel ring is placed at the bottom of a square Petri
plate (120 120 mm), and the compartment is filled with mineral solid medium for
bacterial growth. The surrounding space is filled with MS solid medium for plant
growth. Twenty microliters of a bacterial overnight culture (OD600 = 1) is inoculated
as a single drop inside the ring. Seeds, pre-germinated plantlets, or micropropagated
plant nodes are placed at the top of the plate. The plates are sealed with Parafilm,
and incubated under controlled conditions of light, temperature, and relative humidity (Groenhagen et al. 2013).
Microtiter plate method. To test the effect of bacterial VOCs on plant growth at various distances from the bacterial inoculation site, a 24-well microtiter plate system
is used. Seeds, pre-germinated plantlets, or micropropagated plant nodes are placed
into each well, conditionated with 1 mL of half-strength MS medium. With the purpose of avoid physical contact between the bacterial inoculation and plants, the two
wells of the first row are inoculated with a bacterial suspension at 1089 colonyforming units (CFU) mL1. Then, plates are incubated under controlled conditions
of light, temperature, and relative humidity (Lee et al. 2012).
Magenta box method. The effects of bacterial VOCs are evaluated using Magenta
boxes (75 75 100 mm) coupled in pairs by plastic collar (75 75 20 mm). Sterilized
seeds, pre-germinated plantlets, or micropropagated plants nodes are planted in the
boxes conditioned with half-strength MS solid medium. A separate glass vial (5 mL)
containing solid medium for bacterial growth is placed within the box. Bacteria cells
are harvested from TSA plates in double distilled water to yield 109 CFU mL1 as
determined by optical density. Two days after plant growth, bacterial suspension culture (50 L) is added to each vial. Boxes are placed in a growth room under controlled
conditions of light, temperature, and relative humidity (Xie et al. 2009).
Plastic square plate method. To evaluate the effect of bacterial VOCs on fruit ripening green (unripe) fruit are collected from field-growth plants and surface sterilized.
A bacterial suspension (100 L; OD600 = 0.5) is smeared on solid medium in plastic
Petri plates (60 15 mm). The fruit and Petri plates are placed together in plastic
square plates (118.7 118.7 16.5 mm) and sealed with Parafilm. The square
plates are incubated at 28 C under fluorescent light at 16 h/day. The percentages
color change from green (unripe) to red (ripe) fruit is assessed at day 8 and day 10
after incubation. Fruit ripening is also assessed using a scale of 04, where 0 = 100 %
green, 1 = breaking green color, 2 = <50 % red color, 3 = 5089 %, red color, and
4 = 90 % red color (Sang et al. 2011).
17.2.1.2
Divided plate method. To evaluate the biocontrol activity, bacterial PGPR inocula are
streaked or inoculated as a single 20 L drop (OD600 = 1) on one half of a divided plate
containing mineral solid culture medium. The plates are incubated at a controlled
17
311
17.2.2
Most emitted mVOCs are species specific, suggesting that VOCs profiles or individual compounds can be used as biomarkers (Kai et al. 2009; Thorn et al. 2011).
Gas chromatography-mass spectrometry (GC-MS) is a sensitive method that allows
determination of the number of different compounds and their relative proportions
in the VOCs mixture. Novel compounds that cannot be found in existing databases
can be structurally elucidated by chemical methods such as nuclear magnetic resonance (NMR) analysis (Kai et al. 2009).
17.2.2.1
Collection of mVOCs
Many techniques for extraction and collection of mVOCs have been investigated.
Two systems have become generally accepted and are frequently used. Within these
systems, various research groups have refined them by altering the conditions of
stirring, heating (e.g., 2580 C) and/or collection timing (e.g., 1030 min). In addition, saturated solutions of various salts (e.g., KCl, NaCl, Na2SO4, NaH2PO4) have
been applied to improve the quantity and quality of compounds discovered by GS/
MS analysis (Valduga et al. 2010). All studies have shown that the mechanism of
mVOCs production is extremely specific, depending on not only the microbial
strain but also the culture medium and analysis and the analytical techniques used.
Filter headspace collection method. This technique use adsorbent material (e.g.,
tenax, super Q, charcoal) that favors the binding of compounds with specific chemical proprieties. An Erlenmeyer flask containing the bacterial culture is equipped with
an inlet/outlet device and constant airflow. A sterile cotton plug is placed in the inlet,
and air is forced to pass through adsorbent traps in the outlet. This method typically
involves extraction with organic solvents (e.g., dichloromethane, pentane, hexane)
which may result in an inadequate resolution of highly volatile and early-eluting
312
M. Santoro et al.
compounds (Ryu et al. 2004; Kai et al. 2009; Kai and Piechulla 2009; Xie et al.
2009; Blom et al. 2011; Nawrath et al. 2012).
Head space-solid phase microextraction (HS-SPME). In this well-established alternative method the analytes present in the sample are adsorbed on an extracting phase.
This methodology has several advantages over (1) the amounts of analyzed compounds is almost twofold higher solvent extraction; (2) it is rapid and requires only
sample volumes. Therefore it is suitable for analysis of VOCs present in fermented
broths and in samples with low analyte concentration. The nondestructive application of a thin polymeric film immobilized on a fused silica core allows evaluation of
samples under varying experimental conditions and can be used to resolve small
inorganic or organic gaseous molecules such as CO, CO2, NH3, HCN, and ethylene
(Kai et al. 2009; Valduga et al. 2010). Head space extractions of mVOCs are typically performed on a magnetic stirrer. SPME fiber (stable flex divinylbenzene/
carboxen/PDMS); (DCP, 50/30 m) are inserted into the headspace above the bacterial sample contained in sealed sample vials with 75 % culture medium. The adsorption period is usually 30 min. The fibers are then desorbed at 210 C in the injection
port of a GC-MS. The fibers are cleaned up leaving them in the injection port for
10 min after each run (Farag et al. 2006; Valduga et al. 2010; Lee et al. 2012).
17.2.2.2
Operating parameters for chromatographic analysis have been developed for optimal separation of compounds in a DB-5 column (30 m 0.25 mm 0.25 m). In the
case of SPME, the injection port is operated in splitless mode with a constant He
flow of 1.0 mL min1. The initial oven temperature of 33 C, is held for 3 min,
ramped up at 10 C min1 to 180 C, with a final ramp at 40 C min1 to 220 C, and
held for 5 min. Compounds are considered to be identified only if they demonstrate
identical Kovats indices on two columns of different polarity and display mass spectra consistent with those found in the reference library (most commonly, the NISTGC-MS library). Positive identification of a particular chemical constituent is made
by comparison of its retention time and mass spectrum with those of an authentic
standard (when available). The majority of VOCs studied today cannot be identified
unequivocally using GS-MS libraries, suggesting that in most cases, their structures
remain to be elucidated (Farag et al. 2006; Kai et al. 2009; Thorn et al. 2011).
17.2.3
17.2.3.1
Sealed System
17
313
17.2.3.2
Culture Medium
314
M. Santoro et al.
17.3
Applications
Many studies during the past decade have addressed applications of mVOCs produced by PGPR strains on various plants and phytopathogens. Relatively few of
these studies (summarized in Table 17.1) have included characterization of the effect
and identification of the specific compound responsible for the observed effect.
In the only study to date involving the genus Azospirillum, we examined the
effects of mVOCs on peppermint (Mentha piperita) growth (Santoro et al. 2011).
The effects of three PGPR strains (Pseudomonas fluorescens WCS417r, Bacillus
subtilis GB03, Azospirillum brasilense SP7) were assessed using two-compartment
Petri plates (90 15 mm) conditioned with 50 % strength MS solid medium. A single node removed aseptically form a sterile cultured M. piperita plantlet was placed
in one compartment of the plate and 20 L of PGPR suspension culture (OD600 = 1)
was applied dropwise to the other compartment of the Petri plate. The plates were
sealed with Parafilm and kept in a growth chamber under controlled conditions of
light (16/8-h light/dark cycle), temperature (22 2 C), and relative humidity
(~70 %). Plants were harvested on day 30 and the growth-promoting effects of
PGPR treatments were assessed on the basis of biomass and essential oils (EO)
production. The effects of mVOC emission on plant development differed for the
three PGPRs. P. fluorescens and B. subtilis mVOCs caused significant (p < 0.05)
increases in shoot and root biomass and in as EO production. A. brasilense mVOCs
had no significant effect on the biomass parameters but notably increased EO production, particularly the levels of menthone and menthol.
In summary, the effects of bacterial mVOCs on plant growth and development appear to be species specific. The mVOCs emitted by a particular bacterial
strain do not cause the same effects, or to the same degree, in all plant species.
Each plantbacteria combination has its own characteristic responses. Future
studies of plantbacteria interaction should include as many combinations as
possible. The results will be both variable and unpredictable.
Pseudomonas chlororaphis O6
Pseudomonas chlororaphis
Pseudomonas fluorescens
Pseudomonas corrugate
Pseudomonas aurantiaca
2R,3R-Butanediol
Hexadecane
2R,3R-Butanediol
2,4-Di-tertbutylphenol
Cyclohexanol
Decanal
2-Ethyl-1-hexanol
Nonanal
Benzothiazole
Dimethyl trisulfide
Acetoin
Producer
Paenibacillus polymyxa E681
mVOC
Tridecane
Arabidopsis
thaliana
Pepper
Colletotrichum
acutatum
Phytophthora
capsici
Sclerotinia
sclerotiorum
Arabidopsis
thaliana
Arabidopsis
thaliana
Arabidopsis
thaliana
Target
Arabidopsis
thaliana
Effect
PGPR activity mediated ethylene pathway
ISR mediated by salicylic acid, jasmonic acid and ethylene
pathway effective against Pseudomonas syringae pv.
maculicola ES4326
Systemic tolerance to drought interceded by reducing
stomatal aperture this effect is mediated by salicylic acid,
jasmonic acid, ethylene an abscisic acid
ISR against both Pectobacterium carotovorum and
Pseudomonas syringae stimulating salicylic acid pathway
PGPR activity mediated by cytokinin pathway
ISR status mediated by ethylene and effective against
Erwinia carotovora subsp. carotovora
ISR mediated by salicylic acid and ethylene pathway
effective against Pseudomonas syringae DC3000
Stimulated pepper fruit ripening
Inhibited mycelial growth, sporulation, spore germination,
or appressorium formation
Reference
Lee et al. (2012)
17
Production of Volatile Organic Compounds in PGPR
315
316
M. Santoro et al.
References
Angle J, McGrath S, Chaney R (1991) New culture medium containing ionic concentrations of
nutrients similar to concentrations found in the soil solution. Appl Environ Microbiol 57:
36743676
Banchio E, Xie X, Zhang H, Par PW (2009) Soil bacteria elevate essential oil accumulation and
emissions in sweet basil. J Agric Food Chem 57(2):653657
Blom D, Fabbri C, Connor EC, Schiestl FP, Klauser DR, Boller T, Eberl L, Weisskopf L (2011)
Production of plant growth modulating volatiles is widespread among rhizosphere bacteria and
strongly depends on culture conditions. Environ Microbiol 13(11):30473058
Cho SM, Kang BR, Han SH, Anderson AJ, Park JY, Lee, YH, Cho BH, Yang KY, Ryu CM, Kim
YC (2008) 2R,3R-butanediol, a bacterial volatile produced by Pseudomonas chlororaphis O6,
is involved in induction of systemic tolerance to drought in Arabidopsis thaliana. Mol PlantMicrobe Interact 21:10671075
Dunkel M, Schmidt U, Struck S, Berger L, Gruening B, Hossbach J et al (2009) SuperScenta
database of flavors and scents. Nucleic Acids Res 37:291294
Effmert U, Kalders J, Warnke R, Piechulla B (2012) Volatile mediated interactions between bacteria and fungi in the soil. J Chem Ecol 38:665703
Farag MA, Ryu CM, Sumner LW, Par PW (2006) GCMS SPME profiling of rhizobacterial volatiles reveals prospective inducers of growth promotion and induced systemic resistance in
plants. Phytochemistry 67:22622268
Farag MA, Zhang H, Ryu CM (2013) Dynamic chemical communication between plants and bacteria
through airborne signals: induced resistance by bacterial volatiles. J Chem Ecol 39:10071018
Fernando DW, Ramarathnam R, Krishnamoorthy A, Savchuk S (2005) Identification and use of
potential bacterial organic antifungal volatiles in biocontrol. Soil Biol Biochem 37:955964
Groenhagen U, Baumgartner R, Bailly A, Gardiner A, Eberl L, Schulz S, Weisskopf L (2013)
Production of bioactive volatiles by different Burkholderia ambifaria strains. J Chem Ecol
39:892906
Han SH, Lee SJ, Moon JH, Park KH, Yang KY et al (2006) GacS-dependent production of 2R,
3R-butanediol by Pseudomonas chlororaphis O6 is a major determinant for eliciting systemic
resistance against Erwinia carotovora but not against Pseudomonas syringae pv. tabaci in
tobacco. Mol Plant-Microbe Interact 19:924930
Hoagland DR, Arnon DI (1938) The water-culture method for growing plants without soil.
University of California, College of Agriculture Experiment Station Circular no. 347, Berkeley,
p 347353
Kai M, Piechulla B (2009) Plant growth promotion due to rhizobacterial volatilesan effect of
CO2? FEBS Lett 583(21):34733477
Kai M, Haustein M, Molina F, Petri A, Scholz B, Piechulla B (2009) Bacterial volatiles and their
action potential. Appl Microbiol Biotechnol 81:10011012
Lee B, Farag MA, Park HB, Kloepper JW, Lee SH, Ryu CM (2012) Induced resistance by a longchain bacterial volatile: elicitation of plant systemic defense by a C13 volatile produced by
Paenibacillus polymyxa. PLoS One. doi:10.1371/journal.pone.0048744
Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco
cultures. Plant Physiol 15:473497
Nawrath T, Mgode GF, Weetjens B, Kaufmann SHE, Schulz S (2012) The volatiles of pathogenic
and nonpathogenic mycobacteria and related bacteria. Beilstein J Org Chem 8:290299
Ortiz-Castro R, Valencia-Cantero E, Lpez-Bucio J (2008) Plant growth promotion by Bacillus
megaterium involves cytokinin signaling. Plant Signal Behav 3:263265
Park HB, Lee B, Kloepper JW, Ryu CM (2013) One shot-two pathogens blocked. Exposure of
Arabidopsis to hexadecane, a long chain volatile organic compound, confers induced resistance
against both Pectobacterium carotovorum and Pseudomonas syringae. Plant Signal Behav
8(7):e24619. doi:10.4161/psb.24619
17
317
Radruppa T, Biedrzycki ML, Kunjeti SG, Donofrio NM, Czymmek KJ, Par PW, Bais HP (2010)
The rhizobacterial elicitor acetoin induces systemic resistance in Arabidopsis thaliana.
Commun Integr Biol 3(2):130138
Ryu CM, Farag MA, Hu CH, Reddy MS, Wei HX, Par PW, Kloepper JW (2003) Bacterial volatiles promote growth in Arabidopsis. Proc Natl Acad Sci U S A 100:49274932
Ryu CM, Farag MA, Hu CH, Reddy MS, Kloepper JW, Par PW (2004) Bacterial volatiles trigger
induced systemic resistance in Arabidopsis. Plant Physiol 134:10171026
Ryu CM, Farag MA, Par PW, Kloepper JW (2005) Invisible signals from the underground: bacterial
volatiles elicit plant growth promotion and induce systemic resistance. Plant Pathol 21(1):712
Sang MK, Kim JD, Kim BS, Kim KD (2011) Roottreatment with rhizobacteria antagonistic to
Phytophthora blight affects anthracnose occurrence, ripening, and yield of pepper fruit in the
plastic house and field. Phytopathol 101:666678
Santoro MV, Zygadlo J, Giordano W, Banchio E (2011) Volatile organic compounds from rhizobacteria increase biosynthesis of essential oils and growth parameters in peppermint (Mentha
piperita). Plant Physiol Biochem 49:1771082
Schulz S, Dickschat JS (2007) Bacterial volatiles: the smell of small organisms. Nat Prod Rep
24:814842
Song GC, Ryu CM (2013) Two volatile organic compounds trigger plant self-defense against a
bacterial pathogen and a sucking insect in cucumber under open field conditions. Int J Mol Sci
14:98039819
Thorn RM, Reynolds DM, Greenman J (2011) Multivariate analysis of bacterial volatile compound profiles for discrimination between selected species and strains in vitro. J Microbiol
Methods 84:258264
Ting ASY, Mah SW, Tee CS (2011) Detection of potential volatile inhibitory compounds produced
by endobacteria with biocontrol properties towards Fusarium oxysporum f. sp. cubense race 4.
World J Microbiol Biotechnol 27:229235
Tonelli ML, Taurian T, Ibez F, Angelini J, Fabra A (2010) Selection and in vitro characterization
of biocontrol agents with potential to protect peanut plants against fungal pathogens. J Plant
Pathol 92(1):7382
Valduga E, Valerio A, Treichel H, Nascimento Filho I, Frigo Jnior A, Di Luccio M (2010) Head
Space Solid Phase Micro-Extraction (HS-SPME) of volatile organic compounds produced by
Sporidiobolus salmonicolor (CBS 2636). Cinc Tecnol Aliment 30(4):987992
Vespermann A, Kai M, Piechulla B (2007) Rhizobacterial volatiles affect the growth of fungi and
Arabidopsis thaliana. Appl Environ Microbiol 73:56395641
Xie X, Zhang H, Par PW (2009) Sustained growth promotion in Arabidopsis with long-term exposure to the beneficial soil bacterium Bacillus subtilis (GB03). Plant Signal Behav 4(10):948953
Zhang H, Kim MS, Krishnamachari V, Payton P, Sun Y, Crimson M et al (2007) Rhizobacterial
volatile emissions regulate auxin homeostasis and cell expansion in Arabidopsis. Planta 226:
839851
Zhang H, Xie X, Kim MS, Kornyeyev DA, Holaday S, Par PW (2008a) Soil bacteria augment
Arabidopsis photosynthesis by decreasing glucose sensing and abscisic acid levels in planta.
Plant J 56:264273
Zhang H, Kim MS, Sun Y, Dowd SE, Shi H, Par PW (2008b) Soil bacteria confer plant salt tolerance by tissue-specific regulation of the sodium transporter HKT1. Mol Plant Microbe Interact
21:737744
Zhang H, Sun Y, Xie X, Kim MS, Dowd SE, Par PW (2009) A soil bacterium regulates plant
acquisition of iron via deficiency-inducible mechanisms. Plant J 58(4):568577
Chapter 18
18.1
Introduction
319
320
fungi (PGPF) can stimulate plant growth and/or confer enhanced resistance to biotic
and abiotic stresses (Lugtenberg and Kamilova 2009).
Soil microorganisms may comprise mixed populations of naturally occurring
microbes that can be applied as inoculants to increase soil microbial diversity.
Investigations have shown that the inoculation of efficient microbial community to
the soil ecosystem improves soil quality, soil health, growth, yield and quality of
crops. These microbial populations may consist of selected species including plant
growth-promoting bacteria, N2-fixing microorganisms, plant disease suppressive
bacteria and fungi, actinomycetes, and other useful microbes. Microbial inoculants
are promising components for integrated solutions to agro-environmental problems because inoculants possess the capacity to promote plant growth, enhance
nutrient availability and uptake, and support the health of plants (Adesemoye and
Kloepper 2009).
Bacteria belonging to different genera including Rhizobium, Bacillus,
Pseudomonas, Pantoea, Paenibacillus, Burkholderia, Achromobacter, Azospirillum,
Microbacterium, Methylobacterium, Enterobacter, among others, provide tolerance
to host plants under different abiotic stress environments (Egamberdieva and
Kucharova 2009). Rhizobia (Azorhizobium, Bradyrhizobium, Mesorhizobium,
Rhizobium, and Sinorhizobium) can also be considered as a soil bacteria with PGPR
activity, where root colonization and growth promotion of rice, cereals, and other
non-legumes have been reported (Chabot et al. 1996). Use of these bacteria (rhizobacteria) per se can alleviate stresses in an agriculture thus opening a new and
emerging application of microorganisms (Choudhary et al. 2011).
Rhizobacteria are constantly faced with environmental stimuli stresses and
should be responding to a wide range of factors through signal transduction pathways that convert extracellular information into intracellular forms. The rhizosphere, the soil zone influenced by plant roots is dynamic. Its extent and properties
are influenced by soil physical and chemical properties, weather and plant-induced
changes in soil water content, the composition and density of soil microbial populations, and the metabolic activities of plants and microbes (Miller and Wood 1996).
To survive in different conditions, rhizobacteria need to adapt by the accumulation
or the release of specific solutes and changes in their membranes. Rhizobia are distinguished by their existence as both free-living soil bacteria and nitrogen-fixing
root endosymbionts. Among the rhizobia, the osmoadaptive mechanisms of the
relatively salt-tolerant species Sinorhizobium meliloti have been examined in great
detail (Miller and Wood 1996; Vriezen et al. 2012). Although Azospirillum is also a
nitrogen-fixing Gram-negative bacterium found in the rhizosphere, it does not
induce differentiated structures on the roots of its plant hosts. Instead, this bacterium colonizes the mucigel sheath layer or spaces between the root epidermis and
cortex, thus forming an associative symbiosis with a wide variety of plants (Okon
1985; Miller and Wood 1996). Among azospirilla, the osmoadaptive mechanisms of
Azospirillum brasilense have received the greatest attention.
The main purpose of the chapter is to analyze how different types of abiotic
stress affect the physiology of Azospirillum and plant growth-promoting rhizobacteria (PGPRs) and how to study the system.
18
18.2
321
Rhizobacteria are constantly faced with environmental stimuli stresses and should
be responding to a wide range of factors through signal transduction pathways that
convert extracellular information into intracellular forms (Paulucci et al. 2012). To
survive in different conditions, rhizobacteria need to adapt by the accumulation or
the release of specific solutes and changes in their membranes. In nature, there are
organisms that can survive desiccation by entering a dormant stage where apparent
metabolism is not observed. When rehydrated, these organisms quickly restore their
metabolic processes and often show an extremely high tolerance to various types of
stress, including radiation, extreme temperatures, pressure, and organic solvents
when in the dry state (Vilchez and Manzanera 2011).
Microorganisms possess a positive turgor, and maintenance of this outwarddirected pressure is essential since it is generally considered as the driving force for
cell expansion. Exposure of microorganisms to high-osmolality environments triggers rapid fluxes of cell water along the osmotic gradient out of the cell, thus causing a reduction in turgor and dehydration of the cytoplasm. To counteract the outflow
of water, microorganisms increase their intracellular solute pool by amassing large
amounts of organic osmolytes (Kempf and Bremer 1998). These solutes are often
referred to as compatible solute because they can be accumulated to high levels by
de novo synthesis or transport without interfering with vital cellular processes
(Poolman and Glaasker 1998). Osmoprotectans are solutes that alleviate the inhibitory effect of hyperosmotic stress on the microorganisms when they are added to the
medium, but often this term is also used for any solute that can overcome osmotic
inhibition, but it is preferable to use only compatible solute for any compound that
to accumulate either by uptake from the medium or by de novo synthesis and compatible solutes can protect from stress (Poolman and Glaasker 1998).
Osmoprotectants are solutes have been examined for compatible solute production by means of HPLC (high-performance liquid chromatography), NMR (nuclear
magnetic resonance), and GC (gas chromatography) methods. The composition of
the culture medium is important to study these molecules. The media must have a
definite composition and media supplements such as yeast extract, peptone, and
trypticase contain considerable amounts of protecting solutes or precursors. It can
lead to false results (Galinsky 1995). Thus, the study of the use of each solute compatible as carbon or nitrogen source must be carried out prior to any study of stress.
These osmoprotectants are highly congruous with the physiology of the cell and
comprise a limited number of substances including K+, glutamate, trehalose, proline, glycine betaine, proline betaine, ectoine, and choline. The Gram-negative
enteric bacteria are model organisms to study stress physiology but similarities and
notable differences exist between the osmoadaptive responses of this group and the
Gram-negative rhizobacteria.
Bacteria use lipid diversity to alter their membranes in response to environmental
stress ensuring that the cell membrane remains within optimal membrane state and
continued functionality (Finean and Michell 1981; Hazel and Williams 1990).
322
18.3
18
323
324
18.4
Since soils are subjected to high temperature stress in summer, saline concentration
also increase, which may have detrimental effects on the introduced rhizobacteria.
Temperature can affect rhizobial persistence in inoculants during shipment or in
storage. Also temperature and salt stress can influence survival in soil and can limit
both nodulation and nitrogen fixation (Vriezen et al. 2007; Paulucci et al. 2011). An
understanding of the growth of Rhizobium is likely when the physiology of these
organisms has been carefully studied under these suboptimal conditions
(Abdelmounmen et al. 1999; Kulkarni and Nautiyal 2000).
Little is yet known about the biochemical and physiological basis of saline and
temperature tolerance by rhizobia nodulating Arachis hypogaea (peanut) roots. In
peanut rhizobia (Bradyrhizobium sp. ATCC10317, SEMIA6144, and TAL1371
strains) high growth temperature (37 C) provoked a slightly reduced biomass production, an increase in the cellular content of low molecular weight oligosaccharides and fully suppressed the synthesis of neutral glucans (Dardanelli et al. 1997).
The FA composition profiles of Bradyrhizobium and Rhizobium are quite different,
and effects of growth phase (Boumahdi et al. 1999; 2001) and low temperature
(Drouin et al. 2000; Thberge et al. 1996) on FA synthesis and composition in
these genera have been studied, but not the effects of high temperature or high
salinity. In peanut rhizobia (Bradyrhizobium sp. ATCC10317, SEMIA6144, and
TAL1371 strains) high growth temperature (37 C) provoked a slightly reduced
biomass production, an increase in the cellular content of low molecular weight
oligosaccharides and fully suppressed the synthesis of neutral glucans (Dardanelli
et al. 1997). Salt and combined conditions affected negatively the viability of
SEMIA6144 and the TAL1000 viability. Both rhizobia survived under stress conditions and they showed different saline tolerance, 50 mM SEMIA6144 and
300 mM TAL1000. It was observed that viability of salt-tolerant TAL1000 was
unaffected by high temperature, consistent with studies that indicate a relationship
between salt tolerance and temperature tolerance in rhizobial strains (Paulucci
et al. 2011, 2012). In certain genera of rhizobia, tolerance to salinity has been associated with tolerance to high temperatures. Previous studies have shown that
strains of S. meliloti, salt tolerant can grow well at elevated temperatures (Zhang
et al. 1991) while Rhizobium leguminosarum, salt sensitive is much less tolerant to
higher growth temperatures (Lindstrom and Lehtomaki 1988). Previous studies
relating to the ability of rhizobial strains to grow in presence of salts have demonstrated a marked variation in tolerance. Some strains such as Bradyrhizobium
18
325
326
Table 18.1 Effects of temperature and salinity stress on trehalose content, fatty acid composition
of two peanut-nodulating rhizobia
Molecules
Trehalose
(mol/mg proteins)
Fatty acid type (%)
Saturated
Stearic acid (18:0)
Growth conditions
Strains
28 C
28 C + NaCl 37 C
37 C + NaCl
TAL1000
0.68 0.09 3.44 0.05* 2.88 0.06* 3.78 0.08*
SEMIA6144 0.46 0.04 2.89 0.04
0.95 0.07 3.00 0.06
TAL1000
SEMIA6144
TAL1000
SEMIA6144
12.6 1.5
1.40 0.3
8.40 1.7
11.0 1.2
14.6 1.6*
1.66 0.3
9.30 1.5
12.6 2.7
24.0 2.7*
2.00 2.16
20.0 2.3*
18.6 3.9*
29.0 0.9*
2.16 0.9
16.1 1.8*
19.7 3.5*
TAL1000
SEMIA6144
cis-Vaccenic acid + TAL1000
oleic acid (18:1)
SEMIA6144
Eicosatrienoic
TAL1000
acid (20:3)
SEMIA6144
TAL1000
Cyclopropane
19:0cyclo
SEMIA6144
Others
TAL1000a
SEMIA6144
U/Sb
TAL1000
SEMIA6144
ND
0.42 0.0
63.3 5.4
84.0 2.2
6.30 1.9
ND
3.40 0.7
ND
6.70 1.6
1.10 0.0
3.3
7.0
ND
0.90 0.4
55.8 2.7
82.4 2.9
9.20 1.2
ND
3.85 0.3
ND
7.10 0.8
2.55 0.7
2.7
6.1
ND
0.65 0.2
8.20 0.4*
73.5 3.4*
15.8 1.6*
ND
10.0 1.5*
ND
23.2 2.6*
5.00 0.2
0.5
3.6
ND
0.56 0.2
4.20 0.0*
63.5 6.8*
19.0 4.7*
ND
14.5 1.7*
ND
17.1 1.9*
5.30 1.3
0.5
3.3
Palmitic
acid (16:0)
Unsaturated
Palmitoleic
acid (16:1n-7)
Trehalose was extracted and analyzed by anthrone reagent. Lipids were extracted, and fatty acid of
total lipid were converted to methyl esters and analyzed by GC. Percentage of each fatty acid is
relative to total fatty acids defined as 100 %. Values represent means SEM of three independent
experiments
ND not detected
*Difference from control (28 C) value statistically significant at P < 0.05 level
a
Correspond to two peaks of retention times of 36 and 34.7 min. Such peaks could correspond to
FA of more than 18 carbon atoms
b
Ratio between sum of unsaturated and sum of saturated fatty acids
Fatty acids from the phospholipidic fraction are usually transformed into their
less polar methyl ester derivatives (FAMEs) by mild alkaline methanolysis for analysis by gas chromatography. In the extraction of lipids from Azospirillum, the lipid
extract may be slightly discolored. This is due to the ability of pigment synthesis
that Azospirillum has but that does not interfere with the handling of the sample or
separation of various lipid fractions. Table 18.2 shows how water stress affects fatty
acid composition of the A. brasilense Az39. These changes have also been observed
in the phospholipid composition which varies from this type of stress and these
changes may be the cause of the bacterium presenting lower adhesion to the roots
of maize and peanut (data not shown).
18
327
Table 18.2 Effects of hydric stress on fatty acid composition of A. brasilense Az39
Fatty acid
Saturates
Stearic acid (18:0)
Palmitic acid (16:0)
Myristic acid (14:0)
Lauric acid (12:0)
Unsaturates
cis-Vaccenic acid (18:111)
Palmitoleic acid (16:1)
ND
U/S
2.14 0.2
8.19 0.4
0.44 0.2
1.54 0.4
5.42* 0.4
10.2* 1.9
0.50 0.01
1.31 0.4
63.60 2.2
22.50 2.5
1.20 0.4
7
59.2* 2.4
23.80 2.9
2.06* 0.8
4.75
Lipids were extracted, and fatty acids of total lipid were converted to methyl esters and analyzed
by GC (Paulucci et al. 2011). Percentage of each fatty acid is relative to total fatty acids defined as
100 %. Values represent means SEM of three independent experiments
ND not detected
*Difference from control value statistically significant at P < 0.05 level. U/S ratio between sum
unsaturated and sum saturated fatty acid
18.5
Outlooks
328
References
Abdelmounmen H, Filali-Maltouf A, Neyra M, Belabed A, Missbah El Idrissi M (1999) Effect of
high salts concentrations on the growth of rhizobia and responses to added osmotica. J Appl
Microbiol 86:889898
Adesemoye AO, Kloepper JW (2009) Plant-microbes interactions in enhanced fertilizer-use efficiency. Appl Microbiol Biotechnol 85:112
Bashan Y, Holguin G (1997) Azospirillumplant relationships: environmental and physiological
advances (19901996). Can J Microbiol 43:103121
Bernard T, Pocard JA, Perroud B, Le Rudulier D (1986) Variations in the response of salt-stressed
Rhizobium strains to betaines. Arch Microbiol 143:359364
Bligh E, Dyer W (1959) A rapid method of total lipid extraction and purification. Can J Biochem
Physiol 37:911918
Boumahdi M, Mary P, Hornez J (1999) Influence of growth phases and desiccation on the degrees
of unsaturation of fatty acids and the survival rates of rhizobia. J Appl Microbiol 87:611619
Boumahdi M, Mary P, Hornez J (2001) Changes in fatty acid composition and degree of unsaturation of (brady)rhizobia as a response to phases of growth, reduced water activities and mild
desiccation. Antonie Van Leeuwenhoek 79:7379
Chabot R, Antoun H, Kloepper JW, Beauchamp CJ (1996) Root colonization of maize and lettuce
by bioluminescent Rhizobium leguminosarum biovar phaseoli. Appl Environ Microbiol
62:27672772
Choudhary DK, Sharma KP, Gaur RK (2011) Biotechnological perspectives of microbes in agroecosystems. Biotechnol Lett 33:19051910
Chowdhury SP, Nagarajan T, Tripathi R, Mishra MN, Le Rudulier D, Tripathi AK (2007) Strainspecific salt tolerance and osmoregulatory mechanisms in Azospirillum brasilense. FEMS
Microbiol Lett 267:7279
DSouza-Ault MR, Smith LT, Smith GM (1993) Roles of N-acetylglutaminylglutamine amide and
glycine betaine in adaptation of Pseudomonas aeruginosa. Appl Environ Microbiol 59:473478
Dardanelli MS, Woelke MR, Gonzlez PS, Bueno MA, Ghittoni NE (1997) The effects of nonionic
hyperosmolarity and of hight temperature on cell-associated low molecular weight saccharides
from two peanut rhizobia strains. Symbiosis 23:7384
Dardanelli MS, Gonzlez PS, Bueno MA, Ghittoni NE (2000) Synthesis, accumulation and hydrolysis of trehalose during growth of peanut rhizobia in hyperosmotic media. J Basic Microbiol
40:149156
Dardanelli MS, Busto V, Pereira P, Bueno M, Garca M (2008) Abiotic stress and response of peanutrhizobia. In: Columbus F (ed) Peanut crop. Nova Publishers, Huntington, pp 110
Dardanelli MS, Gonzlez PS, Medeot DB, Paulucci NS, Bueno MA, Garcia MB (2009) Effects of
peanut-rhizobia on the growth and symbiotic performance of Arachis hypogaea under abiotic
stress. Symbiosis 47:175180
Denich TJ, Beaudette LA, Lee H, Trevors JT (2003) Effect of selected environmental and physicochemical factors on bacterial cytoplasmic membranes. J Microbiol Methods 52:149182
Drouin P, Prevost D, Antoun H (2000) Physiological adaptation to low temperatures of strains of
Rhizobium leguminosarum bv. viciae associated with Lathyrus spp. FEMS Microbiol Ecol
32:111120
Egamberdieva D, Kucharova Z (2009) Selection for root colonizing bacteria stimulating wheat
growth in saline soils. Biol Fertil Soils 45:563571
Elsheikh E, Wood M (1990) Rhizobia and Bradyrhizobia under salt stress: possible role of trehalose in osmoregulation. Lett Appl Microbiol 10:127129
Finean JB, Michell RH (1981) Isolation, composition, and general structure of membranes. In:
Finean JB, Michell RH (eds) Membrane structure. Elsevier, New York, pp 1925
Galinsky EA (1995) Osmoadaptation in bacteria. Adv Microb Physiol 37:273328
Hartmann A (1988) Osmoregulatory properties of Azospirillum spp. In: Klingmller W (ed)
Azospirillum IV: genetics, physiology, and ecology. Springer, Berlin, pp 122130
18
329
Hartmann A, Guendisch C, Bode W (1992) Azospirillum mutants improved in iron acquisition and
osmotolerance as tools for the investigation of environmental fitness traits. Symbiosis 13:271279
Hazel JR, Williams EE (1990) The role of alterations in membrane lipid composition in enabling
physiological adaptation of organisms to their physical environment. Prog Lipid Res 29:167227
Hirt H (2009) Plant stress biology: from genomics to systems biology. Wiley-VCH, Weinheim
Kamnev A, Antonyuk L, Matora L, Serebrennikova O, Sumaroka M, Colina M, Renou-Gonnord
M, Ignatov V (1999) Spectroscopic characterization of cell membranes and their constituents
of the plant-associated soil bacterium Azospirillum brasilense. J Mol Struct 480481:
387393
Kempf B, Bremer E (1998) Uptake and synthesis of compatible solutes as microbial stress
responses to high-osmolality environments. Arch Microbiol 170:319330
Kets EPW, Galinski EA, de Wit M, de Bony JAM, Heipieper HJ (1996) Mannitol, a novel bacterial
compatible solute in Pseudomonas putida S12. J Bacteriol 178:66656670
Kulkarni S, Nautiyal CS (2000) Effects of salt and pH stress on temperature-tolerant Rhizobium sp.
NBRI330 nodulating Prosopis juliflora. Curr Microbiol 40:221226
Lindstrom K, Lehtomaki S (1988) Metabolic properties, maximum growth temperature and phage
sensitivity of Rhizobium sp. (Galea) compared with other fast growing rhizobia. FEMS
Microbiol Lett 50:277287
Lpez Lara IM, Geiger O (2001) Novel pathway for phosphatidylcholine biosynthesis in bacteria
associated with eukaryotes. J Biotechnol 91:211221
Lugtenberg B, Kamilova F (2009) Plant-growth-promoting rhizobacteria. Annu Rev Microbiol
63:541556
Madkour MA, Smith LT, Smith GM (1990) Preferential osmolyte accumulation: a mechanism of
osmotic stress adaptation in diazotrophic bacteria. Appl Environ Microbiol 56:28762881
Medeot DB, Bueno MA, Dardanelli MS, Garca de Lema M (2007) Adaptational changes in lipids
of Bradyrhizobium SEMIA 6144 nodulating peanut as a response to growth temperature and
salinity. Curr Microbiol 54:3135
Miller KJ, Wood JM (1996) Osmoadaptation by rhizosphere bacteria. Annu Rev Microbiol
50:101136
Monteoliva-Sanchez M, Ramos-Cormenzana A, Russell NJ (1993) The effect of salinity and compatible solutes on the biosynthesis of cyclopropane fatty acids in Pseudomonas halosaccharolytica. J Gen Microbiol 139:18771884
Nabti E, Sahnoune M, Adjrad S, van Dommelen A, Ghoul M, Schmid M, Hartmann A (2007) A
halophilic and osmotolerant Azospirillum brasilense strain from Algerian soil restores wheat
growth under saline conditions. Eng Life Sci 7:354360
Okon Y (1985) Azospirillum as a potential inoculant for agriculture. Trends Biotechnol 3:223228
Paulucci NS, Medeot DB, Dardanelli MS, Garca de Lema M (2011) Growth temperature and
salinity impact fatty acid composition and degree of unsaturation in peanut-nodulating rhizobia. Lipids 46:435441
Paulucci NS, Medeot DB, Reguera YB, Dardanelli MS, Garca de Lema MB (2012) Membrane
components are determinants in the response of legume-rhizobia symbiosis at the environmental stresses. In: Camiso AF, Pedroso CC (eds) Symbiosis: evolution, biology and ecological
effects. Nova Science Publishers, New York, pp 119142, EEUU
Pereyra MA, Zalazar CA, Barassia CA (2006) Root phospholipids in Azospirillum-inoculated
wheat seedlings exposed to water stress. Plant Physiol Biochem 44:873879
Poolman B, Glaasker E (1998) Regulation of compatible solute accumulation in bacteria. Mol
Microbiol 29:397407
Rangeshwaran R, Ashwitha K, Sivakumar G, Jalali SK (2013) Analysis of proteins expressed by
an abiotic stress tolerant Pseudomonas putida (NBAII-RPF9) isolate under saline and high
temperature conditions. Curr Microbiol 67:659667
Rilfors L, Lindblom G, Wieslander A, Christiansson A (1984) Lipid bilayer stability in biological
membranes. In: Kates M, Morris L (eds) Biomembranes, vol 12, Membrane fluidity. Plenum
Press, New York, pp 206245
330
Riou N, Le Rudulier D (1990) Osmoregulation in Azospirillum brasilense: glycine betaine transport enhances growth and nitrogen fixation under salt stress. J Gen Microbiol 136:14551461
Rodrguez-Salazar J, Surez R, Caballero-Mellado J, Iturriaga J (2009) Trehalose accumulation in
Azospirillum brasilense improves drought tolerance and biomass in maize plants. FEMS
Microbiol Lett 296:5259
Russell NJ (1992) Physiology and molecular biology of psychrophilic microorganisms. In: Herbert
RA, Sharp RJ (eds) Molecular biology and biotechnology of extremophiles. Blackie, Glasgow,
pp 203224
Severin J, Wohlfarth A, Galinski EA (1992) The predominant role of recently discovered tetrahydropyrimidines for the osmoadaptation of halophilic eubacteria. J Gen Microbiol 138:
16291638
Singer SJ, Nicolson GL (1972) The fluid mosaic model of the structure of cell membranes. Science
175:720730
Soltani M, Metzger P, Largeau C (2005) Fatty acid and hydroxy acid adaptation in three gramnegative hydrocarbon-degrading bacteria in relation to carbon source. Lipids 40:12631272
Sutton GC, Russell NJ, Quinn PJ (1991) The effect of salinity on the phase behaviour of total lipid
extracts and binary mixtures of the major phospholipids isolated from a moderately halophilic
eubacterium. Biochim Biophys Acta 1061:235246
Tang Y, Hollingsworth R (1998) Regulation of lipid synthesis in Bradyrhizobium japonicum: low
oxygen concentrations trigger phosphatidylinositol biosynthesis. Appl Environ Microbiol
64:19631966
Thberge M, Prvost D, Chalifour P (1996) The effect of different temperatures on the fatty acids
composition of Rhizobium leguminosarum bv. viciae in the faba bean symbiosis. New Phytol
134:657664
Vilchez S, Manzanera M (2011) Biotechnological uses of desiccation-tolerant microorganisms for
the rhizoremediation of soils subjected to seasonal drought. Appl Microbiol Biotechnol
91:12971304
Vriezen JAC, de Bruijn FJ, Nsslein K (2007) Responses of rhizobia to desiccation in relation to
osmotic stress, oxygen, and temperature. Appl Environ Microbiol 73:34513459
Vriezen JAC, de Bruijn FJ, Nsslein KR (2012) Desiccation induces viable but non-culturable
cells in Sinorhizobium melilioti 1021. AMB Express 2:6
Wessel M, Klsener S, Gdeke J, Fritz C, Hacker S, Narberhaus F (2006) Virulence of
Agrobacterium tumefaciens requires phosphatidylcholine in the bacterial membrane. Mol
Microbiol 62:906915
Zhang X, Harper R, Karsisto M, Lindstrom K (1991) Diversity of Rhizobium bacteria isolated
from the root nodules of leguminous trees. Int J Syst Bacteriol 41:104113
Part III
Chapter 19
Abstract In the face of global changes, plants must adapt to a wide range and often
combined biotic and abiotic stresses that seriously impaired plant growth and development. Plants develop complex strategies to deal with water stress conditions, soil
fertility losses, soil pollutions, pests, and disease. Emerging evidence suggest the
involvement of common hormonal players in plant defense signaling pathways triggered in response to biotic and abiotic stresses. Besides plant strategies, plant
growth-promoting rhizobacteria (PGPR), which colonize the root system and establish cooperative interactions with plants can improve their growth and help them to
adapt to and cope with multiple stresses including drought, salinity, heavy metal
pollutions, and parasites. Accordingly, PGPR supply added values to the plant defense
strategies by expressing many relevant functions for modulating the plant hormonal
balance, increasing nutrients supply to the plant, improving the functional and
physical properties of protective barriers against plant parasites. Among PGPR,
Azospirillum strains were long viewed as biofertilizers and less as biocontrol agents.
It is becoming evident that Azospirillum is able to protect plants against a myriad of
detrimental conditions. This review provides an update of works regarding the ability of Azospirillum strains to alleviate plant stress and brings out the relevant
involved plant-beneficial functions. Developing PGPR-based bio-inoculants is a
promising strategy to improve the growth and health of crops and develop sustainable agriculture.
333
334
19.1
J. Vacheron et al.
Introduction
335
19.2
19.2.1
Mechanisms of plant defense against biotic stresses are complex and consist of
several layers of defense. The recognition of pathogen-associated molecular patterns (PAMPs) can lead to the induction of protective responses in plants, such
as callose deposition, oxidative bursts, production of antimicrobial compounds, and
programmed cell death. This response corresponds to PAMP-triggered immunity
(PTI). If pathogens are able to secrete effectors that suppress PTI, disease occurs
resulting in effector-triggered susceptibility (ETS). If pathogens secrete effectors
that are recognized by the plant, plant disease resistance occurs resulting in effectortriggered immunity (ETI). The latter involves the recognition of an avirulent (Avr)
factor from the pathogen by a plant resistance protein (R). This leads to a hypersensitive response (HR), corresponding to a localized cell death that prevents root invasion of plant tissue by the pathogen.
Plants respond to pathogen attack by synthesizing pathogenesis-related (PR)
proteins. They encode enzymes like chitinases and glucanases that can hydrolyze
the cell walls of fungal pathogens (Mauch et al. 1988). In addition, plants also use
the proteasome system to degrade proteins impaired by cellular stress. Ubiquitin is
used to trigger this response (Dreher and Callis 2007). It acts as a covalent molecular tag to target proteins that must be degraded. After delivery to the proteasome, the
poly-ubiquitylated substrates can be de-ubiquitylated and cleaved in small peptides
to release free amino acids.
336
J. Vacheron et al.
19.2.2
337
Plants have developed common strategies to cope with abiotic stresses like drought,
flooding, salinity, chilling, or high temperatures. One common mechanism involves
the accumulation of compatible solutes, like glycine betaine (amine), trehalose
(sugar), and proline (amino acids) (Ashraf and Foolad 2007; Seki et al. 2007).
In many plant species, the quaternary amine, glycine betaine, is synthesized from
choline at high level in response to various types of abiotic stresses, and protects
plants against water deficiency, frost, and salinity (Chen and Murata 2002). It acts
by stabilizing the quaternary structures of enzymes and proteins, and protecting cell
membranes.
Other compatible solutes like mannitol, proline, and sorbitol are produced for
scavenging ROS, which are produced by plants experiencing drought, salt, and temperature stresses. ROS can directly damage cellular components, and the accumulation of compatible solutes may protect cells against increased levels of ROS, thereby
resulting in the protection of plants against stress-induced damages (Chen and
Murata 2002). Accordingly, upregulation of anti-oxidative enzymes, like superoxide dismutase, is a general response to different abiotic stress conditions.
Polyamines such as putrescine, spermidine, and spermine also accumulate in
response to abiotic stresses. Transcriptomic analyses in the model plant Arabidopsis,
the utilization of polyamine-overproducing transgenic plants or, contrariwise, of
mutants deficient in polyamine biosynthesis permit to evidence the involvement
of polyamines in the tolerance of plants to different kind of stresses (Alczar et al.
2006). It has been suggested that they may act as ROS scavenging molecules and as
membrane protectors.
In response to water deficit or salinity stress, plants increase the synthesis of
osmolytes (Farooq et al. 2009), thereby leading to increased osmotic potentials within
cells and adaptation of the plant to drought. ABA plays a prominent role in plant
responses to drought. It can directly affect ion transport in guard cells, thereby controlling stomatal aperture and plant transpiration (Roelfsema et al. 2004). In addition,
it induces the expression of drought stress-related genes. The level of this hormone
increases in response to drought and salt stresses (Seki et al. 2007).
The levels of several other hormones are induced in response to abiotic stresses.
This is the case of the ET stress hormone, whose synthesis increases when plants are
exposed to different types of abiotic stresses. As mentioned previously, the EIN3
transcription factor acts as a positive regulator that turns on a complex upstream
network of signaling responses, thereby leading to the activation of numerous
defense reactions (cell wall modification, oxidative burst). Increased levels of NO
synthesis and subsequently the upregulation of NO-dependent defense genes are
observed in response to drought, high or low temperature, salinity, heavy metals,
and oxidative stress (Arasimowicz and Floryszak-Wieczorek 2007).
Increasing evidence suggests that crosstalk exists between plant responses to
biotic and abiotic stresses. Signaling pathways regulated by ABA, and ET, play key
roles in this crosstalk (Fujita et al. 2006). The generation of ROS appears as a
338
J. Vacheron et al.
key convergent response mechanism between biotic and abiotic stresses (Mittler
et al. 2004; Fujita et al. 2006). Transcriptomic analyses have thus revealed that a
large set of genes that encode ROS-scavenging enzymes are commonly induced
when plants are subjected to abiotic and biotic stress treatments (Fujita et al. 2006).
Plants respond to biotic and abiotic stresses by changing their physiology and
metabolism, in order to limit the negative effects of stresses on plant tissues. Rootassociated microbial communities might also help them. Some rhizobacteria are
indeed capable of alleviating biotic and/or abiotic stresses.
19.3
19.3.1
Pseudomonas sp.
Bacillus sp.
A. lipoferum
A. brasilense Sp245
A. brasilense AZ-39
A. brasilense Sp245
P. mendocina Palleroni
Consortium of B. cereus AR156,
B. subtilis SM21, and Serratia sp.
XY21
Drought
Drought
Drought
Drought
Drought
Drought
Drought
Drought
Drought
Arthrobacter mysorens 7
Agrobacterium radiobacter 10
Flavobacterium sp. L30
Azospirillum lipoferum 137
Rhodococcus erythropolis EC 34
Achromobacter sp. 1AP2
Microbacterium sp. 3ZP2
Achromobacter piechaudii
Tomato (Lycopersicon
esculentum)
Pea (Pisum sativum)
Lettuce (Lactuca sativa)
Maize (Zea mays)
Wheat (T. aestivum)
Rice (Oryza sativa)
Arabidopsis thaliana
Lettuce (Lactuca sativa)
Cucumber (Cucumis sativus)
Bradyrhizobium japonicum
CB1809
Rhizobium sp.
Plant species
Inoculated bacteria
Cadmium
Stress type
Abiotic stresses
Arsenic
Table 19.1 List of microbes identified for their ability to alleviate plant stress
(continued)
Reichman (2014)
Reference
Salt
Salt
Salt
Biotic stresses
Botrytis cinerea
Colletotrichum
acutatum
Salt
Salt
Salt
Insoluble phosphate
Nitrogen deficiency
Drought
B. thuringiensis UM96
A. brasilense REC2 and REC3
P. fluorescens
P. putida
Arthrobacter sp.
Bacillus sp.
Brevibacterium epidermidis RS15
Micrococcus yunnanensis RS222
B. aryabhattai RS341
A. brasilense NO40
A. lipoferum JA4
A. brasilense Sp-248
Phyllobacterium brassicacearum
STM196
A. brasilense VS9
A. lipoferum AZm5
Bacillus sp.
Medicago truncatula
Strawberry (Fragaria x
ananassa)
Arabidopsis thaliana
Pal (1998)
340
J. Vacheron et al.
Pythium ultimum
Pythium sp.
Albugo candida
Phytophthora
infestans
Ralstonia
solanacearum
Agrobacterium
tumefasciens
Rhizoctonia sp.
Erwinia carotovora
Fusarium
oxysporum
Pseudomonas
syringae
Xanthomonas
campestris
Rhizoctonia solani
A. brasilense Sp7
Azospirillum sp. BNM-65
A. brasilense Sp7
A. brasilense 94-3
P. protegens CHA0
Pythium sp.
Pratylenchus
brachyurus
P. fluorescens 2-79
P. fluorescens 2-79
P. aureofaciens 30-84
A. brasilense
Gaeumannomyces
graminis
Grapevines (Vitis)
Prunus cerasifera
Potato (Solanum tuberosum)
Carnation (Dianthus
caryophyllus)
(continued)
Fusarium
oxysporum
Rhizoctonia solani
Pythium sp.
Magnaporthe
oryzae
Xanthomonas
oryzae
Thielaviopsis
basicola
Meloidogyne
incognita
Pyricularia oryzae
P. protegens CHA0
P. protegens CHA0
342
J. Vacheron et al.
343
344
J. Vacheron et al.
19.3.2
19.3.2.1
345
strawberry plants, which had previously been inoculated with them before the addition of the fungal pathogen (Tortora et al. 2011). Biocontrol activity had also been
tested in sterile artificial substrate, and Azospirillum was inoculated by watering
plants with bacterial solution (Tortora et al. 2012). Natural organic substrates or
autoclaved soils were used to test the biocontrol activity of A. brasilense Sp245 and
another strain of the same species against, respectively, Rhizoctonia spp. and
Pratylenchus brachyurus (Russo et al. 2008; Dias-Arieria et al. 2012). Azospirillum
was inoculated directly on the seed (Dias-Arieria et al. 2012) or by watering the
plantlet (Russo et al. 2008). Bashan and collaborators (2014) recently reviewed
inoculation methods and formulation technologies for Azospirillum.
19.3.2.2
Environmental conditions and their fluctuation may be stressful for plant growth and
development. Cereals require a large amount of water for their growth and development, and water can become the main factor limiting plant development. The inoculation of Azospirillum strains was shown to alleviate drought stress in maize (Bano
et al. 2013), wheat (Creus et al. 2004), and rice (Ruz-Snchez et al. 2011). As noted
above, water deficiency leads to the accumulation of free amino acids, proline, soluble proteins, and soluble sugars in plant tissues (Mohammadkhani and Heidari 2008).
Bano et al. (2013) tested the capacity of an inoculated A. lipoferum strain to alleviate
drought stress on maize, and the impact of the mode of application of Azospirillum on
plant metabolite accumulation. Azospirillum supply was realized either by soaking
seeds in Azospirillum cell suspension or by applying the bacterial inoculum in the
close vicinity of roots. The water stress simulation was conducted by maintaining soil
moisture content at 15 % for the drought stress condition against 19 % in the wellwatered condition. Better drought stress resistance was obtained when Azospirillum
was applied whatever the bacterial inoculation mode (Bano et al. 2013). Another way
to apply water stress conditions on plants could be to decrease water irrigation by
50 % after 2 weeks of well-watered condition (Ruz-Snchez et al. 2011). Using this
condition, the authors showed that beneficial effects of A. brasilense on most of the
physiological and biochemical traits of rice plants were only clearly visible when the
plants were mycorrhized (Ruz-Snchez et al. 2011).
Soil salinity may also strongly affect plant development. To simulate salt stress
conditions, different protocols have been used. Bacilio et al. (2004) used autoclaved
sand and watered wheat seedlings with either 80 or 160 mM NaCl. A. lipoferum JA4
was shown to enhance plant growth (higher height and dry weight of shoots and
roots) under continuous irrigation with 160 mM NaCl compared to the un-inoculated
control (Bacilio et al. 2004). In another study, the salinity stress was applied by
watering barley plants grown in natural soil with either 250 or 350 mM NaCl (Omar
et al. 2009). Omar and collaborators (2009) employed two different wheat cultivars,
one sensitive and one resistant. A. brasilense NO40 addition was shown to enhance
growth and salt tolerance of the sensitive barley cultivar by increasing photosynthetic pigment contents, reducing accumulation of the osmoregulator proline, and
346
J. Vacheron et al.
the activities of antioxidant enzymes (Omar et al. 2009). Salinity stress can also be
obtained using irrigation with diluted seawater solutions (Alamri and Mostafa
2009). These authors compared the effect of Azospirillum inoculation on wheat
watered with seawaters at a final concentration of 4,650 and 9,300 ppm saline, and
with tap water (140 ppm saline) as a control. Results demonstrate the ability of A.
brasilense Sp-248 to reduce the deleterious effects of saline stress on wheat growth
(Alamri and Mostafa 2009). In addition, this A. brasilense strain shares a relatively
high tolerance to saline irrigation.
Soil chemical composition in terms of nitrogen content and heavy metal concentrations, etc. can also be stressful for plants. Esquivel-Cote et al. (2010) showed the
potential of A. lipoferum to stimulate plant growth under different nitrogen levels
(0, 170 and 340 kg Nha1). A better effect was observed when A. lipoferum AZm5
was inoculated in presence of a moderate nitrogen amount of 170 kg Nha1
(Esquivel-Cote et al. 2010). Azospirillum allows a better plant resistance to heavy
metal stress (Belimov et al. 2004). Indeed, in pot and field experiments, Azospirillum
seed inoculation improved the growth of barley plants in Pb- and Cd-contaminated
soils. The presence of Azospirillum also prevented the accumulation of Pb and Cd
in barley plants, thereby mitigating their toxic effects (Belimov et al. 2004).
Azospirillum is a good candidate to ensure the alleviation of biotic and/or abiotic
stress. Mechanisms involved in the establishment of stress resistance in plants
by Azospirillum and the molecular responses of the host plant are increasingly
studied.
19.4
The principal mechanisms permitting alleviation of biotic stresses consist of antagonism, competition, and induction of plant defense against pathogens (Fig. 19.1).
Mechanisms involved in alleviating abiotic stresses consist principally of modifications
of the plant hormonal balance and increased nutrient availability for plants (Fig. 19.2)
(Compant et al. 2005).
19.4.1
19.4.1.1
347
Fig. 19.1 Main bacterial mechanisms involved in alleviation of biotic stresses in plants by
Azospirillum strains and other PGPR. The mechanisms involved in biotic stress alleviation in crops
by PGPR can be separated in three main processes. Antagonism interactions can take place
between PGPR and diverse plant pathogens like fungi, bacteria, nematodes. This involves the
production of antimicrobial components and hydrolytic enzymes by PGPR. Competition for essential elements like iron through siderophore production by PGPR may lead to growth limitation of
the plant pathogen. PGPR can also induce plant defenses (i.e., ISR) by producing plant defense
elicitors like exopolysaccharides
Fig. 19.2 Main bacterial mechanisms involved in alleviation of abiotic stresses in plants by
Azospirillum strains and other PGPR. PGPR can modify the plant hormonal balance (in particular
the ethylene or auxin signaling pathway), thereby favoring the host plant resistance to drought
or salinity. PGPR may improve plant nutrient acquisition especially when nitrogen, phosphate, or
iron are scarce. They can ensure phosphate solubilization by releasing organic acids, improve plant
nitrogen inputs by fixing the atmospheric dinitrogen and/or facilitate iron acquisition through the
production of siderophores. PGPR can play a role in alleviation of heavy metal stress in plants by
trapping heavy metals outside the bacterial cell or by internalizing and detoxifying them
348
J. Vacheron et al.
(Haas and Dfago 2005; Jousset et al. 2006; Meyer et al. 2009). DAPG acts through
membrane permeabilization and destabilization and triggers oxidative burst in the target cell. This oxidative burst causes inactivation of V-ATPase and the disturbance of
cell respiration that leads to a loss of cell homeostasis (Kwak et al. 2011). Other PGPR
belonging to Pseudomonas, Bacillus, and Burkholderia genera are able to produce
hydrogen cyanide (HCN), a volatile compound with antimicrobial activity (Reetha
et al. 2014; Ryall et al. 2008; Voisard et al. 1989). HCN may pass through the plant
pathogen membrane and inhibits the cytochrome C oxidase and several other metalloenzymes (Blumer and Hass 2000). Phenazines have a wide spectrum of action. Their
mechanisms of action, at the cellular level, are still not well resolved. Given the molecular structure of these compounds, it can be suggested that, after their diffusion through
the membrane of the target cell, they can act as electron acceptors and shunt the respiratory chain. This interference leads to the production of hydrogen peroxide (H2O2) and
superoxide ion (O2), and cell death (Delaney et al. 2001). Pseudomonas phenazine
producers are protected by their high superoxide dismutase activity (Delaney et al. 2001).
Indeed, it has been demonstrated that the addition of sublethal doses of phenazines
in the liquid cultures of Mycosphaerella graminicola induced a strong increase of the
activity of catalase, superoxide dismutase and peroxidases, allowing the fungus to survive in the presence of these antibiotics (Levy et al. 1992). Pyrrolnitrin is an antimicrobial compound produced by numerous bacteria like Pseudomonas and Burkholderia
(Costa et al. 2009). Pyrrolnitrin is produced from tryptophan and targets the mitochondrial electron transport system with the inhibition, among others, of succinate and
NADH oxidase activities (Tripathi and Gottlieb 1969). Clp are composed of fatty acid
tails linked to an oligopeptide, which is cyclized by forming a lactone ring between two
amino acids. Clp like iturin and viscosin are surface-active agents causing membrane
permeabilization in fungi, bacteria, oomycetes, protozoans, and nematodes (Raaijmakers
et al. 2006; de Souza et al. 2003b; Ongena and Jacques 2008).
PGPR, especially Bacillus and Pseudomonas strains, can produce extracellular
enzymes such as chitinase or glucanase, which degrade components of the membrane and cell wall of microbial pathogens (Siddiqui et al. 2005; Maksimov et al.
2011; Kim et al. 2014). Moreover, certain PGPR can quench quorum-sensing (QS)
signals and affect QS-dependent pathogenicity in plant pathogenic bacteria by
degrading or mimicking their acyl-homoserine lactones, thereby blocking the expression of virulence functions (Faure and Dessaux 2007; Boyer and WisniewskiDy 2009; Helman and Chernin 2014).
The ability of rhizobacteria to produce insecticidal toxins is more and more
sought-after (Wu et al. 2008; Pchy-Tarr et al. 2008; Lacey and Georgis 2012).
Those rhizobacteria are taxonomically diverse. The most studied and used toxins
for biological control of insects are the Bacillus thuringiensis toxins (Bravo et al.
2011). These toxins induce pore formation in the lipidic membrane of midgut insect
cells (Vachon et al. 2012). Other biocontrol bacteria are known to be entomotoxin
producers, like bacteria belonging to fluorescent pseudomonads (Kupferschmied
et al. 2013, 2014; Ruffner et al. 2013). One of these toxins, fit, is increasingly studied. This insecticidal toxin is produced by some strains belonging to the Pseudomonas
349
19.4.1.2
PGPR may interact with the plant-specific mechanisms related to abiotic stress
resistance. PGPR effects involve multiple changes in plant metabolism and signaling networks (Lugtenberg and Kamilova 2009; Friesen et al. 2011). Modifications
in phytohormone content and/or signaling have been reported (Dodd et al. 2010),
such as decreased ET production via bacterial ACC deaminase activity (Glick et al.
1998; Belimov et al. 2009; Bresson et al. 2013), changes in cytokininABA balance
350
J. Vacheron et al.
351
19.4.2
19.4.2.1
352
J. Vacheron et al.
Another way for Azospirillum to control soil borne diseases is to produce siderophores with high-affinity iron-binding activity. Some of these siderophores seem to
have antimicrobial activity (Tortora et al. 2011). This property may be used by
Azospirillum to compete with other microbes, including pathogens, for access to
iron, and thereby to limit their growth (Shah et al. 1992; Tortora et al. 2011).
Azospirillum may also protect plant against pathogen agents by an indirect process involving the induction of plant defense, notably ISR. The EPS produced by
Azospirillum strains A7, A18, A26, and A37 were described to induce ISR and
protect rice plant against Pyricularia oryzae (Sankari et al. 2011). Recognition of
Azospirillum EPS by plant pattern receptor (PRR) in plant cells might generate
a regulation cascade inducing the transcription of plant defense genes (Boller and
He 2009; Pieterse et al. 2014). Indeed, the protection of strawberry plants against
Colletotrichum acutatum by endophytic Azospirillum PGPR is associated to
enhanced content of plant phenolic compounds, a transient accumulation of SA,
callose accumulation, and the induction of defense-related genes (Tortora et al.
2012). Regarding the protection effects of another endophytic strain, Azospirillum
sp. B510, Yasuda and collaborators (2009) compared the responses of Oryza sativa
cv. Nipponbare challenged with Xanthomonas oryzae in presence and absence of
the PGPR. B510 had no antagonist activity on Xanthomonas in vitro, but activated
the innate-immune system of the host plant. The authors analyzed, using real-time
PCR, the effect of B510 on the expression of pathogenesis-related genes involved in
the SA response (OsPR-1a, OsPR-1b and WRKY45) and in the JA response (OsPR4). The results (i.e., B510 downregulation of OsPR-1a and OsPR-4 and no effect on
OsPR-1b and WRKY45) suggest that B510 rather downregulated SA signaling
pathway (Yasuda et al. 2009). Similar plant responses were observed with Pseudomonas fluorescens WCS417r, which triggers defense responses in A. thaliana
through a pathway independent of SA and PR gene activation but dependent of JA
and ET signaling (Pieterse et al. 1996). Ramos and collaborators (2008) also demonstrate that PGPR plant protection in pathogen-challenged plants is inversely
related to SA production. Among the three PGPR studied, Azospirillum brasilense
Sp7 caused the highest increase in SA, but showed the lowest level of defense of
A. thaliana against P. syringae pv. tomato DC3000.
19.4.2.2
As described above, some PGPR harbor the acdS gene encoding ACC deaminase.
This enzyme is involved in the biotic and abiotic stress alleviation in plant by modulating plant ET amount. This plant hormone has pleiotropic effects on different
processes as on both plant growth and plant development (e.g., seed germination,
root elongation, and fruit development), and response to environmental stresses
(Glick 2014). A model was proposed to explain how bacteria harboring the ACC
deaminase activity could lower ET amount in plant cells (Glick et al. 1998). This model
is valid for certain Azospirillum strains that have ACC deaminase activity (Blaha
et al. 2006; Prigent-Combaret et al. 2008). The ACC deaminase degrades ACC, the
353
354
J. Vacheron et al.
forms (Meyer et al. 2011). As mentioned above, one of the main mechanisms harbored by PGPR to solubilize phosphorus is based on soil acidification via the release
of acid compounds as gluconic acid, citric acid, oxalic acid (Richardson et al. 2009).
However, rhizosphere acidification could be obtained by indirect mechanisms.
Inoculation with A. brasilense Cd increased rhizosphere acidification, and it was
suggested that auxins produced by the Azospirillum PGPR may stimulate the plasma
membrane H-ATPase, thereby leading to the transport of protons across the cell
wall (Carrillo et al. 2002). Lastly, A. brasilense may increase root iron absorption by
releasing bacterial siderophores that can be recognized by plant iron receptors and
used to enhance iron content in plant (Barton et al. 1986).
19.5
Concluding Remarks
References
Alamri SA, Mostafa YS (2009) Effect of nitrogen supply and Azospirillum brasilense Sp-248 on
the response of wheat to seawater irrigation. Saudi J Biol Sci 16:101107. doi:10.1016/j.
sjbs.2009.10.009
Albareda M, Dardanelli MS, Sousa C et al (2006) Factors affecting the attachment of rhizospheric
bacteria to bean and soybean roots. FEMS Microbiol Lett 259:6773. doi:10.1111/
j.1574-6968.2006.00244.x
Alczar R, Marco F, Cuevas JC et al (2006) Involvement of polyamines in plant response to abiotic
stress. Biotechnol Lett 28:18671876. doi:10.1007/s10529-006-9179-3
Almario J, Prigent-Combaret C, Muller D, Monne-Loccoz Y (2013) Effect of clay mineralogy
on iron bioavailability and rhizosphere transcription of 2,4-diacetylphloroglucinol biosynthetic genes in biocontrol Pseudomonas protegens. Mol Plant Microbe Interact 26:566574.
doi:10.1094/MPMI-11-12-0274-R
19
355
Almario J, Muller D, Dfago G, Monne-Loccoz Y (2014) Rhizosphere ecology and phytoprotection in soils naturally suppressive to Thielaviopsis black root rot of tobacco. Environ Microbiol
16:19491960. doi:10.1111/1462-2920.12459
Alvarez ME (2000) Salicylic acid in the machinery of hypersensitive cell death and disease resistance. Plant Mol Biol 44:429442. doi:10.1023/A:1026561029533
Amirsadeghi S, Robson CA, Vanlerberghe GC (2007) The role of the mitochondrion in plant
responses to biotic stress. Physiol Plant 129:253266. doi:10.1111/j.1399-3054.2006.00775.x
Arasimowicz M, Floryszak-Wieczorek J (2007) Nitric oxide as a bioactive signalling molecule in
plant stress responses. Plant Sci 172:876887. doi:10.1016/j.plantsci.2007.02.005
Arshad M, Shaharoona B, Mahmood T (2008) Inoculation with Pseudomonas spp. containing
ACC-deaminase partially eliminates the effects of drought stress on growth, yield, and ripening
of pea (Pisum sativum L.). Pedosphere 18:611620. doi:10.1016/S1002-0160(08)60055-7
Ashraf M, Foolad MR (2007) Roles of glycine betaine and proline in improving plant abiotic stress
resistance. Environ Exp Bot 59:206216. doi:10.1016/j.envexpbot.2005.12.006
Babalola OO (2010) Beneficial bacteria of agricultural importance. Biotechnol Lett 32:15591570.
doi:10.1007/s10529-010-0347-0
Babalola OO, Akindolire AM (2011) Identification of native rhizobacteria peculiar to selected food
crops in Mmabatho municipality of South Africa. Biol Agric Hortic 27:294309. doi:10.1080/
01448765.2011.647798
Bacilio M, Rodriguez H, Moreno M et al (2004) Mitigation of salt stress in wheat seedlings by
a gfp-tagged Azospirillum lipoferum. Biol Fertil Soils 40:188193. doi:10.1007/s00374004-0757-z
Bais HP, Park S-W, Weir TL et al (2004) How plants communicate using the underground information superhighway. Trends Plant Sci 9:2632. doi:10.1016/j.tplants.2003.11.008
Bakanchikova TI, Lobanok EV, Pavlova-Ivanova LK et al (1993) Inhibition of tumor formation
process in dicotyledonous plants by Azospirillum brasilense strains. Mikrobiologiya 62
(Suppl 3):515523 (Russian Federation)
Bakker PAHM, Pieterse CMJ, van Loon LC (2007) Induced systemic resistance by fluorescent
Pseudomonas spp. Phytopathology 97:239243. doi:10.1094/PHYTO-97-2-0239
Bano Q, Ilyas N, Bano A et al (2013) Effect of Azospirillum inoculation on maize (Zea mays l.)
under drought stress. Pak J Bot 45:1320
Bari R, Jones JDG (2009) Role of plant hormones in plant defence responses. Plant Mol Biol
69:47388. doi:10.1007/s11103-008-9435-0
Barton LL, Johnson GV, Miller SO (1986) The effect of Azospirillum brasilense on iron absorption
and translocation by sorghum. J Plant Nutr 9:557565. doi:10.1080/01904168609363466
Bashan Y, de-Bashan LE (2002) Protection of tomato seedlings against infection by Pseudomonas
syringae pv. tomato by using the plant growth-promoting bacterium Azospirillum brasilense.
Appl Environ Microbiol 68:26372643. doi:10.1128/AEM. 68.6.2637-2643.2002
Bashan Y, de-Bashan LE, Prabhu SR, Hernandez J-P (2014) Advances in plant growth-promoting
bacterial inoculant technology: formulations and practical perspectives (19982013). Plant
Soil 378:133. doi:10.1007/s11104-013-1956-x
Belimov AA, Kunakova AM, Safronova VI et al (2004) Employment of rhizobacteria for the inoculation of barley plants cultivated in soil contaminated with lead and cadmium. Microbiology
73:99106. doi:10.1023/B:MICI.0000016377.62060.d3
Belimov AA, Dodd IC, Hontzeas N et al (2009) Rhizosphere bacteria containing 1-aminocyclopropane-1-carboxylate deaminase increase yield of plants grown in drying soil via
both local and systemic hormone signalling. New Phytol 181:413423. doi:10.1111/
j.1469-8137.2008.02657.x
Berg G, Smalla K (2009) Plant species and soil type cooperatively shape the structure and function
of microbial communities in the rhizosphere. FEMS Microbiol Ecol 68:113. doi:10.1111/
j.1574-6941.2009.00654.x
Blaha D, Prigent-Combaret C, Mirza MS, Monne-Loccoz Y (2006) Phylogeny of the
1-aminocyclopropane-1-carboxylic acid deaminase-encoding gene acdS in phytobeneficial
and pathogenic Proteobacteria and relation with strain biogeography. FEMS Microbiol Ecol
56:455470. doi:10.1111/j.1574-6941.2006.00082.x
356
J. Vacheron et al.
Blumer C, Haas D (2000) Mechanism, regulation, and ecological role of bacterial cyanide biosynthesis. Arch Microbiol 173:170177. doi:10.1007/s002039900127
Boller T, He SY (2009) Innate immunity in plants: an arms race between pattern recognition receptors in plants and effectors in microbial pathogens. Science 324:742744. doi:10.1126/
science.1171647
Bouffaud M-L, Poirier M-A, Muller D, Monne-Loccoz Y (2014) Root microbiome relates
to plant host evolution in maize and other Poaceae. Environ Microbiol 16(9):28042814.
doi:10.1111/1462-2920.12442
Boyer M, Wisniewski-Dy F (2009) Cell-cell signalling in bacteria: not simply a matter of quorum. FEMS Microbiol Ecol 70:119. doi:10.1111/j.1574-6941.2009.00745.x
Bravo A, Likitvivatanavong S, Gill SS, Sobern M (2011) Bacillus thuringiensis: a story of a successful bioinsecticide. Insect Biochem Mol Biol 41:423431. doi:10.1016/j.ibmb.2011.02.006
Bresson J, Varoquaux F, Bontpart T et al (2013) The PGPR strain Phyllobacterium brassicacearum
STM196 induces a reproductive delay and physiological changes that result in improved
drought tolerance in Arabidopsis. New Phytol 200:558569. doi:10.1111/nph.12383
Bruto M, Prigent-Combaret C, Muller D, Monne-Loccoz Y (2014) Analysis of genes contributing
to plant-beneficial functions in plant growth-promoting rhizobacteria and related Proteobacteria.
Sci Rep. doi:10.1038/srep06261
Carrillo AE, Li CY, Bashan Y (2002) Increased acidification in the rhizosphere of cactus seedlings induced by Azospirillum brasilense. Naturwissenschaften 89:428432. doi:10.1007/
s00114-002-0347-6
Chen THH, Murata N (2002) Enhancement of tolerance of abiotic stress by metabolic engineering
of betaines and other compatible solutes. Curr Opin Plant Biol 5:250257
Chen C, Blanger RR, Benhamou N, Paulitz TC (2000) Defense enzymes induced in cucumber
roots by treatment with plant growth-promoting rhizobacteria (PGPR) and Pythium aphanidermatum. Physiol Mol Plant Pathol 56:1323. doi:10.1006/pmpp.1999.0243
Chowdhury SP, Nagarajan T, Tripathi R et al (2007) Strain-specific salt tolerance and osmoregulatory mechanisms in Azospirillum brasilense. FEMS Microbiol Lett 267:7279. doi:10.1111/
j.1574-6968.2006.00540.x
Chung H, Park M, Madhaiyan M et al (2005) Isolation and characterization of phosphate solubilizing bacteria from the rhizosphere of crop plants of Korea. Soil Biol Biochem 37:19701974.
doi:10.1016/j.soilbio.2005.02.025
Cohen AC, Bottini R, Piccoli PN (2008) Azospirillum brasilense Sp 245 produces ABA in
chemically-defined culture medium and increases ABA content in Arabidopsis plants. Plant
Growth Regul 54:97103. doi:10.1007/s10725-007-9232-9
Cohen AC, Travaglia CN, Bottini R, Piccoli PN (2009) Participation of abscisic acid and gibberellins produced by endophytic Azospirillum in the alleviation of drought effects in maize. Botany
87:455462. doi:10.1139/B09-023
Cohen AC, Bottini R, Pontin M et al (2014) Azospirillum brasilense ameliorates the response
of Arabidopsis thaliana to drought mainly via enhancement of ABA levels. Physiol Plant
153(1):7990. doi:10.1111/ppl.12221
Compant S, Duffy B, Nowak J et al (2005) Use of plant growth-promoting bacteria for biocontrol
of plant diseases: principles, mechanisms of action, and future prospects. Appl Environ
Microbiol 71:49514959. doi:10.1128/AEM. 71.9.4951-4959.2005
Compant S, Van Der Heijden MGA, Sessitsch A (2010) Climate change effects on beneficial
plant-microorganism interactions: climate change and beneficial plant-microorganism interactions. FEMS Microbiol Ecol. doi:10.1111/j.1574-6941.2010.00900.x
Contesto C, Desbrosses G, Lefoulon C, Bna G, Borel F, Galland M, Gamet L, Varoquaux F,
Touraine B (2008) Effects of rhizobacterial ACC deaminase activity on Arabidopsis indicate
that ethylene mediates local root responses to plant growth-promoting rhizobacteria. Plant Sci
175:178189. doi:10.1016/j.plantsci.2008.01.020
357
Contesto C, Milesi S, Mantelin S et al (2010) The auxin-signaling pathway is required for the lateral root response of Arabidopsis to the rhizobacterium Phyllobacterium brassicacearum.
Planta 232:14551470. doi:10.1007/s00425-010-1264-0
Costa R, Van Aarle IM, Mendes R, Van Elsas JD (2009) Genomics of pyrrolnitrin biosynthetic loci:
evidence for conservation and whole-operon mobility within Gram-negative bacteria. Environ
Microbiol 11:159175. doi:10.1111/j.1462-2920.2008.01750.x
Creus CM, Sueldo RJ, Barassi CA (2004) Water relations and yield in Azospirillum-inoculated
wheat exposed to drought in the field. Can J Bot 82:273281. doi:10.1139/b03-119
Crowley DE (2006) Microbial siderophores in the plant rhizosphere. In: Barton LL, Abadia J (eds)
Iron nutrition in plants and rhizospheric microorganisms. Springer, Dordrecht, pp 169198
de Souza JT, de Boer M, de Waard P et al (2003) Biochemical, genetic, and zoosporicidal properties of cyclic lipopeptide surfactants produced by Pseudomonas fluorescens. Appl Environ
Microbiol 69:71617172. doi:10.1128/AEM. 69.12.7161-7172.2003
de Souza JT, Arnould C, Deulvot C, Lemanceau P, Gianinazzi-Pearson V, Raaijmakers JM
(2003a) Effect of 2,4-Diacetylphloroglucinol on Pythium: cellular responses and variation in
sensitivity among propagules and species. Phytopathology 93:966975. doi: 10.1094/
PHYTO.2003.93.8.966
de Souza JT, de Boer M, de Waard P et al (2003b) Biochemical, genetic, and zoosporicidal properties of cyclic lipopeptide surfactants produced by Pseudomonas fluorescens. Appl Environ
Microbiol 69:71617172. doi:10.1128/AEM.69.12.7161-7172.2003
De Weert S, Vermeiren H, Mulders IHM et al (2002) Flagella-driven chemotaxis towards exudate
components is an important trait for tomato root colonization by Pseudomonas fluorescens.
Mol Plant Microbe Interact 15:11731180. doi:10.1094/MPMI.2002.15.11.1173
Delaney SM, Mavrodi DV, Bonsall RF, Thomashow LS (2001) phzO, a gene for biosynthesis of
2-hydroxylated phenazine compounds in Pseudomonas aureofaciens 30-84. J Bacteriol 183:
318327
Delledonne M (2005) NO news is good news for plants. Curr Opin Plant Biol 8:390396.
doi:10.1016/j.pbi.2005.05.002
Dias-Arieria CR, Marini PM, Fontana LF et al (2012) Effect of Azospirillum brasilense, Stimulate
and potassium phosphite to control Pratylenchus brachyurus in soybean and maize.
Nematropica 42:170175
Dimkpa CO, Svato A, Dabrowska P et al (2008) Involvement of siderophores in the reduction of
metal-induced inhibition of auxin synthesis in Streptomyces spp. Chemosphere 74:1925.
doi:10.1016/j.chemosphere.2008.09.079
Dimkpa C, Weinand T, Asch F (2009) Plant-rhizobacteria interactions alleviate abiotic stress
conditions. Plant Cell Environ 32:16821694. doi:10.1111/j.1365-3040.2009.02028.x
Djavaheri M (2007) Iron-regulated metabolites of plant growth promoting Pseudomonas fluorescens WCS374: their role in induced systemic resistance. Utrecht University, Utrecht
Dobbelaere S, Vanderleyden J, Okon Y (2003) Plant growth-promoting effects of diazotrophs in
the rhizosphere. Crit Rev Plant Sci 22:107149. doi:10.1080/713610853
Dodd IC, Zinovkina NY, Safronova VI, Belimov AA (2010) Rhizobacterial mediation of plant
hormone status. Ann Appl Biol 157:361379. doi:10.1111/j.1744-7348.2010.00439.x
Dreher K, Callis J (2007) Ubiquitin, hormones and biotic stress in plants. Ann Bot 99:787822.
doi:10.1093/aob/mcl255
Eisenhauer N, Cesarz S, Koller R et al (2012) Global change belowground: impacts of elevated
CO2, nitrogen, and summer drought on soil food webs and biodiversity. Glob Chang Biol
18:435447. doi:10.1111/j.1365-2486.2011.02555.x
Esquivel-Cote R, Ramrez-Gama RM, Tsuzuki-Reyes G et al (2010) Azospirillum lipoferum strain
AZm5 containing 1-aminocyclopropane-1-carboxylic acid deaminase improves early growth
of tomato seedlings under nitrogen deficiency. Plant Soil 337:6575. doi:10.1007/
s11104-010-0499-7
Farooq M, Wahid A, Kobayashi N et al (2009) Plant drought stress: effects, mechanisms and
management. Agron Sustain Dev 29:185212. doi:10.1051/agro:2008021
358
J. Vacheron et al.
Faure D, Dessaux Y (2007) Quorum sensing as a target for developing control strategies for the plant
pathogen Pectobacterium. Eur J Plant Pathol 119:353365. doi:10.1007/s10658-007-9149-1
Figueiredo AC, Barroso JG, Pedro LG, Scheffer JJC (2008) Factors affecting secondary metabolite
production in plants: volatile components and essential oils. Flavour Fragrance J 23:213226.
doi:10.1002/ffj.1875
Frapolli M, Dfago G, Monne-Loccoz Y (2010) Denaturing gradient gel electrophoretic analysis
of dominant 2,4-diacetylphloroglucinol biosynthetic phlD alleles in fluorescent Pseudomonas
from soils suppressive or conducive to black root rot of tobacco. Soil Biol Biochem 42:649
656. doi:10.1016/j.soilbio.2010.01.005
Friesen ML, Porter SS, Stark SC et al (2011) Microbially mediated plant functional traits. In:
Futuyma DJ, Shaffer HB, Simberloff D (eds) Annual review of ecology, evolution, and systematics, vol 42. Annual Reviews, Palo Alto, pp 2346
Fujita M, Fujita Y, Noutoshi Y et al (2006) Crosstalk between abiotic and biotic stress responses: a
current view from the points of convergence in the stress signaling networks. Curr Opin Plant
Biol 9:436442. doi:10.1016/j.pbi.2006.05.014
Galland M, Gamet L, Varoquaux F et al (2012) The ethylene pathway contributes to root hair
elongation induced by the beneficial bacteria Phyllobacterium brassicacearum STM196. Plant
Sci 190:7481. doi:10.1016/j.plantsci.2012.03.008
Gerhardson B (2002) Biological substitutes for pesticides. Trends Biotechnol 20:338343.
doi:10.1016/S0167-7799(02)02021-8
Glass JT, Cahen GL, Stoner GE (1989) The effect of phosphoric acid concentration on electrocatalysis. J Electrochem Soc 136:656660. doi:10.1149/1.2096705
Glick BR (2014) Bacteria with ACC deaminase can promote plant growth and help to feed the
world. Microbiol Res 169:3039. doi:10.1016/j.micres.2013.09.009
Glick BR, Penrose DM, Li J (1998) A model for the lowering of plant ethylene concentrations by
plant growth-promoting bacteria. J Theor Biol 190:6368. doi:10.1006/jtbi.1997.0532
Glick BR, Cheng Z, Czarny J, Duan J (2007) Promotion of plant growth by ACC deaminaseproducing soil bacteria. In: Bakker PAHM, Raaijmakers JM, Bloemberg G et al (eds) New
perspectives and approaches in plant growth-promoting rhizobacteria research. Springer,
Dordrecht, pp 329339
Goncalves AFS, Oliveira RGB (1998) Cyanide production by Brazilian strains of Azospirillum.
Rev Microbiol 29:3639
Guo J, Chi J (2014) Effect of Cd-tolerant plant growth-promoting rhizobium on plant growth and
Cd uptake by Lolium multiflorum Lam. and Glycine max (L.) Merr. in Cd-contaminated soil.
Plant Soil 375:205214. doi:10.1007/s11104-013-1952-1
Gupta S, Arora DK, Srivastava AK (1995) Growth promotion of tomato plants by rhizobacteria and
imposition of energy stress on Rhizoctonia solani. Soil Biol Biochem 27:10511058.
doi:10.1016/0038-0717(95)00011-3
Gutirrez-Maero FJ, Ramos-Solano B, Probanza A et al (2001) The plant-growth-promoting
rhizobacteria Bacillus pumilus and Bacillus licheniformis produce high amounts of physiologically active gibberellins. Physiol Plant 111:206211. doi:10.1034/j.1399-3054.2001.1110211.x
Gyaneshwar P, Kumar GN, Parekh LJ, Poole PS (2002) Role of soil microorganisms in improving
P nutrition of plants. In: Adu-Gyamfi JJ (ed) Food security in nutrient-stressed environments:
exploiting plants genetic capabilities. Springer, Dordrecht, pp 133143
Haas D, Dfago G (2005) Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat Rev Microbiol 3:307319. doi:10.1038/nrmicro1129
Haichar F e Z, Santaella C, Heulin T, Achouak W (2014) Root exudates mediated interactions
belowground. Soil Biol Biochem 77:6980. doi:10.1016/j.soilbio.2014.06.017
Harb A, Krishnan A, Ambavaram MMR, Pereira A (2010) Molecular and physiological analysis of
drought stress in Arabidopsis reveals early responses leading to acclimation in plant growth.
Plant Physiol 154:12541271. doi:10.1104/pp. 110.161752
Hartmann A, Schmid M, van Tuinen D, Berg G (2008) Plant-driven selection of microbes. Plant
Soil 321:235257. doi:10.1007/s11104-008-9814-y
19
359
Hassouna MG, ElSaedy MAM, Saleh HMA (1998) Biocontrol of soilborne plant pathogens
attacking cucumber (Cucumis sativus) by Rhizobacteria in a semiarid environment. Arid Soil
Res Rehabil 12:345357. doi:10.1080/15324989809381523
Hayat R, Ali S, Amara U et al (2010) Soil beneficial bacteria and their role in plant growth promotion: a review. Ann Microbiol 60:579598. doi:10.1007/s13213-010-0117-1
Helman Y, Chernin L (2014) Silencing the mob: disrupting quorum sensing as a means to fight
plant disease. Mol Plant Pathol. doi:10.1111/mpp.12180
Hiltner L (1904) ber neuere erfahrungen und probleme auf dem gebiete der bodenbakteriologie
unter besonderer bercksichtigung der grndngung und brache. Arbeiten der deutschen
Landwirtschaftlichen Gesellschaft 98:5978
Hoffland E, Pieterse CMJ, Bik L, van Pelt JA (1995) Induced systemic resistance in radish is
not associated with accumulation of pathogenesis-related proteins. Physiol Mol Plant Pathol
46:309320. doi:10.1006/pmpp.1995.1024
Iavicoli A, Boutet E, Buchala A, Mtraux J-P (2003) Induced systemic resistance in Arabidopsis
thaliana in response to root inoculation with Pseudomonas fluorescens CHA0. Mol Plant
Microbe Interact 16:851858. doi:10.1094/MPMI.2003.16.10.851
IPCC (2001) Climate change 2001: the scientific basis. In: Houghton JT, Ding Y, Griggs DJ,
Noguer M, van der Linden PJ, Dai X, Maskell K, Johnson CA (eds) Contribution of Working
Group I to the Third Assessment Report of the Intergovernmental Panel on Climate Change.
Cambridge University Press, Cambridge, pp 881
Jalili F, Khavazi K, Pazira E et al (2009) Isolation and characterization of ACC deaminaseproducing fluorescent pseudomonads, to alleviate salinity stress on canola (Brassica napus L.)
growth. J Plant Physiol 166:667674. doi:10.1016/j.jplph.2008.08.004
Jousset A, Lara E, Wall LG, Valverde C (2006) Secondary metabolites help biocontrol strain
Pseudomonas fluorescens CHA0 to escape protozoan grazing. Appl Environ Microbiol 72:
70837090. doi:10.1128/AEM. 00557-06
Kerry BR (2000) Rhizosphere interactions and the exploitation of microbial agents for the biological control of plant-parasitic nematodes. Annu Rev Phytopathol 38:423441. doi:10.1146/
annurev.phyto.38.1.423
Kim HJ, Choi HS, Yang SY et al (2014) Both extracellular chitinase and a new cyclic lipopeptide,
chromobactomycin, contribute to the biocontrol activity of Chromobacterium sp. C61: chitinase and cyclic lipopeptide in biocontrol. Mol Plant Pathol 15:122132. doi:10.1111/mpp.12070
Kloepper JW, Leong J, Teintze M, Schroth MN (1980) Enhanced plant growth by siderophores
produced by plant growth-promoting rhizobacteria. Nature 286:885886. doi:10.1038/286885a0
Kloepper JW, Ryu C-M, Zhang S (2004) Induced systemic resistance and promotion of plant
growth by Bacillus spp. Phytopathology 94:12591266. doi:10.1094/PHYTO.2004.94.11.1259
Kohler J, Hernndez JA, Caravaca F, Roldn A (2008) Plant-growth-promoting rhizobacteria and
arbuscular mycorrhizal fungi modify alleviation biochemical mechanisms in water-stressed
plants. Funct Plant Biol 35:141151
Kupferschmied P, Maurhofer M, Keel C (2013) Promise for plant pest control: root-associated
pseudomonads with insecticidal activities. Front Plant Sci. doi:10.3389/fpls.2013.00287
Kupferschmied P, Pchy-Tarr M, Imperiali N et al (2014) Domain shuffling in a sensor protein
contributed to the evolution of insect pathogenicity in plant-beneficial Pseudomonas protegens.
PLoS Pathog 10:e1003964. doi:10.1371/journal.ppat.1003964
Kwak Y-S, Han S, Thomashow LS et al (2011) Saccharomyces cerevisiae genome-wide mutant
screen for sensitivity to 2,4-diacetylphloroglucinol, an antibiotic produced by Pseudomonas
fluorescens. Appl Environ Microbiol 77:17701776. doi:10.1128/AEM. 02151-10
Lacey LA, Georgis R (2012) Entomopathogenic nematodes for control of insect pests above and
below ground with comments on commercial production. J Nematol 44:218
Laloi C, Apel K, Danon A (2004) Reactive oxygen signalling: the latest news. Curr Opin Plant Biol
7:323328. doi:10.1016/j.pbi.2004.03.005
Levy E, Eyal Z, Chet I, Hochman A (1992) Resistance mechanisms of Septoria tritici to antifungal
products of Pseudomonas. Physiol Mol Plant Pathol 40:163171. doi:10.1016/08855765(92)90057-3
360
J. Vacheron et al.
Li J, Brader G, Kariola T, Tapio Palva E (2006) WRKY70 modulates the selection of signaling
pathways in plant defense. Plant J 46:477491. doi:10.1111/j.1365-313X.2006.02712.x
Livremont D, Bertin PN, Lett M-C (2009) Arsenic in contaminated waters: biogeochemical cycle,
microbial metabolism and biotreatment processes. Biochimie 91:12291237. doi:10.1016/
j.biochi.2009.06.016
Ligon JM, Hill DS, Hammer PE et al (2000) Natural products with antifungal activity from
Pseudomonas biocontrol bacteria. Pest Manag Sci 56:688695. doi:10.1002/1526-4998
(200008)56:8<688::AID-PS186>3.0.CO;2-V
Lpez-Guerrero MG, Ormeo-Orrillo E, Rosenblueth M, Martnez-Romero E (2013) Buffet
hypothesis for microbial nutrition at the rhizosphere. Front Plant Sci 4:188. doi:10.3389/
fpls.2013.00188
Lovisolo C, Hartung W, Schubert A (2002) Whole-plant hydraulic conductance and root-to-shoot
flow of abscisic acid are independently affected by water stress in grapevines. Funct Plant Biol
29:13491356
Lugtenberg B, Kamilova F (2009) Plant-growth-promoting rhizobacteria. Annu Rev Microbiol
63:541556. doi:10.1146/annurev.micro.62.081307.162918
Maksimov IV, Abizgildina RR, Pusenkova LI (2011) Plant growth promoting rhizobacteria as
alternative to chemical crop protectors from pathogens (review). Appl Biochem Microbiol
47:333345. doi:10.1134/S0003683811040090
Martnez-Absaln S, Rojas-Sols D, Hernndez-Len R, Prieto-Barajas C, Orozco-Mosqueda MC,
Pea-Cabriales JJ, Sakuda S, Valencia-Cantero E, Santoyo G (2014) Potential use and mode of
action of the new strain Bacillus Thuringiensis UM96 for the biological control of the grey
mould phytopathogen Botrytis Cinerea. Biocontrol Sci Technol 24:13491362. doi:10.1080/
09583157.2014.940846
Martin GB, Bogdanove AJ, Sessa G (2003) Understanding the functions of plant disease resistance
proteins. Annu Rev Plant Biol 54:2361. doi:10.1146/annurev.arplant.54.031902.135035
Marulanda A, Azcn R, Chaumont F et al (2010) Regulation of plasma membrane aquaporins by
inoculation with a Bacillus megaterium strain in maize (Zea mays L.) plants under unstressed
and salt-stressed conditions. Planta 232:533543. doi:10.1007/s00425-010-1196-8
Mauch F, Mauch-Mani B, Boller T (1988) Antifungal hydrolases in pea tissue ii. Inhibition of
fungal growth by combinations of chitinase and -1,3-Glucanase. Plant Physiol 88:936942.
doi:10.1104/pp. 88.3.936
Maurhofer M, Keel C, Haas D, Dfago G (1994) Pyoluteorin production by Pseudomonas fluorescens strain CHA0 is involved in the suppression of Pythium damping-off of cress but not of
cucumber. Eur J Plant Pathol 100:221232. doi:10.1007/BF01876237
Mayak S, Tirosh T, Glick BR (2004) Plant growth-promoting bacteria confer resistance in tomato
plants to salt stress. Plant Physiol Biochem 42:565572. doi:10.1016/j.plaphy.2004.05.009
Mazzola M, Fujimoto DK, Thomashow LS, Cook RJ (1995) Variation in sensitivity of
Gaeumannomyces Graminis to antibiotics produced by fluorescent Pseudomonas spp. and
effect on biological control of take-all of wheat. Appl Environ Microbiol 61:25542559
Mendes R, Garbeva P, Raaijmakers JM (2013) The rhizosphere microbiome: significance of plantbeneficial, plant-pathogenic and human-pathogenic microorganisms. FEMS Microbiol Rev
37:634663. doi:10.1111/1574-6976.12028
Meyer SL, Halbrendt JM, Carta LK et al (2009) Toxicity of 2, 4-diacetylphloroglucinol (DAPG)
to plant-parasitic and bacterial-feeding nematodes. J Nematol 41:274
Meyer JB, Frapolli M, Keel C, Maurhofer M (2011) Pyrroloquinoline quinone biosynthesis gene
pqqC, a novel molecular marker for studying the phylogeny and diversity of phosphatesolubilizing pseudomonads. Appl Environ Microbiol 77:73457354. doi:10.1128/AEM.
05434-11
Meziane H, Van Der Sluis I, Van Loon LC et al (2005) Determinants of Pseudomonas putida
WCS358 involved in inducing systemic resistance in plants. Mol Plant Pathol 6:177185.
doi:10.1111/j.1364-3703.2005.00276.x
19
361
Mishra G, Zhang W, Deng F et al (2006) A bifurcating pathway directs abscisic acid effects on
stomatal closure and opening in Arabidopsis. Science 312:264266. doi:10.1126/science.
1123769
Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004) Reactive oxygen gene network of
plants. Trends Plant Sci 9:490498. doi:10.1016/j.tplants.2004.08.009
Mohammadkhani N, Heidari R (2008) Effects of drought stress on soluble proteins in two maize
varieties. Turkish J Biol 32:2330
Naseem H, Bano A (2014) Role of plant growth-promoting rhizobacteria and their exopolysaccharide in drought tolerance of maize. J Plant Interact 9:689701. doi:10.1080/17429145.2014.
902125
Neill SJ, Desikan R, Clarke A et al (2002) Hydrogen peroxide and nitric oxide as signalling
molecules in plants. J Exp Bot 53:12371247. doi:10.1093/jexbot/53.372.1237
Omar MNA, Osman MEH, Kasim WA, El-Daim IAA (2009) Improvement of salt tolerance mechanisms of barley cultivated under salt stress using Azospirillum brasilense. In: Ashraf M,
Ozturk M, Athar HR (eds) Salinity and Water Stress. Springer, Dordrecht, pp 133147
Ongena M, Jacques P (2008) Bacilus lipopeptides: versatile weapons for plant disease biocontrol.
Trends Microbiol 16:115125
Ongena M, Daayf F, Jacques P et al (2000) Systemic induction of phytoalexins in cucumber in
response to treatments with fluorescent pseudomonads. Plant Pathol 49:523530. doi:10.1046/
j.1365-3059.2000.00468.x
Pal SS (1998) Interactions of an acid tolerant strain of phosphate solubilizing bacteria with a few
acid tolerant crops. Plant Soil 198:169177. doi:10.1023/A:1004318814385
Park KS, Kloepper JW (2000) Activation of PR-1a promoter by rhizobacteria that induce systemic
resistance in tobacco against Pseudomonas syringae pv. tabaci. Biol Control 18:29.
doi:10.1006/bcon.2000.0815
Pchy-Tarr M, Bruck DJ, Maurhofer M et al (2008) Molecular analysis of a novel gene cluster
encoding an insect toxin in plant-associated strains of Pseudomonas fluorescens. Environ
Microbiol 10:23682386. doi:10.1111/j.1462-2920.2008.01662.x
Pchy-Tarr M, Borel N, Kupferschmied P et al (2013) Control and host-dependent activation of
insect toxin expression in a root-associated biocontrol pseudomonad. Environ Microbiol
15:736750. doi:10.1111/1462-2920.12050
Pereira SIA, Barbosa L, Castro PML (2014) Rhizobacteria isolated from a metal-polluted area
enhance plant growth in zinc and cadmium-contaminated soil. Int J Environ Sci Technol 116.
doi: 10.1007/s13762-014-0614-z
Pereyra MA, Garca P, Colabelli MN et al (2012) A better water status in wheat seedlings induced
by Azospirillum under osmotic stress is related to morphological changes in xylem vessels of
the coleoptile. Appl Soil Ecol 53:9497. doi:10.1016/j.apsoil.2011.11.007
Persello-Cartieaux F, Nussaume L, Robaglia C (2003) Tales from the underground: molecular.
Plant Cell Environ 26:189199. doi:10.1046/j.1365-3040.2003.00956.x
Pieterse CM, van Wees SC, Hoffland E et al (1996) Systemic resistance in Arabidopsis induced by
biocontrol bacteria is independent of salicylic acid accumulation and pathogenesis-related gene
expression. Plant Cell 8:12251237. doi:10.1105/tpc.8.8.1225
Pieterse CMJ, Van Wees SCM, Ton J, Van Pelt JA, Van Loon LC (2002) Signalling in rhizobacteriainduced systemic resistance in Arabidopsis thaliana. Plant Biol 4:535544. doi:10.1055/
s-2002-35441
Pieterse CMJ, Zamioudis C, Berendsen RL et al (2014) Induced systemic resistance by beneficial
microbes. Annu Rev Phytopathol 52:347375. doi:10.1146/annurev-phyto-082712-102340
Prigent-Combaret C, Blaha D, Pothier JF et al (2008) Physical organization and phylogenetic
analysis of acdR as leucine-responsive regulator of the 1-aminocyclopropane-1-carboxylate
deaminase gene acdS in phytobeneficial Azospirillum lipoferum 4B and other Proteobacteria.
FEMS Microbiol Ecol 65:202219. doi:10.1111/j.1574-6941.2008.00474.x
Pulsawat W, Leksawasdi N, Rogers PL, Foster LJR (2003) Anions effects on biosorption of Mn(II)
by extracellular polymeric substance (EPS) from Rhizobium etli. Biotechnol Lett 25:1267
1270. doi:10.1023/A:1025083116343
362
J. Vacheron et al.
Raaijmakers JM, de Bruijn I, de Kock MJD (2006) Cyclic lipopeptide production by plant-associated
Pseudomonas spp.: diversity, activity, biosynthesis, and regulation. Mol Plant Microbe Interact
19:699710. doi:10.1094/MPMI-19-0699
Ramamoorthy V, Viswanathan R, Raguchander T et al (2001) Induction of systemic resistance by
plant growth promoting rhizobacteria in crop plants against pests and diseases. Crop Prot 20:
111. doi:10.1016/S0261-2194(00)00056-9
Ramirez KS, Craine JM, Fierer N (2012) Consistent effects of nitrogen amendments on soil microbial communities and processes across biomes. Glob Chang Biol 18:19181927. doi:10.1111/
j.1365-2486.2012.02639.x
Ramirez-Puebla ST, Servin-Garciduenas LE, Jimenez-Marin B et al (2013) Gut and root microbiota commonalities. Appl Environ Microbiol 79:29. doi:10.1128/AEM. 02553-12
Ramos Solano B, Barriuso Maicas J, Pereyra de la Iglesia MT et al (2008) Systemic disease protection elicited by plant growth promoting rhizobacteria strains: relationship between metabolic
responses, systemic disease protection, and biotic elicitors. Phytopathology 98:451457.
doi:10.1094/PHYTO-98-4-0451
Reetha AK, Pavani SL, Mohan S (2014) Hydrogen cyanide production ability by bacterial antagonist and their antibiotics inhibition potential on Macrophomina phaseolina (Tassi.) Goid. Int J
Curr Microbiol Appl Sci 3:172178
Reichman SM (2014) Probing the plant growth-promoting and heavy metal tolerance characteristics of Bradyrhizobium japonicum CB1809. Eur J Soil Biol 63:713. doi:10.1016/j.
ejsobi.2014.04.001
Reinhardt D, Mandel T, Kuhlemeier C (2000) Auxin regulates the initiation and radial position of
plant lateral organs. Plant Cell 12:507518. doi:10.1105/tpc.12.4.507
Richardson AE, Barea JM, McNeill AM, Prigent-Combaret C (2009) Acquisition of phosphorus
and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil
321:305339. doi:10.1007/s11104-009-9895-2
Rodrigues EP, Rodrigues LS, de Oliveira ALM et al (2008) Azospirillum amazonense inoculation:
effects on growth, yield and N2 fixation of rice (Oryza sativa L.). Plant Soil 302:249261.
doi:10.1007/s11104-007-9476-1
Rodrguez-Navarro DN, Dardanelli MS, Ruz-Sanz JE (2007) Attachment of bacteria to the roots
of higher plants. FEMS Microbiol Lett 272:127136. doi:10.1111/j.1574-6968.2007.00761.x
Roelfsema MRG, Levchenko V, Hedrich R (2004) ABA depolarizes guard cells in intact plants,
through a transient activation of R- and S-type anion channels. Plant J 37:578588
Romero AM, Correa OS, Moccia S, Rivas JG (2003) Effect of Azospirillum-mediated plant growth
promotion on the development of bacterial diseases on fresh-market and cherry tomato. J Appl
Microbiol 95:832838. doi:10.1046/j.1365-2672.2003.02053.x
Romero AM, Vega D, Correa OS (2014) Azospirillum brasilense mitigates water stress imposed by
a vascular disease by increasing xylem vessel area and stem hydraulic conductivity in tomato.
Appl Soil Ecol 82:3843. doi:10.1016/j.apsoil.2014.05.010
Rouch DA, Lee BT, Morby AP (1995) Understanding cellular responses to toxic agents: a model
for mechanism-choice in bacterial metal resistance. J Ind Microbiol 14:132141. doi:10.1007/
BF01569895
Ruffner B, Pchy-Tarr M, Ryffel F et al (2013) Oral insecticidal activity of plant-associated pseudomonads. Environ Microbiol 15:751763. doi:10.1111/j.1462-2920.2012.02884.x
Ruz-Snchez M, Armada E, Muoz Y et al (2011) Azospirillum and arbuscular mycorrhizal colonization enhance rice growth and physiological traits under well-watered and drought conditions. J Plant Physiol 168:10311037. doi:10.1016/j.jplph.2010.12.019
Russo A, Vettori L, Felici C et al (2008) Enhanced micropropagation response and biocontrol
effect of Azospirillum brasilense Sp245 on Prunus cerasifera L. clone Mr.S 2/5 plants.
J Biotechnol 134:312319. doi:10.1016/j.jbiotec.2008.01.020
Ryall B, Lee X, Zlosnik JE et al (2008) Bacteria of the Burkholderia cepacia complex are cyanogenic under biofilm and colonial growth conditions. BMC Microbiol 8:108
Ryu CM, Murphy JF, Mysore KS, Kloepper JW (2004) Plant growth-promoting rhizobacterial
systematically protect Arabidopsis thaliana against Cucumber mosaic virus by a salicylic acid
19
363
364
J. Vacheron et al.
Vachon V, Laprade R, Schwartz J-L (2012) Current models of the mode of action of Bacillus
thuringiensis insecticidal crystal proteins: a critical review. J Invertebr Pathol 111:112.
doi:10.1016/j.jip.2012.05.001
Van Der Heijden MGA, Bardgett RD, Van Straalen NM (2008) The unseen majority: soil microbes
as drivers of plant diversity and productivity in terrestrial ecosystems. Ecol Lett 11:296310.
doi:10.1111/j.1461-0248.2007.01139.x
Van Loon LC (2007) Plant responses to plant growth-promoting rhizobacteria. Eur J Plant Pathol
119:243254. doi:10.1007/s10658-007-9165-1
Van Loon LC, Bakker PAHM, Pieterse CMJ (1998) Systemic resistance induced by rhizosphere
bacteria. Annu Rev Phytopathol 36:453483. doi:10.1146/annurev.phyto.36.1.453
Van Loon LC, Geraats BPJ, Linthorst HJM (2006) Ethylene as a modulator of disease resistance
in plants. Trends Plant Sci 11:184191. doi:10.1016/j.tplants.2006.02.005
Van Peer R, Niemann GJ, Schippers B (1991) Induced resistance and phytoalexin accumulation in
biological control of Fusarium wilt of carnation by Pseudomonas sp. strain WCS 417 r.
Phytopathology 81:728734
van Peer R, Schippers B (1992) Lipopolysaccharides of Plant-Growth Promoting Pseudomonas sp.
strain WCS417r induce resistance in carnation to Fusarium wilt. Netherlands J Plant Pathol
98:129139. doi:10.1007/BF01996325
Van Wees SCM, Pieterse CMJ, Trijssenaar A et al (1997) Differential induction of systemic resistance in Arabidopsis by biocontrol bacteria. Mol Plant Microbe Interact 10:716724.
doi:10.1094/MPMI.1997.10.6.716
Verslues PE, Juenger TE (2011) Drought, metabolites, and Arabidopsis natural variation: a promising combination for understanding adaptation to water-limited environments. Curr Opin
Plant Biol 14:240245. doi:10.1016/j.pbi.2011.04.006
Vivas A, Marulanda A, Ruiz-Lozano JM et al (2003) Influence of a Bacillus sp. on physiological
activities of two arbuscular mycorrhizal fungi and on plant responses to PEG-induced drought
stress. Mycorrhiza 13:249256. doi:10.1007/s00572-003-0223-z
Vleesschauwer DD, Djavaheri M, Bakker PAHM, Hfte M (2008) Pseudomonas fluorescens
WCS374r-induced systemic resistance in rice against Magnaporthe oryzae is based on
pseudobactin-mediated priming for a salicylic acid-repressible multifaceted defense response.
Plant Physiol 148:19962012. doi:10.1104/pp. 108.127878
Voisard C, Keel C, Haas D, Defago G (1989) Cyanide production by Pseudomonas fluorescens
helps suppress black root rot of tobacco under gnotobiotic conditions. EMBO J 8:351358
Volfson V, Fibach-Paldi S, Paulucci NS et al (2013) Phenotypic variation in Azospirillum brasilense Sp7 does not influence plant growth promotion effects. Soil Biol Biochem 67:255262.
doi:10.1016/j.soilbio.2013.09.008
Wang YQ, Ohara Y, Nakayashiki H et al (2005) Microarray analysis of the gene expression profile
induced by the endophytic plant growth-promoting rhizobacteria, Pseudomonas fluorescens
FPT9601-T5 in Arabidopsis. Mol Plant Microbe Interact 18:385396. doi:10.1094/mpmi18-0385
Wang C-J, Yang W, Wang C et al (2012) Induction of drought tolerance in cucumber plants by a
consortium of three plant growth-promoting Rhizobacterium strains. PLoS One. doi:10.1371/
journal.pone.0052565
Wendehenne D, Durner J, Klessig DF (2004) Nitric oxide: a new player in plant signalling and
defence responses. Curr Opin Plant Biol 7:449455. doi:10.1016/j.pbi.2004.04.002
Westgate ME, Boyer JS (1985) Osmotic adjustment and the inhibition of leaf, root, stem and silk
growth at low water potentials in maize. Planta 164:540549. doi:10.1007/BF00395973
Wisniewski-Dy F, Borziak K, Khalsa-Moyers G et al (2011) Azospirillum genomes reveal transition
of bacteria from aquatic to terrestrial environments. PLoS Genet 7:e1002430. doi:10.1371/
journal.pgen.1002430
Wu K-M, Lu Y-H, Feng H-Q et al (2008) Suppression of cotton bollworm in multiple crops in
china in areas with bt toxin-containing cotton. Science 321:16761678. doi:10.1126/science.
1160550
365
Xue Q-Y, Chen Y, Li S-M, Chen L-F, Ding G-C, Guo D-W, Guo J-H (2009) Evaluation of the
strains of Acinetobacter and Enterobacter as potential biocontrol agents against Ralstonia wilt
of tomato. Biol Control 48:252258. doi:10.1016/j.biocontrol.2008.11.004
Yang J, Kloepper JW, Ryu C-M (2009) Rhizosphere bacteria help plants tolerate abiotic stress.
Trends Plant Sci 14:14. doi:10.1016/j.tplants.2008.10.004
Yang M-M, Wen S-S, Mavrodi DV, Mavrodi OV, von Wettstein D, Thomashow LS, Guo J-H, Weller
DM (2014) Biological control of wheat root diseases by the CLP-producing strain Pseudomonas
Fluorescens HC107. Phytopathology 104:248256. doi:10.1094/PHYTO-05-13-0142-R
Yasuda M, Isawa T, Shinozaki S et al (2009) Effects of colonization of a bacterial endophyte,
Azospirillum sp. B510, on disease resistance in rice. Biosci Biotechnol Biochem 73:
25952599
Zaidi A, Khan MS, Amil M (2003) Interactive effect of rhizotrophic microorganisms on yield
and nutrient uptake of chickpea (Cicer arietinum L.). Eur J Agron 19:1521. doi:10.1016/
S1161-0301(02)00090-4
Zaidi S, Usmani S, Singh BR, Musarrat J (2006) Significance of Bacillus subtilis strain SJ-101 as
a bioinoculant for concurrent plant growth promotion and nickel accumulation in Brassica
juncea. Chemosphere 64:991997. doi:10.1016/j.chemosphere.2005.12.057
Chapter 20
20.1
A major obstacle in the study of interactions between Azospirillum spp. and plants
is the complexity of the plant. Studies of basic plantbacterium interactions of
Azospirillum spp., done mainly with roots, are difficult because there are many
367
368
tissue functions and numerous possible interactions with plant roots and plant
metabolism, as well as interference with the soil matrix. Plants with relatively small
genomes, such as Arabidopsis thaliana (125-Mb genome) and rice (389-Mb
genome), were sequenced and used as models for Azospirillum spp. interaction.
However, larger plant genomes, in which Azospirillum spp. commonly interacts,
such as maize (2.5 Gb), oat (11.4 Gb), and wheat (16 Gb), even though some are
undergoing sequencing procedures, are unlikely to be understood in detail for some
time. Green microalgae, on the other hand, have the smallest plant genome (~40 Mb).
Chlorella spp. (Chlorophyceae) are simple, nonmotile, unicellular, aquatic green
microalgae that have been intensively studied regarding metabolic functions of the
cell. The Chlorella genome is the smallest eukaryotic, photosynthetic microorganism characterized so far, which makes it an alternative to higher plants with large
genomes interacting with Azospirillum spp., with a specific aim of studying plant
metabolism and molecular mechanisms affected by Azospirillum spp. The reason
for co-immobilization of both microorganisms in a polymer bead is to keep them
together in very close proximity to ensure that each affects the others metabolism.
Consequently the three basic components of the experimental model are cells of
the microalgae Chlorella spp. and cells of Azospirillum spp. that have been coimmobilized in small (34 mm in dia.) alginate beads.
20.2
Co-immobilization Techniques
20.3
20.3.1
Applications
Basic Studies of ProkaryoticEukaryotic Interaction
This conceptual experimental and simple quantitative model offers a convenient and
basic approach to studies of complex interactions between plants and bacteria. These
interactions are mainly physiological, biochemical, and molecular mechanisms
20
369
Fig. 20.1 Flow chart showing methods and techniques used to immobilize, co-immobilize, count,
and cultivate microalgae and A. brasilense for various applications. Composition of media BTB-1,
BTB-2, and OAB are given in this book (Bashan and de-Bashan, Inoculant preparation and formulations for Azospirillum spp.)
370
shared by higher plants and green microalgae (de-Bashan and Bashan 2008;
de-Bashan et al. 2005). Many of the mechanisms proposed so far for Azospirillum
plant interactions (Bashan and de-Bashan 2010; Bashan et al. 2004) are relatively
easy to study using this model. Apart from easy technical handling, the logic of
choosing a microalga as the plant partner for Azospirillum spp. is straightforward.
20
371
The most basic definition of a green plant is that it contains chlorophylls a and b,
starch as a storage material inside the chloroplast, and a cell wall made of cellulose.
Higher plants and algae are part of the same group (Chlorobionta). There is 7098 %
genetic similarity between land plants and algae (Devereux et al. 1990). The size of
the organism, the number of cells and differentiation into organs are not defining
parameters of a plant. Consequently, single-cell microalgae are considered plants.
372
The following sequence of events occurs during the interaction between the two
microorganisms within the polymeric bead. Initial immobilization is a random
spread of particles inside a gel matrix (Gonzalez and Bashan 2000). Nutrients in the
surrounding medium freely diffuse into the porous gel. Over time (648 h), depending on the pairing of microalgae and bacteria, both microorganisms are found in the
same cavity within the bead, mainly just beneath the surface. Small parts of the
internal structure of the bead matrix dissolve or split and separate as microcolonies
develop and enlarge (Covarrubias et al. 2012; Lebsky et al. 2001; de-Bashan et al.
2011). The bacteria mainly excrete indole-3-acetic acid (IAA) and other undefined
signal molecules that reach the nearby microalgal cells (de-Bashan et al. 2008a).
At this stage, the activities of the microalgal enzymes (two were tested so far,
glutamine synthetase and glutamate dehydrogenase) are not enhanced (de-Bashan
et al. 2008c). At the next phase of interaction, beginning about 48 h after joint
immobilization and continuing, glutamate synthetase and glutamate dehydrogenase
activities are enhanced, photosynthetic pigment production is enhanced (de-Bashan
et al. 2002a), nitrogen and phosphorus uptake into microalgal organelles is accelerated (de-Bashan et al. 2005), carbohydrates accumulation, especially starch, occurs
(Choix et al. 2012a, b), as well as an increase in lipids and fatty acids (de-Bashan
et al. 2002a; Leyva et al. 2015). At the same time, the co-immobilized system liberates oxygen produced by Chlorella spp. as a by-product of photosynthesis. The
metabolic functions of this model, studied so far, are illustrated in Fig. 20.3. At the
same time, the common phenotypic colonization of Azospirillum on roots, connection
to the root surface by all sort of fibrillar material (Bashan et al. 1986; Levanony et al.
1989) are detected in the AzospirillumChlorella interactions (de-Bashan et al. 2011).
These favorable characteristics have biotechnological implications. The model is
not restricted to Chlorella vulgarisAzospirillum brasilense interactions that have
comprised most of the studies done so far. Other PGPB, such as Bacillus pumilus,
A. lipoferum, Phyllobacterium myrsinacearum, and other microalgae, such as
C. sorokiniana, were successfully tested (de-Bashan et al. 2008b, c; Gonzalez-Bashan
et al. 2000; Hernandez et al. 2009).
These options create opportunities for endless combinations of microalgae and
PGPB and for many Azospirillum strains. Similarly, different alginates and derivatives
from many macroalgae are commercially available (McHugh 2003) for entrapment
and combination schemes, as needed. Because immobilization of microorganisms is
also commonly used with other polymers (OReilly and Scott 1995), this model is not
restricted to alginates; each polymer has its own advantages and disadvantages.
The practical and analytical aspects of this model are considerable. All ingredients are inexpensive, and the microorganisms are easy to cultivate and test in standard microbiology facilities. The results are available on a microbial time scale
(days to a week). Reproducibility is very high, and replicates are merely Erlenmeyer
flasks, allowing as many replicates as needed in a small space and in a soil-free
system. Reviewing hundreds of published results using this system, it appears that
the standard error is low and allows detection of minute effects between the interacting organisms. So far, we have not observed any disadvantages in experiments conducted over the past 15 years.
20
373
Fig. 20.3 A conceptual model of Azospirillum spp. co-immobilized with microalgae in alginate
beads to study prokaryoticeukaryotic interaction under autotrophic and heterotrophic conditions. Azo
Azospirillum spp., Ch Chlorella spp., GS glutamine synthetase, GDH glutamate dehydrogenase,
IAA indole-3-acetic acid, P-ase phosphatase, Amylase amylase, ACC acetyl-CoA carboxylase,
AGPase ADP glucose pyrophosphorylase. This is an updated version of a model previously published in de-Bashan et al. 2012. Applied Soil Ecology 61: 171189
20.3.1.1
Methods
To observe the physical interaction and fibril formation between the two microorganisms during their association, the following techniques are used. These are common techniques that employ few small modifications to this bacterial species and
are described in detail in the following references. However, when there are many
small modifications, or when these small modifications have a significant importance for obtaining the expected results using this association, a detailed description
of the method needs to be supplied.
Scanning electron microscopy (SEM). There are standard techniques for SEM
for plants, with modifications to adapt to the interaction with microalgae (Bashan
et al. 1986; Covarrubias et al. 2012).
Transmission electron microscopy (TEM) by conventional techniques (Lebsky
et al. 2001).
374
20
375
376
20.3.2
Wastewater Treatment
A combination of microalgae Chlorella vulgaris or C. sorokiniana with A. brasilense strain Cd, co-immobilized in small alginate beads, was developed to remove
phosphorus and nitrogen nutrients from municipal wastewater. Co-immobilization
of the two microorganisms was superior to removal efforts by the microalgae alone,
reaching up to 100 % ammonium, 15 % nitrate, and 36 % phosphorus within 6 days
(varied with the source of the wastewater), compared to 75 % ammonium, 6 %
nitrate, and 19 % phosphorus by the microalgae alone (de-Bashan and Bashan 2010;
Covarrubias et al. 2012; Cruz et al. 2013). This happens in synthetic residual wastewater (de-Bashan et al. 2002b) or domestic wastewater (de-Bashan et al. 2004)
at ambient temperature (~25 C) or extreme temperature (>40 C) and irradiation
(up to 2,500 mol m2 s1), using microalgal strains that are resistant to these conditions (de-Bashan et al. 2008b) and under autotrophic and heterotrophic conditions
(Perez-Garcia et al. 2010, 2011). Artificial, sterile (by autoclaving) wastewater used
in some of these studies is prepared using the following (mg/L): NaCl, 7; CaCl2, 4;
MgSO47H2O, 2; K2HPO4, 21.7; KH2PO4, 8.5; Na2HPO4, 33.4; and NH4Cl, 191.
For continuous and semi-continuous cultures, KH2PO4, at levels in the range of
1215 mg/L, was used as the sole source of phosphorus.
Biological removal of phosphorus is a harder task than removing nitrogen.
In domestic wastewater, phosphorus removed by C. sorokiniana was significantly
enhanced after a starvation period of 35 days in saline solution, combined with
co-immobilization with A. brasilense Cd. The best phosphorus removal treatment of
a batch of synthetic or domestic wastewater was with tandem treatments of wastewater treatment first with pre-starved, co-immobilized microalgae and replacement
of this culture after one cycle of removing phosphorus with a new, similarly starved
culture. This sequential treatment with two cultures was capable of removing up to
72 % of the phosphorus from the wastewater (Hernandez et al. 2006). It appears that
starvation periods, combined with co-immobilization with A. brasilense have
synergistic effects on absorption of phosphorus from wastewater by microalgae.
The advantage of this technology is that microalgae that is co-immobilized with
bacteria are always more effective at removing nitrogen and phosphorus than microalgae without bacteria. As the two microorganisms are immobilized in alginate beads
that are easily and rapidly removed from wastewater by sedimentation, this technology
could be a cost-effective alternative to chemical precipitation, which is the standard
treatment of wastewater. It solves two problems in standard microalgal technology:
increasing the population of microalgae to a level sufficient to clean the wastewater and
using the waste biomass in soil remediation when the cleaning process is completed.
20.3.2.1
Methods
20
377
acidity (mg L1), total suspended solids (mg L1), dissolved solids, and sediments
(mg L1).
SEM and FISH coupled with specialized image-analysis quantification software
(Covarrubias et al. 2012; also see above)
20.3.3
20.3.3.1
Methods
378
20
379
20.3.4
20.3.4.1
Methods
Microbial counts. Beads are solubilized for cell counts by immersing five beads
(one bead per milliliter) in a solution of 4 % NaHCO3 for 30 min at ambient
temperature of 25 4 C. A. brasilense is counted by plating a series of dilutions
380
(in PBS) on BTB agar plates (Bashan et al. 2011). Alternatively, A. brasilense
cells are first stained with fluorescein diacetate (Sigma) (Chrzanowski et al.
1984) and then directly counted under a fluorescent microscope. C. vulgaris
is counted using a Neubauer hemocytometer connected to image analyzer or
manually under light microscopy (Gonzalez and Bashan 2000). Growth rate of
C. vulgaris () is defined as: = (ln Nt1 ln Nt0)/(t1 t0), where Nt1 is the number
of cells at sampling time and Nt0 is the number of cells at the beginning of the
experiment, t1 is sampling time and t0 the beginning of the experiment (Oh-Hama
and Miyachi 1992).
Determining biomass. Ten grams of beads containing co-immobilized microalgae and bacteria are dissolved in 100 mL, as described above. The suspension is
then filtered through a 3 mm (pore size) plankton net, leaving a pellet of microalgae on the net. This pellet is suspended in 100 mL PBS. Aliquots (10 mL) are
centrifuged for 3 min at 1,400 g in tubes containing filter paper at the bottom.
The supernatant containing the bacteria is discarded. The dry weight of the
microalgae is measured after extracting and drying the filter paper at 105 C for
1 h that contains the microalgal pellet.
20.3.5
Green microalgae are commonly used for production of pigments for food and cosmetics (Lebeau and Robert 2006). Pigment production of the four major microalgal
pigments; chlorophyll a and b, lutein, and violaxanthin of C. vulgaris and C. sorokiniana, co-immobilized with A. brasilense, significantly increased (de-Bashan
et al. 2002a). This is very similar to the increase of these pigments in wheat plants
inoculated with A. brasilense (Bashan et al. 2006). This system has not been as yet
scaled up for pigment production.
20.3.5.1
Methods
20
20.3.6
381
20.3.6.1
Methods
382
500 L of the extracted enzyme is added to the reaction buffer. This reaction
mixture is incubated at room temperature (26 2 C) for 20 min. The reaction is
stopped by heating in boiling water for 2 min. Then, 600 L distilled water is
added, and the mixture is centrifuged at 13,000 g for 10 min. The supernatant (1,000 L) is mixed with 0.3 mg NADP+. The activity is recorded as the
increase in A340 after adding 2 L of each of the two enzymes: phosphoglucomutase (0.8 U) and glucose-6-phosphate dehydrogenase (1 U). The enzymatic
activity of AGPase is expressed as U mg1 protein, where one unit is 1 nmol
of ADP mg1 protein min1. Proteins in the mixture are determined by the
Bradford assay (Bradford 1976).
20.3.7
The interaction yielded more fatty acids and more lipids, mainly in the microalgae
(de-Bashan et al. 2002a). Under autotrophic and heterotrophic growth conditions,
co-immobilization always enhanced the activity of acetyl-CoA carboxylase (ACC),
a key enzyme in de novo fatty acid biosynthesis, and yielded more lipids, when
compared with immobilization of the microalga by itself. The highest lipid content
under autotrophic conditions was obtained by also using an ammonium starvation
period. Cultivation under heterotrophic conditions, without limitation of nitrogen,
yielded a higher growth rate and accumulated more lipids than under autotrophic
conditions (Leyva et al. 2014). Considering the major efforts to produce biodiesel
from microalgae (Brennan and Owende 2010), this interaction has a significant, yet
unexplored, biotechnological potential.
20.3.7.1
Methods
20
383
384
20.4
Conclusions
References
Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, Stahl DA (1990) Combination of 16S
rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial
populations. Appl Environ Microbiol 56:19191925
Assmus B, Hutzler P, Kirchhof G, Amann RI, Lawrence JR, Hartmann A (1995) In situ localization
of Azospirillum brasilense in the rhizosphere of wheat with fluorescence labeled, rRNA-targeted
oligonucleotide probes and scanning confocal laser microscopy. Appl Environ Microbiol 61:
10131019
20
385
386
de-Bashan LE, Bashan Y, Moreno M, Lebsky VK, Bustillos JJ (2002a) Increased pigment and lipid
content, lipid variety, and cell and population size of the microalgae Chlorella spp. when coimmobilized in alginate beads with the microalgae-growth-promoting bacterium Azospirillum
brasilense. Can J Microbiol 48:514521
de-Bashan LE, Moreno M, Hernandez J-P, Bashan Y (2002b) Removal of ammonium and phosphorus ions from synthetic wastewater by the microalgae Chlorella vulgaris coimmobilized in
alginate beads with the microalgae growth-promoting bacterium Azospirillum brasilense.
Water Res 36:29412948
de-Bashan LE, Hernandez J-P, Morey T, Bashan Y (2004) Microalgae growth-promoting bacteria
as helpers for microalgae: a novel approach for removing ammonium and phosphorus from
municipal wastewater. Water Res 38:466474
de-Bashan LE, Antoun H, Bashan Y (2005) Cultivation factors and population size control uptake
of nitrogen by the microalgae Chlorella vulgaris when interacting with the microalgae growthpromoting bacterium Azospirillum brasilense. FEMS Microbiol Ecol 54:197203
de-Bashan LE, Antoun H, Bashan Y (2008a) Involvement of indole-3-acetic-acid produced by the
growth-promoting bacterium Azospirillum spp. in promoting growth of Chlorella vulgaris.
J Phycol 44:938947
de-Bashan LE, Magallon P, Antoun H, Bashan Y (2008b) Role of glutamate dehydrogenase and
glutamine synthetase in Chlorella vulgaris during assimilation of ammonium when jointly
immobilized with the microalgae-growth-promoting bacterium Azospirillum brasilense. J Phycol
44:11881196
de-Bashan LE, Trejo A, Huss VAR, Hernandez J-P, Bashan Y (2008c) Chlorella sorokiniana
UTEX 2805, a heat and intense, sunlight-tolerant microalga with potential for removing
ammonium from wastewater. Bioresour Technol 99:49804989
de-Bashan LE, Hernandez J-P, Bashan Y, Maier RM (2010a) Bacillus pumilus ES4: candidate
plant growth-promoting bacterium to enhance establishment of plants in mine tailings. Environ
Exp Bot 69:343352
de-Bashan LE, Hernandez JP, Nelson KN, Bashan Y, Maier RM (2010b) Growth of quailbush in
acidic, metalliferous desert mine tailings: effect of Azospirillum brasilense Sp6 on biomass
production and rhizosphere community structure. Microb Ecol 60:915927
de-Bashan LE, Schmid M, Rothballer M, Hartmann A, Bashan Y (2011) Cell-cell interaction in the
eukaryote-prokaryote model using the microalgae Chlorella vulgaris and the bacterium
Azospirillum brasilense immobilized in polymer beads. J Phycol 47:13501359
Devereux R, Loeblich AR III, Fox GE (1990) Higher plant origins and the phylogeny of green
algae. J Mol Evol 31:1824
Dubois M, Gilles KA, Hamilton JA, Rebers PA, Smith F (1956) Colorimetric method for determination of sugars and related substances. Anal Chem 28:350356
Eaton AD, Clesceri LS, Rice EW, Greenberg AE (eds) (2005) Standard methods for the examination of water and wastewater, 21st edn. American Public Health Association, American
Waterworks Association, Water Environmental Federation. Port City Press, Pikeville
Ferris MJ, Muyzer G, Ward DM (1996) Denaturing gradient gel electrophoresis profiles of 16S
rRNA- defined populations inhabitinga hot spring microbial mat community. Appl Environ
Microbiol 62:340346
Gonzalez LE, Bashan Y (2000) Growth promotion of the microalgae Chlorella vulgaris when
coimmobilized and cocultured in alginate beads with the plant growth-promoting bacteria
Azospirillum brasilense. Appl Environ Microbiol 66:15371541
Gonzalez-Bashan LE, Lebsky VK, Hernandez JP, Bustillos JJ, Bashan Y (2000) Change in the
metabolism of the microalga Chlorella vulgaris when coimmobilized in alginate with the
nitrogen-fixing Phyllobacterium myrsinacearum. Can J Microbiol 46:653659
Hernandez J-P, de-Bashan LE, Bashan Y (2006) Starvation enhances phosphorus removal from
wastewater by the microalga Chlorella spp. co-immobilized with Azospirillum brasilense.
Enzyme Microb Technol 38:190198
Hernandez J-P, de-Bashan LE, Rodriguez DJ, Rodriguez Y, Bashan Y (2009) Growth promotion of
the freshwater microalga Chlorella vulgaris by the nitrogen-fixing, plant growth-promoting
bacterium Bacillus pumilus from arid zone soils. Eur J Soil Biol 45:8893
20
387
388
Chapter 21
Abstract Pseudomonas strains are fast growing, genetically diverse and metabolically versatile bacteria. Many pseudomonad species are preferential inhabitants of
the rhizosphere of plants, reaching up to 108 CFU/g of roots for crop species like
soybean or maize in the field. Rhizospheric pseudomonads contribute to plant
growth and health through a variety of plant probiotic mechanisms, including protection of roots against fungal pathogen attack. Due to their relative ease to isolate
and cultivate in the lab, there is an enormous wealth of knowledge about physiological, biochemical, and genetic traits of pseudomonads. Based on their PGPR traits,
several inoculant products are commercialized, either for seed, foliar, or postharvest treatment of crops, vegetables, and fruits. Provided that pseudomonads
share the rhizosphere niche with Azospirillum species, as well as with many other
PGPR microorganisms, combined formulations have also become available for
agronomic purposes. However, little information about interspecies and multispecies interactions is available. This chapter describes microbiological, genetic, and
agronomic tools that may be applied to isolate and characterize novel Pseudomonas
spp. from diverse source materials, to study their interaction with Azospirillum cells
in the context of dual or multispecies inoculants, and to evaluate the quality and
effectiveness of formulated products.
C. Valverde (*)
Laboratorio de Bioqumica, Microbiologa e Interacciones Biolgicas en el Suelo,
Departamento de Ciencia y Tecnologa, Universidad Nacional de Quilmes,
Roque Senz Pea 352, Bernal B1876BXD, Argentina
e-mail: [email protected]
G. Gonzalez Anta
Departamento de Investigacin, Desarrollo y Servicio Tcnico, Rizobacter Argentina S.A.,
Av. Dr. Arturo Frondizi 1150, Calle N 1, Parque Industrial,
Pergamino B2702HDA, Buenos Aires, Argentina
Ctedra de Microbiologa Agrcola, UNNOBA (Universidad Nacional del Noroeste de
Buenos Aires), Monteagudo 2772, Pergamino B2700KIZ, Buenos Aires, Argentina
e-mail: [email protected]
G. Ferraris
Estacin Experimental Agropecuaria INTA Pergamino,
Av. Dr. Arturo Frondizi km 4.5, Pergamino, B2700WAA, Buenos Aires, Argentina
e-mail: [email protected]
Springer International Publishing Switzerland 2015
F.D. Cassn et al. (eds.), Handbook for Azospirillum,
DOI 10.1007/978-3-319-06542-7_21
389
390
21.1
C. Valverde et al.
Introduction
Members of the genus Pseudomonas (i.e., the pseudomonads) are ubiquitous Gramnegative -proteobacteria. In particular, many pseudomonad species are preferential
inhabitants of the rhizosphere of plants, reaching up to 108 CFU/g of roots for crop
species like soybean or maize in the field (Agaras et al. 2014). These root associated
pseudomonads contribute to plant growth and health through a variety of plant probiotic mechanisms (Table 21.1). For instance, pseudomonads are one of the main
prokaryotic taxonomic groups actively involved in protection of plant roots against
fungal pathogen attack (Mendes et al. 2011; Spence et al. 2014). Many (but not all)
species are proficient in secretion of siderophores (Cornelis 2010), which contribute
to their competitive root colonizing ability (Lugtenberg and Kamilova 2009), and
cause the appearance of fluorescent halos around colonies developed on iron limited
media (i.e., fluorescent pseudomonads).
Pseudomonas strains are fast growing, genetically diverse, and metabolically
versatile bacteria. Due to their relative ease to isolate and cultivate in the lab, there
is an enormous wealth of knowledge about physiological, biochemical, and genetic
traits of pseudomonads (Ramos and Filloux 2007). This is reflected in the number
of sequenced genomes available (www.pseudomonas.com). Based on their PGPR
traits, several inoculant products are commercialized, either for seed, foliar, or postharvest treatment of crops, vegetables, and fruits (Table 21.1). Provided that pseudomonads share the rhizosphere niche with Azospirillum species, as well as with
many other PGPR microorganisms, combined formulations are available for agronomic purposes (Table 21.2). However, little information about interspecies and
multispecies interactions is available. Here, we will summarize a series of microbiological, genetic, and agronomic tools that may be applied to isolate and characterize novel Pseudomonas spp. from diverse source materials, to study their
interaction with Azospirillum cells in the context of dual or multispecies inoculants,
and to evaluate the quality and effectiveness of formulated products.
21.2
There are many nonselective and semi-selective growth media for propagating
pseudomonads in the lab and a few selective media for specific isolation of pseudomonads from complex samples like soil and plant materials. One of the most popular nonselective and differential medium is Kings B (King et al. 1954). This
medium is available as a pre-formulated commercial product (i.e., Pseudomonas
agar or F agar). Kings B medium allows fast growth of pseudomonads and provides iron-limiting conditions that induce siderophore production in fluorescent
pseudomonad isolates.
Cetrimide agar (Brown and Lowbury 1965) and Goulds S1 (Gould et al. 1985)
are two Pseudomonas-selective media that are based on their intrinsic resistance to
detergents and to an antibiotic. In our experience (Agaras et al. 2012), Goulds S1
P. putida (n.d.),
Bacillus spp.
P. fluorescens A506
P. chlororaphis (n.d.)
P. fluorescens (n.d.)
Jet Harvest
Solutions, USA
Nufarm, USA
Bioagri AB, Sweden
Rizobacter Argentina
SA, Argentina
BlightBan A506
Cerall, Cedomon,
Cedress
Rizofos Liq Maz,
Rizofos Liq Trigo
P. syringae ESC-10
and ESC-11
Bio-SoilTM
Bio-Save
10LP & 11LP
Biagro ProSol
P. chlororaphis subsp.
aurantiaca (n.d.)
P. fluorescens
Strain
P. azotoformans (n.d.)
Producer,
country of origin
Bioagri AB, Sweden
Product
Amase
Antifreezing, antibiosis
Antibiosis, ISR,
competence for niche
Phosphorus
solubilization, root
growth promotion
Not specified
Antibiosis
Claimed mechanism
of action
Not specified
Maize, wheat
Not specified
Intended crop
Pine and spruce seedlings,
cucumber, lettuce, tomato, peppers,
eggplant, cabbage, and broccoli
Wheat, barley, sunflower
www.rizobacter.com.ar
www.nufarm.com
www.bioagri.se
www.jetharvest.com
www.jetharvest.com
www.biagro.com.ar
www.biagro.com.ar
More information
www.bioagri.se
21
Pseudomonas and Azospirillum
391
C. Valverde et al.
392
Table 21.2 Commercial products containing both Azospirillum brasilense and Pseudomonas
fluorescens that are available in Argentina for agronomic application
Product
DEGfertil PGPR
Containsa
Pf + Ab
DEGfertil PGPR
Soja
PGPR
Biofertilizantes
Bj + Pf + Ab
Bj + Pf + Ab
Intended crops
Maize, sorghum,
wheat, barley,
sunflower
Soybean
Rhizoflo Premium
Pf + Ab
BioPower
Pf + Ab
Turbo (Soja)
Bj + Pf + Ab
Soybean, maize,
sorghum, wheat,
barley, sunflower
Wheat, sunflower,
maize
Maize, sorghum,
sunflower
Soybean
Azomix Duo
Pf + Ab
Trigo
PGPR Soja
Bj + Pf + Ab
Soja
Phoebus
Biofertilizantes
Phoebus
Biofertilizantes
Pf + Ab
Wheat, sorghum,
maize, sunflower
Soybean
Bj + Pf + Ab
More information
http://www.laboratoriosdegser.com/
biofertilizantes/degfertil_m.html
http://www.laboratoriosdegser.com/
biofertilizantes/degfertil_m.html
http://www.greenquality.com.
ar/#!biofertilizantes/c13uf
http://www.ckc.com.ar/esp/index.html
http://www.inoculantespalaversich.
com/productos-biopower-info.html
http://www.inoculantespalaversich.
com/productos-turbo-info.html
http://www.bionetsrl.com/inoculantesazomix-duo.php
http://www.bionetsrl.com/inoculantespgpr-soja.php
http://agroat.com/new/catalogos/
phoebus-biofertilizantes/
http://agroat.com/new/catalogos/
phoebus-biofertilizantes/
21.2.1
21.2.1.1
21
393
sterile MgSO4 (if added before autoclaving, the medium may become opaque). This
medium is available as a pre-formulated commercial product (i.e., Pseudomonas
agar or F agar).
21.2.1.2
Gelatine peptone, 20 g; potassium sulfate, 10 g; magnesium chloride, 1.4 g; cetrimide, 0.3 g; agar, 15 g. As cetrimide agar is recommended for the isolation and differentiation of P. aeruginosa from different materials of clinical origin, there are
many commercial suppliers of the formulated medium.
21.2.1.3
Sucrose, 10.0 g; glycerol: 10.0 mL; casamino acids: 5.0 g; NaHCO3, 1.0 g;
MgSO47H2O, 1.0 g; K2HPO4, 2.3 g; sodium lauroyl sarcosine: 1.2 g; trimethoprim
(5-[(3,4,5 trimethoxyphenyl)methyl] 2,4-pyrimidinediamine), 0.02 g; agar: 15.0 g.
All ingredients can be dissolved in distilled water before autoclaving. The pH
should be 7.47.6. After autoclaving, let the medium cool down and pour into Petri
dishes. Once solidified, if not used immediately, S1 plates must be stored at room
temperature and never kept in the fridge to avoid precipitation of lauroyl sarcosine.
There is no commercial formulation of S1 medium, so every batch needs to be controlled for its selectivity by streaking positive (Pseudomonas strains) and negative
controls (other Gram-negative and Gram-positive genera).
394
C. Valverde et al.
Fig. 21.1 Isolation of pseudomonads on selective agar plates (Goulds S1 medium) and observation of production of fluorescent diffusible pigments. (a) Bulk soil suspension plated on nonselective nutrient medium at a 1:100 dilution and incubated 72 h at 28 C; (b) the same diluted soil
suspension plated on Goulds S1 medium after incubation 72 h at 28 C; (c) Colonies from a soil
suspension on an S1 plate under normal white light; (d) the same plate as in (c), but under UV
light; (e) a root system collected from soil and directly deposited onto a Goulds S1 plate, after
incubation at 28 C for 48 h and photographed under white light; (f) the same plate photographed
under UV light
21
395
of fungi and yeasts. After 4872 h of incubation at 2830 C, plates are inspected
for the development of colonies under normal light and under UV light (260
290 nm) for individualization of fluorescent siderophore-producing colonies. Those
colonies of interest must be re-streaked individually on S1 plates to confirm purity,
and then they may be grown on rich complex media like nutrient agar or LB agar
for short-term storage and further characterization.
21.2.3
Pseudomonads are highly motile Gram-negative rods that do not sporulate (Holt
1994). Metabolically, Pseudomonas strains are oxidase positive and do not ferment
glucose. Other biochemical traits of the genus are: indole negative, methyl red negative, VogesProskauer negative, and citrate positive (Holt 1994).
21.2.4
Isolated colonies from primary platings on Goulds S1 agar may serve as DNA
source for a direct PCR detection procedure that is highly specific for the genus
Pseudomonas, and that is based on the amplification of an internal fragment of the
oprF gene encoding an outer membrane porin (Agaras et al. 2012). 16S rDNA
sequencing confirmed that 100 % of the colonies developed on Goulds S1 plates
are positive for the oprF PCR and are members of the genus Pseudomonas (Agaras
et al. 2012). The typical protocol used in our lab is described below, and it may be
subject to subtle adaptations depending on the available source of materials
(Tables 21.3 and 21.4).
Table 21.3 PCR mixture for amplification of an internal fragment of the oprF gene, diagnostic for
the Pseudomonas genus
PCR component
Buffer 10
dNTPs
MgCl2
Forward (oprF-FW2)
Reverse (oprF-Rev2)
Taq DNA polymerase
DNA template
Deionized H2O
Stock concentration
10
2 mM
50 mM
10 M
10 M
5 U/L
Volume (L)
2.5
2.5
1.0
2.0
2.0
0.2
See text
Up to 25
Final concentration
1
200 M
2.0 mM
0.8 M
0.8 M
1.0 U
396
C. Valverde et al.
PCR step
1. Initial denaturation
2. Denaturation
3. Annealing
4. Extension
Back to step 2 (34)
5. Final extension
Keep at 4 C until analyzed
Temperature/time
94 C/5 min
94 C/1 min
57 C/45 s
72 C/45 s
72 C/5 min
21.2.5
Storage
Fresh colonies on different growth media may be safely stored as working material
for up to 2 weeks at 4 C without significant loss of viability. It is important to avoid
repeated subculturing in solid or liquid media, as pseudomonads are well known for
their ability to generate phase variants (see Sect. 21.2.6 and Chap. 12 for general
information) and experience genetic rearrangements leading to adaptation to lab
conditions. Instead, long-term storage under conditions of restricted growth is mandatory to preserve the genetic wealth and the corresponding physiological and
PGPR traits. Thus, as a general rule, discard working cultures that have been subcultured up to three times, and go back to long-term storage samples to reinitiate
fresh working plates.
21
397
21.2.5.1
Pick a single colony of a fresh plate and grow it overnight in the appropriate liquid
medium (e.g., Luria broth, nutrient yeast broth). Label a sterile screw cap microcentrifuge tube, and add 450 L of the o/n culture and 150 L of 80 % sterile glycerol
solution. Vortex 1 min, let stand the tube 30 min on the bench, then freeze the glycerol
stock at 80 C. To streak out from the stock, put the tube on ice and take it to the
place that you intend to streak the strain, flame a metal inoculating loop until it is red
hot and once cooled down, scrape off a portion from the top of the frozen glycerol
stock and streak it onto your plate. Return the strain to the ultrafreezer. Flame the
metal inoculating loop a second time, cool it by inserting it into the agar of the plate
and finish streaking out the strain so that it will be possible to isolate single colonies.
21.2.5.2
Freeze-Drying
This process requires the choice of an appropriate drying medium to increase recovery rates upon dehydration, and diverse substances are currently used as cryoprotectants (e.g., polyols, di- and polysaccharides). However, the protective effectiveness
of a given additive will vary with the bacterial species or even strain, so conditions
need to be adjusted for each isolate. A detailed procedure including different growth
media (conventional or osmoadaptative medium) as well as different osmoprotectants has been recently reported (Cabrefiga et al. 2014). In this work, viability of
lyophilized P. fluorescens EPS62e cells was improved to near 99 % when cells were
osmoadapted during cultivation and lactose was used as cryoprotectant. Moreover,
the dry powder remained active for 12 months and retained biocontrol activity similar to that of fresh cells (Cabrefiga et al. 2014).
21.2.5.3
398
21.2.6
C. Valverde et al.
Phase Variation
As reported for Azospirillum brasilense and Azospirillum lipoferum (see Chap. 12),
many plant-associated Pseudomonas species show colony phase variation (van
den Broek et al. 2005) (Fig. 21.2). Colony phase variation is a genetic regulatory
mechanism operating at the DNA level that results in highly frequent reversible
switches between colonies with different phenotype (van den Broek et al. 2005).
Fig. 21.2 Colony phase variation in pseudomonads. Mixed smooth and rough colony variants
corresponding to the same 16S rDNA genotype are usually detected upon plating commercial
inoculants (a) or lab cultures that were grown for several days. Both phenotypic variants, smooth
(b, d), and rough (c, e) were purified on Goulds S1 Pseudomonas-selective medium
21
399
Phase variation often affects cell surface components, thus having a direct impact on
colony morphotype (Sanchez-Contreras et al. 2002) and leading to the emergence of
colonies with different aspect from the parental typical morphotype (Fig. 21.2). For
instance, P. fluorescens F113 experiences phase variation during colonization of
alfalfa roots, and this is caused by both the activity of a site-specific recombinase
encoded by the sss gene (the main factor of phase variation) and by a point mutation
in the gacA gene that alters the phenotype (Sanchez-Contreras et al. 2002). Provided
the gacA gene is member of a global regulatory system controlling many phenotypes
in different pseudomonads (Valverde and Haas 2008), phase variation may affect a
plethora of other physiological and biochemical traits not as easily visualized as
changes in colony aspect. For these reasons, we strongly suggest avoiding repeated
subculturing of Pseudomonas isolates or strains, and to keep instead stock cultures
under long-term preservation conditions (see Sect. 2.5). To discard contaminants
upon sudden appearance of suspicious colonies from a pure culture, the atypical colonies may be streaked onto a Pseudomonas-selective medium like Goulds S1 and
subjected to colony PCR targeting oprF gene (see Sects. 21.2.1 and 21.2.4). If both
tests were positive, the endonuclease restriction pattern of the oprF amplicon may
quickly allow distinguishing among two pseudomonad strains (Agaras et al. 2012).
21.2.7
Due to their ease to isolate, cultivate and genetic manipulation, pseudomonads have
been thoroughly characterized at the genetic and genomic level and a significant
amount of molecular tools have been developed for their qualitative and quantitative study by culture-independent methods. Table 21.5 summarizes the cultureindependent molecular methods available to specifically detect and quantify
pseudomonads DNA and characterize its diversity in complex samples like soil,
rhizosphere, or plant tissues.
21.2.8
The possibility to visualize cells in the presence of other microorganisms or to specifically recover them from complex bacterial habitats like the rhizosphere or the
soil are valuable tools to study the root colonization ability of an isolate, its ability
to establish as an endophyte, its persistence in the soil, and its interactions with
other micro- or macroorganisms under both gnotobiotic and natural conditions.
This can be simultaneously achieved by tagging bacteria with genes encoding fluorescent reporter proteins and antibiotic resistance markers. There are several available plasmids having these features, although plasmid instability in the absence of
400
C. Valverde et al.
Sample type
Soil
References
Xiang et al. (2010)
Rhizosphere
qPCR
Target gene
Specific AFLP
sequences
Specific SCAR
sequences
16S rDNA
Soil
PCR + RFLP
oprF
Soil, rhizosphere
PCR + DGGE
16S rDNA
Soil, rhizosphere
PCR + DGGE
PCR + DGGE
gacA
phlD
Soil, rhizosphere
Rhizosphere
qPCR
Diversity
Gene
expression
Soil
Soil, rhizosphere
Soil
antibiotic selection and horizontal transfer events are issues that complicate interpretation of results under natural conditions in the presence of many other bacterial
species (Bloemberg et al. 2000). Thus, genetic tagging as single copy at one specific, neutral, chromosomal site is desirable. A versatile and efficient Tn7 transposonbased toolset has been developed for stable integration of different reporter variants
into a neutral chromosomal site (Lambertsen et al. 2004). The Tn7-delivery vectors
carrying different fluorescent reporters and different antibiotic resistance markers
can be introduced into the bacterium of interest by electroporation together with the
Tn7-helper plasmid (encoding the required Tn7 transposase) or can be mobilized by
conjugation (Lambertsen et al. 2004). The tagged derivatives are confirmed by fluorescence microscopy, antibiotic resistance phenotypes, and by PCR to check the
correct genomic insertion into the Tn7 attachment site (Lambertsen et al. 2004).
Tagged strains may then be applied to seeds or seedlings and examined under conventional or confocal fluorescence microscopy (Fig. 21.3), and also be selectively
recovered from soil or rhizosphere samples by plating onto pseudomonas-selective
medium (see Sect. 2.2) supplemented with the appropriate antibiotics. This method
has proven useful for different pseudomonads (Jousset et al. 2006; Pliego et al.
2008), although it has not been tested yet for Azospirillum strains.
21
401
21.3
Quality control is a key step of the inoculant production chain. According to local
regulations, inoculants must contain a minimal concentration of viable cells of the
declared microorganisms, must be free of microbial contaminants, and must be
effective in terms of their expected activities (Deaker et al. 2011). Stimulated by the
synergism between a local industry demanding improved quality of inoculants and
the academic institutions strengthening their links with inoculant producers, the
402
C. Valverde et al.
REDCAI network of public and private laboratories was established and committed
to define standard protocols to assess the quality of inoculants in Argentina. The
REDCAI network has recently published a Handbook with consensus protocols for
evaluation of inoculants based on Azospirillum or Pseudomonas spp. (Albanesi
et al. 2013) (for further details about quality control of Azospirillum-based inoculants, see Chap. 27). Such recommended procedures are addressed to single species
inoculants and make use of RC medium (Rodriguez Caceres 1982) for Azospirillum
spp. and F agar (Kings B) for Pseudomonas spp., for determining the viable cell
density of commercial inoculants (Manual de procedimientos microbiolgicos para
la evaluacin de inoculantes 2013). However, mixed inoculants containing both
Azospirillum and Pseudomonas cells cannot be readily analyzed with these protocols because both bacteria can grow on both media. For counting pseudomonads,
Goulds S1 medium (see Sect. 21.2.1.3) provides the required selectivity to enumerate viable cells in mixed inoculants; however, highly selective solid media for
Azospirillum species are not available. In this context, a plausible alternative to
classical microbiological and culture-dependent methods is the estimation of
genomic units by quantitative real-time PCR with specific oligonucleotides targeting both microorganisms ((Couillerot et al. 2013); Table 21.5). We refer the reader
to Chap. 2 for established methods to estimate Azospirillum genomic units.
21.4
Interspecies Interactions
Both Azospirillum and Pseudomonas strains are natural members of the rhizosphere
and endophytic compartments of diverse plant species, and many isolates display
plant probiotic traits that have prompted the formulation of single or combined inoculants for agronomical applications (Tables 21.1 and 21.2). Whereas establishment
of natural microbial communities of plant tissues is subject to diverse environmental, physical, and biological constraints that determine the spatiotemporal distribution of each microbial population, the artificial combination of pseudomonads and
Azospirillum strains generates the forced coexistence at above-normal cell densities
already in the inoculant formulation or on the seed surface upon bacterization. This
may give rise to unexpected interactions among the strains (Couillerot et al. 2013;
Loaces et al. 2011), which may be advantageous to study in detail before formulation. In this regard, the compatibility between wild type strains may be assayed first
by dual culture in solid medium (Loaces et al. 2011; Vidhyasekaran and Muthamilan
1995). Ideally, the compatibility of both types of PGPR should be addressed in
mixed liquid inoculants or in bacterized seeds, which is limited by the lack of fully
selective media for enumeration of Azospirillum strains. To overcome this limitation, it may be useful to utilize antibiotic-resistant variants of the Azospirillum strain
(either spontaneous or genetically modified derivatives) (see Chap. 4), allowing
selective counts of viable cells in the presence of other microorganisms, as well as
studying their colonization properties. We refer the reader to Chap. 11 for a description of Azospirillum tagging procedure for microscopic analysis of biofilm formation and root colonization in the presence of other bacteria.
21
21.5
403
404
C. Valverde et al.
Fig. 21.4 Field trials for evaluation of inoculants containing Azospirillum brasilense and
Pseudomonas fluorescens. (a) Panoramic view of the Ferr wheat experimental field. (b) Maize
experimental field at Ferr
21.5.1
Planting date
13 June 2010
18 July 2011
29 June 2012
12 June 2012
Variety
K. Escorpin
K. Chaj
K. Chaj
K. Capricornio
Previous crop
Wheat/soybean
Soybean
Soybean
Soybean
Planting system
No till
No till
No till
No till
Wheat Trials
The agronomical data of the different season trials is summarized in Table 21.6,
whereas the chemical properties of each site are shown in Table 21.7.
For wheat, the number of spikes per m2 is a good predictor of the potential yield.
As shown in Table 21.8, the dual bacterization of wheat seeds (Ab/Pf) had a differential positive effect on the density of spikes, on top of the Ab effect. This was
particularly evident when field plots were not fertilized with N (0 N).
Biomass production reflects nutritional and growth regulatory effects of the
inoculated PGPR. In all cases, Ab alone or in combination with Pf, or both, had a
positive effect on plant biomass at all three N fertilization levels (Table 21.9).
Finally, the grain yield evaluation is the most important parameter that determines
the adoption of an agronomical practice, such as seed bacterization with single or
dual PGPR inoculants. In this case, the positive impact produced with this technology is significant as evidenced in Table 21.10.
21.5.2
Maize Trials
The agronomical data of the different season trials is summarized in Table 21.11,
whereas the chemical properties of each site are shown in Table 21.12.
405
pH
5.50
5.60
5.40
6.10
N-NO3 (ppm)
15.50
13.60
11.90
13.60
P (ppm)
9.90
10.80
10.10
12.90
OM (%)
2.40
3.70
2.90
2.90
Total N (%)
0.177
0.184
0.144
0.144
C (%)
1.30
2.13
1.68
1.70
C0N
289
221
422
247
295
Ab
0N
304
295
445
304
337
Ab/Pf
0N
317
258
452
361
347
C 40 N
318
261
440
241
315
Ab
40 N
320
361
518
268
367
Ab/Pf
40 N
331
372
452
255
353
C 80 N
294
278
425
283
320
Ab
80 N
292
339
511
276
355
Ab/Pf
80 N
304
270
444
397
354
Table 21.9 Impact of dual treatment of wheat seeds with A. brasilense and P. fluorescens on plant
biomass (kg/ha)
Experimental
site
Junn
Pergamino
Ferr
Pergamino
Average
C0N
555
741
877
907
770
Ab
0N
561
785
937
989
818
Ab Pf
0N
689
735
1,158
931
878
C 40 N
616
916
991
1,001
881
Ab
40 N
617
913
1,044
1,212
947
Ab/Pf
40 N
723
987
1,159
1,097
992
C 80 N
676
827
998
1,024
881
Ab
80 N
632
866
1,066
1,310
969
Ab/Pf
80 N
690
845
1,110
1,221
967
Table 21.10 Impact of dual treatment of wheat seeds with A. brasilense and P. fluorescens on
grain yield (kg/ha)
Experimental
site
Junn
Pergamino
Ferr
Pergamino
Average
C0N
1,681
1,785
3,814
2,378
2,415
Ab
0N
1,567
1,820
4,248
2,783
2,605
Ab/Pf
0N
1,652
2,580
4,111
2,700
2,761
C 40 N
1,461
2,109
3,923
2,904
2,599
Ab
40 N
1,504
2,024
4,226
3,167
2,730
Ab/Pf
40 N
1,562
3,360
4,270
2,867
3,015
C
80 N
1,665
2,064
4,038
3,009
2,694
Ab
80 N
1,614
2,172
4,509
3,015
2,828
Ab/Pf
80 N
1,852
3,560
4,257
3,163
3,208
Planting date
24 October 2010
18 December 2011
09 October 2012
30 September 2012
Variety
DR 684 RR2
DR 684 RR2
DR 747 RR2
DR 747 RR2
Previous crop
Moha
Soybean
Soybean
Soybean
Planting system
No till
No till
No till
No till
406
C. Valverde et al.
pH
5.00
5.00
5.90
6.10
N-NO3 (ppm)
16.00
15.00
13.00
4.30
P (ppm)
7.70
8.10
5.50
8.50
OM (%)
2.70
3.30
2.30
2.70
Total N (%)
0.135
0.165
0.123
0.134
C (%)
1.50
1.90
1.33
1.60
Table 21.13 Impact of dual treatment of maize seeds with A. brasilense and P. fluorescens on
plant biomass (kg/ha)
Experimental site
Junn
Pergamino
Ferr
Pergamino
Average
C0N
533
432
114
122
300
Az
0N
589
462
137
147
334
Az/Pf
0N
675
482
133
161
362
C 50 N
566
360
105
161
298
Az
50 N
644
355
105
171
319
Az/Pf
50 N
668
381
121
158
332
C 100 N
547
285
120
174
282
Az
100 N
579
295
137
187
299
Az/Pf
100 N
670
298
132
195
324
Table 21.14 Impact of dual treatment of maize seeds with A. brasilense and P. fluorescens on
grain yield (kg/ha)
Experimental
site
Junn
Pergamino
Ferr
Pergamino
Average
Az
Az/Pf
Az
Az/Pf
C0N 0N
0N
C 50 N 50 N
50 N
8,668 9,198 9,403 8,859 9,310 9,548
8,817 9,293 11,639 10,308 10,222 10,529
10,067 10,861 11,267 10,129 11,404 12,432
8,656 9,362 9,807 10,164 11,027 11,473
9,052 9,679 10,529 9,865 10,491 10,996
C
100 N
9,126
10,832
10,543
11,022
10,381
Az
100 N
9,742
11,263
11,015
11,026
10,762
Az/Pf
100 N
9,565
11,847
11,561
11,670
11,161
Shoot biomass production did clearly reflect the positive impact of seed inoculation with either Ab or both Ab/Pf at all N fertilization levels (Table 21.13).
Consistently with the increase in plant biomass, there was an incremental effect of
Ab and Ab/Pf on grain yield at almost all treatments, reaching the highest yield with
the combined Ab/Pf bacterization at almost all N fertilizer dose and locations (11
out of 12 treatments; Table 21.14).
The results of these experimental field trials support the use of combined inoculants containing the PGPR A. brasilense and P. fluorescens, and illustrate the importance of evaluating the performance of PGPR at different crops, different field
locations and at different fertilization levels, while keeping constant the rest of the
agronomical practices recommended at each productive region.
21.6
407
References
Agaras B, Wall LG, Valverde C (2012) Specific enumeration and analysis of the community structure of culturable pseudomonads in agricultural soils under no-till management in Argentina.
Appl Soil Ecol 61:305319
Agaras B, Wall LG, Valverde C (2014) Influence of agricultural practices and seasons on the abundance and community structure of culturable pseudomonads in soils under no-till management
in Argentina. Plant Soil 382:117131
Albanesi AS, Benintende S, Cassn F, Perticari A (2013) Manual de procedimientos microbiolgicos para la evaluacin de inoculantes, 1 edn. Asociacin Argentina de Microbiologa, Buenos
Aires
Bashan Y (1986) Alginate beads as synthetic inoculant carriers for slow release of bacteria that
affect plant growth. Appl Environ Microbiol 51(5):10891098
Bashan Y, Gonzalez LE (1999) Long-term survival of the plant-growth-promoting bacteria
Azospirillum brasilense and Pseudomonas fluorescens in dry alginate inoculant. Appl Microbiol
Biotechnol 51:262266
Bergmark L, Poulsen PH, Al-Soud WA, Norman A, Hansen LH, Sorensen SJ (2012) Assessment
of the specificity of Burkholderia and Pseudomonas qPCR assays for detection of these genera
in soil using 454 pyrosequencing. FEMS Microbiol Lett 333(1):7784
Bloemberg GV, Wijfjes AH, Lamers GE, Stuurman N, Lugtenberg BJ (2000) Simultaneous imaging of Pseudomonas fluorescens WCS365 populations expressing three different autofluorescent proteins in the rhizosphere: new perspectives for studying microbial communities. Mol
Plant Microbe Interact 13(11):11701176
Bodilis J, Hedde M, Orange N, Barray S (2006) OprF polymorphism as a marker of ecological
niche in Pseudomonas. Environ Microbiol 8(9):15441551
Brown VI, Lowbury EJ (1965) Use of an improved cetrimide agar medium and other culture methods for Pseudomonas aeruginosa. J Clin Pathol 18(6):752756
408
C. Valverde et al.
409
Pliego C, de Weert S, Lamers G, de Vicente A, Bloemberg G, Cazorla FM, Ramos C (2008) Two
similar enhanced root-colonizing Pseudomonas strains differ largely in their colonization strategies of avocado roots and Rosellinia necatrix hyphae. Environ Microbiol 10(12):32953304
Power B, Liu X, Germaine KJ, Ryan D, Brazil D, Dowling DN (2011) Alginate beads as a storage,
delivery and containment system for genetically modified PCB degrader and PCB biosensor
derivatives of Pseudomonas fluorescens F113. J Appl Microbiol 110(5):13511358
Puente ML, Garca JE (2009) Revisin del uso de Azospirillum brasilense como promotor del
crecimiento en trigo y maz en Argentina. In: Puente ML, Garca JE, Perticari A (eds) Uso
actual y potencial de microorganismos para mejorar la nutricin y el desarrollo en trigo y maz,
1st edn. INTA, Buenos Aires, pp 821
Ramos JL, Filloux A (2007) Pseudomonas. A model system in biology, vol 5, 1 edn. Springer,
New York
Rodriguez Caceres EA (1982) Improved medium for isolation of Azospirillum spp. Appl Environ
Microbiol 44(4):990991
Sanchez-Contreras M, Martin M, Villacieros M, OGara F, Bonilla I, Rivilla R (2002) Phenotypic
selection and phase variation occur during alfalfa root colonization by Pseudomonas fluorescens F113. J Bacteriol 184(6):15871596
Schreiter S, Ding GC, Heuer H, Neumann G, Sandmann M, Grosch R, Kropf S, Smalla K (2014)
Effect of the soil type on the microbiome in the rhizosphere of field-grown lettuce. Front
Microbiol 5:144
Spence C, Alff E, Johnson C, Ramos C, Donofrio N, Sundaresan V, Bais H (2014) Natural rice
rhizospheric microbes suppress rice blast infections. BMC Plant Biol 14:130
Valverde C, Ferraris G (2009) Las pseudomonas: Un grupo heterogneo con diversos mecanismos
promotores del desarrollo vegetal. In: Puente ML, Garca JE, Perticari A (eds) Uso actual y
potencial de microorganismos para mejorar la nutricin y el desarrollo en trigo y maz, 1st edn.
INTA, Buenos Aires, pp 2243
Valverde C, Haas D (2008) Small RNAs controlled by two-component systems. Adv Exp Med
Biol 631:5479
van den Broek D, Bloemberg GV, Lugtenberg B (2005) The role of phenotypic variation in rhizosphere Pseudomonas bacteria. Environ Microbiol 7(11):16861697
Vidhyasekaran P, Muthamilan M (1995) Development of formulations of Pseudomonas fluorescens for control of chickpea wilt. Plant Dis 79:782786
Von Felten A, Defago G, Maurhofer M (2010) Quantification of Pseudomonas fluorescens strains
F113, CHA0 and Pf153 in the rhizosphere of maize by strain-specific real-time PCR unaffected
by the variability of DNA extraction efficiency. J Microbiol Methods 81(2):108115
Xiang SR, Cook M, Saucier S, Gillespie P, Socha R, Scroggins R, Beaudette LA (2010)
Development of amplified fragment length polymorphism-derived functional strain-specific
markers to assess the persistence of 10 bacterial strains in soil microcosms. Appl Environ
Microbiol 76(21):71267135
Chapter 22
22.1
Introduction
J.C. Vicario L.A. Gallarato N.S. Paulucci M.. Bueno M.S. Dardanelli (*)
Laboratorio 17, Departamento de Biologa Molecular, Facultad de Ciencias
Exactas, Fsico-Qumicas y Naturales, Universidad Nacional de Ro Cuarto,
Ruta Nacional N 36 Km 601 CP, XBAY5804 Ro Cuarto, Crdoba, Argentina
e-mail: [email protected]
D.S. Perrig
INDRASA Biotecnologa S.A., Ro Cuarto, Crdoba, Argentina
Springer International Publishing Switzerland 2015
F.D. Cassn et al. (eds.), Handbook for Azospirillum,
DOI 10.1007/978-3-319-06542-7_22
411
412
have specific mechanisms to interact with roots and colonize even the root interior,
while others colonize the mucigel layer or injured root cortical cells. Under certain
environmental and soil conditions, Azospirillum can positively influence plant
growth, crop yields, and N-content of the plant. This plant stimulatory effect exerted
by Azospirillum has been attributed to several mechanisms. The contribution of biological nitrogen fixation in this plant response, however, has been questioned. One of
the most pronounced effects of inoculation with azospirilla on root morphology is
the proliferation of root hairs as observed in several grasses, cereals, and legumes
under controlled conditions in the greenhouse as well as in the field. The factors,
such as the production of plant growth-promoting substances and the increase in the
rate of mineral uptake by plant roots have been taken into account to explain the
plant yield enhancement and could even be more important in establishing the plant
response.
The positive effects of combined inoculation with Azospirillum and rhizobacteria
have been reported for several legumes and cereals. Most Azospirillumrhizobacteria co-inoculation studies have focused on the final effects on plant growth and
nodulation parameters; in contrast, few data are available on the simultaneous effect
of double inoculation and stressful conditions on the early signalling exchange
between the symbiotic partners. The response of dually inoculated plants and the
enhanced growth of legume plants may be attributed to early nodulation, an increase
in the number of nodules, and a general improvement in root development. The
objective of this chapter was to summarize the effects of co-inoculation with
Azospirillum and rhizobia on nodulation and growth of legumes.
22.2
Leguminous plants have the ability to enter into symbiosis with N2-fixing bacteria
(collectively called rhizobia), which results in the formation of a new plant root
organ, the root nodule. The incorporation of atmospheric N2 into organic material
resulting from this Rhizobiumlegume symbiosis is estimated to account for onethird of the total nitrogen needed for world agriculture. This unique intracellular
association contributes significantly to agricultural yields. The formation of
nitrogen-fixing nodules results from an interactive process between the legume and
the rhizobia, in which signal molecules, play a decisive role. Flavonoids in the root
exudate induce the expression of rhizobial nodulation genes (called nod, noe, and
nol) that are involved in the biosynthesis and secretion of lipochitin oligosaccharides (LCOs) or Nod factors, the bacterial signal molecules (Dardanelli et al. 2010).
They are different methods involved in collection, separation, bioassay, and compound characterization from plant root exudates, especially flavonoids. In this case,
studies are much more complicated because the number of compounds is diverse and
more selective and sensitive analytical methods are required. The choice of the
method depends on the sensitivity required for the purpose at hand, the complexity of
22
413
the biological matrix, and pretreatment prior to analysis and include high performance
liquid chromatographic (HPLC).
Microbial attachment capacity to plant cells probably acts as a key factor in
determining microbe competitiveness to colonize the root. Unfortunately, technical
difficulties to purify and identify all possible bacterial surface molecules that could
be involved in bacterial attachment have not been completely overcome. In addition,
mutations that abolish the production of a particular surface molecule can also influence the production and/or the presence of other bacterial surface components,
which makes it difficult to identify which particular surface molecule, is directly
responsible for the changes observed in bacterial attachment capacity. In combination with omics technologies, the structural determination of bacterial surface molecules and the construction of transgenic plants expressing receptors for bacterial
surface components appear as the most promising way to investigate which molecules are actually involved in bacterial attachment, how important they are for successful root colonization under natural conditions, and how they are affected by
environmental conditions (Rodrguez-Navarro et al. 2007).
The attachment assays were described by Smit et al. (1986). The rhizobia pellets
are washed with phosphate buffer (pH 7.5) and suspended in the same solutions to
give a bacterial concentration of 2 108 rhizobial cell/mL. In co-inoculation assays,
Azospirillum should be added to concentrations of 1 106 cell/mL. Furthermore,
portions of 1 cm roots (five root pieces) are incubated in phosphate buffer with the
bacteria for approximately 2 h. Subsequently, the roots are washed, soaked, and the
extract obtained is used for dilutions and plate count.
A variety of compounds, such as surface proteins and polysaccharides, have been
implicated in adherence of several PGPRs to plant roots. Similar to the Rhizobium
legume symbiosis, attachment of Azospirillum brasilense cells to wheat (Triticum
aestivum) roots also can be divided in two different steps (Michiels et al. 1991). The
first phase is a weak, reversible, and unspecific binding governed by bacterial surface proteins, CPSs, and flagella. Polar flagella of A. brasilense contain an adhesin
component that is involved in bacterial attachment to wheat roots. The second
attachment phase appears to be irreversible. It occurs 816 h after inoculation and is
mediated by a bacterial surface polysaccharide. Azospirillum irakense cells are
mainly associated with rice root hairs, whereas A. brasilense cells are mainly located
on root surfaces (Zhu et al. 2002). These differences in spatial distribution are the
reason why these two species do not compete for root colonization.
The involvement of extracellular fibrils was demonstrated in the irreversible
anchoring of A. brasilense (Michiels et al. 1991). The nature of this fibrillar material
has not been determined yet. Extracellular polysaccharide production also has been
related to the process of flocculation of Azospirillum cells and might be similar to
the fibrillar material produced during root association (Burdman et al. 1998;
Skvortsov and Ignatov 1998). The major outer membrane protein of A. brasilense
appears to be involved in cell aggregation and the first step of attachment. This outer
protein exhibits higher affinity to cereal roots than to those of other plants, which
may explain why Azospirillum is mainly found associated with the rhizosphere of
cereals (Rodrguez-Navarro et al. 2007).
414
22
415
also play an important role in co-inoculation of legumes with rhizobia and azospirilla, and confirmed that IAA production by A. brasilense is a key component for
enhancement of secretion of nod-gene-inducing flavonoids by legume roots (Star
et al. 2012).
22.3
416
concentrations and timing of inoculation (Plazinski and Rolfe 1985; Yahalom et al.
1991). Inoculation of cereals with very high numbers of Azospirillum was found to
slightly inhibit root growth (Okon and Kapulnik 1986; Fallik et al. 1988). Both
positive and negative effects of Azospirillum on nodulation and root development
can be mimicked, in some cases, by application of plant growth regulators such as
auxins and cytokinins (Volpin and Kapulnik 1994).
This implies that the amount of Azospirillum to be used in co-inoculation assays
must be previously determined for every crop and combination with the rhizobia.
This was shown by Burdman et al. (1997) on common bean. Combined inoculation
of potted common bean plants with Rhizobium and Azospirillum significantly
increased both upper and total nodule number and N2 fixation as compared with
inoculation with Rhizobium alone. At an Azospirillum concentration of 108 cfu/mL,
the combined inoculation reduced root and shoot dry weight accumulation in comparison with Rhizobium alone and with uninoculated controls. However, when the
combined inoculation was performed using a lower Azospirillum concentration
(5 106 cfu/mL), positive effects on plant growth were observed, although the
enhancement of nodulation and N2 fixation were not as great as observed at the
higher Azospirillum concentration.
In 1994, Okon and Labandera summarized Azospirillum inoculation experiments
according to countries and research groups. Particular emphasis was given, when
pertinent, to descriptions of inoculum preparation and inoculation techniques, soil
and climatic conditions, experimental layout and, most importantly, yield data
expressed as a percentage increase due to inoculation. Later, there were different
revisions reporting how legumes were co-inoculated with varying results, depending even on legume genomes. Remans et al. (2008b) worked with two genotypes of
common bean, BAT477 and DOR364, and demonstrated contrasting in nodulation
response to A. brasilense Sp245 when co-inoculated with Rhizobium. They observed
that AzospirillumRhizobium co-inoculation as compared to single Rhizobium inoculation increased the amount of fixed nitrogen and the yield of DOR364 across all
sites. For BAT477, on the contrary, a negative effect of AzospirillumRhizobium
co-inoculation on yield and nitrogen fixation was observed on most of the sites as
compared to single Rhizobium inoculation. The contrasting response to Azospirillum
Rhizobium co-inoculation of BAT477 and DOR364 observed for yield and N2 fixation is consistent with the difference in nodulation response observed previously in
controlled greenhouse experiments (Remans et al. 2008a). The field results indicate
that the difference in host responsiveness to Azospirillum between bean genotypes
can have an important impact on agronomic outputs.
Recently, Hungra et al. (2013) evaluated the combined action of azospirilla and
rhizobia inoculants on the yields of soybean and common bean. They demonstrated
that the best in-furrow inoculant dose was 2.5 105 cells of A. brasilense/seed for
both crops. Seed co-inoculation with AzospirillumBradyrhizobium resulted in a
mean yield increase of 420 kg/ha (14.1 %) in soybean relative to the non-inoculated
control. For common bean, seed inoculation with R. tropici increased yield by
98 kg/ha (8.3 %), while co-inoculation with A. brasilense in-furrow resulted in the
impressive increase of 285 kg/ha (19.6 %).
22
417
References
Bashan Y, Harrison K, Whitmoyer R (1990) Enhanced growth of wheat and soybean plants inoculated with Azospirillum brasilense is not necessarily due to general enhancement of mineral
uptake. Appl Environ Microbiol 56:769775
Bashan Y, Holguin G, de-Bashan LE (2004) Azospirillum-plant relationships: physiological,
molecular, agricultural, and environmental advances (19972003). Can J Microbiol 50:
521577
Burdman S, Kigel J, Okon Y (1997) Effects of Azospirillum brasilense on nodulation and growth
of common bean (Phaseolus vulgaris L.). Soil Biol Biochem 29:923929
Burdman S, Jurkevitch E, Schwartsburd B, Hampel M, Okon Y (1998) Aggregation in Azospirillum
brasilense: effects of chemical and physical factors and involvement of extracellular components. Microbiology 144:19891999
Cassan F, Garca de Salomone I (eds) (2008) Azospirillum sp.: cell physiology, plant interactions
and agronomic research in Argentina. Asociacin Argentina de Microbiologa, Buenos Aires,
pp 141151
Dardanelli MS, Fernndez FJ, Espuny MR, Rodrguez MA, Soria ME, Gil Serrano AM, Okon Y,
Megas M (2008) Effect of Azospirillum brasilense coinoculated with Rhizobium on Phaseolus
vulgaris flavonoids and Nod factor production under salt stress. Soil Biol Biochem
40:27132721
Dardanelli MS, Carletti SM, Paulucci NS, Medeot DB, Rodriguez Cceres EA, Vita FA, Bueno
MA, Fumero MV, Garcia MB (2010) Benefits of plant growth promoting rhizobacteria (PGPR)
and rhizobia in agriculture. In: Maheshwari DK (ed) Bacteria and plant health. Springer, Berlin,
pp 120
418
Chapter 23
23.1
Introduction
419
420
(Villegas and Fortin 2002; Azcon et al. 1976), and biocontrol agents (Abdel-Fattah
and Mohamedin 2000; Barea et al. 1998) to enhance plant growth.
The AM fungi might affect negatively (Cavagnaro et al. 2006), positively
(Albertsen et al. 2006), or may have no effect (Olsson et al. 1996) on microbial
biomass and growth of specific microbial taxa (Marschner and Timonen 2006).
Many studies have shown that some bacterial species respond to the presence of
certain AM fungi (Artursson et al. 2006; Andrade 1997), suggesting a high degree
of specificity between bacteria associated with AM fungi. Thus, the specific bacteria together with AM fungi may create more indirect synergism for plant growth
(Barea 1997), including nutrient acquisition (Barea et al. 2002) and enhancement of
root branching (Gamalero et al. 2002). Also, a wide variety of Gram-negative and
Gram-positive bacteria stimulates mycorrhizal association with plant root system,
and they are usually referred to as MHB (Garbaye 1994).
Anchoring of PGPB (Plant Growth-Promoting Bacteria) to AM fungal structures
may have special ecological and biotechnological significance because it may facilitate colonization of new rhizosphere by the bacteria traveling on or moving with
fungal hyphae, and may be an essential trait for the development of mixed inocula
(Bashan et al. 2004).
23.2
AM fungi interact with bacteria directly by providing niche and/or habitat or indirectly by modifying host physiology (Bianciotto et al. 2000; Walley and Germida
1997). Thus, communication between motile bacteria and AM roots in soil can be
beneficial for both the microorganisms (Dutta and Podile 2010).
The microsymbionts have distinct habitats in the rhizosphere, such as the
nodules (for the Rhizobium) and the root interior for the associative diazotrophs
and the AM fungi. Both nitrogen-fixers inhabit the interior of the root systems or
the mycelial network. Functional interrelations must exist between them and
the AM fungi (Bethlenfalvay et al. 1985; Subba Rao 1985; Champawat 1990;
Paula et al. 1992).
Azospirillum strains are routinely isolated from agricultural lands and crop
plants, including traditional isolations from grasses and cereals (Nath et al. 1997;
Weber et al. 1999) from soil, roots, or rhizosphere.
However, Azospirillum strains were isolated from the ectomycorrhizal fungi
ECM (ectomycorrhiza, sporocarps). Several studies have been reported related to
nitrogen-fixing bacteria associated with ectomycorrhizae in conifers such as pine,
Douglas fir, and native trees in Southeast Asia belonging to the genera Azospirillum,
Bacillus, Beijerinckia, and Clostridium mainly (Duponnois and Garbaye 1991;
Orozco-Jaramillo and Martinez-Nieto 2009). Also, PGPR such as Burkholderia,
Azospirillum, Acetobacter, and Herbaspirillum were detected in high numbers on
mantle surfaces of ectomycorrhiza of Fagus sylvatica by confocal laser scanning
421
microscopy (Mogge et al. 2000). Three Azospirillum strains were isolated from the
ectomycorrhizal sporocarps (Rhizopogon vinicolor) that colonized Douglas fir trees
(Chang and Li 1998).
Some specific studies of AzospirillumAM fungi interaction and its effect on the
colonization of both groups of microorganisms have been reported.
Miyauchi et al. (2008) showed that mycorrhizal colonization increased the diazotrophic bacteria colonization in maize roots. The bacteria did not affect root morphological traits and mycorrhizal colonization. This effect suggests a beneficial
action of AM fungi in helping the diazotrophic bacteria to penetrate and colonize
the plant roots (Raimam et al. 2007).
Mutants of Azospirillum brasilense deficient in EPS (exopolysaccharides) were
shown to be strongly impaired in their capacity to attach to AM roots and AM fungal
structures (Bianciotto et al. 2001). Belimov et al. (1999) found that when barley was
inoculated with the AM Glomus intraradices, addition of Azospirillum lipoferum
137 and the phosphate-solubilizing bacteria, Agrobacterium radiobacter and
Flavobacterium sp., did not affect the intensity of development of mycorrhizal
structures in the roots. However, while mycorrhization of the plants was conducive
for better establishment of A. lipoferum 137 in the rhizoplane, it significantly
decreased root colonization of Flavobacterium sp.
However, Bauer et al. (2012) did not find interactions between AM fungi and
N2-fixers in communities or Panicum monocultures, indicating that short-term
effects of these microbial functional groups are additive.
Although some significant studies addressing the impact of Azospirillum inoculation on soil microbial communities were made by the Ribosomal Intergenic
Spacer Analysis (RISA) or Community-Level Physiological Profiles (CLPPs) techniques, studies of AM fungi or AM fungi/PGPR co-inoculation were made with
Denaturing-Gradient Gel Electrophoresis (DGGE) (Trabelsi and Mhamdi 2013;
Roesti et al. 2006).
Often, when the specific strains were fluorescently labeled, in situ identification
of isolates and localization of Azospirillum on roots by confocal laser scanning
microscopy or epifluorescence microscopy is possible (Stoffels et al. 2001).
Microorganisms interactions could be more than just competitive. Bellone and
Carrizo de Bellone (2012) described the process of colonization by Azospirillum
brasilense and Glomus intraradices in sugarcane roots. The presence of bacteria in
the young roots and their subsequent introduction into the xylem and phloem vessels are favored by the cell endodermal disorganization that occurs during the primal radical growth of the future lateral roots. At the sites of maximal root
colonization, the cell wall fungi strongly diminish, what allows better interchanges
of metabolites between bacteria and fungi. In the lumen of xylem vessels, the bacteria colonize at random. The presence of intracellular hyphae increases the colonization of the bacteria that occupy the intercellular spaces generated by the fungi.
Mycorrhizas are the most common vectors of endophytes of plants. The changes
produced in the three symbionts (bacterium, VAM, and plant) facilitate the intimate
interaction between them.
422
23.3
Production of Metabolites
23.4
423
424
425
23.5
Artificial seed and soil inoculation techniques were, therefore, started over 100
years ago; as a simple application of a mixed nodule extracts (Hiltner 1895).
Many types of formulations and techniques for inoculation of soil microorganisms, especially of PGPB have been tested in recent years (Bashan et al. 2014).
Dodd and Ruiz-Lozano (2012) suggested that combining different classes of soil
organisms within one inoculant can take advantage of multiple plant growth mechanisms of such an inoculant to enhance crop productivity. One of the main limitations
so far has been the absence of a single polymicrobial inoculant formulation that
426
would promote the growth of a range of crops including legumes, cereals, and vegetable crops (Reddy and Saravanan 2013).
PGPR strains that are often used (singly or in mixture) include species of genera
Bacillus, Pseudomonas, Azospirillum, Azotobacter, Trichoderma, and Glomus
(AM) (Reddy and Saravanan 2013).
Often, precultures from Mycorrhizal fungi and PGPR have been performed, separately for each microorganism, previous to the co-inoculations.
Producing ECM fungi is relatively easy and can be produced by fermentation
using suitable media; for PGPR + ECM co-inoculations, were often used specific
methods of ECM (spore or mycelium) added to PGPR inoculation techniques
(Duponnois and Garbaye 1991); in previous studies (Dominguez et al. 2012) coinoculations of PGPR P. fluorescens and black truffle (Tuber melanosporum) inocula were performed by simple spore suspensions and P. fluorescens cultures.
One of the most common methods of inoculation of AM fungi combined with
Azospirillum inoculums has been the incorporation of grasses soils, colonized roots
fragments, hyphae or spores to the new substrate, or into the seed irrigations.
An example is the study by Bauer et al. (2012); authors test the effects of AM
fungi and N2-fixers (rhizobia and Azospirillum) on the productivity, diversity, and
species abundances of nutrient-poor grassland microcosms; the AM fungi treatment
consisted of a mixture of fungal cultures isolated from prairie soils and cultured
with Sorghum bicolor, and included various arbuscular mycorrhizal fungi. The soil
and coarsely chopped roots from these cultures were used as inocula for this experiment. The N2-fixer treatment included cysts of wild-type Azospirillum brasilense,
suspended in KPO4 buffer (107 cfu mL1) and rhizobia as cultures attached to granular peat (1 108 rhizobia g1).
Other example: In Bellone et al. (2012), sugarcane plants were inoculated with a
combination of 1 mL of an Azospirillum brasilense culture (1.5 107 cfu) and 1 mL
of spore suspension of Glomus intraradices (100 spores mL1).
In 2011, Bashan et al. developed two new culture media for mass cultivation of
the commonly used plant growth-promoting bacterium Azospirillum sp.; based on
substitution of glucose in tryptoneyeast extractglucose medium by Na-gluconate
or glycerol.
Separation of the AM fungi and the other usual rhizosphere components (mainly
bacteria and other micromycetes) is possible using a sterilization and re-inoculation
procedure (Bir et al. 2000). In the microbial treatments, a microbial wash is often
included in uninoculated treatments to control for other microorganisms introduced
in the AM fungi cultures, but Bauer et al. (2012) did not include this background
wash to reduce the potential for contamination with N2-fixing bacteria. A metaanalysis of AM fungi studies found that the absence of this microbial wash provides
a conservative test of the benefits of AM fungi and recommends this approach for
factorial manipulation of AM fungi and rhizobia (Hoeksema et al. 2010).
Until now, a few studies have been performed with polymicrobial inoculums
including both groups Azospirillum and Mycorrhizal fungi at the same time.
A granular clay inoculant containing AM fungus (Glomus fasciculatum),
Azospirillum, and phosphate-solubilizing bacteria (PSB) for easy application in
nurseries had a shelf life of up to 60 day (Lilly and Santhanakrishnan 1999).
427
References
Abdel-Fattah GM, Mohamedin AH (2000) Interactions between a vesicular arbuscular mycorrhizal fungus. (Glomus intraradices) and Streptomyces coelicolor and their effects on sorghum
plants grown in soil amended with chitin of brawn scales. Biol Fertil Soils 32:401409
Akiyama K, Hayashi H (2006) Plant and fungal signalling molecules in the arbuscular mycorrhizal
symbiosis. Tanpakushitsu Kakusan Koso 51:10241029
Albertsen A, Ravnskov S, Green H, Jensen DF, Larsen J (2006) Interactions between the external
mycelium of the mycorrhizal fungus Glomus intraradices and other soil microorganisms as
affected by organic matter. Soil Biol Biochem 38(5):10081014
Aliasgharzad N, Reza M, Neyshabouri Salimi G (2006) Effects of arbuscular mycorrhizal fungi
and Bradyrhizobium japonicum on drought stress of soybean. Biologia 19:324328
428
Andrade G, Mihara KL, Linderman RG, Bethlenfalvay GL (1997) Bacteria from rhizosphere and
hyphosphere soils of different arbuscular-mycorrhizal fungi. Plant Soil 192(1):7179
Andre S, Galiana A, Le Roux C, Prin Y, Neyra M, Duponnois R (2005) Ectomycorrhizal symbiosis
enhanced the efficiency of inoculation with two Bradyrhizobium strains and Acacia holosericea growth. Mycorrhiza 15:357364
Arora N, Khare E, Maheshwari D (2011) Plant growth promoting rhizobacteria: constraints in
bioformulation, commercialization, and future strategies. In: Maheshwari DK (ed) Plant
growth and health promoting bacteria, vol 18. Springer, Berlin, pp 97116
Artursson V, Finlay RD, Jansson JK (2006) Interactions between arbuscular mycorrhizal fungi and
bacteria and their potential for stimulating plant growth. Environ Microbiol 8:110
Avis TJ, Gravel V, Autoun H, Tweddel RJ (2008) Multifaceted beneficial effects of rhizosphere
microorganisms on plant health and productivity. Soil Biol Biochem 40:17331740
Azcon R, Barea JM, Hayman DS (1976) Utilization of rock phosphate in alkaline soil by plants
inoculated with mycorrhizal fungi and phosphate solubilizing bacteria. Soil Biol Biochem
81:135138
Azcon C (2009) Mycorrhizas functional processes and ecological impact. Berlin: Springer
Azcn-Aguilar C, Barea JM, Gianinazzi S, Gianinazzi-Pearson V (eds) (2009) Mycorrhizas functional processes and ecological impact. Springer, Berlin
Babu RS, Sankaranarayanan C, Jothi G (1998) Management of Pratylenchuszeae on maize by
biofertilizers and VAM. Indian J Nematol 28:7780
Barea JM (1997) Mycorrhiza-bacteria interactions on plant growth promotion. In: Ogoshi A,
Kobayashi L, Homma Y, Kodama F, Kondon N, Akino S (eds) Plant growth promoting rhizobacteria. OECD Press, Paris, pp 150158
Barea JM, Azcon-Aguilar C (1983) Mycorrhizas and their significance in nodulating nitrogenfixing plants. In: Brady NC (ed) Advances in agronomy. Academic, New York, pp 154
Barea JM, Bonis AF, Olivares J (1983) Interactions between Azospirillum and VA mycorrhiza and
their effects on growth and nutrition of maize and ryegrass. Soil Biol Biochem 15:705709
Barea JM, Rade G, Bianciotto V, Dowling D, Lohrke S, Bonfante P, OGara F, Azcon-Aguilar C
(1998) Impact on arbuscular mycorrhiza formation of Pseudomonas strains used as inoculants
for biocontrol of soil borne fungal plant pathogens. Appl Environ Microbiol 64:23042307
Barea JM, Azcn R, Azcn-Aguilar C (2002) Mycorrhizosphere interactions to improve plant fitness and soil quality. Antonie Van Leeuwenhoek 81(14):343351
Barea JM, Azcn R, Azcn-Aguilar C (2005) Interactions between mycorrhizal fungi and bacteria
to improve plant nutrient cycling and soil structure. In: Varma A, Buscot F (eds) Microorganisms
in soils: roles in genesis and functions, vol 3. Springer, Berlin, pp 195212
Bashan Y, Holguin G (1997a) Azospirillum-plant relationships: environmental and physiological
advances (19901996). Can J Microbiol 43:103121
Bashan Y, Holguin G (1997b) Short- and medium term avenues for Azospirillum inoculation. In:
Ogoshi A, Kobayashi K, Homma Y, Kodama F, Kondo N, Akino S (eds) Plant growthpromoting rhizobacteriapresent status and future prospects. Faculty of Agriculture, Hokkaido
University, Sapporo, Japan, pp 130149
Bashan Y, Holguin G, de-Bashan LE (2004) Azospirillum-plant relationships: physiological, molecular, agricultural, and environmental advances (19972003). Can J Microbiol 50:521577
Bashan Y, Trejo A, de-Bashan LE (2011) Development of two culture media for mass cultivation
of Azospirillum spp. and for production of inoculants to enhance plant growth. Biol Fertil Soils
47:963969
Bashan Y, de-Bashan LE, Prabhu SR, Hernandez JP (2014) Advances in plant growth-promoting
bacterial inoculant technology: formulations and practical perspectives. Plant Soil 378:133
Bauer JT, Kleczewski NM, Bever JD, Clay K, Reynolds HL (2012) Nitrogen-fixing bacteria,
arbuscular mycorrhizal fungi, and the productivity and structure of prairie grassland
communities. Oecologia 170:10891098
Belimov AA, Serebrennikova NV, Stepanok VV (1999) Interaction of associative bacteria and an
endomycorrhizal fungus with barley upon dual inoculation. Microbiology 68:104108
429
Bellone C, Carrizo de Bellone S (2012) Interaction of Azospirillum brasilense and Glomus intrarradix in sugar cane roots. Indian J Microbiol 52(1):7075
Bethlenfalvay GJ, Schepp H (1994) Arbuscular mycorrhizas and agrosystem stability. In:
Gianinazzi S, Schepp H (eds) Impact of arbuscular mycorrhizas on sustainable agriculture
and natural ecosystems. Birkhauser, Berlin, pp 117131
Bethlenfalvay GJ, Brown MS, Stafford AE (1985) GlycineGlomusRhizobium symbiosis.
II. Antagonistic effects between mycorrhizal colonization and nodulation. Plant Physiol
79:10541058
Bianciotto V, Lumini E, Lanfranco L, Minerdi D, Bonfante P, Perotto S (2000) Detection and
identification of bacterial endosymbionts in arbuscular mycorrhizal fungi belonging to the family Gigasporaceae. Appl Environ Microbiol 66:45034509
Bianciotto V, Andreotti S, Balestrini R, Bonfante P, Perotto S (2001) Extracellular polysaccharides
are involved in the attachment of Azospirillum brasilense and Rhizobium leguminosarum to
arbuscular mycorrhizal structures. Eur J Histochem 45:3949
Bir B, Kves-Pchy K, Szili-Kovcs T, Szegi J (1993) Effect of fertilizer on spontaneous
Rhizobium infection in Hungarian soils. In: Szabolcs I (ed) Soil resilience and sustainable land
use. Agrokem Talajtan 42:207212
Bir B, Kves-Pchy K, Vrs I, Takcs T, Eggenberger P, Strasser RJ (2000) Interrelations between
Azospirillum and Rhizobium nitrogen-fixers and arbuscular mycorrhizal fungi in the rhizosphere
of alfalfa in sterile, AMF-free or normal soil conditions. Appl Soil Ecol 15:159168
Boddey RM, Urquiaga S, Reis V, Dbereiner J (1991) Biological nitrogen fixation associated with
sugar cane. Plant Soil 137:111117
Brown ME, Carr GR (1984) Interaction between Azotobacter chroococcum and vesiculararbuscular mycorrhiza and their elects on plant growth. J Appl Bacteriol 56:429437
Casanovas EM, Barassi CA, Sueldo RJ (2002) Azospirillum inoculation mitigates water stress
effects in maize seedlings. Cereal Res Commun 30:343350
Cavagnaro TR, Jackson LE, Six J et al (2006) Arbuscular mycorrhizas, microbial communities, nutrient availability, and soil aggregates in organic tomato production. Plant Soil 282(12):209225
Champawat RS (1990) Response of chickpea (Cicerarietinum) to Rhizobium and vesicular arbuscular mycorrhiza dual inoculation. Acta Microbiol Pol 39:163169
Chang TT, Li CY (1998) Weathering of limestone, marble, and calcium phosphate by ectomycorrhizal fungal and associated microorganisms. Taiwan J For Sci 13:8590
Creus CM, Graziano M, Casanovas EM, Pereyra MA, Simontacchi M, Puntarulo S (2005) Nitric
oxide is involved in the Azospirillum brasilense-induced lateral root formation in tomato.
Planta 221:297303
Dahm H, Strzelczyk E, Ciesielska A, Redlak K (1998) The effect of ectomycorrhizal fungi and
bacteria on pine seedlings. Acta Mycol 33:2536
Dodd IC, Ruiz-Lozano JM (2012) Microbial enhancement of crop resource use efficiency. Curr
Opin Biotechnol 23:236242
Dominguez-Nuez JA, Martin A, Anriquez A, Albanesi A (2012) The combined effects of
Pseudomonas fluorescens and Tuber melanosporum on the quality of Pinus halepensis seedlings. Mycorrhiza 22(6):429436
Duponnois R, Garbaye J (1991) Effect of dual inoculation of Douglas fir with ectomycorrhizal
fungus Laccaria laccata and mycorrhization helper bacteria (MHB) in two bare root forest
nurseries. Plant Soil 138:169176
Dutta S, Podile AR (2010) Plant growth promoting rhizobacteria (PGPR): the bugs to debug the
root zone. Crit Rev Microbiol 36(3):232244
Finlay RD (2008) Ecological aspects of mycorrhizal symbiosis: with special emphasis on the
functional diversity of interactions involving the extrarradical mycelium. J Exp Bot 59:
11151126
Gamalero E, Martinotti MG, Trotta A, Lemanceau P, Berta G (2002) Morphogenetic modifications
induced by Pseudomonas fluorescens A6RI and Glomus mosseae BEG12 in the root system of
tomato differ according to plant growth conditions. New Phytol 155(2):293300
430
Gamalero E, Trotta A, Massa N, Copetta A, Martinotti MG, Berta G (2004) Impact of two fluorescent Pseudomonads and an arbuscular mycorrhizal fungus on tomato plant growth, root architecture and P acquisition. Mycorrhiza 14:185192
Garbaye J (1994) Helper bacteria: a new dimension to the mycorrhizal symbiosis. New Phytol
128:197210
German MA, Burdman S, Okon Y, Kigel J (2000) Effects of Azospirillum brasilense on root morphology of common bean (Phaseolus vulgaris L.) under different water regimes. Biol Fertil
Soils 32:259264
Gravel V, Antoun H, Tweddell RJ (2007) Growth stimulation and growth yield improvement of
greenhouse tomato plants by inoculation with Pseudomonas putida and Trichoderma atraviride: possible role of indole acetic acid (IAA). Soil Biol Biochem 39:19681977
Hata S, Kobae Y, Banba M (2010) Interactions between plants and arbuscular mycorrhizal fungi.
In: Kwang WJ (ed) International review of cell and molecular biology, vol 281. Academic,
Burlington, pp 148
Hayat R, Ali S, Amara U, Khalid R, Ahmed I (2010) Soil beneficial bacteria and their role in plant
growth promotion: a review. Ann Microbiol 60:579598
Hiltner A (1895) Zurfrage der stickstoffernahrung in Pflanzen. Landw Vers Stat 51:9297
Hoeksema JD, Chaudhary VB, Gehring CA, Johnson NC, Karst J, Koide RT, Pringle A, Zabinski
C, Bever JD, Moore JC, Wilson GWT, Klironomos JN, Umbanhowar J (2010) A meta-analysis
of context-dependency in plant response to inoculation with mycorrhizal fungi. Ecol Lett
13:394407
Jeffries P, Dodd CJ (1991) The use of mycorrhizal inoculants in forestry and agriculture. In: Arora
DK, Rai B, Mukerji KG, Knudsen GR (eds) Handbook of applied mycology, vol 1, Soil and
plants. Marcel Dekker, New York, pp 77129
Joe MM, Jaleel CA, Sivakumar PK, Zhao CX, Karthikeyan B (2009) Co-aggregation in
Azospirillum brasilense MTCC-125 with other PGPR strains: effect of physical and chemical
factors and stress endurance ability. J Taiwan Inst Chem Eng 40:491499
Juge C, Prvost D, Bertrand A, Bipfubusa M, Chalifourb F-P (2012) Growth and biochemical
responses of soybean to double and triple microbial associations with Bradyrhizobium,
Azospirillum and arbuscular mycorrhizae. Appl Soil Ecol 61:147157
Kavitha K, Meenakumari KS, Sivaprasad P (2003) Effect of dual inoculation of native arbuscular
mycorrhizal fungi and Azospirillum on suppression of damping off in chilli. Indian Phytopathol
56:112113
Khalid A, Arshad M, Shaharoona B, Mahmood T (2009) Plant growth-promoting rhizobacteria
and sustainable agriculture. In: Khan MS, Zaidi A, Musarrat J (eds) Microbial strategies for
crop improvement. Springer, Berlin, pp 133160
Kosuta S (2003) Diffusible factor from arbuscular mycorrhizal fungi induces symbiosis-specific
expression in roots of Medicago truncatula. Plant Physiol 131:952962
Li B, Ravnskov S, Xie G, Larsen J (2007) Biocontrol of Pythium damping-off in cucumber by
arbuscular mycorrhiza-associated bacteria from the genus Paenibacillus. Bio Control
52(6):863875
Lilly SS, Santhanakrishnan P (1999) Granulation of VA mycorrhizal inoculum. Madras Agric J
86:256259
Malusa E, Sas-Paszt L, Ciesielska J (2012) Technologies for beneficial microorganisms inocula
used as biofertilizers. Scientific World Journal. doi:10.1100/2012/491206
Marschner P, Timonen S (2006) Bacterial community composition and activity in rhizosphere of
roots colonized by arbuscular mycorrhizal fungi. In: Mukerji KG, Manoharachary C, Singh J
(eds) Microbial activity in the rhizosphere. Springer, Berlin, pp 139154
Miyauchi MYH, Lima DS, Nogueira MA, Lovato GM, Murate LS, Cruz MF, Ferreira JM, Zangaro
W, Andrade G (2008) Interactions between diazotrophic bacteria and mycorrhizal fungus in
maize genotypes. Sci Agric 65(5):525531
Mogge B, Loferer C, Agerer R, Hutzler P, Hartmann A (2000) Bacterial community structure
and colonization patterns of Fagus sylvatica L. ectomycorrhizospheres as determined by fluorescence in situ hybridization and confocal laser scanning microscopy. Mycorrhiza 9:
271279
431
432
St-Arnaud M, Vujanovic V (2007) Effect of the arbuscular mycorrhizal symbiosis on plant diseases and pests. In: Hamel C, Plenchette C (eds) Arbuscular mycorrhizae in crop production.
Haworths Food Products Press, New York, pp 67122
Stoffels M, Castellanos T, Hartmann A (2001) Design and application of new 16S rRNA-targeted
oligonucleotide probes for the Azospirillum-Skermanella-Rhodocista-cluster. Syst Appl
Microbiol 24:8397
Subba Rao NS (1985) Effect of combined inoculation of Azospirillum brasilense and vesicular
arbuscular mycorrhiza on pearl millet (Pennisetum americanum). Plant Soil 81:283286
Toro M, Azcon R, Barea JM (1997) Improvement of arbuscular mycorrhiza development by inoculation of soil with phosphate solubilizing rhizobacteria to improve rock phosphate bioavailability (32P) and nutrient cycling. Appl Environ Microbiol 63:44084412
Trabelsi D, Mhamdi R (2013) Microbial inoculants and their impact on soil microbial communities: a review. Biomed Res Int. doi:10.1155/2013/863240
Tsimilli-Michael M, Eggenberg P, Biro B, Koves-Pechy K, Voros I, Strasser RJ (2000) Synergistic
and antagonistic effects of arbuscular mycorrhizal fungi and Azospirillum and Rhizobium
nitrogen-fixers on the photosynthetic activity of alfalfa, probed by the polyphasic chlorophyll
a fluorescence transient O-J-I-P. Appl Soil Ecol 15:169182
Ude S, Arnold DL, Moon CD, Timms-Wilson T, Spiers AJ (2006) Biofilm formation and cellulose
expression among diverse environmental Pseudomonas isolates. Environ Microbiol 8:19972011
Vassilev N, Vassileva M, Azcon R, Medina A (2001) Application of free and Ca-alginate-entrapped
Glomus deserticola and Yarowia lipolytica in a soil-plant system. J Biotechnol 91:237242
Vzquez MM, Csar S, Azcn R, Barea JM (2000) Interactions between arbuscularmycorrhizal
fungi and other microbial inoculants (Azospirillum, Pseudomonas, Trichoderma) and their
effects on microbial population and enzyme activities in the rhizosphere of maize plants. Appl
Soil Ecol 15:261272
Vestberg M, Kukkonen S, Saari K, Parikka P, Huttunen J, Tainio L et al (2004) Microbial inoculation
for improving the growth and health of micropropagated strawberry. Appl Soil Ecol 27:243258
Villegas J, Fortin JA (2002) Phosphorus solubilization and pH changes as a result of the interactions between soil bacteria and arbuscular mycorrhizal fungi on a medium containing NO3 as
nitrogen source. Can J Bot 80:571576
Walley FL, Germida JJ (1997) Response of spring wheat (Triticum aestivum) to interactions
between Pseudomonas species and Glomus clarum NT4. Biol Fertil Soils 24:365371
Weber OB, Baldani VLD, Teixeira KRS, Kirchhof G, Baldani JI, Dbereiner J (1999) Isolation
and characterization of diazotrophic bacteria from banana and pineapple plants. Plant Soil
210:103113
Part IV
Chapter 24
M. Daz-Zorita (*)
Monsanto Bioag, Calle 10 753, Parque Industrial Pilar (1629), Pilar, Buenos Aires, Argentina
e-mail: [email protected]
M.V.F. Canigia
Private activity consultant, CABA, Buenos Aires, Argentina
e-mail: [email protected]
O.. Bravo
Agronomy Department, Universidad Nacional del Sur, Baha Blanca, Argentina
e-mail: [email protected]
A. Berger
Cultivar Conocimiento Agropecuario S.A., Ciudad de Buenos Aires, Argentina
e-mail: [email protected]
E.H. Satorre
CONICET, Buenos Aires, Argentina
Cultivar Conocimiento Agropecuario S.A., Ciudad de Buenos Aires, Argentina
Agronomy Faculty, Universidad de Buenos Aires, Buenos Aires, Argentina
e-mail: [email protected]
Springer International Publishing Switzerland 2015
F.D. Cassn et al. (eds.), Handbook for Azospirillum,
DOI 10.1007/978-3-319-06542-7_24
435
436
M. Daz-Zorita et al.
the semiarid pampas (Argentina), the range can vary between 60 in seasons with
normal rainfall patterns and almost 200 cases in dry seasons. The analysis of distribution response values is a more realistic approach to measure the crop performance to inoculation under the interaction of complex random factors and provides
also a probabilistic answer to stakeholders. For example, based on the distribution
of maize (Zea mays L.) responses to Azospirillum sp. from 316 cases located in the
pampas region of Argentina it was observed that in more than 81.1 % of the cases
the incremental revenue of the practice exceeded its cost and it could be included as
a crop management practice under the current production conditions.
24.1
Introduction
The diverse single modes of actions to enhance plant growth and crop production in
the presence of Azospirillum sp. has been widely studied also under diverse experiences setups. In general, the modes of action that partially explain crop growth and
yield responses to the inoculation with Azospirillum sp. are both direct and derivate
effects enhancing the nutritional status of the plants and mitigating other abiotic
stresses. Abundant studies show that Azospirillum sp. has the capability, within
other attributes, for fixing nitrogen from the air, delivering hormones and enzymes
to the rhizosphere that can enhance root growth and promote also the growth of
other microbes (Bayan and Levanony 1990; Okon and Labandera-Gonzalez 1994;
Dobbelare et al. 2003). Most of the studies that describe several of its modes of
action have been performed within pots under controlled conditions in greenhouses
(Van Dommelen et al. 2009; Rodrigues et al. 2008) with limitations for the extrapolation to regular crop conditions.
Field trials analyzing the contribution of the inoculation with Azospirillum sp. on
extensive crops under regular crop production conditions are less abundant.
Furthermore, the interpretations of their results are variable and not always conclusive. This could be partially explained because of the complexity in the design of the
field studies in response to the diverse mode of interaction of Azospirillum sp. and
plants under multiplicity in abiotic stress conditions to be mitigated in the presence
of the microorganism. The objective of this contribution is to briefly describe several field and data analysis procedures for the evaluation of crop production
responses to the inoculation with Azospirillum sp.
24.2
We reviewed 47 articles worldwide published during the last decade showing grain
crop production in response to the application of diverse Azospirillum sp. inoculants
in 12 countries, collecting 347 cases. Most of the studies were performed in cereals
crops (86.7 %), mainly rainfed maize (Zea mays L.) and they were located in Latin
America, mostly Brazil, and Asia. Approximately, among all the reported crops,
24
437
10 % was the mean grain response to the inoculation with Azospirillum sp. A greater
response was observed in winter cereals (14.0 %) [i.e., wheat (Triticum aestivum
L.), barley (Hordeum vulgare L.)] than in summer cereals (9.5 %) [maize, sorghum
(Sorghum bicolor L.), rice (Oryza sativa L.)] or legumes (6.6 %) [beans (Phaseolus
vulgaris), soybean (Glycine max (L.) Merrill)].
The frequent procedure for the introduction of the Azospirillum sp. in field crops
is treating the seeds or applying it directly in the sowing furrow with diverse inoculant formulations containing the microorganism. Transplanting seedlings soaked in
a solution containing Azospirillum sp. was also described in the bibliography to
deliver it to the rhizosphere for example of rice crops (Govindarajan et al. 2008;
Islam et al. 2012; Khalid et al. 2011). But, because this procedure is not practical
and has limited application for extensive production we did not described it in this
article. The foliar application of Azospirillum sp. was also described in several of
the reviewed studies, but with controversial results and not clear recommendations
about the moment of application relative to the crop development stage or the environmental conditions for its adequate use (El Habbasha et al. 2013).
The seed treatment with formulations containing Azospirillum sp. is preferred to
be done without the application in slurry with other products (i.e., micronutrients,
fungicides, insecticides, polymers). This is mainly for avoiding potential interactions with the active ingredients as well as with other components of the formulations (i.e., colorants, dispersants, stabilizers). Few studies describe the application
of formulations containing Azospirillum sp. in the planting furrow during sowing
(Hungria et al. 2013). It is a recommended option for reducing the risk of low compatibility treatments applied with the seeds that can reduce the survival of the
microbes. In the case of in-furrow treatments, the inoculants were diluted in waterfree chlorides in a pH range between 6.0 and 8.0 and were applied at a rate and work
pressure that allowed for the delivery of large drops in almost a continues stream
below the seedbed (i.e., 3040 L ha1, 1.02.0 bar and perforated discs as nozzles).
However, several formulations containing Azospirillum sp. have been developed
for allowing its application on the seeds long term before sowing (Daz-Zorita et al.
2012), most of the studies described that the inoculated seeds were in the ground
within less than 6 h after the application of the biological treatment. Independently
of the moment of application of the treatments, it is critical to avoid excessive
manipulation of the treated seeds because it can damage the Azospirillum sp. cells
when exposed to desiccation, high temperatures, ultraviolet light, or toxic compounds. Also, the sowing should be done in a moist seedbed avoiding leaving the
seeds exposed to desiccation or direct sun light.
Similar to other inoculation studies, large plots with more than 10 m long are commonly used performing all crop measurements in the central part of them and discharging the borders. This helps to diminish the risk of contamination between
treatments as well as for the reduction in the manipulation of the treated seeds because
of the use of large seed amounts for sowing. To reduce the potential contamination
among different biological seed treatments during the sowing operation, it is recommended the cleaning of the machinery after changing the treatments to be planted as
well as to initiate the sowing with the control treatment without inoculation.
438
M. Daz-Zorita et al.
Crop management practices that modify the growth of the crops in the presence
of abiotic stresses (i.e., nutrient deficiencies, water stress) also affect the performance of the crops treated with Azospirillum sp. Thus, it is critical to define crop
management practices like irrigation, fertilization, and planting dates and other production conditions (i.e., soil type) in agreement with the objectives of the study. In
general, for the quantification of the integral crop performance to Azospirillum sp.
inoculation, the crop management should reproduce regular production practices
avoiding excessive nutrient availability or irrigation practices that limit the possible
occurrence of moderate abiotic stresses to be mitigated for the inoculated Azospirillum
sp. Both, under strong stressful growing conditions (i.e., severe droughts, major
nutrients limitations) or in the absence of growth limitations the responses to the
biological seed treatment are barely observed (Lana et al. 2012; Mehnaz et al. 2010;
Naiman et al. 2009; Naseri et al. 2013). In general, the studied cases were fertilized
to rich the crops requirements, mainly NPK, for normal production and only in few
situations the crops performed under limited nutrient availability conditions.
The frequent experimental design of these field studies for single locations during few production seasons or few locations during a single season was mostly
described in randomized replicated complete blocks. This experimental design has
limitations for the analysis of the results and for the interpretation of the contribution of Azospirillum sp. to crop production because of the occurrence of random
temporal and spatial interactions. Few studies were performed under abundant locations and growing seasons for the contribution of the biological treatment over a
range of environmental conditions and regular production practices showing variable results on fixed (i.e., soil type) or random (i.e., production seasons) factors
(Daz-Zorita and Fernndez-Canigia 2009). This is the reason why in the following
sections of this chapter we will briefly describe two approaches for the interpretation of the crops grain yield responses to the presence of Azospirillum sp. taking into
account both the spatial (i.e., soil type, crop management practices) and temporal
(i.e., production season) variability.
24.3
For the quantification of the contribution of wheat seeds inoculation with a formulation containing Azospirillum brasilense strain INTA Az39 a field trial was performed during three-consecutive growing seasons in a 50 ha production field located
in Bahia Blanca (Buenos Aires Province, Argentina) within the semiarid pampas
region. The field lies in a rolling landscape located in the upper valley of the
Saladillo Dulce creek containing complex slight to moderate slopes and soils classified as Entic Haplustolls, saline to sodic saline Entic Haplustolls, moderately deep
Petrocalcic Paleustols, and shallow and deep Petrocalcic Calciustolls (Soil Survey
Staff 1999) always with loam to sandy loam textures in the upper profiles. All the
seasons, the wheat crops were managed applying best practices recommended for
24
439
high attainable grain production in the semiarid region [i.e., zero tillage practices
with chemical weed control, sowing dates during late June and fertilized with
40 kg ha1 of diammonium phosphate (18:46:0)]. The two treatments (control without inoculation and treated seeds with Azospirillum brasilense) were yearly placed
in paired strips of 8 ha across the described soil types. The shoot dry matter and
grain yield measurements were yearly performed in 15 geopositioned sites and then
classified into four predominant soil types in pairs of inoculated and control treatments. Descriptive statistics (mean and dispersion parameters) for each of the treatments among spatial (soil type) and temporal (growing seasons) and analysis of
variance (ANOVA) based on a factorial split plot design with seasons and the biological seed treatments as main factors and the soil types as split factor were performed. Only the data of shoot dry matter was transformed for the homogenization
of the variances (Di Rienzo et al. 2013).
The wheat crops inoculated with Azospirillum brasilense, under the studied conditions and averaged among soil types and growing seasons, were observed in 74 %
of the sites and trend to show 15 % more shoot dry matter and 17 % grain yield than
the control without inoculation (Table 24.1). From the ANOVA, significant effects
of the seasons (P < 0.01) and the biological seed treatments (P < 0.05) on the grain
yields were described with no significant interactions between them (P < 0.21). The
available information was not enough to describe differences among the soil types
(P < 0.28). Sixty-five percent (P < 0.01) of the wheat grain yield variability was
attributed to differences in yearly weather conditions explained mainly for the
amount and the distribution of the rainfalls during the growing conditions. The
inoculation with Azospirillum brasilense explained 4 % (P < 0.05) of the variability
in grain yields, the soil types only 1 % (P > 0.50), and the remaining 30 % was allocated in the interaction among the studied factors and the experimental error. The
greatest response to inoculation, in each of the seasons, was observed in the sites
with the highest soil productivity indices corresponding mostly to deep Entic
Haplustolls. But, the absence of significant differences between biological treatments within each soil type was attributed to the limited quantity of samples.
The available information from this study showed different deviations of the
means among seasons (Table 24.2). Thus, that the sample size for describing differences between the biological treatments with a 95 % of confidence also varied among
seasons. For example, in seasons with regular growing conditions 6075 samples
Table 24.1 Shoot dry matter and grain production of wheat crops grown in a field during three
seasons from the semiarid pampas inoculated with Azospirillum brasilense
Mean
SD
Min.
Max.
Treatment
Mg ha1
CV (%)
Control without inoculation
5.8a
2.7
2.5
14.2
46.6
3.1
2.5
13.6
46.9
Inoculated
6.7b
0.5
0.5
2.8
39.0
Grain yield
Control without inoculation
1.2a
Inoculated
1.4b
0.5
0.6
2.6
36.0
SD standard deviation, CV coefficient of variation. In each variable, mean values with different
letters show least significant differences (P < 0.05)
Variable
Shoot dry
matter
440
M. Daz-Zorita et al.
Table 24.2 Maize distribution parameters of control and Azospirillum brasilense inoculated
maize crops in a database from 316 field experiments performed in Argentina
Treatment
Control
Inoculated
Percentile
0
5
25
50
75
Grain yield (kg ha1)
2,020 4,563 7,169 8,792 10,545
2,394 5,092 7,583 9,196 11,015
Relative yield increase to inoculation (%)
43
8
1
4
9
95
100
Mean
SD
12,855
13,095
15,924
18,654
8,794
9,237
2,512
2,562
24
66
11
SD Standard deviation
were needed to describe differences between the means while in the driest and low
yielding season more than 200 samples should be required. This large number of
observations needed for describing significant differences between the treatments
could be diminished limiting the location of samples to spatially homogeneous sites.
24.4
Experimental data are particularly valuable if they are used to support management
decisions. In the previous sections of this chapter, it was shown that Azospirillum sp.
inoculation is expected to increase crop yields. However, response to Azospirillum
sp. cannot be predicted with certainty since it is a random variable partially because
of its diverse modes of actions mitigation also multiple abiotic stresses during crop
growth. In fact, negative, neutral, and positive responses to inoculations with
Azospirillum sp. were found in any crop species (Araujo et al. 2013; Hungria et al.
2013; Piccinin et al. 2011; Turan and Fikrettin 2013). So, how can the experimental
information be used to take decisions? To choose some experiments according to
predefined criteria (i.e., soil type or growing season) could be a way and has been
discussed in the previous section. But, incorporating particular criteria to select
information could be misleading, particularly if it is done by inexperienced persons.
In this section, we are analyzing an alternative way to look and explore experimental data to evaluate the convenience of crop inoculations. For this purpose, we used
results from 316 field experiments where the grain yields of maize crops under
control without inoculation and inoculated with Azospirillum brasilense strain
INTAAz39 treatments were measured in Argentina. The data were obtained in various locations of the pampas region under regular production practices (i.e., NP fertilization, rotated land, mostly uner zero tillage practices) and during 12 consecutive
growing seasons (M. Daz-Zorita, unpublished data). Because, an ANOVA analysis
of the treatment response showed no significant (P = 0.05) differences among them,
the whole database (316 data set) was used.
24
441
Crop management decisions are usually evaluated on the basis of the difference
between incremental revenue and incremental costs. If the incremental revenue is
higher than the incremental cost, there appears to be an advantage in the technology. In
this case, incremental revenue is provided by yield response (yield increment provided
by the technology) multiplied by net price (gross price discounted all marketing
expenses). As both yield response and price are random variables, incremental income
turns out to be a random variable itself. As such, it cannot be described by a static
value. Instead, it needs to be described by a distribution function. Using empirical data,
the probability distribution of maize yield in the control and inoculated treatments
may be described by various percentile values in the range from 0 to 100 (Table 24.2).
Moreover, maize yields may be compared statistically in various percentile ranges
(Table 24.3). In the database used, the treatments were compared in a wide range of
conditions, from crops yielding as low as 2,020 kg ha1 to as high as 18,654 kg ha1
(Table 24.2). Although percentile values differed along the whole distribution,
only mean yields of the treatments distribution in the range from 5 to 95 % were significant (Table 24.3). The probability to find differences in both extremes of the data
distribution was low; however, in the central 90 % of the distribution, in crops yielding
between 6,000 and 12,000 kg ha1, crops inoculated with Azospirillum brasilense had
a consistent higher probability of greater yields than control crops (Table 24.3).
Potent tools may be used to extend and analyze the data described. One of this,
Monte Carlo simulation, is a technique that allows estimating the probability distribution of an outcome that depends on random variables. Even though it was originally
developed with other purposes (i.e., operations research field), it has been widely
applied to crop decision analysis under uncertainty (Clow and Flaskerud 2001;
Ferreyra et al. 2001; Berger and Pena 2013). In order to use Monte Carlo simulation,
probability distributions need to be defined for any random variable involved. From
the experimental data of maize yield responses to Azospirillum brasilense inoculation
in Argentina, a general probability distribution was built showing a range from 43 to
66 % and less than 20 % change of negative responses (Table 24.2). But, as crop
response data are not normally distributed, other probability distributions that are
Table 24.3 Mean values of percentile ranges in the empirical distribution of maize grain yields
from control and Azospirillum brasilense inoculated crops in a database from 316 field experiments
performed in Argentina
Treatment
Control
Inoculated
P
n
SE
7595
95100
11,541
11,948
<0.001
64
82
13,838
14,448
ns
16
316
P statistical significance, n number of sites considered in each range, SE standard errors of the
means, ns nonsignificant differences between means
442
M. Daz-Zorita et al.
frequently employed, betapert and cumulative, were also tested. The betapert distribution is simple to use in a variety of situations, both when counting with observed
data and when working with limited information or also just with only expert opinion. The cumulative distribution can be chosen when large amount of data is available
because it implies no data manipulation. These distributions need the subjective estimation of two values to be used as parameters for the range. The values defined as
minimum and maximum have zero probability of being sampled in a Monte Carlo
simulation process. Therefore, the lowest and the highest values of a sample of real
data cannot be used as estimators, which for the exercise performed here were set at
45 and 75 %. In this example, the maize grain yield response to the inoculation with
Azospirillum brasilense in 316 sites from Argentina was better reproduced when
using a cumulative distribution (Table 24.2). The normal and general distribution
replicated better the observed data than the betapert distribution but both overestimate the probability of null responses.
To analyze and to make decisions with the results, the maize price has to be
described and it is also a random variable. In this analysis, the maize price distribution was defined using a betapert function and the parameters were estimated on the
basis of historical prices with inflation adjustment and expert opinion. This is a
common procedure when using Monte Carlo simulation in daily decision making.
Because of structural changes in commodities markets long time series may not be
relevant for producers decision making in Argentina and we used the last 7 years of
maize prices in Argentina at harvest. The resulting betapert distribution for gross
price was: 118.7 (minimum), 170.0 (most probable), and 200.0 (maximum) US$
ton1. For the analysis, the marketing expenses were set at current values with fixed
expenses (freight and drying) of 38 US$ ton1 and 3 % of commissions and taxes.
Then, the net price was calculated as 97 % of the gross price minus the fixed
expenses per produced ton. Using agricultural simulation models and expert opinion, a betapert distribution was defined for maize base yield without Azospirillum
brasilense inoculation. The parameters for this distribution were 5,009 (minimum),
10,630 (most probable), and 12,623 (maximum) kg ha1, with an expected grain
yield of 10,025 kg ha1. The revenue was calculated as the product between the base
yield, the percent of response and the net price. With the distribution shown in the
Fig. 24.1, the probability of incremental revenue exceeding the cost of inoculation
with Azospirillum brasilense can be calculated. If this probability is high enough,
there may be no doubt that Azospirillum brasilense inoculation will be included as
a crop management practice. In this case, based on the distribution of maize
responses to Azospirillum sp. from 316 cases located in the pampas region of
Argentina, it was observed that in more than 81 % of the cases the incremental revenue of the practice exceeded its cost, and it could be included as a crop management practice under the current production conditions.
The approach presented is quite different from the way that usual experimental
results are used to help stakeholders. A deterministic result, usually the mean response
value, was here replaced by a distribution of values and a probabilistic answer to the
stakeholders. This may be considered a more realistic approach to measure the
response of the maize crops to inoculation with Azospirillum brasilense in Argentina.
24
443
Fig. 24.1 Incremental revenue distribution for Azospirillum brasilense inoculation in maize crops
from the North of Buenos Aires Province, Argentina
24.5
Conclusions
Abundant field studies, mostly in Latin America and Asia show the increase in grain
yields of crops inoculated with Azospirillum sp. mainly in cereals. Although this
microbe can enhance the nutritional status of the inoculated crops, as well as to
reduce minor water or other abiotic stresses, the design of the experiences requires
the implementation of normal production practices avoiding major nutrient limitations and extreme water stress conditions.
In general, the delivery of the inoculum to the production system is with the
seeds, and it is recommended a careful handling and storage of the treated seeds to
facilitate a high survival of the inoculated microbes. The compatibility with other
seed treatments and the long-term survival of Azospirillum sp. is variable depending
on the formulations containing them.
A better interpretation of the results requires the analysis based on the frequency
of their occurrence as well as the discrimination among hierarchical productivity
factors. And, because of the large variability in the crop responses to the inoculation
with Azospirillum sp., also large number of observations is needed to describe significant differences between treatments. The analysis of distribution response values is a more realistic approach to measure the crop performance to inoculation
under the interaction of complex random factors and provides also a probabilistic
answer to stakeholders.
444
M. Daz-Zorita et al.
References
Araujo A, Baldani V, Galisa P, Pereira J, Baldani J (2013) Response of traditional upland rice
varieties to inoculation with selected diazotrophic bacteria isolated from rice cropped at the
Northeast region of Brazil. Appl Soil Ecol 64:4955
Bayan Y, Levanony H (1990) Current status of Azospirillum inoculation technology: Azospirillum
as a challenge for agriculture. Can J Microbiol 36:591608
Berger A, Pena B (2013) Decisiones riesgosas en empresas agropecuarias. Editorial Facultad de
Agronoma, Universidad de Buenos Aires, Buenos Aires, p 100
Clow A, Flaskerud G (2001) Marketing and crop insurance combined to manage risk on a Cass
County representative farm. Agribusiness and applied economics report no 455. Agricultural
Experiment Station North Dakota State University
Di Rienzo J, Casanoves F, Balzarini M, Gonzalez L, Tablada M, Robledo C (2013) InfoStat versin 2013. Grupo InfoStat, FCA, Universidad Nacional de Crdoba, Crdoba, Argentina
Diaz-Zorita M, Fernndez Canigia M (2009) Field performance of a liquid formulation of
Azospirillum brasilense on dryland wheat productivity. Eur J Soil Biol 45:311
Daz-Zorita M, Balia R, Fernndez Canigia M (2012) Azospirillum brasilense enhances alfalfa
productivity: field evaluation. In: Prez JC, Soler Arango J, Posada Uribe LF (eds) PGPR. 9th
international and 1st Latinamerican PGPR workshop. Returning to our roots, Quirama,
Medelln, 38 June 2012
Dobbelaere S, Vanderleyden J, Okon Y (2003) Plant growth-promoting effects of diazotrophs in
the rhizosphere. Crit Rev Plant Sci 22:107149
El Habbasha S, Tawfik M, El Kramany M (2013) Comparative efficacy of different bio-chemical
foliar applications on growth, yield and yield attributes of some wheat cultivars. World J Agric
Sci 9:345353
Ferreyra R, Podest G, Messina C, Letson D, Dardanelli J, Guevara E, Meira S (2001) A linkedmodeling framework to estimate maize production risk associated with ENSO-related climate
variability in Argentina. Agric For Meteorol 107:177192
Govindarajan M, Balandreau J, Kwon S, Weon H, Lakshminarasimhan C (2008) Effects of the
inoculation of Burkholderia vietnamensis and related endophytic diazotrophic bacteria on
grain yield of rice. Microb Ecol 55:2137
Hungria M, Nogueira M, Araujo R (2013) Co-inoculation of soybeans and common beans with
rhizobia and azospirilla: strategies to improve sustainability. Biol Fertil Soils 49:791801
Islam M, Sattar M, Ashrafuzzaman M, Saud H, Uddin M (2012) Improvement of yield potential of
rice through combined application of biofertilizer and chemical nitrogen. Afr J Microbiol Res
6:745750
Khalid A, Sultana S, Arshad M, Mahmood S, Mahmood T, Siddique M (2011) Performance of
auxin producing rhizobacteria for improving growth and yield of wheat and rice grown in rotation under field conditions. Int J Agric Appl Sci 3:4450
Lana M, Dartora J, Marini D, Hann J (2012) Inoculation with Azospirillum, associated with nitrogen fertilization in maize. Rev Ceres Vicosa 59:399405
Mehnaz S, Kowalik T, Reynolds B, Lazarovits G (2010) Growth promoting effects of corn (Zea mays)
bacterial isolates under greenhouse and field conditions. Soil Biol Biochem 42:18481856
Naiman A, Latrnico A, Garca de Salamone I (2009) Inoculation of wheat with Azospirillum
brasilense and Pseudomonas fluorescens: Impact on the production and culturable rhizosphere
microflora: ecology and application of Azospirillum and other plant growth promoting bacteria
(PGPB). Eur J Soil Biol 45:4451
Naseri R, Moghadam A, Darabi F, Hatami A, Tahmasebei G (2013) The effect of deficit irrigation
and Azotobacter chroococcum and Azospirillum brasilense on grain yield, yield components of
maize (S.C. 704) as a second cropping in western Iran. Bull Env Pharmacol Life Sci
2:104112
Okon Y, Labandera-Gonzlez C (1994) Agronomic applications of Azospirillum: an evaluation of
20 years worldwide field inoculation. Soil Biol Biochem 26:15911601
24
445
Chapter 25
25.1 Introduction
With a growing world population that would probably reach 9,000 millions souls in
2050, it will be crucial to redefine agriculture the way we see it today. In order to
satisfy the growing demand, food production would need to increase by 70%
447
448
449
Berg et al. 2013; Reddy and Saravanan 2013; Turner et al. 2013; Coleman-Derr and
Tringe 2014). In this regard, some organic fertilizers recently introduced into the
market are able to stimulate plant growth and development (Malus etal. 2012).
Some of these fertilizers are based on PGPRs, which can help maintain both a
healthy plant and soil through different direct and indirect microbial strategies
(Bhattacharyya and Jha 2012). These last include a relative protection against plant
pathogens, which could be associated in turn to siderophore production, microorganism competition and bacteriocin synthesis (Mitter etal. 2013). A structure
improvement as well as bioremediation of soil has also been reported, the last one
by means of heavy metal sequestering abilities and/or degradation of toxic xenobiotic compounds as pesticides (Zahir etal. 2004). The PGPRs have also been able to
enhance phosphate, organic N, and other nutrients solubility and availability to the
plant. The direct plant-growth promotion effect has been associated to different
molecular mechanisms of action, such as phytohormone production including auxins, gibberellins, ethylene, and abscisic acid. All the above-mentioned beneficial
PGPR effects on plants could help to reduce the amount of dangerous, agroecosystem-
disturbing chemical compounds normally used by farmers (Zahir etal. 2004; Singh
etal. 2011; Malus etal. 2012; Reddy and Saravanan 2013; Nadeem et al. 2014).
Even though plant inoculants based on PGPRs have been initially developed for
extensive farming, a growing demand to extend their use to intensive agriculture
systems such as those used in horticulture, is mounting. Organic, hydroponics, and
greenhouse growth are some of the common methods used to grow vegetables. All
of them are performed under a controlled environment, condition that in turn could
help to obtain more stable PGPR inoculation effects than at the open field (Malus
etal. 2012). In short, seed and/or substrate inoculation with different PGPRs as
Azospirillum, Bacillus, Enterobacter, Klebsiella and Pseudomons could enhance
seedlings vigor, phytohormone production, tolerance to soil pathogens, a higher
efficiency in the use of fertilizers, and a better tolerance to environmental stresses
(Kokallis-Burelle et al. 2006; Lamsal etal. 2013; Park etal. 2013). Some authors
also suggested that PGPR could be able to improve the nutritional value of fruits
and vegetables by increasing the antioxidant capacity and phenolics content
(Nautiyal et al. 2008; Koheler etal. 2009; Cappellari etal. 2013; Jain etal. 2014;
Ramos-Solano etal. 2014).
Amongst PGPRs, Azospirillum is one of the most studied genuses. Phytohormone
production, nitrogen fixation, and roots proliferation in Azospirillum-inoculated
plants are all well-known effects that could improve plant growth. However, after an
exhaustive literature search, Bashan and de-Bashan (2010) arrived to the conclusion
that not a single mechanism of action could explain the promotion of plant growth.
Instead, they have proposed a Multiple Mechanism of Action where several bacterial effects on plant growth could be acting according to the plant species colonized, Azospirillum strain, and the prevailing environmental conditions. An
Additive Hypothesis, where several small mechanisms acting simultaneously or
one after the other in order to produce a larger plant growth effect, has been previously presented by Bashan et al. (2004). A cascade or tandem effects where one
mechanism could stimulate another one cannot be excluded. In this regard,
450
451
25.2.2 S
eed Imbibitions Kinetics Determination
andInoculation Process
Water intake by seeds follows a three-phase pattern, where a fast initial absorption
period (phase I) is followed by an intermission (phase II), and finally by a rise in
water intake along with radicle emergence (phase III) (Bewley 1997) (Fig.25.1).
Seeds can withstand desiccation during I and II phases but become susceptible in
phase III. A high difference between water potential (matric) of seeds and that of the
imbibing solution determines the fast water absorption of phase I. This is however
dependent on both seed composition and cortex permeability to water, which differs
amongst plant species. With relation to the initial dry weight (DW), water content
in different vegetables after phase I was as follows: sweet corn 3740 %, lettuce
38 %, carrot 34 %, onion 3739 % (Bennet and Whipps 2008). Taking this into
account and considering the ample horticultural multiplicity, it is very important to
determine the imbibition curve of seeds on each plant species to be studied.
In short, in the intra-semen method seeds need to be immersed in the inoculum
during the exponential part of phase I, that is, during the maximum water intake of
the imbibition period (Bennet and Wipps 2008). After that, seeds can be superficially blotted or dried up to their original humidity value, which depends on its
immediate or late sowing, respectively.
452
Phase I
Rapid uptake
water
Phase II
Phase III
Reactivaction
of metabolism
Radicle protrusion
Water Absorption
Imbibition time (hs)
Fig. 25.1 Seed imbibition pattern curve
453
25.2.3 D
etermination ofOptimum Inoculums Concentration
Required toPromote Plant Growth
25.2.3.1 Cool Germination Test
The traditional Germination Test is widely used to determine seed viability
(Hampton and TeKrony 1995; ISTA 2014). However, this test does no guarantee an
efficient plant performance at the field, where several environmental factors can
diminish plant emergence. This observation has conducted to the development of
complementing germination tests that tend to evaluate the so-called seed vigor
(Hampton and TeKrony 1995). The Cool Germination Test (CGT) is one of these,
developed to simulate the adverse conditions related to suboptimal field temperatures operating during germination. This test is widely used in the USA and Europe
to evaluate seed vigor in cotton, maize, soy, sorghum, and in several vegetables such
as onion, carrot, and beans (Hampton 1992). The CGT has been proved useful in
determining fungicide efficacy to select genetic traits related to seed germination on
cool and humid soils, to select seed batches devoted to early sowing, to adjust sowing density, and also to evaluate the damaging effects of seed storage on plant physiology (AOSA 1983).
Taking the above into account and the proved Azospirillums ability to promote
plant growth under stressful abiotic conditions (Kohler etal. 2009; Fasciglione etal.
2012; Romero etal. 2014), we have proposed a modified CGT as a complementary
tool to determine the optimum bacterial inoculum concentration to be used in
Azospirillum-vegetable association studies.
Equipment and Supplies
Seeds with a germinating power over 95%, analytical balance, 2025-cm filter
paper rolls (for small seeds), 2050-cm filter paper rolls (for large seeds), polyethylene bags, plastic containers to maintain rolls vertically into the germination chamber, germination chamber settled at 25 0.5 C and a 12-h photoperiod, growth
chamber settled at 10 0.5 C, drying oven.
Procedures
In order to allow humidity and temperature equilibration in all the paper mass, the
day before sowing paper towels must be soaked in SDW to saturation, drained of
water excess, and stored in a refrigerating chamber at 10 C.
According to Sect. 25.2.2, seeds are immersed in diluted Azospirillum cells suspensions to obtain inocula with different bacterial concentrations, e.g., 0, 105, 107,
109, and 1011 cellsseed1. After superficial drying, a minimum of five lots containing
50 inoculated seeds of each inoculum are sown on paper sheet. The seeds are placed
on a doubled layer in two 25-seed rows, 5 and 10cm from the upper edge of the top
of paper and at a distance 23 times seeds size (Fig. 25.2a). A second sheet of wet
paper is put over the seeds, softly compressed and carefully rolled. To allow a normal plant growth, a firm but not excessively compressed roll must be built, paying
special attention to leave ample space at the central part (Fig.25.2b). Rolls can be
maintained as such by means of paper clips or rubber bands.
454
Fig. 25.2 Seed germination in paper rolls. (a) Upper left corner: 2025cm filter paper rectangles
sown with 50 lettuce on top and 50 sweet corn on the bottom; (b) upper right corner: rolled paper
after sowing; (c) lower left corner: sown rolls into polyethylene bags to avoid water evaporation;
(d) lower right corner: seedlings from lettuce and sweet corn distributed as in (a)
Sown rolls are accommodated vertically into containers. To prevent water loss
by evaporation, containers are introduced in polyethylene bags and properly sealed
(Fig. 25.2c). After that, containers are stored during 7 days in the dark, at
10 0.5 C. This last step gives the name to the test. After the cold period, containers are transferred to a germination chamber settled at 25 0.5 C and a 12-h photoperiod, where they remain for 7 additional days. Since the maintenance of a high
humidity level is required, rolls can be sprayed with SDW if needed. At the end of
the 7-day period, rolls are opened and germinated seeds percentage as well as seedlings quality determined (Fig.25.2d). The criteria used to evaluate seedlings are the
same established for each plant species in the standard germination test (ISTA
2014). According to these norms, seedlings can be classified in five groups:
1 . Strong, undamaged seedlings.
2. Strong seedlings with a slight development delay, minor damages as short primary and/or secondary roots, sheets with apical scratches, damaged coleoptile
but undamaged primary sheet, lightly twisted mesocotile.
3. Subgroup A: small or slightly twisted seedlings, low number of lateral roots.
Subgroup B: strong seedlings but disproportionately developed.
4. Abnormal seedlings according to ISTA rules and plant species.
5. Dead seeds.
Percentages of each group are calculated. Groups 1 and 2 represent vigorous seeds.
In addition to CGT, plant growth promotion effect of inoculation can be estimated through main root length and aerial height measurements. Complementary
information is provided by root DW/aerial DW ratio determination.
455
456
Fig. 25.3(a) Lactuca sativa seeds sown on filter paper. (b) Seedlings after 10 days growth in a
germinating chamber at 23 C
These solutions are calculated to obtain inocula containing the entire cell per
seed levels recommended in the literature, including those below and over these
concentrations, e.g., 0, 106, 107, 108, 109, 1010, and 1011 bacteriaseed1.
Lots of 50 seeds are immersed in each inoculum and incubated at 30 2.0 C
with orbital shaking (100 rpm). Total incubation time is calculated from the imbibition curve obtained from the selected plant species (Sect.25.2.2).
Each inoculated seed lot is sown on a petri dish containing two layers of filter
paper previously soaked in 10 mL of SDW or in each NaCl solution (Fig. 25.3). To
prevent moisture loss in the plate containing the seed, it is recommended to cover
them with polyethylene film. Salt concentration to be used in the experiment
depends on the plant species (Shannon 1997), being lettuce considered a relatively
salt-sensitive vegetable (Fasciglione 2012).
A minimum of five lots containing 50 inoculated seeds of each inoculum is sown
on individual petri dishes, wrapped in polyethylene film, and incubated in a germinating chamber at the temperature and photoperiod required by each plant species.
Some plant species require keeping seeds refrigerated for about 1224 h before
sowing (ISTA 2014).
Germinated seed percentages are determined 4 and 7 days after sowing (DAS),
these values representing germinative energy (GE) and germinating power (GP),
respectively. In addition, at the end of a 7-day period seedlings are classified as
normal or abnormal, according to the following criteria (ISTA 2014).
I. Normal: strong seedlings with a slight development delay, with minor damages as short primary and/or secondary roots, sheets with apical scratches, damaged
coleoptile but undamaged primary sheet, lightly twisted mesocotile. In the case of
dicots, it is accepted the presence of one intact cotyledon or three of them.
II. Abnormal: deformed, achromatic, fractured seedlings, twisted or thick roots.
In dicots: primary roots emerged after cotyledons or white and yellow cotyledons,
glued or necrotic or colorless cotyledons, a twisted or thick or absent hypocotile.
Also included in the group: glued cortical seeds, strong but disproportionally developed seedlings, dead seeds.
457
25.3 P
roduct Quality andNutritional Value Parameters
Determination
25.3.1 Antioxidant Activity
25.3.1.1 -Carotene Bleaching Test
Beta carotene bleaching test is a spectrophotometric technique used to estimate
antioxidant capacity in plants.
Test Principles
Linoleic acid peroxidation induced by heat discolors -carotene in water. The presence of antioxidants in plant extracts proportionally reduces -carotene bleaching,
which can be quantified by measuring absorbance at 470nm (A470) (Marco 1968;
Miller 1971; Velioglu et al. 1998).
Equipment and Supplies
Analytical balance, spectrophotometer, refrigerated centrifuge, magnetic stirrer,
rotary evaporator, boiling flask, centrifuge tubes, test tubes, cuvettes.
Extracting solution: prepare 80% methanol (v/v) in DW.
-carotene: dissolve 20mg -carotene in 10 mL with chloroform. This stock solution can be preserved up 2 weeks at 20 C. Working solution (0.2 mgmL1) is
prepared fresh by diluting 1mL stock in 10mL chlorophorm.
Butylated hydroxytoluene (BHT): dissolve 0.5 mg BHT in 10 mL with 80 % methanol. This solution (0.05 mgmL1) can be preserved up to 2 weeks at 20 C.
-carotene-linoleic acid emulsion (reactant mix): Prepare fresh. Put 40L linoleic
acid, 400L Tween 20 and 2 mL -carotene working solution in a 250-mL boiling
flask. Remove chlorophorm in rotary evaporator during 10 min at 35 C. Immediately
after, add 100mL DW and mix vigorously to form an emulsion. Protect from light
wrapping boiling flask in aluminum foil.
Procedures
Sample preparation: disrupt 1 g FW plant sample in mortar with pestle and liquid N
to obtain a paste. Add 15 mL extracting solution, homogenize, and distribute in
458
centrifuge tubes. Incubate tubes for 2 h at 70 C with orbital shaking. Note: in case
of processing antocianin-rich tissues, temperature must be set at 25 C to avoid
decomposition of these pigments. Centrifuge tubes at 13,000 g during 10min at
4 C and transfer supernatants to previously conditioned test tubes. If not immediately used, extracted samples can be kept at 20 C.
Test tube conditioning: put 5mL -carotene-linoleic acid emulsion in each test tube.
Add 200 L extract sample to each tube. Note: sample dilution in 80% methanol is
empirically adjusted according to the antioxidant activity plant tissue displays in
the assay. Control is obtained replacing extract sample by 200L 80% methanol.
A tube lacking -carotene emulsion is used as a blank.
A470 determination: determine A470 at T0 (initial point). Then, put test tubes in a
water bath and incubate at 50 C in the dark. Determine A470 after 30 and 60 min
thereafter. Incubation period can be extended up to 120min, but -carotene discoloration after 60 min incubation is already evident. All samples are assayed in
triplicate.
Antioxidant Capacity Calculation
According to Velioglu et al. (1998), antioxidant capacity can be expressed in four
different ways:
1. Antioxidant value (AOX). Plot A470 vs. time. The absolute value of slope represents AOX and corresponds to bleaching rates of -carotene. Determine AOXcontrol
and AOXsample, which correspond to reactant mix without antioxidant and with
plant extract, respectively. Slope obtained from A470 control vs. incubation time
plot will be AOXcontrol.
2. Antioxidant activity (AA). Calculate percent inhibition relative to control using
the equation
459
Test Principles
The deep violet color displayed in methanol by stable-free radical DPPH compound
becomes discolored when transformed on its non-radical form by the action of antioxidant H atoms donors (Fig.25.4). Radical discoloration degree due to the presence of antioxidants can be calculated from optical absorbance data at 517nm (A517)
on control blank and extract samples.
According to Argoti et al. (2011), the radical scavenging activity is expressed in
terms of the extract concentration (gmL1) required to decrease the initial DPPH
concentration by 50% (efficient concentration, EC50). A lower EC50 value will mean
a higher plant extract capacity to sequester free radicals.
Equipment and Supplies
Analytical balance, spectrophotometer, refrigerated centrifuge, magnetic stirrer,
orbital shaker, glass cuvettes.
Extracting solution: prepare 80% methanol (v/v) in DW.
DPPH solution (60 M; MW 392.32): 2.36 mg DPPH are dissolved in 100 mL
methanol. To prevent stability decay, the reagent must be prepared the same day to
be used and kept refrigerated in the dark.
Stocking ascorbic acid (AscA) solution (60 M; MW 176.12): dissolve 1.06 mg
AscA in DW and bring total volume to 100 mL. To prevent antioxidant loss, the
reagent must be prepared the same day to be used and kept refrigerated in the dark.
Standard AscA curve: 40160 L of 60 M AscA stocking solution aliquots are
taken by duplicate, 1,000L 60 M DPPH added, and total volume completed with
DW to a total 3,500 L on each point. The 4060 L rank corresponds to a rank of
AscA concentration comprised between 0.12 and 0.49 gmL1. Let the reaction
proceed during 30 min at room temperature and determine A517. Zero spectrophotometer setting is done with 80% methanol in water.
Procedures
Plant tissue antioxidant extraction: disrupt plant sample in mortar with liquid
N. Homogenize 1 g of powder in 10 mL of 80 % methanol and keep refrigerated
460
461
462
Procedures
Sample preparation: disrupt 200mg FW plant sample in mortar with pestle and
liquid N to obtain a paste. Add 5 mL of ice-cold extracting solution in the presence
of 1 g NaCl, homogenize, and distribute in centrifuge tubes. Centrifuge tubes at
13,000 g during 15 min at 4 C and transfer supernatants to previously conditioned
test tubes. If not immediately used, extracted samples can be kept at 80 C.
Calibrating curve: 100, 150, 200, and 300 mL aliquots from standard AscA solution
were pipetted into plastic cuvettes, that is, covering a 4.212.3 mgmL1 range.
Complete total volume to 300 mL with extracting solution.
Cuvette conditioning: Considering that Leipner etal. (1997) method is based on
DCPIP reduction by AscA, total AscA (vitamin C) determination in samples will
require a previous reduction of DAscA to AscA by homocystein. On the other hand,
AscA is obtained from samples where homocystein has been replaced by DW. The
following steps describe cuvette conditioning in both assays:
(a) Preparation of cuvettes concerning total AscA determination. Pipet 300 mL
sample extract, 200mL K2PO4 solution, and 100mL homocystein solution into
a disposable plastic cuvette.
(b) Preparation of cuvettes concerning AscA determination. Use procedure
described in (a), except that homocystein solution is replaced by the same volume of DW.
A524 determination: Incubate cuvettes during 15 min at 25 C. Add 1 mL citratephosphate buffer 2M and 1mL DCPIP solution to each one. Determine A524 immediately after. Total AscA content is calculated from the standard AscA curve and the
obtained A524 sample data. DAscA concentration is calculated according to the
equation DAscA= Total AscA (vitamin C) AscA.
25.3.3 D
etermination ofTotal Phenolics Content
(FolinCiocalteu Assay)
Phenolic compounds comprise a wide range of plant antioxidant substances possessing an aromatic ring with one or more hydroxyl substituents. The Folin
Ciocalteu assay estimates total phenolics content in plant tissues.
Technique Principles
The FolinCiocalteu assay relies on the transfer of electrons in alkaline medium
from plant phenolic compounds to phosphomolybdic/phosphotungstic acid complexes. Reduced FolinCiocalteu reagent forms a blue complex that can be quantified spectroscopically at 724nm (Singleton and Rossi 1965).
Gallic acid (3,4,5-trihydroxybenzoic acid, GA) is used as phenolics standard.
Due to the presence of other than GA phenolic compounds in plant tissues, results
are expressed in GA equivalents (GAE).
463
1,2
0,8
Y = 0,426x + 0,086
0,4
R2 = 0,999
0
0
0,5
1,5
GAE.g-1
2
FW)
Fig. 25.6 Typical A724 vs. gallic acid equivalent concentration plot (FolinCiocalteu method)
464
References
Adesemoye AO, Tobert HA, Kloepper JW (2008) Enhanced plant nutrient use efficiency with
PGPR and AMF in an integrated nutrient management system. Can J Microbiol 54:876886
Adesemoye AO, Tobert HA, Kloepper JW (2009) Plant growth-promoting rhizobacteria allow
reduced application rates of chemical fertilizers. Microb Ecol 58:921929
Allen RD (1995) Dissection of oxidative stress tolerance using transgenic plants. Plant Physiol
107:10491054
AOSA (1983) Seed vigour testing handbook. Contribution no 32 to the handbook on seed testing.
Association of Official Seed Analysts, Washington, DC
Argoti JC, Salido S, Linares-Palomino PJ, Ramrez B, Insuasty B, Altarejos J (2011) Antioxidant
activity and free radical scavenging capacity of a selection of wild-growing Colombian plants.
J Sci Food Agric 91(13):23992406
Barassi CA, Ayrault G, Creus CM, Sueldo RJ, Sobrero MT (2006) Seed inoculation with
Azospirillum mitigates NaCl effects on lettuce. Sci Hortic 109(1):814
Barassi CA, Sueldo RJ, Creus CM, Carrozzi LE, Casanovas EM, Pereyra MA (2007) Azospirillum
spp., a dynamic soil bacterium favourable to vegetable crop production. Dyn Soil Dyn Plant
1(2):6882
Barassi CA, Sueldo RJ, Creus CM, Carrozzi L, Casanovas EM, Pereyra MA (2008) Potencialidad
de Azospirillum en optimizar el crecimiento vegetal bajo condiciones adversas. In: Cassn F,
Garca Salamone I (eds) International workshop in Azospirillum: cell physiology, plant
response and agronomic research in Argentine. SMAyA, AAM, chap 3, pp 4958. ISBN:
978-987-98475-8-9
Barrow JR, Lucero ME, Reyes-Vera I, Havstad KM (2008) Do symbiotic microbes have a role in
plant evolution, performance and response to stress? Commun Integr Biol 1:6973. doi:10.4161/
cib.1.1.6238
Bashan Y, de-Bashan LE (2010) How the plant growth-promoting bacterium Azospirillum promotes plant growth: a critical assessment. Adv Agron 108:77136
Bashan Y, Holguin G, De-Bashan LE (2004) Azospirillum-plant relationships: physiological,
molecular, agricultural and environmental advances (19972003). Can J Microbiol 50:
521577
Bennett AJ, Whipps JM (2008) Dual application of beneficial microorganisms to seed during drum
priming. Appl Soil Ecol 38:8389. doi:10.1016/j.apsoil.2007.08.001
Berg G, Zachow C, Mller H, Philipps J, Tilcher R (2013) Next-generation Bio-products sowing
the seeds of success for sustainable agriculture. Agronomy 3:648656. doi:10.3390/
agronomy3040648
Bewley JD (1997) Seed germination and dormancy. Plant Cell 9:10551057
Bhattacharyya PN, Jha DK (2012) Plant growth-promoting rhizobacteria (PGPR): emergence in
agriculture. World J Microbiol Biotechnol 28(4):13271350. doi:10.1007/s11274-011-0979-9
Bruno RS, Leonard SW, Atkinson J, Montine TJ, Ramakrishnan R, Bray TM, Traber MG (2006)
Faster plasma vitamin E disappearance in smokers is normalized by vitamin C supplementation. Free Radic Biol Med 40(4):689697
Cappellari LR, Santoro MV, Nievas F, Giordano W, Banchio E (2013) Increase of secondary
metabolite content in marigold by inoculation with plant growth-promoting rhizobacteria.
Appl Soil Ecol 70:1622
465
Casanovas EM, Barassi CA, Sueldo RJ (2000) Azospirillum inoculation of maize seed during
imbibition. Cereal Res Commun 28(12):2532
Coleman-Derr D, Tringe SG (2014) Building the crops of tomorrow: advantages of symbiontbased approaches to improving abiotic stress tolerance. Front Microbiol 5:283. doi:10.3389/
fmicb. 2014.00283
Creus CM, Sueldo RJ, Barassi CA (1996) Azospirillum inoculation in pregeminating seeds. Can J
Microbiol 42:8386
del Amor FM, Serrano-Martnez A, Fortea MI, Legua P, Nez-Delicado E (2008) The effect of
plant-associative bacteria (Azospirillum and Pantoea) on the fruit quality of sweet pepper under
limited nitrogen supply. Sci Hortic 117(3):191196
Drewnowski A (2010) The nutrient rich foods index helps to identify healthy, affordable foods. Am
J Clin Nutr 91(4):10951101
East R (2013) Microbiome: soil science comes to life. Nature 501(7468):1819. doi:10.1038/
501S18a
Editorial (2010) How to feed a hungry world. Nature 466:531532. doi:10.1038/466531a
Eraslan FA, Savasturk I, Gunes OA (2007) Changes in antioxidative system and membrane damage of lettuce in response to salinity and boron toxicity. Sci Hortic 114:510
Fasciglione G, Casanovas EM, Yommi A, Sueldo RJ, Barassi CA (2012) Azospirillum improves
lettuce growth and transplant under saline conditions. J Sci Food Agric 92:25182523
Flores P, Fenoll J, Hellin P, Aparicio-Tejo P (2010) Isotopic evidence of significant assimilation of
atmospheric-derived nitrogen fixed by Azospirillum brasilense co-inoculated with phosphate-
solubilising Pantoea dispersa in pepper seedling. Appl Soil Ecol 46(3):335340
Gleick PH (1993) Water in crisis: a guide to the Worlds fresh water resources. Oxford University
Press, New York
Grover M, Ali SZ, Sandhya V, Rasul A, Venkateswarlu B (2010) Role of microorganisms in adaptation of agriculture crops to abiotic stresses. World J Microbiol Biotechnol 27:12311240.
doi:10.1007/s11274-010-0572-577
Hacisevki A (2009) An overview of ascorbic acid biochemistry. J Fac Pharm Ankara 38:233255
Hampton JG (1992) Prolonging seed quality. In: Proceedings of the 4th Australian seeds research
conference, pp 181194
Hampton JG, TeKrony DM (eds) (1995) Handbook of vigour test methods, vol 3. ISTA Vigour test
Committee, Zurich, p117
International Society for Horticultural Science (ISHS) (2012) Harvesting the sun. A profile of
world horticulture. Scripta horticulturae, no 14. ISHS, Belgium. ISBN 978 90 6605 704 3
ISTA (2014) International rules for seed testing. Seed Science and Technology, Edinburgh, 147
Jain A, Singh A, Chaudhary A, Singh S, Singh HB (2014) Modulation of nutritional and antioxidant potential of seeds and pericarp of pea pods treated with microbial consortium. Food Res
Int 64:275282
Jeremy JY, Shukla N, Muzaffar S, Handley A, Angelini GD (2004) Reactive oxygen species, vascular disease and cardiovascular surgery. Curr Vasc Pharmacol 2:229236
Kim H, Fonseca J, Choi J, Kubota C, Kwon DY (2008) Salt irrigation water affects the nutritional
an visual properties of romaine lettuce. J Agric Food Chem 56:37723776
Kberl M, Mller H, Ramadan EM, Berg G (2011) Desert farming benefits from microbial potential in arid soils and promotes diversity and plant health. PLoS One 6:e24452. doi:10.1371/
journal.pone.0024452
Kohler J, Hernndez JA, Caravaca F, Roldn A (2009) Induction of antioxidant enzymes is
involved in the greater effectiveness of a PGPR versus AM fungi with respect to increasing the
tolerance of lettuce to severe salt stress. Environ Exp Bot 65(23):245252
Kokalis-Burelle N, Kloepper JW, Reddy MS (2006) Plant growth-promoting rhizobacteria as
transplant amendments and their effects on indigenous rhizosphere microorganisms. Appl Soil
Ecol 31:91100
Lamsal K, Kim SW, Kim YS, Lee YS (2013) Biocontrol of late blight and plant growth promotion
in tomato using rhizobacterial isolates. J Microbiol Biotechnol 2(7):897904
466
Lantican MA, Pingali PL, Rajaram S (2003) Is research on marginal lands catching up? The case of
unfavourablewheatgrowingenvironments.AgricEcon29:353361.doi:10.1111/j.1574-0862.2003.
tb00171.x
Larson C (2013) Losing arable land, China faces stark choice: adapt or go hungry. Science
339:644645. doi:10.1126/science.339.6120.644
Le Marchand L (2002) Cancer preventive effects of flavonoidsa review. Biomed Pharmacother
56:296301
Lebeis SL (2014) The potential for give and take in plantmicrobiome relationships. Front Plant
Sci 5:287. doi:10.3389/fpls.2014.00287
Leipner J, Fracheboud Y, Stamp P (1997) Acclimation by suboptimal growth temperature diminishes photooxidative damage in maize leaves. Plant Cell Environ 20:366372
Malus E, Sas-Paszt L, Ciesielska J (2012) Technologies for beneficial microorganisms inocula
used as biofertilizers. ScientificWorldJournal 2012:112. doi:10.1100/2012/491206, Article ID
491206
Marasco R, Rolli E, Ettoumi B, Vigani G, Mapelli F, Borin S (2012) A drought resistancepromoting microbiome is selected by root system under desert farming. PLoS One 7:e48479.
doi:10.1371/journal.pone.0048479
Marco GJA (1968) A rapid method for evaluation of antioxidants. J Am Oil Chem Soc
45:594598
Miller HE (1971) A simplified method for the evaluation of antioxidants. J Am Oil Chem Soc
48:91
Mitter B, Brader G, Afzal M, Compant S, Naveed M, Trognitz F, Sessitsch A (2013) Advances in
elucidating beneficial interactions between plants, soil and bacteria. Adv Agron 121:381445
Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7(9):405410
Molina-Favero C, Creus CM, Simontacchi M, Puntarulo S, Lamattina L (2008) Aerobic nitric
oxide production by Azospirillum brasilense Sp245 and its influence on root architecture in
tomato. Mol Plant Microbe Interact 21(7):10011009
Nadeem SM, Ahmad M, Zahir A, Javaid A, Ashraf M (2014) The role of mycorrhizae and plant
growth promoting rhizobacteria (PGPR) in improving crop productivity under stressful environments. Biotechnol Adv 32(2):429448
Nautiyal CS, Govindarajan R, Lavania M, Pushpangadan P (2008) Novel mechanism of modulating natural antioxidants in functional foods: involvement of plant growth promoting
Rhizobacteria NRRL B-30488. J Agric Food Chem 56(12):44744481. doi:10.1021/jf073258i
Okon Y, Kapulnik Y (1986) Development and function of Azospirillum-inoculated roots. Plant Soil
21:316
Okon Y, Albrecht SL, Burris RH (1976) Factors affecting growth and nitrogen fixation of Spirillum
lipoferum. J Bacteriol 127:12481254
Oustan S, Jafarzadeh A, Aliasgharzad N (2007) Electrical conductivity as a salient factor in salinesodic soils of Tabriz plain. Bioclimatology and natural hazards. In: International scientific conference, Polana nad Detvou, Slovakia. http://cbks.cz; consulta: septiembre de 2009
Park J-W, Balaraju K, Kim J-W, Lee S-W, Park K (2013) Systemic resistance and growth promotion of chili pepper induced by an antibiotic producing Bacillus vallismortis strain BS07. Biol
Control 65(2):246257
Postgate JR (1969) Viable counts and viability. In: Norris JR, Ribbons DW (eds) Methods in
microbiology, vol 1. Academic, New York, pp 611618
Ramos-Solano B, Garcia-Villaraco A, Gutierrez-Maero FJ, Lucas JA, Bonilla A, Garcia Seco D
(2014) Annual changes in bioactive contents and production in field-grown blackberry after
inoculation with Pseudomonas fluorescens. Plant Physiol Biochem 74:18
Reddy CA, Saravanan RS (2013) Polymicrobial multi-functional approach for enhancement of
crop productivity. Adv Appl Microbiol 82:53113
Rodrguez Cceres E (1982) Improved medium for isolation of Azospirillum spp. Appl Environ
Microbiol 44(4):990991
Romero AM, Vega D, Correa OS (2014) Azospirillum brasilense mitigates water stress imposed by
a vascular disease by increasing xylem vessel area and stem hydraulic conductivity in tomato.
Appl Soil Ecol 82:3843
467
Chapter 26
Dedication: This review is dedicated to the memory of the Israeli soil microbiologist Prof. Yigal
Henis (19262010) of the Faculty of Agriculture, The Hebrew University of Jerusalem in Rehovot,
Israel, one of the pioneers of studies of inoculants in Israel.
Y. Bashan (*) L.E. de-Bashan
Environmental Microbiology Group, Northwestern Center for Biological
Research (CIBNOR), Av. IPN 195, La Paz, Baja California Sur 23096, Mexico
The Bashan Foundation, 3740 NW Harrison Blvd, Corvallis, OR 97330, USA
e-mail: [email protected]; [email protected]
Springer International Publishing Switzerland 2015
F.D. Cassn et al. (eds.), Handbook for Azospirillum,
DOI 10.1007/978-3-319-06542-7_26
469
470
26.1
Introduction
The end goal and economic justification of any long-term investigation of the effect
of the plant growth-promoting bacteria (PGPB) Azospirillum spp. on plant growth
and productivity is practical application of inoculants by growers. To that end, inoculants are made of viable cultures with high numbers of Azospirillum spp. embedded, suspended, or mixed in a carrier of choice. The later can be either solid or
liquid. A fundamental requirement of such technology, in an industrial setting, is the
production of cultures of Azospirillum spp. of high cell number, usually in fermenters using cheap, yet efficient, culture medium for growth and simple procedures for
growing conditions (Bashan 1998).
Azospirillum spp. has been commercially used on a relative large scale in
Argentina, Mexico, Europe, South Africa, and India, mainly on cereals, but also on
other crops (Daz-Zorita and Fernndez-Canigia 2009; Fuentes-Ramirez and
Caballero-Mellado 2005; Hartmann and Bashan 2009). Manufacturers are mostly
small- to medium-sized companies and government agencies that are involved in
inoculant production (Fuentes-Ramirez and Caballero-Mellado 2005).
This chapter provides technical details on production of several formulations
proven useful for Azospirillum spp. from propagation of the bacterium in culture
medium to final formulation to be used in the field and industrial considerations in
the entire process of inoculant production.
26.2
There are several proven media for successfully growing Azospirillum spp. in fermenters. Some are less useful for inoculant production, mainly because of low cell
counts and costs.
26.2.1
26
471
26.2.2
Modified TYG
Comments: TYG medium, based on tryptone, yeast extract and glucose, allows
massive cultivation of many PGPB/PGPR. This medium was further developed to
enhance the growth of Azospirillum by supplementing it with the buffer capacity
and micronutrients of the OAB medium that were specially designed for this species
(Bashan et al. 2002). Yet, it has a major deficiency. Glucose is not used by some
species of Azospirillum, such as the most common species used as an inoculant,
A. brasilense, and glucose is not a preferred carbon source for this genus.
TYG medium contains (g/L): tryptone, 5 (Difco); yeast extract, 5, D-glucose, 5;
NaCl, 1.2; MgSO47H2O, 0.25; K2HPO4 0.13; CaCl2, 0.22; K2SO4, 0.17; Na2SO4,
2.4; NaHCO3, 0.5; Na2CO3, 0.09; Fe(III) EDTA, 0.07; the pH was adjusted to 7.0
after sterilization (Bashan et al. 2002).
26.2.3
Comments: These media increase mass production of cells more than what is
obtained with modified TYG medium and in the shortest period of time (18 h) to a
level of ~1011 cells/mL. The variant medium using glycerol is much cheaper because
industrial grade glycerol from biodiesel production is readily available. Currently,
these are the most suitable media for mass production of Azospirillum spp.
These media contained the modified TYG medium, where the glucose is replaced
by 5 g/L Na-gluconate or 8 mL/L glycerol (Bashan et al. 2011).
26.2.4
Comments: These media produce less than optimal yields of cells for propagation of
the bacteria for inoculants compared to the two BTB media. They are still useful for
experimental laboratory propagation of Azospirillum spp. All these commercial
media are prohibitively expensive for industrial-scale inoculant production.
472
26.3
In general, shortly after suspensions of Azospirillum spp. are inoculated into the
soil, seed surface, or root surfaces without a proper carrier, the bacteria population
declines rapidly. In plantless soil, they disappeared within 15 days (Bashan 1999).
This phenomenon, combined with poor production of bacterial biomass, difficulty
sustaining activity in the rhizosphere, and the physiological state of Azospirillum
spp. at application time, prevents the buildup of a sufficiently large Azospirillum
population in the rhizosphere. A threshold number of cells, ~106107 cellsplant1
for Azospirillum brasilense is required (Bashan 1986b). The inherent heterogeneity
of the soil is the key obstacle, where introduced bacteria sometimes cannot find an
empty niche in the soil. These unprotected, inoculated bacteria must compete with
the often better-adapted native microflora and withstand predation by soil microfauna. Consequently, a major role of formulation of inoculants is to provide a more
suitable microenvironment, combined with physical protection for a prolonged
period, to prevent a rapid decline of introduced Azospirillum spp. Inoculants for
field-scale use have to be designed to provide a dependable source of bacteria that
survives in the soil and become available to crops, when needed (Bashan 1998).
Many inoculants do not do this; yet, this is the main purpose of inoculant formulation. The three fundamental and essential characteristics for all inoculants are to: (1)
support the growth of the intended microorganisms, (2) support the necessary number of viable microbial cells in good physiological condition for an acceptable
period of time, and (3) deliver enough microorganisms at the time of inoculation to
reach a threshold number of bacteria that is usually required to obtain a plant
response, i.e., the inoculant must contain enough viable bacteria after the formulation process. Formulation is the crucial issue for commercial inoculants. In practice,
the formulated inoculant is the sole delivery vehicle of live microorganisms from
the factory to the field.
26.3.1
The oldest method of inoculation of seeds and plants with bacterial culture suspension,
as has been practice since the pioneering times of plant inoculation decades ago, still
prevails today. It is practiced mostly at research facilities. It is a very common practice,
especially among highly trained researchers because it is the least laborious.
Obviously, despite the large number of publications demonstrating repeated
success of researchers, no formulation inoculants are definitely not a practical
inoculation technology. This is mainly because the level of expertise needed for
proper delivery of the bacteria, under optimal conditions, is many times beyond the
skills and the available time of growers. It is also impractical for large-scale application; the large volume of liquids involved, incubation, and refrigeration facilities
26
473
26.3.2
Liquid Inoculants
26.3.3
Peat Inoculants
Peat is the carrier of choice for rhizobia and many PGPB, including Azospirillum
spp. in North and South America, Europe, and Australia, and the main ingredient of
inoculants that are sold in large volumes. Currently, technical details of production
of the basic peat-based inoculant, such as grain size, pH, optimal moisture, several
amendments, quality of inoculants, quality control standards, and occupational
health and safety are common knowledge (Deaker et al. 2011) The physical state of
the formulation of peat (solid [powder], pellet, or liquid [slurry]) can make a difference in the success of inoculation in rhizobia, but such studies are not available for
Azospirillum spp.
474
There are many small variations of preparing peat inoculant (depending on the
desired formulation required) and most are small modification that are based on the
following procedure: for preparation of 100 g of inoculant for Azospirillum spp.,
45 g of ground peat (40 mesh) is thoroughly mixed with 5 g of CaCO3 and 20 mL
of tap water (final pH 6.8) stored in polyethylene bags sealed with a plug. The bags
are sterilized (gamma-irradiated or tyndelization in an autoclave), and 30 mL of a
24-h-old bacterial culture (approximately 5 109 CFU/mL) are aseptically added to
each bag, mixed, and incubated for an additional 7 days at 33 2 C. Every 2 days,
the peat is mixed by shaking the bags. The final number of bacteria in the inoculant
range from 5 107 to 5 108 CFU/g of inoculant. The bags are stored for up to several months at 4 C. One day before plant inoculation, the bags are transferred to
30 2 C for acclimation before inoculation.
Peat is user-friendly to several amendments used for other PGPB but not tested
so far for Azospirillum spp. Such amendments include: vermiculite (KokalisBurelle et al. 2003), chitin, heat-killed Aspergillus niger mycelium or spent
compost from Agaricus bisporus (Manjula and Podile 2001), pyrophyllite
(hydrous aluminum silicate) (Meyer et al. 2000, 2001), and charcoal plus an
adhesive (Riggs et al. 2001).
Another option to consider for small-scale inoculant production is that some
organic wastes and composts can perform equally well or better than peat as a carrier. The main limitation is availability of the raw material for industry. Compost
made of cork, bagasse, sawdust, brewery waste, or banana leaves (tested for other
PGPB; Bashan et al. 2014) can sustain a small, local inoculant industry where the
materials are available. They cannot form a base for a large nationwide industry,
especially when the batch raw material is variable.
26.3.4
Synthetic Inoculants
26
475
bacteria in the needed quantities, usually at the time of seed germination and emergence
of seedlings, (3) physical protection for the inoculated bacteria from soil competitors and many environmental stresses (Covarrubias et al. 2012, Schoebitz et al.
2012; Zohar-Perez et al. 2003), (4) sufficient water for survival of the bacteria, and
(5) dispersive in water to allow movement of the bacteria from the polymer to the
plants. For Azospirillum spp. the polymer of choice is alginate (Bashan 1986a;
Bashan and Gonzalez 1999; Bashan et al. 2002).
26.3.5
476
26.3.5.1
Production of Macrobeads
26.3.5.2
Production of Microbeads
26.4
Quality control of inoculants ensures that the declared content of Azospirillum spp.
is present and that it is alive. Several countries now have guidelines that state how
many cells should be in the inoculant. In other countries, this is left to the
26
477
manufacturers discretion. The method for detection of the genus/species/strain varies and depends on the microbiological/molecular analytical capacity of the manufacturer. Generally, traditional, immunological, and molecular methods are
employed for Azospirillum spp.
26.4.1
26.4.1.1
The limit of detection depends on the level of contamination by other microorganisms because these methods are based on serial dilutions. Lower limits of detection
by these methods are ~103105 cfu/g inoculant. Because regulations require that the
inoculant will contain at least 108 cfu/g, these cultivation methods, despite being
almost obsolete in other diagnostic fields, are still useful. These techniques require
minimal microbiological infrastructure.
478
26.4.1.1.1
26.4.1.1.1.1
Congo Red-NFb
This medium is basically the original NFb medium supplemented with 15 mL/L
medium of 1:400 aqueous solution of Congo red, autoclaved separately, and added
just before using (Rodriguez-Caceres 1982).
Note: This medium permits the recognition of Azospirillum colonies on plates and facilitates the isolation of pure cultures since the colonies appear dark red or scarlet with
typical colony characteristics, whereas many soil bacteria do not absorb Congo red.
26.4.1.1.1.2
These two semi-selective media are based on the OAB medium. The BL medium is
the OAB medium supplemented with (mg/L) streptomycin sulfate, 200; cycloheximide, 250; sodium deoxycholate, 200; and 2,3,5-triphenyltetrazolium chloride, 15.
The BLCR is the BL medium supplemented with an aqueous solution of Congo red
(approximately 1 mL of a 1 mg/mL solution per liter) (Bashan and Levanony 1985).
Note: These media are very suitable for the isolation of Azospirillum from the rhizosphere since the colonies are easily recognizable, especially on BLCR medium.
However, some strains of A. brasilense failed to grow on this medium, and the
growth of Azospirillum on BLCR medium is significantly slower compared to the
original OAB medium (about 10 days incubation time). Lower limits of detection
are ~102103 cfu/g inoculant when the inoculant has a low contamination load.
Contaminants are easily recognizable.
26.4.2
Immunological Methods
For immunological detection of A. brasilense, only the enzyme-linked immunosorbent assay (ELISA) was developed (Levanony et al. 1987). Although highly specific
for the species, lower limit of detection is 104 cfu/g inoculant, still useful for inoculant evaluation for the reason explained above for bacteria load in inoculants. When
a production of inoculant fails, and the number of Azospirillum spp. is below the
detection level, but still the manufacturer needs to know the number of Azospirillum
spp. in the inoculant, this method can be combined with limited enrichment (Bashan
et al. 1991). Minor limitations of the immunological method are an access for antibody facility (many commercial facilities are available) and access to plate count
reader equipment that reads the ELISA plates.
26.4.3
Molecular Methods
Many molecular methods were developed and are capable of detecting specific
Azospirillum spp. Yet, only one technique, fluorescent in situ hybridization (FISH)
has been shown, so far, to detect this species in inoculants (Bashan et al. 2011) and
26
479
later on the roots of inoculated plants (Trejo et al. 2012). Because many FISH procedures are available, the technique described by Stoffels et al. (2001), but with numerous small modifications was used for detection of A. brasilense and A. lipoferum:
Hybridization was performed at 35 % formamide stringency at 46 C for 2 h. The
final concentration of the probe was 3 ng L1. Samples were then washed at 48 C
for 5 min with 50 mL of pre-warmed washing buffer. The slides were rinsed for a few
seconds with ice cold, deionized water and then air dried. Slides were stored at
20 C in the dark until observation. Three types of probes were used: an equimolar
mixture of probes EUB-338 I (Amann et al. 1990), and II and III (Daims et al. 1999)
that cover the domain of bacteria. An Azospirillum brasilense-specific probe (Abras
1420, Stoffels et al. 2001) was used for the two A. brasilense strains and Alila 1113
(Stoffels et al. 2001) for A. lipoferum. The probes Abras 1420 and Alila 1113 were
labeled with the fluorochrome FITC (green) and the mix of EUB I, II, and III was
labeled with the fluorochrome Cy3 (red). All fluorescent-labeled probes were purchased from Integrated DNA Technologies (Coralville, IA). Before visualization, the
slides were mounted in AF1 anti-fading reagent (Citifluor, London, UK).
Visualization was done with an epifluorescent microscope (Olympus) with two filters, the Cy3 filter (maximum excitation at 552 nm with maximum emission of light
at 565 nm, red fluorescence (Olympus America, Center Valley, PA)) and the FITC
filter (maximum excitation at 490 nm with maximum emission of light at 520 nm,
green fluorescence (Olympus America)). Positive fluorescent signals that identify
the bacteria are a combination of red and green that yields a green-yellow-orange
tone, depending on the intensities of the individual color channels. Evaluation of
Azospirillum spp. in the inoculant can be done either by fluorescent microscopy
where images in red and green are superimposed to create a green-yellow-orange
tone that provide absolute detection of the species (Fig. 26.2; Bashan et al. 2011) or
directly by confocal laser microscopy and quantification by an image analyzer (Trejo
et al. 2012).
The main advantage is specific identification of the species. The main limitation
of this technique is the skill of the technician and the availability of equipment,
which is expensive. Technologies for identifying specific strains of Azospirillum
spp. in inoculants have not been developed.
26.5
Inoculation Techniques
Azospirillum spp. can be inoculated directly on the seed surface or in the soil. Seed
applications greatly outnumber soil applications. This happens because it is easy to
use and requires a relatively small amount of inoculant and because Azospirillum do
not survive well in soils.
480
Fig. 26.2 Determination of the quality of the inoculant. Fluorescence in situ hybridization (FISH)
of Azospirillum brasilense Cd. (ad) after formulation and release from microbead alginate inoculant. Bars represent 1 m. Original figure published in Bashan et al. Biology and Fertility of Soils
47: 963969 (2011)
26.5.1
Seed Inoculation
There are many small variations of the basic technique. Using a variety of machinery, the basic technology of even seed-coating has not changed for decades. Briefly,
prior to sowing, seeds are dusted with peat inoculant, with or without water or
adhesive. For small seeds, this is followed by superfine, ground limestone, with or
without adhesive, and allowed to dry. Drying can be done in situ or when the coating is applied prior to sowing. The seeds, held in shallow trays, are air-dried or dried
by forced air. Coating and drying is also possible by using fluidized beds, where the
seeds are floating on a cushion of pressurized air and then sprayed with inoculant.
The inoculant is mixed with seeds either by hand, rotating drums that are cheap to
operate, large dough or cement mixers, or mechanical tumbling machines.
Alternatively, large farm operators use automated seeders fitted with an inoculant
26
481
tank, pump, and a mixing chamber commonly used for applying chemical coatings.
The latter are not specialized equipment for microbial inoculation, so inoculant may
be dislodged from the seeds.
Because every seed needs to be coated with a threshold number of Azospirillum
spp., adhesives (the same level that were mentioned before for liquid inoculants) are
used. A second role of an adhesive is to prevent the inoculant (either dry inoculant
as powder or wet inoculant once the moisture evaporates) from dislodging during
sowing with the seeding equipment, especially the powdered type, when applied
with air seeders. The seeds are then sown with common seeding equipment. While
it is commonly agreed that one essential condition to seed coating is adding adhesive materials, there is no agreement on what are the best adhesives. Each manufacturer or experimentalist empirically evaluates which adhesive best fits seeds and
inoculants. When seeds are inoculated with liquid inoculant, with or without dissolved adhesive, the inoculant is sprayed directly onto the seeds. After drying, the
seeds are sown.
Seed inoculation, despite their popularity in the marketplace, has several significant disadvantages. (1) Each seed, especially small ones, can be coated only
with a limited amount of inoculant, which may be a limiting factor because a
threshold of Azospirillum spp. (106107 cfu/g, Bashan 1986b) may be needed for
successful inoculation. (2) If an inoculant is not attached well with an adhesive or
by pelleting, it may be dislodged by the sowing machinery. (3) In some seedlings,
the seed coat is lifted out of the soil during germination, causing desiccation and
death of the inoculant bacteria if the inoculant had been applied directly to the
seeds. (4) Some species release anti-bacterial compounds from their seeds, which
can inhibit the inoculant. (5) Some fungicides and insecticides commonly applied
to the seeds may be detrimental to the inoculant (Bashan et al. 2004; Bashan and
de-Bashan 2010).
26.5.2
Soil Inoculation
This technique is popular with rhizobia but is far less useful for Azospirillum spp.
Only a few publications, mostly old, support this application. Therefore, at the stateof-the-art of our knowledge, this technique is not recommended for inoculation of
Azospirillum.
482
Fig. 26.3 Flow diagram of procedures for developing bacterial inoculants (Original figure published in Bashan et al. Plant and Soil 378: 133 (2014))
26
26.5.3
483
26.6
Conclusions
Inoculation of culture medium as inoculants is a recipe for failure under field condition. Proper formulation of Azospirillum is essential and irreplaceable for any successful inoculation beyond the level of test tubes and in vitro studies.
References
Albareda M, Rodriguez-Navarro DN, Camacho M, Temprano FJ (2008) Alternatives to peat as a
carrier for rhizobia inoculant: solid and liquid formulations. Soil Biol Biochem 40:27712779
Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, Stahl DA (1990) Combination of 16S
rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial
populations. Appl Environ Microbiol 56:19191925
Bashan Y (1986a) Alginate beads as synthetic inoculant carriers for the slow release of bacteria
that affect plant growth. Appl Environ Microbiol 51:10891098
Bashan Y (1986b) Significance of timing and level of inoculation with rhizosphere bacteria on
wheat plants. Soil Biol Biochem 18:297301
Bashan Y (1998) Inoculants of plant growth-promoting bacteria for use in agriculture. Biotechnol
Adv 16:729770
Bashan Y (1999) Interactions of Azospirillum spp. in soils: a review. Biol Fertil Soils 29:246256
Bashan Y, de-Bashan LE (2010) How the plant growth-promoting bacterium Azospirillum promotes plant growtha critical assessment. Adv Agron 108:77136
Bashan Y, Gonzalez LE (1999) Long-term survival of the plant-growth-promoting bacteria
Azospirillum brasilense and Pseudomonas fluorescens in dry alginate inoculant. Appl Microbiol
Biotechnol 51:262266
Bashan Y, Levanony H (1985) An improved selection technique and medium for the isolation and
enumeration of Azospirillum brasilense. Can J Microbiol 31:947952
Bashan Y, Levanony H (1987) Horizontal and vertical movement of Azospirillum brasilense Cd in
the soil and along the rhizosphere of wheat and weeds in controlled and field environments.
J Gen Microbiol 133:34733480
Bashan Y, Mitiku G, Ziv-Vecht O, Levanony H (1991) Estimation of minimal numbers of
Azospirillum brasilense using time-limited liquid enrichment combined with enzyme-linked
immunosorbent assay. Soil Biol Biochem 23:135138
484
26
485
Chapter 27
F.D.Cassn (*)
Laboratorio de Fisiologa Vegetal y de la Interaccin Planta-Microorganismo,
Universidad Nacional de Ro Cuarto, Ro Cuarto, Crdoba, Argentina
e-mail: [email protected]
C. Penna R. Massa
Stoller Biociencias SRL, CABA, Argentina
C.M. Creus
Laboratorio de Bioqumica Vegetal y Microbiana. Unidad Integrada Balcarce: Facultad de
Ciencias Agrarias, Universidad Nacional de Mar del Plata-EEA Balcarce, INTA,
Balcarce, Buenos Aires, Argentina
D. Radovancich
Laboratorio de Especialidades Medicinales Formosa SA (LAFORMED SA), Formosa, Argentina
E. Monteleone
Nitrasoil Argentina S.A., Quilmes, Buenos Aires, Argentina
I.G. de Salamone L. Di Salvo
Ctedra de Microbiologa Agrcola, Facultad de Agronoma, Universidad de Buenos Aires,
Buenos Aires, Argentina
I. Mentel
Planta Piloto de Procesos Industriales Microbiolgicos (PROIMI-CONICET),
San Miguel de Tucumn, Argentina
J. Garca M. Puente
Laboratorio de Bacterias Promotoras del Crecimiento Vegetal, IMYZA, INTA Castelar,
Castelar, Buenos Aires, Argentina
Springer International Publishing Switzerland 2015
F.D. Cassn et al. (eds.), Handbook for Azospirillum,
DOI10.1007/978-3-319-06542-7_27
487
488
489
490
conditions, was developed. The main features to identify the microorganisms in this
medium were scarlet red staining of the colonies and rough and flattened structure
on their surface. These allowed easy identification and selection even in the presence of other rhizosphere microorganisms. Thus, this medium, proposed by Enrique
Rodrguez Cceres in 1982, was named RC (Fig.27.2). After that, this new tool
allowed isolating a large number of strains from different crops and obtaining a collection of 64 strains, which were lyophilized for conservation at the Instituto de
Microbiologa y Zoologa Agrcola (IMYZA) of the Instituto Nacional de Tecnologa
Agropecuaria (INTA) Castelar (Buenos Aires, Argentina).
27.2 P
rotocol fortheEvaluation ofInoculants Containing
Azospirillum spp.
27.2.1 Conservation ofSamples
In the case that the samples are transported to the laboratory in their original container, during transportation and storage, these must be kept under the conditions
recommended by the manufacturer. Rapid temperature changes can cause changes
in moisture in the solid products by condensation or induce physiological changes
in the microorganisms. Control samples must be kept at room temperature and away
from direct sunlight.
491
27.2.3 E
numeration ofViable Cells ofAzospirillum spp. Using
thePlate Count Technique by Spreading ontheSurface
inRed Congo (RC) Medium
27.2.3.1 Preparation oftheHomogenate
Shake the container vigorously for 30s.
Remove 10mL of the product under flame or laminar flow, with syringe and
needle or sterile pipette.
Dilute with 90mL of physiological solution, with the addition of Tween 80 to a
final concentration of 0.01% (0.360mL of Tween 80 stock solution.
Methodological Annex 3) per 90mL of physiological solution. This is considered the 101 dilution.
Shake for 1520min in any of the following conditions:
Linear stirrer with a 250-mL Erlenmeyer flask (point 3 or similar).
Orbital shaker with a 500-mL Erlenmeyer flask at 150rpm (2.5 of eccentricity).
Magnetic stirrer with 250-mL Erlenmeyer flask at 300350rpm with a magnetic bar (407mm).
27.2.3.2 Preparation ofWorking Dilutions
Remove the Erlenmeyer flask from the agitator (the 101 dilution must be homogeneous, avoiding precipitation or phase separation).
Remove 1mL of the 101 dilution, preferably with automatic pipette, and place
it in a test tube containing 9.0mL of sterile saline.
This dilution is called 102. Vortex for 20s to mix thoroughly.
Repeat the previous step until dilution 107, as shown in Fig.27.1.
492
Fig. 27.1 Scheme of the tenfold dilution procedure to estimate viable cell enumeration
493
Fig. 27.2 Scarlet red colonies of Azospirillum spp. in Petri dishes containing RC culture medium,
according to Rodrguez Cceres (1982). Photographic credit: (a, b) Mariana Puente, (c) Luciana
Di Salvo, and (d) Lina Lett
Fig. 27.3 Schematic counting of the colonies in plate. Photographic credit: Mariana Puente
to the formula described below and then the result is averaged. Typical colonies
of Azospirillum spp. are usually scarlet red, circular, convex, 13mm in diameter, and raised edges, as shown in Fig.27.2. Count example is shown in Fig.27.3.
494
Formula
The result is expressed as colony forming units per milliliter (CFUmL1) and is
calculated as follows:
CFUmL1 = no of colonies counted 10 dilution factor
where number of colonies is the average number of colonies present in the three
reading plates, aliquot factor is 10 if 0.1mL is used for spreading on the plates, and
dilution factor is the inverse of the dilution in which the colonies are counted to
obtain the result.
27.2.4 R
eference Procedure fortheDetection
ofContaminating Microorganisms
To detect contaminating microorganisms, we suggest direct spreading from the
container with spatula and by depletion in plates with trypticase soy agar (TSA) for
bacteria in general or with Sabouraud agar for saprophytic fungi. In addition, we suggest carrying out Gram staining and observing a direct sample under a microscope.
27.2.4.1 S
preading inCulture Medium fortheDetection
or Quantification ofContaminants
Spread on the surface a loaded spatula obtained directly from the sample without
burning.
Incubate the TSA plates in an incubation chamber at 2830C for 4872h and
the Sabouraud agar plates at 24C for 72h.
27.2.4.2 Observation ofSlides Stained withGram Stain Modified by Hucker
Preparation ofSmears
On a clean slide, place a drop of the material to be analyzed.
Spread with a spatula and fix by cutting several times the oxidant flame of the
burner.
Proceed to staining.
Staining Technique
(a) Reagents
Preparation of reagents and solutions. See Methodological Annex 4. Follow
the procedure of the manufacturer if you work with a commercial kit.
495
496
27.2.6 P
rocedure toEvaluate theMicroaerophilic and
Diazotrophic Capacity ofPresumptive Bacterial Colonies
Since it is common to observe dimorphism of colonies in RC medium plates inoculated
with Azospirillum sp., our strategy to assume the presence of the microorganism is
based on the evaluation of the bacterial ability to fix atmospheric nitrogen under microaerophilic conditions, by means of a procedure modified from Dbereiner etal. (1995).
27.2.6.1 Preparation oftheMedium
Prepare semisolid NFb medium as mentioned in point 2 of the Methodological
Annex and as it is presented in Fig.27.4.
Load 10mL sterile flasks with 5mL of freshly sterilized medium.
27.2.6.2 Inoculation ofNFb Medium
Inoculation is carried out from the presumptive bacterial colonies obtained in the
RC medium.
Select a colony with an inoculating loop and seed at depth on the semisolid medium.
Incubate between 4 and 6 days in an oven at 2830C.
Presumptive growth is considered in those cases in which the presence of a cloud
or halo of growth is observed below the surface of the culture medium (Fig.27.4).
Methodological Appendix
Agar-RC Medium (AgarCongo Red)
Component
K2HPO4
MgSO47H2O
NaCl
Yeast extract
FeCl36H2O
dl-malic acid
KOH
Congo red solutiona
Agar
H2O
Amount
0.5g
0.2g
0.1g
0.5g
0.015g
5.0g
4.8g
15.0mL
20.0g
1,000mL
Component
Congo red
H2O
Amount
2.5g
1,000mL
Amount
5.0g
0.5g
0.2g
0.1g
0.02g
2.0mL
2.0mL
0.015g
4.5g
1.8g
1,000mL
Amount
0.5g
100mL
497
498
Amount
0.286g
0.235g
0.024g
0.008g
0.2g
200.0mL
Micronutrient solution
Amount
5g
200mL
Prepare solutions A and B separately and use a working solution prepared with 4mL
of solution A, 36mL of distilled water, and 160mL of solution B.
Lugols Iodine Solution
Iodine
Potassium iodide
Distilled water
1g
2g
300mL
Safranin
Alcohol 95
2.5g
100mL
Safranin Reagent
499
References
Baldani VLD, Baldani JI, Dbereiner J (1983) Effects of Azospirillum inoculation on root infection
and nitrogen in wheat. Can J Microbiol 29(8):869881
Bashan Y, Holguin G, de-Bashan L (2004) Azospirillum-plant relationships: physiological, molecular, agricultural, and environmental advances (19972003). Can J Microbiol 50:521577
Bottini R, Fulchieri M, Pearce D, Pharis R (1989) Identification of gibberellins A1, A3, and Iso-A3
in cultures of A.Lipoferum. Plant Physiol 90:4547
Dbereiner J, Day JM (1976) Associative symbioses in tropical grasses: characterization of microorganisms and dinitrogen-fixing sites. In: Newton WE, Nyman CJ (eds) Proceedings of the 1st
international symposium on nitrogen fixation. Washington State University Press, Pullman,
pp518538
Dbereiner J, Baldani V, Baldani I (1995) Como isolar e identificar bacterias diazotrficas de plantas nao-leguminosas. MAARA-EMBRAPA-CNPAB, Brasilia, p60
Figueiredo M, Burity H, Stamford N, Santos C (2008) Microrganismos e agrobiodiversidade: o
novo desafio para a agricultura. Agrolivros, Guaiba, p100
Okon Y, Labandera C (1994) Agronomic application of Azospirillum: an evaluation of 20 years
worldwide field inoculation. Soil Biol Biochem 26(12):15911601
Okon Y, Albrecht S, Burris R (1977) Methods for growing Spirillum lipoferum and for counting it
in pure culture and in association with plants. Appl Environ Microbiol 33:8588
Rodrguez Cceres E (1982) Improved medium for isolation of Azospirillum spp. Appl Environ
Microbiol 44(4):990991
Rodrguez Cceres E, Gonzlez Anta G, Lpez JR, Pacheco Basurco JC, Parada JL (1995)
Response of field grown wheat to inoculation with Azospirillum brasilense and Bacillus polymyxa in semiarid region of Argentina. Arid Soil Res Rehabil 10:1320
Strzelczyk E, Kamper M, Li C (1994) Cytocinin-like-substances and ethylene production by
Azospirillum in media with different carbon sources. Microbiol Res 149:5560
Tien T, Gaskin M, Hubbell D (1979) Plant growth substances produced by Azospirillum brasilense
and their effect on the growth of pearl millet (Pennisetum americanum L.). Appl Environ
Microbiol 37:10161024
Index
A
Abiotic stresses
alleviation, 345346
Azospirillum, 352354
hormone activity, 116
plant responses, 337338
rhizobacteria, 324327, 349351
SA, 120
N-Acyl-l-homoserine lactones (AHL)
bacterial genes, 264
detection
biosensors, 265, 266
Chromobacterium violaceum, 265, 267
extractions, 268269
sensitivity, 267268
sensor strain grown, 267
structural identification, 270
TLC, 269270
QS regulation, 265 (see also Quorumsensing (QS) regulation, AHL)
structures, 263, 264
Vibrio fischeri, 263
Agar-RC medium (Agar-Congo Red), 499
Airliquid interface, biofilms, 210
Alginate formulations
advantages, 477
disadvantages, 477
macrobead production, 478
microbead production, 478
Alleviation, plant stress. See Plant stress
alleviation
1-Aminocyclopropane-1-carboxylate (ACC)
deaminase
abiotic stresses, 352354
biochemistry, 288289
501
502
Auxins
abiotic and biotic stress, 118
biosynthesis and metabolism, plants and
bacteria, 116117
cell elongation, 116
chemically defined culture medium, 126
mVOCs, 309
plant defense signaling networks, 336
plant growth regulator, 416
vascular differentiation, in plant, 353
AzospirillumAM fungi interaction
artificial seed and soil inoculation
techniques, 427429
associative diazotrophs, 426
CLPPs, 423
co-inoculation, ECM fungi and PGPR, 427
DGGE, 423
ecological and biotechnological
significance, 422
ectomycorrhizal fungi, 427
metabolite production, 424
microorganisms interactions, 423
microsymbionts, 422
mutual synergistic interactions, 421
mycorrhizosphere, 421
nitrogen-fixers, 422
PGPB, 422
polymicrobial formulations, 425
rhizosphere-mycorrhizosphere systems,
426
RISA, 423
strains, 422
synergistic and antagonistic effects, 427
synergistic interactions, 425
Azospirillum and PGPR inoculation
abiotic stresses, 450
fruit and vegetable production, 450
phytohormone production, 451
product quality and nutritional value
parameters
antioxidant activity, 459462
ascorbic acid concentration, 462464
total phenolics content, 464466
seed inoculation (see Seed inoculation
techniques)
Azospirillum brasilense
and A. lipoferum, 398
alleviate plant stress, 339342
Az39, 323324
and Cd, 414
and Chlorella vulgaris, 372, 379
co-immobilization, 376
drought tolerance, 323
EO production, 314
Index
inoculation, 415
NaCl concentrations, 323
in PCR-DGGE profiles, 378
and P. fluorescens, 392, 404406
REC2 and REC3, 344
rice plants, 345
Sp7 and Cd resistant, 323
Sp245 cell membrane, 323
strains, 417
Azospirillum brasilense Az39, 122, 323,
327, 492
Azospirillum brasilense Sp245
and A. lipoferum 4B, 77
cell membrane, 323
intercellular spaces, 50
IPA pathway, 117
nitrogen cycle, 139
NO production, 159
plasmid 2, 140
wheat roots, 48
xylem vessels, 353
Azospirillumrhizobacteria co-inoculation
agronomic applications, 415417
Azospirilla, 411412
leguminous plants, 412415
PGPR, 411
plant growth and nodulation parameters,
412
Azospirillum spp.
BHI, 5
co-immobilized with microalgae, 373
culturable N-fixing bacteria, 910
diazotrophic bacteria (see Diazotrophic
bacteria)
DNA homology, 4
genomic tools (see Bioinformatics tools,
Azospirillum)
genus-specific primers, 36
in industrial setting, 472
manufacturers, 472
media
autoclaving, 17
BAz medium and BAc agar plates, 16
enrichment and cultivation, 1315
JMV medium (Burkholderia spp.), 16
JNFb medium (Herbaspirillum spp.), 16
LGI-P medium (Gluconacetobacter
diazotrophicus), 16
oxygen-protective mechanisms, 15
potato medium, 16
molecular tools, PGPR (see Plant
growth-promoting rhizobacteria
(PGPR))
N-free NFb medium, 4
Index
physiological tests
carbon sources, Biolog/API systems,
1719
classification, 20, 21
culture preservation, 22
N-fixing, acetylene reduction activity,
1920
plant samples, solid and semi-solid media,
4, 5
proteobacteria, -subclass, 3
serial dilution technique, 4
in situ localization (see In situ localization,
Azospirillum spp.)
standard tenfold dilution plating
technique, 6
B
Bacillus subtilis, 161, 314
Bacterial genome sequencing
de novo sequencing, 85
NGS technologies, 84
Sanger sequencing, 84
SNPs, 85
Beta carotene bleaching test
antioxidant capacity calculation, 460
equipment and supplies, 459
procedures, 459460
test principles, 459
Biofilms
A. brasilense, 200, 201
B. subtilis, 161
c-di-GMP, 203204
cell density, 203
definition, 200
extracellular fibrils, 202
fluorescent and confocal microscopy
CLSM, 219
Raman spectroscopyCLSM
combination, 220
sample preparation, 219
staining options, 219220
genetic studies, 200
growth conditions and culture media,
204205
GSNO, 169
inoculant formulations, 429
microorganisms, 200
multiwell microtiter plate assay (see
Microtiter plate assay)
PGPR, 199
polar flagella, 201202
receptor proteins and riboswitches, 203
rhizobia attachment, 200
503
staining techniques, 211
surfaces types, 205206
transmission electron microscope, 218
viable cell quantification, colony, 210211
Bioinformatics tools, Azospirillum
annotation and visualization, 8586
bacterial genome sequencing, 8485
genome assembly, 8586
GIs, 8889
ISfinder, 90
orthologs and protein families, 9091
phages, 8890
phylogenomics and pangenome model,
9192
prophages, 8990
reference databases and integral web
resources, 8688
whole genome alignments, 88
Biopriming, 452
Biotic stresses
alleviation, 344345
Azospirillum, 351352
plant responses, 335336
rhizobacteria, 346349
Brain-heat infusion (BHI) agar, 5
C
Calcofluor assay, 216
Calgary biofilm device, 209
Carbohydrate production
AGPase, 381382
Azospirillum spp. with microalgae, 381
carbohydrates, 381
D-glucose/Na-acetate uptake, 381
starch, 381
CGT. See Cool germination test (CGT)
Chemotaxis, in Azospirillum
aerotaxis assay, 104105, 110, 111
agricultural applications, 113
Brownian motion, 102
capillary assay, 104
chemical-in-plug assay, 108110
chemoeffector concentrations, 103
citric acid cycle, 104
electron acceptors, 105
energy taxis, environmental sensing, 106
environmental signals, 102
flagellar-based motility, 112
long-term adaptive responses, 101
MCP, 102
mini-plug assay, 110
molecular mechanism, 102
motile bacteria, 102
504
Chemotaxis, in Azospirillum (cont.)
polyhydroxybutyrate, 107
redox taxis, 105106
sensing and signaling, 113
signal transduction pathways, 103, 112
soft agar plate assay, 108
spatial and temporal gradient assays, 106,
107
taxis responses, 106
temporal gradient assay, 111112
Chlorella vulgaris
counting, 380
C. vulgarisA. brasilense interactions, 371,
372, 376, 379
growth rate, 380
violaxanthin, 380
Citric acid cycle, 104, 252
CKs. See Cytokinins (CKs)
CLPPs. See Community-level physiological
profiles (CLPPs)
CLSM. See Confocal laser scanning
microscopy (CLSM)
Clusters of Orthologous Genes (COG), 87
Co-immobilization techniques
animal and human feed, 379380
C. vulgaris and A. brasilense, 368
OAB medium, 368371
Colony biofilm assay
principle, 208
protocol, 208209
Community-level physiological profiles
(CLPPs), 423
Confocal laser scanning microscopy (CLSM)
A. brasilense Sp245, 48
with FISH, 47, 219, 221
with Raman spectroscopy, 220
sample preparation, 219
staining options, 219220
Continuous flow system, 210
Cool germination test (CGT)
as complementary tool, 455
description, 455
equipment and supplies, 455
procedures
groups, seedlings, 456
seed germination, in paper rolls, 455,
456
superficial drying, 455
and SGT, 459
Crops inoculation
abiotic stresses, 442
cereals crops, 438
contamination, 439
definition, 444
Index
field trials, 438
growth, 438
incremental revenue distribution, 444, 445
INTAAz39 treatments, 442
maize price, 444
mean values, 443, 444
net price, 443
nutrient availability/irrigation, 440
procedure, 439
seed treatment, 439
soil type and temporal variability
ANOVA, 441
Azospirillum brasilense strain, 440
maize distribution parameters, 442
shoot dry matter and grain production,
441
stakeholders, 438
temporal and spatial interactions, 440
Crystal violet (CV) staining
calculations, 211
principle, 211
procedure, 211
Cyclic diguanosine monophosphate
(c-di-GMP), 203
Cytokinins (CKs)
applications, 119
biosynthesis, Azospirillum sp. and PGPR,
119
oxidase/dehydrogenase action, 119
phytopathogenic bacteria, 119
plant development phases, 118
D
DAF. See Diamine derivatives of fluorescein
(DAF)
3,4-Dehydroproline (DHP), 323
Deleterious peak, 353
Denaturing-gradient gel electrophoresis (DGGE)
Azospirillum species, soil samples, 33
PCR amplicons, 37
soil microbial communities, 423
16S rRNA gene products, 378
statistical analysis, 38
DHP. See 3,4-Dehydroproline (DHP)
Diamine derivatives of fluorescein (DAF)
cellular lysis, 163
controls, types, 162
DAF-2 DA, 161
materials and reagents, 161
NO detection, 160, 161
NO fluorescent probes, 160
probe assay, 162
reagent preparation, 162
Index
Diazotrophic bacteria
antibodies and molecular probes (see In
situ localization, Azospirillum spp.)
counting, solid media
bacterial pellicles, 13
Gluconacetobacter diazotrophicus, 12
isolation, Azospirillum, 1112
description, 6
disease symptoms, 7
environmental samples and human
pathogens, 8
Gluconacetobacter diazotrophicus, 7
media, plant tissues and soil samples, 6, 7
most probable number (MPN) counting,
McCradys tables, 10, 11
semi-solid medium, estimation, 10
Dichlorophenolindophenol (DCPIP) reduction,
463, 464
1,9-Dimethyl methylene blue (DMMB)
principle, 216
procedure, 216217
2,2-Diphenyl-1-picrylhydrazyl (DPPH) radical
scavenging assay
equipment and supplies, 461
procedures
activity calculation, 462
extract analysis, 462
plant tissue antioxidant extraction,
461462
test principles, 461
use, 460
Disease suppression, Azospirillum-mediated,
191192
DMMB. See 1,9-Dimethyl methylene blue
(DMMB)
DNA Data Bank of Japan (DDBJ), 86
DNADNA hybridization assay, 4041
Dual inoculation, Azospirillum and
Mycorrhiza
formulations and techniques types, 427
macro-alginate beads, 429
PGPM strains, 429
PGPR strains, 428
polymicrobial inoculant formulation,
427428
E
Effector-triggered immunity (ETI), 335
EIN3 family. See Ethylene-insensitive 3
(EIN3) family
Electrochemical methods
calibration, 164
carbon/platinum-coated, 163
505
Escherichia coli, 163
materials and reagents, 164
membranes, 163
real-time Azospirillum, 165
sensor calibration, 164
Electron paramagnetic resonance (EPR)
assay, 160
biological applications, 159
materials and reagents, 160
transient nature, 159
Ethylene-insensitive 3 (EIN3) family, 336, 337
Exopolysaccharides (EPS), 349, 352, 353
F
Facultative endophytes, 491
Fatty acid methyl esters (FAME), 39, 326
Fatty acids and lipid production
ACC, enzymatic activity, 383384
Agilent Technologies, 383
autotrophic and heterotrophic growth
conditions, 382
hexane layer, 382
pre-programmed steps, 383
PTFE film, 382
quantification and subsequent
identification, 382, 384
standard curve, 384
Fertility, eroded soil
A. brasilense, 377
applications, 377
biological wastewater treatment, 377
DGGE gels, 378
DNA extraction, 377
microbial biomass, 379
OTU, 378
PCR-DGGE analysis, 378
polymerase chain reaction, 377378
root colonization by FISH, 379
Tukeys post hoc analysis, 379
Fluorescence in situ hybridization (FISH)
A. brasilense, 482
application, 222
cell counting, 375
dissolve beads, 374
hybridization buffer preparation, 5254
hybridization oligonucleotide probes, 53
in situ hybridization, 54, 374
microalgaebacteria interactions, 375
microbial colonization patterns and
community composition, 221
oligonucleotide probes, 221
PFA fixation solution preparation, 52
plant sample fixation, 49, 51
506
Fluorescence in situ hybridization (FISH) (cont.)
principle, 221222
procedure, 222
root fixation, 52
samples, fixation and preparation, 374
sliced beads, 374
visualization, 375
Fluorescently labeled/enzymatic markers
A. brasilense gfp-and gusA-labeling, 58
antibiotic resistance/strain sensitivity, 59
bacterial colonization, 57
endophytic colonization, sugarcane, 58
gene marker transfer
conjugation, 5960
electroporation, 60
selection marker and vector, 58
Fluorometric detection, biofilms
autofluorescence, 212213
DAPI, 214
live/dead staining techniques, 214
principle, 213
procedure, 213
Resazurin assay, 215
tagging bacteria
GFP, 215
principle, 215
FolinCiocalteu assay
equipment and supplies, 465
phenolics content determination, 464
procedures
A724 determination, 465466
sample preparation, 465
typical A724 vs. garlic acid (GA)
concentration, 465
technique principles, 464
G
GC-MS with selective ion monitoring
(GC-MS-SIM), 133, 134
GenBank-RefSeq, 86
Gene expression, Azospirillum
promoter-bound reporter genes, 7576
qRT-PCR (see Quantitative reverse
transcribed PCR (qRT-PCR))
RNA extraction, 76
Gene marker transfer
conjugation, 5960
electroporation, 60
Genetic transformation techniques. See also
Mutagenesis and genetic
transformation, in Azospirillum
biparental conjugation, 70
morphological traits, 72
Index
plasmid-mobilizing E. coli donors, 70
proline-free minimal medium, 71
promoter-bound reporter genes, 75
triparental conjugation, 70
Genome analyses, QS
A. brasilense strains, 273
BLASTP, 274
genetic organization, 273, 274
InterPro family IPR001690, 272
LuxI and LuxR proteins, 274276
Genomic DNA extraction
freeze-boil method, 74
large scale Azospirillum, 74
PCR amplification, 73
Southern blotting, 73
Genomic islands (GIs)
Azospirillum genomes, IslandViewer,
92, 93
computational programs, 8889
genomic strategies, bioinformatics tools
and databases, 89
GIS prediction, 89
horizontal gene transfer, 88
Gibberellins (GAs)
biosynthesis, Azospirillum sp. and PGPR,
118
chemically defined culture medium, 118
detection and quantification, 126
tetracyclic diterpenoid plant hormone, 117
Goulds S1 medium, 394, 402
Gram staining technique, 500
Group S-nitrosoglutathione (GSNO), 168, 169
H
Head space-solid phase microextraction
(HS-SPME), 312
High-performance liquid chromatography
(HPLC), 39, 129, 133, 246247,
270, 296297, 380, 383, 414
Hydrogen cyanide (HCN), 312, 348, 351
I
Immunogold labeling method
chemical fixation, roots, 55
IGL-SE, 57
sample preparation, 5556
Immunogold silver-enhancement (IGL-SE), 57
Indole-3-acetic acid (IAA)
A. brasilense Sp7, 414
and ACC deaminase, plant growth, 290
and indole-acetic acid, 353
and nitric oxide, 414415
Index
transport and signal transduction, 291
Induced systemic resistance (ISR)
definition, 343
induction, 349
mVOCs, 308
PGPR, 343
Pyricularia oryzae, 352
Inoculant formulation, Azospirillum spp.
alginate inoculants (see Alginate
formulations)
characteristics, 474
field-scale use, 474
liquid inoculants, 475
peat inoculants, 475476
primitive inoculants, 474475
synthetic inoculants, 476477
Inoculation techniques
industrial considerations, 484, 485
microbial inoculants development, 484,
485
seed applications, 481
seed inoculation, 482483
soil inoculation, 483484
Inorganic nitrogen metabolism, Azospirillum
spp.
A. brasilense Sp245, 139, 140
ammonia assimilation, 140
ammonium/methylamonium ions transport,
147148
diazotrophic growth and nitrogenase
de-repression, 151
metabolic characterization, 139
metabolic pathways, 140
NFbHP growth medium, 150151
nif gene cluster, 140
nitric oxide reductase norBCQD, 140
nitrogenase activity (see Nitrogenase
activity)
nitrous oxide reductase nosZ, 140
oxygen concentrations, gas phase, 151
physiological methods, 140
Insertion sequences (IS), bacterial, 72, 90
In situ localization, Azospirillum spp.
cell labeling, fluorescence/enzymatic
markers, 5760
FISH (see Fluorescence in situ
hybridization (FISH))
Gluconacetobacter diazotrophicus PAL5,
49, 50
immunogold labeling, light microscopy
and TEM, 5457
intercellular spaces, A. brasilense Sp245,
49, 50
light microscope-based approach, 48
507
molecular genetic and immunochemical
methods, 46
rice roots, Herbaspirillum seropedicae,
49, 51
SCAR-markers, 6162
wheat root, colonization
A. brasilense Sp7, 49
A. brasilense Sp245, 47, 48
International Nucleotide Sequence
Database, 86
Intra-semen method, 452, 453
ISR. See Induced systemic resistance (ISR)
J
Jasmonates (JAs)
bioactive oxylipins, 120
biosynthesis and metabolism, bacteria, 121
JA-Ile, 120121
microbial pathogen resistance, 336
phytohormones extraction, 124
Jasmonoyl-Ile (JA-Ile), 120121
K
Kyoto Encyclopedia of Genes and Genomes
(KEGG), 87, 88
L
Lectins assay
Concanavalin A, 217
procedure, 217
Lipochitin oligosaccharides (LCOs), 412, 414
Lipophilic dyes
blue-stained PHB, 243
colony staining
Nile Red, 244
Sudan black B, 243244
Lipopolysaccharides (LPS), 349
Liquid inoculants, 475
M
Maize seeds
with A. brasilense and P. fluorescens
on grain yield, 406
on plant biomass, 406
agronomic information, 405
with siderophore-producing
pseudomonads, 254
soil chemical analysis, 406
1-(Malonylamino)cyclopropane-1-carboxylic
acid (MACC), 290
508
Mass spectrometry (MS)
AHLs, structural identification, 270
coulomb explosion, 131
electrically charged molecules, 130
electrospray ionization, 130
with gas chromatography, 258
GC-MS-SIM
cytokinins determination, 133
simultaneous determination, 134
high-performance liquid chromatography,
130, 131
HPLC-LC-MS, 133
LC-ESI-MS-MS, 134135
Magenta box method, 310
microtiter plate method, 310
trace chromatograms, MRM mode, 131, 132
Mesorhizobium species, 294, 320
Methyl accepting chemotaxis protein ( MCP),
102
Microbial volatile organic compounds
(mVOCs)
adsorption and desorption, 308
analysis and identification, 312
applications, 314315
A. thaliana, 309
bioconversion, 307
as biomarkers, 311
culture medium, 313314
fermentation pathways, 308
filter headspace collection method, 311312
functions, 308
host plants, 307
HS-SPME, 312
ISR, 308
metabolic reactions, 307
PGPR, 309
phytopathogens
divided plate method, 310311
sealed plate method, 311
plants
divided plates method, 309310
magenta box method, 310
microtiter plate method, 310
plastic square plate method, 310
rhizobacteria VOCs, 308
saturated solutions, 311
sealed system, 312313
as Super-Scent and DOVE-MO, 308
Microtiter plate assay
A. brasilense biofilm formation assay,
207208
PGPR technique, 207
Molecular methods, Azospirillum, 480481.
See also Mutagenesis and genetic
transformation, in Azospirillum
Index
Morphological transformation, Azospirillum
aggregation
bioassay, 185186
quantitative measurement, 185
carbon sources, 181, 182
characteristic formation, 182
colonies, 181, 182
FlcA, 183184
flocculation, 184185
phase-contrast microscopy, 184
pleomorphism, 183
proliferation, 182
ultrastructure, 183
MS. See Mass spectrometry (MS)
Mutagenesis and genetic transformation, in
Azospirillum
chromosomal modifications, 65
electroporation and conjugation, 7072
gene expression (see Gene expression,
Azospirillum)
genomic DNA extraction, 7374
plasmid vectors
gene discovery, 68
genomic libraries, 66
pLA2917, 66, 67
pLAFR3, 66
plasmid pCIB100 (ColE1 replicon), 70
pVK100, 66, 67
stable vectors, 68
suicide vector pSUP2021, 69
transposon and gene knockout, 7273
mVOCs. See Microbial volatile organic
compounds (mVOCs)
Mycosphaerella graminicola, 348
N
N-acetylglutaminylglutamine amide
(NAGGN), 325
NFb semisolid medium, 499500
Nitrate metabolism
assimilatory and dissimilatory reduction,
149
denitrification, semi-solid medium, 149
oxygen, nitrate reductase induction, 150
Nitric oxide (NO)
bioactive molecule, 156
chemical properties, 156
culture media and growth conditions,
165166
description, 156
endogenous-free radical, 157
genetic approach, 170171
histochemical approach
detection, 172, 173
Index
in inoculated plants, 174
materials, 172
plant-rhizobacteria associations, 172
tissue sections stain, 172, 174
measurement (see Rhizospheric
microorganisms)
oxidation, 156
PGPR, 156
pharmacological approach
definition, 167168
donors, 168
scavengers, 168
SNP/GSNO/NO donors, 168170
production pathways, 166167
Nitrogenase activity
ARA, 19
de-repression
cell density, 144
inoculum size, 145
nitrogen source, 144145
in liquid medium
ADP-ribosylated dinitrogenase
reductase, 146147
de-repression, cell density effect, 144
inoculum size effect, 145
nitrogenase de-repression and activity,
142
nitrogen source effect, 144145
oxygen concentration, in gas phase,
143144
switch-off /on by ammonium ions, 146
in semi-solid medium
inoculum size effect, 142
time course, 141142
switch-off/on experiment, 146
Nitrogen fixation (NifH), 170
acetylene reduction activity, 15
oxygen concentrations, 182
plant growth promoting activities, 28
semi-solid media, 141
Non-metric multidimensional scaling
(NMDS), 378
O
OAB medium, 165, 368, 453, 472473
Operative Taxonomic Unit (OTU), 378
oprF gene, internal fragment, 395, 396
P
PAA. See Phenylacetic acid (PAA)
PAMPs. See Pathogen-associated molecular
patterns (PAMPs)
PAMP-triggered immunity (PTI), 335
509
Pan-genome analysis pipeline (PGAP), 92
Pangenome model, 9192
Parental strains
monosaccharide composition, 232
phenotypic variants, 234
survival, variants, 236237
variants, effect, 237238
Pathogen-associated molecular patterns
(PAMPs), 335
PCR-denaturing gradient gel electrophoresis
(PCR-DGGE), 34, 37, 378
Peanut-nodulating rhizobia, 326
Peat inoculants, 475476
Pectobacterium carotovorum, 308
PGPB. See Plant growth-promoting bacteria
(PGPB)
PGPF. See Plant growth-promoting fungi
(PGPF)
PGPR. See Plant growth-promoting
rhizobacteria (PGPR)
Phage Orthologous Groups (POGs), 90
PHB. See Polyhydroxybutyrate/poly-hydroxybutyrate (PHB)
Phenotypic/phase variation (PV)
A. brasilense Sp7, 232
bacterial species, 232
CPS and LPS, 232
environmental changes, 231
EPS, CPS and LPS extraction, 235236
extracellular polysaccharides, 235
genome-sequencing experiments, 233
genomic analysis, 234235
molecular mechanisms, 232
parental strains, 236237
variants and assessing stability, 233234
Phenylacetic acid (PAA), 351
Photosynthetic pigments
chlorophylls, 380
microalgal pigments, 380
wheat plants, 380
Phylogenomics, 83, 88, 9192
Phytohormones and plant growth regulators
ABA, 121122
auxins, 116117
biological activity
CKs determination, 128
GAs determination, 126127
IAA determination, 127128
CKs, 118119
extraction, purification and quantification
protocols, 116
GAs, 117118
hormone activity, 116
IAA, spectrophotometry, 128129
JAs, 120121
510
Phytohormones and plant growth
regulators (cont.)
MS (see Mass spectrometry (MS))
SA, 122123
sample assessment
ABA determination, 124125
bacterial culture, IAA determination,
126
bacterial culture medium, 125
JA determination, 124
signaling systems, 115116
Plantbacteria interaction
Azospirillum spp., 367368
Chlorella spp., 368
Plant-beneficial functions, 335, 354
Plant growth-promoting bacteria (PGPB)
ACC deaminase, 289, 291, 292, 299300
biotic and abiotic stresses, 287
free-living, 293294
IAA, 290
and microalgae, 372
Plant growth-promoting fungi (PGPF),
319320
Plant growth-promoting rhizobacteria (PGPR)
agronomical application, 392, 407
and Azospirillum spp.
A. brasilense, 156, 406
genus-specific primers, 36
occurrence, 28, 3031
phylogenetic analysis, 28, 29
strains, 353
bacterial genomic DNA, 34
bacterized seeds, 402
beneficial effects, 186
biochemical and chemotaxonomic
characterization
DNADNA hybridization assay, 4041
FAME, 39
polar lipids, 39
polyamines, 39
biomass/activity determination, 33
dilution plating technique, 36
drought-response transcript abundances, 350
fatty acid profiles, 28, 3132
genus-specific PCR-based technique, 33
morphological and physiological
characterization
carbon source utilization pattern, 39
catalase activity, 38
cell morphology, 38
gram staining, 38
mVOCs, 310 (see also Microbial volatile
organic compounds (mVOCs))
N-metabolism, 19
nucleic acid analysis, 34
Index
PCR
and DGGE analysis, 37
nifH gene sequencing, 35
and 16S rRNA gene sequencing, 3435
P. fluorescens, 406
plant-beneficial functions, 354
polar lipid profiles, 29, 32
polyphasic approaches, 3334
qPCR, SCAR-markers, 6162
rRNA-targeted oligonucleotide probes, 29
RT-PCR, 3738
seed/substrate inoculation, 451
Spirillum lipoferum, 28
structure improvement, 451
Xanthomonas oryzae, 352
Plant roots, Azospirillum attachments
A. brasilense, 235
ACC deaminase enzyme, 294
colonisation efficiency, 184
cps mutants, 186
exogenous auxin, 350
genetic tools, 187
labelling, strains, 187
N2-fixing bacteria, 412
PGPR, 413
phenotype, 186
plasmid DNA, 186187
Rhizobium and Agrobacterium, 186
Plant stress alleviation
Azospirillum
abiotic stresses, 345346, 352354
biotic stresses, 344345, 351352
Rhizobacteria
ACC deaminase, 338
Bacillus and Arthrobacter strains, 338
ISR, 343
mechanisms against abiotic stresses,
349351
mechanisms against biotic stresses,
346349
taxonomic and functional diversity,
338342
Plate count technique
dilution plating, 494
homogenate preparation, 493
incubation, 494
reading
colony forming units per milliliter
(CFUmL-1), 496
counting, 495
scarlet red colonies, 495
viable cell enumeration, 494
working dilutions, preparation, 493
PLP. See Pyridoxal 5-phosphate (PLP)
Polar lipids
Index
Azospirillum strains, 29, 32
lipid composition, 322
PGPR, 39
Polyamines
abiotic stresses, 337
PGPR, 39
plant growth regulatory substances, 28
Polyhydroxybutyrate/poly--hydroxybutyrate
(PHB), 182183
accumulation, 242
biosynthesis, 241242
carbon oversupply, 241
Fourier transform infrared spectroscopy,
247248
gas chromatography, 244246
and HPLC, 246247
lipophilic dyes, 243244
metabolism, 242
PGPRs, 242
screening and quantification methods,
243
spectrophotometric quantification, 247
Polymerase chain reaction (PCR)
ACC deaminase, 297298
fertility, eroded soil, 378
genomic DNA extraction, 73
PCR-DGGE, 34, 37, 378
phylogenetic analysis
nifH gene sequencing, 35
16S rRNA gene sequencing, 3435
qRT-PCR (see Quantitative reverse
transcribed PCR (qRT-PCR))
RT-PCR, 3738, 62
Polymeric inoculants, 475476
Prokaryoticeukaryotic interaction
Azospirillum spp.
brasilense, 375
with Chlorella, 372
co-immobilized with microalgae, 372,
373
with plant, 370
disadvantages, 372
epifluorescence microscopy, 375
fibril formation, 373
FISH (see Fluorescence in situ
hybridization (FISH))
indole-3-acetic acid, 372
microalgae and PGPB, 372
microalgaebacteria, 375
physical interaction, 373
plants and algae, 371
practical and analytical aspects, 372
quantitative model, 368
SEM, 373
TEM, 373
511
Promoter-bound reporter genes
chloramphenicol acetyl transferase, 75
description, 74
-galactosidase assay, 7576
Propagation media, Azospirillum in vitro
BTB-1 and BTB-2, 473
LuriaBertani broth, 473
Nutrient Broth medium, 473
OAB medium, 472473
Tryptone Soy Broth, 473
TYG medium, 473
Protein Families and Domains (PFAM), 87
Pseudomonas fluorescens
and A. brasilense, wheat seeds
on grain yield, 405
on plant biomass, 405
on spikes per m2, 405
P. fluorescens F113, 397, 399
P. fluorescens WCS417r, 352
PGPR, 315, 406
Pseudomonas strains
agronomical data and Azospirillum, 403
agronomic information, wheat fields, 404
biotic factors, 403
cetrimide agar, 393
complex nonsterile systems, 399401
culture-independent methods, 399
fluorescent pseudomonads, 390
Goulds S1, 393
interspecies interactions, 402
isolation
and characterization, 390392
microbiological confirmation, 395
molecular confirmation, 395396
soil and plant material, 393395
Kings B agar, 392393
legume inoculants, 407
liquid inoculants and Azospirillum,
401402
maize trials, 404406
microbiological products, 403
N fertilization, 403
PGPR microorganisms, 390
phase variation, 398399
prokaryotic taxonomic groups, 390
storage
alginate beads, 397
cryoprotectant, 397
freeze-drying, 397
glycerol stocks, 397
physiological and PGPR traits, 396
solid/liquid media, 396
taxonomic PGPR groups, 407
wheat trials, 404
Pseudomonas syringae, 308, 315, 351
512
PTI. See PAMP-triggered immunity (PTI)
PV. See Phenotypic/phase variation (PV)
Pyricularia oryzae, 352
Pyridoxal 5-phosphate (PLP), 288, 289
Q
Quality control, Azospirillum spp. inoculants
A. brasilense Az39, 492
in Argentina, inoculants, 491492
facultative endophytes, 491
immunological methods, 480
molecular methods, 480481
PGPR, 490491
protocol
conservation of samples, 492
contaminating microorganisms,
detection, 496497
microaerophilic and diazotrophic
capacity, bacterial colonies, 498
pH evaluation, 497
plate count technique (see Plate count
technique)
sampling procedures, 493
traditional microbiological techniques,
479480
Quantitative reverse transcribed PCR
(qRT-PCR)
one-step PCR, 7778
primer design, 77
reaction mix and cycling conditions, 79
reference gene selection, 7677
RNA extraction, 76
two-step cycling protocol, 7879
Quorum-sensing (QS) regulation, AHL. See
also Genome analyses, QS
heterologous complementation, 271272
molecular approaches, 278279
omics approaches, 279280
phenotypic assays, 277278
strain deficient, 276277
transposon mutagenesis, 271
R
Reactive oxygen species (ROS), 157, 337338
Real-time PCR (RT-PCR)
quantitative analysis, genus Azospirillum,
3738
strain-specific RT-PCR quantification, 62
Reference databases and integral web
resources
COG, 87
Index
FASTA format, 86
HMMER, 87
International Nucleotide Sequence
Database, 86
InterPro, 87
microscope, 88
PFAM, 87
protein-coding genes, 87
protein family databases, 87
Pubmed, 86
SEEDRAST, 87
TIGRfam, 87
UniProt, 8687
Resazurin assay, 215
Rhizobacteria
abiotic stress, 324327
environmental stimuli stresses, 320
stress tolerance, 321322
Rhizobium etli ISP42, 414, 415
Rhizobium tropici CIAT899, 414, 415
Rhizo-microbiote, 334, 349
Rhizospheric microorganisms
DAF, 160163
electrochemical methods, 163165
EPT, 159160
Griess assay, 158
materials and reagents, 158
NED, 157
Ribosomal intergenic spacer analysis (RISA),
423
Root colonization
A. lipoferum B518, 280
biofilm, 221
-galactosidase activity
assays, 190
inoculatation, 189
plant debris, 191
yellow colouration, 191
glutaraldehyde fixation, 190
and growth promotion, 320
lacZ fusion, 187
plant protein determination, 190
seed and plant preparation, 188189
strawberry plants, 259
Root exudation, 334
ROS. See Reactive oxygen species (ROS)
S
S-adenosyl-L-methionine (SAM), 290
Salicylic acid (SA)
biosynthesis and metabolism, 123
defense-related genes, 336
513
Index
GC-MS, 258
glucose conjugation, 122123
HPLC-LC-MS, 133
LC-ESI-MS-MS, 134135
physiological and biochemical activities,
plants, 122
Salt germination test (SGT)
and CGT, 459
equipment and supplies, 457
procedures
disinfected seeds, inoculated, 457
Lactuca sativa seeds, on filter paper, 458
salt concentration, 458
seedlings, 458
salt-tolerance, 457
soil salinity and freshwater scarcity, 457
SAM. See S-adenosyl-L-methionine (SAM)
SAR. See Systemic acquired resistance (SAR)
Scanning electron microscopy (SEM)
and CLSM, 202
dehydration steps, 221
environmental, 218
polystyrene surface, 201
procedure, 221
root colonization, 221
secondary electrons, 218
Search Tool for the Retrieval of Interacting
Genes/Proteins (STRING), 88
Seed inoculation techniques
adhesives, role, 483
coating and drying, 482
cultures and multiplication, Azospirillum,
453
disadvantages, 483
inoculant preparation and application, 452
liquid formulations, 452
optimum inoculums concentration
CGT, 455456
SGT, 457459
root colonization, 452
seed imbibition
curve, three-phase pattern, 453, 454
equipment and supplies, 454
intra-semen method, 453
procedures, 454
SEM. See Scanning electron microscopy
(SEM)
Sequence characterized amplified regions
(SCARs)
bacteria in situ analysis, 6162
BLAST search, 62
putative strain-specific sequences, 62
root fixation procedure, 52
RT-PCR quantification, 62
strain-specific quantification, 46
SGT. See Salt germination test (SGT)
Sinorhizobium meliloti, 294, 320, 322, 324
Stress
associative symbiosis, 320
bacteria, 320
desiccation and drought, 327
osmoadaptive mechanisms, salt-tolerant
species, 320
PGPRs, 320
rhizobacteria (see Rhizobacteria)
Rhizobia, 320
salinity, 327
signals, plants, 319320
soil biological processes and biodiversity,
319
soil microorganisms, 320
tolerance and osmoregulation, in
Azospirillum, 322324
Synthetic inoculants, 476477
Systemic acquired resistance (SAR), 336
T
Thin-layer chromatography (TLC), 39, 123,
257258, 269270, 414
Transposon mutagenesis, 271
Trehalose content, 325, 326
Trichoderma asperellum T203, 291
Trypsoy soy agar plates, 5
TYG medium, 473
U
Unweighted Pair Group Matching Average
(UPGMA), 378
V
Vitamin C, 462463
W
Wastewater treatment
advantages, 376
alginate beads, 376
autotrophic and heterotrophic conditions,
376
bioreactors, 376
co-immobilization, 376
microalgae, 376
phosphorus, 376
SEM and FISH, 377
water analytical methods, 376377
514
Weighted Pair Group Matching Average
(WPGMA), 378
Wheat fields
agronomic information, 404
soil chemical analysis, 405
Wheat seeds, A. brasilense and P. fluorescens
on grain yield, 405
Index
on plant biomass, 405
on spikes per m2, 405
X
Xanthomonas oryzae, 352
Xylem vessels, 8, 353, 423