Wolfgang R. Streit, Rolf Daniel Eds. Metagenomics Methods and Protocols
Wolfgang R. Streit, Rolf Daniel Eds. Metagenomics Methods and Protocols
Wolfgang R. Streit
Rolf Daniel Editors
Metagenomics
Methods and Protocols
Second Edition
Methods in Molecular Biology
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
Second Edition
Edited by
Wolfgang R. Streit
Mikrobiologie & Biotechnologie, Biocenter Klein Flottbek, University of Hamburg,
Hamburg, Germany
Rolf Daniel
Göttingen Genomics Laboratory, Department of Genomic and Applied Microbiology,
Institut für Mikrobiologie und Genetik, Georg-August-Universität Göttingen,
Göttingen, Germany
Editors
Wolfgang R. Streit Rolf Daniel
Mikrobiologie & Biotechnologie Göttingen Genomics Laboratory
Biocenter Klein Flottbek Department of Genomic and Applied
University of Hamburg Microbiology
Hamburg, Germany Institut für Mikrobiologie und Genetik
Georg-August-Universität Göttingen
Göttingen, Germany
v
vi Preface
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
vii
viii Contents
Erratum to: . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E1
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 301
Contributors
ix
x Contributors
Abstract
The vast majority of the Earth’s biological diversity is hidden in uncultured and yet uncharacterized micro-
bial genomes. The construction of metagenomic libraries is a cultivation-independent molecular approach
to assess this unexplored genetic reservoir. High numbers of novel biocatalysts have been identified by
function-based or sequence-based screening of metagenomic libraries derived from various environments.
Here, we describe detailed protocols for the construction of metagenomic small-insert and large-insert
libraries in plasmids and fosmids, respectively, from environmental DNA.
Key words Metagenomic DNA, Small-insert library, Large-insert library, Plasmid, Fosmid, Whole
genome amplification, WGA
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_1, © Springer Science+Business Media LLC 2017
1
2 Carola Simon and Rolf Daniel
2 Materials
3 Methods
3.1.3 S1 Nuclease 1. Set up the reaction mix as follows: the purified DNA from
Treatment (See Note 2) Subheading 3.1.2, step 4, 10 μL S1 nuclease buffer (5×), 2 μL
S1 nuclease (100 U/μL). Add up to a final volume of 50 μL
with H2O.
2. Incubate at 37 °C for 30 min.
3. Purify the DNA with SureClean Plus (see Subheading 3.1.1,
steps 2 and 3).
3.1.4 Shearing 1. Test the proportion of sheared DNA by running 1–2 μL of the
of Metagenomic DNA DNA solution on a 0.8 % agarose gel. If more than 50 % of the
DNA fragments display the desired insert size proceed with
Subheading 3.1.5.
2. Assemble the nebulizer as indicated by the manufacturer.
3. Add 10–15 μg environmental DNA to 750 μL of shearing buffer
and transfer into the bottom of the nebulizer (see Note 3).
4. Screw on cap of the nebulizer and place on ice to keep the
DNA cold.
5. Connect the nebulizer to the compressed gas or air source and
shear the DNA by applying 9–10 psi for approximately 10–15 s
to obtain DNA fragments that are 3–8 kb in size. Check the
6 Carola Simon and Rolf Daniel
3.1.5 End-Repair 1. Add the following reagents to the resuspended DNA from
of Insert DNA Subheading 3.1.4, step 9: 5 μL Buffer O (10×), 1 μL 10 mM
dNTP Mix, 1 μL T4 DNA polymerase (5 U/μL), and 1 μL
DNA polymerase I (10 U/μL). Add H2O to a final volume of
50 μL (see Note 4).
2. Incubate the reaction mix for 3 h at room temperature.
3. Inactivate the enzymes for 10 min at 75 °C.
3.1.6 Size Fractionation 1. Run the blunt-ended DNA on a 1 % LMP agarose gel pre-
of the Insert DNA pared with 1× TAE buffer and a DNA size marker at each of
the outside lanes of the gel. Do not include ethidium bromide
in the gel.
2. Following electrophoresis, cut off the outer lanes of the gel
containing the DNA ladder and stain with ethidium bromide.
Visualize the DNA ladder with UV light and mark the position
of the desired fragment sizes on both DNA ladders. After
removing the gel slices from the UV light, reassemble the gel
and cut out a gel slice containing DNA with the desired frag-
ment size.
3. Weigh the gel slice in a tared tube.
4. Exchange the electrophoresis buffer in the gel slice with 1×
GELase buffer by adding 3 μL of 1× GELase buffer per milli-
gram of gel. Incubate at room temperature for 1 h and subse-
quently remove the buffer (see Note 5).
5. Melt the LMP gel by incubation at 70 °C for 3 min for each
200 mg of gel. If required, continue incubating at 70 °C for a
few more minutes.
6. Transfer the molten agarose to 45 °C and equilibrate 2 min for
each 200 mg of gel. Temperatures higher than 45 °C will inac-
tivate the GELase enzyme.
Small-Insert and Large-Insert Metagenomic Libraries 7
3.1.7 Addition of 3′ 1. Add the following reagents to the resuspended DNA from
A-Overhangs to Blunt- Subheading 3.1.6, step 11: 7 μL Taq DNA polymerase buffer
Ended, (10×), 6 μL 25 mM MgCl2, 1 μL 100 mM dATP, and 1 μL Taq
Size-Fractionated DNA DNA polymerase (5 U/μL). Add H2O to a final volume of
70 μL.
2. Incubate at 72 °C for 30 min.
3. Purify DNA by using SureClean (see Subheading 3.1.1, step
2).
4. Resuspend DNA pellet in 30 μL H2O (see Note 7).
3.1.9 TOPO® Cloning 1. Set up the following cloning reaction in a sterile microcentri-
fuge tube: 4 μL dephosphorylated insert DNA and 1 μL pCR®-
XL-TOPO® vector.
2. Mix gently without pipetting the solution and incubate for
5 min at room temperature.
3. Add 1 μL of the TOPO® Cloning Stop Solution (6×) and mix
gently.
4. Briefly centrifuge the tube and place on ice. The ligation mix
may be stored for 24 h at 4 °C.
5. Add 2 μL of the cloning reaction to one vial of Invitrogen’s
One Shot® electrocompetent Escherichia coli cells and mix
gently. Do not pipet.
8 Carola Simon and Rolf Daniel
3.2 Generation 1. Streak the E. coli EPI300-T1® cells on a LB plate. The cells are
of Large-Insert included in the CopyControl™ Fosmid Library Production Kit.
Metagenomic Incubate overnight at 37 °C. Seal the plate and store at 4 °C.
Libraries 2. The day before performing the lambda packaging reaction
3.2.1 Preparation
(see Subheading 3.2.5) inoculate 5 mL of LB broth with a single
of Host Cells
colony of EPI300-T1® cells and incubate overnight at 37 °C
and 150 rpm.
3.2.4 End-Repair 1. Add the following reagents, which are all included in the
of Insert DNA CopyControl™ Fosmid Library Production Kit, to the 50 μL
resuspended size-fractionated DNA from Subheading 3.2.3,
step 4: 8 μL end-repair buffer (10×), 8 μL 2.5 mM dNTP Mix,
8 μL 10 mM ATP, 4 μL end-repair enzyme mix. Add H2O to
a final volume of 80 μL.
2. Incubate at room temperature for 2 h.
3. Inactivate the enzyme mix at 70 °C for 10 min.
4. Purify the blunt-ended DNA with SureClean (see
Subheading 3.1.1, step 2).
5. Resuspend the DNA in 20–30 μL H2O (see Note 7).
3.2.5 Ligation 1. Add the following reagents, which are also included in the
CopyControl™ Fosmid Library Production Kit, to the end-
repaired insert DNA (approx 600 ng): 1 μL Fast-Link ligation
buffer (10×), 1 μL 10 mM ATP, 1 μL CopyControl™
pCC1FOSVector (0.5 μg/μL), 1 μL Fast-Link DNA ligase
(2 U/μL). Add H2O to a final volume of 10 μL.
2. Incubate overnight at 16 °C.
3. Add 0.5 μL Fast-Link DNA ligase to the reaction mix and
incubate for another 1.5 h at room temperature.
4. Stop the reaction at 70 °C for 10 min.
3.2.7 Transduction 1. Add 10, 20, 30, 40, and 50 μL of the packaged phage particles
of Host Cells individually to 100 μL of the prepared EPI300-T1® cells from
Subheading 3.2.6, step 1.
2. Incubate for 45 min at 37 °C.
3. Spread the infected EPI300-T1® cells on a LB plate supple-
mented with 12.5 μg/mL chloramphenicol and incubate over-
night at 37 °C.
4. Count colonies and mix the remaining packaged phage parti-
cles with the host cells in the ratio, which yielded the highest
amount of fosmid-containing E. coli clones.
5. Incubate for 45 min at 37 °C.
6. Ensure that the fosmid library contains the desired insert size.
For this purpose, pick randomly several E. coli clones, grow
each in 5 mL LB broth supplemented with 12.5 μg/mL chlor-
amphenicol overnight at 37 °C and 150 rpm.
7. To induce a high copy number of the fosmids in the host cells
combine 500 μL of the overnight culture from step 6, 5 μL of
the CopyControl™ Induction Solution (1.000×), and 4.5 mL
LB broth supplemented with 12.5 μg/mL chloramphenicol in
a 15 mL tube.
8. Shake the tubes at 37 °C horizontally for 5 h vigorously as
aeration is critical for induction of a high copy number.
9. Extract, digest, and analyze the fosmid DNA by standard techniques
to ensure that the fosmid library contains metagenomic DNA.
10. Store the fosmid library in microtiter plates containing LB
broth supplemented with 12.5 μL chloramphenicol at
−70 °C.
4 Notes
References
1. Handelsman J (2004) Metagenomics: applica- nomics and biochemical characterization of new
tion of genomics to uncultured microorgan- esterases and an arabinopyranosidase. Appl
isms. Microbiol Mol Biol Rev 68:669–685 Microbiol Biotechnol 99(23):10031–10046
2. Simon C, Daniel R (2009) Achievements and 8. Simon C, Herath J, Rockstroh S, Daniel R
new knowledge unraveled by metagenomic (2009) Rapid identification of genes encoding
approaches. Appl Microbiol Biotechnol 85: DNA polymerases by function-based screening
265–276 of metagenomic libraries derived from glacial
3. Daniel R (2005) The metagenomics of soil. ice. Appl Environ Microbiol 75:2964–2968
Nat Rev Microbiol 3:470–478 9. Cohen LJ, Kang HS, Chu J, Huang YH,
4. Simon C, Daniel R (2011) Metagenomic anal- Gordon EA, Reddy BV et al (2015)
yses: past and future trends. Appl Environ Functional metagenomic discovery of
Microbiol 77:1153–1161 bacterial effectors in the human microbiome
5. Daniel R (2004) The soil metagenome – a rich and isolation of commendamide, a GPCR
resource for the discovery of novel natural G2A/132 agonist. Proc Natl Acad Sci U S A
products. Curr Opin Biotechnol 15:199–204 112:E4825–E4834
6. Nacke H, Engelhaupt M, Brady S, Fischer C, 10. Zhang K, Martiny AC, Reppas NB, Barry KW,
Tautzt J, Daniel R (2012) Identification and Malek J, Chisholm SW, Church GM (2006)
characterization of novel cellulolytic and hemi- Sequencing genomes from single cells by poly-
cellulolytic genes and enzymes derived from merase cloning. Nat Biotechnol 24:680–686
German grassland soil metagenomes. 11. GE Healthcare Life Sciences. Illustra™
Biotechnol Lett 34:663–675 GenomiPhi V2 DNA Amplification Kit:
7. Placido A, Hai T, Ferrer M, Chernikova TN, instruction manual. GE Healthcare Europe
Distaso M, Armstrong D et al (2015) Diversity GmbH, Freiburg. [Link]
of hydrolases from hydrothermal vent sediments com/
of the Levante Bay, Vulcano Island (Aeolian 12. Bioline. SureClean: instruction manual. Bioline,
archipelago) identified by activity-based metage- Luckenwalde. [Link]
Chapter 2
Abstract
Microbial communities play an important role in marine ecosystem processes. Although the number of
studies targeting marker genes such as the 16S rRNA gene has been increased in the last few years, the vast
majority of marine diversity is rather unexplored. Moreover, most studies focused on the entire bacterial
community and thus disregarded active microbial community players. Here, we describe a detailed proto-
col for the simultaneous extraction of DNA and RNA from marine water samples and for the generation
of cDNA from the isolated RNA which can be used as a universal template in various marker gene
studies.
Key words Metagenomics, Metatranscriptomics, Marker gene studies, Microbial diversity, Microbial
functions
1 Introduction
Sequencing of marker genes has been widely used for the investigation
of microbial communities in many environments including water
[1] or microbial biofilms [2]. However, the vast majority of inves-
tigations focused on assessing entire community structures by 16S
rRNA gene analysis and thus did not consider the active microbial
community members. In the last few years, RNA-based studies
have received more attention. These studies provided first insights
into community structure and diversity of the potentially active
microbes and their functions (for example [1, 3–5]).
Here, we describe a standard protocol for the simultaneous
extraction of DNA and RNA from marine water samples. The extrac-
tion is based on the protocol described by Weinbauer et al. [6]. It is
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_2, © Springer Science+Business Media LLC 2017
13
14 Dominik Schneider et al.
2 Materials
2.1 Bacterioplankton The basis for the simultaneous DNA and RNA extraction are
Samples membrane filter samples obtained as follows: seawater samples are
prefiltered through a 10-μm-mesh-size nylon net and a precom-
busted (4 h at 450 °C) 47 mm-diameter glass fiber filter (Whatman®
GF/D; Whatman, Maidstone, UK). The free-living bacterioplank-
ton is subsequently harvested by filtration of 1 L prefiltered seawa-
ter through a filter sandwich consisting of a glass fiber filter
(Whatman® GF/F) and a 47-mm-diameter (pore-size 0.2 μm)
polycarbonate filter (Nuclepore®, Whatman).
2.4 DNA Digestion 1. Ambion™ TURBO DNA-free™ Kit (Thermo Fisher Scientific,
and Control PCR Waltham, USA) (see Note 2).
2. Thermo Scientific™ Taq DNA polymerase, recombinant
(1 U/μL), reaction buffer with (NH4)2SO4 (10×) and 25 mM
MgCl2 (Thermo Fisher Scientific, Waltham, USA).
3. Thermo Scientific™ 10 mM dNTP Mix (Thermo Fisher
Scientific, Waltham, USA).
4. Thermo Scientific™ Ribolock RNase Inhibitor (40 U/μL)
(Thermo Fisher Scientific, Waltham, USA).
5. Ten micromolar solutions of each of the following oligonucle-
otides: 8F (5′-AGAGTTTGATCCTGGCTCAG-3′) [8], 518R
(5′-ATTACCGCGGCTGCTGG-3′) [9], 1055F (5′-ATGGCT
GTCGTCAGCT-3′) [10] and 1378R (5′-CGGTGTGTA
CAAGGCCCGGGAACG-3′) [11] (see Note 3).
6. DEPC-treated water.
7. Phenol–chloroform–isoamyl alcohol (Carl Roth, Karlsruhe,
Germany).
16 Dominik Schneider et al.
2.5 First and Second 1. Random hexamer primers (Roche, Penzberg, Germany).
Strand Synthesis 2. Invitrogen™ SuperScript® Double-Stranded cDNA Synthesis
Kit (Thermo Fisher Scientific, Waltham, USA).
3. DEPC-treated water.
3 Methods
3.1 Simultaneous 1. To prepare the extraction mixture for one extraction, mix
DNA and RNA 7.5 mL extraction buffer with 0.2 mL 20 % SLS-solution. Scale
Extraction up as needed.
from Marine Filter 2. Place glass beads in a fresh 50 mL Greiner tube.
Samples 3. Use sterile scissor and forceps to cut the frozen filter sandwich
3.1.1 Co-extraction in short pieces. Place the filter pieces in the Greiner tube.
of DNA and RNA 4. Add 5 mL of the extraction mixture.
5. Add 5 mL of buffer-saturated phenol.
6. Vibrate the mixture with 4 m/s for 60 s using a FastPrep®-24
Instrument.
7. Centrifuge for 20 min at 7200 × g and 4 °C. During centrifu-
gation, the mixture separates into a lower phenol phase with
glass beads, an interphase and an upper aqueous phase.
8. Transfer the upper aqueous phase containing the RNA to a
fresh Greiner tube.
9. Add 2 mL of the extraction mixture and 2 mL of buffer-saturated
phenol to the phenolic phase for repeated phenol extraction.
10. Mix thoroughly by vortexing the capped tube and centrifuge
again for 20 min at 7200 × g and 4 °C.
11. Transfer the upper aqueous phase to the already collected
aqueous phase from step 8. The volume of the pooled aqueous
phases is about 5 mL.
12. For DNA isolation, add 5 mL Tris-base to the phenolic phase
and mix well. Store at 4 °C for at least 40 min but not longer
than 3 h.
13. Continue with RNA isolation.
Simultaneous Extraction of DNA and RNA 17
3.1.2 RNA Isolation 1. Add 0.1 volumes of 3 M sodium acetate to the Greiner tube
containing the pooled aqueous phases from the extraction and
phase separation procedure (see Subheading 3.1.1, step 11).
2. Add 5 mL of chloroform–isoamyl alcohol (see Note 4).
3. Mix vigorously by vortexing and centrifuge for 10 min at
9000 × g and 4 °C to separate the phases.
4. Transfer the aqueous phase to a fresh Greiner tube and repeat
steps 2 and 3.
5. Transfer the aqueous phase to a fresh Greiner tube and add a
1/700 volume of glycogen (see Note 5).
6. Mix vigorously and add 1 volume of isopropanol to precipitate
the RNA.
7. Mix vigorously and incubate samples at −20 °C overnight (see
Note 6).
8. Continue with DNA isolation.
3.1.3 DNA Isolation 1. Mix the Greiner tube containing the extracted DNA vigor-
ously from Subheading 3.1.1, step 12 and centrifuge for
15 min at 2000 × g and 4 °C.
2. Transfer upper aqueous phase to a fresh Greiner tube.
3. Add 2 mL 1 M Tris-base to the lower phenolic phase and
repeat mixing and centrifugation for 15 min at 2000 × g and
4 °C.
4. Transfer upper aqueous phase to the aqueous phase already
collected in step 2. Add 5 mL of chloroform–isoamyl alcohol
to the Greiner tube.
5. Mix by vortexing and centrifuge for 10 min at 9000 × g and
4 °C to separate the phases.
6. Transfer upper phase to a fresh Greiner tube and repeat steps
4 and 5.
7. Add 1/10 volume of 3 M sodium acetate and 1/700 volume
of glycogen (see Note 5).
8. Mix vigorously. Add 2.5 volumes of ice-cold pure ethanol to
precipitate the DNA.
9. Mix vigorously and incubate samples at −20 °C overnight (see
Note 6).
3.1.4 Washing 1. Pellet the precipitated nucleic acids (see Subheading 3.1.2, step 7
and Resuspension of RNA and Subheading 3.1.3, step 9) by centrifugation at maximum
and DNA speed for 30 min and 4 °C.
2. Wash the pellets twice with 1 mL of ice-cold 80 % ethanol.
Centrifuge at maximum speed for 10 min and 4 °C.
3. Dry pellet for about 10 min at room temperature (see Note 7).
4. Dissolve the DNA or RNA in 200 μL 1× TE buffer.
18 Dominik Schneider et al.
3.2 DNA and RNA 1. Add 1 μL RNase A to the extracted DNA (see Subheading 3.1.4,
Purification step 4).
3.2.1 Removal 2. Incubate at 37 °C for 1 h.
of Residual RNA from DNA 3. Purify the DNA using the peqGold Cycle-Pure Kit.
Samples 4. Elute DNA with 100 μL pre-warmed DEPC-treated water.
5. Repeat DNA elution with 100 μL Tris buffer (supplied with
the Kit).
3.2.2 RNA Purification 1. Add 700 μL RLT buffer and 7 μL ß-mercaptoethanol to the
with the Qiagen RNeasy RNA from Subheading 3.1.4, step 4. Mix well.
MiniKit 2. Add 500 μL of 96–100 % ethanol to the diluted RNA. Mix
well. Do not centrifuge. Proceed immediately to step 3.
3. Transfer 700 μL of the sample to an RNeasy Mini spin column
placed in a 2 mL collection tube (supplied). Close the lid gen-
tly, and centrifuge for 15 s at >8000 × g. Discard the
flow-through.
4. Repeat step 3 once.
5. Place the RNeasy Mini spin column in a new 2 mL collection
tube (supplied).
6. Add 500 μL Buffer RPE (supplied) to the spin column.
7. Close the lid gently and centrifuge for 15 s at >8000 × g.
Discard the flow-through.
8. Add 500 μL of 80 % ethanol to the RNeasy Mini spin column.
Close the lid gently, and centrifuge for 2 min at 8000 × g.
9. Place the RNeasy Mini spin column in a new 2 mL collection
tube (supplied). Open the lid of the spin column, and centri-
fuge at full speed for 5 min. Discard the flow-through and col-
lection tube.
10. Place the RNeasy Mini spin column in a new 1.5 mL collection
tube (supplied). Elute RNA two times with 50 μL DEPC-
treated H2O (~95 μL eluate).
11. Mix 5 μL of the purified RNA with 5 μL 2× RNA loading dye
and control the success of the RNA extraction and purification
by agarose gel electrophoresis.
3.2.3 DNA Digestion 1. If nucleic acid solution concentration is higher than 200 ng/μL,
dilute with DEPC-treated water.
2. Add 1/10 volume of 10× TURBO DNase Buffer (supplied) to
RNA sample.
3. Add 1/40 volume of Ribolock RNase Inhibitor (final concen-
tration 1 U/μL).
4. Add 1 μL TURBO DNase (2 U) per 10 μg of RNA (see Note 2).
5. Incubate at 37 °C for 30 min.
Simultaneous Extraction of DNA and RNA 19
3.3 First and Second 1. Add 1 μL of random hexamer primers to 10.5 μL of DNA-free
Strand Synthesis RNA from Subheading 3.2.3, step 27.
2. Incubate at 70 °C for 10 min.
3. Quick-chill on ice.
4. Add in the following order: 4 μL first strand buffer, 0.5 μL
Ribolock, 2 μL 100 mM DTT and 1 μL dNTP mixture.
5. Vortex gently and collect the reaction by brief centrifugation.
6. Incubate at 25 °C for 2 min to equilibrate the temperature.
7. Add 1 μL SuperScript™ II RT (200 U).
8. Incubate at 25 °C for 10 min.
9. Incubate at 45 °C for 1 h.
10. Place on ice.
11. On ice, add the following reagents in the order shown to the
first-strand reaction tube: 94 μL DEPC-treated water, 30 μL
second strand buffer (5×), 3 μL dNTPs, 0.5 μL E. coli DNA
ligase (10 U/μL), 2 μL E. coli DNA polymerase I (10 U/μL),
0.5 μL E. coli RNase H (2 U/μL) (see Note 8).
12. Vortex gently to mix and incubate for 2 h at 16 °C. Do not
allow the temperature to rise above 16 °C.
13. Add 1 μL (10 U) of T4 DNA Polymerase and continue to
incubate at 16 °C for 5 min (see Note 8).
14. Place the tube on ice and add 10 μL of 0.5 M EDTA.
15. Purify with Bioline SureClean Plus Solution as recommended
by the manufacturer (see Note 9).
4 Notes
References
coding for 16S rRNA. Appl Environ Microbiol 11. Heuer H, Krsek M, Baker P, Smalla K,
59:695–700 Wellington EM (1997) Analysis of actinomy-
10. Amann RI, Ludwig W, Schleifer KH (1995) cete communities by specific amplification of
Phylogenetic identification and in situ detec- genes encoding 16S rRNA and gel-
tion of individual microbial cells without culti- electrophoretic separation in denaturing gradi-
vation. Microbiol Rev 59:143–169 ents. Appl Environ Microbiol 63:3233–3241
Chapter 3
Abstract
The marine environment covers more than 70 % of the world’s surface. Marine microbial communities are
highly diverse and have evolved during extended evolutionary processes of physiological adaptations under
the influence of a variety of ecological conditions and selection pressures. They harbor an enormous diver-
sity of microbes with still unknown and probably new physiological characteristics. In the past, marine
microbes, mostly bacteria of microbial consortia attached to marine tissues of multicellular organisms, have
proven to be a rich source of highly potent bioactive compounds, which represent a considerable number
of drug candidates. However, to date, the biodiversity of marine microbes and the versatility of their bioac-
tive compounds and metabolites have not been fully explored. This chapter describes sampling in the
marine environment, construction of metagenomic large insert libraries from marine habitats, and exem-
plarily one function based screen of metagenomic clones for identification of quorum quenching activities.
Key words Isolation of metagenomic DNA, 16S rDNA phylogenetic analysis, Construction of fos-
mid libraries, Function-based screen, Quorum quenching
1 Introduction
The oceans are the largest ecological system on earth [1] harboring
marine microorganisms with an average cell density of approxi-
mately 5 × 105 cells/mL, leading to the estimation that the oceans
are a living space for approximately 3.6 × 1028 microorganisms [2].
Marine microbial communities are highly diverse and have evolved
during extended evolutionary processes of physiological adapta-
tions under the influence of a variety of ecological conditions and
selection pressures. They harbor an enormous diversity of meta-
bolically complex microbes with still unknown and probably new
physiological characteristics and are thus rich sources for isolating
novel bioactive compounds and genes [3, 4]. Microbes are also
known to form symbiotic relationships with various marine inver-
tebrates, e.g., sponges, corals, and squids, and are thus suspected
to produce particular biologically active and pharmacologically
valuable natural products [5, 6].
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_3, © Springer Science+Business Media LLC 2017
23
24 Nancy Weiland-Bräuer et al.
2 Materials
2.1.2 Sampling 1. Equipment for sampling marine organisms, e.g., clean buckets,
from Marine Invertebrates bottles, a dip net.
2. Autoclaved seawater to wash away loosely attached
microorganisms.
3. Sterile petri dishes and sterile cotton-tipped applicators to swab
microorganisms from the surfaces of the marine eukaryote.
4. Sterile pistils or mortars to homogenize whole animals of small
size.
5. Liquid nitrogen to freeze the samples for long term storage at
−80 °C.
2.5 Screening 1. 0.5 mL 0.2 μm centrifugal filter units (Carl Roth, Karlsruhe),
Metagenomic Geno/Grinder 2000 (BT&C/OPS Diagnostics,
Libraries for Quorum Bridgewater, NJ).
Quenching Activities 2. LB plates.
3. Topagar containing 0.8 % agar supplemented with final con-
centrations of 100 μM N-(β-ketocaproyl)-L-homoserine lac-
tone (3-oxo-C6-HSL) (Sigma-Aldrich, Munich), 100 μg/mL
ampicillin, 30 μg/mL kanamycin, and 10 % (vol/vol) growing
culture of the reporter strain AI1-QQ.1 [37].
4. Topagar containing 0.8 % agar supplemented with final con-
centrations of 50 mM 4-hydroxy-5-methyl-3-furanone (Sigma-
Aldrich, Munich), 100 μg/mL ampicillin, 30 μg/mL
kanamycin, and 5 % (vol/vol) growing culture of the reporter
strain AI2-QQ.1 [37].
5. 50 mM Tris–HCl pH 8.0.
6. 0.1 and 2.5 mm glass beads (Carl Roth, Karlsruhe).
3 Methods
3.1 Sampling Surface water can be collected either by membrane pumps or any
Procedures other highly effective clean pumping system on board. Further,
samples can also be taken by a Conductivity Temperature Depth
3.1.1 Marine Surface
sensor (CTD), equipped with a 24 Niskin 10 L bottle rosette
Water Sampling
(Fig. 1).
Marine Metagenomic Large Insert Libraries 27
3.1.2 Marine Deep Water Samples from below the euphotic zone, where not much cell mate-
Sampling rial is present, should be collected in larger volumes of at least
200 L. A CTD equipped with a 24 Niskin 10 L bottle rosette can
be used for the collection of such samples; filtration is then carried
out as described above. As this sampling method is limited to a
certain volume, mostly 240 L, it is highly time consuming, and
may lead to stress responses due to dramatically changing environ-
mental conditions during the filtration time on board (light, tem-
perature, pressure). In this case, a sample collection by in situ
pumps should be preferred. Those pumps can be set at the depth
of interest, depending on the cable length of the ships’ winch
28 Nancy Weiland-Bräuer et al.
Fig. 2 Deployment of an in situ pump from RV Meteor, (a) filter-holder with filter of an in situ pump (b)
3.1.3 Sampling After sampling, the marine organisms are thoroughly rinsed with
from Marine Invertebrates filtered (0.22 μm) and autoclaved seawater to remove loosely
attached microorganisms. If possible the organisms are then placed
in sterile petri dishes and an area of approximately 2–5 cm2
(depending on the amounts of microbes and downstream applica-
tions) is swabbed with a sterile cotton-tipped applicator. In case of
a fragile organism, the complete animal can be homogenized with
a pistil or mortar, if necessary under liquid nitrogen, to extract
DNA resulting in a mixture of prokaryotic and eukaryotic DNA of
unknown ratio. In this case, enrichment of prokaryotic cells for
example by fractionated centrifugation can be applied prior to
DNA extraction. For comparative phylogenetic analysis, ambient
seawater should be sampled and filtered as described above.
3.2 Isolation DNA from filters, swabs or whole animals is commonly extracted
of Metagenomic DNA by a direct lysis of the microorganisms. Additional steps prior to
the lysis may be required to isolate DNA from inhibitor-
contaminated habitats or enrich prokaryotic cells in order to mini-
mize co-extraction of eukaryotic DNA [38]. The following
modified protocol of Henne et al. [39] describes the genomic
DNA isolation based on direct lysis of the microorganisms from
Marine Metagenomic Large Insert Libraries 29
filter, swab and tissue samples. The volumes are appropriate for
2.5 cm2 of a filter and should be adjusted according to the filter or
sample size.
1. 1.35 mL DNA extraction buffer (see Note 5), supplemented
with 20 μL Proteinase K (20 mg/mL) and 200 μL lysozyme
(50 mg/mL) are added to the sample followed by an incuba-
tion at 37 °C for 30 min; optional shaking (150 rpm).
2. 1.5 μL (17,000 U) RNase A are added followed by further
incubation at 37 °C for 30 min.
3. 150 μL 20 % SDS are added followed by an incubation for 2 h
at 65 °C and subsequent centrifugation at 4500 × g for 10 min.
4. Chloroform extraction of the supernatant followed by precipi-
tation of the nucleic acids with isopropanol (0.7 vol) for 1 h at
room temperature and subsequent centrifugation for 45 min
at 16,000 × g and 4 °C.
5. The DNA precipitate is washed with 70 % ethanol, dried and
solved in 25 μL TE buffer.
This extraction protocol uses enzymatic methods to remove cell
walls, resulting in sphaeroplasts or protoplasts. The use of sodium
dodecyl sulfate (SDS) disrupts mainly tertiary or quaternary protein
structures; cetyl trimethylammonium bromide (CTAB) additionally
removes polysaccharides and remaining proteins. An increase from 1
to 5 % CTAB in the DNA extraction buffer allows an improved lysis
of archaeal cell walls which significantly differ from the bacterial cell
walls [40, 41] (see Note 6). In some cases, e.g., DNA extraction of
samples containing high amounts of gram-positive bacteria, initial
mechanical cell lyses might be necessary, e.g., using a bead beater
with small glass, ceramic, zirconium, or steel beads [42] (see Note 7).
Finally, the isolated metagenomic DNA is analyzed by gel electro-
phoresis and should contain large fragments (Fig. 3) in case of con-
structing a metagenomic large insert library.
Fig. 4 Phylogenetic analysis of a marine habitat using 16S rRNA amplicon sequencing. (a) GS FLX Titanium
series amplicon sequencing. (b) Respective phylogenetic composition of the marine habitat based on 16S
rDNA sequencing analysis
The 16S rDNA analysis not only allows insight into present com-
munity structure of the respective habitat, it also points out the likely
potential of the habitat to detect new biotechnological relevant
enzymes. In addition to the knowledge gained on the actual micro-
bial diversity, additional PCR amplifications can be performed using
specific primer sets in order to analyze the presence of functional
genes, e.g., the nifH gene for diazotrophs, encoding a structural
gene of nitrogenase, the key enzyme of nitrogen fixation [46, 47].
3.4 Construction Fosmid and Bacterial Artificial Chromosome (BAC) vectors have
of a Metagenomic been developed to clone large genomic DNA fragments of up to
Large Insert Library 40 kb and ~120 kb, respectively. These vectors replicate using the
single-copy F-factor replicon and show high stability carrying large
inserts [48]. Meanwhile, novel large insert vectors have been devel-
oped carrying both, the single-copy and an additional inducible
high copy number origin of replication [34, 49]. This ensures on
the one hand insert stability and successful cloning of encoded and
expressed toxic proteins and unstable DNA sequences, and on the
other hand allows increased DNA yields in vector preparations and
functional screens of clone libraries by induction to high copy
numbers [50, 51]. Thus, BACs and fosmids have become standard
tools for constructing genomic clone libraries.
Genomic library construction kits are commercially available that
pursue blunt-end cloning strategies resulting in complete and unbi-
ased libraries. The “Copy Control™ Fosmid Library Production Kit”
(e.g., with pCC1FOS) combines all advantages to stable insert large
DNA fragments into the vector with little expenditure of time (Fig. 5).
Table 1
End-repair of DNA fragments
Sterile water x μL
10× End-Repair buffer 8 μL
2.5 mM dNTPs 8 μL
10 mM ATP 8 μL
Up to 20 μg sheared DNA x μL
End-Repair enzyme mix 4 μL
Total reaction volume 80 μL
Marine Metagenomic Large Insert Libraries 33
Table 2
Ligation reaction
Sterile water x μL
10× Fast-Link ligation buffer 1 μL
10 mM ATP 1 μL
CopyControl pCC1FOS vector (0.5 mg/mL) 1 μL
insert DNA (0.25 μg of 40 kb DNA) x μL
Fast-Link DNA ligase 1 μL
Total reaction volume 10 μL
3.6 Function-Based Functional screens for novel genes in metagenomic libraries explore
Screens the genetic potential of a habitat by directly monitoring products or
of Metagenomic enzymatic activities of the metagenomic clones. Metagenomic
Libraries libraries have been screened for various biomolecules, such as bio-
technologically relevant enzymes. So far, functional screens of
metagenomic libraries have identified for example several novel
antibiotics, e.g., turbomycin A and B [59], aminoacylated
Marine Metagenomic Large Insert Libraries 35
3.6.1 Screening The bacterial cell-cell communication based on small signal mole-
Metagenomic Libraries cules (autoinducers), so-called quorum sensing (QS), is a cell
for Natural Quorum density-dependent process effecting gene regulation in bacteria.
Quenching Compounds Accumulation and perception of autoinducers enables the bacteria
to detect an increasing cell density by sensing the signal molecule
concentration and thus allows changing their gene expression to
coordinate behaviors that require high cell densities, e.g., pathoge-
nicity and biofilm formation [69–71]. Well known and studied
autoinducers are acyl-homoserine lactones (AHL) in Gram-
negative bacteria, oligopeptide signals in Gram-positive bacteria,
and furan molecules known as autoinducer-2 (AI-2) in both groups
[72]. In addition, several other autoinducers like AI-3 of enterohe-
morrhagic E. coli (EHEC) [73, 74] and CAI-1 of Vibrio cholerae
[75] were recently identified which are proposed to be interking-
dom signaling systems between microbes and their hosts.
QS is known to play a crucial role in bacterial biofilm formation
[69]. Undesired biofilms can cause material degradation, fouling,
contamination, or even infections [76, 77]. Since biofilm formation
crucially depends on QS, one attractive strategy considered to pre-
vent biofilm formation is to interfere with the signaling mechanisms
(quorum quenching, QQ) [78–80]. Novel naturally occurring
quorum quenching compounds or mechanisms can be identified
using cultivation-independent methods, e.g., metagenomic
approaches, and can be applied as novel therapeutic agents combat-
ing resistant microorganisms [81–85]. Recently, we established two
reporter strains AI1-QQ.1 and AI2-QQ.1 [37] to identify such
quorum quenching compounds interfering with AHL- and AI-2
based cell-cell communication. The E. coli-based reporter strains
contain the gene encoding the lethal protein CcdB under the con-
trol of the AHL-(PluxI) or AI-2-(PlsrA) inducible promoter.
Consequently, E. coli strains carrying such a reporter fusion are
unable to grow in the presence of the respective signal molecules,
unless nontoxic interfering molecules are present. Both, cell extracts
and culture supernatants of single clones or clone pools (up to 96
single clones equivalent to one microtiter plate) can be rapidly and
easily screened for quorum quenching activities. The following pro-
tocol describes (I) the preparation of cell extracts and cell-free cul-
ture supernatants and (II) the quorum quenching assay (Fig. 6).
(I) PREPARATION OF CELL EXTRACTS AND CELL-FREE CULTURE
SUPERNATANTS FROM METAGENOMIC FOSMID CLONES
36 Nancy Weiland-Bräuer et al.
Fig. 6 Flowchart of screening for quorum quenching activities in cell extracts and cell-free culture superna-
tants of metagenomics fosmid clones
Fig. 7 Original test plate illustrates growth re-establishment of the reporter strain
AI1-QQ. 1 by interference with the present signal molecule (circled)
38 Nancy Weiland-Bräuer et al.
4 Notes
References
1. Kodzius R, Gojobori T (2015) Marine metage- concepts promising new horizons for marine
nomics as a source for bioprospecting. Mar biodiscovery and synthetic biology. Mar Drugs
Genomics 24(Pt 1):21–30 13:2924–2954
2. DeLong EF, Karl DM (2005) Genomic per- 5. Kennedy J, Marchesi JR, Dobson AD (2007)
spectives in microbial oceanography. Nature Metagenomic approaches to exploit the bio-
437:336–342 technological potential of the microbial con-
3. Karl DM (2007) Microbial oceanography: par- sortia of marine sponges. Appl Microbiol
adigms, processes and promise. Nat Rev Biotechnol 75:11–20
Microbiol 5:759–769 6. Zhang X, Wei W, Tan R (2015) Symbionts, a
4. Reen FJ, Gutiérrez-Barranquero JA, Dobson promising source of bioactive natural products.
ADW, Adams C, O’Gara F (2015) Emerging Sci China Chem 58:1097
40 Nancy Weiland-Bräuer et al.
7. Bowman JP (2007) Bioactive compound syn- 22. Pham VD, Palden T, DeLong EF (2007)
thetic capacity and ecological significance of Large-scale screens of metagenomic libraries.
marine bacterial genus Pseudoalteromonas. Mar J Vis Exp 201.
Drugs 5:220–241 23. DeLong EF (2009) The microbial ocean from
8. Jaiganesh R, Sampath Kumar NS (2012) genomes to biomes. Nature 459:200–206
Marine bacterial sources of bioactive com- 24. Fu J, Leiros H-KS, de Pascale D, Johnson KA,
pounds. Adv Food Nutr Res 65:389–408 Blencke H-M, Landfald B (2013) Functional
9. Singh AJ, Field JJ, Atkinson PH, Northcote and structural studies of a novel cold-adapted
PT, Miller JH (2015) From marine organism esterase from an Arctic intertidal metagenomic
to potential drug: using innovative techniques library. Appl Microbiol Biotechnol
to identify and characterize novel compounds - 97:3965–3978
a bottom-up approach. In: Bioactive natural 25. Xing M-N, Zhang X-Z, Huang H (2012)
products, chemistry and biology. Wiley- Application of metagenomic techniques in min-
Blackwell, London, pp 443–472 ing enzymes from microbial communities for
10. Machado H, Sonnenschein EC, Melchiorsen J, biofuel synthesis. Biotechnol Adv 30:920–929
Gram L (2015) Genome mining reveals 26. Wang Q, Qian C, Zhang X-Z, Liu N, Yan X,
unlocked bioactive potential of marine Gram- Zhou Z (2012) Characterization of a novel
negative bacteria. BMC Genomics 16:158 thermostable ß-glucosidase from a metage-
11. Molina G, Pelissari FM, Pessoa MG, Pastore nomic library of termite gut. Enzyme Microb
GM (2015) Bioactive compounds obtained Technol 51:319–324
through biotechnology. In: Biotechnology of 27. Nimchua T, Uengwetwanit T, Eurwilaichitr L
bioactive compounds: sources and applica- (2012) Metagenomic analysis of novel
tions. Wiley-Blackwell, London, p 433 lignocellulose-degrading enzymes from higher
12. Bhakuni DS, Rawat DS (2005) Bioactive termite guts inhabiting microbes. J Microbiol
metabolites of marine algae, fungi and bacteria. Biotechnol 22:462–469
In: Bioactive marine natural products. Springer, 28. Steele HL, Jaeger KE, Daniel R, Streit WR
Netherlands, pp 1–25 (2009) Advances in recovery of novel biocata-
13. Sidebottom AM, Carlson EE (2015) A rein- lysts from metagenomes. J Mol Microbiol
vigorated era of bacterial secondary metabolite Biotechnol 16:25–37
discovery. Curr Opin Chem Biol 24:104–111 29. Beja O, Suzuki MT, Koonin EV, Aravind L,
14. Blunt JW, Copp BR, Keyzers RA, Munro Hadd A, Nguyen LP et al (2000) Construction
MHG, Prinsep MR (2014) Marine natural and analysis of bacterial artificial chromosome
products. Nat Prod Rep 31:160–258 libraries from a marine microbial assemblage.
15. Newman DJ, Hill RT (2006) New drugs from Environ Microbiol 2:516–529
marine microbes: the tide is turning. J Ind 30. Beja O, Spudich E, Spudich J, Leclerc M,
Microbiol Biotechnol 33:539–544 DeLong E (2001) Proteorhodopsin photot-
16. Roussis V, King RL, Fenical W (1993) rophy in the ocean. Nature 411:786–789
Secondary metabolite chemistry of the 31. de la Torre JR, Christianson LM, Beja O,
Australian brown alga Encyothalia cliftonii: Suzuki MT, Karl DM, Heidelberg J, DeLong
evidence for herbivore chemical defence. EF (2003) Proteorhodopsin genes are distrib-
Phytochemistry 34:107–111 uted among divergent marine bacterial taxa.
17. Kobayashi J, Ishibashi M (1993) Bioactive Proc Natl Acad Sci U S A 100:12830–12835
metabolites of symbiotic marine microorgan- 32. O’Malley MA (2007) Exploratory experimen-
isms. Chem Rev 93:1753–1769 tation and scientific practice: metagenomics
18. Blunt JW, Copp BR, Keyzers RA, Munro MH, and the proteorhodopsin case. Hist Philos Life
Prinsep MR (2015) Marine natural products. Sci 29:337–360
Nat Prod Rep 32:116–211 33. Woyke T, Teeling H, Ivanova NN, Huntemann
19. Amann RI, Ludwig W, Schleifer K-H (1995) M, Richter M, Gloeckner FO et al (2006)
Phylogenetic identification and in situ detec- Symbiosis insights through metagenomic anal-
tion of individual microbial cells without culti- ysis of a microbial consortium. Nature
vation. Microbiol Rev 59:143–169 443:950–955
20. Streit WR, Schmitz RA (2004) Metagenomics- 34. Wild J, Hradecna Z, Szybalski W (2002)
-the key to the uncultured microbes. Curr Conditionally amplifiable BACs: switching
Opin Microbiol 7:492–498 from single-copy to high-copy vectors and
21. Lorenz P, Eck J (2005) Metagenomics and genomic clones. Genome Res 12:1434–1444
industrial applications. Nat Rev Microbiol 35. Shizuya H, Kouros-Mehr H (2001) The devel-
3:510–516 opment and applications of the bacterial artificial
Marine Metagenomic Large Insert Libraries 41
60. Brady SF, Chao CJ, Clardy J (2002) New nat- formation--a review. Wei Sheng Wu Xue Bao
ural product families from an environmental 52:271–278
DNA (eDNA) gene cluster. J Am Chem Soc 73. Moreira CG, Sperandio V (2010) The epi-
124:9968–9969 nephrine/norepinephrine/autoinducer-3
61. Banik JJ, Brady SF (2010) Recent application interkingdom signaling system in Escherichia
of metagenomic approaches toward the discov- coli O157:H7. In: Lyte M, Cryan JF (eds)
ery of antimicrobials and other bioactive small Microbial endocrinology. Springer, New York,
molecules. Curr Opin Microbiol 13:603–609 NY, pp 213–227
62. MacNeil IA, Tiong CL, Minor C, August 74. Zohar B-A, Kolodkin-Gal I (2015) Quorum
PR, Grossman TH, Loiacono KA et al (2001) sensing in Escherichia coli: interkingdom,
Expression and isolation of antimicrobial small inter-and intraspecies dialogues, and a suicide-
molecules from soil DNA libraries. J Mol inducing peptide. In: Quorum sensing vs quo-
Microbiol Biotechnol 3:301–308 rum quenching: a battle with no end in sight.
63. Madalozzo AD, Martini VP, Kuniyoshi KK, Springer, New York, NY, pp 85–99
de Souza EM, Pedrosa FO, Glogauer A et al 75. Higgins DA, Pomianek ME, Kraml CM, Taylor
(2015) Immobilization of LipC12, a new lipase RK, Semmelhack MF, Bassler BL (2007) The
obtained by metagenomics, and its application major Vibrio cholerae autoinducer and its
in the synthesis of biodiesel esters. J Mol Catal role in virulence factor production. Nature
B: Enzym 116:45–51 450:883–886
64. Selvin J, Kennedy J, Lejon DPH, Kiran GS, 76. Donlan RM, Costerton JW (2002) Biofilms:
Dobson ADW (2012) Isolation identification survival mechanisms of clinically relevant micro-
and biochemical characterization of a novel organisms. Clin Microbiol Rev 15:167–193
halo-tolerant lipase from the metagenome of 77. Elias S, Banin E (2012) Multi-species bio-
the marine sponge Haliclona simulans. Microb films: living with friendly neighbors. FEMS
Cell Fact 11:72 Microbiol Rev 36:990
65. Henne A, Schmitz RA, Bomeke M, Gottschalk 78. Dong YH, Zhang LH (2005) Quorum sensing
G, Daniel R (2000) Screening of environmen- and quorum-quenching enzymes. J Microbiol
tal DNA libraries for the presence of genes 43(Spec No):101–109
conferring lipolytic activity on Escherichia coli. 79. Hoiby N, Bjarnsholt T, Givskov M, Molin
Appl Environ Microbiol 66:3113–3116 S, Ciofu O (2010) Antibiotic resistance of
66. Cretoiu MS, Kielak AM, Al-Soud WA, Sörensen bacterial biofilms. Int J Antimicrob Agents
SJ, van Elsas JD (2012) Mining of unexplored 35:322–332
habitats for novel chitinases - chiA as a helper 80. Romero M, Acuna L, Otero A (2012) Patents
gene proxy in metagenomics. Appl Microbiol on quorum quenching: interfering with bacte-
Biotechnol 94:1347–1358 rial communication as a strategy to fight infec-
67. Cottrell MT, Moore JA, Kirchman DL (1999) tions. Recent Pat Biotechnol 6:2–12
Chitinases from uncultured marine microorgan- 81. Dong YH, Wang LH, Xu JL, Zhang HB,
isms. Appl Environ Microbiol 65:2553–2557 Zhang XF, Zhang LH (2001) Quenching
68. Majernik A, Gottschalk G, Daniel R (2001) quorum-sensing-dependent bacterial infection
Screening of environmental DNA librar- by an N-acyl homoserine lactonase. Nature
ies for the presence of genes conferring 411:813–817
Na(+)(Li(+))/H(+) antiporter activity on 82. Hentzer M, Wu H, Andersen JB, Riedel
Escherichia coli: characterization of the recov- K, Rasmussen TB, Bagge N et al (2003)
ered genes and the corresponding gene prod- Attenuation of Pseudomonas aeruginosa viru-
ucts. J Bacteriol 183:6645–6653 lence by quorum sensing inhibitors. EMBO
69. Dickschat JS (2010) Quorum sensing and bac- J 22:3803–3815
terial biofilms. Nat Prod Rep 27:343–369 83. Zhang LH (2003) Quorum quenching and pro-
70. Shrout JD, Tolker-Nielsen T, Givskov M, active host defense. Trends Plant Sci 8:238–244
Parsek MR (2011) The contribution of cell- 84. Zhang LH, Dong YH (2004) Quorum sensing
cell signaling and motility to bacterial biofilm and signal interference: diverse implications.
formation. MRS Bull 36:367–373 Mol Microbiol 53:1563–1571
71. Landini P, Antoniani D, Burgess JG, Nijland R 85. Kalia VC, Purohit HJ (2011) Quenching the
(2010) Molecular mechanisms of compounds quorum sensing system: potential antibacterial
affecting bacterial biofilm formation and dis- drug targets. Crit Rev Microbiol 37:121–140
persal. Appl Microbiol Biotechnol 86:813
86. Inoue H, Nojima H, Okayama H (1990) High
72. Liu L, Tan X, Jia A (2012) Relationship efficiency transformation of Escherichia coli
between bacterial quorum sensing and biofilm with plasmids. Gene 96:23–28
Chapter 4
Abstract
Natural cold or alkaline environments are common on Earth. A rare combination of these two extremes is
found in the permanently cold (less than 6 °C) and alkaline (pH above 10) ikaite columns in the Ikka Fjord
in Southern Greenland. Bioprospecting efforts have established the ikaite columns as a source of bacteria
and enzymes adapted to these conditions. They have also highlighted the limitations of cultivation-based
methods in this extreme environment and metagenomic approaches may provide access to novel extremo-
philic enzymes from the uncultured majority of bacteria. Here, we describe the construction and screening
of a metagenomic library of the prokaryotic community inhabiting the ikaite columns.
Key words Extreme environments, Extremophilic enzymes, Cell extraction, Metagenome, Function-
based screen, Biotechnology
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_4, © Springer Science+Business Media LLC 2017
43
44 Mikkel A. Glaring et al.
Fig. 1 Top; location of the Ikka Fjord in Southern Greenland. Bottom; images of a diver harvesting a small ikaite
column and a cross-sectional view of the top of an older column
A Metagenomic Library of an Extreme Environment 45
(less than 6 °C) and alkaline (pH above 10) environment with a
salinity of less than 10‰ [5–7]. The columns are composed of a
metastable hexahydrate of calcium carbonate, called ikaite, a rare
low-temperature mineral named after the location where it was
first described. Previous reports have shown that the ikaite col-
umns are home to a surprisingly diverse bacterial community and
bioprospecting for cold- and alkaline-adapted enzyme has been
carried out over the last decade [8–12]. The unique polyextreme
nature of the ikaite columns makes them an obvious target for
studies aimed at identifying low temperature versions of industrial
alkaline enzymes.
Based on high-throughput sequencing of 16S rRNA genes
and cultivation experiments, it has been determined that only a
minor fraction of the total bacterial diversity in the ikaite columns
can be cultivated using standard methods [11]. Extended incuba-
tion of mixed cultures from ikaite columns has been shown to
increase the diversity of cultivable bacteria [13], but these cultiva-
tion attempts are inherently biased towards certain phylogenetic
groups, which makes metagenomic approaches to enzyme discov-
ery an attractive alternative. These approaches, however, are ham-
pered by low cell numbers and difficulties in extracting DNA
directly from ikaite material. The following protocol describes the
construction of a metagenomic library from low-biomass ikaite
material using a prokaryotic cell extraction protocol and presents
a screening procedure for cold- and alkaline-active enzymes in a
standard E. coli strain.
2 Materials
2.2 Library 1. REPLI-g Mini Kit (Qiagen) for multiple displacement amplifi-
Construction cation (MDA).
2. Restriction enzymes ApaLI (10 U/μL) and NsiI (10 U/μL)
(New England Biolabs, Ipswich, MA, USA).
3. 0.5× TAE buffer.
4. Low melting point SeaPlaque Agarose (Lonza Bioscience,
Basel, Switzerland).
5. Ethidium bromide staining solution: 0.5 μg/mL in 0.5× TAE.
6. GELase Agarose Gel-Digesting Preparation (Epicentre, Madison,
WI, USA).
7. 3 M sodium acetate, pH 5.2.
8. 96 and 70 % ethanol.
9. GFX PCR DNA and Gel Band Purification Kit (GE Healthcare
Europe GmbH, Brondby, Denmark).
10. Shrimp alkaline phosphatase (rSAP; New England Biolabs).
11. T4 DNA ligase (New England Biolabs).
12. MF-Millipore membrane filter, pore size 0.025 μm (Merck
Millipore).
13. MegaX DH10B T1R electrocompetent E. coli cells (Life
Technologies, Thermo Fisher Scientific).
14. Standard plasmid preparation kit for purification of plasmid
DNA from liquid cultures of E. coli transformants.
2.3 Enzyme Activity 1. Square screening plates, e.g., Nunc Square BioAssay Dishes,
Screening 241 × 241 × 20 mm (Thermo Scientific).
2. LB agar medium.
3. 12.5 mg/mL chloramphenicol stock.
4. 10 % (w/v) arabinose stock, filter-sterilized.
5. Tributyrin (1,3-di(butanoyloxy)propan-2-yl butanoate).
6. 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-β-gal).
7. 5-bromo-4-chloro-3-indolyl-α-D-galactopyranoside (X-α-gal).
8. Azurine-crosslinked (AZCL) insoluble chromogenic substrates
(Megazyme, Wicklow, Ireland).
A Metagenomic Library of an Extreme Environment 47
3 Methods
3.1 Obtaining DNA The ikaite columns are composed of a calcium carbonate mineral
from Ikaite Samples called ikaite. While newly formed ikaite is soft and porous, older
material is affected by recrystallization of ikaite into monohydro-
calcite and calcite, which forms a hardened cement-like material
(Fig. 1). This matrix and the high concentration of positively
charged calcium ions, which may cause adsorption of DNA to
ikaite surfaces, pose a significant challenge to direct DNA extrac-
tion. Low levels of biomass and the presence of significant num-
bers of microscopic eukaryotes further complicates the preparation
of metagenomic libraries. Direct extraction of DNA from such an
environment would yield metagenomes dominated by DNA of
eukaryotic origin, which would significantly complicate the subse-
quent functional screening of libraries in bacterial hosts by lower-
ing the frequency of useful coding regions.
In order to produce libraries useful for functional screening, a
cell extraction protocol is used to enrich for the smaller prokaryotic
cells present in the ikaite matrix. Isolation of intact cells also mini-
mizes interference from extracellular DNA present in the environ-
ment, such as that derived from biofilm [14]. To avoid extensive
cell lysis before extraction, we recommend using unfrozen envi-
ronmental material. In the case of ikaite, samples can be stored at
4 °C for extended periods, but this may severely affect the micro-
bial community composition and therefore the final metagenomic
library [13]. The cell extraction protocol is a modified version of a
previously published method [15] and is suitable for 100–150 g of
ikaite material. All steps are performed at 4 °C.
3.1.1 Extraction of Intact 1. Mix the harvested ikaite material with 450 mL 0.9 % NaCl and
Cells from the Ikaite Matrix homogenize in a Waring blender at low speed. Centrifuge the
slurry at 3000 × g for 5 min.
2. Wash the pellet twice by resuspending in 100 mL 0.9 % NaCl
and centrifuging at 3000 × g for 5 min (see Note 1).
3. Resuspend the pelleted material in a mixture containing
100 mL 0.9 % NaCl with 0.1 % NaN3, 17 mL methanol and
17 mL detergent mix and detach cells by vortexing at 1400 rpm
for 60 min.
4. Separate the detached cells from ikaite particles and the larger
eukaryotic cells by low-speed centrifugation at 500 × g for
2 min.
5. Collect the smaller prokaryotic cells present in the supernatant
by centrifugation at 10,000 × g for 10 min.
3.1.2 DNA Extraction 1. Resuspend the cell pellet in 1.5 mL STET-buffer with 2 mg/mL
from Intact Cells lysozyme and incubate at 37 °C for 30 min.
48 Mikkel A. Glaring et al.
3.2 Library The ikaite cell extraction protocol yields high quality metagenomic
Construction DNA enriched in prokaryotic sequences, but does not solve the
problem of low biomass, which limits the amount of DNA that can
be obtained from ikaite material. While the cell extraction protocol
could in theory be scaled up to increase the yield of DNA, the
protected nature of the ikaite columns, the difficult sampling pro-
cedure, and problems with transporting and storing ikaite material
locally, makes this solution unappealing. To obtain sufficient
amounts of DNA for subsequent cloning an amplification step may
therefore be necessary. Multiple displacement amplification (MDA)
with the ϕ29 DNA polymerase is a whole genome amplification
technique which can rapidly amplify minute amounts of DNA.
However, MDA introduces a significant amount of bias in the
DNA template, which will ultimately influence the final diversity of
the library [11, 16].
Unlike alkaline-adapted bacteria, which generally maintain a
near-neutral intracellular pH [17], enzymes from cold-adapted
bacteria may also require a cold-adapted expression system for effi-
cient protein production. Several systems based on engineered
E. coli strains or naturally cold-adapted expression hosts are available
[18]. A commercially available system is the Arctic Express E. coli
strain (Agilent Technologies, Santa Clara, CA, USA) carrying
chaperones from the psychrophilic bacterium Oleispira antarctica
to facilitate proper folding of proteins at low temperature.
A Metagenomic Library of an Extreme Environment 49
3.2.1 Preparation of High 1. The purified high molecular weight DNA is used as a template
Molecular Weight DNA for MDA using the REPLI-g Mini Kit following the manufac-
for Cloning turer’s protocol.
2. Mix approximately 100 μg of the resulting DNA with restriction
enzyme buffer in a total volume of 120 μL on ice.
3. Divide the DNA mixture into three tubes with a volume of
60 μL (tube 1), 40 μL (tube 2), and 20 μL (tube 3).
4. Keep the three tubes on ice and add 1.5 μL ApaLI (10 U/μL)
and 1.5 μL NsiI (10 U/μL) to tube 1 and mix carefully.
5. Transfer 20 μL from tube 1 to tube 2 and mix carefully.
6. Transfer 20 μL from tube 2 to tube 3 and mix carefully. All
three tubes should now contain 40 μL. Keep on ice.
7. The three tubes are incubated for exactly 10 min at 37 °C and
then transferred to ice (ApaLI cannot be heat inactivated).
50 Mikkel A. Glaring et al.
3.2.3 Construction 1. Mix the partially digested metagenomic DNA with the digested
of a Metagenomic Library [Link]-BAC vector in an approximate molar ratio of 10:1.
in E. coli Ligate using T4 DNA ligase following the manufacturer’s pro-
tocol with overnight incubation at 15 °C.
2. Inactivate the ligase at 65 °C for 20 min.
3. Desalt the ligation mixture by drop dialysis by spotting 25 μL
drops on a membrane filter (pore size 0.025 μm) floating on
deionized water in a petri dish. Dialyze for 30 min and collect
the drops with a pipette [21].
A Metagenomic Library of an Extreme Environment 51
4 Notes
References
1. Siddiqui KS, Williams TJ, Wilkins D, Yau S, 9. Glaring MA, Vester JK, Lylloff JE, Abu
Allen MA, Brown MV et al (2013) Al-Soud W, Sorensen SJ, Stougaard P (2015)
Psychrophiles. Annu Rev Earth Planet Sci 41: Microbial diversity in a permanently cold and
87–115 alkaline environment in Greenland. PLoS One
2. Fujinami S, Fujisawa M (2010) Industrial 10:e0124863
applications of alkaliphiles and their enzymes - 10. Vester JK, Glaring MA, Stougaard P (2015) An
past, present and future. Environ Technol exceptionally cold-adapted alpha-amylase from
31:845–856 a metagenomic library of a cold and alkaline
3. Margesin R, Feller G (2010) Biotechnological environment. Appl Microbiol Biotechnol
applications of psychrophiles. Environ Technol 99:717–727
31:835–844 11. Vester JK, Glaring MA, Stougaard P (2014)
4. Cavicchioli R, Charlton T, Ertan H, Omar SM, Discovery of novel enzymes with industrial
Siddiqui KS, Williams TJ (2011) potential from a cold and alkaline environment
Biotechnological uses of enzymes from psy- by a combination of functional metagenomics
chrophiles. Microbial Biotechnol 4:449–460 and culturing. Microb Cell Fact 13:72
5. Buchardt B, Seaman P, Stockmann G, Vous M, 12. Schmidt M, Stougaard P (2010) Identification,
Wilken U, Duwel L et al (1997) Submarine cloning and expression of a cold-active
columns of ikaite tufa. Nature 390:129–130 β-galactosidase from a novel Arctic bacterium,
6. Buchardt B, Israelson C, Seaman P, Stockmann Alkalilactibacillus ikkense. Environ Technol
G (2001) Ikaite tufa towers in Ikka Fjord, 31:1107–1114
southwest Greenland: their formation by mix- 13. Vester JK, Glaring MA, Stougaard P (2013)
ing of seawater and alkaline spring water. Improving diversity in cultures of bacteria from
J Sediment Res 71:176–189 an extreme environment. Can J Microbiol
7. Hansen MO, Buchardt B, Kuhl M, Elberling B 59:581–586
(2011) The fate of submarine ikaite tufa columns 14. Okshevsky M, Meyer RL (2015) The role of
in Southwest Greenland under changing climate extracellular DNA in the establishment, main-
conditions. J Sediment Res 81:553–561 tenance and perpetuation of bacterial biofilms.
8. Schmidt M, Larsen DM, Stougaard P (2010) Crit Rev Microbiol 41:341–352
A lipase with broad temperature range 15. Kallmeyer J, Smith DC, Spivack AJ, D’Hondt S
from an alkaliphilic gamma-proteobacterium (2008) New cell extraction procedure applied
isolated in Greenland. Environ Technol 31: to deep subsurface sediments. Limnol Oceanogr
1091–1100 Methods 6:236–245
A Metagenomic Library of an Extreme Environment 55
Abstract
Stable-isotope probing (SIP) enables researchers to target active populations within complex microbial
communities, which is achieved by providing growth substrates enriched in heavy isotopes, usually in the
form of 13C, 18O, or 15N. After growth on the substrate and subsequent extraction of microbial biomarkers,
typically nucleic acids or proteins, the SIP technique is used for the recovery and analysis of isotope-labeled
biomarkers from active microbial populations. In the years following the initial development of DNA- and
RNA-based SIP, it was common practice to characterize labeled populations by targeted gene analysis.
Such approaches usually involved fingerprint-based analyses or sequencing of clone libraries containing
16S rRNA genes or functional marker gene amplicons. Although molecular fingerprinting remains a valu-
able approach for rapid confirmation of isotope labeling, recent advances in sequencing technology mean
that it is possible to obtain affordable and comprehensive amplicon profiles, metagenomes, or metatran-
scriptomes from SIP experiments. Not only can the abundance of microbial groups be inferred from
metagenomes, but researchers can bin, assemble, and explore individual genomes to build hypotheses
about the metabolic capabilities of labeled microorganisms. Analysis of labeled mRNA is a more recent
advance that can provide independent metatranscriptome-based analysis of active microorganisms.
The power of metatranscriptomics is that mRNA abundance often correlates closely with the correspond-
ing activity of encoded enzymes, thus providing insight into microbial metabolism at the time of sam-
pling. Together, these advances have improved the sensitivity of SIP methods and allow the use of labeled
substrates at ecologically relevant concentrations. Particularly as methods improve and costs continue to
drop, we expect that the integration of SIP with multiple omics-based methods will become prevalent
components of microbial ecology studies, leading to further breakthroughs in our understanding of novel
microbial populations and elucidation of the metabolic function of complex microbial communities. In
this chapter we provide protocols for obtaining labeled DNA, RNA, and proteins that can be used for
downstream omics-based analyses.
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_5, © Springer Science+Business Media LLC 2017
57
58 Eleanor Jameson et al.
1 Introduction
2 Materials
2.3 DNA/RNA 1. Ultracentrifuge and vertical (or near vertical) rotor, such as the
Ultracentrifugation Vti 65.2 (Beckman Coulter).
2. CsCl stock solution (7.163 M; density is 1.890 g/mL in water)
for DNA, or Illustra CsTFA (VWR) for RNA.
62 Eleanor Jameson et al.
3. Deionised formamide.
4. Gradient buffer (GB): 0.1 M Tris–HCl, 0.1 M KCl, 1 mM
EDTA, pH 8.0.
5. Ethanol.
6. RNAse inhibitor.
7. DNA precipitation solution: 30 % polyethylene glycol 6000,
1.6 M NaCl.
8. Linear polyacrylamide (LPA; e.g., co-precipitant pink
[Bioline]) (see Note 1).
9. Suitable device for gradient fractionation. For example, the
Multi-Speed Syringe Pump (BSP) works well with a 60-mL
syringe for gradient fractionation.
10. Digital refractometer (e.g., Reichert AR200) for determining
gradient density.
2.4 16S rRNA Gene 16S rRNA gene amplicon sequencing primers and methods are
Sequencing described in several publications, such as [41] or [42].
3. 5 mM ammonium bicarbonate.
4. 10 mM ammonium bicarbonate.
5. 10 mM 1,4-dithiothreitol (DTT) in 10 mM ammonium
bicarbonate.
6. 100 mM 2-iodoacetamide in 10 mM ammonium bicarbonate.
7. Trypsin-buffer: dissolve 20 μg Trypsin Proteomics Sequencing
Grade in 20 μL 1 mM HCl. Add 5 μL of dissolved trypsin to
495 μL of 5 mM ammonium bicarbonate directly before use.
8. Peptide extraction buffer: 50 % acetonitrile, 5 % formic acid.
3 Methods
Mix gently and leave on the bench for 10 min. Store the
remainder of your extract at −80 °C.
15. Continue with the RNA purification protocol using the RNeasy
kit. Elute RNA from column by adding 30 μL of water twice
(you will obtain 50–60 μL of RNA eluate).
16. Verify that your RNA is free of contaminating DNA by a PCR
targeting the 16S rRNA gene. Set-up a reverse transcription
PCR assay, but include a control without added reverse tran-
scriptase enzyme (i.e., substitute with an equivalent volume of
water). Repeat the DNase treatment if a product is obtained
without added reverse transcriptase.
17. Store RNA in non-stick microcentrifuge tubes (e.g., Ambion)
at −80 °C. It is also recommended to store in multiple aliquots
to avoid freeze-thawing the stock solution.
3.2 Isolation 1. Calculate the total volume of DNA sample and GB to mix with
of Labeled DNA 4.9 mL of CsCl stock solution for a 1.725 g/mL gradient
by CsCl Gradient solution desired density, as follows:
Centrifugation 2. GB / DNA volume = (CsCl stock solution density - 1.725)
´ 4.9 ´ 1.52
3. Add the appropriate DNA and GB volumes required to achieve
the volume determined before at the bottom of a sterile 15-mL
tube and gently tap to mix. Aim to add between 0.5 and 5 μg
of DNA to each gradient. If possible, maximizing DNA addi-
tion to the gradient, within the specified range, is ideal for
yielding sufficient labeled material for downstream analyses.
4. Add 4.9 mL of CsCl to the tube containing DNA/GB and
gently mix by inversion. Prepare a GB control without DNA to
evaluate possible contamination. If possible, include a second
control combining pure culture 12C-DNA and 13C-DNA to
verify gradient formation.
5. Fill the ultracentrifuge tubes slowly with the resulting solution
up to the tube neck base using a Pasteur pipette, avoiding bub-
ble formation.
6. Pair the tubes by weight and adjust as necessary (±0.01 g) for
balance during ultracentrifugation.
7. Seal the tubes, verifying the absence of leakage by applying
gentle pressure to the tube between two fingers. Confirm that
each tube pair remains balanced.
8. Load the rotor and centrifuge for 36–40 h at 177,000 × g
(average; 44,100 rpm for a Vti65.2 rotor) at 20 °C. Program
the ultracentrifuge with vacuum, maximum acceleration, and
without brake for the final deceleration.
9. Remove the rotor from the ultracentrifuge and carefully
remove each tube sequentially for fractionation. Do not allow
66 Eleanor Jameson et al.
light
1 2 3 4 5 6 7 8 9 10 11 12
Fig. 2 Schematic overview including a visual example of gradient fractionation using a syringe pump and a
burette stand in order to hold the gradient during the fractionation process
3.3 Isolation Many of the procedures for isopycnic banding and isolation of
of Labeled RNA labeled DNA (Subheading 3.2) are the same for labeled RNA, with
by CsTFA Gradient some important differences indicated here. Total RNA can be used
Centrifugation or it is possible to perform an mRNA enrichment step before load-
ing the RNA into the gradient (see Note 4).
1. For each gradient, combine 4.9 mL of CsTFA (2.0 g/mL)
with 1 mL of gradient buffer (GB), vortexing thoroughly. If
necessary, adjust the refractive index to 1.3702 by small addi-
tions of either CsTFA or GB. Add 210 μL of deionised for-
mamide and vortex thoroughly. The refractive index should be
approximately 1.3725.
2. Add 0.5 μg of RNA to each gradient (see Note 5). Ensure that
the tubes are balanced (±0.01 g) and properly sealed.
3. Centrifuge for 65 h at 130,000 × g and at 20 °C, using ultra-
centrifuge vacuum, acceleration, and deceleration conditions
specified for DNA-SIP above.
4. Fractionate the gradients by displacing from the top with
nuclease-free water (Fig. 2). Twelve fractions per gradient are
usually sufficient, but more fractions can be collected to obtain
a higher resolution. Measure the refractive index of the gradi-
ent fractions.
5. Precipitate the RNA by adding 4 μL LPA to each fraction,
1/10th volume of 3 M sodium acetate (pH 5.2), and 2.5 vol-
umes of ethanol. Vortex thoroughly and leave 1 h at −20 °C,
then spin 30 min at maximum speed (~13,000 × g) on a bench-
top microcentrifuge at 4 °C. Remove the supernatant and add
1 mL of 70 % ethanol. Spin in microcentrifuge, aspirate and
discard the ethanol. Remove the last drops of ethanol with a
small pipette tip and allow the pellet to just dry. Add 6 μL of
68 Eleanor Jameson et al.
3.4 Analysis There are several bioinformatic tools that provide approaches to
of Metagenomes and analyzing community composition directly based on metagenomic
Metatranscriptomes read data or assembled metagenome data, such as Kraken [44],
metaphlan [45], Kaiju [46], MG-RAST [47], and others. Due to
reliance on databases containing sequenced genomes of relevant
microorganisms, which often do not include representatives of
uncultivated lineages that are relevant in a given environment,
these bioinformatics tools may generate a biased perspective of
microbial community functional profiles compared to those based
on ribosomal gene amplicons. However, these tools have the
advantage of assessing community composition across all domains
of life (and also include viruses) in a single assessment, without
requiring PCR amplification of ribosomal RNA genes.
Although it is beyond the scope of this chapter to describe the
methods and approaches available to analyze metagenomes and
metatranscriptomes, such methods have been reviewed extensively
elsewhere.
3.6 In-Gel Tryptic 1. Cut gel horizontally into 2–4 pieces per lane and transfer the
Digestion of Proteins pieces into individual 0.5 mL tubes. Perform all following
steps at room temperature unless indicated otherwise. Add
200 μL wash solution to each gel piece, shake for 1 h. Remove
wash solution and add 200 μL acetonitrile, shake for 5 min.
2. Remove acetonitrile, dry gel pieces in a vacuum centrifuge for
5 min. Add 30 μL 10 mM DTT solution and shake for 30 min
(reduction of proteins).
3. Remove DTT solution, add 30 μL 100 mM 2-iodoacetamide
solution and shake for 30 min (alkylation of proteins).
4. Remove 2-iodoacetamide solution, add 200 μL acetonitrile,
shake for 5 min.
5. Remove acetonitrile, add 200 μL 10 mM ammonium bicar-
bonate solution, shake for 10 min.
6. Remove the ammonium bicarbonate solution, add 200 μL ace-
tonitrile, shake for 5 min.
7. Remove acetonitrile, dry gel pieces in a vacuum centrifuge for
5 min.
8. Add 20 μL of trypsin-buffer and incubate at 37 °C over night.
9. Add 30 μL 5 mM ammonium bicarbonate solution and shake
for 10 min.
10. Remove and collect the ammonium bicarbonate solution in
separate tube for each gel piece.
11. Add 30 μL peptide extraction buffer to gel piece and shake for
10 min.
12. Remove peptide extraction buffer and add it to the collected
ammonium bicarbonate solution.
13. Repeat steps 11 and 12 once more.
14. For each gel piece from step 7, you now should have one tube
containing the gel piece without any liquid (which can be dis-
carded) and one tube containing the collected solutions
(ammonium bicarbonate and peptide extraction buffer),
70 Eleanor Jameson et al.
1.0
0.8
Relative intensity
0.6
0.4
0.2
0.0
1070 1080 1090 1100 1110 1120 1130 1140
Mass / charge
4 Notes
Acknowledgments
References
1. Handelsman J (2004) Metagenomics: applica- labelling experiments are coming of age. ISME
tion of genomics to uncultured microorgan- J 1:103–110
isms. Microbiol Mol Biol Rev 68:669–685 9. Uhlik O, Leewis MC, Strejcek M, Musilova L,
2. Lynch MD, Neufeld JD (2015) Ecology and Mackova M, Leigh MB, Macek T (2013)
exploration of the rare biosphere. Nat Rev Stable isotope probing in the metagenomics
Microbiol 13:217–229 era: a bridge towards improved bioremedia-
3. Rusch DB, Halpern AL, Sutton G, Heidelberg tion. Biotechnol Adv 31:154–165
KB, Williamson S, Yooseph S et al (2007) The 10. Grob C, Taubert M, Howat AM, Burns OJ,
sorcerer II global ocean sampling expedition: Chen Y, Murrell JC (2015) Generating
northwest Atlantic through eastern tropical enriched metagenomes from active microor-
Pacific. PLoS Biol 5:e77 ganisms with DNA stable isotope probing.
4. Quince C, Curtis TP, Sloan WT (2008) The Hydrocarb Lipid Microbiol Protoc 10:1007
rational exploration of microbial diversity. 11. Friedrich MW (2006) Stable-isotope probing
ISME J 2:997–1006 of DNA: insights into the function of unculti-
5. Shade A, Hogan CS, Klimowicz AK, Linske M, vated microorganisms from isotopically labeled
McManus PS, Handelsman J (2012) Culturing metagenomes. Curr Opin Biotechnol
captures members of the soil rare biosphere. 17:59–66
Environ Microbiol 14:2247–2252 12. Neufeld JD, Dumont MG, Vohra J, Murrell JC
6. Radajewski S, Ineson P, Parekh NR, Murrell (2007) Methodological considerations for the
JC (2000) Stable-isotope probing as a tool in use of stable isotope probing in microbial ecol-
microbial ecology. Nature 403:646–649 ogy. Microb Ecol 53:435–442
7. Dumont MG, Murrell JC (2005) Stable iso- 13. Schloss PD, Handelsman J (2003)
tope probing - linking microbial identity to Biotechnological prospects from metagenom-
function. Nat Rev Microbiol 3:499–504 ics. Curr Opin Biotechnol 14:303–310
8. Neufeld JD, Wagner M, Murrell JC (2007) 14. Wellington EM, Berry A, Krsek M (2003)
Who eats what, where and when? Isotope- Resolving functional diversity in relation to
SIP for High-Throughput Analysis of Microorganisms 73
microbial community structure in soil: exploit- mRNA stable isotope probing coupled with
ing genomics and stable isotope probing. Curr single-cell raman-fluorescence in situ hybrid-
Opin Microbiol 6:295–301 ization. Appl Environ Microbiol 75:234–241
15. Martineau C, Whyte LG, Greer CW (2010) 25. Dumont MG, Pommerenke B, Casper P
Stable isotope probing analysis of the diversity (2013) Using stable isotope probing to obtain
and activity of methanotrophic bacteria in soils a targeted metatranscriptome of aerobic meth-
from the Canadian high Arctic. Appl Environ anotrophs in lake sediment. Environ Microbiol
Microbiol 76:5773–5784 Rep 5:757–764
16. Bell TH, Yergeau E, Martineau C, Juck D, 26. Jehmlich N, Schmidt F, Taubert M, Seifert J,
Whyte LG, Greer CW (2011) Identification of Bastida F, von Bergen M et al (2010) Protein-
nitrogen-incorporating bacteria in petroleum- based stable isotope probing. Nat Protoc
contaminated arctic soils by using [15N] 5:1957–1966
DNA-based stable isotope probing and pyro- 27. Seifert J, Taubert M, Jehmlich N, Schmidt F,
sequencing. Appl Environ Microbiol Volker U, Vogt C et al (2012) Protein-based
77:4163–4171 stable isotope probing (protein-SIP) in func-
17. Eyice Ö, Namura M, Chen Y, Mead A, tional metaproteomics. Mass Spectrom Rev
Samavedam S, Schäfer H (2015) SIP metage- 31:683–697
nomics identifies uncultivated Methylophilaceae 28. von Bergen M, Jehmlich N, Taubert M, Vogt
as dimethylsulphide degrading bacteria in soil C, Bastida F, Herbst FA et al (2013) Insights
and lake sediment. ISME J 9:2336–2348 from quantitative metaproteomics and protein-
18. Grob C, Taubert M, Howat AM, Burns OJ, stable isotope probing into microbial ecology.
Dixon JL, Richnow HH et al (2015) ISME J 7:1877–1885
Combining metagenomics with metapro- 29. Pan C, Fischer CR, Hyatt D, Bowen BP,
teomics and stable isotope probing reveals Hettich RL, Banfield JF (2011) Quantitative
metabolic pathways used by a naturally occur- tracking of isotope flows in proteomes of
ring marine methylotroph. Environ Microbiol microbial communities. Mol Cell Proteomics
17:4007–4018 10(M110):006049
19. Dumont MG, Radajewski SM, Miguez CB, 30. Taubert M, Vogt C, Wubet T, Kleinsteuber S,
McDonald IR, Murrell JC (2006) Identification Tarkka MT, Harms H et al (2012) Protein-SIP
of a complete methane monooxygenase operon enables time-resolved analysis of the carbon
from soil by combining stable isotope probing flux in a sulfate-reducing, benzene-degrading
and metagenomic analysis. Environ Microbiol microbial consortium. ISME J 6:2291–2301
8:1240–1250 31. Lünsmann V, Kappelmeyer U, Benndorf R,
20. Coyotzi S, Pratscher J, Murrell JC, Neufeld JD Martinez-Lavanchy PM, Taubert A, Adrian L
(2016) Targeted metagenomics of active et al (2016) In situ protein-SIP highlights
microbial populations with stable-isotope Burkholderiaceae as key players degrading tol-
probing. Curr Opin Biotechnol 41:1–8 uene by para ring hydroxylation in a con-
21. Albertsen M, Hugenholtz P, Skarshewski A, structed wetland model. Environ Microbiol
Nielsen KL, Tyson GW, Nielsen PH (2013) 18:1176
Genome sequences of rare, uncultured bacteria 32. Herbst FA, Bahr A, Duarte M, Pieper DH,
obtained by differential coverage binning of Richnow HH, von Bergen M et al (2013)
multiple metagenomes. Nat Biotechnol Elucidation of in situ polycyclic aromatic hydrocar-
31:533–538 bon degradation by functional metaproteomics
22. Dumont MG, Pommerenke B, Casper P, (protein-SIP). Proteomics 13:2910–2920
Conrad R (2011) DNA-, rRNA- and mRNA- 33. Taubert M, Baumann S, von Bergen M, Seifert
based stable isotope probing of aerobic metha- J (2011) Exploring the limits of robust detec-
notrophs in lake sediment. Environ Microbiol tion of incorporation of 13C by mass spectrom-
13:1153–1167 etry in protein-based stable isotope probing
23. Haichar FZ, Roncato MA, Achouak W (2012) (protein-SIP). Anal Bioanal Chem
Stable isotope probing of bacterial community 401:1975–1982
structure and gene expression in the rhizo- 34. Taubert M, von Bergen M, Seifert J (2013)
sphere of Arabidopsis thaliana. FEMS Limitations in detection of 15N incorporation
Microbiol Ecol 81:291–302 by mass spectrometry in protein-based stable
24. Huang WE, Ferguson A, Singer AC, Lawson isotope probing (protein-SIP). Anal Bioanal
K, Thompson IP, Kalin RM et al (2009) Chem 405:3989–3996
Resolving genetic functions within microbial 35. Jehmlich N, Kopinke FD, Lenhard S, Vogt C,
populations: in situ analyses using rRNA and Herbst FA, Seifert J et al (2012) Sulfur-36S stable
74 Eleanor Jameson et al.
isotope labeling of amino acids for quantification 42. Caporaso JG, Lauber CL, Walters WA, Berg-
(SULAQ). Proteomics 12:37–42 Lyons D, Huntley J, Fierer N et al (2012)
36. Justice NB, Li Z, Wang Y, Spaudling SE, Ultra-high-throughput microbial community
Mosier AC, Hettich RL et al (2014) 15N- and analysis on the Illumina HiSeq and MiSeq plat-
2
H proteomic stable isotope probing links forms. ISME J 6:1621–1624
nitrogen flow to archaeal heterotrophic activ- 43. Jünemann S, Sedlazeck FJ, Prior K, Albersmeier
ity. Environ Microbiol 16:3224–3237 A, John U, Kalinowski J et al (2013) Updating
37. Slysz GW, Steinke L, Ward DM, Klatt CG, benchtop sequencing performance compari-
Clauss TR, Purvine SO et al (2014) Automated son. Nat Biotechnol 31:294–296
data extraction from in situ protein-stable 44. Wood DE, Salzberg SL (2014) Kraken: ultra-
isotope probing studies. J Proteome Res fast metagenomic sequence classification using
13:1200–1210 exact alignments. Genome Biol 15:R46
38. Sachsenberg T, Herbst FA, Taubert M, Kermer 45. Segata N, Waldron L, Ballarini A, Narasimhan
R, Jehmlich N, von Bergen M et al (2015) V, Jousson O, Huttenhower C (2012)
MetaProSIP: automated inference of stable Metagenomic microbial community profiling
isotope incorporation rates in proteins for using unique clade-specific marker genes. Nat
functional metaproteomics. J Proteome Res Methods 9:811–814
14:619–627 46. Menzel P, Ng KL, and Krogh A (2015) Kaiju:
39. Neufeld JD, Vohra J, Dumont MG, Lueders T, fast and sensitive taxonomic classification for
Manefield M, Friedrich MW, Murrell JC (2007) metagenomics. bioRxiv. doi: 10.1101/
DNA stable-isotope probing. Nat Protoc 031229.
2:860–866 47. Meyer F, Paarmann D, D’Souza M, Olson R,
40. Whiteley AS, Thomson B, Lueders T, Manefield Glass EM, Kubal M et al (2008) The metage-
M (2007) RNA stable-isotope probing. Nat nomics RAST server - a public resource for the
Protoc 2:838–844 automatic phylogenetic and functional analysis
41. Bartram AK, Lynch MD, Stearns JC, Moreno- of metagenomes. BMC Bioinformatics 9:386
Hagelsieb G, Neufeld JD (2011) Generation 48. Bartram A, Poon C, Neufeld J (2009) Nucleic
of multimillion-sequence 16S rRNA gene acid contamination of glycogen used in nucleic
libraries from complex microbial communities acid precipitation and assessment of linear
by assembling paired-end illumina reads. Appl polyacrylamide as an alternative co-precipitant.
Environ Microbiol 77:3846–3852 Biotechniques 47:1019–1022
Chapter 6
Abstract
Plants are colonized various microorganisms including endophytes. These microbes can play an important
role in agricultural production as they promote plant growth and/or enhance the resistance of their host
plant against diseases and environmental stress conditions. Although culture-independent molecular
approaches such as DNA barcoding have greatly enhanced our understanding of bacterial and fungal endo-
phyte communities, there are some methodical problems when investigating endophyte diversity. One main
issue are sequence contaminations such as plastid-derived rRNA gene sequences which are co-amplified due
to their high homology to bacterial 16S rRNA genes. The same is true for plant and fungal ITS sequences.
The application of highly specific-primers suppressing co-amplification of these sequence contaminations is
a good solution for this issue. Here, we describe a detailed protocol for assessing bacterial and fungal endo-
phyte diversity in plants using these primers in combination with next-generation sequencing.
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_6, © Springer Science+Business Media LLC 2017
75
76 Bernd Wemheuer and Franziska Wemheuer
2 Materials
3 Methods
3.3 DNA Extraction 1. Extract DNA using the peqGOLD Plant DNA Mini kit accord-
ing to the manufacturer’s instructions with two modifications
to improve initial cell lysis: add glass beads and 10 μL Proteinase
K to the first step of the DNA extraction protocol.
2. Elute DNA with sterile-filtered and DEPC-treated water.
3.4 Amplification 1. For the first PCR reaction mixture, combine the following
and Sequencing ingredients in a sterile DNA-free 0.2 mL PCR tube: 5 μL of 5×
of Marker Genes Phusion GC buffer, 1 μL of primer ITS1F-KYO2, 1 μL of
primer ITS4, 1.25 μL DMSO, 0.75 μL MgCl2, 0.5 μL dNTP
3.4.1 Amplification
mix, 0.25 μL Phusion polymerase (2 U/μL), and approxi-
of Fungal ITS rRNA Genes
mately 25 ng of the DNA from Subheading 3.3, step 2. Add
water to a final volume of 25 μL.
2. To control the success of the surface sterilization, use the water
from the final washing step of the surface sterilization (see
Subheading 3.2.1, step 7 as template.
3. Perform negative controls using the reaction mixture without
template.
4. Use the following thermal cycling scheme for amplification:
initial denaturation at 98 °C for 30 s, 6 cycles of: 15 s at 98 °C,
30 s at 53 °C (−0.5 °C per cycle), and 30 s at 72 °C, 20 cycles
of: 15 s at 98 °C, 30 s at 50 °C, and 30 s at 72 °C, and a final
extension at 72 °C for 2 min.
5. Control the success of the PCR by gel electrophoresis.
6. For the second PCR reaction mixture, combine the following
ingredients in a sterile DNA-free 0.2 mL PCR tube: 5 μL of 5×
Phusion GC buffer, 1 μL of primer ITS3F-KYO2 containing the
MiSeq adaptor, 1 μL of primer ITS4 containing the MiSeq adap-
tor, 1.25 μL DMSO, 0.75 μL MgCl2, 0.5 μL dNTP mix, and
0.25 μL Phusion polymerase (2 U/μL). Add up to a final volume
of 24 μL with H2O. The reaction mix can be scaled up as needed.
7. Add 1 μL of the first PCR reaction mixture.
8. Perform negative controls using the reaction mixture without
template.
9. Use the thermal cycling scheme for amplification as described
in step 4.
10. Purify the resulting PCR products using the peqGOLD Gel
Extraction kit (Peqlab) according to the manufacturer’s
instructions.
11. Determine the sequences using the MiSeq Reagent Kit v3 on a
MiSeq sequencer (Illumina, San Diego, USA).
80 Bernd Wemheuer and Franziska Wemheuer
3.4.2 Amplification 1. For the first PCR reaction mixture, combine the following
and Sequencing ingredients in a sterile DNA-free 0.2 mL PCR tube: 2.5 μL of
of Bacterial 16S rRNA 10× Mg-free Taq polymerase buffer, 1.75 μL MgCl2, 0.5 μL of
Genes primer 799f, 0.5 μL of primer 1492r, 0.5 μL dNTP mix,
1.25 μL DMSO, and 1.5 μL Taq DNA polymerase (1 U/μL)
and approximately 25 ng of the DNA from Subheading 3.3,
step 2 to the mixture. Add water to a final volume of 25 μL.
2. To control the success of the surface sterilization, use the wash
water from the final washing step of the surface sterilization
(see Subheading 3.2.1, step 7) as template.
3. Perform negative controls using the reaction mixture without
template.
4. Use the following thermal cycling scheme for amplification:
initial denaturation at 95 °C for 5 min, 35 cycles of: 1 min at
95 °C, 1 min at 50 °C, and 1 min at 72 °C, and a final extension
at 72 °C for 5 min.
5. Control the success of the PCR by gel electrophoresis.
6. Purify the bacterial-specific band by gel extraction using the
peqGOLD Gel Extraction Kit according to the manufacturer’s
instructions (see Note 4). Elute DNA in 30 μL sterile-filtered
and DEPC-treated water.
7. For the second PCR reaction mixture, combine the following
ingredients: 5 μL of 5× Phusion HF buffer, 1 μL of primer F968
containing the MiSeq adaptor, 1 μL of primer R1401 contain-
ing the MiSeq adaptor, 0.5 μL dNTP mix, and 0.5 μL of Phusion
polymerase (2 U/μL). Add up to a final volume of 24 μL with
H2O. The reaction mix can be scaled up as needed.
8. Add 1 μL of the purified PCR product from step 6.
9. Perform negative controls using the reaction mixture without
template.
10. Use the following thermal cycling scheme for amplification:
initial denaturation at 98 °C for 30 s, 30 cycles of: 15 s at
98 °C, 30 s at 53 °C, and 30 s at 72 °C, and a final extension
at 72 °C for 2 min.
11. Purify obtained PCR products using the peqGOLD Gel
Extraction kit according to manufacturer’s instructions.
12. Determine the sequences using the MiSeq Reagent Kit v3 on a
MiSeq sequencer (Illumina, San Diego, USA).
3.5 Processing After sequencing, you will obtain at least two files per sample: one
of Obtained Sequence file from the forward run and the second one from the reverse run.
Data In the first step, sequences must be merged prior to further pro-
cessing. In addition, reads being too short or having a bad quality
3.5.1 Preprocessing
have to be removed. Afterwards, every sample is tagged: a label is
of Sequence Data
added to the header of each sequence. This label is needed for later
(Sample-Wise)
remapping of all sequences on the final OTU sequences and OTU
Assessing Bacterial and Fungal Endophyte Diversity 81
3.5.2 Processing The initial step is to join all preprocessed sequences from all inves-
of Preprocessed Data tigated samples. Do not mix 16S rRNA gene and ITS data. They
need to be processed separately. Afterwards, sequences are derepli-
cated, meaning that all identical sequences are reduced to a single
sequence. Dereplicated sequences are clustered into operational
taxonomic units (OTUs) using the UPARSE algorithm imple-
mented in USEARCH [18]. The clustering involves a de novo
chimera removal step. Afterwards, a reference based chimera
removal is performed with UCHIME [19]. Taxonomy is subse-
quently assigned to each OTU by UBLAST alignment against a
reference data set. Finally, the initial sequences are mapped on
OTU sequences and the result of the mapping is converted to an
OTU table.
1. Join all processed sequences.
cat *_merged_filtered.fasta>[Link]
2. Dereplicate all sequences.
usearch -derep_fulllength [Link] -fastaout /
AllSamples_uniques.fasta -sizeout
3. Cluster sequences in operational taxonomic units.
usearch -cluster_otus AllSamples_uniques.fasta -otus /
AllSamples_otus.fasta -relabel OTU_ -sizein
4. Remove chimeras using UCHIME (see Note 6).
usearch -uchime_ref AllSamples_otus.fasta –db /
<PATH_TO_REFERENCE_DATA>-strand plus /
-nonchimeras AllSamples_otus_uchime.fasta
5. Classify sequences suing UBLAST (see Note 7).
usearch -usearch_local AllSamples_otus_uchime.fasta /
82 Bernd Wemheuer and Franziska Wemheuer
4 Notes
References
1. Hardoim PR, van Overbeek LS, Berg G, 2. Lodewyckx C, Vangronsveld J, Porteous F,
Pirttila AM, Compant S, Campisano A et al Moore ERB, Taghavi S, Mezgeay M et al
(2015) The hidden world within plants, eco- (2002) Endophytic bacteria and their potential
logical and evolutionary considerations for applications. Crit Rev Plant Sci 21:583–606
defining functioning of microbial endophytes. 3. Bulgarelli D, Garrido-Oter R, Münch PC,
Microbiol Mol Biol Rev 79:293–320 Weiman A, Dröge J, Pan Y et al (2015)
84 Bernd Wemheuer and Franziska Wemheuer
Structure and function of the bacterial root heterogeneities of genes encoding 16S rRNAs
microbiota in wild and domesticated barley. in Paenibacillus polymyxa detected by tempera-
Cell Host Microbe 17:392–403 ture gradient gel electrophoresis. J Bacteriol
4. Gottel NR, Castro HF, Kerley M, Yang Z, 178:5636–5643
Pelletier DA, Podar M et al (2011) Distinct 12. Edgar RC (2010) Search and clustering orders
microbial communities within the endosphere of magnitude faster than BLAST. Bioinformatics
and rhizosphere of Populus deltoides roots 26:2460–2461
across contrasting soil types. Appl Environ 13. Abarenkov K, Henrik Nilsson R, Larsson
Microbiol 77:5934–5944 K-H, Alexander IJ, Eberhardt U, Erland S
5. Wemheuer F, Wemheuer B, Kretzschmar D, et al (2010) The UNITE database for molec-
Pfeiffer B, Herzog S, Daniel R et al (2016) ular identification of fungi – recent updates
Impact of grassland management regimes on and future perspectives. New Phytol
bacterial endophyte diversity differs with grass 186:281–285
species. Lett Appl Microbiol 62:323. 14. Cole JR, Wang Q, Cardenas E, Fish J, Chai B,
doi:10.1111/lam.12551 Farris RJ et al (2009) The Ribosomal Database
6. Robinson RJ, Fraaije BA, Clark IM, Jackson Project, improved alignments and new tools
RW, Hirsch PR, Mauchline TH (2016) for rRNA analysis. Nucleic Acids Res
Endophytic bacterial community composition 37:D141–D145
in wheat (Triticum aestivum) is determined by 15. Quast C, Pruesse E, Yilmaz P, Gerken J,
plant tissue type, developmental stage and soil Schweer T, Yarza P et al (2013) The SILVA
nutrient availability. Plant Soil 405:381 ribosomal RNA gene database project,
7. Toju H, Tanabe AS, Yamamoto S, Sato H improved data processing and web-based tools.
(2012) High-coverage ITS primers for the Nucleic Acids Res 41:D590–D596
DNA-based identification of ascomycetes and 16. R Core Team (2014) R, a language and envi-
basidiomycetes in environmental samples. ronment for statistical computing. Vienna, R
PLoS One 7:e40863 Foundation for Statistical Computing.
8. White TJ, Bruns T, Lee S, Taylor J (1990) Available at: [Link]
Amplification and direct sequencing of fungal 17. Araujo WL, Marcon J, Maccheroni W Jr, Van
ribosomal RNA genes for phylogenetics. PCR Elsas JD, Van Vuurde JW, Azevedo JL (2002)
Protoc 18:315–322 Diversity of endophytic bacterial populations
9. Chelius MK, Triplett EW (2001) The diversity and their interaction with Xylella fastidiosa in
of Archaea and Bacteria in association with the citrus plants. Appl Environ Microbiol
roots of Zea mays L. Microb Ecol 41:252–263 68:4906–4914
10. Lane DJ (1991) 16s/23s rRNA sequencing. 18. Edgar RC (2013) UPARSE: highly accurate
In: Stackebrandt E, Goodfellow M (eds) OTU sequences from microbial amplicon
Nucleic acid techniques in bacterial systemat- reads. Nat Methods 10:996–998
ics. John Wiley & Sons, New York, NY, 19. Edgar RC, Haas BJ, Clemente JC, Quince C,
pp 115–175 Knight R (2011) UCHIME improves sensitivity
11. Nübel U, Engelen B, Felske A, Snaidr J, and speed of chimera detection. Bioinformatics
Wieshuber A, Amann RI et al (1996) Sequence 27:2194–2200
Chapter 7
Abstract
Shotgun metagenomic sequencing of bacterial communities in necrotic plant lesions allows insights of
host–pathogen molecular interactions. Soft-rot Enterobacteriaceae are significant crop pathogens with a
wide host range. Reconstructed polymicrobial community DNA from soft-rot affected crops provides
details of species relative abundance and functional potential, enabling significant insights into their lifestyle.
Here, we describe a workflow for DNA recovery, metagenomic shotgun sequencing and in particular, an
in silico analysis of bacterial isolates from affected plant tissue.
1 Introduction
1.1 Soft-Rot The soft-rot Enterobacteriaceae (SRE) are a family of lytic bacterial
Enterobacteriaceae plant pathogens which include members of the former soft-rot
Erwiniae, primarily belonging to the Pectobacterium and Dickeya
genera [1]. These bacteria are responsible for substantial commer-
cial loss on arable and horticultural crops and are both represented
in the top ten bacterial plant pathogens [2]. SRE are necrotrophic
or brute force pathogens which break down plant tissue and estab-
lish infection primarily through pathogenicity components known
as Plant Cell Wall Degrading Enzymes (PCWDE). Unlike the lipid
based structures of mammalian cell walls, plant cell walls are com-
posed of polysaccharides (pectate and cellulose). PCWDE must be
armed with the capability to target these particular polysaccha-
rides in order for the pathogen to be virulent [1]. Animal patho-
genic Enterobacteriaceae also produce PCWDE, but at much
lower levels, and have a reduced capacity to macerate plant tissue
[3]. SRE discharge specific enzymes which destroy plant cell wall
polysaccharides (soft-rot disease) and release nutrients for bacterial
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_7, © Springer Science+Business Media LLC 2017
85
86 James Doonan et al.
1.3 Horizontal Gene The SRE have a battery of established virulence factors. Their
Transfer reproductive success in wide ranging hosts is in part due to their
proclivity for gene loss and horizontal gene transfer (HGT). This
presents a method of virulence gene uptake “en bloc,” as opposed
to the slow evolutionary process of selective point mutations [11].
Additionally, this propensity to exchange genes allows rapid adap-
tation to novel environments and can ultimately lead to speciation
due to the diversifying power of HGT. Virulence genes found
within a metagenome can be readily acquired by Enterobacteriaceae
in the polymicrobial environment and retained if they present an
evolutionary advantage, as opposed to nonbeneficial genes which
are rapidly lost in the dynamics of genome fluctuation [12]. This
gene gain/loss model perpetuates the view of the microbiome as a
community genome whose genes are not only the preserve of a
single bacterium, but as the property of a collective dynamic entity
[13]. To understand community functionality a holistic approach
is required to gain a broader view of inter-bacterial relationships
acting synergistically and antagonistically. This can be explored
through sequenced-based environmental genomics [14].
Metagenomic Analysis of Soft-Rot Enterobacteriaceae 87
2 Materials
2.1 DNA Extraction 1. Qiagen (Manchester, UK) Gentra Puregene Yeast/Bact. kit.
Chemicals
2.2 DNA Enrichment 1. Qiagen (Manchester, UK) QIAamp DNA microbiome kit.
Chemicals
2.3 DNA Library 1. Illumina (Illumina UK, Little Chesterford, UK) Nextera DNA
Preparation Kit library preparation kit.
3 Methods
3.2.1 Plant Tissue 1. The optimal method of host tissue homogenization for bacte-
Homogenization rial DNA extraction, will vary between samples. For plant roots
a ribolyzer (Thermo Savant FastPrep 120 Cell Disrupter
System) may be the most appropriate, e.g., [37]. For leaves a
bead beater (BeadBeater, Thistle Scientific) may be the most
appropriate, e.g., [38]. For homogenization of woody tissue,
use a mallet and chisel to remove the lesion, then place the
material into an appropriate container and transfer to liquid
nitrogen storage. Successful homogenization can be measured
by recovery of bacterial DNA; however, for each sample the
best method will vary. For all disruption methods, prepare a
90 James Doonan et al.
3.2.2 DNA Extraction 1. The Qiagen (Manchester, UK) Gentra Puregene Yeast/Bact.
Kit, produces a high total volume of DNA and has successfully
isolated bacterial DNA from necrotic plant lesions, e.g., [39]
[for alternatives see Note 2].
3.2.4 Library Preparation 1. DNA is prepared for sequencing using platform specific library
preparation kits. Each sequencing platform, e.g., Pacific
Biosciences RSII, Oxford Nanopore MinION or Illumina
HiSeq has tailored kits, with a specific workflow. For the
Illumina HiSeq, there are three kits available for shotgun
metagenomic sequencing, these are; the TruSeq DNA PCR
free kit, TruSeq Nano DNA kit and the Nextera DNA kit. The
TruSeq kits differ in the amount of input DNA required, with
low input volume for the Nano kit (25–75 ng DNA) and high
input volume for the PCR free methods (1–2 μg). Due to its
enzymatic fragmentation method the Nextera kit offers larger
output sequences (300–1500 bp), low input volume (50 ng)
and shorter preparation time, compared to the mechanical
fragmentation and lower output sequence length (350 or
550 bp) of the TruSeq methods.
3.3 Pre-assembly The Illumina HiSeq produces sequence data in Fastq format.
Data Optimization These are typically left and right or 5′ and 3′, paired end sequences,
in large compressed files.
3.3.1 Sequencing Output 1. For a rapid check of sequence data quality, the Java based,
Data and Quality Control NGS quality check program FastQC [17] offers an intuitive
graphical display of sequence data quality. Fastq files can be
directly loaded into the program.
Metagenomic Analysis of Soft-Rot Enterobacteriaceae 91
3.3.2 Removing Adapters 1. Attached sequence adapters should be removed prior to assembly.
and Low Quality The Unix based program Cutadapt [18], removes adapters,
Sequences if the adapter sequence is known, or Trim Galore! [19], a
wrapper tool for Cutadapt, can automatically detect and
remove adapter sequences.
2. Removing low quality sequence data will improve the accuracy
of resultant assemblies, the Unix based NGS tool Sickle [20]
trims and discards poor quality data. Resultant trimmed high
quality sequence data in Fastq format is now ready for down-
stream applications.
Fig. 1 Flowchart beginning with metagenomic sequencing data. Step 1—Data QC. Step 2—Measure relative
species abundance, depicted here using MetaPhlan2 (as part of the HUMAnN software package) and illus-
trated with a heatmap of the top 100 species present at the genus and species level from healthy and unhealthy
plant microbiomes, and a Krona plot [43] of all taxonomic levels. Step 3—Functional analysis, illustrated with
output from HUMAnN2, with sample sequences from healthy and unhealthy plant microbiomes aligned against
the MetaCyc database. General annotation is helpful for taxonomic and functional data overview illustrated
here with PROKKA and MG-RAST. Specific annotation provides a closer examination of community function
examining genes/pathways of interest such as PCWDE using the CAZy database, here through dbCAN, and
secretion systems using T346Hunter, illustrated within a genome
5500 kb
b
0k
50
450
0 kb
1500 kb
kb
00
35
2500
kb
3.6 Specific 1. Biological databases often lack oversight and contain many erro-
Annotation Tools neously identified products. The manually curated CAZy data-
base is an exemplary resource which identifies closely related
carbohydrate active enzymes (CAZymes) and actively updates
nomenclature in keeping with taxonomic appraisals [49].
CAZymes are enzymes involved in the assembly (glycosyltrans-
ferases) and breakdown (glycoside hydrolases, polysaccharide
lyases, and carbohydrate esterases) of complex carbohydrates.
2. A simple method to explore annotation data in the CAZy data-
base is through the online server dbCAN [27]. Using hidden
Markov models dbCAN searches for CAZyme signature domain
regions to identify CAZymes and transfer annotation from the
protein database if the CAZyme family is known. Additionally,
dbCAN has links to GenBank [50] and Pfam [51] domain-
based searches to further explore annotated CAZymes.
Submission of data to dbCAN requires a translated protein file.
Prokka faa output files can be uploaded directly to dbCAN.
3. Extracting secretion system coding domains from general
annotation databases can be laborious and confusing as various
nomenclature schemes are used. Using hidden Markov mod-
els, the Type 3, 4 and 6 secretion system Hunter (T346Hunter)
[28], provides a web-based tool for the prediction of secretion
system clusters and unifies the nomenclature. This annotation
tool was designed for bacterial genomes, but multi-contig
metagenome Fasta files can be uploaded to the server and a
Metagenomic Analysis of Soft-Rot Enterobacteriaceae 95
4 Notes
5 Conclusions
References
1. Toth IK, Pritchard L, Birch PR (2006) plant pathogenic bacteria in molecular plant
Comparative genomics reveals what makes an pathology. Mol Plant Pathol 13:614–629
enterobacterial plant pathogen. Annu Rev 3. Manulis S, Kobayashi DY, Keen NT (1988)
Phytopathol 44:305–336 Molecular cloning and sequencing of a pectate
2. Mansfield J, Genin S, Magori S, Citovsky V, lyase gene from Yersinia pseudotuberculosis.
Sriariyanum M, Ronald P et al (2012) Top 10 J Bacteriol 170:1825–1830
96 James Doonan et al.
4. Toth IK, Bell KS, Holeva MC, Birch PR 18. Martin M (2011) Cutadapt removes adapter
(2003) Soft rot erwiniae: from genes to sequences from high-throughput sequencing
genomes. Mol Plant Pathol 4:17–30 reads. EMBnetJ 17(1):10–12
5. Beaulieu C, Boccara M, Vangijsegem F (1993) 19. Krueger F (2013) Trim Galore!: a wrapper tool
Pathogenic behavior of pectinase-defective around Cutadapt and FastQC to consistently
Erwinia chrysanthemi mutants on different apply quality and adapter trimming to FastQ
plants. Mol Plant Microb Interact 6:197–202 files.
6. Barras F, van Gijsegem F, Chatterjee AK 20. Joshi N and Fass J (2011) Sickle. A sliding-
(1994) Extracellular enzymes and pathogenesis window, adaptive, quality-based trimming tool
of soft-rot erwinia. Annu Rev Phytopathol for FastQ files.
32:201–234 21. Boisvert S, Raymond F, Godzaridis E,
7. Nasser W, Reverchon S, Robert-Baudouy Laviolette F, Corbeil J (2012) Ray Meta: scal-
J (1992) Purification and functional character- able de novo metagenome assembly and profil-
ization of the KdgR protein, a major repressor ing. Genome Biol 13:R122
of pectinolysis genes of Erwinia chrysanthemi. 22. Huson DH, Auch AF, Qi J, Schuster SC
Mol Microbiol 6:257–265 (2007) MEGAN analysis of metagenomic data.
8. Nykyri J, Niemi O, Koskinen P, Nokso-Koivisto Genome Res 17:377–386
J, Pasanen M, Broberg M et al (2012) Revised 23. Seemann T (2014) Prokka: rapid prokaryotic
phylogeny and novel horizontally acquired genome annotation. Bioinformatics
virulence determinants of the model soft rot 30:2068–2069
phytopathogen Pectobacterium wasabiae 24. Abubucker S, Segata N, Goll J, Schubert AM,
SCC3193. PLoS Pathog 8, e1003013 Izard J, Cantarel BL et al (2012) Metabolic
9. Murdoch SL, Trunk K, English G, Fritsch MJ, reconstruction for metagenomic data and its
Pourkarimi E, Coulthurst SJ (2011) The application to the human microbiome. PLoS
opportunistic pathogen Serratia marcescens Comput Biol 8, e1002358
utilizes type VI secretion to target bacterial 25. Segata N, Izard J, Waldron L, Gevers D,
competitors. J Bacteriol 193:6057–6069 Miropolsky L, Garrett WS, Huttenhower C
10. Ochman H, Davalos LM (2006) The nature (2011) Metagenomic biomarker discovery and
and dynamics of bacterial genomes. Science explanation. Genome Biol 12:R60
311:1730–1733 26. Asnicar F, Weingart G, Tickle TL, Huttenhower
11. Dobrindt U, Hochhut B, Hentschel U, Hacker C, Segata N (2015) Compact graphical
J (2004) Genomic islands in pathogenic and representation of phylogenetic data and meta-
environmental microorganisms. Nat Rev data with GraPhlAn. PeerJ 3:e1029
Microbiol 2:414–424 27. Yin Y, Mao X, Yang J, Chen X, Mao F, Xu Y
12. Nowell RW, Green S, Laue BE, Sharp PM (2012) dbCAN: a web resource for automated
(2014) The extent of genome flux and its role carbohydrate-active enzyme annotation.
in the differentiation of bacterial lineages. Nucleic Acids Res 40:W445–W451
Genome Biol Evol 6:1514–1529 28. Martinez-Garcia PM, Ramos C, Rodriguez-
13. Goldenfeld N, Woese C (2007) Biology’s next Palenzuela P (2015) T346Hunter: a novel
revolution. Nature 445:369 web-based tool for the prediction of type III,
14. Marchi G, Sisto A, Cimmino A, Andolfi A, type IV and type VI secretion systems in bacte-
Cipriani MG, Evidente A, Surico G (2006) rial genomes. PLoS One 10, e0119317
Interaction between Pseudomonas savastanoi 29. Vieites JM, Guazzaroni ME, Beloqui A,
pv. savastanoi and Pantoea agglomerans in olive Golyshin PN, Ferrer M (2009) Metagenomics
knots. Plant Pathol 55:614–624 approaches in systems microbiology. FEMS
15. Knight R, Jansson J, Field D, Fierer N, Desai Microbiol Rev 33:236–255
N, Fuhrman JA et al (2012) Unlocking the 30. Frank JA, Pan Y, Tooming-Klunderud A,
potential of metagenomics through replicated Eijsink VGH, McHardy AC, Nederbragt AJ,
experimental design. Nat Biotechnol Pope PB (2015) Improved metagenome
30:513–520 assemblies and taxonomic binning using long-
16. Loman NJ, Pallen MJ (2015) Twenty years of read circular consensus sequence data. bioRxiv
bacterial genome sequencing. Nat Rev doi: 10.1101/026922.
Microbiol 13:787–794 31. Herlemann DP, Lundin D, Labrenz M, Jurgens
17. Andrews S (2010) FastQC: a quality control K, Zheng Z, Aspeborg H, Andersson AF
tool for high throughput sequence data. (2013) Metagenomic de novo assembly of an
Available at: [Link] aquatic representative of the verrucomicrobial
[Link]/projects/fastqc class Spartobacteria. MBio 4:e00569–12
Metagenomic Analysis of Soft-Rot Enterobacteriaceae 97
32. Rinke C, Schwientek P, Sczyrba A, Ivanova NN, in a Web browser. BMC Bioinformatics
Anderson IJ, Cheng JF et al (2013) Insights into 12:385
the phylogeny and coding potential of microbial 44. Meyer F, Paarmann D, D’Souza M, Olson R,
dark matter. Nature 499:431–437 Glass EM, Kubal M et al (2008) The metage-
33. Darling AE, Jospin G, Lowe E, Matsen FA, Bik nomics RAST server - a public resource for the
HM, Eisen JA (2014) PhyloSift: phylogenetic automatic phylogenetic and functional analysis
analysis of genomes and metagenomes. PeerJ of metagenomes. BMC Bioinformatics 9:386
2:e243 45. Carver T, Harris SR, Berriman M, Parkhill J,
34. Phillippy AM, Schatz MC, Pop M (2008) McQuillan JA (2012) Artemis: an integrated
Genome assembly forensics: finding the elusive platform for visualization and analysis of high-
mis-assembly. Genome Biol 9:R55 throughput sequence-based experimental data.
35. Mason OU, Hazen TC, Borglin S, Chain PS, Bioinformatics 28:464–469
Dubinsky EA, Fortney JL et al (2012) 46. Krzywinski M, Schein J, Birol I, Connors J,
Metagenome, metatranscriptome and single- Gascoyne R, Horsman D et al (2009) Circos:
cell sequencing reveal microbial response to an information aesthetic for comparative
Deepwater Horizon oil spill. ISME genomics. Genome Res 19:1639–1645
J 6:1715–1727 47. Altschul SF, Gish W, Miller W, Myers E,
36. Ju F, Zhang T (2015) Experimental design and Lipman D, Park U (1990) Basic local align-
bioinformatics analysis for the application of ment search tool. J Mol Biol 215:403–410
metagenomics in environmental sciences and 48. Segata N, Boernigen D, Tickle TL, Morgan
biotechnology. Environ Sci Technol XC, Garrett WS, Huttenhower C (2013)
49:12628–12640 Computational meta’omics for microbial com-
37. Viebahn M, Veenman C, Wernars K, van Loon munity studies. Mol Syst Biol 9:666
LC, Smit E, Bakker PA (2005) Assessment of 49. Lombard V, Golaconda Ramulu H, Drula E,
differences in ascomycete communities in the Coutinho PM, Henrissat B (2014) The
rhizosphere of field-grown wheat and potato. carbohydrate-active enzymes database (CAZy)
FEMS Microbiol Ecol 53:245–253 in 2013. Nucleic Acids Res 42:D490–D495
38. Cai R, Lewis J, Yan S, Liu H, Clarke CR, 50. Benson DA, Clark K, Karsch-Mizrachi I,
Campanile F et al (2011) The plant pathogen Lipman DJ, Ostell J, Sayers EW (2015)
Pseudomonas syringae pv. tomato is genetically GenBank. Nucleic Acids Res 43:D30–D35
monomorphic and under strong selection to 51. Finn RD, Mistry J, Tate J, Coggill P, Heger A,
evade tomato immunity. PLoS Pathog 7, Pollington JE et al (2010) The Pfam protein
e1002130 families database. Nucleic Acids Res
39. Maes M, Huvenne H, Messens E (2009) 38:D211–D222
Brenneria salicis, the bacterium causing water- 52. Niemann S, Pühler A, Tichy HV, Simon R,
mark disease in willow, resides as an endophyte Selbitschka W (1997) Evaluation of the resolv-
in wood. Environ Microbiol 11:1453–1462 ing power of three different DNA fingerprint-
40. Sharpton TJ (2014) An introduction to the ing methods to discriminate among isolates of
analysis of shotgun metagenomic data. Front a natural Rhizobium meliloti population. J Appl
Plant Sci 5:209 Microbiol 82:477–484
41. Namiki T, Hachiya T, Tanaka H, Sakakibara Y 53. Brady C, Hunter G, Kirk S, Arnold D, Denman
(2012) MetaVelvet: an extension of Velvet S (2014) Rahnella victoriana sp. nov., Rahnella
assembler to de novo metagenome assembly bruchi sp. nov., Rahnella woolbedingensis sp.
from short sequence reads. Nucleic Acids Res nov., classification of Rahnella genomospecies
40, e155 2 and 3 as Rahnella variigena sp. nov. and
42. Clark SC, Egan R, Frazier PI, Wang Z (2013) Rahnella inusitata sp. nov., respectively and
ALE: a generic assembly likelihood evaluation emended description of the genus Rahnella.
framework for assessing the accuracy of genome Syst Appl Microbiol 37:545–552
and metagenome assemblies. Bioinformatics 54. Minot SS, Krumm N, Greenfield NB (2015)
29:435–443 One codex : a sensitive and accurate data plat-
43. Ondov BD, Bergman NH, Phillippy AM form for genomic microbial identification.
(2011) Interactive metagenomic visualization bioRxiv.
Chapter 8
Abstract
The choice of an expression system for the metagenomic DNA of interest is of vital importance for the
detection of any particular gene or gene cluster. Most of the screens to date have used the gram-negative
bacterium Escherichia coli as a host for metagenomic gene libraries. However, the use of E. coli introduces
a potential host bias since only 40 % of the enzymatic activities may be readily recovered by random cloning
in E. coli. To recover some of the remaining 60 %, alternative cloning hosts such as Streptomyces spp. have
been used. Streptomycetes are high-GC gram-positive bacteria belonging to the Actinomycetales and they
have been studied extensively for more than 15 years as an alternative expression system. They are extremely
well suited for the expression of DNA from other actinomycetes and genomes of high GC content.
Furthermore, due to its high innate, extracellular secretion capacity, Streptomyces can be a better system
than E. coli for the production of many extracellular proteins. In this article an overview is given about the
materials and methods for growth and successful expression and secretion of heterologous proteins from
diverse origin using Streptomyces lividans has a host. More in detail, an overview is given about the proto-
cols of transformation, type of plasmids used and of vectors useful for integration of DNA into the host
chromosome, and accompanying cloning strategies. In addition, various control elements for gene expres-
sion including synthetic promoters are discussed, and methods to compare their strength are described.
Integration of the gene of interest under the control of the promoter of choice into S. lividans chromo-
some via homologous recombination using pAMR4-based system is explained. Finally a basic protocol for
benchtop bioreactor experiments which can form the start in the production process optimization and
upscaling is provided.
Key words Streptomyces, Expression, Cloning, Actinomycetes, Cloning vectors, Integrative vectors,
Plasmids, Protein secretion, Fermentation
The original version of this chapter was revised. The erratum to this chapter is available at:
DOI 10.1007/978-1-4939-6691-2_20
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_8, © Springer Science+Business Media LLC 2017
99
100 Yuriy Rebets et al.
1 Introduction
Fig. 2 Syringe with cotton wool, used to filter the spore suspension
2.1.4 Triparental Mating 1. E. coli ET12567 [pUB307], BAC of cosmid library in suitable
E. coli host strain, S. lividans lawn-grown culture.
2. Lysogeny broth (LB): see above in Subheading 2.1.3.
3. Sterile water.
4. Mannitol soya flour (MS) medium: see above in Subheading 2.1.3.
5. Antibiotic stock solutions (where appropriate): ampicillin
(50 mg/mL in dH2O), apramycin (50 mg/mL in dH2O),
kanamycin (50 mg/mL in dH2O), nalidixic acid (25 mg/mL
in 0.2 N NaOH), thiostrepton (50 mg/mL in DMSO), chlor-
amphenicol (25 mg/mL in ethanol).
2.2 Methods S. lividans, and Streptomyces spp. in general, are relatively easy to
grow. However, S. lividans grows much slower than E. coli: a 5 mL
2.2.1 Growth
culture can take 48 h to grow to a sufficient density for further
of S. lividans
experiments. Contrary to E. coli, S. lividans does not show fully
dispersed growth but tends to grow as pellets of mycelium. These
pellets can be troublesome to work with, especially when using one
culture to inoculate a second one. Mechanical homogenization, or
the addition of dispersants or 2 mm glass beads to the medium can
greatly reduce this pelleted growth. Here we describe a basic work-
flow to grow Streptomyces spp. starting from a colony obtained as a
spore suspension or glycerol stock and leading to a 50 mL flask
culture.
1. Pour 20 mL of R2 medium into a standard petri dish and
spread 100 μL of the spore suspension or glycerol stock on the
agar using a glass spreader (see Note 10).
2. After 2–3 days, use an inoculation loop to pick up a single
colony and suspend this colony in 5 mL phage medium.
This culture can be used as a starter for the 50 mL flask culture
(see Note 11).
3. Incubate at 27 °C at 300 rpm for 48–60 h.
4. Pour the culture into a glass cell homogenizer and move the
Teflon piston up and down in the culture to homogenize the
mycelium pellets (see Note 12).
5. Pipette 1 mL of this homogenized culture suspension into an
Erlenmeyer flask containing 50 mL of TSB medium and incu-
bate this culture at 27 °C at 300 rpm. After 24–48 h of growth,
this culture can be used for further analysis (e.g., enzymatic
activity, secondary metabolites).
2.2.2 Preparation Streptomyces spore suspensions are a very useful tool. They are eas-
of S. lividans Spore ier to work with than with standard glycerol stocks (20 % final glyc-
Suspension erol concentration) and inoculation with spore suspension usually
results in cultures that faster reach the required density for further
Expression of Metagenomic DNA in S. lividans and Production Optimization 105
Fig. 3 5 mL sterile tip with inserted cotton wool connected with a short silicone tube to a 20 mL syringe used
for additional filtration of the spore suspension
2.2.3 Plasmid/Cosmid Depending on the type of vector used introducing DNA into
Conjugation from E. coli S. lividans can be done either by protoplast transformation or by
to S. lividans conjugation. The latter has several advantages, the main one being
that the vectors can replicate in E. coli, greatly facilitating the pro-
duction of the required constructs. Furthermore, protoplast trans-
formation is very inefficient when large DNA fragments such as
cosmids are introduced, while having very little influence on the
conjugation efficiency.
Different Streptomyces vectors and their features are described
in heading 3. E. coli–S. lividans cosmid shuttle vectors allow the
construction of libraries using the standard host E. coli, but
the subsequent screening can be performed employing E. coli or
S. lividans as hosts. Here we describe a standard protocol to
perform the conjugation of these or other cosmids from E. coli to
S. lividans.
1. Transform competent E. coli S17-1 (ATCC #4705) or E. coli
ET12567 [pUZ8002] cells containing the DNA of interest
with the oriT containing cosmid (see Note 6).
2. Inoculate the cells of a colony into 5 mL of LB medium,
supplemented with the appropriate antibiotic(s) to select
for the oriT containing plasmid and grow overnight at 30 °C
(see Note 14).
3. Dilute the overnight culture 1:100 in fresh LB medium and
grow at 37 °C to an OD600 of 0.4–0.5.
4. Centrifuge the cells at 5000 × g for 5 min.
5. Decant the supernatant and resuspend the cell pellet in an
equal volume of ice cold LB.
6. Repeat steps 4–5–4 in this order
7. Finally, resuspend the cell pellet in 0.1 volume of ice cold LB
and place the suspension on ice.
8. While washing the E. coli cells, add 108 S. lividans spores to
0.5 mL of 2× YT medium.
9. Centrifuge the spores at 13,000 × g for 1 min
10. Decant the supernatant and resuspend the spores in 0.5 mL of
2× YT medium.
11. Repeat steps 9–10–9–10 in this order
12. Use a heat block to incubate the spore mix at 59 °C for 10 min,
then allow the mixture to cool to room temperature.
13. Add 500 μL of the E. coli cells to the spore mixture. Vortex and
spin briefly.
14. Pour off the supernatant and resuspend the pellet in the
remaining fluid.
15. Plate on MS agar [15] supplemented with 10 mM MgCl2
(see Note 15) and incubate the plates at 27–30 °C for 16–20 h.
Expression of Metagenomic DNA in S. lividans and Production Optimization 107
16. Overlay the plate with 1 mL dH2O containing 0.5 mg nalidixic
acid and the appropriate antibiotic to select for proper excon-
jugants (see Note 16).
17. Spread the antibiotic solution evenly (see Note 17).
18. Continue incubation at 27–30 °C for 3–4 more days.
19. Pick off potential exconjugants to selective media containing
(25 μg/ml) and proper antibiotic for plasmid selection.
2.2.4 Triparental Mating 1. Inoculate cells of a colony of E. coli ET12567 (pUB307) into
5 mL of LB medium, supplemented with chloramphenicol
(25 μg/mL) and kanamycin (25 μg/mL), grow overnight at
37 °C (but not more than 16 h).
2. Inoculate E. coli carrying the BAC or cosmid library based on
oriT containing vector from a glycerol stock into 5 mL of LB
medium supplemented with the appropriate antibiotic. Grow
overnight at 37 °C.
3. Centrifuge the cells at 5000 × g for 5 min.
4. Decant the supernatant, wash the cells with 5 mL of LB to
remove antibiotics. Centrifuge the cells at 5000 × g for 5 min.
5. Resuspend the cell pellet in 0.5 mL of LB and place the sus-
pension on ice.
6. While washing the E. coli cells prepare S. lividans spore suspen-
sion in sterile water or TSB medium. Transfer the spores into
1.5 mL microcentrifuge tubes.
7. Centrifuge the spores at 13,000 × g for 1 min.
8. Decant the supernatant and resuspend the spores in the
remaining liquid.
9. Incubate the spores at 42–45 °C for 10 min, then allow cool-
ing to room temperature (We have found that lowering the
temperature for spore heat shock increases the efficiency of
plasmid transfer).
10. Add 100 μL of the E. coli helper and donor cells to the spore
mixture. Vortex.
11. Plate on MS agar [15] supplemented with 10 mM MgCl2
(see Note 15) and incubate the plates at 27–30 °C for 12 h.
12. Overlay the plate with 1 mL dH2O containing 0.5 mg nalidixic
acid and the appropriate antibiotic (for apramycin 1 mg should
be used) to select for successful exconjugants (see Note 16).
13. Spread the antibiotic solution evenly (see Note 17).
14. Continue incubation at 27–30 °C for 3–4 more days.
15. Pick off potential exconjugants to selective media containing
nalidixic acid (25 μg/mL) and antibiotic for plasmid selection.
108 Yuriy Rebets et al.
2.2.6 Protoplast 1. Take the protoplasts suspension out of the freezer and thaw it
Transformation quickly (see Note 20) without too much heating.
2. Put 200 μL of the thawed protoplast suspension in an
Eppendorf tube.
3. Add the DNA (or ligation mixture) to the protoplast suspen-
sion and mix gently by pipetting up and down.
4. Immediately add 500 μL of the 35 % PEG6000 solution and
mix by gently pipetting up and down.
5. Leave the mixture at room temperature for 5 min.
6. Plate the mixture on R2 plates (see Note 21) and incubate the
plates at 27–30 °C for 16–20 h allowing the protoplasts to
regenerate.
7. Overlay the plate with 1 mL dH2O containing the appropriate
antibiotic (see Note 16).
8. Spread the antibiotic solution evenly (see Note 17).
E. coli Streptomyces
pKC1218 5.8 p15A aac(3)IV SCP2* aac(3)IV lacZ′; oriT RK2 [23]
(continued)
111
112
Table 1
(continued)
E. coli Streptomyces
pTES 5.9 pUC aac(3)IV intøC31 aac(3)IV pSET152 derivative; attP [24]
flanked by loxP sites;
ermEp; tfd terminator
pKC824 5.3 pUC aac(3)IV int pSAM2 aac(3)IV lacZ′ [25]
pKTO2 6.0 pUC bla intVWB tsr [26]
pSOK804 5.3 ColE1 aac(3)IV intVWB aac(3)IV oriT RK2 [27]
pTOS 5.4 ColE1 aac(3)IV intVWB aac(3)IV pSOK804 derivative; [24]
attP flanked by rox
sites; oriT RK2
Cosmid vectors
pOJ446 10.4 p15A aac(3)IV SCP2* aac(3)IV (cos)3λ; oriT RK2 [23]
pKC505 18.7 ColE1 aac(3)IV SCP2* replicon aac(3)IV (cos)3λ [28]
and tra genes
pOJ436 10.4 pUC aac(3)IV intøC31 aac(3)IV (cos)3λ; oriT RK2 [23]
pMM436 10.4 pUC aac(3)IV intøC31 aac(3)IV (cos)3λ; derivative of [8]
pOJ436 with attP and
int gene flanked with
the PacI restriction
site.
pKC767 8.7 pUC aac(3)IV int pSAM2 aac(3)IV (cos)3λ [25]
E. coli Streptomyces
A B
top of the plate
NotI, XbaI, SpeI, MfeI, BsrGI, NheI, NdeI, ClaI, BamHI, PstI, XbaI
FRT
bla
KpnI
pAMR4 neo
10.5 kb
EcoRI bottom of the plate
EcoRI ApaI
EcoRI
KpnI
EcoRI
bpsA BsrGI
EcoRV
NotI
Fig. 4 (a) Restriction map of the plasmid pAMR4. It contains the promoterless bpsA gene, the kanamycin
resistance gene from Tn5 (neo), and the apramycin resistance gene aac3(IV) with oriT and FRT regions from
the plasmid pIJ773 [52] in the backbone of the E. coli plasmid pBluescript II SK+. Unique restriction sites are
colored red. (b) Example of colonies of TK24 after conjugation of the plasmid pAct1LL to delete the actinorho-
din cluster [33] to distinguish between single crossover (blue colonies) and double crossover (white colonies)
Table 2
Antibiotic resistance selective markers for use in Streptomyces
3.1.2 Isolation of Low- 1. 50 mL conical centrifuge tubes, centrifuge for 50 mL tubes
Copy Number Plasmids with at least 15,000 × g, water bath 37 °C, freezer −20 °C, ice
from S. lividans Using bath, glass microscopy slide, QIAGEN Plasmid Midi kit with
the QIAGEN Plasmid QIAGEN-tip 100.
Midi Kit 2. 50–100 mL 2–4 days old culture of S. lividans strain harboring
the plasmid in TSB, YEME or Phage medium.
3. 10.3 % sucrose solution, sterilized by autoclaving.
4. Lysozyme. Weight 50 mg of lysozyme into 50 mL tube. Dis
solve the enzyme in 10 mL of P1 buffer. Store on ice before use.
5. P1 (resuspension) buffer: 50 mM Tris–HCl (pH 8.0), 10 mM
EDTA, RNase A 100 μg/mL (RNase is optional, already
supplemented in QIAGEN Plasmid Midi kit). P2 (lysis buffer):
200 mM NaOH, 1 % SDS (v/v). P3 (neutralization) buffer:
3 M potassium acetate (pH 5.5). QBT (equilibration) buffer:
750 mM NaCl, 50 mM MOPS (pH 7.0), 15 % isopropanol
(v/v), 0.15 % Triton X-100 (v/v). QC (washing) buffer: 1.0 M
NaCl, 50 mM MOPS (pH 7.0), 15 % isopropanol (v/v). QF
(elution) buffer: 1.25 M NaCl, 50 mM Tris–HCl (pH 8.5),
15 % isopropanol (v/v).
6. RNase A solution 10 mg/mL, 10 % SDS solution, Isopropanol,
70 % ethanol, TE buffer, pH 8.0.
Fig. 5 Sealed Pasteur pipette for spooling the total DNA from solution
3.2 Methods Several protocols for plasmid DNA purification from Streptomyces
cells were successfully adapted. In all cases the efficiency of plasmid
3.2.1 Plasmid DNA
purification depends on the replicon used in the vector, age of the
Purification
culture, size of the plasmid. The small replicative shuttle plasmids
with pIJ101 or pSG5 replicon can be easily purified from recombi-
nant S. lividans using the protocol described below. Generated
pDNA is suitable for further manipulations like for PCR, E. coli
transformation, and restriction endonucleases mapping. The DNA
is not suitable for sequencing. For large constructs with low copy
number and for sequencing purposes, an alternative protocol is
described using the QIAGEN pDNA isolation kit.
8. Optional. Spin down tube for a few seconds. Remove all liquid,
dry at room temperature and subsequently dissolve in 500 μL
of TE buffer. Add 30 μL of 5 M potassium acetate (unbuf-
fered), 30 μL of 5 M sodium chloride, and 920 μL of ethanol.
Mix by inverting. Centrifuge for 10 min at 16,000–18,000 × g.
Decant supernatant (see Note 24).
9. Add 700 μL of 70 % ethanol. Centrifuge for 5 min at 16,000–
18,000 × g. Decant supernatant. Spin down for a few seconds
and remove all liquid. Dry the DNA at RT.
10. Dissolve the DNA in 30–50 μL of TE buffer.
Isolation of Low-Copy This protocol is suitable for large size low copy number plasmid
Number Plasmids and cosmid constructs. The yield and purity of DNA is sufficient
from S. lividans Using for enzymatic digestion and sequencing.
the QIAGEN Plasmid 1. Harvest the bacterial cells by centrifugation at 5000 × g for
Midi Kit 10 min at 4 °C. S. lividans TSB grown culture from 50 to
100 mL of media is sufficient for this protocol. Collect biomass
in one sterile 50 mL centrifuge tube.
2. Wash the pellet in 20–30 mL 10.3 % sucrose. Centrifuge at
3000 × g for 10 min. Freeze at −20 °C.
3. Add 8 mL Buffer P1 containing 5 mg/mL of lysozyme.
Resuspend the cells. Incubate 30–60 min at 37 °C, mix by
inversion every 15 min. Control the lysis by mixing 10 μL of
cell suspension with 1 μL of 10 % SDS on a microscope slide.
4. Add 8 mL of Buffer P2, mix gently inverting 4–6 times, incu-
bate at room temperature for 5–15 min (see Note 25).
5. Add 8 mL of chilled Buffer P3, mix immediately by inverting
4–6 times, and incubate on ice for 30–60 min.
6. Centrifuge at 15,000–20,000 × g for 30 min at 4 °C. Gently
transfer supernatant containing DNA into new tube.
7. Centrifuge for another 10 min at 15,000–20,000 × g.
8. During centrifugation equilibrate a QIAGEN-tip 100 by
applying 4 mL Buffer QBT. Allow the column to empty by
gravity flow (2 min) (see Note 26).
9. Apply the supernatant immediately after centrifugation to the
QIAGEN-tip 100 and allow it to flow through the resin by
gravity flow (5 min) (see Note 27).
10. Wash the QIAGEN-tip 100 with 2× 10 mL Buffer QC.
11. Elute the DNA with 5 mL Buffer QF (see Note 28).
12. Combine the eluted DNA solution in one tube. Add 7 mL
room temperature isopropanol. Mix by inverting.
13. Centrifuge at 15,000 × g for 30 min at 4 °C.
Expression of Metagenomic DNA in S. lividans and Production Optimization 121
14. Wash the DNA pellet twice with 1 mL ice-cold 70 % ethanol,
centrifuge at 15,000 × g for 10 min, and carefully decant the
supernatant without disturbing the pellet. Spin down for a few
seconds and remove all liquid.
15. Air-dry the pellet for 5 min and dissolve the DNA in 50–100 μL
TE by incubation at 4 °C overnight.
3.2.2 Total DNA Isolation In many cases the plasmid DNA cannot be directly obtained from
from S. lividans S. lividans culture due to large size, low copy number, integration
into chromosome. In such cases the construct can be recovered by
isolation of the total DNA. The replicative constructs can then be
used to transform E. coli and subsequently be purified. Here we
describe two protocols for isolation of total DNA from S. lividans
and other actinobacteria.
Quick Isolation of Total This procedure is simple and a fast way to purify total DNA from
DNA with Potassium Streptomyces strains. The entire protocol takes around 2 h. The
Acetate Precipitation DNA might still contain contaminating proteins and polysaccha-
rides, but is suitable for downstream applications like enzymatic
digestion, DNA hybridization, and PCR.
1. Transfer 1 mL of 2–3 days old culture of S. lividans into 2 mL
centrifuge tube. Harvest biomass by centrifugation for 1 min
at 5,000 × g. Decant supernatant.
2. Wash cells with 1 mL of STE25 buffer.
3. Resuspend cells in 450 μL of STE25 buffer containing RNase
A (20 μg/mL final concentration) and lysozyme 5 mg/mL.
Incubate at 37 °C for 30–60 min. Mix cells by inverting every
15 min.
4. Preheat the water bath to 65 °C.
5. Add 50 μL of 5 M NaCl to the lysate. Immediately mix by
inverting 2–3 times.
6. Add 120 μL of 10 % SDS. Immediately mix by inverting 2–3
times.
7. Incubate the tube at 65 °C for 15–20 min. The lysate should
become clear.
8. Chill the lysate at room temperature for 2 min. Add 240 μL of
prechilled 5 M potassium acetate (unbuffered). Mix by invert-
ing. Incubate on ice for 30 min.
9. Centrifuge at 16,000–18,000 × g or 15 min at 4 °C. Move the
supernatant containing DNA into fresh 1.5 mL centrifuge
tube.
10. Add 500 mL of isopropanol. Mix gently by inverting. Incubate
at RT for 5 min. Centrifuge at 16,000–18,000 × g for 15 min.
Remove supernatant.
122 Yuriy Rebets et al.
3.2.3 High Quality This protocol is more time consuming but provides a high quality
Genomic DNA Isolation and high yield of genomic DNA. The DNA is suitable for any
downstream manipulations including library construction, genome
sequencing, PCR, enzymatic digestion.
1. Transfer 30 mL of 2–3 days old culture of S. lividans into
50 mL centrifuge tube. Harvest biomass by centrifugation for
10 min at 5000 × g. Decant supernatant.
2. Wash cells with 30 mL of STE25 buffer. Resuspend cells in
5 mL of STE25 buffer containing RNase A (20 μg/mL) and
lysozyme 5 mg/mL. Incubate at 37 °C for 30–60 min. Mix
cells by inverting every 15 min. Control the lysis by mixing
10 μL of cells with 1 μL of 10 % SDS on glass microscopy slide.
3. Add 140 μL of Proteinase K solution, mix by inverting several
times. Add 600 μL of 10 % SDS, mix by inverting. Incubate
55 °C for 2 h. Mix occasionally.
4. Add 2 mL of 5 M sodium chloride solution, mix thoroughly
by inverting.
5. Add 5 mL of chloroform. Mix by inverting for 10 min at room
temperature (see Note 30). Centrifuge for 5 min at 3000 × g
at 20 °C. Transfer aqueous (upper) phase to a fresh 50 mL
tube.
6. Repeat step 5.
7. Transfer aqueous (upper) phase to a fresh 50 mL tube. Add
100 μL of RNase A. Incubate at 37 °C for 30 min.
8. Add 5 mL of isopropanol. Gently mix by inverting. DNA will
appear as white hank of filaments. Spool DNA onto sealed
Pasteur pipette, transfer into 2 mL tube with 1.5 mL of 70 %
ethanol. Centrifuge for 3 min 15,000 × g. Wash DNA with
2 mL of 70 % ethanol. Dry and dissolve in 1–2 mL of TE at
55 °C.
Table 3
Streptomyces promoters used in expression vectors
4.2 Methods Below we will describe the procedure for cloning of the target gene
for functional expression in S. lividans. In many cases the vectors
4.2.1 Cloning of Target
provide the promoter for gene expression. However, the choice of
Gene Under Control
restriction nucleases that can be used is limited by the vector
of Synthetic Promoter
Multiple Cloning Site. In addition, the choice of promoters is lim-
of Choice
ited. Majority of Streptomyces expression vectors are built around
ermEp and tipAp. In most cases these promoters will be sufficient
for functional expression of the target gene. However, if a specific
tuning of gene expression or particular vector is required the pro-
moter sequence can be introduced into the construct by PCR. The
promoters of different strength can be obtained from the synthetic
library [65]. The procedure for cloning of desired gene into
pSOK101 vector under control of synthetic promoter is described
below. The same procedure can be used for other Streptomyces
vectors.
1. Primers design. The forward primer for cloning of the target
gene should be designed in the following way: TATGG
ATCCTGTGCGGGCTCTAACACGTCCTAGTATGGTAG
GATGAGCAA(NNNNNNAAAGGAGGNNNNN)A/CTG
NNNNNNNNNNNNNNNNNNNN
GGATCC—BamHI cloning site.
Expression of Metagenomic DNA in S. lividans and Production Optimization 127
4.2.2 Modification In case the library is built on cosmid or BAC vectors a different
of Large Clones approach can be used to reprogram the transcriptional regulation
by Insertion of Promoter of the target gene or operon. For this purpose the promoter can be
Cassettes introduced as a cassette containing resistance marker by means of
Red/ET recombination technique (Dr. Myronovskyi, unpublished
data). Several such cassettes are built including strong, moderate,
and weak promoters and aac(3)IV, hyg, or aadA resistance genes
(Fig. 6) (accession numbers: KP234256, KP234259; KP234261;
KP234258; KP234260 and KP234257). The resistance markers are
flanked by the modified φC31 integrase recognition sites allowing
simple removal of the marker from the cassette in S. lividans [82].
Fig. 6 (a) The structure of promoter cassette. AntR—antibiotic resistance gene; P-GG and B-CC recombination
sites for antibiotic resistance marker removal [82]. (b) Scheme of promoter replacement and antibiotic resis-
tance gene removal
Removal of the Marker In case the marker in the promoter cassette should be reused, it can
be removed by expression of φC31 integrase in the recombinant
S. lividans strain. If the used vector is based on φC31 integration
system the marker will be removed during conjugation (efficiency
of removal 50–95 % after one passage).
1. Conjugate the pUWLint plasmid into strain harboring the
constructed cosmid or BAC clone with the promoter cassette.
Select exconjugants on thiostrepton-containing medium.
2. Plate one colony on MS media containing thiostrepton
(30 μg/mL) to obtain lawn growth. After 4–5 days scrape
spores and prepare the spore suspension.
3. Plate serial dilutions of spore suspension in TSB on MS plates
without antibiotics.
4. Pick 20 colonies from dilutions plating and transfer on
LB agar plates with antibiotic for selection of promoter cas-
sette and LB agar plates with antibiotic for vector selection.
Select the colonies that are not growing in presence of the first
antibiotic.
5. Verify the removal of antibiotic resistance marker by PCR with
the same primers that were used for verifying the integration of
promoter cassette.
5.1 Materials 1. Primers designed as described in the Methods section (see above).
2. Pfu DNA polymerase or other proof reading DNA
polymerase.
3. The cloning plasmid pAMR4, appropriate restriction enzymes,
T4 DNA ligase.
4. Competent cells from appropriate E. coli cloning host strain
(e.g., E. coli DH5α).
130 Yuriy Rebets et al.
Fig. 7 Scheme of the act cluster replacement in S. lividans TK24 by the rfp1 gene for red fluorescent protein under
the control of the ermEp promoter using the plasmid pRFP1. This plasmid contains 3 kb DNA regions upstream and
downstream of the act cluster cloned in pAMR4, followed by cloning of the rfp1 gene controlled by ermEp and
terminated by the fd terminator. Thick arrows denote the direction and size of genes. Bent arrow indicates
the position of the ermEp promoter. Gene labeling is based on the genomic sequence of S. lividans TK24 (GenBank
Acc. No. CP009124)
5. Agarose gel system, power supply, TAE buffer [83], gel DNA
purification kit (e.g., commercial QIAquick Gel extraction kit,
Qiagen).
6. Solid LB agar medium [83] with apramycin (50 mg/mL).
7. Solid MS agar medium [15] and solid Bennet medium [13]
apramycin (50μg/mL) or kanamycin (50μg/mL).
5.2 Methods 1. Amplify 3 kb DNA fragment by PCR using the S. lividans
TK24 chromosomal DNA as a template and a pair of primers
containing 24 bp homologous regions from the 3 kb region
upstream the S. lividans TK24 actinorhodin gene cluster (con-
taining genes SLIV_12905 to SLIV_12920; Fig. 7) flanked at
the 5′ end with the sequence containing SpeI and MfeI recog-
nition sites (5′-CCCCCACTAGT and 5′-CCCCCAATTG),
preferentially using Pfu proofreading DNA polymerase.
2. Extract the mixture by phenol/chloroform and chloroform,
add 5 μg of glycogen (Roche), and precipitate with ethanol.
Dissolve in water, digest with SpeI and MfeI, and purify the
DNA fragment after preparative agarose electrophoresis by
some commercial kit (Qiaprep etc.). Clone the fragment into
pAMR4 digested by SpeI and MfeI by standard protocol [83].
3. Similarly amplify and clone downstream region of the
actinorhodin cluster (containing genes SLIV_13035 to
Expression of Metagenomic DNA in S. lividans and Production Optimization 131
6.1 Materials For general growth media and media for inoculum preparation: see
Subheading 2.1. Two basic media for fermentation studies are the
6.1.1 Fermentation
following:
Media
1. Minimal medium (MM; adjusted from [87]): Per liter, use
1.8 g NaH2PO4 (Sigma—S0751), 2.6 g K2HPO4 (Chem-
Lab—CL00.1156), 0.6 g MgSO4 · 7H2O (Chem-Lab—
CL00.1324), 3 g (NH4)2SO4 (Chem-Lab—CL00.0148),
10 g glucose (Fisher—G/0500/60), 25 mL trace elements
solution (see Note 34).
2. Trace element solution (40× concentrated): dissolve 40 mg
ZnSO4 · 7H2O (Chem-Lab—CL00.2629), 40 mg FeSO4 ·
7H2O (Fluka—44970), 40 mg MnCl2 · 4H2O (Acros—
205895000), 40 mg CaCl2 (Sigma—21074) in 1 L deionized
water. Filter-sterilize (0.2 μm) and store at 4 °C away from the
light (see Note 35).
3.
Modified minimal liquid medium (NMMP): minimal
medium supplemented with 5 g/L Casamino acids (Bacto
DB) (see Note 36).
6.2.2 Medium Selection Media for research purposes focusing on in-depth characterization
of understanding, e.g., metabolic flux analysis, require a minimal
medium containing a single carbon and nitrogen source (e.g.,
MM). A richer medium is more suitable for preliminary testing of
expression, e.g., NMMP.
Media for production can be very diverse and are typically
undefined complex media, e.g., NMMP, TSB, NB. Amino acids
are typically supplied from a protein hydrolysate, e.g., casamino
acids results from a casein hydrolysate, or result from the degradation
134 Yuriy Rebets et al.
6.2.3 Small-Scale Batch The following protocol describes a batch fermentation in a stan-
Fermentations dard 5 L benchtop bioreactor.
1. Fill the reactor with medium and autoclave (see Notes 36
and 40).
2. Add sterile trace element solution to obtain the desired final
medium composition.
3. Set process operation conditions (see Note 41).
(a) Temperature: 30 °C.
(b) pH: 6.8 (control by automatic addition of 1 M KOH and
1 M H2SO4).
(c) Agitation speed: 400 rpm (see Note 42).
(d) Aeration: 2 L/min compressed air (see Note 43).
(e) DO control: – (see Note 44).
4. Add 500 μL/L of Y-30 antifoaming agent (see Note 45).
5. Inoculate the bioreactor with the desired amount of washed
preculture (see Note 46).
The fermentation for S. lividans wild-type strain takes typically
48–72 h. The duration is determined by the doubling time during
exponential growth and thus by the nutritional properties of the
medium as well as the metabolic burden imposed by metagene
expression. Since secretion is often observed in the (early) station-
ary phase, the culture is typically maintained for a determined
period in this condition. Proteolytic activity may cause degradation
of secreted heterologous proteins and determines the final fermen-
tation time.
6.2.5 Upscaling Medium and process conditions optimization start with lab-scale
Strategies fermentations in 1–10 L bioreactors. The final and challenging
phase includes production process upscaling to 5,000–10,000 L
for high-added value products like biopharmaceuticals, up to more
than 100,000 L for industrial enzymes. Biological, chemical and
physical factors impact upscaling and should be carefully evaluated,
and if possible accounted for beforehand, e.g., [91].
The number of generations (cell divisions) in a large scale pro-
duction will be much higher than in the small bioreactor and a seed
train (i.e., cells are grown to a particular volume and density
through a series of increasingly sized fermenters) is set up to inocu-
late the large reactor tank. Consequently, recombinant production
strains must be stable (e.g., no loss of the plasmid with heterolo-
gous gene) during the seed train and production process. Mixing
is no longer homogeneous in large-scale bioreactors and local
substrate gradients will affect the metabolic capacity of the
production strain and the observed overall production yield.
Increasing stirrer speed avoids heterogeneity but is limited by cell
damage or lysis due to shear stress and by foaming problems which
are especially pronounced with filamentous microorganisms grown
in nutritionally rich media. Besides mixing, transfer of oxygen to
the liquid phase is slow and critical in large-scale aerobic bioreac-
tors. Oxygen availability is important to maintain desired product
yields in streptomycetes fermentations.
Empirical relations between geometric, physical and process
operation parameters (e.g., stirrer speed, tank diameter, impeller
type, viscosity) and mixing and mass transfer efficiency in large-
scale bioreactors can be guiding tools in process upscaling and are
described in many handbooks on bioreactor engineering, e.g., [86,
136 Yuriy Rebets et al.
7 Notes
Acknowledgment
References
1. Gabor EM, Alkema WB, Janssen DB (2004) 5. Anné J, Vrancken K, Van Mellaert L, Van Impe
Quantifying the accessibility of the metage- J, Bernaerts K (2014) Protein secretion bio-
nome by random expression cloning tech- technology in Gram-positive bacteria with spe-
niques. Environ Microbiol 6:879–886 cial emphasis on Streptomyces lividans. Biochim
2. Liebl W, Angelov A, Juergensen J, Chow J, Biophys Acta 1843:1750–1761
Loeschcke A, Drepper T et al (2014) Alter 6. Rückert C, Albersmeier A, Busche T, Jaenicke
native hosts for functional (meta)genome S, Winkler A, Friethjonsson OH et al (2015)
analysis. Appl Microbiol Biotechnol 98:
Complete genome sequence of Streptomyces
8099–8109 lividans TK24. J Biotechnol 199:21–22
3. Rondon MR, August PR, Bettermann AD, 7. Wang GY, Graziani E, Waters B, Pan W, Li X,
Brady SF, Grossman TH, Liles MR et al (2000) McDermott J et al (2000) Novel natural prod-
Cloning the soil metagenome: a strategy for ucts from soil DNA libraries in a streptomycete
accessing the genetic and functional diversity of host. Org Lett 2:2401–2404
uncultured microorganisms. Appl Environ 8. McMahon MD, Guan C, Handelsman J,
Microbiol 66:2541–2547 Thomas MG (2012) Metagenomic analysis of
4. Vrancken K, Anné J (2009) Secretory produc- Streptomyces lividans reveals host-dependent
tion of recombinant proteins by Streptomyces. functional expression. Appl Environ Microbiol
Future Microbiol 4:181–188 78:3622–3629
Expression of Metagenomic DNA in S. lividans and Production Optimization 141
9. Kang HS, Brady SF (2014) Mining soil meta antibiotic biosynthesis in the nystatin producer
genomes to better understand the evolution of Streptomyces noursei ATCC 11455. Micro
natural product structural diversity: pentangu- biology 146(Pt 3):611–619
lar polyphenols as a case study. J Am Chem Soc 21. Fedoryshyn M, Petzke L, Welle E, Bechthold
136:18111–18119 A, Luzhetskyy A (2008) Marker removal from
10. Courtois S, Cappellano CM, Ball M, Francou actinomycetes genome using Flp recombinase.
FX, Normand P, Helynck G et al (2003) Gene 419:43–47
Recombinant environmental libraries provide 22. Dyson PJ, Evans M (1996) pUCS75, a stable
access to microbial diversity for drug discovery high-copy-number Streptomyces Escherichia coli
from natural products. Appl Environ Microbiol shuttle vector which facilitates subcloning from
69:49–55 pUC plasmid and M13 phage vectors. Gene
11. Sianidis G, Pozidis C, Becker F, Vrancken K, 171:71–73
Sjoeholm C, Karamanou S et al (2006) 23. Bierman M, Logan R, Obrien K, Seno ET, Rao
Functional large-scale production of a novel RN, Schoner BE (1992) Plasmid cloning vec-
Jonesia sp. xyloglucanase by heterologous tors for the conjugal transfer of DNA from
secretion from Streptomyces lividans. J Bio Escherichia coli to Streptomyces spp. Gene 116:
technol 121:498–507 43–49
12. Meilleur C, Hupe JF, Juteau P, Shareck F 24. Herrmann S, Siegl T, Luzhetska M, Petzke L,
(2009) Isolation and characterization of a new Jilg C, Welle E et al (2012) Site-specific recom-
alkali-thermostable lipase cloned from a bination strategies for engineering actinomy-
metagenomic library. J Ind Microbiol cete genomes. Appl Environ Microbiol 78:
Biotechnol 36:853–861 1804–1812
13. Horinouchi S, Hara O, Beppu T (1983) 25. Kuhstoss S, Richardson MA, Rao RN (1991)
Cloning of a pleiotropic gene that positively Plasmid cloning vectors that integrate site-
controls biosynthesis of A-factor, actinorhodin, specifically in Streptomyces spp. Gene 97:
and prodigiosin in Streptomyces coelicolor A3(2) 143–146
and Streptomyces lividans. J Bacteriol 155: 26. Van Mellaert L, Mei LJ, Lammertyn E, Schacht
1238–1248 S, Anné J (1998) Site-specific integration of
14. Macneil DJ, Gewain KM, Ruby CL, Dezeny G, bacteriophage VWB genome into Streptomyces
Gibbons PH, Macneil T (1992) Analysis of venezuelae and construction of a VWB-
Streptomyces avermitilis genes required for based integrative vector. Microbiology 144:
avermectin biosynthesis utilizing a novel inte- 3351–3358
gration vector. Gene 111:61–68 27. Sekurova ON, Brautaset T, Sletta H, Borgos
15. Kieser T, Bibb MJ, Buttner MJ, Charter KF, SEF, Jakobsen OM, Ellingsen TE et al (2004)
Hopwood D (2000) Practical Streptomyces In vivo analysis of the regulatory genes in the
genetics. John Innes Foundation, Norwich nystatin biosynthetic gene cluster of
16. Sun N, Wang ZB, Wu HP, Mao XM, Li YQ Streptomyces noursei ATCC 11455 reveals their
(2012) Construction of over-expression shut- differential control over antibiotic biosynthesis.
tle vectors in Streptomyces. Ann Microbiol J Bacteriol 186:1345–1354
62:1541–1546 28. Richardson MA, Kuhstoss S, Solenberg P,
17. Yang R, Hu Z, Deng Z, Li J (1998) Con Schaus NA, Rao RN (1987) A new shuttle cos-
struction of Escherichia coli-Streptomyces shut- mid vector, pKS505, for streptomycetes—its
tle expression vectors for gene expression in use in the cloning of 3 different spiramycin-
Streptomyces. Chin J Biotechnol 14:1–8 resistance genes from a Streptomyces ambofa
18. Hatanaka T, Onaka H, Arima J, Uraji M, ciens library. Gene 61:231–241
Uesugi Y, Usuki H et al (2008) pTONA5: a 29. Sosio M, Giusino F, Cappellano C, Bossi E,
hyperexpression vector in Streptomycetes. Puglia AM, Donadio S (2000) Artificial chro-
Protein Expr Purif 62:244–248 mosomes for antibiotic-producing actinomy-
19. Vara J, Lewandowskaskarbek M, Wang YG, cetes. Nat Biotechnol 18:343–345
Donadio S, Hutchinson CR (1989) Cloning of 30. Jones AC, Gust B, Kulik A, Heide L, Buttner
genes governing the deoxysugar portion of the MJ, Bibb MJ (2013) Phage P1-derived artifi-
erythromycin biosynthesis pathway in Saccharo cial chromosomes facilitate heterologous
polyspora erythraea (Streptomyces erythreus). expression of the FK506 gene cluster. PLoS
J Bacteriol 171:5872–5881 One 8:e69319
20. Zotchev S, Haugan K, Sekurova O, Sletta H, 31. Miao V, Coeffet-LeGal MF, Brian P, Brost R,
Ellingsen TE, Valla S (2000) Identification of a Penn J, Whiting A et al (2005) Daptomycin
gene cluster for antibacterial polyketide-derived biosynthesis in Streptomyces roseosporus: cloning
142 Yuriy Rebets et al.
and analysis of the gene cluster and revision 43. Bilyk B, Luzhetskyy A (2014) Unusual site-
of peptide stereochemistry. Microbiology 151: specific DNA integration into the highly active
1507–1523 pseudo-attB of the Streptomyces albus J1074
32. Liu H, Jiang H, Haltli B, Kulowski K, genome. Appl Microbiol Biotechnol 98:
Muszynska E, Feng XD et al (2009) Rapid 5095–5104
cloning and heterologous expression of the 44. Anné J, Wohlleben W, Burkardt HJ, Springer
meridamycin biosynthetic gene cluster using a R, Pühler A (1984) Morphological and molec-
versatile Escherichia coli-Streptomyces artificial ular characterization of several actinophages
chromosome vector, pSBAC. J Nat Prod 72: isolated from soil which lyse Streptomyces
389–395 cattleya or Streptomyces venezuelae. J Gen
33. Knirschova R, Novakova R, Mingyar E, Microbiol 130:2639–2649
Bekeova C, Homerova D, Kormanec J (2015) 45. Gregory MA, Till R, Smith MCM (2003)
Utilization of a reporter system based on the Integration site for streptomyces phage phi
blue pigment indigoidine biosynthetic gene BT1 and development of site-specific integrat-
bpsA for detection of promoter activity and ing vectors. J Bacteriol 185:5320–5323
deletion of genes in Streptomyces. J Microbiol 46. Fayed B, Younger E, Taylor G, Smith MCM
Methods 113:1–3 (2014) A novel Streptomyces spp. integration
34. Kieser T, Hopwood DA, Wright HM, vector derived from the S. venezuelae phage,
Thompson CJ (1982) pIJ101, a multi-copy SV1. BMC Biotechnol 14:51
broad host-range Streptomyces plasmid: func- 47. Morita K, Yamamoto T, Fusada N, Komatsu
tional analysis and development of DNA clon- M, Ikeda H, Hirano N, Takahashi H (2009)
ing vectors. Mol Gen Genet 185:223–238 The site-specific recombination system of
35. Muth G, Wohlleben W, Pühler A (1988) The actinophage TG1. FEMS Microbiol Lett 297:
minimal replicon of the Streptomyces ghanaensis 234–240
plasmid pSG5 identified by subcloning and 48. Pernodet JL, Simonet JM, Guerineau M
Tn5 mutagenesis. Mol Gen Genet 211: (1984) Plasmids in different strains of
424–429 Streptomyces ambofaciens - free and integrated
36. Schrempf H, Goebel W (1977) Characterization form of plasmid pSAM2. Mol Gen Genet
of a plasmid from Streptomyces coelicolor A3(2). 198:35–41
J Bacteriol 131:251–258 49. Boccard F, Pernodet JL, Friedmann A,
37. Lydiate DJ, Malpartida F, Hopwood DA Guerineau M (1988) Site-specific integration
(1985) The Streptomyces plasmid SCP2star - its of plasmid Psam2 in Streptomyces lividans and
functional analysis and development into useful Streptomyces ambofaciens. Mol Gen Genet
cloning vectors. Gene 35:223–235 212:432–439
38. Bibb MJ, Hopwood DA (1981) Genetic stud- 50. Smokvina T, Mazodier P, Boccard F, Thompson
ies of the fertility plasmid Scp2 and its Scp2 star CJ, Guerineau M (1990) Construction of a
variants in Streptomyces coelicolor A3(2). J Gen series of pSAM2-based integrative vectors for
Microbiol 126:427–442 use in actinomycetes. Gene 94:53–59
39. Hu ZH, Hopwood DA, Hutchinson CR 51. West SC (2003) Molecular views of recombi-
(2003) Enhanced heterologous polyketide nation proteins and their control. Nat Rev Mol
production in Streptomyces by exploiting plas- Cell Biol 4:435–445
mid co-integration. J Ind Microbiol Biotechnol 52. Gust B, Challis GL, Fowler K, Kieser T, Chater
30:516–522 KF (2003) PCR-targeted Streptomyces gene
40. Fong R, Vroom JA, Hu ZH, Hutchinson CR, replacement identifies a protein domain needed
Huang JQ, Cohen SN, Kao CM (2007) for biosynthesis of the sesquiterpene soil
Characterization of a large, stable, high-copy- odor geosmin. Proc Natl Acad Sci U S A 100:
number Streptomyces plasmid that requires sta- 1541–1546
bility and transfer functions for heterologous 53. Cundliffe E (1978) Mechanism of resistance to
polyketide overproduction. Appl Environ thiostrepton in the producing-organism
Microbiol 73:4094 Streptomyces azureus. Nature 272:792–795
41. Kuhstoss S, Rao RN (1991) Analysis of the 54. Stanzak R, Matsushima P, Baltz RH, Rao RN
integration function of the streptomycete bac- (1986) Cloning and expression in Streptomyces
teriophage Phi C31. J Mol Biol 222:897–908 lividans of clustered erythromycin biosynthesis
42. Combes P, Till R, Bee S, Smith MCM (2002) genes from Streptomyces erythreus. Nat Biotech
The Streptomyces genome contains multiple nol 4:229–232
pseudo-attB sites for the phi C31-encoded site- 55. Labigneroussel A, Harel J, Tompkins L (1987)
specific recombination system. J Bacteriol Gene transfer from Escherichia coli to
184:5746–5752 Campylobacter species - development of shuttle
Expression of Metagenomic DNA in S. lividans and Production Optimization 143
vectors for genetic analysis of Campylobacter 68. Lussier FX, Denis F, Shareck F (2010)
jejuni. J Bacteriol 169:5320–5323 Adaptation of the highly productive T7 expres-
56. Mazodier P, Petter R, Thompson C (1989) sion system to Streptomyces lividans. Appl
Intergeneric conjugation between Escherichia Environ Microbiol 76:967–970
coli and Streptomyces species. J Bacteriol 69. Herai S, Hashimoto Y, Higashibata H, Maseda
171:3583–3585 H, Ikeda H, Omura S, Kobayashi M (2004)
57. Flett F, Mersinias V, Smith CP (1997) High Hyper-inducible expression system for strepto-
efficiency intergeneric conjugal transfer of plas- mycetes. Proc Natl Acad Sci U S A 101:
mid DNA from Escherichia coli to methyl 14031–14035
DNA-restricting streptomycetes. FEMS 70. Horbal L, Fedorenko V, Luzhetskyy A (2014)
Microbiol Lett 155:223–229 Novel and tightly regulated resorcinol
58. Bibb MJ, Janssen GR, Ward JM (1985) and cumate-inducible expression systems for
Cloning and analysis of the promoter region of Streptomyces and other actinobacteria. Appl
the erythromycin resistance gene (ErmE) of Microbiol Biotechnol 98:8641–8655
Streptomyces erythraeus. Gene 38:215–226 71. Hindle Z, Smith CP (1994) Substrate induc-
59. Bibb MJ, White J, Ward JM, Janssen GR tion and catabolite repression of the Streptomyces
(1994) The mRNA for the 23S rRNA methyl- coelicolor glycerol operon are mediated
ase encoded by the ermE gene of through the GylR protein. Mol Microbiol
Saccharopolyspora erythraea is translated in the 12:737–745
absence of a conventional ribosome-binding 72. Kataoka M, Tatsuta T, Suzuki I, Kosono S,
site. Mol Microbiol 14:533–545 Seki T, Yoshida T (1996) Development of a
60. McDaniel R, Ebertkhosla S, Hopwood DA, temperature-inducible expression system for
Khosla C (1993) Engineered biosynthesis of Streptomyces spp. J Bacteriol 178:5540–5542
novel polyketides. Science 262:1546–1550 73. Shao ZY, Rao GD, Li C, Abil Z, Luo YZ, Zhao
61. Van Mellaert L, Lammertyn E, Schacht S, HM (2013) Refactoring the silent spectinabilin
Proost P, Van Damme J, Wroblowski B et al gene cluster using a plug-and-play scaffold.
(1998) Molecular characterization of a novel ACS Synth Biol 2:662–669
subtilisin inhibitor protein produced by 74. Luo YZ, Zhang L, Barton KW, Zhao HM
Streptomyces venezuelae CBS762.70. DNA Seq (2015) Systematic identification of a panel of
9:19–30 strong constitutive promoters from Streptomyces
62. Du D, Zhu Y, Wei JH, Tian YQ, Niu G, Tan albus. ACS Synth Biol 4:1001–1010
HR (2013) Improvement of gougerotin and 75. Bai CX, Zhang Y, Zhao XJ, Hu YL, Xiang SH,
nikkomycin production by engineering their Miao J et al (2015) Exploiting a precise design
biosynthetic gene clusters. Appl Microbiol of universal synthetic modular regulatory ele-
Biotechnol 97:6383–6396 ments to unlock the microbial natural products
63. Wang WS, Li X, Wang J, Xiang SH, Feng XZ, in Streptomyces. Proc Natl Acad Sci U S A
Yang KQ (2013) An engineered strong pro- 112:12181–12186
moter for streptomycetes. Appl Environ 76. Murakami T, Holt TG, Thompson CJ (1989)
Microbiol 79:4484–4492 Thiostrepton-induced gene expression in
64. Seghezzi N, Amar P, Koebmann B, Jensen PR, Streptomyces lividans. J Bacteriol 171:
Virolle MJ (2011) The construction of a library 1459–1466
of synthetic promoters revealed some specific 77. Schmittjohn T, Engels JW (1992) Promoter
features of strong Streptomyces promoters. Appl constructions for efficient secretion expression
Microbiol Biotechnol 90:615–623 in Streptomyces lividans. Appl Microbiol
65. Siegl T, Tokovenko B, Myronovskyi M, Biotechnol 36:493–498
Luzhetskyy A (2013) Design, construction and 78. Chiu ML, Folcher M, Katoh T, Puglia AM,
characterisation of a synthetic promoter library Vohradsky J, Yun BS et al (1999) Broad spec-
for fine-tuned gene expression in actinomy- trum thiopeptide recognition specificity of the
cetes. Metab Eng 19:98–106 Streptomyces lividans TipAL protein and its role
66. Kuhstoss S, Rao RN (1991) A thiostrepton- in regulating gene expression. J Biol Chem
inducible expression vector for use in Strep 274:20578–20586
tomyces spp. Gene 103:97–99 79. Pulido D, Jimenez A (1987) Optimization of
67. Rodriguez-Garcia A, Combes P, Perez- gene expression in Streptomyces lividans by a
Redondo R, Smith MCA, Smith MCM (2005) transcription terminator. Nucleic Acids Res
Natural and synthetic tetracycline-inducible 15:4227–4240
promoters for use in the antibiotic-producing 80. Ward JM, Janssen GR, Kieser T, Bibb MJ,
bacteria Streptomyces. Nucleic Acids Res 33 Buttner MJ, Bibb MJ (1986) Construction
144 Yuriy Rebets et al.
Abstract
Network reconstruction procedures based on meta-“omics” data are an invaluable tool for inferring total
and active set of reactions mediated by different members in a microbial community. Within them,
network-based methods for automatic analysis of catabolic capacities in metagenomes are currently limited.
Here, we describe the complete workflow, scripts, and commands allowing the automatic reconstruction of
biodegradation networks using as an input meta-sequences generated by direct DNA sequencing.
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_9, © Springer Science+Business Media LLC 2017
145
146 Rafael Bargiela and Manuel Ferrer
2 Materials
3 Methods
3.1 Identification The Web-based AromaDeg resource [18] is used for catabolic net-
of Catabolic Genes work reconstruction. AromaDeg is a Web-based resource with an
in the Meta- up-to-date and manually curated database that includes an associ-
Sequences ated query system which exploits phylogenomic analysis of the
degradation of aromatic compounds. Each query sequence from a
genome or metagenome that matches a given protein family of
AromaDeg is associated with an experimentally validated catabolic
enzyme performing an aromatic compound degradation reaction.
1. AromaDeg Web-based resource (see Note 1) is used to filter
predicted open reading frames in the metagenomic DNA
sequences (see Note 2) by alignment length (>50 amino acids)
and minimum percentage of homology (>50 %).
2. After a manual check, a final list of gene sequences encoding
enzymes potentially involved in degradation is prepared.
3.2 Creating 1. Each connection in the network represents a step in the deg-
a Degradation Node radation pathway (a degradation reaction), connecting a
Table product with its substrate (nodes), which is assigned to a gene
encoding a catabolic enzyme (for examples see Table 1). Thus,
degradation pathways are represented from the initial sub-
strate to the main common intermediaries and the final steps
until the tricarboxylic acid (TCA) substrates. A table connect-
ing pollutant products, intermediates, and final degradation
products to catabolic enzymes of interest should be prepared
before a network is reconstructed (see Note 3). An example of
the naphthalene-to-catechol-to TCA pathways is summarized
in Fig. 1.
2. Relative abundance (see Note 4) for each type of gene encod-
ing catabolic enzymes found for each metagenomes (according
to the list of detected gene sequences encoding enzymes
potentially involved in degradation) is used to set up the nodes
table, resulting in a list of weights that specifies the size of the
connections in each step of the network for each sample, as
exemplified in Table 1.
Table 1
Table with nodes and connections for graphical visualization of degradation networks
Rel. ab.
genes
(continued)
Degradation Network Reconstruction 149
Table 1
(continued)
Rel. ab.
genes
+ header=TRUE,dec=",",sep="\t",check.
names=FALSE)
> g <-[Link](directed=TRUE)
> u <-unique(c([Link](edgelist[,2]),
150 Rafael Bargiela and Manuel Ferrer
Fig. 1 Description of the general pattern used to draw each degradation pathway. Using the naphthalene deg-
radation pathway as an example, naphthalene is the initial substrate of the pathway, which through several
reactions (represented by dashed lines) is converted to salicylate (intermediate 1) that is degraded to catechol
by a direct reaction (solid line). Catechol is further converted into muconate by a direct reaction (solid line).
Finally, muconate is addressed to the TCA pathway
+ [Link](edgelist[,3])))
> g<-[Link](g,length(u),name=u,
+ size=size,degree=degre
e,dist=dist)
2. After creating a new graph with [Link], all the substrate/
product names are listed in a value with unique and added as
nodes of the new graph with [Link], where some attri-
butes like the size of the node or the position for the labels can
be set up using values like size, degree, or dist.
3.4 Adding 1. There are two different types of connections for the network.
the Connections Those with 0 abundance of the gene of interest in all samples
Between Nodes (empty connections) and the connections with at least one
to the Network sample with an abundance >0 (positive connections). We make
this difference in order to set up independently the drawing
attributes of both types of connections, like the type and curve
of the line in the arrows. See Fig. 2.
2. Empty connections are added first. A loop checking the data is
needed:
> for(i in 1:nrow(edgelist)){
+ if (sum(edgelist[i,4:ncol(edgeli
st)])==0){
+ g<- [Link](g,rbind(edgelist
[i,2],edgelist[i,3]),
+ attr=list(color=
"grey60",curve=0,
+ name=as.
character(edgelist[i,1])))
+ }
+}
3. Connections are introduced in the graph with the function
[Link]. Calculating the total abundance in each network
step (row) from the nodes table (Table 1), it is possible to see
Degradation Network Reconstruction 151
Fig. 2 Description of the two distinct types of connections in the catabolic net-
works. Multiple connections are used when multiple metagenomes are com-
pared. (a) an empty connection with 0 abundance in all the samples, meaning
that no genes encoding catabolic enzymes for this reaction was found in the
metagenomes. (b) a positive connection with abundance >0 in three different
metagenomes (arbitrarily represented in green, red, and blue colored-lines), with
the size of the line according to the relative abundance value of catabolic gene
for each sample
+ name<-append(name,
+
[Link](edgelist[j,1]),
+
after=length(name))
+ }
+ }
+ g<- [Link](g,rbind(from,to),
+
attr=list(weight=weights,
+ color=color,cu
rve=curve),name=name)
+
+ if (curve%%2==0){
+ curve<-abs(curve)
+ }
+ else{
+ curve<- -curve
+ }
+
+ if (curve<0){
+ curve<-curve
+ }
+ else{
+ curve<-abs(curve)+0.2
+ }
+
+}
4. In the case of abundance >0 (at least in one sample) the loop is
more complicated. In the first part, empty vectors for each
sample are created to save (using the function append) the dif-
ferent attributes of the connections in each case (name, weight,
and nodes of the connections). The connections for each sam-
ple are added to the graph at the final of the loop again with
[Link]. The attribute curve is configured before running
this step and is changed at the end of the loop to set the curve
for the next sample.
5. Reason for running two independent loops and checking twice
the whole table, is simple. Checking empty connections needs
to look over the table row by row, like in the first loop, but
checking the positive connections needs to look over the table
column by column (sample by sample), like in the second loop.
6. Note that the line for empty connections is drawn in grey
color, which means that abundance in this case is 0, and the
width of the line is not representing any percentage of gene
presence. Also, these connections can represent a single step in
the pathway (straight line) or multiple reactions (dashed line).
Degradation Network Reconstruction 153
3.5 Setting 1. Coordinates of the nodes determine the position of each node
Up the Coordinates (substrate/product) in the final draw of the network. These
of the Nodes coordinates can be set manually, in order to obtain a custom-
in the Network ized layout for the network, saved in a file, which is used when
needed to draw a new network, without a new manual setup:
> p <- tkplot(g)
> Coords <- [Link](p)
> [Link](Coords,”[Link]”,row.
names=FALSE,[Link]=FALSE)
> Coords<- matrix(scan(“Coords.
txt”),nc=2,byrow=TRUE)
2. Function tkplot displays a new interactive screen where one can
point each node in the desired position and then save the coor-
dinates in a value with [Link]. Using [Link] is pos-
sible to print the value with the coordinates in an output file,
and read it again using matrix and scan.
3.6 Drawing 1. Network can be drawn using the coordinates and the configu-
the Degradation ration in the prior steps:
Network > jpeg("[Link]",width=5796,height=3561,
+ res=300,quality=100,units="px")
> par(mar=c(0,0,0,0),xpd=TRUE)
> [Link](g,
+ layout=Coords,
+ [Link]=shape,
+ [Link]=size1,
+ vertex.size2=size2,
+ vertex.size2=size2,
+ [Link]=labels,
+ [Link]=V(g)$dist,
+ [Link]=V(g)$degree,
+ [Link]=V(g)$dist,
+ [Link]=V(g)$degree,
+ [Link]=ifelse(E(g)$weight<=0.01,1,
+ ifelse(E(g)$weight>0.10,10,E(g)$
weight*100)),
+ [Link]=lty
+ )
+ [Link]()
2. Functions jpeg and [Link] are used to save the plot in a jpeg file.
The main function to draw the network is [Link], using
the coordinates saved before as layout, and the parameters pro-
vided when the vertices were added to the graph object to set
up the different options of the function. Other options can be
modified using vector objects with values for the different ver-
tices/connections. Abundances for each node in each sample
are used as the width of the connections (saved as connection
154 Rafael Bargiela and Manuel Ferrer
4 Notes
Fig. 3 Potential aromatic catabolic networks constructed using metagenome data sets. The biodegradation
network reconstruction was performed as in Subheadings 3.2–3.6, for two arbitrary metagenomes repre-
sented by red and blue color (see Note 5). Briefly, catabolic genes were identified as described in
Subheading 3.1. For network reconstruction, each sequence subsequently was assigned to a metabolic
substrate as well as a product (as defined by [18]) with an assigned code. The putative substrates and
products processed in the sample were connected, creating a metabolic network using appropriate scripts
and commands [19, 20]. The number of each catabolic gene assigned to degradation reactions, is repre-
sented by the thickness of the lines in the figure and the complete list of substrates possibly degraded by
the communities are summarized. Common and sample-specific initial pollutants or intermediates for
which presumptive degradation signatures are identified are specifically indicated in the figure. Solid lines
represent single step reactions while dotted lines represent degradation steps where multiple reactions are
involved [19, 20]. Gene names or codes (see Note 6) as follows: Abs 4-aminobenzenesulfonate 3,4-dioxy-
genase, Bph biphenyl dioxygenase, Bzn benzene dioxygenase, Bzt benzoate dioxygenase, Cat catechol
2,3-dioxygenase, 2CB 2-chlorobenzoate dioxygenase, Cum p-cumate dioxygenase, Dhb
2,3-Dihydroxybiphenyl dioxygenase, Dpp 2,3-dihydroxyphenylpropionate dioxygenase, Gen gentisate diox-
ygenase, Hna 1-hydroxy-2-naphthoate dioxygenase, Hpc homoprotocatechuate 2,3-dioxygenase, Ibu ibu-
profen-CoA dioxygenase, Ind Rieske oxygenase involved in indole acetic acid degradation, Odm
2-oxo-1,2-dihydroxyquinoline monooxygenase, Orc orcinol hydroxylase, Pca protocatechuate 3,4-dioxy-
genase, Pht phthalate 4,5-dioxygenase, Thb 2,2′,3-trihydroxybiphenyl dioxygenase
156 Rafael Bargiela and Manuel Ferrer
Acknowledgments
References
1. Röling WF, Ferrer M, Golyshin PN (2010) 10. Zamboni N, Kummel A, Heinemann M (2008)
Systems approaches to microbial communities anNET: a tool for network-embedded thermo-
and their functioning. Curr Opin Biotechnol dynamic analysis of quantitative metabolome
21:532–538 data. BMC Bioinformatics 9:199
2. Yamada T, Letunic I, Okuda S, Kanehisa M, 11. Pey J, Tobalina L, de Cisneros JP, Planes FJ
Bork P (2011) iPath2.0: interactive pathway (2013) A network-based approach for predict-
explorer. Nucleic Acids Res 39:W412–W415 ing key enzymes explaining metabolite abun-
3. Letunic I, Yamada T, Kanehisa M, Bork P dance alterations in a disease phenotype. BMC
(2008) iPath: interactive exploration of bio- Syst Biol 7:62
chemical pathways and networks. Trends 12. Bachmann H, Fischlechner M, Rabbers I,
Biochem Sci 33:101–103 Barfa N, Branco dos Santos F, Molenaar D,
4. Palsson B (2009) Metabolic systems biology. Teusink B (2013) Availability of public goods
FEBS Lett 583:3900–3904 shapes the evolution of competing metabolic
5. McCloskey D, Palsson BO, Feist AM (2013) strategies. Proc Natl Acad Sci U S A 110:
Basic and applied uses of genome-scale meta- 14302–14307
bolic network reconstructions of Escherichia 13. Zomorrodi AR, Suthers PF, Ranganathan S,
coli. Mol Syst Biol 9:661 Maranas CD (2012) Mathematical optimiza-
6. Bordbar A, Palsson BO (2012) Using the tion applications in metabolic networks. Metab
reconstructed genome-scale human metabolic Eng 14:672–686
network to study physiology and pathology. 14. Henry CS, DeJongh M, Best AA, Frybarger
J Intern Med 271:131–141 PM, Linsay B, Stevens RL (2010) High-
7. Jerby L, Shlomi T, Ruppin E (2010) throughput generation, optimization and anal-
Computational reconstruction of tissue-specific ysis of genome-scale metabolic models. Nat
metabolic models: application to human liver Biotechnol 28:977–982
metabolism. Mol Syst Biol 6:401 15. Branco dos Santos F, de Vos WM, Teusink B
8. Rezola A, Pey J, de Figueiredo LF, Podhorski (2013) Towards metagenome-scale models for
A, Schuster S, Rubio A, Planes FJ (2013) industrial applications--the case of Lactic Acid
Selection of human tissue-specific elementary Bacteria. Curr Opin Biotechnol 24:200–206
flux modes using gene expression data. 16. Zomorrodi AR, Maranas CD (2012) OptCom:
Bioinformatics 29:2009–2016 a multi-level optimization framework for the
9. Tobalina L, Bargiela R, Pey J, Herbst FA, metabolic modeling and analysis of microbial
Lores I, Rojo D et al (2015) Context-specific communities. PLoS Comput Biol 8:e1002363
metabolic network reconstruction of a 17. Khandelwal RA, Olivier BG, Roling WF,
naphthalene-degrading bacterial community Teusink B, Bruggeman FJ (2013) Community
guided by metaproteomic data. Bioinformatics flux balance analysis for microbial consortia at
31:1771–1779 balanced growth. PLoS One 8:e64567
Degradation Network Reconstruction 157
18. Duarte M, Jauregui R, Vilchez-Vargas R, Junca acid and ammonium amendments in oil-
H, Pieper DH (2014) AromaDeg, a novel degrading marine microcosm guides by
database for phylogenomics of aerobic bacterial metagenomic data. Front Microbiol 6:1270
degradation of aromatics. Database (Oxford) 20. Bargiela R, Mapelli F, Rojo D, Chouaia B,
2014:bau118 Tornes J, Borin S et al (2015) Bacterial popula-
19. Bargiela R, Gertler C, Magagnini M, Mapelli tion and biodegradation potential in chronically
F, Chen J, Daffonchio D et al (2015) crude oil-contaminated marine sediments are
Degradation network reconstruction in uric strongly linked to temperature. Sci Rep 5:11651
Chapter 10
Abstract
Functional expression of genes from metagenomic libraries is limited by various factors including
inefficient transcription and/or translation of target genes as well as improper folding and assembly of the
corresponding proteins caused by the lack of appropriate chaperones and cofactors. It is now well accepted
that the use of different expression hosts of distinct phylogeny and physiology can dramatically increase the
rate of success. In the following chapter, we therefore describe tools and protocols allowing for the com-
parative heterologous expression of genes in five bacterial expression hosts, namely Escherichia coli,
Pseudomonas putida, Bacillus subtilis, Burkholderia glumae, and Rhodobacter capsulatus. Different broad-
host-range shuttle vectors are described that allow activity-based screening of metagenomic DNA in these
bacteria. Furthermore, we describe the newly developed transfer-and-expression system TREX which com-
prises genetic elements essential to allow for expression of large clusters of functionally coupled genes in
different microbial species.
Key words Metagenomic library, Environmental DNA, Activity-based screening, Functional expression,
Multi-host screening, Shuttle vector, Escherichia coli, Pseudomonas putida, Bacillus subtilis, Rhodobacter
capsulatus, Burkholderia glumae, Transposon
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_10, © Springer Science+Business Media LLC 2017
159
160 Nadine Katzke et al.
Table 1
Features of bacterial expression host strains
2 Materials
2.1 Bacterial Strains, Chemicals were obtained from Carl Roth GmbH (Karlsruhe,
Media, and Antibiotics Germany) if not noted otherwise.
1. E. coli DH5α (Thermo Fisher Scientific, Waltham, Massachusetts,
USA) is used for DNA cloning and E. coli S17-1 [48] for conju-
gational transfer of plasmids to R. capsulatus and B. glumae PG1
(see Note 1).
2. P. putida KT2440 [37] and B. subtilis TEB1030 [43] are used
for screening and expression with the pEBP18 and TREX
system.
3. B. glumae PG1 [32] is used for transformation with plasmids
or transposons.
4. R. capsulatus B10S is used for expression with plasmids of the
pRhok series. Strain B10S-T7 is used for T7-dependent expres-
sion [49].
5. Luria–Bertani (LB) medium [50] contains 10 g/L tryptone
(peptone from casein), 5 g/L yeast extract, and 5 g/L NaCl
solubilized in deionized water and autoclaved (121 °C, 2 bar,
20 min). 2× LB medium contains the same components at
doubled concentration.
6. EM medium is prepared by dissolving 20 g/L tryptone (pep-
tone from casein), 5 g/L yeast extract, and 5 g/L NaCl in
deionized water, adjusting pH to 7.2 and autoclaving (121 °C,
2 bar, 20 min). After sterilization and cooling, 5 mL/L of ster-
ile glucose solution (50 % (w/v) α-d(+)-glucose monohydrate)
is added to obtain a final concentration of 0.5 % (w/v).
7. EM1 medium is EM medium containing 1 % (w/v) glucose.
8. Minimal Medium E (MME) is prepared as 50× stock solution
[51]. 10 g MgSO4 · 7H2O, 100 g citric acid × 1H2O, 500 g
K2HPO4, and 175 g NaNH4HPO4 · 4H2O are dissolved suc-
cessively in 670 mL deionized water, resulting in approxi-
mately 1 L stock, and autoclaved (121 °C, 2 bar, 20 min).
After 50-fold dilution with autoclaved water the resulting
medium has a pH of 7.0. For MME agar plates, 1.5 % (w/v)
agar, dissolved in water, is autoclaved and subsequently supple-
mented with 0.5 % (w/v) glucose, 1/50 volume of MME stock
solution and appropriate volumes of antibiotic solutions added
after cooling to about 60 °C.
9. RCV minimal medium for cultivation of R. capsulatus is pre-
pared according to Table 2. This solution is autoclaved (121 °C,
2 bar, 20 min). After cooling, add 9.6 mL 1 M phosphate buffer
(81.3 g KH2PO4 and 78.7 g K2HPO4 in 500 mL deionized
water, pH 6.8), 40 mL of a 10 % dl-malate solution (pH 6.8)
and 10 mL of a 10 % (NH4)2SO4 solution (see Note 2).
Tools for Metagenomic Gene Expression 163
Table 2
RCV minimal medium composition (modified from ref. [49])
2.2 Vectors 1. Shuttle vector pEBP18 (Fig. 1a): this 10.6 kb shuttle vector
replicates in E. coli (oriEc) and in P. putida (oriPp) as episomal
plasmid. In B. subtilis, the shuttle vector is integrated into the
amylase locus of the bacterial chromosome (amyE’Bs, ‘amyEBs)
via homologous recombination. Heterologous DNA is inserted
into the BamHI cloning site. SwaI restriction sites upstream
and downstream of the cloning site enable reisolation of DNA
fragments. Heterologous genes are expressed from the induc-
ible promoters PT7 (T7 RNA polymerase dependent) in E. coli,
P. putida and B. subtilis or Pxyl (inducible by xylose) in B. subti-
lis. The included GFP gene (gfp) can be used to monitor gene
expression. The cos site allows highly efficient transduction of
E. coli by phage infection (which is necessary if the shuttle vec-
tor carries large inserts increasing its size to 37–52 kb) [52].
2. pUC18: 2.6 kb standard cloning vector for E. coli with ori
pMB1, carrying an ampicillin resistance gene (Thermo Fisher
Scientific, Waltham, Massachusetts, USA).
3. pBBR1MCS series (Fig. 1b): pBBR1MCS vectors contain a
multiple cloning site, a mob site for conjugational transfer and
a broad-host-range origin of replication which is recognized by
Gram-negative bacteria like E. coli and B. glumae. For the pro-
tocols in this chapter, the 4.7 kb plasmid pBBR1MCS [53] is
used which harbors a chloramphenicol resistance marker.
Other plasmids of the pBBR1MCS series [54] can also be
used, namely pBBR1MCS-2 (kanamycin), pBBR1MCS-3
(tetracycline), and pBBR1MCS-5 (gentamycin).
4. pIC20H-RL (Fig. 2c): The 9.5 kb plasmid pIC20H-RL is a
pUC19 derived multi copy E. coli vector with ori pMB1 and
ApR as resistance gene and carries the TREX cassettes [31].
Tools for Metagenomic Gene Expression 165
Fig. 1 Vectors for metagenomic library construction and expression in various host organisms. (a) Shuttle vector
pEBP18 for library construction in E. coli, P. putida, and B. subtilis. (b) Expression plasmid pBBR1MCS for B. glu-
mae PG1. Additional vectors of the pBBR1MCS series are available which differ in the antibiotic resistance gene
and in multiple cloning site composition [43]. (c) Plasmid pRhokHi-2 for constitutive expression in R. capsulatus.
(d) Plasmid pRhotHi-2 for T7 RNA polymerase dependent expression in R. capsulatus. KmR kanamycin resistance
gene, CmR chloramphenicol resistance gene, PT7 T7-promoter region, PXyl Xyl-promoter-region, Plac lac-promoter
region, oriPp origin of replication for P. putida, oriEc origin of replication for E. coli, rep origin of replication, mob
origin of transfer, amyEBs integration sites for B. subtilis, His6 6× histidine tag, cos transduction site, ++ additional
restriction sites available. Drawings are not to scale
Fig. 2 Structure and function of the pathway transfer and expression system
TREX. (a) The TREX system consists of two DNA cassettes, the L-TREX (white)
and R-TREX (black) cassette, which comprise all elements for integrating and
expressing a DNA fragment with multiple genes in a heterologous bacterial host.
(b) Schematic depiction of the principle of TREX-mediated transfer and expres-
sion, which includes the “labeling” of a DNA fragment with target genes of inter-
est with the TREX cassettes (step 1), the conjugational transfer of the TREX-labeled
genes to a Gram-negative bacterial host (step 2), the randomized integration of
TREX-labeled genes into the bacterial chromosome by transposition (step 3) (the
transposing region of the plasmid construct is indicated by grey shading at step
1), and finally, the bidirectional expression of all genes by T7 RNA polymerase
(step 4). (c) Plasmid pIC20H-RL carries the TREX cassettes as <L-TREX-R> mod-
ule encompassing the L-TREX and R-TREX cassettes in an “inside-out” fashion
with the T7 promoters pointing outward, flanked by XbaI restriction sites. For
straight-forward one-step TREX labeling, this module can be inserted into a vec-
tor carrying a DNA fragment to be expressed. Alternatively, NdeI, XmnI, or ScaI
sites may be used to introduce target genes in this vector. ApR ampicillin resis-
tance gene, GmR gentamicin resistance gene, TcR tetracycline resistance gene,
oriT origin of transfer, OE outside end of transposon Tn5, PT7 T7 bacteriophage
promoter, tnp Tn5 transposase gene
Tools for Metagenomic Gene Expression 167
2.3 Preparation All chemicals are obtained from Carl Roth GmbH (Karlsruhe,
of Competent Cells: Germany), if not noted otherwise.
Solutions and Cuvettes
1. Electroporation cuvettes: 1 mm gap and 2 mm gap (Bio-
Budget Technologies GmbH, Krefeld, Germany).
2. MilliQ water is a registered trademark for water purification
systems (Millipore GmbH, Schwalbach, Germany) providing
water with a conductance of 18.2 mΩ at 25 °C. Sterilize by
autoclaving (121 °C, 2 bar, 20 min) and store at 4 °C.
3. Glycerol solution: 10 % (v/v) Rotipuran glycerol (Carl Roth
GmbH, Karlsruhe, Germany) in MilliQ water. Sterilize by
autoclaving (121 °C, 2 bar, 20 min) and store at 4 °C.
4. Sucrose solution: 300 mM sucrose (Merck KGaA, Darmstadt,
Germany) in MilliQ water. Sterilize by autoclaving (121 °C,
2 bar, 20 min) and store at 4 °C.
5. Sucrose–glycerol solution: 300 mM sucrose (Merck KGaA,
Darmstadt, Germany) and 10 % (v/v) Rotipuran glycerol (Carl
Roth GmbH, Karlsruhe, Germany) in MilliQ water. Sterilize
by autoclaving (121 °C, 2 bar, 20 min) and store at 4 °C.
6.
Paris-Medium: 60 mM potassium hydrogen phosphate
(K2HPO4), 40 mM potassium dihydrogen phosphate
168 Nadine Katzke et al.
Table 3
Concentrations [μg/mL] of antibiotics
2.4 Solutions Chemicals were obtained from Carl Roth GmbH (Karlsruhe,
for DNA Extraction Germany) if not noted otherwise.
and Purification
1. Isopropanol: Rotisolv 2-propanol.
2. Ethanol: Rotisolv ethanol is diluted to 70 % (v/v) with deion-
ized water.
3. Sodium acetate: solution of 3 M sodium acetate in deionized
water. Adjust to pH 5.5 with acetic acid (do not use HCl).
4. Solution #1 (for extraction of genomic DNA from a bacterial
sample): 345 mM sucrose (Merck KGaA, Darmstadt,
Germany), 10 mM Tris–HCl pH 8.0, 1 mM EDTA pH 8.0,
and 2 mg/mL lysozyme (Sigma-Aldrich Chemie GmbH,
Munich, Germany).
5. Solution #2 (for extraction of genomic DNA from a bacterial
sample): 300 mM NaCl, 2 % (w/v) SDS, 100 mM Tris–HCl
pH 8.0, and 20 mM EDTA pH 8.0.
Tools for Metagenomic Gene Expression 169
2.5 Commercial Kits 1. Plasmid DNA preparation: innuPREP Plasmid Mini Kit
(Analytik Jena AG, Jena, Germany) or NucleoBond Xtra Midi
Kit (Macherey-Nagel GmbH & Co. KG, Dueren, Germany).
2. DNA isolation from agarose gels: innuPrep DOUBLEpure Kit
(Analytik Jena AG, Jena, Germany).
2.6 Enzymes Enzymes are obtained from Thermo Fisher Scientific (Waltham,
Massachusetts, USA) unless noted otherwise and applied with buf-
fers at optimal reaction temperature.
1. Restriction enzymes: BamHI (10 U/μL), Bsp143I (Sau3AI,
10 U/μL), NdeI (10 U/μL), SwaI (10 U/μL), XhoI (10 U/μL).
2. FastAP thermosensitive alkaline phosphatase, 1 U/μL.
3. T4 DNA ligase, 1 U/μL.
4. T4 polynucleotide kinase, 10 U/μL.
5. Lysozyme from chicken egg white (Fluka, Sigma-Aldrich
Chemie GmbH, Munich, Germany): 100 mg/mL dissolved in
10 mM Tris–HCl, sterilized by sterile filtration (pore diameter
of filter: 0.22 mm), and stored at −20 °C.
6. Proteinase K from Tritirachium album (Merck KGaA,
Darmstadt, Germany): 10 mg/mL solubilized in deionized
water, sterilized by filtration (pore diameter of filter: 0.22 mm),
and stored at −20 °C.
7. DNase-free RNaseA is prepared according to ref. [50], Vol. 3,
Appendix A4.39. 100 mg/mL Ribonuclease A from bovine
pancreas (Fluka, Sigma-Aldrich Chemie GmbH, Munich,
Germany) is dissolved in sodium acetate solution (0.01 M
sodium acetate; adjust to pH 5.2 with acetic acid). Heat to
170 Nadine Katzke et al.
2.7 DNA Ladder 1. GeneRuler 1 kb DNA ladder (Thermo Fisher Scientific,
Waltham, Massachusetts, USA), fragments (in bp): 10,000,
8000, 6000, 5000, 4000, 3500, 3000, 2500, 2000, 1500,
1000, 750, 500, 250.
2. 1 kb DNA extension ladder (Thermo Fisher Scientific,
Waltham, Massachusetts, USA), fragments (in bp): 40,000,
20,000, 15,000, 10,000, 8144, 7126, 6108, 5090/5000,
4072, 3054, 2026, 1636, 1018, 517/506.
2.8 Devices The devices described here may be replaced by alternative devices
and Materials with adequate specifications.
1. DNA concentration is measured with a BioPhotometer
(Eppendorf AG, Hamburg, Germany) in combination with
the quartz cuvette TrayCell (Hellma GmbH & Co. KG,
Müllheim, Germany) and a 1 or 0.2 mm lid.
2. For anaerobic cultivation of R. capsulatus on solid media:
Microbiology Anaerocult A system (Merck KGaA, Darmstadt,
Germany), consisting of air-tight containers as well as gas packs
to deplete atmospheric oxygen.
3. French Press cell disruptor, with French pressure cell 40K, 1″
piston diameter (Thermo Fisher Scientific, Waltham,
Massachusetts, USA).
4. Electroporation Device: MicroPulser (Bio-Rad, Munich,
Germany).
5. Cellulose acetate membrane filters: 0.2 μm pore size, 25 mm
diameter (GE Healthcare UK Limited, Buckinghamshire, UK).
3 Methods
3.1 Metagenomic 1. Prepare 50 μg of vector pEBP18 DNA from an overnight cul-
Library Construction ture of E. coli DH5α (pEBP18) with the NucleoBond Xtra
with the Shuttle Vector Midi Kit. Determine DNA concentration photometrically.
pEBP18 2. Hydrolyze 50 μg of vector with 50 U BamHI in a volume of
3.1.1 Linearization
200–300 μL at 37 °C for 4 h (see Note 5).
and Dephosphorylation 3. Use agarose gel electrophoresis to analyze an aliquot (1–2 μL)
of the Shuttle Vector of the hydrolyzed DNA and the same amount of undigested
pEBP18 vector as control. If linearization is incomplete, add 2.5 μL
enzyme buffer (10×), 20 U BamHI, and 20.5 μL deionized
water. Mix carefully and incubate for 2 additional hours at
37 °C. Repeat this step until complete linearization of the
Tools for Metagenomic Gene Expression 171
3.1.2 Isolation This method for isolation of metagenomics DNA applies to sam-
of Metagenomic DNA ples from bacterial cell pellets derived from biofilms or lake water.
It is not recommended to use this protocol for extraction of DNA
from soil samples, since humic substances, organic compounds, or
saline that often contaminate environmental DNA are difficult to
remove and interfere with enzyme reactions like restriction digest
or ligation.
172 Nadine Katzke et al.
10. Pick individual clones and replate them to agar plates with an
appropriate substrate to screen for the desired enzyme
activity.
3.2 Expression The TREX system enables the expression of native gene clusters in
of Clustered Genes diverse bacterial hosts [30, 31]. It consists of two DNA cassettes
with TREX (L-TREX and R-TREX cassette) and is handled including the fol-
lowing key steps (Fig. 2).
(1) A plasmid is constructed which carries a DNA fragment
containing the target gene cluster and the TREX cassettes. (2)
Conjugational transfer to a host organism and transposon integra-
tion of the construct into the host genome are employed to pro-
duce stable expression strains. (3) Expression of clustered genes is
178 Nadine Katzke et al.
3.2.1 General Guidelines Principle: As a first step, the TREX cassettes and the target DNA
for the Application fragment are combined on a plasmid, the “TREX expression con-
of the TREX Expression struct” (see Fig. 2b, step 1). The target DNA fragment containing
System the gene cluster of interest is thus labeled with the TREX cassettes
to enable delivery and expression.
Construction of the TREX
Construction procedure: TREX expression constructs can be
Expression Construct
assembled by various methods including restriction/ligation clon-
ing, Gibson assembly, or homologous recombination in yeast.
1. A “carrier vector” containing the target DNA fragment can be
constructed and TREX cassettes that can be obtained as a
6.8 kb XbaI fragment from pIC20H-RL (see Subheading 2.2,
item 4, Fig. 2c) inserted into a unique XbaI site of the vector
(as described in ref. [31]).
2. In case XbaI is not applicable because it hydrolyzes the inserted
DNA fragment or the chosen vector, any appropriate unique
endonuclease restriction site in the carrier vector can be chosen
and TREX cassette inserted by blunting DNA ends (using for
example the Fast End Repair Kit from Thermo Fisher
Scientific™).
3. Alternatively, the E. coli vector pIC20H-RL which carries the
TREX cassettes can be used as the vector element and the
DNA fragment to be expressed inserted into one of the unique
endonuclease restriction sites XmnI, ScaI, or NdeI. Note that
use of XmnI and ScaI will disrupt the ampicillin resistance
gene and hence requires use of tetracycline for selection of cells
carrying this vector.
Size of insert DNA fragment: As shown experimentally,
DNA fragments up to ca. 20 kb can be inserted into host chromo-
somes and successfully expressed [30, 31]. Theoretically, there is
no size limit known for the TREX application, and thus transfer
and expression also of larger DNA fragments may be envisaged.
Choice of replicon: It is important to use a narrow host range
E. coli replicon for the TREX expression construct, as present in
Tools for Metagenomic Gene Expression 179
Transfer to Expression Host Principle: The TREX expression construct is introduced into an
and TREX-Transposon expression host of choice (Fig. 2b, step 2) where it does not repli-
Integration cate but is integrated into the bacterial chromosome to produce
stable expression strains (Fig. 2b, step 3).
Transfer of TREX construct: The TREX expression con-
struct can be transferred to any Gram-negative host which is acces-
sible via conjugation (e.g., P. putida or R. capsulatus) or may
alternatively be introduced by any method of choice like electro-
poration (e.g., E. coli or P. putida). For screening of metagenome
libraries, the use of expression strains with chromosomally inte-
grated T7 polymerase gene is preferable as opposed to plasmid-
based expression of the T7 polymerase (see below) to enable
enhanced throughput by one-step construction of expression
clones that can then directly be subjected to an appropriate screen-
ing assay.
Transposon integration: The use of a suicide vector and
selection with gentamycin enables straightforward selection of
clones with the TREX-transposon stably integrated in the host
chromosome (see Note 11). Notably, elements of transposon Tn5
enabling this step convey non-directed integration. Therefore, a
library of different strains with individual transposon insertion sites
is generated. It was shown that each individual insertion site of the
TREX transposon affects the induced gene expression mediated by
T7 RNA polymerase [31]. Furthermore, it was shown, that the
insertion site can facilitate constitutive T7 RNA polymerase-
independent gene expression mediated by a chromosomal pro-
moter [30]. Therefore, the investigation of multiple clones for
functional gene expression is recommended to identify clones pro-
viding optimal expression conditions and product yields.
3.2.2 Application of TREX 1. The 6.9 kb carotenoid biosynthesis gene cluster from Pantoea
for the Functional ananatis is amplified by PCR using genomic DNA as a tem-
Expression of Carotenoid plate with primers adding appropriate restriction sites (here
Biosynthesis Genes in P. XbaI and EcoRI).
putida 2. Hydrolyze 5 μg of both the PCR product and vector pUC18
Construction of a TREX according to Subheading 3.1.1, steps 2–4 with XbaI and
Vector Carrying Carotenoid EcoRI in a total reaction volume of 50 μL. Incubation is carried
Biosynthesis Genes out overnight.
3. Purify the DNA by performing agarose gel electrophoresis fol-
lowed by preparation of DNA from agarose gel slices with the
innuPREP Plasmid Mini Kit.
4. Insert the DNA fragment into the vector pUC18 by ligation
(see Subheading 3.1.4) to construct the carrier vector (see
Subheading [Link], Fig. 2b, step 1).
5. Excise TREX cassettes from vector pIC20H-RL by hydrolysis
(see Subheading 3.1.1, steps 2–4): Use 5 μg plasmid DNA in
a total volume of 50 μL with XbaI as restriction endonuclease.
Proceed with gel extraction purification of the 6.8 kb TREX
fragment using the innuPrep DOUBLEpure kit.
6. Linearize the carrier vector with XbaI using the same proce-
dure as in step 5.
7. Ligate (Subheading 3.1.4) the TREX fragment into the carrier
vector to generate the TREX expression construct.
Preparation of Competent 1. Cultivate E. coli cells from a fresh LB agar plate in 5 mL LB
E. coli Cells and Heat medium. Incubate overnight at 37 °C.
Shock Transformation 2. Inoculate 100 mL LB medium with 1 mL of the preculture
from step 1 and grow this culture at 37 °C to an OD580 of
0.4–0.6. Keep cells on ice during the following steps and only
use solutions precooled to 4 °C.
3. Centrifuge at 4000 × g and 4 °C for 3 min to harvest cells.
Resuspend the pellet in 10 mL 100 mM cold MgCl2 solution.
Incubate on ice for 30 min.
4. Harvest the cells and resuspend them in 5 mL 100 mM CaCl2
solution containing 20 % glycerol. Separate the resuspension
into 200 μL aliquots and freeze at −80 °C.
Tools for Metagenomic Gene Expression 181
Creation of P. putida 1. Use heat shock transformation (see Subheading [Link], steps
Carotenoid Biosynthesis 5–9) to transfer the TREX expression construct from
Gene Expression Strains by Subheading [Link] into E. coli S17-1.
Conjugational Transfer 2. Streak out recipient strain P. putida KT2440 on an LB agar
of the TREX Construct plate without antibiotic.
3. Inoculate separate liquid cultures of E. coli S17-1 transformed
with the TREX expression construct and P. putida in 5 mL LB
(supplemented with tetracycline in case of E. coli) and incubate
shaking overnight at 30 °C.
4. Mix 500 μL of overnight cultures of both donor and recipient,
and pellet cells by centrifugation (2 min, 11,000 × g).
5. To wash out antibiotic, discard supernatant, resuspend cells in
1 mL fresh LB medium, and pellet cells again. Remove super-
natant leaving a small volume of ca. 100–200 μL for gentle
resuspension of cells.
6. Pipet the cell solution onto a cellulose acetate filter that is
placed on an LB agar plate without antibiotic and incubate at
30 °C overnight for conjugational plasmid transfer (see Fig. 2b,
step 2).
7. After incubation, add 1 mL LB medium to a 2 mL reaction
tube and use sterile forceps to transfer the filter into the tube
(see Note 12). Wash cells from filter by vortexing, and remove
the filter.
8. Prepare three consecutive 1:10 dilutions from the cell suspen-
sion (see Note 13). Plate 100 μL of each dilution on selection
agar containing 25 μg/mL irgasan to prevent growth of E. coli
and 25 μg/mL gentamycin to select for clones with the TREX
transposon (see Fig. 2b, step 3).
9. In addition, centrifuge the remaining volume of the initial
cell suspension to pellet cells (2 min, 11,000 × g), remove
182 Nadine Katzke et al.
3.3 Expression The genome of B. glumae PG1 consists of 7.8 Mbp and is orga-
in Burkholderia nized in two replicons of 4.1 Mbp on chromosome 1 and 3.7 Mbp
glumae on chromosome 2 [32]. Several B. glumae strains are phytopatho-
genic and produce virulence factors which are missing in strain
PG1 [33]. This strain is already used for the production and secre-
tion of an industrially relevant lipase [34, 35]; thus, it represents an
interesting alternative to existing Gram-negative bacterial expres-
sion hosts. We describe here the expression of plasmid-derived
genes using B. glumae PG1.
3.3.1 Construction 1. Plasmid pBBR1MCS [53] does not provide a ribosome bind-
of pBBR1MCS-Based ing site (RBS), thus, DNA fragments to be cloned should be
Plasmids for Expression amplified by PCR using primers including a RBS as well as
in B. glumae PG1 restriction sites for cloning and additional 2–4 bases to enable
Tools for Metagenomic Gene Expression 183
3.3.2 Transfer of Plasmid 1. Inoculate 10 mL LB medium with 20 μL of a B. glumae PG1
DNA into B. glumae PG1 cryo culture (see Note 15) and incubate at 30 °C under con-
by Conjugation stant shaking (120 rpm) for 24 h. On the same day, transfer
pBBR1MCS containing the gene of interest (or any other
mobilizable vector) into E. coli S17-1 by heat shock transfor-
mation (see Subheading [Link], steps 5–9), plate on LB agar
plates containing appropriate antibiotics, and incubate over-
night at 37 °C.
2. Inoculate 10 mL LB medium with 500 μL of the B. glumae
PG1 overnight culture and incubate at 30 °C under constant
shaking (120 rpm) overnight, but at least for 16 h. Transfer a
single E. coli S17-1 colony carrying the mobilizable vector into
10 mL LB medium with appropriate antibiotics and incubate
at 37 °C under constant shaking (120 rpm) overnight.
3. On the next day, inoculate 10 mL LB medium (with antibiot-
ics) with an appropriate volume of E. coli S17-1 preculture to
an OD580 = 0.05 and incubate at 37 °C under constant shaking
(120 rpm) until an OD580 = 0.5–0.8 is reached (see Note 16).
4. Centrifuge 2 mL of E. coli S17-1 culture (21,000 × g, 1 min)
and remove supernatant with a pipette.
5. Add 1 mL of B. glumae PG1 overnight culture, centrifuge
(21,000 × g, 1 min) immediately, and remove supernatant with
a pipette.
184 Nadine Katzke et al.
NdeI site added to the primer must include the start codon as
part of the 6-bp NdeI recognition site (CATATG). The primer
designated to bind at the end of the target gene has to be
designed without the stop codon in order to fuse the gene
product to a His6 short tag peptide.
2. Hydrolyze vector and PCR product separately (as described in
Subheading 3.1.1, steps 2–4) with 5 μg of plasmid DNA and
NdeI and XhoI in a total reaction volume of 50 μL. Incubation
is carried out at 37 °C overnight.
3. Apply the whole mixture to agarose gel electrophoresis.
4. Excise a gel slice containing the DNA fragment of the desired
size (~6.6 kb for vectors pRhokHi-2 and pRhotHi-2) and purify
DNA from the gel using the innuPrep DOUBLEpure kit.
5. Perform ligation procedure as described in Subheading 3.1.4.
6. Use heat shock transformation (see Subheading [Link], steps
5–9) with the complete reaction mixture to transfer the plas-
mid DNA into E. coli DH5α cells.
7. Inoculate ten single clones separately in 5 mL LB-medium
containing kanamycin at 37 °C overnight. Isolate plasmid
DNA from harvested cells with the innuPrep Plasmid Mini Kit.
Hydrolyze a 5 μL aliquot of each isolated DNA sample with
NdeI and XhoI (see Subheading 3.1.1, steps 2–4) and perform
agarose gel electrophoresis. Successful cloning is indicated by
appearance of two bands at appropriate positions for vector
(~6.6 kb) and insert.
4 Notes
Table 4
Paris-medium composition (from ref. [64])
Table 5
Properties of pRho expression vectors (modified from ref. [36])
Acknowledgments
References
1. Sharpton TJ (2014) An introduction to the 6. López-López O, Cerdán ME, González Siso
analysis of shotgun metagenomic data. Front MI (2014) New extremophilic lipases and
Plant Sci 5:209 esterases from metagenomics. Curr Protein
2. Monciardini P, Iorio M, Maffioli S, Sosio M, Pept Sci 15:445–455
Donadio S (2014) Discovering new bioactive 7. Cowan DA, Ramond JB, Makhalanyane TP,
molecules from microbial sources. Microbial De Maayer P (2015) Metagenomics of extreme
Biotechnol 7:209–220 environments. Curr Opin Microbiol
3. Lee MH, Lee SW (2013) Bioprospecting 25:97–102
potential of the soil metagenome: novel 8. Alcaide M, Stogios PJ, Lafraya A, Tchigvintsev
enzymes and bioactivities. Genomics Inform A, Flick R, Bargiela R et al (2015) Pressure
11:114–120 adaptation is linked to thermal adaptation in
4. Lombard N, Prestat E, van Elsas JD, Simonet salt-saturated marine habitats. Environ
P (2011) Soil-specific limitations for access and Microbiol 17:332–345
analysis of soil microbial communities by 9. Tchigvintsev A, Tran H, Popovic A, Kovacic F,
metagenomics. FEMS Microbiol Ecol Brown G, Flick R et al (2015) The environ-
78:31–49 ment shapes microbial enzymes: five cold-
5. Anderson RE, Sogin ML, Baross JA (2014) active and salt-resistant carboxylesterases from
Evolutionary strategies of viruses, bacteria and marine metagenomes. Appl Microbiol
archaea in hydrothermal vent ecosystems Biotechnol 99:2165–2178
revealed through metagenomics. PLoS One 10. Mhuantong W, Charoensawan V, Kanokratana
9:e109696 P, Tangphatsornruang S, Champreda V (2015)
194 Nadine Katzke et al.
Comparative analysis of sugarcane bagasse 22. Leis B, Angelov A, Liebl W (2013) Screening
metagenome reveals unique and conserved and expression of genes from metagenomes.
biomass-degrading enzymes among lignocel- Adv Appl Microbiol 83:1–68
lulolytic microbial communities. Biotechnol 23. Ekkers DM, Cretoiu MS, Kielak AM, Elsas JD
Biofuels 8:1–17 (2012) The great screen anomaly—a new fron-
11. McCarthy DM, Pearce DA, Patching JW, tier in product discovery through functional
Fleming GT (2013) Contrasting responses to metagenomics. Appl Microbiol Biotechnol
nutrient enrichment of prokaryotic communi- 93:1005–1020
ties collected from deep sea sites in the south- 24. Liebl W, Angelov A, Juergensen J, Chow J,
ern ocean. Biology (Basel) 2:1165–1188 Loeschcke A, Drepper T et al (2014)
12. McNamara PJ, LaPara TM, Novak PJ (2015) Alternative hosts for functional (meta)genome
The effect of perfluorooctane sulfonate, expo- analysis. Appl Microbiol Biotechnol
sure time, and chemical mixtures on methano- 98:8099–8109
genic community structure and function. 25. Leis B, Angelov A, Mientus M, Li H, Pham
Microbiol Insights 8:1–7 VT, Lauinger B et al (2015) Identification of
13. Tan B, Fowler SJ, Abu Laban N, Dong X, novel esterase-active enzymes from hot envi-
Sensen CW, Foght J, Gieg LM (2015) ronments by use of the host bacterium Thermus
Comparative analysis of metagenomes from thermophilus. Front Microbiol 6:275
three methanogenic hydrocarbon-degrading 26. Jiang PX, Wang HS, Zhang C, Lou K, Xing
enrichment cultures with 41 environmental XH (2010) Reconstruction of the violacein
samples. ISME J 9:2028–2045 biosynthetic pathway from Duganella sp. B2 in
14. Mori T, Kamei I, Hirai H, Kondo R (2014) different heterologous hosts. Appl Microbiol
Identification of novel glycosyl hydrolases with Biotechnol 86:1077–1088
cellulolytic activity against crystalline cellulose 27. McMahon MD, Guan C, Handelsman J,
from metagenomic libraries constructed from Thomas MG (2012) Metagenomic analysis of
bacterial enrichment cultures. Springerplus Streptomyces lividans reveals host-dependent
3:365 functional expression. Appl Environ Microbiol
15. Ferrer M, Beloqui A, Timmis KN, Golyshin 78:3622–3629
PN (2009) Metagenomics for mining new 28. Liu L, Yang H, Shin HD, Chen RR, Li J, Du
genetic resources of microbial communities. G, Chen J (2013) How to achieve high-level
J Mol Microbiol Biotechnol 16:109–123 expression in microbial enzymes: strategies and
16. Saïdani N, Grando D, Valadié H, Bastien O, perspectives. Bioengineered 4:212–223
Maréchal E (2009) Potential and limits of in 29. Troeschel SC, Thies S, Link O, Real CI, Knops
silico target discovery - case study of the search K, Wilhelm S et al (2012) Novel broad host
for new antimalarial chemotherapeutic targets. range shuttle vectors for expression in
Infect Genet Evol 9:359–367 Escherichia coli, Bacillus subtilis and
17. Galvão TC, Mohn WW, de Lorenzo V (2005) Pseudomonas putida. J Biotechnol 161:71–79
Exploring the microbial biodegradation and 30. Domröse A, Klein AS, Hage-Hülsmann J,
biotransformation gene pool. Trends Thies S, Svensson V, Classen T et al (2015)
Biotechnol 23:497–506 Efficient recombinant production of prodigio-
18. Trindade M, van Zyl LJ, Navarro-Fernández J, sin in Pseudomonas putida. Front Microbiol
Abd Elrazak A (2015) Targeted metagenomics 6:972
as a tool to tap into marine natural product 31. Loeschcke A, Markert A, Wilhelm S, Wirtz A,
diversity for the discovery and production of Rosenau F, Jaeger KE, Drepper T (2013)
drug candidates. Front Microbiol 6:890 TREX: a universal tool for the transfer and
19. Vakhlu J, Sudan AK, Johri BN (2008) expression of biosynthetic pathways in bacteria.
Metagenomics: future of microbial gene min- ACS Synth Biol 2:22–33
ing. Indian J Microbiol 48:202–215 32. Voget S, Knapp A, Poehlein A, Vollstedt C,
20. Coughlan LM, Cotter PD, Hill C, Alvarez- Streit W, Daniel R, Jaeger KE (2015) Complete
Ordóñez A (2015) Biotechnological applica- genome sequence of the lipase producing strain
tions of functional metagenomics in the food Burkholderia glumae PG1. J Biotechnol
and pharmaceutical industries. Front Microbiol 204:3–4
6:672 33. Seo YS, Lim JY, Park J, Kim S, Lee HH,
21. Ufarté L, Potocki-Veronese G, Laville E (2015) Cheong H et al (2015) Comparative genome
Discovery of new protein families and func- analysis of rice-pathogenic Burkholderia pro-
tions: new challenges in functional metage- vides insight into capacity to adapt to different
nomics for biotechnologies and microbial environments and hosts. MBC Genomics
ecology. Front Microbiol 6:563 16:349
Tools for Metagenomic Gene Expression 195
34. Knapp A, Voget S, Gao R, Zaburannyi N, 45. Masepohl B, Hallenbeck PC (2010) Nitrogen
Krysciak D, Breuer M et al (2016) Mutations and molybdenum control of nitrogen fixation
improving production and secretion of extra- in the phototrophic bacterium Rhodobacter
cellular lipase by Burkholderia glumae PG1. capsulatus. Adv Exp Med Biol 675:49–70
Appl Microbiol Biotechnol 100:1265–1273 46. Kyndt JA, Fitch JC, Berry RE, Stewart MC,
35. Boekema BK, Beselin A, Breuer M, Hauer B, Whitley K, Meyer TE et al (2012) Tyrosine
Koster M, Rosenau F et al (2007) Hexadecane triad at the interface between the Rieske iron-
and Tween 80 stimulate lipase production in sulfur protein, cytochrome c1 and cytochrome
Burkholderia glumae by different mechanisms. c2 in the bc1 complex of Rhodobacter capsula-
Appl Environ Microbiol 73:3838–3844 tus. Biochim Biophys Acta 1817:811–818
36. Katzke N, Arvani S, Bergmann R, Circolone F, 47. Loppnow H, Libby P, Freudenberg M, Krauss
Markert A, Svensson V et al (2010) A novel T7 JH, Weckesser J, Mayer H (1990) Cytokine
RNA polymerase dependent expression system induction by lipopolysaccharide (LPS) corre-
for high-level protein production in the photo- sponds to lethal toxicity and is inhibited by
trophic bacterium Rhodobacter capsulatus. nontoxic Rhodobacter capsulatus LPS. Infect
Protein Expr Purif 69:137–146 Immun 58:3743–3750
37. Nelson KE, Weinel C, Paulsen IT, Dodson RJ, 48. Simon R, Priefer U, Pühler A (1983) A broad
Hilbert H, Martins dos Santos VA et al (2002) host range mobilization system for in vivo
Complete genome sequence and comparative genetic-engineering-transposon mutagenesis
analysis of the metabolically versatile in Gram-negative bacteria. Nat Biotechnol
Pseudomonas putida KT2440. Environ 1:784–791
Microbiol 4:799–808 49. Katzke N, Bergmann R, Jaeger KE, Drepper T
38. Loeschcke A, Thies S (2015) Pseudomonas (2012) Heterologous high-level gene expres-
putida-a versatile host for the production of sion in the photosynthetic bacterium
natural products. Appl Microbiol Biotechnol Rhodobacter capsulatus. Methods Mol Biol
99:6197–6214 824:251–269
39. Blank LM, Ebert BE, Buehler K, Bühler B 50. Sambrook J, Russell DW (2001) Molecular
(2010) Redox biocatalysis and metabolism: cloning: a laboratory manual. Cold Spring
molecular mechanisms and metabolic network Harbor Press, New York
analysis. Antioxid Redox Signal 13:349–394 51. Vogel HJ, Bonner DM (1956) Acetylornithase
40. Tiso T, Wierckx N, Blank L (2014) Non- of Escherichia coli – partial purification and
pathogenic Pseudomonas as a platform for some properties. J Biol Chem 218:97–106
industrial biocatalysis. In: Grunwald P (ed) 52. Cronan JE (2003) Cosmid-based system for
Industrial biocatalysis. Pan Stanford, Singapore, transient expression and absolute off-to-on
pp 323–372 transcriptional control of Escherichia coli genes.
41. Fernández M, Duque E, Pizarro-Tobías P, Van J Bacteriol 185:6522–6529
Dillewijn P, Wittich RM, Ramos JL (2009) 53. Kovach ME, Phillips RW, Elzer PH, Roop RM
Microbial responses to xenobiotic compounds. 2nd, Peterson KM (1994) pBBR1MCS: a
Identification of genes that allow Pseudomonas broad-host-range cloning vector. Biotechniques
putida KT2440 to cope with 16:800–802
2,4,6-trinitrotoluene. Microbial Biotechnol 54. Kovach ME, Elzer PH, Hill DS, Robertson
2:287–294 GT, Farris MA, Roop RM 2nd, Peterson KM
42. Simon O, Klaiber I, Huber A, Pfannstiel (1995) Four new derivatives of the broad-host-
J (2014) Comprehensive proteome analysis of range cloning vector pBBR1MCS, carrying
the response of Pseudomonas putida KT2440 different antibiotic-resistance cassettes. Gene
to the flavor compound vanillin. J Proteomics 166:175–176
109:212–227 55. Labes M, Pühler A, Simon R (1990) A new
43. Eggert T, Brockmeier U, Dröge MJ, Quax WJ, family of RSF1010-derived expression and lac-
Jaeger KE (2003) Extracellular lipases from fusion broad-host-range vectors for gram-
Bacillus subtilis: regulation of gene expression negative bacteria. Gene 89:37–46
and enzyme activity by amino acid supply and 56. Arvani S, Markert A, Loeschcke A, Jaeger KE,
external pH. FEMS Microbiol Lett Drepper T (2012) A T7 RNA polymerase-
225:319–324 based toolkit for the concerted expression of
44. Laible PD, Scott HN, Henry L, Hanson DK clustered genes. J Biotechnol 159:162–171
(2004) Towards higher-throughput membrane 57. Fischbach M, Voigt CA (2010) Prokaryotic
protein production for structural genomics ini- gene clusters: a rich toolbox for synthetic biology.
tiatives. J Struct Funct Genomics 5:167–172 Biotechnol J 5:1277–1296
196 Nadine Katzke et al.
58. Rocha-Martin J, Harrington C, Dobson AD, the T7-expression system. Protein Expr Purif
O’Gara F (2014) Emerging strategies and inte- 55:325–333
grated systems microbiology technologies for 63. Ferrieres L, Hemery G, Nham T, Guerout
biodiscovery of marine bioactive compounds. AM, Mazel D, Beloin C, Ghigo JM (2010)
Mar Drugs 12:3516–3559 Silent mischief: bacteriophage Mu insertions
59. Ferrer M, Martinez-Martinez M, Bargiela R, contaminate products of Escherichia coli ran-
Streit WR, Golyshina OV, Golyshin PN (2016) dom mutagenesis performed using suicidal
Estimating the success of enzyme bioprospect- transposon delivery plasmids mobilized by
ing through metagenomics: current status and broad-host-range RP4 conjugative machinery.
future trends. Microbial Biotechnol 9:22–34 J Bacteriol 192:6418–6427
60. McAllister WT, Morris C, Rosenberg AH, 64. Troeschel SC, Drepper T, Leggewie C, Streit
Studier FW (1981) Utilization of bacterio- WR, Jaeger KE (2010) Novel tools for the
phage T7 late promoters in recombinant plas- functional expression of metagenomic
mids during infection. J Mol Biol DNA. Methods Mol Biol 668:117–139
153:527–544 65. Kuan CT, Tessman I (1992) Further evidence
61. Widenhorn KA, Somers JM, Kay WW (1988) that transposition of Tn5 in Escherichia coli is
Expression of the divergent tricarboxylate strongly enhanced by constitutively activated
transport operon (tctI) of Salmonella RecA proteins. J Bacteriol 174:6872–6877
typhimurium. J Bacteriol 170:3223–3227 66. Schmidt TG, Skerra A (2007) The Strep-tag
62. Kang Y, Son MS, Hoang TT (2007) One step system for one-step purification and high-
engineering of T7-expression strains for pro- affinity detection or capturing of proteins. Nat
tein production: increasing the host-range of Protoc 2:1528–1535
Chapter 11
Abstract
A procedure for the high-throughput screening (HTS) of esterases is described. This includes a pretest for
discrimination of active and inactive clones using an agar plate overlay assay, the enzyme expression in microti-
ter plates and the measurement of activity and enantioselectivity (E) of the esterase variants using acetates
of secondary alcohols as model substrates. Acetic acid released is converted in an enzyme cascade leading
to the stoichiometric formation of NADH, which is quantified in a spectrophotometer. The method allows
screening of several thousand mutants per day and has already been successfully applied to identify an
esterase mutant with an E > 100 towards an important building block for organic synthesis. This protocol
can also be used for lipases and possibly other hydrolases that are expressed in soluble form in conventional
E. coli strains.
Key words Hydrolase, Esterase, Lipase, High-throughput assay, Enantioselectivity, Directed evolution,
Metagenome
1 Introduction
Lipases and esterases are the most frequently used hydrolases (EC
3) in organic synthesis [1, 2]. They are important biocatalysts and
especially suitable for industrial applications as they are very stable
and also active in organic solvents. Moreover, they very often
exhibit high enantioselectivity and are therefore used in the synthe-
sis of optically active compounds, for which more than 1000 exam-
ples can be found in literature. Besides a considerable number of
commercially available lipases and to a lesser extent esterases,
researchers can create optimized enzyme variants using protein
engineering [3–5] or identify new esterases or lipases with desired
activity/selectivity using the metagenomic approach [6–8]. These
methods can create huge numbers of novel biocatalysts, which are
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_11, © Springer Science+Business Media LLC 2017
197
198 Dominique Böttcher et al.
Fig. 1 Assay based on the conversion of acetic acid released in the hydrolase-
catalyzed reaction in a subsequent enzyme cascade yielding an increase in
NADH [16]
Screening for Active and Stereoselective Hydrolytic Enzymes 199
2 Materials
2.1 Activity Test 1. Agar plates containing colonies from metagenomic libraries.
on Agar Plates 2. Replica-plating tool and sterile clothes.
(Overlay Agar)
3. Soft agar (0.5 % agar dissolved in water)
4. 1-naphthyl acetate solution: 40 mg/mL in N,N′-dimethyl
formamide.
5. Fast Red TR solution: 100 mg/mL in dimethyl sulfoxide.
2.3 Cell Lysis 1. Lysis buffer: 50 mM NaH2PO4, 300 mM NaCl, pH 8.0, 0.1 %
(w/v) lysozyme, 1 U/mL DNaseI.
3 Methods
The acetic acid assay allows to differentiate active from inactive and
enantioselective from nonselective enzyme variants. In the activity
test (option A) the resulting graphs will provide only the relative
activity of each enzyme variant for the tested substrate (acetate
ester). In the selectivity test (option B), one has to calculate the
initial reaction rates (ΔA/Δt) for each enantiomer separately, and
the quotient of the two rates then yields the apparent enantiose-
lectivity Eapp.
Positive hits from the assay must be verified afterwards using
conventional analytical methods, such as chiral GC or HPLC to
determine conversion, kinetic parameters, and the true enantiose-
lectivity Etrue.
3.1 Activity Test 1. Spread cells containing metagenomic library onto LB agar
on Agar Plates plates containing an appropriate antibiotic.
2. Incubate the plates overnight at 30 or 37 °C.
3. Transfer colonies by replica plating to LB agar plates contain-
ing an appropriate antibiotic and IPTG to induce esterase
production.
4. Incubate the plates for 5 h at 37 °C.
5. Prepare overlay soft agar.
6. Prepare solutions of 1-naphthyl acetate and Fast Red TR.
7. Melt the soft agar in a microwave and let it cool down to
approximately 40 °C.
8. Mix 100 μL of both solutions with 10 mL soft agar and pour
it carefully over the colonies.
9. Active clones will turn brownish in a few seconds.
Screening for Active and Stereoselective Hydrolytic Enzymes 201
3.2 Enzyme 1. Pick single colonies into 96-well microtiter plates containing
Production 200 μL LB medium, supplemented with the required antibi-
in Microtiter Plates otic, per well. These plates serve as master plates. After cell
(Fig. 2) growth for 4–6 h at 37 °C and 220 rpm, duplicate the master
plates by transferring a 1 μL aliquot (see Note 2) into a new
microtiter plate (containing 200 μL LB-antibiotic medium
per well) used for the subsequent production of esterase
(production plates).
2. Supplement the master plates with glycerol (final concentration
15 % v/v) and store them at −80 °C. These master plates can
be also used for future high-throughput assays.
3. Incubate the production plates overnight at 37 °C and 220 rpm
and dilute 1:10 the next day with fresh medium (see Note 3).
Cultivate at 37 °C and 220 rpm.
4. After 3 h start enzyme production by addition of inducer solu-
tion in an appropriate concentration (e.g., IPTG usually in
concentrations from 10 to 1000 μM).
3.3 Cell Lysis 1. After cultivation for approximately 5 h at 30 °C and 220 rpm,
in Microtiter Plates centrifuge at 2000 × g for 15 min, discard the supernatant and
add 200 μL lysis buffer.
2. Incubate the plates for 30 min at 4 °C, freeze the plates at
−80 °C for 1 h and thaw them at 37 °C for approx. 20 min.
3. Centrifuge again at 2000 × g for 15 min and transfer enzyme
solution into new microtiter plates (see Note 4).
Fig. 2 Enzyme production in microtiter plates and principle of the screening of metagenomic libraries for
altered enantioselectivity by adding (R )- and (S )-substrates to separate wells of a microtiter plate containing
the same enzyme variant. If only activity is measured, the enzyme sample must not be split into two wells
4 Notes
1. The acetic acid assay is buffered at pH 8.4. Make sure that your
enzyme is active at this pH.
2. This step can be done using a 96-pin replicator or using a liquid
handling robot.
3. Dilution with fresh medium is very important to achieve a
comparable cell density in each well of the microtiter plate.
4. These plates can be stored at −20 °C, freeze-dried, or directly
used for the determination of enantioselectivity/activity.
Freeze-dry the enzyme solution if you are expecting only very
low activity in the diluted cell extract. Make sure that the
enzyme tolerates this procedure.
Screening for Active and Stereoselective Hydrolytic Enzymes 203
References
1. Bornscheuer UT, Kazlauskas RJ (2006) (eds) Industrial biotechnology. Wiley-VCH,
Hydrolases in organic synthesis: regio- and ste- Weinheim, pp 173–205
reoselective biotransformations, 2nd edn. 4. Bornscheuer UT, Huisman G, Kazlauskas RJ,
Wiley-VCH, Weinheim Lutz S, Moore J, Robins K (2012) Engineering
2. Romano D, Bonomi F, de Mattos MC, Fonseca the third wave in biocatalysis. Nature
TD, de Oliveira MDF, Molinari F (2015) 485:185–194
Esterases as stereoselective biocatalysts. 5. Davids T, Schmidt M, Böttcher D,
Biotechnol Adv 33:547–565 Bornscheuer UT (2013) Strategies for the
3. Schmidt M, Böttcher D, Bornscheuer UT discovery and engineering of enzymes for
(2010) Directed evolution of industrial biocatalysis. Curr Opin Chem Biol 17:
biocatalysts. In: Soetaert W, Vandamme E 215–220
204 Dominique Böttcher et al.
Abstract
For modern biotechnology there is a steady need to identify novel enzymes. In biotechnological applica-
tions, however, enzymes often must function under extreme and nonnatural conditions (i.e., in the pres-
ence of solvents, high temperature and/or at extreme pH values). Cellulases have many industrial
applications from the generation of bioethanol, a realistic long-term energy source, to the finishing of
textiles. These industrial processes require cellulolytic activity under a wide range of pH, temperature, and
ionic conditions, and they are usually carried out by mixtures of cellulases. Investigation of the broad
diversity of cellulolytic enzymes involved in the natural degradation of cellulose is necessary for optimizing
these processes.
Key words Cellulase, Ionic liquid, Metagenome, Bioethanol, Renewable energy, Biotechnology
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_12, © Springer Science+Business Media LLC 2017
205
206 Nele Ilmberger and Wolfgang R. Streit
Fig. 1 Celulose structure D-glucose; linked to large polymers via the β-1,4 glyco-
sidic linkage
Screening for Cellulase Encoding Clones 207
2 Materials
3 Methods
3.1 Enrichment From our experience the number of clones that encode cellulases
of Highly Cellulolytic in environmental libraries is rather low. Therefore it is sometimes
Microbial useful to slightly enrich on a suitable substrate to increase the fre-
Communities quency of cellulolytic organisms and hence enzymes. Therefore
(See Note 1) usually mineral salt media (see Subheading 2.1) are used. The cul-
tures can be run under the desired parameters regarding pH, tem-
perature, oxygen supply, etc. For the enrichment of cellulolytic
organisms cellulosic substrates like carboxymethylcellulose (CMC),
crystalline cellulose like avicel, cellulosic filter paper or plant mate-
rial like wood or silage can be used as carbon source.
Once microbial communities are established they can be used
for library construction. It is recommended to analyze the micro-
bial community by 16S profiling in order to survey the diversity.
210 Nele Ilmberger and Wolfgang R. Streit
3.2 Identification Cellulase-positive clones are usually screened for by using a colori-
of Cellulase-Positive metric assay on plates containing a cellulosic substrate. The inter-
Clones by Screening action of the direct dye Congo red with intact β-D-glucans provides
on Congo Red Plates the basis for a rapid and sensitive screening test for cellulolytic
(See Note 2) bacteria possessing β-D-glucan-hydrolase activities [41].
1. The E. coli clones are stamped or streaked on LB-agar + CMC
and incubated overnight at 37 °C, followed by an incubation
of 2–7 days at the desired temperature.
2. Colonies are washed off with ddH2O to permit the homoge-
neous penetration of the staining dye into the medium.
3. Agar plates are stained with Congo red solution for 30 min.
4. The solution is poured off and the agar plates are destained up
to three times for 30 min with 1 M NaCl.
5. Cellulase expressing clones exhibit a yellow halo against a red
background (see Fig. 2).
3.3 Retrans- To ensure that the observed catalytic activity of clones is not due to
formation of Putative contaminations, the isolation and retransformation of the vector
Positive Clones and a subsequent activity assay is recommended.
3.4 Preparation 1. For the preparation of crude cell extracts of cellulase positive
of Crude Cell Extracts clones cultures are grown in LB + CMC containing an appro-
of Clones priate antibiotic at 30 °C to an OD of 1.0–1.5.
with Cellulolytic 2. Cells are harvested via mild centrifugation and resuspended in
Activity an appropriate volume of 50 mM Tris–HCl pH 8.0 prior to
3.5 Enzyme Assays Cellulase activity is routinely assayed by measuring the amount of
for Cellulase Activities reducing sugar released from CMC using 3,5-dinitrosalicylic acid
reagent (see Subheading 2.4). The standard assay mixture contains
3.5.1 DNSA-Assay (See
2 μg of the enzyme or crude cell extract and 1 % CMC in a final vol-
Note 3)
ume of 0.5 mL with 150 μL McIllvaine buffer (see Subheading 2.4).
This mixture is incubated at an appropriate temperature for 15 min.
During the hydrolysis of cellulose glucose oligomers and monomers
are produced and the number of reducing ends increases. These
reducing groups react with 3,5-dinitrosalicylic acid forming brown
3-amino-5-nitrosalicylic acid at 100 °C.
The amount of 3-amino-5-nitrosalicylic acid formed is equi-
molar to the number of reducing ends. Therefore the amount of
reducing sugars can be quantified at 546 nm (Fig. 3).
Units of enzyme activity (U) are expressed as micromoles of
reducing sugar released per minute per milligram protein. Enzyme
activities are formulated by regressing absorbance on concentra-
tion following the Beer’s law. That describes the relationship
between known concentrations and absorbance is linear except at
very low or high concentration of the product, in this case reduc-
ing sugar. One unit is equal to 1 μmol of reduced sugar per
minute.
The enzymatic activity volume is calculated according to the
following formula:
U / mL = ( DE / min´V ) / ( e ´ d ´ v )
ΔE/min = Extinction
V = Volume of the test reaction mix.
d = Thickness of the cuvette [cm].
ε = Ascendant of straight calibration line
Fig. 3 DNSA assay reaction for the measurement of cellulolytic activity based on the release of reducing sugar
ends
212 Nele Ilmberger and Wolfgang R. Streit
v = Sample volume
The specific enzymatic activity [U/mg protein] is defined as
the amount of enzyme that liberates 1 μmol of substrate per min-
ute and is calculated as follows:
Specific activity [U/mg protein] = Enzymatic activity volume
[U/mL]/protein concentration [mg/mL]
1. The reactions are prepared combining first buffer and enzyme
and then adding the substrate.
Reaction mix:
Sample 100 μL
CMC in ddH2O (2 %) 250 μL
McIlvaine-buffer, pH 6.5 150 μL
2. The mixture is incubated for 15 min at 37 °C.
3. After this incubation DNSA reagent is added and the samples
are boiled at 100 °C for 15 min.
Sample 100 μL
CMC in ddH2O (2 %) 250 μL
McIllvaine-buffer, pH 6.5 150 μL
+ DNSA reagent 750 μL
4. After cooling down on ice the samples are centrifuged at
16,000 × g for 2 min to precipitate falling proteins.
5. The samples are transferred to cuvettes and absorbance is mea-
sured at 546 nm.
The pH range of the enzyme is usually determined by measur-
ing standard assay activity between pH 4 and pH 10.5 using
50 mM of appropriate buffers. Acetate buffer is used for pH 4 to
pH 6.0, citrate/phosphate buffer (McIllvaine buffer) is used for
pH 6 to pH 7.5, Tris–HCl is used for pH 7.5 to pH 9.0, and
N-cyclohexyl-3-aminopropanesulfonic acid (CAPS) is used for pH
9.7 to pH 10.5.
For the analysis of the temperature range of the enzyme, activ-
ity of the standard assay mixture is assayed at temperatures between
20 and 95 °C.
To analyze substrate specificity, CMC can replaced in the stan-
dard assay mixture by lichenan, barley β-glucan, laminarin, oat
spelt xylan, or avicel.
Inhibition or enhancement of cellulase activity can be deter-
mined for a range of different metal chloride salts, solvents, deter-
gents, and EDTA using in general 1 mM concentrations. The
influence of ionic liquids (IL) can be evaluated in the standard
assay mixture system when McIllvaine (see Subheading 2.4) buffer
is replaced by an IL. The assay mixture therefore comprises an IL
content of 30 % (some ILs that can be used for cellulase activity
Screening for Cellulase Encoding Clones 213
Fig. 4 Ionic liquids that are suitable for cellulase activity assays
assays are shown exemplarily in Fig. 4). This value can be regulated
up and down. For ILs as well as other additives long term stability
assays might be of interest. Therefore the enzyme is incubated in
buffer with the desired additives at the favored conditions for dif-
ferent time periods. At the respective time point the substrate is
added and the assay can proceed as described above.
Fig. 5 TLC detection of end products from cellulose degradation: Lane (-) is the
sample without the addition of enzyme, (std.) is the standard with glucose (G1),
cellobiose (G2), cellotriose (G3), and cellotetraose (G4). The other lanes are
different time points of the hydrolysis of lichenan with Cel5A [9]
4 Notes
1. The most “critical” step in this procedure and for the discovery
of a pool of enzymes which is adequate for the detection of one
or more cellulases with interesting properties might be the
choice of sample. Furthermore, the quality of enrichment cul-
ture, if used, and of the metagenomic library must be taken
into account. We suggest investigating habitats with a high
potential of the occurrence of cellulolytic bacteria, like intesti-
nal tracts of herbivores or rotting trees. If an enrichment step
is desired or inevitable, it is reasonable to enrich over a rather
short time period to keep diversity as broad as possible.
2. Screening for cellulase-active clones on Congo red indicator
plates is easy, only the time period for growth of bacteria and
expression of cellulolytic activity might be variable. Washing off
bacterial cells is critical, when cellulolytic activity is rather low.
3. The same occurs for the DNSA-assay, where gloves should be
worn and when samples are boiled, the lid should be stabilized
to protect from spraying phenol (in DNSA solution, see
Subheading 2.3). When ionic liquids are added to the assay
mixtures, it is necessary to completely agitate IL and aquatic
phase, otherwise results are falsified.
References
1. Streit WR, Schmitz RA (2004) Metagenomics - Novel polyphenol oxidase mined from a
the key to the uncultured microbes. Curr Opin metagenome expression library of bovine
Microbiol 7:492–498 rumen: biochemical properties, structural anal-
2. Daniel R (2004) The soil metagenome - a rich ysis, and phylogenetic relationships. J Biol
resource for the discovery of novel natural Chem 281:22933–22942
products. Curr Opin Biotechnol 15:199–204 8. Voget S, Leggewie C, Uesbeck A, Raasch C,
3. Schmeisser C, Steele H, Streit WR (2007) Jaeger KE, Streit WR (2003) Prospecting for
Metagenomics, biotechnology with non- novel biocatalysts in a soil metagenome. Appl
culturable microbes. Appl Microbiol Environ Microbiol 69:6235–6242
Biotechnol 75:955–962 9. Voget S, Steele HL, Streit WR (2006)
4. Schmidt TM, DeLong EF, Pace NR (1991) Characterization of a metagenome-derived
Analysis of a marine picoplankton community halotolerant cellulase. J Biotechnol 126:26–36
by 16S rRNA gene cloning and sequencing. 10. Grant S, Sorokin DY, Grant WD, Jones BE,
J Bacteriol 173:4371–4378 Heaphy S (2004) A phylogenetic analysis of
5. Ferrer M, Golyshina OV, Chernikova TN, Wadi el Natrun soda lake cellulase enrichment
Khachane AN, Reyes-Duarte D, Santos VA cultures and identification of cellulase genes
et al (2005) Novel hydrolase diversity retrieved from these cultures. Extremophiles 8:421–429
from a metagenome library of bovine rumen 11. Rees HC, Grant S, Jones B, Grant WD,
microflora. Environ Microbiol 7:1996–2010 Heaphy S (2003) Detecting cellulase and ester-
6. Ferrer M, Golyshina OV, Plou FJ, Timmis KN, ase enzyme activities encoded by novel genes
Golyshin PN (2005) A novel alpha-glucosidase present in environmental DNA libraries.
from the acidophilic archaeon Ferroplasma aci- Extremophiles 7:415–421
diphilum strain Y with high transglycosylation 12. Healy FG, Ray RM, Aldrich HC, Wilkie AC,
activity and an unusual catalytic nucleophile. Ingram LO, Shanmugam KT (1995) Direct
Biochem J 391:269–276 isolation of functional genes encoding cellu-
7. Beloqui A, Pita M, Polaina J, Martinez-Arias A, lases from the microbial consortia in a thermo-
Golyshina OV, Zumarraga M et al (2006) philic, anaerobic digester maintained on
216 Nele Ilmberger and Wolfgang R. Streit
lignocellulose. Appl Microbiol Biotechnol 25. Bayer EA, Chanzy H, Lamed R, Shoham Y
43:667–674 (1998) Cellulose, cellulases and cellulosomes.
13. Feng Y, Duan CJ, Pang H, Mo XC, Wu CF, Yu Curr Opin Struct Biol 8:548–557
Y et al (2007) Cloning and identification of 26. Kumar R, Singh S, Singh OV (2008)
novel cellulase genes from uncultured microor- Bioconversion of lignocellulosic biomass: bio-
ganisms in rabbit cecum and characterization chemical and molecular perspectives. J Ind
of the expressed cellulases. Appl Microbiol Microbiol Biotechnol 35:377–391
Biotechnol 75:319–328 27. Ando S, Ishida H, Kosugi Y, Ishikawa K (2002)
14. Pottkamper J, Barthen P, Ilmberger N, Hyperthermostable endoglucanase from
Schwaneberg U, Schenk A, Schulte M et al Pyrococcus horikoshii. Appl Environ Microbiol
(2009) Applying metagenomics for the identi- 68:430–433
fication of bacterial cellulases that are stable in 28. Lynd LR, Zhang Y (2002) Quantitative deter-
ionic liquids. Green Chem 11:957–965 mination of cellulase concentration as distinct
15. Guo H, Feng Y, Mo X, Duan C, Tang J, Feng from cell concentration in studies of microbial
J (2008) Cloning and expression of a beta- cellulose utilization: analytical framework and
glucosidase gene umcel3G from metagenome methodological approach. Biotechnol Bioeng
of buffalo rumen and characterization of the 77:467–475
translated product. Sheng Wu Gong Cheng 29. Schwarz WH (2001) The cellulosome and cel-
Xue Bao 24:232–238 lulose degradation by anaerobic bacteria. Appl
16. Pang H, Zhang P, Duan CJ, Mo XC, Tang JL, Microbiol Biotechnol 56:634–649
Feng JX (2009) Identification of cellulase 30. Pope PB, Mackenzie AK, Gregor I, Smith W,
genes from the metagenomes of compost soils Sundset MA, McHardy AC et al (2012)
and functional characterization of one novel Metagenomics of the Svalbard reindeer rumen
endoglucanase. Curr Microbiol 58:404–408 microbiome reveals abundance of polysaccha-
17. Warnecke F, Luginbuhl P, Ivanova N, ride utilization loci. PLoS One 7:e38571
Ghassemian M, Richardson TH, Stege JT et al 31. Flint HJ, Scott KP, Duncan SH, Louis P, Forano
(2007) Metagenomic and functional analysis of E (2012) Microbial degradation of complex
hindgut microbiota of a wood-feeding higher carbohydrates in the gut. Gut Microbes
termite. Nature 450:560–565 3:289–306
18. Ilmberger N, Güllert S, Dannenberg J, 32. Zhang YH, Lynd LR (2004) Toward an aggre-
Rabausch U, Torres J, Wemheuer B et al gated understanding of enzymatic hydrolysis of
(2014) A comparative metagenome survey of cellulose: noncomplexed cellulase systems.
the fecal microbiota of a breast- and a plant-fed Biotechnol Bioeng 88:797–824
Asian elephant reveals an unexpectedly high 33. Bolam DN, Ciruela A, McQueen-Mason S,
diversity of glycoside hydrolase family enzymes. Simpson P, Williamson MP, Rixon JE et al
PLoS One 9:e106707 (1998) Pseudomonas cellulose-binding domains
19. Heinze T, Schwikal K, Barthel S (2005) Ionic mediate their effects by increasing enzyme sub-
liquids as reaction medium in cellulose func- strate proximity. Biochem J 331(Pt 3):775–781
tionalization. Macromol Biosci 5:520–525 34. Carvalho AL, Goyal A, Prates JA, Bolam DN,
20. Swatloski RP, Spear SK, Holbrey JD, Rogers Gilbert HJ, Pires VM et al (2004) The family
RD (2002) Dissolution of cellulose [correction 11 carbohydrate-binding module of
of cellose] with ionic liquids. J Am Chem Soc Clostridium thermocellum Lic26A-Cel5E
124:4974–4975 accommodates beta-1,4- and beta-1,3-1,4-
21. Wu J, Zhang J, Zhang H, He J, Ren Q, Guo M mixed linked glucans at a single binding site.
(2004) Homogeneous acetylation of cellulose J Biol Chem 279:34785–34793
in a new ionic liquid. Biomacromolecules 35. Coutinho JB, Gilkes NR, Kilburn DG, Warren
5:266–268 RAJ, Miller RC Jr (1993) The nature of the
22. Beguin P, Aubert JP (1994) The biological cellulose-binding domain effects the activities
degradation of cellulose. FEMS Microbiol Rev of a bacterial endoglucanase on different forms
13:25–58 of cellulose. FEMS Microbiol Lett
23. Birsan C, Johnson P, Joshi M, MacLeod A, 113:211–217
McIntosh L, Monem V et al (1998) 36. Fontes CM, Clarke JH, Hazlewood GP,
Mechanisms of cellulases and xylanases. Fernandes TH, Gilbert HJ, Ferreira LM
Biochem Soc Trans 26:156–160 (1997) Possible roles for a non-modular, ther-
24. Hilden L, Johansson G (2004) Recent devel- mostable and proteinase-resistant cellulase
opments on cellulases and carbohydrate- from the mesophilic aerobic soil bacterium
binding modules with cellulose affinity. Cellvibrio mixtus. Appl Microbiol Biotechnol
Biotechnol Lett 26:1683–1693 48:473–479
Screening for Cellulase Encoding Clones 217
37. Cazemier AE, Verdoes JC, Op den Camp HJ, expression of an endocellulase gene from a
Hackstein JH, van Ooyen AJ (1999) A beta- novel streptomycete isolated from an East
1,4-endoglucanase-encoding gene from African soda lake. Extremophiles 5:333
Cellulomonas pachnodae. Appl Microbiol 40. Handelsman J, Rondon MR, Brady SF, Clardy
Biotechnol 52:232–239 J, Goodman RM (1998) Molecular biological
38. Sanchez-Torres J, Perez P, Santamaria RI access to the chemistry of unknown soil
(1996) A cellulase gene from a new alkalo- microbes: a new frontier for natural products.
philic Bacillus sp. (strain N186-1). Its clon- Chem Biol 5:R245–R249
ing, nucleotide sequence and expression in 41. Teather RM, Wood PJ (1982) Use of Congo
Escherichia coli. Appl Microbiol Biotechnol red-polysaccharide interactions in enumeration
46:149–155 and characterization of cellulolytic bacteria
39. Solingen P, Meijer D, Kleij W, Barnett C, Bolle from the bovine rumen. Appl Environ
R, Power S, Jones B (2001) Cloning and Microbiol 43:777–780
Chapter 13
Abstract
To access the genetic potential contained in large metagenomic libraries, suitable high-throughput func-
tional screening methods are required. Here we describe a high-throughput screening approach which
enables the rapid identification of metagenomic library clones expressing functional accessory lignocellu-
losic enzymes. The high-throughput nature of this method hinges on the multiplexing of both the E. coli
metagenomic library clones and the colorimetric p-nitrophenyl linked substrates which allows for the
simultaneous screening for β-glucosidases, β-xylosidases, and α-L-arabinofuranosidases. This method is
readily automated and compatible with high-throughput robotic screening systems.
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_13, © Springer Science+Business Media LLC 2017
219
220 Mariette Smart et al.
2 Materials
3 Methods
Fig. 1 Schematic representation of the liquid-phase high-throughput screening method. (a) Multiplex eight E.
coli EPI300TM-T1R fosmid (pCCFOS) library clones into one well of a 96-well microtiter plate containing 100 μL
LB supplemented with 15 μg/mL chloramphenicol and 0.1 % L-arabinose. Culture at 37 °C for 48 h with shak-
ing (200 rpm) and lyse by the addition of 10 μL BugBuster® protein extraction reagent (Novagen) (b). (c)
Perform enzyme assays in 50 mM sodium phosphate buffer (pH 7) supplemented with 2 mM of pNP-α-L-
arabinofuranoside, pNP-β-D-xylopyranoside and pNP-β-D-glucopyranoside. Incubate enzyme reactions at
37 °C for 4 h before identifying wells containing positive clones (d). (e) Inoculate each of the eight clones
contained within a positive well singularly to identify the clone harboring the enzyme activity by repeating the
enzyme assay with the mixed substrates. Upon identification of the positive clone, inoculate it in triplicate and
screen it with individual substrates to determine specific enzyme activity (f)
224 Mariette Smart et al.
3.3 Identifying 1. Determine which of the multiplexed clones harbor the enzyme
Clones Harboring activity of interest by locating the clones of interest from the
Enzymes of Interest master plates (see Notes 2 and 3), and inoculating each of the
eight clones originally multiplexed into the well which showed
positive activity individually into separate wells of a 96-well
secondary screening plate. Use 96-well microtiter plates with
100 μL growth and induction medium as described in step 1
of Subheading 3.1.
Fig. 2 High-throughput screening plate showing the yellow color produced after
the addition of the pNP-linked substrates to the multiplexed fosmid metage-
nomic library clones
Multiplex HTS of Metagenomic Libraries 225
4 Notes
References
1. Schloss PD, Handelsman J (2003) Archaeon Sulfolobus solfataricus. Methods Mol
Biotechnological prospects from metagenom- Biol 668:109–116
ics. Curr Opin Biotechnol 14:303–310 14. Hildalgo A, Berenguer J (2013)
2. Streit WR, Schmitz RA (2004) Metagenomics– Biotechnological applications of Thermus ther-
the key to the uncultured microbes. Curr Opin mophilus as host. Curr Biotechnol 2:304–312
Microbiol 7:492–498 15. Craig JW, Chang F-Y, Kim JH, Obiajulu SC,
3. Cowan D, Meyer Q, Stafford W, Muyanga S, Brady SF (2010) Expanding small-molecule
Cameron R, Wittwer P (2005) Metagenomic functional metagenomics through parallel
gene discovery: past, present and future. screening of broad-host-range cosmid environ-
Trends Biotechnol 23:321–329 mental DNA libraries in diverse Proteobacteria.
4. Simon C, Daniel R (2011) Metagenomic Appl Environ Microbiol 76:1633–1641
analyses: past and future trends. Appl Environ 16. Burton S, Cowan DA, Woodley JM (2002)
Microbiol 77:1153–1161 The search for the ideal biocatalyst. Nat
5. Ferrer M, Martínez-Martínez M, Bargiela R, Biotechnol 30:35–46
Streit WR, Golyshina OV, Golyshin PN (2015) 17. Fortune BM (2014) Cloning and characteriza-
Estimating the success of enzyme bioprospect- tion of three compost metagenome-derived
ing through metagenomics: current status and α-L-arabinofuranosidases with differing ther-
future trends. Microb Biotechnol 9:22–34 mal stabilities. Dissertation, University of the
6. Handelsman J, Rodon MR, Brady SF, Clardy J, Western Cape
Goodman RM (1998) Molecular biological 18. Ohlhoff CW, Kirby BM, Van Zyl L, Mutepfab
access to the chemistry of unknown soil DLR, Casanuevaa A, Huddya RJ et al (2015)
microbes: a new frontier for natural products. An unusual feruloyl esterase belonging to family
Chem Biol 5:R242–R249 VIII esterases and displaying a broad substrate
7. Simon C, Daniel R (2009) Achievements and range. J Mol Catal B Enzym 118:79–88
new knowledge unraveled by metagenomic 19. Handelsman J, Liles M, Mann D, Riesenfeld C,
approaches. Appl Microbiol Biotechnol 85: Goodman RM (2002) Cloning the metage-
265–276 nome: culture-independent access to the diver-
8. Vieites JM, Gauzzaroni M-E, Beloqui A, sity and functions of the uncultivated microbial
Golyshin PN, Ferrer M (2010) Molecular world. Methods Microbiol 33:241–255
methods to study complex microbial commu- 20. Anné J, Vrancken K, Van Mellaert L, Van Impe
nities. Methods Mol Biol 668:1–37 J, Bernaerts K (2014) Protein secretion bio-
9. Schmeisser C, Steele H, Streit WR (2007) technology in Gram-positive bacteria with spe-
Metagenomics, biotechnology with non- cial emphasis on Streptomyces lividans. Biochim
culturable microbes. Appl Microbiol Biotechnol Biophys Acta 1843:1750–1761
75:955–962 21. Horbal L, Fedorenko V, Luzhetskyy A (2014)
10. Liebl W, Angelov A, Juergensen J, Chow J, Novel and tightly regulated resorcinol and
Loeschcke A, Drepper T et al (2014) cumate-inducible expression systems for
Alternative hosts for functional (meta)genome Streptomyces and other actinobacteria. Appl
analysis. Appl Microbiol Biotechnol 98: Microbiol Biotechnol 98:8641–8655
8099–8109 22. Maruthamuthu M, Jiménez DJ, Stevens P, van
11. Vrancken K, Van Mellaert L, Anné J (2010) Elsas JD (2016) A multi-substrate approach for
Cloning and expression vectors for a Gram- functional metagenomics-based screening for
positive host, Streptomyces lividans. Methods (hemi)cellulases in two wheat straw-degrading
Mol Biol 668:97–107 microbial consortia unveils novel thermoalkali-
12. McMahon MD, Guan C, Handelsman J, philic enzymes. BMC Genomics 17:86
Thomas MG (2012) Metagenomic analysis of 23. Rabausch U, Juergensen J, Ilmberger N,
Streptomyces lividans reveals host-dependent Böhnke S, Fischer S, Schubach B et al (2013)
functional expression. Appl Environ Microbiol Functional screening of metagenome and
78:3622–3629 genome libraries for detection of novel
13. Angelov A, Liebl W (2010) Heterologous flavonoid-modifying enzymes. Appl Environ
gene expression in the hyperthermophilic Microbiol 76:4551–4563
Chapter 14
Abstract
Glycosyltransferases offer the opportunity to glycosylate a variety of substrates including health beneficial
molecules like flavonoids in a regiospecific manner. Flavonoids are plant secondary metabolites that have
antimicrobial, antioxidative, and health beneficial effects. Glycosylation often has impact on these proper-
ties and furthermore enhances the water solubility, the stability, and the bioavailability of the molecules.
To detect flavonoid glycosylating enzymes we established a metagenome screen for the discovery of modi-
fying clones. This function based screening technique can furthermore detect other modifications like
methylations. The method relies on analysis of the culture supernatant extracts from biotransformation
reactions in a thin layer chromatography (TLC) approach.
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_14, © Springer Science+Business Media LLC 2017
229
230 Nele Ilmberger and Ulrich Rabausch
Fig. 1 Exemplary reaction of the glycosyltransferase GtfC [17]. The enzyme glycosylates quercetin at the OH
group at C3 by transferring rhamnose from the nucleotide sugar dTDP-rhamnose. The reaction product is
quercitrin
Screening Glycosyltransferases for Polyphenol Modifications 231
2 Materials
3 Methods
3.3 Analysis 1. The ethyl acetate extracts (Subheading 3.2) from biotransfor-
of Biotransformation mation reactions (Subheading 3.1) or enzyme assays
Products by TLC (See (Subheading 3.4) are transferred into HPLC flat bottom vials
Notes 2 and 3) and used for TLC analysis. Samples of 20 μL are applied on
20 × 10 cm2 (HP)TLC silica 60 F254 plates (Merck KGaA,
Germany) versus 200 pmol of reference flavonoids with the
ATS 4 (CAMAG, Switzerland). If this device is not available,
samples can be applied with a micropipette tip by hand.
2. The sampled TLC plates are developed in TLC eluent and
dried in hot air for 1 min, e.g., with a hair-dryer.
3. The chromatograms are read depending on the absorbance
maximum of the respective educt flavonoid at 285–370 nm by
the TLC Scanner 3 (CAMAG, Switzerland) (Fig. 2). Next to
the comparison of Rf (retardation factor, aka retention factor)
values, the TLC scanner allows the scanning of UV absorbance
spectra in single bands. This enables a more distinct identification
3.4 Enzyme Assay For the determination of kinetic parameters or characteristics like
pH and temperature optima the enzyme’s activity must be
measured directly.
1. Biocatalytic reaction mixtures of 1 mL contained 5 μg purified
enzyme.
2. Reactions are performed in 50 mM sodium phosphate buffer,
at appropriate pH and temperature.
3. The respective activated sugar (UDP-glucose) is added to
defined concentrations from 50 mM stock solutions in 50 mM
4 Notes
References
1. Perner M, Ilmberger N, Köhler HU, Chow J, 6. Xiao ZP1, Peng ZY, Peng MJ, Yan WB,
Streit WR (2011) Metagenomics in different Ouyang YZ, Zhu HL (2011) Flavonoids health
habitats. In: Bruijn FJD (ed) Handbook of benefits and their molecular mechanism. Mini
molecular microbial ecology II. John Wiley Rev Med Chem11(2):169–177
and Sons, Inc., Hoboken, NJ, pp 481–498 7. Kren V, Martinkova L (2001) Glycosides in
2. Taupp M, Mewis K, Hallam SJ (2011) The art medicine: “The role of glycosidic residue in bio-
and design of functional metagenomic screens. logical activity”. Curr Med Chem 8:1303–1328
Curr Opin Biotechnol 22:465–472 8. Graefe EU, Wittig J, Mueller S, Riethling AK,
3. Boyce S, Tipton KF (2001) Enzyme classifica- Uehleke B, Drewelow B et al (2001)
tion and nomenclature. In: Encyclopedia of Pharmacokinetics and bioavailability of querce-
life sciences. John Wiley and Sons, Ltd., tin glycosides in humans. J Clin Pharmacol
Hoboken, NJ 41:492–499
4. Lairson LL, Henrissat B, Davies GJ, Withers 9. Osmani SA, Bak S, Møller BL (2009) Substrate
SG (2008) Glycosyltransferases: structures, specificity of plant UDP-dependent glycosyl-
functions, and mechanisms. Annu Rev Biochem transferases predicted from crystal structures
77:521–555 and homology modeling. Phytochemistry
5. Luzhetskyy A, Bechthold A (2008) Features 70:325–347
and applications of bacterial glycosyltransfer- 10. Breton C, Snajdrova L, Jeanneau C, Koca J,
ases: current state and prospects. Appl Imberty A (2006) Structures and mechanisms of
Microbiol Biotechnol 80:945–952 glycosyltransferases. Glycobiology 16:29–37
236 Nele Ilmberger and Ulrich Rabausch
11. Noguchi A, Inohara-Ochiai M, Ishibashi N, based enzyme activity assay. Proc Natl Acad Sci
Fukami H, Nakayama T, Nakao M (2008) A U S A 105:3678–3683
novel glucosylation enzyme: molecular clon- 16. Yang M, Brazier M, Edwards R, Davis BG
ing, expression, and characterization of (2005) High-throughput mass-spectrometry
Trichoderma viride JCM22452 alpha-amylase monitoring for multisubstrate enzymes: deter-
and enzymatic synthesis of some flavonoid mining the kinetic parameters and catalytic
monoglucosides and oligoglucosides. J Agric activities of glycosyltransferases. Chembiochem
Food Chem 56:12016–12024 6:346–357
12. Shimoda K, Hamada H (2010) Production of 17. Rabausch U, Juergensen J, Ilmberger N,
hesperetin glycosides by Xanthomonas camp- Bohnke S, Fischer S, Schubach B et al (2013)
estris and cyclodextrin glucanotransferase and Functional screening of metagenome and
their anti-allergic activities. Nutrients genome libraries for detection of novel
2:171–180 flavonoid-modifying enzymes. Appl Environ
13. Aharoni A, Thieme K, Chiu CP, Buchini S, Microbiol 79:4551–4563
Lairson LL, Chen H et al (2006) High- 18. Rabausch U, Ilmberger N, Streit WR (2014)
throughput screening methodology for the The metagenome-derived enzyme RhaB opens
directed evolution of glycosyltransferases. Nat a new subclass of bacterial B type alpha-L-
Methods 3:609–614 rhamnosidases. J Biotechnol 191:38–45
14. Collier AC, Tingle MD, Keelan JA, Paxton JW, 19. Wagner H, Bladt S, Zgainski EM (1983)
Mitchell MD (2000) A highly sensitive fluores- D r o g e n a n a l y s e ,
cent microplate method for the determination Dünnschichtchromatographische Analyse von
of UDP-glucuronosyl transferase activity in tis- Arzneidrogen. Springer, Berlin, p 321
sues and placental cell lines. Drug Metab 20. Neu R (1957) Chelate von Diarylborsäuren
Dispos 28:1184–1186 mit aliphatischen Oxyalkylaminen als
15. Northen TR, Lee JC, Hoang L, Raymond J, Reagenzien für den Nachweis von Oxyphenyl-
Hwang DR, Yannone SM et al (2008) A benzo-γ-pyronen. Naturwissenschaften 44:
nanostructure-initiator mass spectrometry- 181–182
Chapter 15
Abstract
Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by
mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-
plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in
Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools
to identify complementing novel PHA synthesis genes. Identification of novel genes through their func-
tion rather than sequence facilitates the functional proteins that may otherwise have been excluded through
sequence-only screening methodology. We present here methods that we have developed for the isolation
of clones expressing novel PHA metabolism genes from metagenomic libraries.
Key words PHA/PHB pathway, Sinorhizobium meliloti, Pseudomonas putida, Microbial community
gene libraries, Phenotypic complementation
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_15, © Springer Science+Business Media LLC 2017
237
238 Jiujun Cheng et al.
PHB
phaZ
phbC
3-Hydroxybutyrate
NAD+
bdhA
3-Hydroxybutryl-CoA PHB Cycle
NADH
Acetoacetate
NADP+
phbB
acsA2
Acetoacetyl-CoA
NADPH
phbA
Acetyl-CoA
PhaC
scl-PHA Polymer (PHB)
3-hydroxybutyryl-CoA
PhaB
de novo fatty acid synthesis
acetoacetyl-CoA
malonyl-CoA
PhaA malonyl-ACP
acyl-ACP
acetyl-CoA 3-ketoacyl-ACP
enoyl-ACP
3-hydroxyacyl-ACP
PhaG
Feedstock
PhaC
mcl-PHA Polymer
Fig. 2 PHB/PHA synthesis pathways of S. meliloti and P. putida. Note that phaA, phaB, and phaC gene designa-
tions are often used interchangeably with phbA, phbB and phbC in the scl-PHA pathway
2 Materials
3 Methods
3.1 Bacterial Growth 1. Escherichia coli strains are routinely grown at 37 °C using
and Storage Luria–Bertani (LB) medium [24]. S. meliloti strains are rou-
Conditions tinely cultured at 30 °C in either LB [24] or TY [25] medium.
P. putida strains are routinely cultured at 30 °C in LB [24].
When S. meliloti is grown in modified M9 [26] or Rhizobium
minimal medium (RMM) [27] the medium is supplemented
with 15 mM glucose, D-3-hydroxybutyrate (D3HB), L-3-
hydroxybutyrate (L3HB), DL-3-hydroxybutyrate (DLHB),
acetoacetate (AA), or acetate as the carbon source. For growth
under high carbon conditions, S. meliloti is cultured in Yeast
Mannitol (YM) medium.
2. Antibiotics are used in the growth medium where appropriate.
Concentrations for E. coli are as follows: ampicillin 100 μg/
mL, chloramphenicol 25 μg/mL, gentamycin 10 μg/mL,
kanamycin 25 μg/mL, nalidixic acid 5 μg/mL, tetracycline
10 μg/mL. Concentrations for S. meliloti are as follows: gen-
tamicin 75 μg/mL, neomycin 200 μg/mL, spectinomycin
100 μg/mL, streptomycin 200 μg/mL, tetracycline 10 μg/
mL, trimethoprim 400 μg/mL.
3. All bacterial cultures are stored at −70 °C in glass cryovials
containing 7 % dimethyl sulfoxide (DMSO).
3.2 Construction 1. High molecular weight total DNA from soil samples is isolated
of Metagenomic as described by Cheng et al. [28].
Libraries from Soil 2. Cosmid libraries are constructed by cloning fragments from
BamHI partial digests (see Note 2) into the BamHI site of the
IncP TcR plasmid pRK7813 [29] or pJC8 [28] followed by
packaging with Gigapack III XL Lambda packaging extract
and transduction of E. coli HB101 [30].
3. TcR colonies are selected and representative library clones are
analyzed by restriction digest.
4. Colonies are pooled and subcultured. The resultant libraries
are maintained at −70 °C as aliquots in LB containing 7 %
DMSO.
242 Jiujun Cheng et al.
3.8 Utilization S. meliloti mutants of different PHB cycle genes exhibit nutritional
of Nutritional auxotrophies that represent powerful selection tools for the isola-
Auxotrophy tion of complementing clones from metagenomic libraries. These
to Facilitate are summarized in Table 1.
the Isolation of PHB
Cycle Genes
from Metagenomic
Libraries
3.8.1 Complementation 1. The metagenomic libraries are introduced en masse into the
appropriate S. meliloti mutant.
2. Transconjugants are selected on RMM or M9 agar supple-
mented with appropriate antibiotic to counterselect the E. coli
donor and an appropriate carbon source.
3. Isolated clones are screened for the presence of a cosmid by
patching onto LB or TY medium containing the appropriate
antibiotic (Tc for libraries constructed in pRK7813 or pJC8).
4. Cosmids from the resulting colonies are transferred to E. coli
DH5α by triparental conjugation.
Table 1
Nutritional auxotrophies and colony phenotypes of S. meliloti PHB cycle mutants
4 Notes
References
1. Henne A, Daniel R, Schmitz RA, Gottschalk G 9. Kadouri D, Jurkevitch E, Okon Y (2003)
(1999) Construction of environmental DNA Involvement of the reserve material poly-β-
libraries in Escherichia coli and screening for the hydroxybutyrate in Azospirillum brasilense
presence of genes conferring utilization of stress endurance and root colonization. Appl
4-hydroxybutyrate. Appl Environ Microbiol Environ Microbiol 69:3244–3250
65:3901–3907 10. Senior PJ, Beech GA, Ritchie GAF, Dawes EA
2. Anderson AJ, Dawes EA (1990) Occurrence, (1972) The role of oxygen limitation in the
metabolism, metabolic role, and industrial uses formation of poly-3-hydroxybutyrate during
of bacterial polyhydroxyalkanoates. Microbiol batch and continuous culture of Azotobacter
Rev 54:450–472 beijerinckii. Biochem J 128:1193–1201
3. Zevenhuizen LPTM (1981) Cellular glycogen, 11. Stam H, van Verseveld HW, de Vries W,
β-1,2-glucan, poly-3-hydroxybutyric acid and Stouhamer AH (1986) Utilization of poly-β-
extracellular polysaccharides in fast-growing hydroxybutyrate in free-living cultures of
species of Rhizobium. Antonie Van Rhizobium ORS571. FEMS Microbiol Lett
Leeuwenhoek 47:481–497 35:215–220
4. Madison LL, Huisman GW (1999) Metabolic 12. Stockdale H, Ribbons DW, Dawes EA (1968)
engineering of poly(3-hydroxyalkanoates): Occurence of poly-3-hydroxybutyrate in the
from DNA to plastic. Microbiol Mol Biol Rev Azotobacteriaceae. J Bacteriol 95:1798–1803
63:21–53 13. Senior PJ, Dawes EA (1971) Poly-3-
5. Shishatskaya EI, Voinova ON, Goreva AV, hydroxybutyrate biosynthesis and the regula-
Mogilnaya OA, Volova TG (2008) tion of glucose metabolism in Azotobacter
Biocompatibility of polyhydroxybutyrate beijinkereii. Biochem J 125:55–66
microspheres: in vitro and in vivo evaluation. 14. Page WJ, Knosp O (1989) Hyperproduction
J Mater Sci Mater Med 19:2493–2502 of poly-3-Hydroxybutyrate during exponential
6. Shishatskaya EI, Volova TG, Puzyr AP, growth of Azotobacter vinelandii UWD. Appl
Mogilnaya OA, Efremov SN (2004) Tissue Environ Microbiol 55:1334–1339
response to the implantation of biodegradable 15. Schallmey M, Ly A, Wang C, Meglei G, Voget
polyhydroxyalkanoate sutures. J Mater Sci S, Streit WR et al (2011) Harvesting of novel
Mater Med 15:719–728 polyhydroxyalkanaote (PHA) synthase encod-
7. Holmes PA (1985) Applications of PHB -- a ing genes from a soil metagenome library using
microbially produced biodegradable thermo- phenotypic screening. FEMS Microbiol Lett
splastic. Phys Technol 16:32–36 321:150–156
8. Pötter M, Steinbüchel A (2005) Poly(3- 16. Aneja P, Charles TC (1999) Poly-3-
hydroxybutyrate) granule-associated pro- hydroxybutyrate degradation in Rhizobium
teins: impacts on poly(3-hydroxybutyrate) (Sinorhizobium) meliloti: isolation and charac-
synthesis and degradation. Biomacromolecules terization of a gene encoding 3-hydroxybutyrate
6:552–560 dehydrogenase. J Bacteriol 181:849–857
248 Jiujun Cheng et al.
17. Aneja P, Dziak R, Cai GQ, Charles TC (2002) use in a rapid method for marker exchange in
Identification of an acetoacetyl coenzyme-A Pseudomonas fluorescens strain HV37a. Gene
synthetase-dependent pathway for utilization 61:299–306
of L-(+)-3-hydroxybutyrate in Sinorhizobium 30. Wang C, Meek DJ, Panchal P, Boruvka N,
meliloti. J Bacteriol 184:1571–1577 Archibald FS, Driscoll BT, Charles TC (2006)
18. Charles TC, Cai GQ, Aneja P (1997) Isolation of poly-3-hydroxbutyrate metabolism
Megaplasmid and chromosomal loci for the genes from complex microbial communities by
PHB degradation pathway in Rhizobium phenotypic complementation of bacterial
(Sinorhizobium) meliloti. Genetics 146: mutants. Appl Environ Microbiol 72:384–391
1211–1220 31. Law J, Slepecky R (1961) Assay of poly-3-
19. Willis LB, Walker GC (1998) The phbC (poly- hydroxybutyric acid. J Bacteriol 82:33–36
β-hydroxybutyrate synthase) gene of Rhizobium 32. Kovach ME, Elzer PH, Hill DS, Robertson
(Sinorhizobium) meliloti and characterization GT, Farris MA, Roop RM, Peterson KM
of phbC mutants. Can J Microbiol (1995) Four new derivatives of the broad-host-
44:554–564 range cloning vector pBBR1MCS, carrying
20. Aneja P, Dai M, Lacorre DA, Pillon B, Charles different antibiotic-resistance cassettes. Gene
TC (2004) Heterologous complementation of 166:175–176
the exopolysaccharide synthesis and carbon uti- 33. Altschul SF, Madden TL, Schäffer AA, Zhang
lization phenotypes of Sinorhizobium meliloti Z, Miller W, Lipman DJ (1997) Gapped
Rm1021 polyhydroxyalkanoate synthesis BLAST and PSI-BLAST: a new generation of
mutants. FEMS Microbiol Lett 239:277–283 protein database search programs. Nucleic
21. Ostle AG, Holt JG (1982) Nile blue as a fluo- Acids Res 25:3389–3402
rescent stain for poly-β-hydroxybutyrate. Appl 34. Meade HM, Long SR, Ruvkun GB, Brown SE,
Environ Microbiol 44:238–241 Ausubel FM (1982) Physical and genetic char-
22. Kranz RG, Gabbert KK, Madigan MT (1997) acterization of symbiotic and auxotrophic
Positive selection systems for discovery of novel mutants of Rhizobium meliloti induced by
polyester biosynthesis genes based on fatty acid transposon Tn5 mutagenesis. J Bacteriol 149:
detoxification. Appl Environ Microbiol 114–122
63:3010–3013 35. Cai G, Driscoll BT, Charles TC (2000)
23. Povolo S, Tombolini R, Morea A, Anderson AJ, Requirement for the enzymes acetoacetyl
Casella S, Nuti MP (1994) Isolation and charac- coenzyme-A synthetase and poly-3-
terization of mutants of Rhizobium meliloti hydroxybutyrate (PHB) synthase for growth of
unable to synthesize poly-3-hydroxybutyrate Sinorhizobium meliloti on PHB cycle interme-
(PHB). Can J Microbiol 40:823–829 diates. J Bacteriol 182:2113–2118
24. Sambrook J, Russell DW (2001) Molecular 36. Aneja P, Zachertowska A, Charles TC (2005)
cloning: a laboratory manual. Cold Spring Comparison of the symbiotic and competition
Harbor Press, Cold Spring Harbor, NY phenotypes of Sinorhizobium meliloti PHB
25. Beringer JE (1974) R factor transfer in synthesis and degradation pathway mutants.
Rhizobium leguminosarum. J Gen Microbiol Can J Microbiol 51:599–604
84:188–198 37. Wang CX, Sheng XY, Equi RC, Trainer MA,
26. Miller JH (1972) Experiments in molecular Charles TC, Sobral BWS (2007) Influence of
genetics. Cold Spring Harbor Laboratory, the poly-3-hydroxybutyrate (PHB) granule-
Cold Spring Harbor, NY associated proteins (PhaP1 and PhaP2) on
27. Dowling DN, Samrey U, Stanley J, Broughton PHB accumulation and symbiotic nitrogen
WJ (1987) Cloning of Rhizobium leguminosa- fixation in Sinorhizobium meliloti Rm1021.
rum genes for competitive nodulation blocking J Bacteriol 189:9050–9056
on peas. J Bacteriol 169:1345–1348 38. Leigh JA, Signer ER, Walker GC (1985)
28. Cheng J, Pinnell L, Engel K, Neufeld JD, Exopolysaccharide-deficient mutants of
Charles TC (2014) Versatile broad-host-range Rhizobium meliloti that form ineffective nodules.
cosmids for construction of high quality Proc Natl Acad Sci U S A 82:6231–6235
metagenomic libraries. J Microbiol Methods 39. Miller-Williams M, Loewen PC, Oresnik IJ
99:27–34 (2006) Isolation of salt-sensitive mutants of
29. Jones JD, Gutterson N (1987) An efficient Sinorhizobium meliloti strain Rm1021.
mobilizable cosmid vector, pRK7813, and its Microbiology 152:2049–2059
Chapter 16
Abstract
The release of phosphate from inorganic and organic phosphorus compounds can be mediated enzymatically.
Phosphate-releasing enzymes, comprising acid and alkaline phosphatases, are recognized as useful biocata-
lysts in applications such as plant and animal nutrition, bioremediation and diagnostic analysis. Metagenomic
approaches provide access to novel phosphatase-encoding genes. Here, we describe a function-based
screening approach for rapid identification of genes conferring phosphatase activity from small-insert and
large-insert metagenomic libraries derived from various environments. This approach bears the potential
for discovery of entirely novel phosphatase families or subfamilies and members of known enzyme classes
hydrolyzing phosphomonoester bonds such as phytases. In addition, we provide a strategy for efficient
heterologous phosphatase gene expression.
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_16, © Springer Science+Business Media LLC 2017
249
250 Genis A. Castillo Villamizar et al.
2 Materials
2.1 Identification The function-based screening approach presented here has been
of Phosphatase Genes tested using small-insert and large-insert metagenomic libraries
by Function-Based derived from soil, compost, volcano sediments, glacial samples,
Screening and microbial mats. Metagenomic library construction was per-
of Metagenomic formed according to protocols described by Simon and Daniel
Libraries [17]. Small-insert metagenomic libraries were constructed using
the plasmid pCR-XL-TOPO (Thermo Fisher Scientific, Waltham,
2.1.1 Metagenomic MA, USA) as vector. Large-insert metagenomic libraries were gen-
Libraries erated using the fosmid vector pCC1FOS™ (Epicentre
Biotechnology, Madison, WI, USA).
2.1.2 Medium for Small- 1. Modified Sperber medium (SpM): 16 g/L agar, 10 g/L glu-
Insert Metagenomic cose or 2 % glycerol, 500 mg/L yeast extract, 100 mg/L
Library Screening CaCl2, and 250 mg/L MgSO4, supplemented with a phospho-
rus source such as 2.5 g/L phytic acid, β-glycerol phosphate
disodium salt pentahydrate, or D-fructose 6-phosphate diso-
dium salt hydrate, 5-bromo-4-chloro-3-indolyl phosphate
(BCIP) stock solution: 25 mg/mL in dimethylformamide.
2. Kanamycin stock solution: 50 mg/mL in H2O.
3. NaOH solutions for pH adjustment.
2.1.3 Medium for The materials listed for small-insert metagenomic library screening
Large-Insert Metagenomic medium can be used by considering the following modifications
Library Screening and extensions:
1. Chloramphenicol instead of kanamycin stock solution:
12.5 mg/mL in ethanol.
2. L-arabinose stock solution: 1 % (w/v) in H2O.
2.2.2 Heterologous 1. E. coli BL21 one shot cells (Thermo Fisher Scientific GmbH,
Expression of Genes Schwerte, Germany).
Encoding Phosphatase 2. LB agar plates supplemented with 100 mg/L ampicillin.
Activity
3. Minimal medium is prepared from stock solution of 5× salts
solution (50 g Na2HPO4 · 7H2O, 30 g KH2PO4, 5 g NaCl,
5 g NH4Cl) in 1 L water. For 1 L media, add 200 mL of the
10× salt solution to 500 mL of water supplemented with
0.20 % glycerol, adjust the volume and sterilize by autoclav-
ing. Supplement the media by adding 1 mL of MgSO4
(1 M), 1 mL CaCl2 (1 M), and 1 mL FeSO4 · 7H2O
(0.01 mM). The solutions should be sterilized separately by
filtration.
4. 50 mM Hepes buffer pH 8.
5. Shaker with temperature control.
6. French press or any other effective cell disruption device.
Microbial Phosphatases from Metagenomes 253
3 Methods
3.1.3 Analysis 1. Pick single positive colonies and grow them individually in
of Metagenomic DNA 5 mL LB broth (see Note 2) supplemented with the appropri-
Fragments Carried ate antibiotic (kanamycin, final concentration: 50 mg/L or
by Positive Clones chloramphenicol, final concentration: 12.5 mg/L).
2. Shake overnight at 37 °C and 150 rpm.
3. Extract, digest with restriction endonucleases, e.g., HindIII or
any other enzyme present in the used vector and analyze insert
DNA by using standard techniques.
4. Determine the insert sequences of vector DNA extracted from
positive clones.
5. After the insert DNA sequences have been determined, identify
open reading frames (ORFs). An initial prediction of ORFs can
be performed using the ORF finder tool provided by the
National Center for Biotechnology Information [19, 20].
6. To identify ORFs potentially conferring phosphatase activity,
examine coding sequences for similarities to protein families
Microbial Phosphatases from Metagenomes 255
3.2.2 Heterologous 1. Transform E. coli BL21 one shot cells. Thaw one tube of E. coli
Expression of Genes BL21 one shot cells on ice and subsequently add 1 μL of the
Encoding Phosphatase constructed expression plasmid harboring the target gene
Activity (maximum of 30 ng). Incubate on ice for 30 min. Perform
transformation of the recombinant plasmids into the cells by
heat shock treatment at 42 °C for 30 s in a temperature-
controlled water bath. Immediately transfer the tube to ice and
subsequently add 250 μL SOC medium. Incubate the tube at
37 °C for 45 min. Spread 100 as well as 150 μL suspension of
transformed cells on LB plates containing ampicillin (see Note 6).
Incubate plates overnight at 37 °C.
2. Pick 3–4 colonies and grow each in 30 mL minimal medium
containing ampicillin (final concentration: 100 mg/L) over-
night at 30 °C and 150 rpm.
3. Use the overnight culture to inoculate 250 mL of minimal
medium (resulting OD600 should be approximately 0.1).
Incubate the culture with shaking (150 rpm) at 30 °C until it
reaches log phase (OD600 0.4–0.8). Induce the production of
the recombinant protein by adding IPTG to a final concentra-
tion of 0.25 mM and incubate with shaking (150 rpm) at
30 °C until OD600 of approximately 3.2 (see Note 7).
4. Harvest the cells by centrifugation at 10,000 × g and 4 °C for
20 min. Suspend the resulting cell pellet in chilled lysis buffer
50 mM HEPES pH 7.5. Use a ratio of 1:2 w/v of pellet to
buffer (see Note 8). Disrupt the cells using a prechilled French
Press cell (1.38 × 108 Pa).
5. Clarify the cell lysate by centrifugation for 20 min at 9000 × g
and 4 °C. The supernatant (crude extract) should be cleared by
filtration using a 0.2 μm syringe filter. Note: Subsequent puri-
fication methods of the crude extract can be applied to purify
the target protein but a check for phosphatase activity should
be performed using the crude extract.
4 Notes
References
1. McDowell LR (2003) Chapter 2 - Calcium and 8. Greiner R (2004) Purification and Properties
phosphorus. In: McDowell LR (ed) Minerals of a Phytate-degrading Enzyme from Pantoea
in animal and human nutrition, 2nd edn. agglomerans. Protein J 23:567–576
Elsevier, Amsterdam, pp 33–100 9. Cho J, Lee C, Kang S, Lee J, Lee H, Bok J et al
2. Smil V (2000) Phosphorus in the environment: (2005) Molecular cloning of a phytase gene
natural flows and human interferences. Annu (phy M) from Pseudomonas syringae MOK1.
Rev Energy Environ 25:53–88 Curr Microbiol 51:11–15
3. Tarafdar JC, Marschner H (1994) Phosphatase 10. Cheng W, Chiu CS, Guu YK, Tsai ST, Liu
activity in the rhizosphere and hyphosphere of CH (2013) Expression of recombinant phy-
VA mycorrhizal wheat supplied with inorganic tase of Bacillus subtilis E20 in Escherichia coli
and organic phosphorus. Soil Biol Biochem HMS 174 and improving the growth perfor-
26:387–395 mance of white shrimp, Litopenaeus vanna-
4. Bagyaraj DJ, Krishnaraj PU, Khanuja SPS mei, juveniles by using phytase-pretreated
(2000) Mineral phosphate solubilization: agro- soybean meal-containing diet. Aquacult Nutr
nomic implications, mechanism and molecular 19:117–127
genetics. Proc Indian Nat Sci Acad B Rev 11. Sarikhani M, Malboobi M, Aliasgharzad N,
Tracts Biol Sci 66:69–82 Greiner R, Yakhchali B (2010) Functional
5. Cromwell GL (2009) ASAS Centennial Paper: screening of phosphatase-encoding genes from
landmark discoveries in swine nutrition in the bacterial sources. Iran J Biotech 8:275–279
past century. J Anim Sci 87:778–792 12. Riccio ML, Rossolini GM, Lombardi G,
6. Lim BL, Yeung P, Cheng C, Hill JE (2007) Chiesurin A, Satta G (1997) Expression clon-
Distribution and diversity of phytate- ing of different bacterial phosphataseencoding
mineralizing bacteria. ISME J 1:321–330 genes by histochemical screening of genomic
7. Muginova SV, Zhavoronkova AM, Polyakov libraries onto an indicator medium containing
AE, Shekhovtsova TN (2007) Application of phenolphthalein diphosphate and methyl
alkaline phosphatases from different sources in green. J Appl Microbiol 82:177–185
pharmaceutical and clinical analysis for the 13. Tan H, Mooij MJ, Barret M, Hegarty PM,
determination of their cofactors; Zinc and Harington C, Dobson ADW, O’Gara F (2014)
Magnesium ions. Anal Sci 23:357–363 Identification of novel phytase genes from an
260 Genis A. Castillo Villamizar et al.
agricultural soil-derived metagenome. 19. Altschul SF, Gish W, Miller W, Myers EW,
J Microbiol Biotechnol 24:113–118 Lipman DJ (1990) Basic local alignment search
14. Yao MZ, Zhang YH, Lu WL, Hu MQ, Wang tool. J Mol Biol 215:403–410
W, Liang AH (2012) Phytases: crystal struc- 20. Sayers EW, Barrett T, Benson DA, Bolton E,
tures, protein engineering and potential bio- Bryant SH, Canese K et al (2012) Database
technological applications. J Appl Microbiol resources of the National Center for Biotechnology
112:1–14 Information. Nucleic Acids Res 40:D13–D25
15. Kennelly PJ (2001) Protein phosphatases – a 21. Marchler-Bauer A, Zheng C, Chitsaz F,
phylogenetic perspective. Chem Rev Derbyshire MK, Geer LY, Geer RC et al (2013)
101:2291–2312 CDD: conserved domains and protein three-
16. Huang H, Pandya C, Liu C, Al-Obaidi NF, dimensional structure. Nucleic Acids Res
Wang M, Zheng L et al (2015) Panoramic view 41:D348–D352
of a superfamily of phosphatases through sub- 22. Heinonen JK, Lahti RJ (1981) A new and con-
strate profiling. Proc Natl Acad Sci U S A venient colorimetric determination of inor-
112:E1974–E1983 ganic orthophosphate and its application to the
17. Simon C, Daniel R (2010) Construction of assay of inorganic pyrophosphatase. Anal
small-insert and large-insert metagenomic Biochem 113:313–317
libraries. Methods Mol Biol 668:39–50 23. Vijayaraghavan P, Primiya RR, Prakash Vincent
18. Dower WJ, Miller JF, Ragsdale CW (1988) SG (2013) Thermostable alkaline phytase from
High efficiency transformation of E. coli by Alcaligenes sp. in improving bioavailability of
high voltage electroporation. Nucleic Acids phosphorus in animal feed: in vitro analysis.
Res 16:6127–6145 ISRN Biotechnol 2013:6
Chapter 17
Abstract
Here we outline how to identify hydrogenase enzymes from metagenomic libraries through an activity-based
screening approach. A metagenomic fosmid library is constructed in E. coli and the fosmids are transferred
into a hydrogenase deletion mutant of Shewanella oneidensis (ΔhyaB) via triparental mating. If a fosmid
exhibits hydrogen uptake activity, S. oneidensis’ phenotype is restored and hydrogenase activity is indicated
by a color change of the medium from yellow to colorless. This new method enables screening of 48
metagenomic fosmid clones in parallel.
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_17, © Springer Science+Business Media LLC 2017
261
262 Nicole Adam and Mirjam Perner
2 Materials
2.1 Laboratory 1. General equipment for handling anaerobic cultures, e.g., gas
Equipment attachments, syringes, needles, serum bottles (120 mL), butyl
rubber stoppers, aluminum caps, crimping tool.
2. 96-well microtiter plates and 96-deep-well plates as well as a
48-pin replicator tool with flat pins (e.g., by Boekel scientific,
Feasterville, PA, USA).
3. Centrifuge with rotor (adapter) for microtiter/deep-well
plates.
2.3 Kits 1. Copy control™ Fosmid Library Production Kit with pCC1FOS
and (Restriction) (Epicentre, Madison, WI, USA).
Enzymes 2. Plasmid isolation mini kit.
3. Gel/PCR DNA purification kit.
4. Restriction enzyme Eco72I (Thermo Scientific, Waltham, MA,
USA).
5. Fast AP Thermosensitive Alkaline Phosphatase (Thermo
Scientific, Waltham, MA, USA).
264 Nicole Adam and Mirjam Perner
3 Methods
3.1 Construction 1. Prior to ligation, the broad host range vector pRS44 has to be
of the Metagenomic linearized and dephosphorylated: 1 μg of purified fosmid DNA
Library with the Broad (e.g., by means of a Plasmid isolation mini kit) is digested with
Host Range Vector 10 U Eco 72I with the corresponding buffer on a 20 μL scale
pRS44 and 1 μL of Fast AP Phosphatase is added.
3.1.1 Preparation
2. The digestion/dephosphorylation is incubated for 2 h at 37 °C
of the Broad Host Range
and inactivated at 80 °C for 20 min.
Vector pRS44 3. The success of the restriction digest is verified by running a
standard 0.8 % TAE agarose gel (e.g., 100 V for 30 min).
4. The linearized and dephosphorylated vector is purified using a
suitable Gel/PCR DNA purification kit.
5. The vector DNA should be eluted with nuclease-free, deion-
ized water or Tris buffer (pH 8.0). The concentration of the
purified vector DNA should at least be 100 ng/μL.
3.1.3 Ligation, 1. The ligation reaction of the metagenomic DNA into the
Transduction, and Storing pRS44 vector and the packaging reaction of the vector con-
of the Metagenomic struct can be done analogous to the protocol using the
Library pCC1FOS vector. Prior to the “main transduction” the titer of
the phage particles should be determined: 2.5, 5, and 10 μL of
the packaging reaction are provided in microcentrifuge tubes
and 100 μL of exponentially grown E. coli EPI300-T1R cells
(grown in LB with MgSO4 and maltose) are added to each
tube.
2. The mixtures are incubated at 37 °C (shaking) for 30–60 min.
3. Subsequently the cells are plated onto LB plates containing
kanamycin, chloramphenicol, and IPTG/X-Gal (for selection
Activity-Based Screening for Hydrogenase Enzymes 265
3.2 Screening The screening method for hydrogen uptake active metagenomic
of Metagenomic clones is based on the complementation of the [NiFe]-hydrogenase
Libraries for Hydrogen deletion mutant of Shewanella oneidensis MR-1 (S. oneidensis
Uptake Activities ΔhyaB). S. oneidensis can couple the oxidation of molecular hydro-
gen to the reduction of Fe-compounds such as Fe(III)citrate [16,
18, 19]. The ability to reduce Fe(III)citrate (yellow) to Fe(II)
citrate (colorless) under anaerobic conditions with hydrogen as the
sole energy source is used for the detection of hydrogen uptake
activity. A color change of the FW-medium from yellow to color-
less during anaerobic chemolithotrophic growth shows the hydrog-
enase activity (Fig. 1, reaction scheme Fig. 2). In S. oneidensis
ΔhyaB the structural gene of the [NiFe]-hydrogenase large subunit
(hyaB) is deleted and accordingly no color change can be detected.
The restoration of the wildtype phenotype by complementation of
S. oneidensis ΔhyaB with the pRS44 vector harboring hydrogenase
genes is possible and used for the screening for hydrogen uptake
active enzymes. For the screening of metagenomic libraries, fos-
mids harboring metagenomic DNA are transferred into S. oneiden-
sis ΔhyaB via triparental mating and pools of 48 conjugated clones
are inoculated on FW-medium for the detection of hydrogen
uptake activity.
3.2.1 Transfer 1. Precultures (5 mL) of E. coli K-12 HBH101 (with the helper
of Metagenomic Fosmids plasmid pRK2013) are grown in LB containing kanamycin
into S. oneidensis ΔhyaB overnight shaking at 37 °C. S. oneidensis ΔhyaB (recipient
(See Note 4) strain) overnight cultures (5 mL) are grown in LB(+gentamycin)
shaking at 28 °C. Microtiter plates with metagenomic E. coli
Fig. 2 Reaction mechanism of Fe(III)citrate with electrons generated by a hydrogen uptake hydrogenase
Activity-Based Screening for Hydrogenase Enzymes 267
4 Notes
Acknowledgments
References
1. Schlapbach L, Zuttel A (2001) Hydrogen- 8. Hügler M, Sievert SM (2011) Beyond the
storage materials for mobile applications. Calvin cycle: autotrophic carbon fixation in the
Nature 414:353–358 ocean. Ann Rev Mar Sci 3:261–289
2. Karyakin AA, Morozov SV, Karyakina EE, 9. Hallenbeck PC (2009) Fermentative hydrogen
Zorin NA, Perelygin VV, Cosnier S (2005) production: principles, progress, and progno-
Hydrogenase electrodes for fuel cells. Biochem sis. Int J Hydrog Energy 34:7379–7389
Soc Trans 33:73–75 10. Vignais PM, Billoud B (2007) Occurrence, clas-
3. Armstrong FA, Belsey NA, Cracknell JA, sification, and biological function of hydroge-
Goldet G, Parkin A, Reisner E et al (2009) nases: an overview. Chem Rev 107:4206–4272
Dynamic electrochemical investigations of 11. Perner M, Gonnella G, Kurtz S, LaRoche
hydrogen oxidation and production by J (2014) Handling temperature bursts reach-
enzymes and implications for future technol- ing 464°C: different microbial strategies in the
ogy. Chem Soc Rev 38:36–51 Sisters Peak hydrothermal chimney. Appl
4. Wait AF, Parkin A, Morley GM, dos Santos L, Environ Microbiol 80:4585–4598
Armstrong FA (2010) Characteristics of 12. Constant P, Chowdhury SP, Hesse L, Pratscher
enzyme-based hydrogen fuel cells using an oxy- J, Conrad R (2011) Genome data mining and
gen-tolerant hydrogenase as the anodic catalyst. soil survey for the novel group 5 [NiFe]-
J Phys Chem C 114:12003–12009 hydrogenase to explore the diversity and eco-
5. Tang KH, Tang YJ, Blankenship RE (2011) logical importance of presumptive high-affinity
Carbon metabolic pathways in phototrophic H(2)-oxidizing bacteria. Appl Environ
bacteria and their broader evolutionary impli- Microbiol 77:6027–6035
cations. Front Microbiol 2:165 13. Vargas W, Weyman P, Tong Y, Smith H, Xu Q
6. Bothe H, Schmitz O, Yates MG, Newton WE (2011) A [NiFe]-hydrogenase from
(2010) Nitrogen fixation and hydrogen metab- Alteromonas macleodii with unusual stability in
olism in cyanobacteria. Microbiol Mol Biol Rev the presence of oxygen and high temperature.
74:529–551 Appl Environ Microbiol 77:1990–1998
7. Dilling W, Cypionka H (1990) Aerobic respira- 14. Maroti G, Tong Y, Yooseph S, Baden-Tillson
tion in sulfate-reducing bacteria. FEMS H, Smith HO, Kovacs KL et al (2009)
Microbiol Lett 71:123–127 Discovery of [NiFe] hydrogenase genes in
270 Nicole Adam and Mirjam Perner
metagenomic DNA: cloning and heterologous 19. Meshulam-Simon G, Behrens S, Choo AD,
expression in Thiocapsa roseopersicina. Appl Spormann AM (2007) Hydrogen metabolism
Environ Microbiol 75:5821–5830 in Shewanella oneidensis MR-1. Appl Environ
15. Aakvik T, Degnes KF, Dahlsrud R, Schmidt F, Microbiol 73:1153–1165
Dam R, Yu L et al (2009) A plasmid RK2-based 20. Guiral M, Tron P, Belle V, Aubert C, Leger C,
broad-host-range cloning vector useful for trans- Guigliarelli B, Giudici-Orticoni MT (2006)
fer of metagenomic libraries to a variety of bacte- Hyperthermostable and oxygen resistant
rial species. FEMS Microbiol Lett 296:149–158 hydrogenases from a hyperthermophilic bacte-
16. Lovley DR, Phillips EJ, Lonergan DJ (1989) rium Aquifex aeolicus: physicochemical proper-
Hydrogen and formate oxidation coupled to ties. Int J Hydrog Energy 31:1424–1431
dissimilatory reduction of iron or manganese 21. Ishii M, Takishita S, Iwasaki T, Peerapornpisal
by Alteromonas putrefaciens. Appl Environ Y, Yoshino J, Kodama T, Igarashi Y (2000)
Microbiol 55:700–706 Purification and characterization of membrane-
17. Balch WE, Fox GE, Magrum LJ, Woese CR, bound hydrogenase from Hydrogenobacter
Wolfe RS (1979) Methanogens: reevaluation thermophilus strain TK-6, an obligately auto-
of a unique biological group. Microbiol Rev trophic, thermophilic, hydrogen-oxidizing
43:260–296 bacterium. Biosci Biotechnol Biochem
18. Myers CR, Myers JM (1993) Ferric reductase 64:492–502
is associated with the membranes of anaerobi- 22. Hansen M, Perner M (2015) A novel hydro-
cally grown Shewanella putrefaciens Mr-1. gen oxidizer amidst the sulfur-oxidizing
FEMS Microbiol Lett 108:15–22 Thiomicrospira lineage. ISME J 9:696–707
Chapter 18
Abstract
Quorum sensing (QS)-based signaling is a widespread pathway used by bacteria for the regulation of func-
tions involved in their relation to the environment or their host. QS relies upon the production, accumula-
tion and perception of small diffusable molecules by the bacterial population, hence linking high gene
expression with high cell population densities. Among the different QS signal molecules, an important
class of signal molecules is the N-acyl homoserine lactone (N-AHSL). In pathogens such as Erwinia or
Pseudomonas, N-AHSL based QS is crucial to overcome the host defenses and ensure a successful infec-
tion. Interfering with QS-regulation allows the algae Delisea pulcra to avoid surface colonization by bac-
teria. Thus, interfering the QS-regulation of pathogenic bacteria is a promising antibiotic-free antibacterial
therapeutic strategy. To date, two N-AHSL lactonases and one amidohydrolase families of N-ASHL deg-
radation enzymes have been characterized and have proven to be efficient in vitro to control N-AHSL-
based QS-regulated functions in pathogens. In this chapter, we provide methods to screen individual
clones or bacterial strains as well as pool of clones for genomic and metagenomic libraries, that can be used
to identify strains or clones carrying N-ASHL degradation enzymes.
Key words N-acyl homoserine lactone, Quorum sensing, Quorum quenching, N-AHSL lactonase,
N-AHSL acylase, N-AHSL amidohydrolase
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_18, © Springer Science+Business Media LLC 2017
271
272 Stéphane Uroz and Phil M. Oger
Fig. 1 N-AHSL chemical and enzymatic alterations. Center: Common structure of N-AHSLs (R1 = OH or O;
0 ≤ n ≤ 6). Left: Biologically active derivatives of N-AHSL following oxidase and oxido-reductase attacks. Right:
Biologically inactive N-AHSL derivatives following lactonase or amidohydrolase degradation
Screening for N-AHSL-Based-Signaling Interfering Enzymes 273
2 Materials
2.1 Strains 1. N-AHSL sensor systems (see Note 2): Sensor system for 3-oxo
and Growth Media and 3-hydroxy N-AHSL (3O, and 3OH, N-AHSL respec-
for Cell Cultures tively) Agrobacterium tumefaciens strain NTL4(pZLR4) [14].
This strain should be maintained and cultured on gentamycin
100 mg/L.
2. Sensor system for short chain N-AHSLs Chromobacterium vio-
laceum strain CV026 [15]. This strain should be cultured on
Luria Broth with 5 g NaCl per liter. It cannot be maintained
for long periods on plates, and should be streaked regularly
from frozen stocks.
3. Low salt Luria Broth (5 g NaCl/L, Gibco). When necessary
this medium is buffered to pH = 6.5 with 100 mM phosphate
buffer to avoid spontaneous degradation of N-AHSLs. To pre-
pare 1 L of pH = 6.5-buffered LB dissolve 20 g of LB powder
into 900 mL of water, then add 27.8 mL of 1 M K2HPO4 and
72.2 mL of 1 M KH2PO4. Sterilize by autoclaving.
4. AB minimal medium is prepared from stock solutions of 20×
AB salts and 20× AB buffer and sterile water for liquid media
and sterile water agar for solid media. 20× AB salts (per liter):
20 g NH4Cl, 6 g MgSO4 · 7H2O, 3 g KCl, 200 mg CaCl2,
50 mg FeSO4 · 7H2O; Sterilize by autoclaving. 20× AB Buffer
(per liter): 60 g K2HPO4, 23 g NaH2PO4; Adjust the pH to 7
if necessary; Sterilize by autoclaving. 5 mM mannitol from a
stock solution at 100 mM is added as a carbon source. When
necessary gentamycin (100 mg/L) and X-gal (40 mg/L) are
added to the medium.
5. Phosphate buffered saline solution (PBS 1×): 8 g NaCl, 0.2 g
KCl, 1.44 g Na2HPO4, 0.24 g KH2PO4; Dissolve in 800 mL of
distilled H2O. Adjust the pH to 6.5 with HCl. Add H2O to
1 L. Sterilize by autoclaving.
274 Stéphane Uroz and Phil M. Oger
2.3 Thin Layer 1. Whatman 3MM filter paper (Whatman, Springfield Mill, UK).
Chromatography 2. Glass TLC Developing Tank for 20 cm × 20 cm TLC plates
(Whatman, Springfield Mill, UK).
3. Glass C18 coated TLC plates with 200 μm coating. We use
Partisil® KC18 TLC plates, Silica gel 60 Å (Whatman,
Springfield Mill, UK).
4. Methanol, analytical grade (Sigma-Aldrich, St. Louis, MO).
5. Overlay preparation: Sterilize by autoclaving 88 mL of soft
water agar (7 g/L), then add to the medium 5 mL of each 20×
AB salts and 20× AB buffer and 2 mL of 100 mM mannitol
solution. Cool until it reaches ~50–55 °C, then add 150 μL of
X-gal (40 mg/mL).
6. Custom made TLC overlaying container (see Note 3). This
container is made out of 5 mm thick plexiglass. The base of the
container is a 25 cm wide square, in which four 3 cm-wide
holes placed approximately 5 cm from each corner along the
diagonals have been drilled. These holes allow the user to
access the plate from underneath and push to release it after
the overlay has solidified. 2 cm wide bars are glued on top of
the base form a 20.2 cm × 20.2 cm 5 mm deep internal space
which will accept the TLC plate. It is important to allow some
extra spacing around the TLC to facilitate the extraction of the
plate after solidification of the agar. The thickness of the over-
lay is 3 mm.
2.4 HPLC 1. Waters 625 HPLC system (Waters Corp., Millford, MA) cou-
pled with a Waters 996 PDA photodiode array detector
(operating with a Millennium 2010 Chromatography Manager)
equipped with a Kromasil C8 5 μm column, 2.1 × 250 mm
(Jones Chromatography, Mid Glamorgan, UK) or equivalent
for the identification of amidohydrolysis degradation
products.
Screening for N-AHSL-Based-Signaling Interfering Enzymes 275
3 Methods
3.1.2 Preparation of CCE 1. Cycle the RC suspension five times in a cell disrupter (Constant
Systems Cell Disrupter) under 15 kPa pressure.
2. Remove Cell debris by centrifugation (120 min, 4 °C,
10,000 × g).
3. Filter the supernatant through a 0.22 μm membrane.
4. Adjust the protein concentration to 0.5 mg/mL using the
Bradford Protein Quantification method and store at 4 °C.
3.2 Microplate Fast 1. Grow the bacterial clones in 200 μL of LB supplemented with
Screening of N-AHSL the appropriate antibiotics in microtiter plates for 24 h at 30 °C
Degradation Individual (or 37 °C for E. coli) (see Note 4).
Clones [16] (Sub 2. Subculture the clones into 200 μL of fresh pH = 6.5-buffered
heading 3.2.1) or LB medium without antibiotics but supplemented with 25 μM
Mixed Pools of Clones of the appropriate N-AHSL. Incubate for up to 2 days at 25 °C
(Subheading 3.2.2) (see Note 4). Since N-AHSL may be spontaneously degraded
in buffered LB medium over long incubation period, it is
3.2.1 Screen of Pure
important to include a spontaneous degradation control. It
Strains, Clones or Isolates
consists of a non inoculated growth medium supplemented
with the same amount of N-AHSL.
3. Transfer 5 μL aliquots of the bacterial suspensions to a 96-well
microtiter plate containing 200 μL of solidified,
pH = 6.5-buffered LB agar (16 g/L) medium. Kill the bacteria
by UV irradiation by placing the microtiter plates upside-down
on a transilluminator for 10 min.
4. Overlay the wells with 10 μL of an overnight culture of the
reporter strain Chromobacterium violaceum CV026.
5. Monitor violacein (purple pigment) production after 24 h of
incubation at 28 °C.
6. Wells in which no violacein production occurs are indicative of
putative positive N-AHSL degrading clones/strains (Fig. 2).
ATTENTION: The lack of violacein production may also
reflect other activities due to molecules inhibiting the growth
of the sensor, or inhibiting the recognition of the N-AHSLs by
the sensor. Thus, the ability of the positive clones to effectively
degrade the N-AHSLs needs to be confirmed by separating the
degradation products by TLC (see Subheading 3.4).
Screening for N-AHSL-Based-Signaling Interfering Enzymes 277
3.2.2 Screen of Mixed 1. Dilute the total library in the appropriate volume of
Pools of Clones pH = 6.5-buffered liquid LB supplemented with 12.5 mg/L of
chloramphenicol, to reach ca. 50 cells per 150 μL.
2. Transfer 150 μL of this bacterial suspension in the wells of
microtiter plates. Thus, each well will have a set of 50 cells. At
this step it is important to know the number of independent
clones present in your library, since it will determine the num-
ber of microtiter plates that you will have to set up to test all
clones (see Note 5).
3. Grow the bacterial clones for 24 h at 37 °C.
4. From this step, the test of mixed pools is essentially the same as
that described above for individual clones with an adaptation
of volumes and incubation times.
5. Add 50 μL of pH = 6.5-buffered LB supplemented 100 μM the
appropriate N-ASHL, to obtain a final concentration of
25 μM. Incubate for up to 2 days at 25 °C (see Note 4). Since
N-AHSL may be spontaneously degraded in buffered LB
medium over long incubation period or by the library host E.
coli, it is important to include: (1) a spontaneous degradation
control, which consists of a non inoculated growth medium
supplemented with the same amount of N-AHSL; and (2) a
well inoculated with E. coli with an empty vector.
6. Proceed as in steps 3–6 of Subheading 3.1. Important:
Remember to keep the microtiter plates containing the pools
incubated in LB supplemented 25 μM N-ASHL at 4 °C to
stop E. coli development until biosensor revelation, since it will
be the source for the purification of the positive clones.
7. Wells in which no violacein production occurs are indicative of
putative positive N-AHSL degrading pool. As it results from
the activity of a mix of clones, the active clones need to be
identified and isolated.
278 Stéphane Uroz and Phil M. Oger
3.3 N-AHSL Positive wells in the microplate assay group bacterial strains or
Lactonase and Acylase clones capable of N-AHSL degradation as well as strains/clones
Activity Screen/N- with sensor interfering abilities. To detect the fraction of N-AHSL
AHSL Degradation degraders, N-AHSLs and putative inhibitory molecules present in
Confirmation Test the growth medium are separated by thin layer chromatography,
and detected using the QS sensor. Only clones with N-AHSL deg-
radation abilities will fail to induce the QS sensor in both assays
(For the detection of false-positive clones, proceed directly to
Subheading 3.3.2, step 10).
The same approach is used to differentiate clones harboring
lactonase and amidohydrolase activities. Lactonolysis of N-AHSLs
yields N-acyl homoserine (Fig. 1). This reaction is reversible under
low pH, and the N-AHSL molecule can thus be regenerated [12,
18]. On the contrary, the amidohydrolysis is irreversible. This
divergence is exploited in a test to quickly differentiate lactonases
from acylases in which one runs side by side on a TLC plate the
products of a N-AHSL degradation reaction and a subsample acid-
ified to induce lactonization (Fig. 3).
3.4 Identification 1. N-AHSL degradation reactions are set as described above for
of N-AHSL Lactonase the TLC plate assay, except that one should use 50 μL of a
Activities by HPLC-MS 1 mM N-AHSL solution, stop the complete reaction after the
appropriate incubation time and dissolve the reaction in 50 μL
of ethyl acetate (see Note 8).
2. Inject 10 μL of the reaction mixture into the HPLC system.
3. Elution: Water/formic acid 0.1 % (solvent A) and acetonitrile/
formic acid 0.1 % (solvent B) under the following elution
sequence: 100 % A 5 min; linear gradient 100 % A 0 % B to
reach 80 % A and 20 % B 5 min; 80 % A and 20 % B 10 min.
Between two samples, the column is rinsed by applying a linear
gradient to reach 100 % B (2 min), and 100 % B (3 min).
Column is then re-equilibrated with 100 % A for 7 min at a
flow rate of 2 mL/min (see Note 16).
4. Under our experimental conditions, the C6-HS and C6-HSL
harbors retention times of 15.81 and 21.00 min respectively
(Fig. 4). Retention times and mass spectra for individual stan-
dard molecules in solution need to be obtained in the same
conditions. Degradation of the N-AHSL is evidenced by the
reduction of the surface of the N-AHSL characteristic peak
and concomitant increase in the surface of the N-AHS peak.
282 Stéphane Uroz and Phil M. Oger
4 Notes
5. This step involves being able to know (1) the exact number of
individual clones forming the library (titration) and (2) the
number of colony forming unit of the library (cell density).
For classical soil metagenomic libraries, titration of 105
clones is obtained. If the library considered is not subculti-
vated, the number of clones is equivalent to the number of
cfu. In this case, dilute the original library in a volume of LB
to obtain 333 cfu per mL (equivalent to 50 cfu in 150 μL of
culture medium). It is our experience that pools of 50 cfu
give the best compromise between the cost and time reduc-
tion due to pooling and the reproducibility of the detection
of N-AHSL degradation. If the library considered has been
subcultivated, then the number of cfu will be higher than the
actual tiration of the library. The number of microtiter plate
wells to inoculate to test the library is calculated by dividing
the titration by 50. Each well is inoculated as described
above with 150 μL a 333 cells/mL dilution of the library.
Thus, in both cases, the test of 105 clones will require ca.
300 mL of a suspension of 50 cfu/mL and ten 96-well
microtiter plates. It is essential for the success of this approach
that the number of cells inoculated in each well is around 50.
If a higher number of clones is used, the degradation may fail
due to the dilution of the positive clones. Furthermore, it
may become difficult to recover individual clones from the
pools.
6. The procedure to follow to assay for “false-positives” isolated
in the microplate assay is essentially the same except that one
just needs to run the original degradation reaction after
extraction with 1 volume of ethyl acetate. Then proceed
directly to step 10.
7. It is recommended to evaporate the N-AHSLs under a flux of
nitrogen to avoid chemical alteration.
8. The same procedure can be followed with CCE or purified
N-AHSL lactonases.
9. Incubation times and buffer conditions may have to be adapted
to reflect these systems.
10. Sensor systems will differ from one sensor to the other.
Reference concentrations for each N-AHSL can be found for
the Agrobacterium and Chromobacterium sensor system in
[19] and [15], respectively.
11. The TLC plate assay is easily adaptable to other sensor systems.
To use it with the Chromobacterium violaceum sensor CV026
proceed as noted above with the following modifications. The
sensor culture is a 5 mL culture of CV026 grown overnight at
30 °C. The overlay is composed of LB soft (7 g/L) agar
(150 mL) to which the sensor culture is added.
Screening for N-AHSL-Based-Signaling Interfering Enzymes 285
References
1. Winans SC, Bassler BL (2002) Mob psychol- 5. Rasmussen TB, Givskov M (2006) Quorum
ogy. J Bacteriol 184:873–883 sensing inhibitors: a bargain of effects.
2. Reading NC, Sperandio V (2006) Quorum Microbiology 152:895–904
sensing: the many languages of bacteria. FEMS 6. Uroz S, Dessaux Y, Oger P (2009) Quorum
Microbiol Lett 254:1–11 sensing and quorum quenching: the yin and
3. Hassett DJ, Ma JF, Elkins JG, McDermott TR, yang of bacterial communication. Chem
Ochsner UA, West SE et al (1999) Quorum sens- biochem 10:205–216
ing in Pseudomonas aeruginosa controls expres- 7. Dong YH, Xu JL, Li XZ, Zhang LH (2000)
sion of catalase and superoxide dismutase genes AiiA, an enzyme that inactivates the acylho-
and mediates biofilm susceptibility to hydrogen moserine lactone quorum- sensing signal and
peroxide. Mol Microbiol 34:1082–1093 attenuates the virulence of Erwinia carotov-
4. Beck von Bodman S, Farrand SK (1995) ora. Proc Natl Acad Sci U S A 97:3526–
Capsular polysaccharide biosynthesis and 3531
pathogenicity in Erwinia stewartii require 8. Tannières M, Beury-Cirou A, Vigouroux A,
induction by an N-acylhomoserine lactone Mondy S, Pellissier F, Dessaux Y et al (2013) A
autoinducer. J Bacteriol 177:5000–5008 metagenomic study highlights phylogenetic
286 Stéphane Uroz and Phil M. Oger
Abstract
The advent of metagenomics based biodiscovery has provided researchers with previously unforeseen
access to the rich tapestry of natural bioactivity that exists in the biosphere. Unhindered by the “culturable
bottleneck” that has severely limited the translation of the genetic potential that undoubtedly exists in
nature, metagenomics nonetheless requires ongoing technological developments to maximize its efficacy
and applicability to the discovery of new chemical entities.
Here we describe methodologies for the detection and isolation of quorum sensing (QS) signal mol-
ecules from metagenomics libraries. QS signals have already shown considerable potential for the activa-
tion and “awakening” of biosynthetic gene clusters, bridging the existing divide between the natural
product repertoire and the natural biosynthetic biodiversity hinted at by nature’s blueprint. The QS pipe-
line from high-throughput robotics to functional screening and hit isolation is detailed, highlighting the
multidisciplinary nature of progressive biodiscovery programs.
Key words Metagenomics, Quorum sensing signals, Secondary metabolites, High throughput,
Biosensors, Natural product biodiscovery
1 Introduction
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_19, © Springer Science+Business Media LLC 2017
287
288 F. Jerry Reen et al.
2 Materials
Prepare the agar or broth medium using distilled water. The quorum
sensing biosensor strains are stored long-term at −80 °C. AHLs are
dissolved in DMSO or methanol, while AHQs are dissolved in
methanol alone. 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside
(X-gal) is dissolved in dimethylformamide (DMF). Antibiotics are
dissolved in their corresponding solvents. All biological and chemi-
cal waste is disposed of properly, following the appropriate waste
disposal regulations. The materials described below are sufficient
to perform the tasks required to identify, extract, and validate QS
signals from metagenomic libraries.
2.2 Quorum Sensing 1. Short chain AHL detection: Biosensor reporter strain Serratia
Biosensor Strains marcescens SP19 readily maintained at 30 °C on LB agar (see
Note 1) [14].
2.
Medium chain AHLs: Biosensor reporter strain
Chromobacterium violaceum CV026 (see Note 2) [15].
Maintained as above.
3. Long chain AHLs: Biosensor strain Agrobacterium tumefa-
ciens NTL4 (see Note 3) [16]. X-gal (40 μg/mL) and genta-
micin (Gm, 30 μg/mL) are added to the media post-autoclave.
Maintained as above.
4. AHQs: Pseudomonas aeruginosa pqsA− mutant carrying a pqsA-
lacZ promoter fusion (see Note 4) [17]. This strain is maintained
on LB supplemented with carbenicillin (Cb 200 μg/mL).
5. 90 mm petri dishes with 20 mL of LB agar for maintenance of
biosensors (Gm used to maintain A. tumefaciens NTL4 and
Cb used to maintain P. aeruginosa pqsA−).
2.3 High-Throughput 1. QPix 400 series colony picking robot (Molecular Devices,
Robotic Platform UK). The QPix robot can be mounted with different picking
for Screening heads (96 and 384).
2. 96- and 384-well plates compatible with the QPix system.
3. LB freezing medium: 36 mM K2HPO4 (anhydrous), 13.2 mM
KH2PO4, 1.7 mM sodium citrate, 0.4 mM MgSO4, 6.8 mM
290 F. Jerry Reen et al.
3 Methods
3.1 Screening Classical screening strategies have not delivered the full potential
of Metagenomic of the natural environment. The advent of high-throughput
Library for QS Active robotic screening capacity and smarter more selective screening
Clones methodologies has underpinned a new wave of hit-discovery. Here
we describe the screening methodology for isolation of AHL and
AHQ like signal molecules from metagenomics libraries. The
screening protocols described here, using multiple biosensors, are
specifically designed to capture a broad spectrum of signals from
the same library. For example, detection of short, medium, and
long chain AHLs requires the use of three distinct biosensors, each
with their own requirements and limits of detection. The protocols
described below are broadly applicable to all the biosensors. Where
differences exist, biosensor-specific requirements are included as
appropriate. The necessary components needed to successfully
complete the analysis are described in Subheadings 2.1–2.3.
292 F. Jerry Reen et al.
3a. Transform
into E. coli
1. Isolate
sponge DNA
QS Active
QS Inactive
6. Soft-top agar
overlay with QQ
biosensor
5. High-throughput grid of
7. Validate for QS
libraries onto Q-Tray
activity
Fig. 1 Overview of the metagenomics mining process for QS activity. Isolation of good quality DNA precedes
cloning into suitable expression systems and transformation into a compatible heterologous host. Robotics
mediated high-throughput screening on Q-Tray plates facilitates the identification of QS active clones, depend-
ing on the biosensor strain used
3.2 Extraction While the exact composition of solvents used in extraction meth-
and Validation of QS odologies for QS signals can vary considerably, they follow the
Active Compounds general principal of using acidified organic solvents to separate
compounds of interest from the aqueous phase. In general, ethyl
acetate is the solvent of choice, with acidification achieved using
formic or acetic acid at concentrations ranging from 0.01 to 1 %.
We routinely use 1 % acetic acid acidification for both AHL and
AHQ extractions but have also found formic acid to be efficient.
Furthermore, buffering the LB with for example 50 mM
3-[N-morpholino] propanesulfonic acid (MOPS) at pH 6.5 can
help prevent spontaneous lactonolysis of AHLs. The materials
required for successful extraction and validation are listed in
Subheading 2.4.
1. 500 mL sterile flasks with 100 mL LB broth supplemented
with the required antibiotic, are inoculated with the positive
clones at an OD600nm of 0.05 and grown for 24 h at 37 °C.
2. Cultures are centrifuged at 10,000 rpm (15,180 × g) for 10 min
at room temperature after which the supernatant is recovered
and filter-
sterilized using a vacuum filter system (pore size
0.22 μm) to achieve cell-free status.
294 F. Jerry Reen et al.
QS active control
QS active clone
pellet
EtOAc
TLC and HPLC
TLC Profiling
CFS
QS Active
Isolate
Fig. 2 Validation of QS activity. Individual clones are cultured overnight and fractioned into pellet and CFS
following filtration through a 0.2 μm membrane filter. CFS is added to agar wells in a plate swabbed with QS
biosensors. QS-active CFS is subsequently extracted and spotted on a TLC plate and visualized either by
biosensor overlay or UV illumination
3.3 HPLC At this stage of the process, QS active extracts will have been con-
Identification of QS firmed and are ready for identification. This is generally achieved
Compounds using HPLC-MS with standards available for AHL and AHQ dis-
covery. As with the extraction protocols, several independent
methodologies for the identification of QS molecules by HPLC
have been described [18–20]. Materials are listed in Subheading 2.5.
3.3.1 HPLC Detection 1. All the extracts from the positive clones are resuspended in
of AHLs 1 mL of methanol for AHL identification by HPLC. Aliquots
(50 μL) of 10−1 and 10−2 dilutions from active extracts are
loaded into HPLC glass vials. AHL standards are prepared as
follows: using a 100 μM stock, dilute to 10, 100, and 500 nM
in methanol and transfer 50 μL to HPLC glass vials [18].
2. AHLs are separated at 30 °C with a flow rate of 0.2 mL/min,
using a gradient solvent system as mobile phase with increas-
ing methanol concentration and with the effluent flowing
directly into the mass spectrometer (mobile phase solvents:
methanol and H2O containing 0.2 % (v/v) glacial acetic acid).
The gradient is increased linearly from 40 % (v/v) metha-
nol–60 % (v/v) water–acetic acid to 80 % (v/v) methanol–20 %
(v/v) water–acetic acid over 25 min.
3. AHLs are identified by comparison of the retention times and
m/z values from extracts with those obtained for the standard
AHLs.
3.3.2 HPLC Detection 1. Transfer AHQ active extracts in acidified methanol (200 μL)
of AHQs into HPLC glass vials. Prepare AHQ standards as follows:
using a 10 mM stock, dilute to 1, 10, 100, and 500 μM in
acidified methanol (final volume 200 μL), and transfer to
HPLC vials.
2. Standards (50 μL) are injected on the system, followed by a
mobile phase wash, and finally injection of the test samples. A
workflow of 60 % acidified methanol for 10 min, ramp up to
100 % in 5 min, hold at 100 % for 5 min, drop to 60 % in 1 min,
and hold at 60 % for 3 min, has been previously reported [21].
296 F. Jerry Reen et al.
3.4 Experimental The final stage of the QS signal validation and characterization
Validation of AHL involves the use of model pathogen strains such as P. aeruginosa,
Compounds in a Model which encodes both AHL and AHQ based QS systems. The auto-
Pathogen System inducing LasIR and RhlIR systems are activated by long and short
chain AHLs, respectively. Therefore, extracted AHLs identified
from the metagenomic library would be expected to enhance tran-
scription of the respective AHL receptor genes lasR and rhlR. It is
important to note that LasIR is activated early in the exponential
growth phase while RhlIR is associated with entry to stationary
phase. Therefore, it is crucial that kinetic experiments are employed
to monitor changes in expression over time. Furthermore, P. aeru-
ginosa is a Class II pathogen, therefore requiring certified clearance
before use. Where this is not feasible, AHL encoding Class I model
systems such as Vibrio fischeri can be used. All relevant materials
required for this analysis are listed in Subheading 2.6.
1. P. aeruginosa carrying a lasR- or rhlR-lacZ promoter fusion
(e.g., pMP220 or pMP190) is inoculated into LB media
supplemented with the appropriate antibiotic and grown over-
night at 37 °C at 150 rpm.
2. The culture is inoculated into 18 mL of fresh LB media
(supplemented with antibiotic) at OD600nm 0.05 in a 100 mL
conical flask.
3. Extract or supernatant from the AHL positive clone is added
to the inoculated conical flask (starting with 2 mL in 20 mL).
4. Each conical is placed on a 37 °C incubating shaker and growth
is monitored into stationary phase. At 2 h periods, samples are
removed for OD600nm analysis (from 500 μL to 1 mL) from
which 20 μL is added to a 1.5 mL microcentrifuge tube and
stored in 80 μL of permeabilization solution at 4 °C for
β-galactosidase analysis.
5. Once all samples have been collected, tubes are incubated at
30 °C on a heating block in a fume hood for 30 min.
Meanwhile, ONPG and β-mercaptoethanol are added to sub-
strate solution in a fresh container and incubated at 30 °C
immediately prior to use.
6. Substrate solution (600 μL) is added to the incubated tubes in
the heating block (Time 0) and the formation of a yellow color
is monitored carefully over time. Upon the emergence of a yel-
low color, stop solution (700 μL) is added to the tubes and the
time recorded.
Mining Microbial Signals for Biodiscovery of Secondary Metabolites 297
4 Notes
the robot pins and the plate has to be calibrated to ensure the
pins touch but do not penetrate the surface of the agar. Where
this occurs, growth will be limited and phenotypes are not eas-
ily scorable if at all. Therefore, agar should be topped to the
glass rim of the 250 mL bottle prior to pouring into a Q-Tray
plate that has been levelled using a spirit-level or other measuring
device.
8. LB media is suitable for the majority of heterologous hosts
currently used to carry and express metagenomic libraries. As
such, it is compatible with the use of LB soft top agar overlays.
As advances are made in the development of heterologous
hosts, other media requirements for growth of the library may
lead to incompatibility issues with the biosensor overlays. In
this case, efforts need to be made to find a common media
composition to support the growth of both metagenomic
clones and the biosensor.
9. A positive QS clone is that which display a colored ring around
the colony. The ring color will depend on the AHLs produc-
tion of the determined clone. Red color for the production of
short chain AHLs, purple color for the production of medium
chain AHLs, and blue color for the production of long chain
AHLs.
10. The volume added must not exceed 80 % of the capacity of
the well. Leakage over the wall of the well onto the surface of the
agar will typically inhibit QS induction of the surrounding cells
and thus interfere with the assay creating false negatives.
11. A teaspoon of anhydrous magnesium sulfate (MgSO4) can be
added to the recovered organic phase to remove excess water
in the sample. The presence of water in the organic phase can
generate problems downstream when the sample is undergo-
ing evaporation, in addition to allowing possible carryover of
unwanted material. Once the magnesium sulfate has been
added, mix well, and allow to settle for 2 min. The organic
phase is then recovered into a new receptacle avoiding the pre-
cipitate formed by the magnesium sulfate and water. Normally
after this treatment the organic phase should be clarified.
Acknowledgments
References
1. Milshteyn A, Schneider JS, Brady SF (2014) cluster and a novel phenomycin-like locus in
Mining the metabiome: identifying novel natu- the plant pathogen, Pectobacterium carotovo-
ral products from microbial communities. rum. Environ Microbiol 12:1811–1827
Chem Biol 21:1211–1223
12. Bassler BL (2002) Small talk. Cell-to-cell
2. Reen FJ, Gutierrez-Barranquero JA, Dobson communication in bacteria. Cell 109:
ADW, Adams C, O'Gara F (2015) Emerging 421–424
concepts promising new horizons for marine 13. Diggle SP, Matthijs S, Wright VJ, Fletcher MP,
biodiscovery and synthetic biology. Mar Drugs Chhabra SR, Lamont IL et al (2007) The
13:2924–2954 Pseudomonas aeruginosa 4-quinolone signal
3. Machado H, Sonnenschein EC, Melchiorsen J, molecules HHQ and PQS play multifunctional
Gram L (2015) Genome mining reveals roles in quorum sensing and iron entrapment.
unlocked bioactive potential of marine Gram- Chem Biol 14:87–96
negative bacteria. BMC Genomics 16:158 14. Poulter S, Carlton TM, Su X, Spring DR,
4. Reen FJ, Romano S, Dobson ADW, O'Gara F Salmond GP (2010) Engineering of new
(2015) The sound of silence: activating silent prodigiosin- based biosensors of Serratia for
biosynthetic gene clusters in marine microor- facile detection of short-chain N-acyl homoser-
ganisms. Mar Drugs 13:4754–4783 ine lactone quorum-sensing molecules.
5. Rutledge PJ, Challis GL (2015) Discovery of Environ Microbiol Rep 2:322–328
microbial natural products by activation of 15. McClean KH, Winson MK, Fish L, Taylor A,
silent biosynthetic gene clusters. Nat Rev Chhabra SR, Camara M et al (1997) Quorum
Microbiol 13:509–523 sensing and Chromobacterium violaceum:
6. Gaudêncio SP, Pereiraa F (2015) Dereplication: exploitation of violacein production and inhi-
racing to speed up the natural products discov- bition for the detection of N-acylhomoserine
ery process. Nat Prod Rep 32:779–810 lactones. Microbiology 143:3703–3711
7. Patridge E, Gareiss P, Kinch MS, Hoyer D 16. Farrand SK, Hwang I, Cook DM (1996) The
(2015) An analysis of FDA-approved drugs: tra region of the nopaline-type Ti plasmid is a
natural products and their derivatives. Drug chimera with elements related to the transfer
Discov Today 21:204–207 systems of RSF1010, RP4, and F. J Bacteriol
8. Cooper MA, Shlaes D (2011) Fix the antibiot- 178:4233–4247
ics pipeline. Nature 472:32 17. McGrath S, Wade DS, Pesci EC (2004)
9. Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Dueling quorum sensing systems in
Spencer J et al (2016) Emergence of plasmid- Pseudomonas aeruginosa control the produc-
mediated colistin resistance mechanism tion of the Pseudomonas quinolone signal
MCR-1 in animals and human beings in China: (PQS). FEMS Microbiol Lett 230:27–34
a microbiological and molecular biological 18. Nievas F, Bogino P, Sorroche F, Giordano W
study. Lancet Infect Dis 16:61–168 (2012) Detection, characterization, and bio-
10. Brakhage AA, Schuemann J, Bergmann S, logical effect of quorum-sensing signaling mol-
Scherlach K, Schroeckh V, Hertweck C (2008) ecules in peanut-nodulating Bradyrhizobia.
Activation of fungal silent gene clusters: a new Sensors 12:2851–2873
avenue to drug discovery. Prog Drug Res 19. Rasch M, Andersen JB, Fog Nielsen K,
66:1–12 Flodgaard LR, Christensen H, Givskov M et al
11. Williamson NR, Commander PM, Salmond GP (2005) Involvement of bacterial quorum-
(2010) Quorum sensing-controlled Evr regu- sensing signals in spoilage of bean sprouts.
lates a conserved cryptic pigment biosynthetic Appl Environ Microbiol 71:3321–3330
300 F. Jerry Reen et al.
20. Lade H, Paul D, Kweon JH (2014) Isolation 21. Palmer GC, Schertzer JW, Mashburn-Warren
and molecular characterization of biofouling L, Whiteley M (2011) Quantifying
bacteria and profiling of quorum sensing signal Pseudomonas aeruginosa quinolones and exam-
molecules from membrane bioreactor activated ining their interactions with lipids. Methods
sludge. Int J Mol Sci 15:2255–2273 Mol Biol 692:207–217
ERRATUM TO
Erratum to: Chapter 8 in Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology,
vol. 1539, DOI 10.1007/978-1-4939-6691-2_8, © Springer Science+Business Media LLC 2017
In the original version of this chapter the name of the third author was misspelled. The
name should read Andriy Luzhetskyy
The updated original online version for this chapter can be found at
DOI 10.1007/978-1-4939-6691-2_8
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2_20, © Springer Science+Business Media LLC 2017
E1
INDEX
Wolfgang R. Streit and Rolf Daniel (eds.), Metagenomics: Methods and Protocols, Methods in Molecular Biology, vol. 1539,
DOI 10.1007/978-1-4939-6691-2, © Springer Science+Business Media LLC 2017
301
METAGENOMICS: METHODS AND PROTOCOLS
302 Index
F M
Fermentation ............... 99–110, 114, 115, 117–122, 124–140 Marine metagenomes .............. 23–27, 29, 31, 32, 34–39, 101
Flavonoid.......................................................... 226, 230–233 Marine microorganisms...................................................... 23
Fosmid .........................2–4, 8–10, 24, 26, 31, 33–39, 49, 221, Marker gene studies...................................................... 13–21
223–227, 251, 253, 255, 258, 262–264, 266–269, 292 META. See Metagenome extract thin-layer chromatography
Fosmid libraries ..................... 2–4, 8–10, 26, 31, 33, 262–264 analysis (META)
Functional expression ...............................126, 159–162, 164, Metagenome ..................................... 1, 34, 36, 44, 47, 49,
167, 169–189, 191–193 52–53, 58, 62, 68, 86, 88, 89, 91–94, 146, 147, 149,
Function-based screen ................................... 33–38, 58, 100, 151, 154, 156, 160, 178, 179, 205, 206, 208, 210,
160, 250–255, 257 220, 221, 231, 234, 258
Function-driven screening ................................................ 258 Metagenome extract thin-layer chromatography analysis
Fungal diversity ............................................................ 75–83 (META) ............................................................... 231
Metagenomic DNA ............................. 2, 5–6, 8, 10, 11, 24,
G 29, 34, 38, 39, 48, 50, 52, 58, 62, 99–110, 114, 115,
GC content .................................................. 91, 93, 100, 220 117–122, 124–140, 159–162, 164, 167, 169–189,
Genome ..................... 4, 24, 34, 48, 58, 59, 68, 86, 88–94, 100, 191–193, 220, 221, 251–252, 254–255, 264, 266
108, 115, 145, 146, 154, 160, 161, 176, 177, 182, 189 Metagenomic library ..................................... 1–11, 25, 26, 31,
GFP. See Green fluorescent protein (GFP) 34–38, 43–54, 59, 71, 100, 160, 166, 170–177, 199,
β-Glucosidase ................................................... 207, 221, 227 200, 202, 205–215, 219–227, 230, 232, 238, 241, 242,
Glycosyl hydrolases........................................................... 207 244–246, 249–259, 261–269, 273, 275, 284, 288, 289,
Glycosyltransferase ..................................... 94, 229–233, 235 291–293, 296
Green fluorescent protein (GFP) ..................................... 164 Metagenomics ................................................... 1, 24, 44, 58,
81, 87, 99, 145, 159, 197, 205, 219, 229, 237, 250,
H 262, 273, 287
Metatranscriptomics ..................................................... 59, 61
Heterologous gene expression .................................. 250, 255
Microbial community ................................. 13, 23, 24, 28, 44,
High-throughput......................................45, 52, 58–72, 146,
47, 58, 60, 61, 67, 68, 87–89, 145, 159, 209–210, 237,
160, 198, 201, 219–227, 229, 288–292
238, 240–246
High-throughput assay ............................................. 198, 201
Microbial community gene libraries ........................... 44, 209
High-throughput screening...........160, 219–227, 229, 288, 292
Microbial diversity ................................................. 31, 34, 52,
Host-range .......................................... 49, 160, 164, 167, 180
58, 159, 219
Hydrogen uptake .............................................. 264, 266–269
Microbial functions ............................................................ 13
Hydrogenase ............................................. 261–264, 266–269
Microtiter plate......................................... 10, 26, 33, 35, 197,
Hydrolase ......................................................................... 210
199–201, 203, 232, 262, 266, 267, 269, 276–278, 284
Hydrolytic enzyme ................................... 197, 199–201, 203
Multiplex screening .................................................. 219–227
I
N
Indicator plate .......................................................... 177, 215
N-acyl homoserine lactone ............................................... 271
Inducible promoter ..................................... 35, 123, 124, 164
N-AHSL acylase ...................................................... 282–283
In silico ........................................................................ 86, 100
N-AHSL amidohydrolase ........................................ 273, 282
Integrative vectors .................................................... 110, 114
N-AHSL lactonase................................... 273, 278–282, 284
Ionic liquid ....................................................... 206, 212, 215
Natural product biodiscovery..................................... 24, 159,
Isolation of metagenomic DNA ............. 25, 28–29, 171–173
287, 288
L Network reconstruction ............................ 145–147, 150–154
Next generation sequencing (NGS) ...................... 29, 34, 52,
Labeled DNA ................................................... 59, 63, 65–67 76, 87, 90, 146, 227
Lactonase................................... 272, 273, 275, 278–282, 284 NGS. See Next generation sequencing
Lambda .......................................................8, 9, 32, 240, 241 Nitrogenase ................................................................ 31, 189
Large-insert library............................................................... 2
Lignocellulosic enzymes ........................................... 219–227 O
Lipase ............................................ 35, 52, 161, 182, 197, 198
Oxidase..................................................................... 272, 285
Liquid-phase screening ............................................ 220, 221
METAGENOMICS: METHODS AND PROTOCOLS
Index
303