0% found this document useful (0 votes)
894 views164 pages

PCR Technologies: A Technical Guide

1

Uploaded by

botond77
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
894 views164 pages

PCR Technologies: A Technical Guide

1

Uploaded by

botond77
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

A Technical Guide

PCR TECHNOLOGIES
• PCR
• RT-PCR

• qPCR

• RT-qPCR

• dPCR
Foreword
The introduction of the Polymerase Chain Reaction (PCR) This guide contains the material presented during technical
has revolutionized identification and measurement of DNA workshops and therefore covers the questions that are often
sequences and RNA when used in conjunction with reverse raised, and answers the questions we encounter on a day-
transcription. The technique has become ubiquitous across to-day basis when offering technical support. This guide is
all fields of life science and has been adapted to provide presented as a complete solution to those working with PCR-
quantitative analysis (qPCR) and more recently copy number based techniques.
determinations (dPCR). All of these PCR-based techniques are
conceptually and practically simple to implement and, with Editor
appropriate controls, yield highly informative data. However, Tania Nolan, Ph.D.
the vast quantity of information flooding both the peer
reviewed and popular literature, is daunting to those wishing Contributors
to embark on a PCR experiment or adopt a new technique. Anders Bergkvist, Ph.D.
The situation is made more difficult by conflicting advice Carol Carvallo, M.S.
and recommendations. During the preparation of the MIQE Peter H. Chereson, Ph.D.
recommendations1, a publication dedicated to clarifying the Laura Daley, Ph.D.
information required for a qPCR experiment to be evaluated, Ashley Heath, Ph.D.
and the subsequent evaluation of peer reviewed papers Suzanne Hibbs, M.S.
relying on qPCR data2, it became clear that there was a Stacey Hoge, B.S.
desperate need for detailed guidance on the essentials of how Elena Jouravlena, Ph.D.
to carry out PCR techniques and why particular practices may Carol Kreader, Ph.D.
be recommended under specific circumstances. This guide Mudassir Mohammed, Ph.D.
has been written to address that need. Ernie Mueller, Ph.D.
While there are many excellent textbooks and guides available, Genova Richardson, M.S.
this is a unique offering in that it provides detailed technical Tom Russell, Ph.D.
explanations and protocols for PCR and RT-PCR techniques, Brian Ward, Ph.D.
including specific information relevant to qPCR and digital Scott A. Weber, B.S.
PCR. Many popular myths have been addressed and a detailed Marina Wiklander, Ph.D.
troubleshooting guide provided that includes training on the References
appropriate use of controls and how to apply this information 1. Bustin, S.A., Benes, V., Garson J.A., et al. The MIQE guidelines: minimum
to any experiment. It is clear from the requests for support that information for publication of quantitative real-time PCR experiments.
we receive, that data analysis is a bottleneck in the scientific Clin Chem 2009, 55, 611-622.
process and so this is also addressed in a separate chapter. 2. Bustin, S.A., Benes, V., Garson J., et al. The need for transparency and good
practices in the qPCR literature. Nat Methods 2013, 10, 1063-1067.
Table of Contents

Table of Contents
Chapter 1: Introduction and Historical Timelines Chapter 8: Reverse Transcription
Introduction 3 Introduction 53
Historical Timelines 3 Reverse Transcription Linearity 53
Reverse Transcription Priming 54
Chapter 2: Polymerase Chain Reaction Reverse Transcription Efficiency 55
Cycling Procedure 7
PCR Assay Components 9 Chapter 9: Assay Optimization and Validation
Instruments 9 Introduction 59
Application-specific PCR Modifications 10 Validating Primer Design 59
Optimizing Probe Concentration 63
Chapter 3: Quantitative PCR Optimizing Reaction Components and Multiplex Assays 63
Basic Principles 11 Optimizing Mg2+ Concentration 63
Quantification and Analysis of gDNA Targets 14 Probe Fluorophore and Quencher Selection 63
Quantification and Analysis of mRNA Transcripts 14 Guidelines for Optimization of Quantitative Reverse
Quantification and Analysis of ncRNA Transcripts 14 Transcription PCR (RT-qPCR) 64
qPCR Requirements 15 Assay Evaluation 65
The MIQE Guidelines 16
Chapter 10: Data Analysis
Chapter 4: Digital PCR PCR/qPCR Qualitative Analysis 69
Instruments 20 qPCR Data Analysis 69
Instrument Limitations 21 Deriving Accurate Cq Values 69
dPCR Applications 22 Setting the Threshold 70
Digital PCR MIQE 23 qPCR Quantification Strategies 73
Standard Curve Quantification 73
Chapter 5: Quantitative PCR and Digital PCR Detection Methods Relative/Comparative Quantification 73
Introduction 25 Normalization 74
dsDNA-Binding Dyes 25 Reference Gene Selection 75
Probes 26 Analysis of Reference Gene Stability 76
Quenchers 28 Alternative Normalization Methods 78
Nucleic Acid Analogs 29 Statistical Analysis and Data Visualization 80
Summary 30 Statistical Tests 80
Chapter 6: PCR/qPCR/dPCR Assay Design Visualization Techniques for Univariate Analysis 81
Hierarchical Clustering 82
Introduction 31
Principal Component Analysis 83
Amplicon Selection 31
Methylation-specific Assays 33 Chapter 11: Troubleshooting
Primer Design 33 Developing a Troubleshooting Protocol 85
Probe Design 36 Troubleshooting Examples Demonstrating the Use of the
Oligo Synthesis and Handling 38 Diagnostic Tools 88
Oligonucleotide Purification 38 Troubleshooting Case Studies 98
Oligonucleotide Preparation 39 Summary—A Troubleshooting Protocol 99
Chapter 7: Sample Purification and Quality Assessment Chapter 12: Regulatory Agencies and Conclusions
Introduction 41 Regulatory Landscape Overview 101
Nucleic Acid Purification 41 Assay Validation 102
Chaotropic Agents 41 Approved Tests 103
Extraction of Genomic DNA 41 Conclusions 103
Purification of Total RNA 42 Next-generation Sequencing 105
Nucleic Acid Sample Quality Assessment 43 Additional Technical Support 105
Gel Electrophoresis and Capillary Nucleic Acid Quality Analysis Systems 45
Contamination 48
Inhibition 49
An Integrated Example: Analysis of RNA Sample Quality 49

PCR Technologies: A Technical Guide 1




Appendix A: Protocols Optimization of qPCR Conditions


Introduction 107 Protocol 13: Primer Concentration Optimization 137
Protocol 1: OligoArchitect Assay Design 110 Protocol 14: Primer Optimization Using Temperature Gradient 139
Protocol 15: qPCR Reference Gene Selection 141
End-point PCR Protocols Protocol 16: qPCR Efficiency Determination 143
Protocol 2: Antibody–Enzyme Mediated Hot Start PCR 116 Protocol 17: qPCR Gene Expression/Copy Number Analysis Using
Protocol 3: dNTP-Mediated Hot Start PCR 118 SYBR Green I Dye Detection 145
Protocol 18: qPCR Gene Expression/Copy Number/SNP Analysis
Quantitative PCR Protocols
Using Probe Detection 147
Protocol 4: SYBR Green I Dye Quantitative PCR 121
Protocol References 149
Protocol 5: qPCR Using a Single Detection Probe 124
Protocol 6: Multiplex qPCR 126 Appendix B: Additional Resources
Protocol 7: dPCR 128 Books, Seminars and Tools 151
Protocol 8: The SPUD Assay for Detection of Assay Inhibitors 130 Products and Support 154
Protocol 9: The 3’/5’ Assay for Analysis of RNA Integrity 132 Design Your Probe Online with OligoArchitect 158
Reverse Transcription Trademarks
Protocol 10: Standard Reverse Transcription Protocol (Two-step) 134
Protocol 11: Reverse Transcription Protocol (One-step SYBR 
Green I Dye Detection) 135
Protocol 12: Reverse Transcription Protocol (One-step Probe Detection) 136

2 [Link]
Introduction and Historical Timelines

Chapter 1:
Introduction and Historical Timelines

Introduction While this passage appears to be a clear description of


the process that is now recognized as the PCR, it could
The Polymerase Chain Reaction (PCR) is used in all areas of not be verified experimentally at the time because the
biological science research, including the clinical, forensic and target sequences required for primer design were not
diagnostic fields and the widespread adoption of the PCR readily available, nor was there a convenient method for
technique has revolutionized life science research. manufacturing the synthetic PCR primer oligonucleotides.
Many improvements have been made to the basic technique Originally, when considering the process of DNA amplification,
and many adaptations have evolved, including reverse Kary Mullis, et al.,2 had assumed that when primers were added
transcription PCR (RT-PCR), quantitative real-time PCR (qPCR), to denatured DNA, they would be extended, the extension
reverse transcription qPCR (RT-qPCR) and digital PCR (dPCR). products would become unwound from their templates, be
This guide is designed for scientists with a background in primed again and then the process of extension repeated.
molecular biology and for scientists in other fields who are However, this was not the case and the DNA had to be heated
interested in learning more about PCR-based techniques. Basic almost to boiling after each round of synthesis to denature the
principles are presented and supplemented with practical newly formed, double-stranded DNA. The Klenow fragment of
examples and theoretical concepts. DNA polymerase I that was being used for synthesis was then
inactivated by the high temperature and so more enzyme was
To illustrate the theoretical concepts, protocols are provided required at the start of each cycle, as predicted by Kleppe1.
that can be used to analyze sample quality, optimize assay A critical development that led to the universal adoption of
conditions, determine assay efficiency and RT linearity. These the PCR technique was the concept of using a thermal stable
protocols can be easily adapted for all research applications. DNA polymerase that could tolerate the high temperature
of the repeated denaturation steps. The Klenow fragment
Historical Timelines of DNA polymerase I was replaced with the heat tolerant
Taq DNA polymerase3,4. When using Taq DNA polymerase,
In 1971, Kjell Kleppe and the Nobel laureate, Gobind Khorana, several rounds of amplification could be executed in a closed
published a description of a technique that represented the reaction tube without replenishing the enzyme. In addition,
basic principles of a method for nucleic acid replication: larger fragments could be amplified, the use of higher
temperature reactions was sufficient to increase replication
“… The DNA duplex would be denatured to form single strands. This
fidelity, reduce nonspecific product formation and allow the
denaturation step would be carried out in the presence of a sufficiently
large excess of the two appropriate primers. Upon cooling, one would
products to be detected directly on ethidium bromide stained,
hope to obtain two structures, each containing the full length of agarose gels5,6,7.
the template strand appropriately complexed with the primer. DNA The 1993 Nobel Prize for Chemistry was awarded jointly
polymerase will be added to complete the process of repair replication. to Michael Smith “for his fundamental contributions to
Two molecules of the original duplex should result. The whole cycle the establishment of oligonucleotide-based, site-directed
could be repeated, there being added every time a fresh dose of the
mutagenesis and its development for protein studies” and to
enzyme. It is however, possible that upon cooling after denaturation
of the DNA duplex, renaturation to form the original duplex would Kary Mullis “for his invention of the polymerase chain reaction
predominate over the template-primer complex formation. If this (PCR) method.”
tendency could not be circumvented by adjusting the concentrations At around the same time that the 1993 Nobel Prize for PCR
of the primers, clearly one would have to resort to the separation of was awarded, Higuchi, et al.,8 recognized the process of PCR
the strands and then carry out repair replication. After every cycle of could be monitored by addition of a fluorescent label that
repair replication, the process of strand separation would have to
binds to the accumulating PCR product. As the concentration
be repeated.”1
of PCR product increases, the intensity of the fluorescence
signal also increases. This discovery paved the way for modern

PCR Technologies: A Technical Guide 3


Chapter 1
quantitative real-time PCR (qPCR). In current qPCR technology, More recently, a family of small, non-coding RNA (ncRNA)
these fluorescence signals are generated by inclusion of either species, including microRNA (miRNA), has been identified.
fluorescent DNA-binding dyes or oligonucleotide probes. It is increasingly apparent that the expression profile of
Fluorescent DNA-binding dyes, such as SYBR® Green I, are miRNA molecules can be used as genetic biomarkers that are
included in the PCR buffer. When the dye is free in solution, characteristic for specific diseases. Using PCR to amplify these
it emits excess energy as vibrational energy. However, as the targets is particularly challenging because they are very small
DNA target is amplified, the dye binds to the DNA product and do not have natural polyA tails. However, there are options
and adopts an alternative conformation. This conformational for analyzing the genetic information of these molecules, such
change reduces the molecular mobility and results in the as capturing all the miRNA in a sample by adding an artificial
excess energy being emitted as fluorescence. Hence, the polyA tail and then performing selective qPCR of the target of
DNA-bound dye has a higher fluorescence than the unbound interest (see Chapter 6).
dye. An alternative approach to monitoring the reaction is
Regardless of the chosen PCR technique or application, in
to include a labeled primer in the reaction9 or, for additional
theory, a single template molecule should be replicated
specificity, an additional oligo probe is situated between the
during each PCR cycle. Assuming absolute, perfect replication
two primers. This oligo probe is labeled and in most cases,
at each cycle, this would lead to 240 or 1012 identical molecules
also quenched. Various probe options are available, but the
(amplicons) after 40 rounds of amplification. However, the
most popular are the Dual-Labeled Probe (also referred to as
actual sensitivity of any PCR-based assay is determined by
TaqMan®)10, Molecular Beacons11, Scorpions® Probes12 and
the assay design14, as described in Chapter 6, sample quality
LightCycler® Probes13 (see Chapter 5).
and the susceptibility of the assay to inhibitors, as described
The most recent qPCR development has been digital PCR in Chapter 7, and optimization, described in Chapter 9.
(dPCR) in which a sample is diluted and divided into hundreds A functioning assay requires that all of these factors be
to millions of reaction chambers. The dilution and partition considered prior to application.
must be such that each chamber contains either zero or one
Along with dynamic range, the analytical sensitivity of a
template copy and the starting concentration is estimated
PCR-based assay depends on the variability of the data. The
from the ratio of partitions with a positive signal to those with
presence of inhibitors in the sample matrix, degradation and
a negative signal. A Poisson distribution is used to quantify the
unspecific amplification of off-target products in the reaction
target copies. Since the target is diluted to a single copy, dPCR
are all potential sources of variability. If these occur randomly,
is particularly useful for applications requiring quantification
or pseudo-randomly, in the biological samples, measuring
of rare mutations amidst a high concentration of wild-type
replicates can minimize the impact of the variability on the
sequences (see Chapter 4).
end result. However, there may be cases where the variability
In addition to genomic DNA sequence analysis, it has long is not random, but systematic. In these cases, averaging of
been believed that investigating specific mRNA sequences replicates will not alleviate the problem. For both systematic
with PCR can yield essential information about the biology of and random technical errors, experimental approaches to
the cell. Studying gene quantity changes between normal and minimize the errors are preferred.
diseased tissues, or looking for changes in gene expression
In addition, to protect against uncertainties due to reaction
in response to drug treatments, is being used to understand
variability, it is important to include a series of controls
how regulation of gene expression is a part of the complex
alongside all samples in any experiment. The choice of controls
system of cellular control. Measuring mRNA requires an
and whether to include them should always depend only
additional reverse transcription (RT) step in order to convert
upon the nature of the study. Scientific integrity should be the
RNA to a DNA template that is suitable for PCR amplification.
driving factor behind all experimental design. It amounts to a
This is carried out using a reverse transcriptase enzyme and
false economy of all resources to run inadequate experiments
extension from one or more oligo primers. Priming of the
that could even result in retractions15,16. Some controls should
reverse transcription reaction may be from a sequence specific
certainly be considered obligatory and original data should
primer, from a series of random primers that hybridize along
be presented for inspection, especially when the results of
the length of the mRNA, or from a primer directed towards
the study or analysis may lead to life and death decisions17.
a tract of adenosines that are present on the 3’ end of most
Controls that are run in parallel with experimental samples
messenger RNA sequences (polyA tail). After elongation from
are widely used as verification of assay quality and during
the primer, a double-stranded hybrid of RNA and DNA, called
the troubleshooting process, as described in Chapter 11.
first-strand cDNA, is produced. This cDNA is then a suitable
In recent years, the importance of reporting assay quality
template for PCR and relative quantities of specific RNA
has been recognized. A team of internationally renowned,
templates are determined by semi-quantitative or preferably
expert Molecular Biologists compiled The MIQE Guidelines:
quantitative PCR (see Chapter 8).
Minimum Information for Publication of Quantitative Real-

4 [Link]
Introduction and Historical Timelines
Time PCR Experiments17. These guidelines direct the researcher 7. Mullis, K.B. and Faloona, F.A. Specific synthesis of DNA in vitro via a
through the process of assay quality control. Information polymerase-catalyzed chain reaction. Methods Enzymol. 155: 335-350
(1987).
derived from controls during assay verification is required to
8. Higuchi, R., et al., Kinetic PCR analysis: real-time monitoring of DNA
establish that the experiment is MIQE compliant. As a follow amplification reactions. Biotechnology (N. Y. ) 11: 1026-1030 (1993).
up to the publication of these recommendations, a review 9. Liu, [Link] Hong, Y. Q-priming PCR: a quantitative real-time PCR system
of qPCR publications was made and an increase in adoption using a self-quenched BODIPY FL-labeled primer. Anal. Biochem. 360:
of the guidelines was shown18. Similar recommendations for 154-156 (2007).
studies containing data derived from dPCR experiments were 10. Holland, P.M., et al., Detection of specific polymerase chain reaction
product by utilizing the 5’----3’ exonuclease activity of Thermus aquaticus
published recently19.
DNA polymerase. Proc. Natl. Acad. Sci. U. S. A 88: 7276-7280 (1991).
11. Tyagi, S. and Kramer, F.R. Molecular beacons: probes that fluoresce upon
References hybridization. Nat. Biotechnol. 14: 303-308 (1996).
1. Kleppe, K., et al., Studies on polynucleotides. XCVI. Repair replications of 12. Whitcombe, D., et al., Detection of PCR products using self-probing
short synthetic DNA’s as catalyzed by DNA polymerases. J. Mol. Biol. 56: amplicons and fluorescence. Nat. Biotechnol. 17: 804-807 (1999).
341-361 (1971).
13. Wittwer, C.T., et al., Continuous fluorescence monitoring of rapid cycle
2. Mullis, K.B. 1997. The Polymerase Chain Reaction (Nobel Prize Acceptance DNA amplification. Biotechniques 22: 130-138 (1997).
Speech). World Scientific Publishing Co, Singapore.
14. Nolan, T., et al., Quantification of mRNA using real-time RT-PCR. Nat.
3. Saiki, R.K., et al., Primer-directed enzymatic amplification of DNA with a Protoc. 1:1559-1582 (2006).
thermostable DNA polymerase. Science 239: 487-491 (1988).
15. Fang, F.C. and Casadevall, A. Retracted science and the retraction index.
4. Lawyer, F.C., et al., High-level expression, purificationand enzymatic Infect. Immun. 79: 3855-3859 (2011).
characterization of full-length Thermus aquaticus DNA polymerase and a
16. Fang, F.C., et al., Misconduct accounts for the majority of retracted
truncated form deficient in 5’ to 3’ exonuclease activity. PCR Methods Appl.
scientific publications. Proc. Natl. Acad. Sci. U. S. A . 109: 17028-33 (2012).
2: 275-287 (1993).
17. Bustin, S.A., et al., The MIQE guidelines: minimum information for
5. Saiki, R. K., Scharf,S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and
publication of quantitative real-time PCR experiments. Clin. Chem. 55:
Arnheim, N. Enzymatic amplification of beta-globin genomic sequences
611-622 (2009).
and restriction site analysis for diagnosis of sickle cell anemia. Science 230:
1350-1354 (1985). 18. Bustin, S.A., Benes, V., Garson, J., et al. The need for transparency and good
practices in the qPCR literature. Nat Methods 10: 1063-1067 (2013).
6. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G. and Erlich, H. Specific
enzymatic amplification of DNA in vitro: the polymerase chain reaction. 19. Huggett, J.F., et al., Guidelines for Minimum Information for Publication of
Cold Spring Harb. Symp. Quant. Biol. 51 Pt 1:263-273 (1986). Quantitative Digital PCR Experiments. Clin. Chem. 59: 892-902 (2013).

PCR Technologies: A Technical Guide 5


OligoArchitect™ Primer and Probe Design Solutions from
Sigma® Life Sciences. Visit our OligoArchitect gateway at
[Link]/probedesignonline
Polymerase Chain Reaction

Chapter 2:
Polymerase Chain Reaction

The polymerase chain reaction (PCR)1,2,3 has become one of PCR consists of cycles of reaction heating and cooling. Each
the most widely used techniques in molecular biology. It is temperature plateau is used to control a defined stage of
used in applications from basic research to high-throughput the reaction and the incubation times are dependent on
screening. While it is a powerful technique, the universal the instrument, reaction plates or tubes and reagents. These
adoption and diverse range of applications is due to its should be optimized for each experiment, especially if
apparent simplicity and relatively low cost. The technique increased detection sensitivity is required5.
is used to amplify specific, target DNA fragments from low
The initial denaturation phase consists of a period at high
quantities of source DNA or RNA (after a reverse transcription
temperature, during which the secondary structure of the
step to produce complementary DNA (cDNA), see Chapter 8).
complex double-stranded DNA (dsDNA) is melted to become
One major advantage of PCR is that target sequences can be
single-stranded DNA (ssDNA). Since DNA is being subjected
amplified from a single copy of starting material, even when
to high temperature, this phase needs to be long enough to
the template is degraded and contaminated with inhibitors.
separate all strands so that they are available for priming but
For example, studies have been performed on DNA extracted
not so long that the DNA is damaged. Degradation during
from ancient Egyptian mummies to identify the members of
the initial (or subsequent) denaturation steps or incomplete
King Tutankhamun’s family4. PCR even features in major films
denaturation, results in decreased detection sensitivity5.
and in most crime series television dramas at some stage in
the “investigation,” even if somewhat over fictionalized. During the shorter denaturation step that initiates the cycling
(10 sec to 1 min at 95 °C), the DNA strands of the target
sequence separate to form single strands, just as in the initial
Cycling Procedure denaturation stage. The reaction is then cooled to the primer
A typical PCR consists of: annealing temperature.
• Initial Denaturation: The reaction temperature is increased The annealing step (30 sec to 1 min, at temperatures 45–60 °C),
to 95 °C and the reaction is incubated for 2–5 min (up to is required so that the primers bind to the complementary
10 min depending on enzyme characteristics and template sequence on each of the DNA single strands. The primers are
complexity) to ensure that all complex, double-stranded designed such that they bracket the target of interest and the
DNA (dsDNA) molecules are separated into single strands region of sequence that lies between them is referred to as
for amplification. the amplicon. In general, the annealing temperature may be
estimated to be 5 °C lower than the melting temperature of
• Cycling:
the primer-template DNA duplex.
1. Denaturation: The reaction temperature is increased
to 95 °C, which melts (disrupts the hydrogen bonds The final stage is the extension step (20 sec to 1 min at 72 °C),
between complementary bases) all dsDNA into single- which is performed so that the DNA polymerase extends
stranded DNA (ssDNA). the primer sequences from the 3’ of each primer to the end
of the amplicon. A 1 min extension is typically sufficient to
2. Annealing: The temperature is lowered to
synthesize PCR fragments up to 2 kilobases (kb). To amplify
approximately 5 °C below the melting temperature
larger fragments, the elongation step is extended at a rate of
(Tm) of the primers (often 45–60 °C) to promote primer
1 min per kb. During the first extension, the template will not
binding to the template.
be length limiting and so templates will be synthesized that
3. Extension: The temperature is increased to 72 °C, which exceed the amplicon length. In subsequent extension steps,
is optimum for DNA polymerase activity to allow the the amplicon length will be defined by the primer sequence at
hybridized primers to be extended. each end.
• Repeat: Steps 1–3 are performed in a cyclical manner,
resulting in exponential amplification of the amplicon
(Figures 2.1 and 2.2).

PCR Technologies: A Technical Guide 7


Chapter 2
Double-stranded DNA by variable lengths of the amplicon extended at the 3’ end.
Remaining original DNA strands that were not primed in
5'
3' the first cycle may be captured in the second and result in
3'
5' molecules consisting of primer and extension product. The
molecules from the first cycle that were primed and extended
will be the template for primers that are complementary to the
Sense newly synthesized material.
5' In the third cycle, the newly synthesized target region DNA
3'
+ resulting from the second cycle comprises only the amplicon
Anti-sense and therefore becomes the specific template.
3' Cycling is repeated continuously, resulting in exponential
5'
amplification of the copied sequences (Figure 2.2). The
number of cycles required depends on the desired yield of
5' PCR product. This, in turn, depends on the initial starting
3' copy number and amplification efficiency. Since the relative
Forward Primer
+ Reverse Primer concentration of the starting material to the end product is
incredibly low (e.g., 1/5.511 if a single molecule is subjected to
3' 40 cycles of amplification and 100% efficiency is achieved at
5'
each cycle, Figure 2.1), the resulting DNA at the end of the
reaction is almost exclusively the PCR amplicon.
5' Although the theoretical PCR should result in continuous
3'
+ exponential amplification, the reaction eventually reaches a
plateau phase. This appears to be due to nonspecific binding
3'
5'
of the DNA polymerase to DNA products6,7. This is clearly
visualized when using quantitative real-time PCR (qPCR) and
monitoring changes in fluorescent labels (see Chapter 3).
5' At the end of the reaction, the amplification products are
3'
+ analyzed using gel electrophoresis. Depending on the
quantity produced and the size of the amplified fragment, the
reaction products can be visualized directly by staining the
3'
5' gel with ethidium bromide (Figure 2.3) or using more recently
introduced dyes, such as BlueView™ 8.
Figure 2.1. Diagram of the individual reaction processes in a typical PCR.
Duplex PCR
Theoretical PCR Amplification of a O‘GeneRuler
Single Target Molecule Low range
Ladder Template 1 Templates 1 and 2 Template 2
6E+11
5E+11
4E+11 300 bp
3E+11 200 bp
150 bp
2E+11
100 bp
1E+11 75 bp
50 bp
0
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 25 bp

Figure 2.2. In a theoretical PCR, the quantity of target amplicon doubles with each
cycle, leading to exponential amplification of the target sequence (X axis shows the Figure 2.3. An example of conventional PCR products resolved through an agarose
PCR cycles, and the Y axis shows total number of amplicon molecules). gel stained with ethidium bromide. A duplex PCR was run to detect 2 targets
simultaneously, each differing in size. Both fragments can be seen as distinct bands
At the start of the second cycle, two forms of template are in (image courtesy of Marion Grieβl).
the reaction; original DNA strands and the newly synthesized
DNA strands, consisting of the primer sequence followed

8 [Link]
Polymerase Chain Reaction

PCR Assay Components dNTPs


Below is a summary of the components that are required The concentration of each dNTP (dATP, dCTP, dGTP, dTTP) in
for PCR. Many of these are described in additional detail in the PCR is usually 200 μM. However, the dNTP concentration
dedicated chapters as well as in the detailed, standard PCR must be in excess and may need to be increased for
protocols at the end of this guide (Appendix A). amplification of long fragments or highly abundant targets.
Recently, there have been enhancements to PCR buffer
Template components, such as CleanAmp™ dNTPs12. These are modified
nucleoside triphosphates that block DNA polymerase
There are several available methods for purification of RNA
nucleotide incorporation. CleanAmp dNTPs are activated by
and DNA. While these are all suitable, they may not all be
the initial heating step and subsequent denaturing steps in
equal. Contamination of template with other materials from
typical hot start cycling conditions. This process limits the
the sample source can result in PCR inhibition and in extreme
amount of available activated dNTPs during each cycle of PCR,
cases, complete failure of the assay. There are some examples
which allows for more specific and efficient amplification of
that demonstrate that contaminants may even result in
the desired product. In turn, they reduce, or completely avoid,
reaction enhancement9,10. See Chapter 7 for more details on
mis-priming or primer dimer formation and therefore are an
template purification and quality control and Chapter 8 for
alternative to hot start DNA polymerases.
information concerning Reverse Transcription (RT) reactions.
Typically, 10 ng to 1 μg of genomic DNA (gDNA) is added to
20–100 μL PCR assays, whereas cDNA synthesis reactions are
MgCl2 Concentration
diluted 1/5 to 1/10 and 5 μL is added to 20–50 μL reactions. Free Mg2+ ions are required as a co-factor for DNA polymerase
activity; however Mg2+ ions form complexes with dNTPs,
Primers primers and DNA templates. For this reason, the optimal
concentration of MgCl2 needs to be selected for each
Oligonucleotide primers are typically 15–25 nucleotides
experiment by testing reactions containing different
in length with 40–60% GC and a Tm that is similar for each
concentrations. MgCl2 concentration is typically between
member of the pair. A simple method to assess the Tm of short
1.5–5.5 mM but can be tested in the range 1–8 mM during
oligos (<25 bases) is to use the formula11:
optimization (see Chapter 9).
Tm = 4(G + C) + 2(A + T)
See Chapter 6 for more details on primer design and Fluorescent Labels
handling. The ideal starting temperature to use for annealing Fluorescent dyes are incorporated into the reaction when the
is estimated to be 5 °C less than the melting temperature. The amplicon is to be detected directly, such as when using a qPCR
annealing temperature can be optimized using a temperature or digital PCR (dPCR) set up. These are included in the buffer or
gradient PCR block. A protocol for temperature optimization attached to the primers or additional probes (see Chapter 5).
(using qPCR as an example) is given in Appendix A.

DNA Polymerase Instruments


Originally, performing PCR was labor intensive because it
There is a large variety of DNA polymerase enzymes and it
was carried out by physically moving the reaction tubes
is critical that the correct enzyme is selected by using the
between 3 water baths, each of which was set at the required
definition of the experiment (not simply the availability of a
temperature for denaturation, annealing and elongation. Oil
given enzyme in the lab freezer). For example, some enzymes
was added to the top of the reaction to prevent evaporation
are designed to be inactive at low temperatures and are used
and analysis was tricky to run without getting interference
in hotstart protocols to reduce nonspecific amplification, while
from the oil. Today, it is common to use one of the many
others have low error rates and are selected for amplification
specialized thermal cycling instruments that are commercially
of fragments for cloning.
available. Plate and block formats vary between 48-, 96- or
384-wells and are compatible with multichannel pipettes.
Most utilize a heated lid that negates the need for the oil
overlay. However, there are high-throughput instruments
based upon the original water bath principle13.

PCR Technologies: A Technical Guide 9


Chapter 2

Application-specific PCR Modifications References


1. Saiki, R.K., Scharf, S., Faloona, F., et al. Enzymatic amplification of beta-
Various derivations of PCR require reaction modifications. globin genomic sequences and restriction site analysis for diagnosis of
Some of these modifications for popular applications are sickle cell anemia. Science 1985; 230: 1350-1354
included here. 2. Mullis, K., Faloona, F., Scharf, S., et al. Specific enzymatic amplification
of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp
Quant Biol 1986; 51 Pt 1: 263-273
Cloning 3. Mullis, K.B., Faloona, F.A. Specific synthesis of DNA in vitro via a
PCR may be used to amplify selected sequences for insertion polymerase-catalyzed chain reaction. Methods Enzymol 1987; 155: 335-
350
into a vector. These sequences can be modified to include
4. Hawass, Z., Gad, Y.Z., Ismail, S., et al. Ancestry and pathology in King
specific regions (tails) for cloning enzyme recognition. Primers Tutankhamun’s family. JAMA 2010; 303: 638-647
directed to the vector are used to isolate fragments that 5. Douglas, A., Atchison, B. Degradation of DNA during the denaturation
have already been cloned into vectors. A low error rate DNA step of PCR. PCR Methods Appl 1993; 3: 133-134
polymerase enzyme is necessary for the PCR steps. 6. Morrison, C., Gannon, F. The impact of the PCR plateau phase on
quantitative PCR. Biochim Biophys Acta 1994; 1219: 493-498
Sequence Tag Sites 7. Kainz, P. The PCR plateau phase - towards an understanding of its
limitations. Biochim Biophys Acta 2000; 1494: 23-27
These are engineered into the 5’ end of the primers and are 8. Sigma-Aldrich. BlueView. Sigma-Aldrich [2012; Available at: [Link]
used during high-throughput sequencing when the specific [Link]/catalog/product/sigma/T9060?lang=en&region=GB.
tag is required as an indicator that a particular segment of a 9. Witt, N., Rodger, G., Vandesompele, J., et al. An assessment of air as a
specific sample genome is present in a selected clone so that source of DNA contamination encountered when performing PCR. J
genomic sequence data can be deconvoluted and ascribed to Biomol Tech 2009; 20: 236-240
the original source sample. 10. Huggett, J.F., Novak, T., Garson, J.A., et al. Differential susceptibility of PCR
reactions to inhibitors: an important and unrecognized phenomenon.
BMC Res Notes 2008; 1: 70
Site-directed Mutagenesis 11. Wallace, R.B., Shaffer, J., Murphy, R.F., et al. Hybridization of synthetic
To study protein function, a desired mutation may be oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base
pair mismatch. Nucleic Acids Res 1979; 6: 3543-3557
introduced into a DNA sequence. The desired base change
12. Sigma. CleanAmp. Sigma-Aldrich [2012; Available at: [Link]
is engineered into the primers (towards the 5’ end), which [Link]/catalog/product/sigma/dntpca1?lang=en&region=GB.
also contain the required cloning enzyme restriction sites. An 13. GC Biotech. Hydrocycler. GC Biotech [2012; Available at: [Link]
alternative approach adopts a multiple step protocol whereby [Link]/[Link]?id=68.
primers that are specific to the target and contain the cloning
sites are used in conjunction with primers containing the
desired mutation.

10 [Link]
Quantitative PCR

Chapter 3:
Quantitative PCR

As described in Chapters 1 and 2, PCR is currently Alternatively, a probe (or combination of two depending
considered to be the most useful technique that is applied on the detection chemistry) can add a level of detection
to investigations using molecular biology. This is primarily specificity beyond the dsDNA-binding dye, since it binds to
due to its ability to amplify a target nucleic acid sequence a specific region of the template that is located between the
(the template; genomic DNA, gDNA, or complementary primers. The most commonly used probe format is the Dual-
DNA, cDNA) by several million fold. When combined with Labeled Probe (DLP; also referred to as a Hydrolysis or TaqMan®
quantitative PCR (formally quantitative real-time PCR, qPCR) Probe). The DLP is an oligonucleotide with a 5’ fluorescent
detection, it can be used to estimate the quantity of starting label, e.g., 6-FAM™ and a 3’ quenching molecule, such as one
material in a sample. Since the products are detected as of the dark quenchers e.g., BHQ®1 or OQ™ (see Chapter 5).
the reaction proceeds, qPCR has a much wider dynamic These probes are designed to hybridize to the template
range of analysis than conventional, end-point PCR; from between the two primers and are used in conjunction with
a single copy to around 1011 copies are detectable within a DNA polymerase that has inherent 5’ to 3’ exonuclease
a single run. Quantitative real-time PCR and subsequent activity. When the DLP is free in solution, the signal intensity
amplicon detection is carried out in a closed-tube format is low because the reporter dye is in close proximity to the
which eliminates the need for post-PCR manipulation, such quencher moiety. As more of the template is produced during
as gel electrophoresis and significantly reduces the risk of the reaction, more probes hybridize to the template, which
cross contamination. in turn are cleaved by the 5’ to 3’ exonuclease activity of the
advancing DNA polymerase. The fluorescent signal intensity
The basic principles of qPCR will be discussed in this chapter
increases as the 5’ reporter dye is released into solution. The
and the mechanisms of the common detection chemistries
use of probes labeled with different reporter dyes allows for
will be described in Chapter 5.
the simultaneous detection and quantification of multiple
targets in a single (multiplex) reaction.
Basic Principles A typical qPCR run consists of repeated cycles of alternating
When performing qPCR, a fluorescent reporter dye is used temperature incubations, see Cycling Procedure 3.1. This
as an indirect measure of the amount of nucleic acid present profile is often used when dsDNA-binding dyes, Molecular
during each amplification cycle. The increase in fluorescent Beacons, or Scorpion® Probes are the chosen detection
signal is directly proportional to the quantity of exponentially chemistries for qPCR. Primer extension is most efficient at
accumulating PCR product molecules (amplicons) produced 72 °C because this is the optimal temperature for processivity
during the repeating phases of the reaction (see Chapter 2). of most DNA polymerases. At 72 °C, polymerization occurs
Reporter molecules are categorized as; double-stranded at a rate of approximately 100 bases per second. However,
DNA (dsDNA) binding dyes, dyes conjugated to primers, or there is still processivity at lower temperatures that is sufficient
additional dye-conjugated oligonucleotides, referred to as to amplify shorter templates. qPCR amplicons are typically
probes (see Chapter 5). shorter (<200 bases) than conventional PCR products, thus
The use of a dsDNA-binding dye, such as SYBR® Green I, extension is often combined with annealing in a single step at
represents the simplest form of detection chemistry. When 60 °C when working with Dual-Labeled Probles (see Cycling
free in solution or with only single-stranded DNA (ssDNA) Procedure 3.2).
present, SYBR Green I dye emits light at low signal intensity.
As the PCR progresses and the quantity of dsDNA increases,
more dye binds to the amplicons and hence, the signal
intensity increases.

PCR Technologies: A Technical Guide 11


Chapter 3

Cycling Procedure 3.1 Cycling Procedure 3.2


An example of a standard qPCR profile using dsDNA-binding An example two-step cycling qPCR profile for DLP detection.
dye, Molecular Beacon, or Scorpions® Probe detection.
• Initial Denaturation: The temperature is increased to 95 °C
• Initial Denaturation: The reaction temperature is increased and the reaction is incubated for 2–10 min (depending on
to 95 °C and the sample is incubated for 2–10 min (the the hot start properties of the polymerase enzyme)
time depends on the polymerase enzyme hot start
mechanism) to ensure that all all complex targets (dsDNA)
• Cycling:

are separated and are single stranded and available for Denaturation: The reaction temperature is increased to
1. 
amplification 95 °C for 10 sec to melt all dsDNA.
Annealing and Extension: The temperature is lowered
2. 
• Cycling:
to 60 °C for 30 sec to promote primer binding to the
Denaturation: The reaction temperature is increased to
1.  template and subsequent elongation occurs due
95 °C for 10 sec to melt all dsDNA. to sufficient activity of the DNA polymerase at this
Annealing: The temperature is lowered to 60 °C for
2.  temperature.
30 sec to promote primer and probe (if included) • Repeat: Steps 1–2 are repeated, usually for 40 cycles.
binding to the template.
The change in fluorescence over the course of the reaction
Extension: Subsequent elongation occurs at an
3.  is measured by a real-time PCR thermal cycler. Dedicated
increased temperature of 72 °C, which is optimal for Taq real-time PCR instruments combine temperature cycling with
DNA polymerase processivity. Duration of extension will an optical unit. The optical unit provides light at a suitable
be dependent upon amplicon size (30 sec per 1 kb). The wavelength to excite the fluorophore and detects the resulting
period of elongation depends upon the desired length emission. Many modern instruments have an affixed display
of the amplicon and the enzyme used. Since qPCR screen or nearby computer monitor, which allows the reaction
amplicons are short, this is typically 5–30 sec. to be tracked as it progresses (Figure 3.1).
• Repeat: Steps 1–3 are repeated, usually for 40 cycles.

12 [Link]
Quantitative PCR
14000
A Plateau
13000

12000

11000

10000
Fluorescence (norm)

9000

8000 Linear
7000

6000

5000

4000

3000
Exponential
2000

1000
Baseline
0

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Cycle

14000
13000
B
12000

11000

10000
Fluorescence (norm)

9000

8000
Lower Cq equals Higher Cq equals
7000
abundant starting scarce starting
6000 material materials
5000

4000

3000

2000

1000

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Cycle

Figure 3.1. Example qPCR Assay Data. A) The different phases of the reaction. Baseline: The initial concentration of template is low; therefore, the fluorescence intensity is
too low to be detected and only the background signal is evident. Exponential: After the target yield has reached the detection threshold, shown as the red threshold line,
the course of the reaction can be followed through the exponential phase. Linear: As the concentration of template increases the available DNA polymerase concentration
reduces and the reaction rate decreases. Plateau: The reaction is at the maximum yield. B) Individual reactions are characterized by the cycle at which fluorescence first rises
above the threshold, which is referred to as the Quantification Cycle (Cq). If the starting material is abundant, amplification is observed in earlier cycles and the Cq is lower.
If the starting material is scarce, amplification is observed in later cycles and the Cq is higher. This correlation between fluorescence, Cq and amount of amplified product
enables quantification of the template over a wide dynamic range.

PCR Technologies: A Technical Guide 13


Chapter 3

Quantification and Analysis of gDNA Targets qPCR3. As illustrated in Figure 3.2A, the 5’-end of the RT primer
can base-pair with a region several nucleotides from its own
Quantitative real-time PCR can be readily applied to analysis 3’-end to create a base-paired stem separated by an unpaired
of gDNA targets. Such studies may be genotyping/SNP loop. All except the last few nucleotides at the 3’-end of the RT
determination, methylation analysis, screening transgenic primer are universal, that is, they contain the same sequence in
sequences, or monitoring of insertions and deletions. all miRNA primers. The last few nucleotides that extend 3’ from
the stem are complementary to the 3’-end of a target miRNA.
Quantification and Analysis of Extension of the primer along a miRNA template creates a
cDNA that can be amplified with a miRNA-specific forward
mRNA Transcripts primer and a universal reverse primer, the latter of which is
complementary to the 5’-end of the stem-loop RT primer.
A common application of qPCR is gene expression analysis,
e.g., comparing the mRNA concentrations of a gene of interest All other commercial miRNA qPCR methods, including Sigma’s
between control and treated samples. The mRNA can be MystiCq® brand, use poly-A tailing to lengthen the miRNA,
quantified via a two-step or one-step RT-qPCR process (see as described by Shi and Chiang4. Poly(A) Polymerase (PAP),
Chapter 8, Reverse Transcription Quantitative Real-time PCR, a template-independent enzyme, catalyzes the transfer of
for more details of RT reactions). adenosine residues from ATP to the 3’-end of any RNA. As
illustrated in Figure 3.2B, RT can then be performed using
Two-step RT-qPCR an oligo-dT primer. The oligo-dT primer includes an adapter
The reverse transcription and qPCR reactions are carried sequence at its 5’-end, which enables subsequent qPCR
out sequentially in separate tubes. Either total RNA or, less with a forward primer that is complementary to a specific
commonly poly(A)+ RNA, is used as the starting material miRNA and a reverse primer that is complementary to the
and cDNA is produced by elongation from oligo-dT primers, adapter sequence.
random primers, a blend of oligo-dT primers/random primers, miRNA RT-qPCR
or gene-specific primers using a reverse transcriptase enzyme. A. TaqMan/Stem-loop primer B. Sigma, et al./Poly-A Tailing
An aliquot of this reaction is then added to the qPCR. miRNA RT Primer 5’ miRNA
3’

Poly-A polymerase

One-step RT-qPCR Step 1:


Stem-loop RT
Step 1:
Poly-A Tailing
ATP

When the reverse transcription and qPCR reactions are AAAAAAAAAAAAAAA

combined into one tube, the experimental setup is simplified cDNA


Step 2: AAAAAAAAAAAAAAA
Step 2:
and there is a lower chance of contamination because there is Real-time PCR
Oligo-dT RT dNTPs
Reverse
Oligo-dT Adapter Primer
Transcriptase
no requirement for further handling of the sample.
Forward Primer
AAAAAAAAAAAAAAA

Quantification and Analysis of TaqMan Probe


Reverse
Primer Step 3:
SYBR Green
miR-specific Primer

ncRNA Transcripts
qPCR
Universal PCR
Chen, et al., 20053 Primer
hp://[Link]/product_mirna.php?base_id=95107
Most non-coding RNAs are longer than 100 nucleotides
and therefore, can be detected and quantified by RT-qPCR Figure 3.2. There are two commercially available methods for RT and qPCR of
miRNA. A) A looped primer is used to prime the RT step after hybridization to the
with the same techniques that are used for mRNA analysis. 3’ end of the miRNA. PCR extension through the loop results in a combined miRNA
In contrast, short non-coding RNAs, such as micro and piwi and universal sequence which is long enough for amplification B) Addition of a
RNAs, are essentially the length of a single PCR primer. As a poly A tail to the miRNA provides a priming site for a primer that is composed of a
oligo-dT tract and a universal priming sequence.
consequence, a technique that lengthens these short RNAs
Nucleic acids research by Oxford University Press. Reproduced with permission
is needed before performing qPCR. Two main approaches are of Oxford University Press in the format reuse in a book/e-book via Copyright
adopted in commercially available systems: 1) use of a stem- Clearance Center
loop RT primer and 2) poly-A tailing followed by RT with an
oligo-dT adapter primer (Figure 3.2). An alternative approach Both commercial approaches have advantages and
developed by Casoldi et al., that is not commercially available, disadvantages. Stem-loop priming allows 2-step RT-qPCR,
uses ligation of an adapter molecule to all RNA in the sample whereas most poly-A tailing methods require an additional
and specific primer design to differentiate between the step for RT before qPCR. There are products that combine
desired targets1,2. poly-A tailing and RT in a single reaction for 2-step PAP tailing/
RT-qPCR. However, detection may be less sensitive with this
The stem-loop RT primer approach was developed and approach (unpublished internal results, Sigma). Conversely,
commercialized by Applied Biosystems (currently Life poly-A tailing followed by RT produces a stable pool of
Technologies/Thermo) for subsequent TaqMan probe-based

14 [Link]
Quantitative PCR
cDNA that can be used to detect any microRNA, mRNA, or Primers
other RNA, immediately or at any time in the future. With the
stem-loop/TaqMan approach, a different primer is needed for Whether using a dsDNA-binding dye or a probe-based
detection of each miRNA. Multiple stem-loop primers can be detection chemistry, designing high-quality primers is one of
added to the same RT reactions5 and pools of RT primers for the most critical pre-experimental steps in qPCR. For a detailed
multiple miRNAs may be purchased from Life Technologies to discussion of assay design, see Chapter 6.
perform multiplex RT. However, neither option allows for qPCR
detection of miRNAs discovered at a later date, nor do they Probe(s)
allow qPCR to detect mRNA from the same cDNA. The system When using probes as the amplicon detection mechanism,
described by Castoldi et al1,2 is unique in that it does provide primer dimers and nonspecific products are not detected but
the means to detect mRNA, precursor and fully processed should be avoided because they can lower reaction efficiency.
miRNA molecules from the same total RNA sample. To maximize sensitivity and specificity, the appropriate probe
type for the application should be selected and any required
qPCR Requirements modifications, such as Locked Nucleic Acid® (LNA®), included
(see Chapter 5, qPCR Detection Chemistry).
Instruments dNTPs
Many qPCR instruments have been designed to support a
Standard PCR/qPCR master mixes contain dATP, dCTP, dGTP
specific range of applications, e.g., contrast the capability of
and dTTP. However, some mixes are available that replace dTTP
the ABi 7900 high throughput instrument using automatic
with dUTP. Products from previous reactions run with dUTP will
loading of 384-well plates with the Illumina produced and
contain uracil instead of thymine. These are then susceptible
marketed Eco instrument that supports a single 48-well plate.
to cleavage by Uracil-DNA-Glycosylase (UNG). Therefore, prior
Therefore, the most suitable instrument meets the needs of
incubation of subsequent reactions with UNG prevents carry-
the research. It is desirable to select an instrument with user
over contamination between reactions. To be effective, all PCRs
friendly software that performs the most desirable functions
in the laboratory must use dUTP.
and has flexibility in terms of data output so that it can be
easily manipulated in downstream statistical analysis software
packages. This reduces the time required to train personnel
Magnesium
and therefore to begin generating results. Additional features Magnesium chloride (MgCl2) is necessary for reverse
that are required include a PCR block that is absolutely uniform transcriptase, Taq DNA polymerase and Taq DNA 5’ to 3’
(an absolute maximum deviation of 1 Cq = 2-fold across exonuclease activity. Optimum Mg2+ concentrations for
96 wells of replication) and an optical system that excites and reactions containing DLPs are usually between 3–6 mM.
detects emission as sensitively and as evenly as possible across The majority of master mixes contain MgCl2, however, it is
a wide range of wavelengths. This allows for a wide choice sometimes necessary to optimize the concentration, so an
of fluorophores and enables multiplexing. Other features additional tube of pure MgCl2 is typically included with the
to consider are the operating costs associated with specific master mix product (see Chapter 9, Assay Optimization and
consumables, e.g., if a standard microtitre plate is not used for Validation). In some cases, a reaction mix that does not contain
reactions and also the convenience of loading plates/tubes MgCl2 may be required so that a low concentration can be
that are non-standard format. used, e.g., when using Scorpions® Probe detection.

Template Reverse Transcriptase


Very few copies of target nucleic acid (equivalent to about A reverse transcriptase enzyme that provides high yields of
100 pg of gDNA or cDNA) are required to initiate qPCR. To cDNA, while retaining activity at high temperature, is critical
minimize contamination with reaction inhibitors, the starting to the success of RT-qPCR. Performance at high temperatures
template amount should be kept to the minimum required to helps to ensure that regions of RNA with significant secondary
achieve accurate quantification. When the starting material is structure are destabilized and accessible for hybridization and
RNA, primer design and DNase I treatment will reduce signals subsequent amplification. When performing one-step RT-
that may be generated from gDNA contamination. qPCR, high-temperature performance allows the use of gene-
specific primers with high melting temperatures (Tm), which
increases reaction specificity. When performing two step
protocols, it is important to ensure that the enzyme results in a
linear and proportional yield of cDNA from RNA (see Chapter 8
for details of RT evaluation).

PCR Technologies: A Technical Guide 15


Chapter 3

Taq DNA Polymerase The MIQE Guidelines


As with selecting the most appropriate reverse transcriptase One clear problem with the use of qPCR is that it is very easy
for the RT, selection of the appropriate polymerase enzyme to produce numbers that can then readily be interpreted as
is vital. A fundamental problem with natural Taq DNA quantitative results. However, this can be equally misleading
polymerase is that the enzyme has residual activity at low because quality control and further analysis may be required
temperature. Nonspecific primer binding leads to nonspecific to differentiate between potential artifacts caused by
product formation as a result of this residual polymerase inappropriate assay design, execution, or data analysis. The
activity. Antibody-blocked or chemically blocked Taq DNA publication of apparently significant data without adequate
polymerases (‘hot start’) help to rectify this situation by quality controls has led to reports that are, at best, not
preventing enzyme activity until the high-temperature, biologically or clinically relevant and, at worst, are inaccurate.
denaturation step begins.
Each step of the qPCR experimental process, from sample
acquisition to qPCR data analysis, is vulnerable to variability6.
Buffer Therefore, variability may occur during sample selection
Buffers or reaction master mixes, typically contain dNTPs, a and processing, extraction of nucleic acids (can result in
Taq DNA polymerase, MgCl2 and stabilizers. SYBR Green I dye, differences in quality which cause lack of reproducibility
ROX™, fluorescein and inert loading dyes may also be included of qPCR target detection), assay design and optimization
(see Loading Control Dyes), depending on the detection (contribute to differences in assay efficiency and sensitivity)
chemistry, instrument and reaction requirements. The PCR and data analysis (requires some subjective interpretation and
buffer components and stabilizers are typically proprietary to application of appropriate statistical methods). It is critical that
the manufacturer. If purchased separately, maximum flexibility the information provided to a scientific audience contains
is possible, since each ingredient can be optimized individually adequate information for the experiment to be critically
in the reaction. However, in contrast, while purchasing the assessed7, yet it is apparent that this is not always the case8.
ingredients together as a master mix reduces flexibility, it The “Minimum Information for Publication of Quantitative
increases batch consistency and convenience while reducing Real-time PCR Experiments” (MIQE) guidelines9 address these
the number of pipetting steps and hence, the chances of error concerns. The aims of the MIQE guidelines are to increase
and contamination. transparency by specifying the minimum information about
an assay that is required for the reader to be able to assess the
Loading Control Dyes technical validity of a publication and to provide guidance for
Some real-time PCR thermal cyclers require a loading dye design, optimization and validation of new qPCR assays.
such as ROX to be included into each reaction to control for MIQE consists of nine sections (experimental design, sample,
variability in the optical system and to normalize differences nucleic acids, reverse transcription, target, primers and probes,
in signal intensity. Likewise, some thermal cyclers require an assay details, PCR cycling and data analysis; see [Link]/
initial fluorescein signal to create a virtual background when MIQE to download a checklist, Figure 3.3). All parameters
working with SYBR Green I dye assays (which have very low relate to information that should be obtained during the
background). These may be supplied in the master mix or as process of experimental design, optimization and validation.
separate components so that the appropriate concentration When using commercial assays or those from the published
can be used. literature, optimization and validation should still be executed.
The MIQE paper includes a checklist with factors labeled
Essential, which are considered indispensable for an adequate
description of the qPCR assay, whereas other components
are labeled Desirable, indicating that this information is
useful but even without it, the assay could be replicated and
the data within the publication evaluated. It is important to
recognize that reporting PCR efficiency, analytical sensitivity
and specificity of each individual assay is essential and should
be determined by the investigator using the conditions in the
laboratory. There are specific considerations when performing
digital PCR (see Chapter 4, dPCR) that have been addressed in
a recent digital PCR MIQE publication10.

16 [Link]
Quantitative PCR
Are You MIQE Compliant?
Minimum Information for Publication of Quantitative Real-time PCR Experiments
The MIQE Checklist for qPCRa Importanceb The MIQE Checklist for qPCRa Importanceb
Experimental Design qPCR Protocol
Definition of experimental and control group Essential Complete reaction conditions Essential
Number within each group Essential Reaction volume and amount of cDNA/DNA Essential
Assay carried out by core lab or investigator’s lab? Desirable Primer, (probe), Mg++ and dNTP concentrations Essential
Acknowledgement of authors’ contributions Desirable Polymerase identity and concentration Essential
Sample Buffer/kit identity and manufacturer Essential
Description Essential Exact chemical constitution of the buffer Desirable
Volume/mass of sample processed Desirable Additives (SYBR Green I, DMSO, etc.) Essential
Microdissection or macrodissection Essential Manufacturer of plates/tubes and catalog number Desirable
Processing procedure Essential Complete thermocycling parameters Essential
If frozen - how and how quickly? Essential Reaction setup (manual/robotic) Desirable
If fixed - with what, how quickly? Essential Manufacturer of qPCR instrument Essential
Sample storage conditions and duration (especially for FFPE samples) Essential qPCR Validation
Nucleic Acid Extraction Evidence of optimization (from gradients Desirable
Procedure and/or instrumentation Essential Specificity (gel, sequence, melt, or digest) Essential
Name of kit and details of any modifications Essential For SYBR Green I, Cq of the NTC Essential
Source of additional reagents used Desirable Standard curves with slope and y-intercept Essential
Details of DNase or RNAse treatment Essential PCR efficiency calculated from slope Essential
Contamination assessment (DNA or RNA) Essential Confidence interval for PCR efficiency or standard error Desirable
Nucleic acid quantification Essential R2 of standard curve Essential
Instrument and method Essential Linear dynamic range Essential
Purity (A260/A280) Desirable Cq variation at lower limit Essential
Yield Desirable Confidence intervals throughout range Desirable
RNA integrity method/instrument Essential Evidence for limit of detection Essential
RIN/RQI or Cq of 3’ and 5’ transcripts Essential If multiplex, efficiency and LOD of each assay Essential
Electrophoresis traces Desirable Data Analysis
Inhibition testing (Cq dilutions, spike or other) Essential qPCR analysis program (source, version) Essential
Reverse Transcription Cq method determination Essential
Complete reaction conditions Essential Outlier identification and disposition Essential
Amount of RNA and reaction volume Essential Results of NTCs Essential
Priming oligonucleotide (if using GSP) and concentration Essential Justification of number and choice of reference genes Essential
Reverse transcriptase and concentration Essential Description of normalization method Essential
Temperature and time Essential Number and concordance of biological replicates Desirable
Manufacturer of reagents and catalogue numbers Desirable Number and stage (RT or qPCR) of technical replicates Essential
c
Cqs with and without RT Desirable Repeatability (intra-assay variation) Essential
Storage conditions of cDNA Desirable Reproducibility (inter-assay variation, %CV) Desirable
qPCR Target Information Power analysis Desirable
If multiplex, efficiency and LOD of each assay Essential Statistical methods for result significance Essential
Sequence accession number Essential Software (source, version) Essential
Location of amplicon Desirable Cq or raw data submission using RDML Desirable
Amplicon length Essential Clinical chemistry Copyright 2009 by American Association For Clinical Chemistry, Inc.
a

Reproduced with permission of American Association For Clinical Chemistry, Inc. in the format
In silico specificity screen (BLAST, etc) Essential Internet posting via Copyright Clearance Center.
Pseudogenes, retropseudogenes or other homologs? Desirable
All essential information must be submitted with the manuscript. Desirable information
b
Sequence alignment Desirable should be submitted if available. If primers are from RTPrimerDB, information on qPCR target,
Secondary structure analysis of amplicon Desirable oligonucleotides, protocols, and validation is available from that source.
Location of each primer by exon or intron (if applicable) Essential Assessing the absence of DNA using a no-reverse transcription assay is essential when first
c

What splice variants are targeted? Essential extracting RNA. Once the sample has been validated as DNA-free, inclusion of no-reverse
transcription control is desirable but no longer essential.
qPCR Oligonucleotides
Primer sequences Essential Disclosure of the probe sequence is highly desirable and strongly encouraged. However,
d

because not all commercial pre-designed assay vendors provide this information, it cannot be
RTPrimerDB Identification Number Desirable
an essential requirement. Use of such assays is discouraged.
d
Probe sequences Desirable
- See more at: [Link]
Location and identity of any modifications Essential lines/[Link]#[Link]
Manufacturer of oligonucleotides Desirable
Figure 3.3 The MIQE Guidelines Checklist. Clinical chemistry by American Associa-
Purification method Desirable
tion of Clinical Chemists; American Association for Clinical Chemistry Reproduced
with permission of P.B. Hoeber, in the format Republish in a book via Copyright
Clearance Center.

PCR Technologies: A Technical Guide 17


Chapter 3
References
1. Benes, V., Castoldi, M. Expression profiling of microRNA using real-time
quantitative PCR, how to use it and what is available. Methods 2010; 50:
244-249
2. PCR Technologies: Current Innovations. 3rd ed. ed Nolan and Bustin CRC
Press; 2013
3. Chen, C., Ridzon, D.A., Broomer, A.J., et al. Real-time quantification of
microRNAs by stem-loop RT-PCR. Nucleic Acids Res 2005; 33: e179
4. Shi, R., Chiang, V.L. Facile means for quantifying microRNA expression by
real-time PCR. Biotechniques 2005; 39: 519-525
5. Tang, F., Hajkova, P., Barton, S.C., et al. MicroRNA expression profiling of
single whole embryonic stem cells. Nucleic Acids Res 2006; 34: e9
6. Nolan, T., Hands, R.E., Bustin, S.A. Quantification of mRNA using real-time
RT-PCR. Nat Protoc 2006; 1: 1559-1582
7. Bustin, S.A. Why the need for qPCR publication guidelines?—The case for
MIQE. Methods 2010; 50: 217-226
8. Huggett, J. and Bustin, S.A. Standardisation and reporting for nucleic acid
quantification. Accredit Qual Assur 2011; 399-405
9. Bustin, S.A., Benes, V., Garson, J.A., et al. The MIQE guidelines: minimum
information for publication of quantitative real-time PCR experiments.
Clin Chem 2009; 55: 611-622
10. Huggett, J.F., Foy, C.A., Benes, V., et al. Guidelines for Minimum Information
for Publication of Quantitative Digital PCR Experiments. Clin Chem 2013;
892-902

18 [Link]
Digital PCR

Chapter 4:
Digital PCR

Digital PCR is an end-point PCR method that is used for reaction-based on the number of cycles required to reach a
absolute quantification and for analysis of minority sequences quantification cycle (Cq); see Chapter 3. When using dPCR,
against a background of similar majority sequences, e.g., the sample is diluted and separated into a large number of
quantification of somatic mutations. When using this reaction chambers, such that each partition contains either
technique, the sample is taken to limiting dilution and one or no copies of target. The number of reaction chambers
the number of positive and negative reactions is used to or partitions varies between systems, from several thousand
determine a precise measurement of target concentration. when using the QX100 Bio-Rad system to millions when using
the RainDrop approach. The PCR is then performed in each
The digital PCR (dPCR) concept was conceived in 1992 by
partition and the amplicon detected using a fluorescent label
Sykes et al.1 and then developed into a nanoscale array format
(see Chapter 5, qPCR and dPCR Detection Methods) such that
by Kalinina et al. in 19972. One of the drivers of continuous
the collected data are a series of positive and negative results.
improvement of dPCR was the demonstration by Vogelstein
In theory, this would result in a positive signal from a partition
and Kinzler3 that rare KRAS mutations could be detected
that originally contained a single copy of target and a negative
and quantified in material extracted from colorectal cancer
(i.e., no signal) from one that did not originally contain
patients. Vogelstein diluted the patient samples such that
template. However, since it is possible that some partitions will
they expected an average of 1 template molecule per 2
contain more than a single copy of template, the dispersal of
wells of a reaction plate. The target sequence around the
the sample into the partitions is considered to obey Poisson
mutation site was amplified and then two Molecular Beacons
distribution.
(see Chapter 5) were used to detect the amplicons. The
first Molecular Beacon was specific to a region that was not In theory, dPCR can be used to overcome some of the
expected to contain a mutation and this assay served as a difficulties that are encountered when using conventional PCR.
PCR amplification positive control. The second Molecular When using dPCR, a sample is partitioned so that individual
Beacon had a different dye label and was specific for the nucleic acid molecules within the sample are localized into
wild type (WT) sequence. In this way, reactions showing a many separate regions and therefore detection of any target
positive signal from both labels were expected to be WT and is not dependent on the number of amplification cycles. This
those showing only the positive control were expected to approach results in a much more sensitive differentiation of
be mutants. Since all the product within a well was expected fold change than that afforded by qPCR; a well-optimized
to be homogeneous as a result of the dilution, an accurate qPCR may differentiate 1.5-fold changes at best, whereas
measure of the ratio of mutant to WT could be made. These dPCR has been reported to differentiate 1.2-fold5. The
experiments provide examples of dPCR being carried out dilution of sample makes this a useful tool for studying
in standard 96-well plates, but higher throughput options minority sequences against a majority of similar but differing
were suggested by others, including Dressman et al.4 who sequences. For example, dPCR can be used to detect a low
introduced the concept of using emulsion beads for dPCR incidence somatic single nucleotide polymorphism (SNP)
(now used in the Bio-Rad QX100™ Droplet Digital™ PCR, against a high concentration of WT sequence. This is because,
ddPCR™ system and RainDance Technologies’ RainDrop™ when the total sample is diluted, the rare sequence is also
instrument). In an alternative format, the reactions are run on diluted to a single copy, so it will be amplified in the absence
integrated fluidic circuits (chips). These chips have integrated of competition from the prominent sequence. Far fewer
chambers and valves for partitioning samples and reaction partitions will contain a positive for the rare SNP than for the
reagents. The first commercial dPCR system using chip WT, so it is possible to make an accurate measurement of the
technology, the BioMark™, was launched in 2006 by Fluidigm. ratio of the two sequences.
When performing conventional PCR, the final concentration Digital PCR has many potential applications, including the
of template is proportional to the starting copy number detection and quantification of low-level pathogens, rare
and the number of amplification cycles. One experiment genetic sequences, copy number variations (CNVs) and relative
of a given number of reactions is performed on a single gene expression in single cells. Clonal amplification enabled by
sample and the result is an analysis of fragment sizes or, single-step dPCR is a key factor in reducing the time and cost
for quantitative real-time PCR (qPCR), the analysis is an of many of the “next-generation sequencing” methods and
estimate of the concentration of the target sequences in the hence enabling personal genomics.

PCR Technologies: A Technical Guide 19


Chapter 4

Instruments Life Technologies


Although dPCR is a relatively new technology, many platforms The OpenArray® and QuantStudio® 12K Flex dPCR systems
have been developed in an effort to provide better tools for (Life Technologies) use microfluidic technology to generate
analyses such as; determining absolute quantification without and analyze partitioned samples. The OpenArray system was
the use of standards, detecting rare genetic mutations using the first to be developed and can hold up to 3 dPCR plates.
multiplex systems and identifying small fold differences (<1.5) The QuantStudio 12K Flex dPCR instrument is able to hold
with confidence between diagnostic samples. Across the up to 4 dPCR plates. Each 384-well plate has 48 arrays. Within
platforms, the general concept of dPCR remains the same: each array, there are 64 ‘through holes’ resulting in 3,072
Input DNA is diluted to generate nanoscale or picoscale compartmentalized reactions per plate. Nanoliter reactions
reactions containing 1 or 0 copies of template. Individual qPCR are partitioned into the “through holes” using an automated
assays take place within each droplet containing template, as dispensing system and are stabilized there by hydrophobic
opposed to a pooled population of target DNA3. In addition and hydrophilic interactions between the droplet and the
to increased sensitivity of detection of rare allelic mutations coating on the plate. This platform can be used to multiplex
and CNV measurements, absolute quantification of positive reactions containing two targets per sample. The versatility
end-point reactions can be made, in part because dPCR of this instrument makes it compatible for use in qPCR
measurements do not depend on standard curves or sample applications12.
calibrations. Other features that can be attributed to increased
precision in dPCR quantification include the reproducible and RainDance Technologies
homogeneous droplets generated as well as the increased The RainDrop™ instrument (RainDance Technologies)
number of partitioned reactions analyzed6,7. The type of represents another highly sensitive dPCR platform. The
instrument that the end user chooses ultimately depends on increase in sensitivity and quantitative power can be
the specific application(s) that will be carried out. attributed to the smaller, picoliter reactions and the number
of droplets partitioned; around 10 million droplets per sample.
Fluidigm Corporation RainDrop dPCR is based on droplet emulsification microfluidic
One of the first commercially available dPCR instruments was technology. The chips are designed to hold 8 samples and
the BioMark HD dPCR system (Fluidigm). This platform is based each sample is partitioned into 10 million reactions, resulting
on microfluidic chip technology. The chips can be purchased in 80 million partitioned reactions per chip. More input DNA
in a variety of formats, including 12-chamber or 48-chamber can be included due to the increased number of reaction
arrays. In the 12-chamber array, samples are partitioned into partitions, making this platform ideal for identifying extremely
765 nanoliter reactions yielding 9,180 reactions per chip. rare mutations. In accordance with the increased number of
The 45-chamber array partitions samples into 770 nanoliter reactions, limiting dilution of input DNA becomes less of a
reactions resulting in 36,960 reactions per chip. Samples are concern with this instrument. Furthermore, reports indicate
loaded into each chamber inlet and nanoliter reactions are that the RainDrop system can be used to quantify 1 in
partitioned by pressure controlled valves and pumps. Sample 200,000 mutants and has a lower limit of detection of 1 in
partitioning and mixing, as well as thermo cycling reactions 1,000,000. These observations underscore the sensitivity of this
are all performed on-chip. Following amplification, fluorescent instrument13. In addition to enhanced sensitivity, the RainDrop
images are captured using the BioMark system8. On-chip platform can multiplex 5 targets per sample simply using red
processing allows for less hands-on manipulation, thereby and green labeled fluorescent probes. Varying the amount of
reducing the potential introduction of error while maintaining fluorescent probe with each target generates a unique color
a more simplified, user-friendly system. intensity that corresponds to the mutation-specific Dual-
Labeled Probe (see Chapter 5) and the intensity is directly
Fluidigm’s dPCR system allows reactions to be multiplexed related to the concentration of probe used in the assay. The
using four targets per sample. A fluorescent image of the technique of diluting fluorescent probes to generate an
chip is taken before and after each round of thermo cycling. optical code may not be limited to a 5× multiplex system, but
This allows for any pre-thermo cycling background to be may be employed to generate a 10× multiplex system, making
subtracted from the final fluorescent image, facilitating this one of the most powerful dPCR multiplexing systems
accurate counts of positive compartments. Another feature available14,15.
of the system is the ability to quantify template that is
partitioned into each chamber using chamber specific, real- Although the RainDrop is one of the more cost effective
time amplification plots. In the event that dPCR is not the only platforms, it cannot also be used for qPCR applications. In
application used in the lab, the BioMark HD also functions as a addition, the set-up is more labor intensive and may, therefore,
qPCR compatible instrument9,10,11. be more prone to the introduction of errors. For example, the
droplets are generated in a microfluidic chip, collected and

20 [Link]
Digital PCR
then thermo cycling is performed off-chip. The reaction is then
injected into another chip for analysis. When multiplexing
Instrument Limitations
samples, droplets containing diluted fluorescent probes are Digital PCR offers many advantages over qPCR. These
collected from one chip and injected into another chip where advantages are made possible by partitioning out individual
they are fused with droplets containing primers, master mix reactions, thereby enriching low copy and rare allelic
and DNA. The merged droplets are amplified off-chip and then amplification, while concomitantly enhancing the precision
analyzed for the presence or absence of the desired targets15. and quantification power of dPCR as a result of the increased
number of microscale reactions. Not only can dPCR be used
Bio-Rad to measure absolute copy numbers, CNVs and rare allelic
mutations, but it can also be used to quantify low quantity/
The Bio-Rad QX100™ Droplet Digital™ PCR technology is low quality DNA6,16,18,13,19,5,17. For example, when using next-
the only platform that does not use microfluidic chips at generation sequencing, quantification by dPCR has the
any stage of the process. Instead, this instrument utilizes oil potential to eliminate the need and cost of running titration
emulsification technology in a standard 96-well plate format. analyses on input DNA. This, in turn, allows the use of smaller
Eight samples containing master mix, primers, Dual-Labeled amounts of input DNA, minimizing the need for the seemingly
Probes and DNA can be loaded into a cartridge at the same biased pre-amplification step commonly used in next-
time. Each sample is positioned adjacent to a well containing generation sequencing7.
oil and together they undergo droplet emulsification using a
vacuum-based droplet generator. Each sample is partitioned However, there may be some instances where pre-
into 20,000 reactions. Droplets are transferred from the amplification cannot be avoided. When working with DNA
8-sample cartridge into a standard 96-well plate. A total from a single cell or when the input DNA is already at a low
of 1,920,000 droplets per plate can be generated for dPCR concentration, whole genome amplification may be required
analysis. Once the droplets have been transferred to the 96- before partitioning the sample into thousands of reactions.
well plate, the samples are amplified using PCR and end-point It is important to note that pre-amplification of target DNA
fluorescent signals are read using a flow cytometric based samples may result in biased amplification of input DNA and
droplet reader16,9. this has the potential to skew dPCR results. It may therefore be
necessary to examine whether the method used for this step
The larger number of reactions (20,000 per sample/1.9 million results in amplification bias before assessing absolute copy
per plate) generated with this platform augments the numbers9,11. In addition, the structure of DNA has been shown
precision associated with dPCR in determining absolute to affect copy number measurements in dPCR analysis. This
quantification and CNV measurements. The increased number is especially true for circularized plasmid DNA, which should
of reactions per sample affords the ability to load larger consequently be linearized before use in dPCR applications9.
amounts of template DNA when compared to the other
systems that have fewer partitioned reactions per sample. This One of the more obvious drawbacks of dPCR is the initial cost
becomes increasingly valuable when detecting rare events of of equipment and ongoing requirement for consumable
importance. Digital reads from duplicated wells can also be materials. Relatedly, qPCR instruments are more common in
combined to determine CNVs for rare or low copy mutational laboratory settings and researchers are more comfortable with
events. Lower limits of detection have been reported to handling this platform. Of course, the desired applications
allow identification of 0.001% of the mutant population in of the user will ultimately provide guidance on the type of
partitioned reactions. Bio-Rad’s QX100™ Droplet Digital™ PCR instrument required to carry out those studies.
platform has also been used with maternal plasma DNA to
determine absolute quantification measurements of maternal
and fetal markers, underscoring the advantages of dPCR
technology in measuring CNVs with low quality/low quantity
template DNA17,16. Though the QX100™ Droplet Digital™
PCR instrument offers a substantial number of partitioned
reactions per plate (1.9 million) and is reasonably priced, it is
not compatible with qPCR applications and can be used to
multiplex only two targets per sample.

PCR Technologies: A Technical Guide 21


Chapter 4

dPCR Applications CNVs are abnormal copies of DNA due to deletion, insertion,
or rearrangement and are associated with susceptibility
Since dPCR samples are partitioned into individual to disease20,21,22. In cancer, gene copy numbers are often
microreactors, the number of partitions determines the range increased and patient responsiveness to drug treatment
of sensitivity of detection. Quantification relies on counting is correlated to copy number23,24,25,26. Numerous methods
the number of positive partitions at the end point, as opposed have been used to quantify CNVs, including SNP arrays,
to amplification cycles and therefore does not rely heavily on next-generation sequencing and qPCR. Recently, dPCR has
amplification efficiency. To account for the random distribution materialized as an attractive tool for quantifying patient
of target DNA into partitions, the Poisson statistical model is biomarkers due to the greater precision in copy number
applied1 and an absolute quantity is calculated. The quantity determination. Digital PCR has been used to determine
of the target sequence is typically evaluated in comparison accurately the CNV with a resolution of <1.25. Specific qPCR
to a reference sequence of known quantity to determine probes enhanced with the addition of LNA bases (see
a relative quantification. Applications for the absolute and Chapter 5) may be utilized in dPCR to discriminate and detect
relative quantification of target DNA include measuring CNVs, the presence of somatic SNP variations (Figure 4.1). Probes
biomarker analysis and detection of rare events. In addition, are designed such that a mutation-specific probe carries the
reverse transcription may be combined with dPCR to measure fluorophore FAM and a second probe, specific to the wild-type
RNA molecules. This technique is beneficial for quantification sequence (WT), carries the fluorophore HEX. The WT and SNP
of low concentrations of virus from complex, transcription in DNA targets are discriminated in the assay. In some cases, gene
single cells and allele-specific transcription. copies may be “linked” on the same allele and consequently
CNV could be underestimated9. Gene duplication in tandem
may be resolved by digestion of template DNA with a specific
restriction nuclease surrounding the target sequence16
(Figure 4.2).

Ch1+Ch2+:4199 Ch1+Ch2-: 3461 Ch1-Ch2+:2507 Ch1-Ch2-: 2175


18000
16000
Channel 1 Amplitude

14000
12000
10000
8000
6000
4000
2000
0
0 1000 2000 3000 4000 5000 6000 7000 8000 9000
Channel 2 Amplitude

Figure 4.1. Detection and determination of the relative copy number of a SNP mutation with droplet digital PCR. A mutation-specific probe was prepared carrying the
fluorescent dye FAM and the probe for unmodified (wild type) sequence carried the fluorophore HEX. The X axis is the HEX signal, generated as a function of the presence
of wild type sequence. The Y axis is the FAM signal, generated as a function of the presence of the SNP mutation sequence. Both modified and wild type sequences were
detected in the target DNA and the relative abundance of each sequence could be directly determined.

6
5
Copy Number

4 3.94

2 1.75
1

0
Digested DNA Undigested DNA
Sample

Figure 4.2. Droplet digital PCR assay to determine CNV. Purified, undigested DNA was used as template to quantify gene copy number relative to reference. The same DNA
sample was also digested with a restriction endonuclease surrounding the target sequence to elucidate linked copies of target sequence. Poisson error bars are shown.

22 [Link]
Digital PCR
Digital PCR is used to quantify a variant DNA sequence that A)
FAM Amplification Plots HEX Amplification Plots
is present in a background of abundant WT sequence. For
example, somatic mutations that are specific to cancers
may be detected when present in a background of normal Dilution
Sample
genotype in clinical samples. Quantitative PCR is limited to
1
detecting mutant sequences present at 1% or greater. Digital 2

PCR provides a tool for sensitive detection of rare copies due to 3

the diluting effect of the partitioning mutant target DNA from 4

the WT. The dynamic range for quantification is determined


by the amount of target DNA present and the number of
partitions evaluated. Available instruments vary with regard to
B)
the recommended dynamic range. The Bio-Rad QX100 Droplet 1.1
1 0.967
Digital PCR system was used to accurately detect rare mutant 0.9

DNA from 100,000-fold WT16 and the RainDrop instrument was 0.8
0.7
used to detect a mutated copy from 200,000 WT copies13. A 0.6

Ratio
typical evaluation of primer/probe sets for use in rare event 0.5 0.484
0.4
detection consists of titrating SNP-containing template DNA 0.3
into WT-template DNA, reducing the SNP-containing template 0.2
0.227
0.115
by half at each dilution. An example of such an experiment 0.1
0
0.0649
0.0319

is shown in Figure 4.3; a single well allowed for detection 1.1


1 2 3 4 5 6

when the frequency of mutant sequence was as low as 1

approximately 1 in 2,000, while by comparison, the qPCR limit 0.9


0.8
of detection was 1 in 10. The limit of detection for dPCR may 0.7
Ratio

0.6
be further extended by aggregating data across multiple 0.5
wells in order to increase the number of partitions without 0.4
0.3
increasing the SNP-containing concentration. 0.2
0.1
Due to the often limiting amount of DNA sample available 0 0.0136
7
0.00734
8
0.00341
9
0.00147
10
0.00161
11
0.000442
12
for use in next-generation sequencing, the samples are Sample
typically amplified by PCR or whole genome amplification. Figure 4.3. Evaluation of primer/probe set in droplet digital PCR assay and qPCR
Quantification of DNA molecules post-amplification is critical for rare event detection. A mutation-specific probe was prepared carrying the
to the performance of the sequencing assay and could be fluorescent dye FAM and the probe for unmodified (wild type) sequence carried
the fluorophore HEX. SNP-containing template DNA was titrated into wild-type
done with methods such as spectrophotometry. Recently, the template DNA to evaluate detection of the SNP mutation when present in an
capability of dPCR for absolute DNA quantification has been abundant wild type background. SNP-containing template was reduced by half
applied to next-generation sequencing library preparation7. A at each dilution. A) Primer/probe set was used in qPCR with mutation-titrated
DNA template. B) Primer/probe set was used in single well of droplet dPCR with
universal template fluorescent probe PCR assay was developed mutation-titrated DNA. The ratio of mutant to wild type copies is shown. Digital PCR
such that a probe-specific sequence is designed at the end allowed for detection when the frequency of the mutant sequence was as low as
of one PCR primer for library amplification27. This universal approximately 1 in 2,000, while the qPCR limit of detection was 1 to 10. The limit of
detection for dPCR may be further extended by aggregating data across multiple
template probe-based assay may be utilized in conjunction wells in order to increase the number of partitions.
with dPCR to quantify library molecules accurately.
Expression of genes that control cellular activity, including
cell differentiation, varies among individual members of cell
Digital PCR MIQE
populations and whole population measurements reflect the Previously the “Minimum Information for Publication of
average values28. Although it may be preferable to measure Quantitative Real-time PCR Experiments” (MIQE guidelines30)
transcription in single cells, the amount of RNA present is were published to outline experimental design details that
very small, i.e., <1pg29. The regular workflow for single cell are categorized as essential or desirable for publication of
transcriptome analysis using qPCR requires a pre-amplification qPCR results (see Chapter 3). The addition of dPCR as a new
step to amplify cDNA. Due to the dynamic range and ability tool and the introduction of multiple dPCR instruments,
to quantify low concentrations of template, dPCR is a suitable necessitates development of MIQE standards specific for dPCR.
method for single cell transcript analysis without the use of The published digital PCR MIQE (dMIQE) proposes essential
pre-amplification. and desirable elements to consider for validity of dPCR
data31. In many aspects, including primer/probe design and
optimization, the requirements for dPCR are similar to qPCR.

PCR Technologies: A Technical Guide 23


Chapter 4
However, there are properties that are specifically relevant to 12. Morrison, T., Hurley, J., Garcia, J., et al. Nanoliter high throughput
dPCR. The average copies per partition and partition volume quantitative PCR. Nucleic Acids Res 2006; 34: e123
13. Pekin, D., Skhiri, Y., Baret, J.C., et al. Quantitative and sensitive detection
are variable and the values are necessary to apply Poisson
of rare mutations using droplet-based microfluidics. Lab Chip 2011; 11:
statistics accurately and therefore should be reported. Also, the 2156-2166
number of partitions from which the results are derived must 14. Zhong, Q., Bhattacharya, S., Kotsopoulos, S., et al. Multiplex digital PCR:
be documented. It is desirable to include the partition volume breaking the one target per color barrier of quantitative PCR. Lab Chip
variance and standard deviation, as provided by instrument 2011; 11: 2167-2174
manufacturer. It is essential to include the type and treatment 15. Brouzes, E., Medkova, M., Savenelli, N., et al. Droplet microfluidic
technology for single-cell high-throughput screening. Proc Natl Acad Sci
of template DNA used in the experiment. The template DNA
U S A 2009; 106: 14195-14200
is often pre-amplified or digested with restriction enzymes.
16. Hindson, B.J., Ness, KD., Masquelier, D.A., et al. High-throughput droplet
These methods and corresponding controls, must be reported. digital PCR system for absolute quantitation of DNA copy number. Anal
It is desirable to record optimization experiments, such as Chem 2011; 83: 8604-8610
temperature gradient and cycle number determinations. 17. Fan, H.C., Blumenfeld, Y.J., El-Sayed ,Y.Y., et al. Microfluidic digital PCR
The sample volume needed is variable among instruments enables rapid prenatal diagnosis of fetal aneuploidy. Am J Obstet Gynecol
2009; 200: 543-547
and therefore is appropriate and desirable to include. As is
18. Beer, N.R., Hindson, B.J., Wheeler, E.K., et al. On-chip, real-time, single-copy
necessary with all published reports, positive and negative
polymerase chain reaction in picoliter droplets. Anal Chem 2007; 79:
reaction controls and calculated variance and confidence 8471-8475
intervals are required. The dMIQE checklist outlines the 19. Didelot, A., Kotsopoulos, S.K., Lupo, A., et al. Multiplex picoliter-droplet
considerations and designates each as essential (E) or digital PCR for quantitative assessment of DNA integrity in clinical
desirable (D). samples. Clin Chem 2013; 59: 815-823
20. Shlien, A., Malkin, D. Copy number variations and cancer susceptibility.
Since dPCR is still a relatively new technology, there is the Curr Opin Oncol 2010; 22: 55-63
hope that early adoption of the dMIQE guidelines will prevent 21. Shlien, A., Malkin, D. Copy number variations and cancer. Genome Med
the publication of studies that were conducted without 2009; 1: 62
appropriate quality and scientific controls. 22. Ionita-Laza, I., Lange, C., Laird, M. Estimating the number of unseen
variants in the human genome. Proc Natl Acad Sci U S A 2009; 106:
5008-5013
References
23. Moroni, M., Veronese, S., Benvenuti, S., et al. Gene copy number for
1. Sykes, P.J., Neoh, S.H., Brisco, M.J., et al. Quantitation of targets for PCR by
epidermal growth factor receptor (EGFR) and clinical response to
use of limiting dilution. Biotechniques 1992; 13: 444-449
antiEGFR treatment in colorectal cancer: a cohort study. Lancet Oncol
2. Kalinina, O., Lebedeva, I., Brown, J., et al. Nanoliter scale PCR with TaqMan 2005; 6: 279-286
detection. Nucleic Acids Res 1997; 25: 1999-2004
24. Cappuzzo, F., Toschi, L., Domenichini, I., et al. HER3 genomic gain and
3. Vogelstein, B., Kinzler, K.W. Digital PCR. Proc Natl Acad Sci U S A 1999; 96: sensitivity to gefitinib in advanced non-small-cell lung cancer patients. Br
9236-9241 J Cancer 2005; 93: 1334-1340
4. Dressman, D., Yan, H., Traverso, G., et al. Transforming single DNA 25. Cappuzzo, F., Varella-Garcia, M., Shigematsu, H., et al. Increased HER2
molecules into fluorescent magnetic particles for detection and gene copy number is associated with response to gefitinib therapy in
enumeration of genetic variations. Proc Natl Acad Sci U S A 2003; 100: epidermal growth factor receptor-positive non-small-cell lung cancer
8817-8822 patients. J Clin Oncol 2005; 23: 5007-5018
5. Whale, A.S., Huggett, J.F., Cowen, S., et al. Comparison of microfluidic 26. Takano, T., Ohe, Y., Sakamoto, H., et al. Epidermal growth factor receptor
digital PCR and conventional quantitative PCR for measuring copy gene mutations and increased copy numbers predict gefitinib sensitivity
number variation. Nucleic Acids Res 2012; 40: e82 in patients with recurrent non-small-cell lung cancer. J Clin Oncol 2005;
6. Pinheiro, L.B., Coleman, V.A., Hindson, C.M., et al. Evaluation of a droplet 23: 6829-6837
digital polymerase chain reaction format for DNA copy number 27. Zhang, Y., Zhang, D., Li, W., et al. A novel real-time quantitative PCR
quantification. Anal Chem 2012; 84: 1003-1011 method using attached universal template probe. Nucleic Acids Res 2003;
7. White, R.A., III, Blainey, P.C., Fan, H.C., et al. Digital PCR provides sensitive 31: e123
and absolute calibration for high throughput sequencing. BMC Genomics 28. Li, G.W., Xie, X.S. Central dogma at the single-molecule level in living cells.
2009; 10: 116 Nature 2011; 475: 308-315
8. Qin, J., Jones, R.C., Ramakrishnan, R. Studying copy number variations 29. Bengtsson, M., Stahlberg, A., Rorsman, P., et al. Gene expression profiling
using a nanofluidic platform. Nucleic Acids Res 2008; 36: e116 in single cells from the pancreatic islets of Langerhans reveals lognormal
9. Sanders, R., Huggett, J.F., Bushell, C.A., et al. Evaluation of digital PCR for distribution of mRNA levels. Genome Res 2005; 15: 1388-1392
absolute DNA quantification. Anal Chem 2011; 83: 6474-6484 30. Bustin, S.A., Benes, V., Garson, J.A., et al. The MIQE guidelines: minimum
10. Spurgeon, S.L., Jones, R.C., Ramakrishnan, R. High throughput gene information for publication of quantitative real-time PCR experiments.
expression measurement with real time PCR in a microfluidic dynamic Clin Chem 2009; 55: 611-622
array. PLoS One 2008; 3: e1662 31. Huggett, J.F., Foy, C.A., Benes, V., et al. Guidelines for Minimum Information
11. Blow, N. PCR’s Next Frontier. Nature Methods 2007; 4: 869-875 for Publication of Quantitative Digital PCR Experiments. Clin Chem 2013:
892-902

24 [Link]
Quantitative PCR and Digital PCR Detection Methods

Chapter 5:
Quantitative PCR and Digital PCR Detection Methods

Introduction Action of SYBR Green I Dye

Fluorescent dyes or probes are included in PCR mixes to


monitor the change in DNA amplicon concentration as the
reaction proceeds. Several popular detection methods, that
are well established for the indirect measurement of template
in qPCR, are discussed in this chapter. In addition, Dual-labeled 1. Dye in solution emits 2. Emission of the
low fluorescence fluorescence by binding
Probes and some DNA-binding dyes have been shown to work
well in digital PCR (dPCR). Figure 5.1. SYBR Green I dye cycles between an unbound (denatured) and a bound
(annealing through extension) state as the reaction progresses and signal intensity
increases as the quantity of amplicons increase.
dsDNA-Binding Dyes Table 5.1. Spectral Characteristics of SYBR Green I Dye.
Double-stranded DNA (dsDNA) binding dyes function as
intercalating and/or minor groove binding agents and emit Excitation Emission
Name Maximum (nM)a Maximum (nM)a
detectable fluorescence when bound to dsDNA but have
Reporter Dye
a very low background when free in solution. Therefore,
SYBR Green 1 497 520
fluorescent signal intensity increases proportionately to the a
When complexed to dsDNA
quantity of amplicon present. Double-stranded DNA-binding
dyes are popular because they are a low cost detection option 13000
and do not require additional design considerations. 12000
Specific amplification
11000
SYBR® Green I Dye 10000
9000
This dye is the most popular dsDNA-binding dye and has a
Fluorescence, -R’(T)

8000 Nonspecific amplification


long history of use in molecular biology. When free in solution, 7000
with only single-stranded DNA (ssDNA) present, SYBR Green I 6000
dye emits a signal of low intensity (Figure 5.1, Table 5.1). As 5000
the PCR progresses and the quantity of dsDNA increases, 4000
more dye binds to the amplicons and hence, signal intensity 3000

increases (see the animation on the following web page 2000


1000
[Link]/sybr-animation).
0
However, since the dye binds to all amplified products 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
indiscriminately, artefacts such as those resulting from primer Temperature (°C)
dimers or nonspecific binding of the primers also contribute Figure 5.2. Example Melt Curve Analysis. dsDNA-binding dyes bind reversibly, so
to the overall fluorescence. This can make it difficult to fluorescence intensity decreases as the reaction temperature increases above the
obtain accurate quantification, especially at low template melting temperature (Tm). In conjunction with controls, this type of analysis enables
the detection of nonspecific products which melt at different temperatures than
concentrations. However, a post-PCR melt curve analysis can the specific product.
help determine reaction specificity1 (Figure 5.2).

PCR Technologies: A Technical Guide 25


Chapter 5

Probes
In all applications of qPCR, the amplification reaction is driven
by specific forward and reverse primers. However, unlike 5’ Reporter
3’ Quencher 3’ Quencher
assays relying on detection using dsDNA-binding dyes, probe Taq
detection systems do not include a free dye but rather a third DNA
polymerase
oligonucleotide (and sometimes a fourth) conjugated to a
reporter dye and/or a quencher moiety. Amplified Target DNA

1. Probe in solution emits 2. Emission of the fluorescence


Dual-Labeled Probes low fluorescence by hydrolysis

Dual-Labeled Probes (also known as hydrolysis or alternatively Figure 5.3. Mechanism of Dual-Labeled Probes. Taq DNA polymerase extends the
TaqMan® probes) are used in the 5’ nuclease assay2,3, which primer situated on the same strand as the probe until it reaches the probe position.
The inherent exonuclease activity hydrolyzes the probe from 5’ to 3’, which releases
is the most popular probe detection chemistry (Figure 5.3; the reporter dye into solution and thereby causes an increase in fluorescence. The
also see the animation of the following web page: measured fluorescence signal is directly proportional to the amount of target DNA.
[Link]/probe-animation). A Dual-Labeled Probe is
a single-stranded oligonucleotide that is labeled with a Table 5.2. Spectral Characteristics of Common Dual-Labeled Probe
reporter dye and a quencher moiety. The reporter is located Reporter Dyes.
at the 5’ end and the quencher at the 3’ end. The quencher Excitation Emission Compatible
absorbs the natural fluorescence emission of the reporter, Name Maximum (nm) Maximum (nm) Quencher
usually by Forster-type energy transfer, more commonly Reporter Dye
referred to as fluorescence resonance energy transfer (FRET). 6-FAM™ 494 515 BHQ®-1, TAMRA
After amplification from the forward primer, the Taq DNA JOE™ 520 548 BHQ-1, TAMRA

polymerase encounters the probe. The 5’ exonuclease activity TET™ 521 536 BHQ-1, TAMRA
Cal Fluor® Gold 540a 522 541 BHQ-1
inherent in the Taq DNA polymerase then separates the 5’
HEX™b 535 555 BHQ-1, TAMRA
reporter from the 3’ quencher (Table 5.2, Figure 5.3), which
Cal Fluor Orange 560b 540 561 BHQ-1
provides a fluorescent signal that is proportional to the
TAMRA™ 555 576 BHQ-2
amplicon yield. Cyanine 3 550 570 BHQ-2
The hydrolysis probe assay is specific and accurate for Quasar® 570c 548 566 BHQ-2
quantification of low copy number targets. Specificity can Cal Fluor Red 590d 565 588 BHQ-2
be improved even further by the inclusion of modified ROX™ 573 602 BHQ-2

nucleotides such as LNA® in the probe (as described below). Texas Red® 583 603 BHQ-2
Cyanine 5 651 674 BHQ-3
LNA modified probes are particularly useful for differentiating
Quasar 670e 647 667 BHQ-3
between single nucleotide polymorphisms (SNPs) or other
Cyanine 5.5 675 694 BHQ-3
similar sequences. Dual-Labeled Probes require careful design a
JOE/TET alternative c
Cyanine 3 alternative e
Cyanine 5 alternative
(see Chapter 6) and are generally more expensive than b
VIC® alternative d
TAMRA alternative
dsDNA-binding dyes. Furthermore, while amplification of Most real-time PCR thermal cyclers have multiple detection channels enabling flexibility in the
nonspecific products may remain undetected, side reactions choice of probe labels. It is critical to select the reporter dyes that are compatible with the detec-
tion channels for the instrument and ensure that the correct filters and calibration are in place.
may cause the overall reaction to be less efficient and so assays When multiplexing, reporter combinations are required that are as distinct as possible from each
containing probes may still benefit from optimization (see other to minimize optical cross talk. Typical reporters include: FAM, HEX, Texas Red and Cyanine 5.
Under identical conditions, it is usual to observe differences in emission intensity from different
Chapter 7). reporters. For this reason, it is advisable to analyze the data from each reporter combination
independently (using different threshold settings as appropriate for the probe emission).

26 [Link]
Quantitative PCR and Digital PCR Detection Methods
Molecular Beacons LightCyler® Probes
Molecular Beacons (also known as hybridization probes) A LightCycler Probe or FRET system (also known as dual-
are single-stranded probes that are held in a hairpin-loop hybridization probes) consists of a pair of single-stranded
conformation (20–25 nucleotides) by complementary stem fluorescent-labeled oligonucleotides5,6 (Figure 5.5). Oligo
sequences (4–6 nucleotides) at each terminus4 (Figure 5.4). Probe 1 is labeled at the 3’ end with a donor fluorophore
The hairpin-loop is complementary to the template and the dye and Oligo Probe 2 is labeled at the 5’ end with one of a
hydrogen-bonded stem sequences allow the 3’ quencher to few available acceptor fluorophore dyes (Table 5.4). The free
suppress the fluorescence of the 5’ reporter (Table 5.3) when 3’ hydroxyl group of Oligo Probe 2 must be blocked with a
the probe is free in solution. phosphate group to prevent DNA polymerase extension.
Loop 3’ Donor Fluorophore (FD)
Sequence Loop Sequence
5’ Reporter
Stem 3’ Quencher Oligo Probe 1 5’ Acceptor
Sequence Fluorophore (FA)
Amplifed Target DNA
Oligo Probe 2

5’ Reporter Amplified Target DNA 1. Probes in solution emit 2. Emission through fluorescence
3’ Quencher
low fluorescence resonance energy tranasfer
1. Unbound beacon with 2. Bound beacon with
Figure 5.5. Mechanism of LightCycler FRET Probes. During the annealing step, the
quenched fluorescence unquenched fluorescence
primers and both of the probes hybridize to their specific target regions, bringing
the donor dye into close proximity to the acceptor dye (the probes are usually
Figure 5.4. Mechanism of Molecular Beacons. Molecular Beacons hybridize to their
spaced 1 to 5 nucleotides apart). When the donor is excited by light from the real-
specific target sequence causing the hairpin-loop structure to open, separating
time PCR instrument, energy is transferred by FRET from the donor to the acceptor.
the 5’ reporter from the 3’ quencher. As the quencher is no longer in proximity
The emission wavelength for the dye on the acceptor probe is detected. The
to the reporter, fluorescence emission takes place. Unlike Dual-Labeled Probes,
increase in fluorescence signal is directly proportional to the amount of target DNA.
the mechanism of detection of Molecular Beacons does not rely on degradation
during the reaction. The measured fluorescence signal is directly proportional to the
amount of target DNA. Table 5.4. Spectral Characteristics of LightCycler Acceptor and Donor
Fluorophore Dyes.
Table 5.3. Spectral Characteristics of Common Molecular Beacons Excitation Emission
Reporter Dyes. Name Maximum (nm) Maximum (nm)
Excitation Emission Compatible Oligo Probe 1: Donor Fluorophore
Name Maximum (nm) Maximum (nm) Quencher 3’ Donor Fluorophore (Fluorescein) 495 520
Reporter Dye Oligo Probe 2: Acceptor Fluorophore/Reporter Dye
6-FAM™ 494 515 BHQ®-1, DABYCL 5’ Acceptor Fluorophore N/A 610, 640, 670,
Fluorescein 495 520 BHQ-1, DABYCL (LC Red 610, 640, 670, and 705) and 705
JOE™ 520 548 BHQ-1, DABYCL
TET™
HEX™
521
535
536
555
BHQ-1, DABYCL
BHQ-1, DABYCL
Scorpions® Probes
Cyanine 3 550 570 BHQ-2, DABYCL Scorpions® probes are available in two forms; uni-probe and
ROX™ 573 602 BHQ-2, DABYCL bi-probe. The uni-probe consists of a stem-loop structure,
Texas Red® 583 603 BHQ-2, DABYCL similar to a Molecular Beacon but this is attached to the
Cyanine 5 651 674 BHQ-3, DABYCL forward primer with a PCR blocker located between the two
Cyanine 5.5 675 694 BHQ-3, DABYCL oligo sections7 (the blocker prevents Taq DNA Polymerase from
extending the primer (Figure 5.6A, Table 5.5).
The bi-probe structure is a duplex with the 5’ reporter, probe
sequence, PCR blocker and forward primer on one strand and
the 3’ quencher on the other strand; the quencher strand is
duplexed with the reporter strand (Figure 5.6B).

PCR Technologies: A Technical Guide 27


Chapter 5
A) Scorpions® Uni-probe Mechanism
Blocker
Loop
Sequence
Quenchers
Loop
Sequence Most probe detection systems require a quencher moiety.
Internal
Stem Quencher 5’ Reporter Some of those used in the original probes structures were
Sequence Q acceptor fluorescent dyes, e.g., TAMRA, which work well with
Internal R
Quencher FAM but are not suitable for other dyes. As a reporter dye
R Q
PCR Primer PCR Primer itself, TAMRA produces fluorescence and therefore can result
5’ Reporter Newly Synthesized
DNA Strand in a poor signal-to-noise ratio. For this reason, dark quenchers
Blocker Target DNA Complementary Sequence which emit heat instead of light, such as Black Hole Quencher®
1. Quenching of the fluorescence 2. Emission of the fluorescence (BHQ®) were developed by Biosearch Technologies. The choice
of dark quenchers as popular alternatives to dye molecules
B) Scorpions® Bi-probe Mechanism provides quenching over a wide range of wavelengths and
Complementary
Sequences Probe opens the possibility of multiplex reactions containing a larger
Blocker Sequence number of target/probe combinations.
3’ Quencher
Q
5’
5’ Reporter Onyx Quencher™ (OQ™) is a proprietary dark quencher from
PCR Primer hγ1 Sigma-Aldrich. Four derivative versions (OQA, OQB, OQC
R
5’ Reporter
3’ and OQD) are available. As shown in Table 5.6, the four
PCR Primer
3’ Newly
Onyx Quenchers are compatible with a variety of popular
hγ1
Target DNA
Synthesized reporter dyes.
Blocker Complementary DNA Strand
Sequences
The data presented in Figure 5.7 show amplification of an
1. Quenching of the fluorescence 2. Emission of the fluorescence artificial template that was derived from a synthetic oligo
Figure 5.6. Mechanism of Scorpions® Probes. The uni-probe A) has all probe for the optimization of a Schistosoma mansoni target assay8.
components on one strand, whereas the bi-probe B) has the probe components Detection was using a FAM-labeled probe with a comparable
on two strands. Both formats of Scorpions® Probes include the forward PCR primer.
dark quencher, CDQ (A) or OQA (B). From these data, it is
This forward primer is extended to become part of the newly formed amplicon.
During annealing/extension, the probe sequence in the Scorpions® hybridizes evident that both the CDQ and the OQA have equivalent
to the template, which separates the reporter from the quencher and thereby performance, with similar background fluorescence and
results in a fluorescent signal. As the tail of the Scorpions® and the amplicon are
similar Cq values for analyzed data from template of the same
part of the same strand, the detection interaction is intramolecular and therefore
more rapid than other probe detection systems. The template is typically chosen concentration.
to be between 5 and 50 bases from the 3’ end of the Scorpions® primer. Both the
uni-probe and bi-probe Scorpions® require a separate reverse primer. In summary, OQ is equivalent in performance to CDQ and
importantly, is available license, restriction and royalty free for
Table 5.5. Spectral Characteristics of Common Scorpions® any application. This makes the Onyx Quencher an excellent
Reporter Dyes. and cost effective choice for the development of commercial
Excitation Emission Compatible kits and reagents for molecular diagnostics that contain qPCR
Name Maximum (nm) Maximum (nm) Quencher probes.
Uni-Probe and Bi-Probe: Reporter Dye
6-FAM™ 494 515 BHQ®-1, DABYCL dT
Table 5.6. Onyx Quencher or OQ is Compatible with a Variety of
JOE™ 520 548 BHQ-1, DABYCL dT
Common Reporter Dyes.
TET™ 521 536 BHQ-1, DABYCL dT Name Compatible Quencher
HEX™ 535 555 BHQ-1, DABYCL dT Reporter Dye
Rhodamine Green™ 504 532 BHQ-1, DABYCL dT FAM, HEX, TET, JOE, Rhodamine 6G OQA
Oregon Green® 488 490 514 BHQ-1, DABYCL dT TAMRA, Cyanine 3 OQB
Oregon Green 514 489 526 BHQ-1, DABYCL dT ROX, Texas Red OQC
TAMRA™ 555 576 BHQ-2, DABYCL dT Cyanine 5, Cyanine 5.5 OQD
Cyanine 3 550 570 BHQ-2, DABYCL dT
ROX™ 573 602 BHQ-2, DABYCL dT
Texas Red® 583 603 BHQ-2, DABYCL dT
Cyanine 5 651 674 BHQ-3, DABYCL dT
Cyanine 5.5 675 694 BHQ-3, DABYCL dT

28 [Link]
Quantitative PCR and Digital PCR Detection Methods
A) LNA® also provides protection against nuclease digestion
making it suitable for in vivo use12.

CDQ

OQA LNA Monomer DNA Monomer


Figure 5.8. Comparison of LNA and DNA nucleotide structures. LNA differs from
DNA in that LNA contains ribose with a methylene bridge between the 2’ oxygen
B) and 4’ carbon, which ‘locks’ the ribose in the 3’ endo conformation, whereas DNA
3000 contains 2’-deoxyribose with no methylene bridge.
2800

2600

Zip Nucleic Acid (ZNA®)


2400

2200
2000
Fluorescence (norm)

1800
1600

1400
ZNA-modified oligos have been demonstrated to increase
1200

1000
hybridization affinity for their targets by decreasing the
800
600
electrostatic repulsions resulting from the polyanionic nature
400
200
of nucleic acids13. This is achieved by conjugating spermine
0
derivatives as cationic moieties (Z units) to an oligonucleotide
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
Cycle
(Figure 5.9). ZNA molecules are versatile as the number
Figure 5.7. Dilutions of an artificial oligo were amplified using 250 nM primers and of Z units is variable and can be placed throughout the
the amplicon detected with a Dual-Labeled Probe at 200 nM. A) The probe was oligonucleotide: 5’, 3’ or internal. By selecting the number of
labeled with FAM and quenched with CDQ or OQA (as indicated) and the raw fluo-
rescence data are shown. B) The probe was labeled with FAM and quenched with cationic units, the global charge of the ZNA molecule can
CDQ or OQA and the baseline corrected data are shown. There are no significant be modulated.
differences between the performances of either probe.
ZNA™ Molecule Single-stranded DNA

Nucleic Acid Analogs oligocationic tail Target sequence

A number of modifications can be used to produce ZNA™

oligonucleotides with altered biochemical properties. These


oligonucleotide

modifications generally confer a higher Tm which can be


manipulated to provide improved specificity. This allows for m-1
assay design in regions of challenging sequence or when a Global charge: 3n-(m-1)

single oligonucleotide is required to detect several sequences,


e.g., all serotypes of a virus.
A) Oligonucleotide with Z Unit B) Mechanism of Action

Locked Nucleic Acid™ (LNA®) Figure 5.9. ZNA structure and mechanism. A) Structure of oligonucleotide with
LNA® is an RNA analog base (Figure 5.8) that yields enhanced Z unit at the 5’ end. The number and placement of the units is variable.
B) ZNA functions by reducing the charge repulsion between the oligonucleotide
sensitivity and specificity when incorporated into probes9. and target and hence, zips up the molecules.
Probes with LNA bases have greater thermal stability and
therefore hybridize more strongly to the template. Each LNA ZNA oligos are reported to be easy to design and specific,
base may increase the Tm of the probe by up to 8 °C10, which offer improved performance at high annealing temperatures,
makes LNA a powerful tool in SNP discrimination assays11 (a effective at very low concentrations, provide robust
single base mismatch has a greater destabilizing effect on amplification in AT-rich regions and efficient under short
duplex formation than without LNA), multiplexing (allows for cycling conditions14.
simpler Tm optimization) and problematic target sequences
(LNA probes can be shorter, which allows them to be designed
around problems such as AT- or GC-rich regions, repetitive
sequences, or sequences with significant secondary structure).

PCR Technologies: A Technical Guide 29


Chapter 5

Summary References
1. Ririe, K.M., Rasmussen, R.P., Wittwer, C.T. Product differentiation by analysis
There are many considerations when selecting a detection of DNA melting curves during the polymerase chain reaction. Anal
method for a particular application. While SYBR Green I dyes Biochem 1997; 245: 154-160
and Dual-Labeled Probe assays are popular and generally work 2. Holland, P.M., Abramson, R.D., Watson, R., et al. Detection of specific
polymerase chain reaction product by utilizing the 5’----3’ exonuclease
well, there are situations in which the other detection systems activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A
might be preferable. Table 5.7 can be used as guidance during 1991; 88: 7276-7280
early assay development. 3. Heid, C.A., Stevens, J., Livak, K.J., et al. Real time quantitative PCR. Genome
Res 1996; 6: 986-994
Table 5.7. Relative Effectiveness of Detection Methods for 4. Tyagi, S., Kramer, F.R. Molecular beacons: probes that fluoresce upon
Common Applications. hybridization. Nat Biotechnol 1996; 14: 303-308
Dual- 5. Wittwer, C.T., Herrmann, M.G., Moss, A.A., et al. Continuous fluorescence
SYBR Labeled Molecular LightCycler Scorpions® monitoring of rapid cycle DNA amplification. Biotechniques 1997; 22:
130-138
Application Green I Probes Beacons Probes Probes
6. Bernard, P.S., Ajioka, R.S., Kushner, J.P., et al. Homogeneous multiplex
Mass Screening XX
genotyping of hemochromatosis mutations with fluorescent
Microarray Validation XX x
hybridization probes. Am J Pathol 1998; 153: 1055-1061
Multiple Target Genes/ X X
Few Samples 7. Whitcombe, D., Theaker, J., Guy, S.P., et al. Detection of PCR products
using self-probing amplicons and fluorescence. Nat Biotechnol 1999; 17:
SNP Detection X X XX
804-807
Allelic Discrimination X X XX
8. PCR Technologies: Current Innovations. 3 ed. CRC Press; 2013
Pathogen Detection X X X X XX
9. Costa, J.M., Ernault, P., Olivi, M., et al. Chimeric LNA/DNA probes as a
Multiplexing XX XX X XX
detection system for real-time PCR. Clin Biochem 2004; 37: 930-932
Viral Load X X X XX
Quantification 10. Petersen, M., Wengel, J. LNA: a versatile tool for therapeutics and
genomics. Trends Biotechnol 2003; 21: 74-81
Gene Expression X XX XX XX XX
Analysis 11. Johnson, M.P., Haupt, L.M., Griffiths, LR. Locked nucleic acid (LNA) single
Gene Copy X X X XX nucleotide polymorphism (SNP) genotype analysis and validation using
Determination real-time PCR. Nucleic Acids Res 2004; 32: e55
End-point XX XX 12. Wahlestedt, C., Salmi, P., Good, L., et al. Potent and nontoxic antisense
Genotyping oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci U S A
In vitro Quantification XX 2000; 97: 5633-5638
Blank spaces indicate that the detection method is not recommended; 13. Noir, R., Kotera, M., Pons, B., et al. Oligonucleotide-oligospermine
X = good performance; and XX = better performance. conjugates (zip nucleic acids): a convenient means of finely tuning
hybridization temperatures. J Am Chem Soc 2008; 130: 13500-13505
14. Moreau, V., Voirin, E., Paris, C., et al. Zip Nucleic Acids: new high affinity
oligonucleotides as potent primers for PCR and reverse transcription.
Nucleic Acids Res 2009; 37: e130.

30 [Link]
PCR/qPCR/dPCR Assay Design

Chapter 6:
PCR/qPCR/dPCR Assay Design

Introduction When using qPCR for the final readout, a smaller amplicon
is selected to ensure accurate quantification at each cycle.
The entire PCR workflow is vulnerable to factors which Ideally a qPCR amplicon size ranges from 75 to 200 bases in
introduce variability. Many of the variable components length, unless design restrictions take the primers beyond
are unavoidable, such as the source of the sample or the this range. In reality, the fragment size may be determined
requirement for a reverse transcription step. Assay design is by consideration of several factors, including the biology
also highly variable and can make the difference between PCR under consideration.
success and failure and also contributes to the reproducibility
and sensitivity of an assay. The process of assay design follows The assay location may be pre-determined by the objectives
a logical flow: The first step is to determine the desired of the experiment: Ideally, assays for the determination of
target location. In some cases the sequence of the oligos the presence or quantity of a mRNA target are located over
is determined by the application and cannot be avoided, an exon–exon junction to avoid detection of contaminating
e.g., SNP detection, in others the entire gene may be used, gDNA sequences. However, these regions are often highly
e.g., copy number determination. Once the approximate assay folded; therefore a pragmatic decision is required as to the
sites are selected, the most suitable primers are identified preference for an exon spanning assay with potentially
and modifications determined. When assays are to be run poorer performance or an exonic assay of higher quality. If
in multiplex it is important to consider the potential for the mRNA is abundant and transcribed from a single copy
interaction of all oligos in the reaction and also the relative gene, the contribution of signal from gDNA contamination
abundance of the targets. In challenging situations, e.g., where will be considerably less significant than when detecting a
the objective is to detect very low copy numbers or small low abundant transcript from a multicopy gene. Detection of
differences in target concentration, it is advisable to select and SNPs requires location of a probe or the 3’ of a primer over the
test several primer combinations and then combine with a mismatch site.
suitable probe. Analysis of splice variants requires a design approach that is
The process of assay design is greatly facilitated by adoption specific to the objective. In some cases it is desirable to detect
of suitable design software. OligoArchitect, provided by all splice variants simultaneously and this is simply achieved
Sigma‑Aldrich ([Link]/probedesignonline), provides two by selecting an exon boundary that is conserved between all
options for design support. The first is OligoArchitect Online, variants. However, investigations into differential expression
a software design tool with a wide range of options. If the of each splice variant require a more creative approach. In
design requires a specialized capability, the second option is one example experiment, the objective is to examine which
to request the design via OligoArchitect Consultative, utilizing of the alternative transcripts, shown in Figure 6.1, are being
the assistance of Sigma’s expert, molecular biologists. expressed. Since the exons are relatively small, amplification
across all exons results in a product of around 300 bases, with
smaller products resulting from amplification of splice variants.
Amplicon Selection The design options for this study would be:
The amplicon is the region of target sequence that is to be
analyzed and is encompassed by the forward and reverse • Design several assays across each exon junction and probe
each sample with each assay.
PCR primers. The determination of the amplicon size is, in
part, dependent on the method to be used for analysis. When • Design a primer to the 3’ of exon 1 and the 5’ of exon 4.
visualizing PCR fragments by gel electrophoresis, the PCR Amplification of any transcript comprised of any
fragment needs to be large enough to be stained efficiently combination of exons would result in an amplicon of a
using a DNA binding dye and fit within the range of the specific length. The definition of the transcript would be
chosen artificial size marker. Similarly, when resolving the determined using a qPCR, post reaction SYBR Green I dye
fragment through a capillary electrophoresis instrument, the melt curve.
PCR product will be between 100 base pairs and anywhere
over 2 kb (eventually restricted by enzyme performance).

PCR Technologies: A Technical Guide 31


Chapter 6
Coding DNA • Identify regions of homology or heterogeneity (as required)
when designing assays to gene families. Sequences should
Transcript then be aligned and examined for stretches of suitable
Product ~300
118 143 100 consensus sequence.
Transcript 2
Product ~200
• For transcript-specific designs (to avoid detection of gDNA
templates), target regions over an exon-exon junction
Transcript 3 where possible.
Product ~160

Transcript 4 Transcript-specific Amplicon Selection


Product ~60
Most, but not all, DNA is eliminated from the sample during
RNA purification. To avoid DNA amplification during RT-qPCR,
Figure 6.1. A schematic representation of a gene expressed as four potential splice
variants. Each splice variant can be distinguished by design of specific primer pairs
it is advisable to select primers that either flank a large intron
across each exon junction or by amplification from a generic primer pair in exons that is not present in the mRNA sequence or that span an
1 and 4 and differentiation of the splice variants using qPCR, SYBR Green I dye exon-exon junction (Figure 6.2).
melt analysis.
Intron/exon annotations for known genes from many
In general, amplicon sequences should be assessed using the vertebrate, bacteria, protist, fungi, plant and invertebrate
following criteria: metazoan species are available at the EnsemblGenomes
• An initial assessment of the region of the target sequence website ([Link] Alternatively, if both
is recommended. genomic and cDNA sequences for the target gene are publicly
available, intron positions can be identified by performing a
• Ensure that there are no unexpected SNPs. A single
BLAST search with the cDNA sequence against the genomic
mismatch between the primer and the template can
database for the target organism (Figure 6.3). Intron 1 in
decrease the melting temperature by up to 10 °C, affecting
Figure 6.3 is long enough (~6.5 kb) that DNA should not be
the efficiency of PCR.
amplified under conventional qPCR conditions or controlled
• Confirm that the selected sequence does not have PCR conditions. However, all other introns are relatively short
homology to any other sequence in the genome/ (<1 kb), thus the DNA is likely to be amplified during RT-qPCR
transcriptome of the target species. When targeting multi- (for an example, see Chapter 9). Primers should either span
organism systems, e.g., pathogen detection, the homology exon-exon junctions, flank a long (several kb) intron, or flank
determination must include all sequences that may be in multiple small introns.
the sample.
A) Primers span intron
• Test the potential for the target sequence to adopt
DNA:
P2 P2

a secondary structure using the folding algorithm of P1 P1


OligoArchitect ([Link]/probedesignonline), the P2
selected design software or mfold ([Link] mRNA:
P1
[Link]/) to model the template folding at the desired
primer annealing temperature. Select template regions B) Primers flank intron
that have a predicted open structure by avoiding stem P4
DNA:
loop secondary structures with very negative ΔG values. P3
This is an important consideration when using a one-step P4
reverse transcription protocol and gene-specific primers. mRNA:
P3
• Avoid palindromic sequences and repetitive regions.
Figure 6.2. Illustration of (A) intron-spanning and (B) intron-flanking primers
• Avoid G/C rich areas, aiming for approximately 50% GC for RT-PCR. Introns are in red and exons are in green. Primers P1 and P2 span an
intron and primers P3 and P4 flank an intron. Note that primers P1 and P2 will not
content.
generate a PCR product from DNA unless the annealing temperature is extremely
• When multiplex assays are being designed the amplicons low. P3 and P4 may generate a longer PCR product from DNA if the intron is short
(~1 kb), but not if it is sufficiently long (several kb).
should be as similar as possible, in length and CG content,
to avoid biased amplification.

32 [Link]
PCR/qPCR/dPCR Assay Design
gDNA cDNA General Design Criteria for Primers
For the majority of applications, primers are designed to be
fully complementary to the template DNA sequences that
they are intended to prime. The basic design considerations for
PCR primers include:
• Primers are typically 20–24 nucleotides in length with a
melting temperature (Tm) of approximately 60 °C
(59±2 °C) for qPCR but may vary (55±5 °C) for conventional
PCR. Specific applications may require modifications to
primer length and Tm.
• Primer pairs should possess 40–60% GC content and
should lack significant secondary structure.
Figure 6.3. BLAST alignment of cDNA sequence with genomic DNA sequence.
The complete cDNA sequence for rat p53 from Genbank (accession number
• Primers should not be complementary to themselves or
NM_030989) was used in a megaBLAST search for identical sequences in the rat
partner primers, particularly at the 3’ end. This reduces
genome ([Link] The align- the potential for the formation of primer-dimer products
ment of the cDNA to the gDNA on chromosome 10 is shown. Using this informa- during amplification.
tion, the exons of the cDNA can be aligned to the corresponding gDNA regions
and primer design is directed towards exons that are separated by long introns, • Avoid 3’ clamping (examine the 5 bases of the 3’ and
e.g., exons 1 and 2. accept 3 of these as A or T and 2 as G or C).
• Avoid runs of the same nucleotide that are longer than 4
Methylation-specific Assays repeats or palindromic regions.
DNA methylation is a crucial part of cellular differentiation,
causing gene expression to be altered in a stable manner.
SNP-specific Primers
Methylation is important for normal development in higher In some cases, such as when designing single-nucleotide
organisms and can be inherited. Gene regulation via DNA polymorphism (SNP) assays, there is no flexibility for the
methylation involves the addition of a methyl group to location of the assay and the surrounding sequence will
position 5 of the cytosine pyrimidine ring or nitrogen 6 also influence the sequence of the selected oligos. The
of the adenine purine ring. In adult somatic tissues, DNA recognition of the association between clinical conditions
methylation typically occurs in a CpG dinucleotide context and both germline and acquired somatic SNPs continues
whereas non-CpG methylation is prevalent in embryonic stem to drive considerable efforts into the development of
cells. Methylation specific assays require identification of CpG increasingly sensitive and specific detection systems. This
islands within the sequence, often within the gene promoter reflects the challenging nature of SNP discrimination using
region. This information is automatically located when using oligo hybridization. The challenge is due to the differences
Beacon Designer (Premier Biosoft) and is available at in destabilization between different mismatches. Where G:A,
[Link] C:T and T:T may have a strong destabilizing effect, G:T and
C:A are much weaker because hydrogen bonds can form
and therefore it is difficult to discriminate these pairings from
Primer Design the natural G:C and T:A. Many systems are adaptations of the
While the general primer and probe design suggestions Amplification-Refractory Mutation System (ARMS)1 that has
described in this chapter are applicable to numerous been widely used and was instrumental in screening for cystic
applications including gene expression studies, SNP detection, fibrosis mutations2. ARMS primers are 30 bases long (longer
methylation detection studies, copy number determination, primers, up to 60 bases are functional). The base at the 3’ is SNP
monitoring viral load and splice variant quantification, each specific and therefore specific for the target sequence (normal
application also has specific design considerations which will or mutant base). An additional mismatch is introduced at the
be discussed separately. penultimate position. This is determined with consideration
to the neighboring bases and the SNP mismatch (Table 6.1
adapted from Little, 2001).

PCR Technologies: A Technical Guide 33


Chapter 6
Table 6.1. Selection of Penultimate Base Mismatch for ARMS Primers. Multiplex PCR
3’ Base Amplification of several targets simultaneously in multiplex
in Primer Mismatch Base in Template Coding Strand Base Pairing to PCR is required when there is a desire to increase throughput
Matching of Mutant under Terminal Penultimate Base in Primer
with more PCRs per tube or to save sample material. Primer
to WT SNP Bases of Primer A C G T
A A A G A G
design is the most critical factor to successful multiplex PCR.
G A C T A G
It is crucial that the general guidelines are followed and that
C A G A C T compatibility is verified for all the primers (and probes) to be
T T C T A G included in the reaction. In some cases it can be advantageous
G T G A T C or T to use slightly longer primers with a Tm of around 65 °C. If
C T C T A G the resulting amplicons are to be analyzed based on size
C C C T A G discrimination, the resolving power of the analysis must be
G G A G A G considered in the assay design. When attempting to quantify
Reprinted with permission of Current Protocols in Human Genetics. Little, S. 2001. Amplification- multiple targets using qPCR, the amplicons should be as
Refractory Mutation System (ARMS) Analysis of Point Mutations. Curr. [Link]. Genet. similar as possible to avoid amplification bias. In addition to
7:9.8.1–9.8.12.
the primers, it is important that the template cannot adopt
Table 6.2. An Example of the Potential Hybridization Pairing of stable secondary structure as this would impede PCR. If it is
Specific and Mismatched Primers to Detect a G>A Mutation. known that the targets are present at significantly different
The addition mismatch added to the penultimate primer base results in concentrations, it may be advantageous to include a blocking
greater destabilization and prevents elongation that may occur from a primer to the high concentration target to facilitate accurate
primer which has a single mismatch at the 3’ end. detection of the lower concentration target4.
Normal Target Sequence Mutant Target Sequence
Normal Primer 3’CGTTAGACGAT.....5’ 3’CGTTAGACGAT.....5
Non-coding RNA Quantification
…………… GCAATCTGCTA……… ………………ACAATCTGCTA……… In contrast to the coding genome, it is estimated that ~97%
Normal Primer 3’CCTTAGACGAT.....5’ 3’CCTTAGACGAT.....5’ of the human transcriptome is composed of non-coding RNA
with Penultimate (ncRNA)5;6,7. One member of this family is the long non-coding
Mismatch Added ………………GCAATCTGCTA……… ………………ACAATCTGCTA………

Mutant Primer 3’TGTTAGACGAT.....5’ 3’TGTTAGACGAT.....5’


RNA which have been described as a class of regulatory
…………… GCAATCTGCTA……… ………………ACAATCTGCTA……… RNA molecules. These molecules have roles in epigenetics,
Mutant Primer 3’TCTTAGACGAT.....5’ 3’TCTTAGACGAT.....5
development, cancer and essential biological processes8,9.
with Penultimate Long ncRNAs are traditionally defined as consisting of RNA
Mismatch Added ………………GCAATCTGCTA……… ………………ACAATCTGCTA………
strands of at least 200 bases10,11,12. This means that after
Reprinted with permission of Current Protocols in Human Genetics. Little, S. 2001. Amplification- recognition of the amplicon length, no special considerations,
Refractory Mutation System (ARMS) Analysis of Point Mutations. Curr. Protoc. Hum. Genet.
7:9.8.1–9.8.12. other than those already referred to, need to be made when
designing for these targets.
Additional research groups have used similar ideas and
demonstrated the utility of introducing mismatches at the N-2 In contrast, the family members that comprise the microRNAs
and N-3 positions in the primers, Liu et al.3 have performed (miRNAs) present considerable design challenges. These
an in depth analysis of the relative positions of mismatches are short non-coding RNAs (sncRNA) of 21–23 nt that are
for the greatest destabilization effect and, therefore, produced via a complex cellular pathway at several stages of
highest specificity. transcript processing. MicroRNAs negatively regulate protein
translation by binding to the transcript (reviewed in Kato et al.,
200813) and induce the formation of the RNA induced silencing
complex (RISC)14. Commercial assays, such as the MystiCq®
(Sigma) line are a welcome solution to the design challenges
presented by miRNA. There have been several proposed
schemes for qPCR for miRNA analysis15 and for those studying
organisms for which there are no commercial products, there
are several publications describing potential solutions. Many
of these rely on addition of bases to the original miRNA by
ligation of an adapter (see Chapter 22, Casoldi, et al., in PCR
Technologies; Current Innovations ed Nolan16) or by addition

34 [Link]
PCR/qPCR/dPCR Assay Design
of a poly-A tail using polyA polymerase (PAP)17. The addition Primer Design Example
of a tag to each of the miRNA specific primers enables
optimization of hybridization Tm and reactions containing Since target sequences dictate the primer sequences, it may
DNA primers have been shown to be more efficient than not always be possible to achieve the desired design criteria.
those spiked with LNA18. In this report DNA primers specific Therefore compromises to assay design are overcome by
to miRNA were designed using conventional PCR primer assay-specific optimization. Some PCR targets may require
guidelines with additional considerations: special processing before a successful assay may be designed.
A frequently encountered case concerns the detection of
• Examine miRNA sequence and disregard all terminal A pathogens, including viruses. It is well-known that many
bases at the 3’. viruses have high degrees of variability at specific locations
• Identify the forward primer as the longest stretch of in their genomes. A good example is the Hepatitis B virus.
sequence from 5’ to the terminal 4 bases of the 3’ (ignoring In a recent study, to design a successful qPCR assay against
the A bases identified above). the known HBV variants19, it was necessary to conduct an
extensive alignment of all of the available HBV genomic
• It is preferable for one of the 2 bases at the 3’ of the forward
sequences. Several hundred sequences were compared
primer to be A or T.
using ClustalW in an attempt to find significant stretches
• It is preferable for the 3 bases at the 3’ to include 1 or 2 of consensus sequence that might be used for a generic
A or T. assay design. A snippet of the alignment result is shown
• It is preferable for the 5 bases at the 3’ to include 2–3 A or T. in Figure 6.4. The asterisks (*) represent the consensus
• Analyze the Tm of the forward primer using a nearest nucleotides found in the analysis of all of the genomes (a large
neighbor algorithm. If this is below 59 °C, add the following number of other sequences that were a part of this alignment
bases to the 5’ in the given order and calculate the Tm after are not shown due to space restrictions).
each addition: G,A,C,G,C (resulting in a primer of the form
CGCAGN18 where N are the miRNA specific bases). Select
the shortest primer with Tm closest to 59 °C. If it is above
59 °C, remove 5’ bases and calculate Tm after each base
removal. Select the longest primer with Tm closest to 59 °C.
• Select the 3’ bases for the reverse primer ensuring that
these are not complimentary to the forward primer. Assess
the terminal 5 bases as described for the forward primer.
• Add 15×T to the primer (e.g., 5’ T15 N5 3’).
• Analyze the Tm of the forward primer using a nearest
neighbor algorithm. If this is below 59 °C add the following
bases to the 5’ of the primer in the given order and
calculate the Tm after each addition:
G,A,C,C, T,G,G,A,C, C (resulting in a primer of the form
CAGGTCCAG T15 N5 where N are the miRNA specific bases). Figure 6.4: Partial ClustalW analysis of HBV genome data. All known HBV genomic
Select the shortest primer with Tm closest to 59 °C. sequences were aligned using ClustalW and conserved nucleotides identified (*)

• The RT primer is CAGCTCCAG T15 V N (where V=A, C and G When designing primers and probes in such situations, it
and N=A,C,G,T). may be necessary to use oligos that contain mixed bases,
also known as “wobbles” or degenerate bases. For example,
consider the details of the consensus sequence shown for
HBV (Figure 6.5).

Figure 6.5. A selected region of the HBV alignment showing regions of consensus

PCR Technologies: A Technical Guide 35


Chapter 6
A region of approximately twenty-three bases is required Seq 1 AATTTGAGAGTTGAAAAGCTTGAAGAAGGTGTTTTGTTCATACATCGTA
** * * * * ** * ** ** * *AC************* ** *
for a primer. In this case, when considering all possibilities of
Consensus primer: G[G/A][T/C]GTTTTGTTCATAC
sequence for all HBV genomes the actual sequence of that
twenty-three base region is shown in Figure 6.6: Consensus primer: G[R][Y]GTTTTGTTCATAC

5‘ T (C/T) CA (C/T) CA (G/A) (G/A) C (C/T/A) (C/G) T (G/T) (T/C) (T/A) (G/A) G A (T/A) (C/A) C G3‘
Figure 6.8. Sequence showing alignment consensus bases and potential primer
location to a consensus region. The consensus primer is shown using wobble codes
Figure 6.6. The permutations of primer sequence to accommodate all base options
for the selected consensus primer region When using degenerate oligos in PCR, a modified amplification
protocol may be necessary. Cycling may be started with 2–5
The positions of ambiguous base can be represented using cycles at a low annealing temperature (35–45 °C). Also, a
standard single letter codes for mixed bases (Table 6.3). When slow ramp from the annealing temperature to the extension
these are applied to the sequence shown in Figures 6.5 and temperature should be incorporated, taking approximately
6.6, the oligo can be described as in Figure 6.7. 3–5 minutes to reach the extension temperature. The protocol
Table 6.3. Single Letter Mixed Base Codes. should then be finished with 25–40 cycles at a more stringent
annealing temperature without the ramp modification.
Code Mixed Bases
B C G T It is preferable, when possible, to avoid nucleotide
D G T A heterogeneity. If is not possible to avoid regions of
H C T A heterogeneity, which is often the case with difficult targets,
K G T then the use of specialized oligo modifications, such as inosine
M C A and other “universal” bases, such as 5-nitroindole, may help
N C G T A reduce the complexity ([Link]/mods) and addition of
R G A
modifying groups such as ZNA (see Chapter 5) may improve
S C G
performance.
V C G A
W T A
Y C T Probe Design
A = adenosine, C = cytidine, G = guanosine, T = thymidine
As for PCR primers, qPCR probe design also depends largely
5‘ T Y C A Y C A R R C H S T K Y W R G A W M C G 3‘ on the sequence context and the desired application. Single
Figure 6.7. The ambiguous bases of the consensus region oligo are represented by probes such as Dual-Labeled Probes or Molecular Beacons are
standard single letter codes typically 20–30 bases long. Scorpions® Probes have a shorter
This option is unlikely to result in a successful PCR primer, probe length of 15–25 bases. In a LightCycler or FRET system,
because there are additional considerations that need to there are two probes; the sensor (probe 1) and anchor (probe
be addressed concerning the high number of degenerate 2) probes that are situated in close proximity, separated by
bases. In particular, a synthetic oligo manufactured using 1–5 bases.
this sequence would, in fact, result in a mixture of each of • When using Dual-Labeled Probes, the Tm should be 7 °C
the possible single base sequences. The number of possible, to 10 °C higher than that of the primers to ensure that the
individual primer sequences is calculated by multiplying the probe has bound to the target before the primers hybridize
individual base numbers at each position. For this sequence, and are extended. This is also the case for both FRET probes
this means 1×2×1×1×2×1×1×2×2×1×3×2×1×2×2×2×2×1× in the reaction. When used for SNP detection, the sensor
1×2×2×1×1 = 6,144 possible individual oligos. Therefore, the probe (probe 1) is situated over the site of mismatch,
effective concentration of each specific oligo in the reaction avoiding the terminal 3 bases of the probe and has a lower
is reduced proportionally. Empirical analysis has shown that Tm (about 5 °C) than the anchor probe (probe 2). Scorpions®
the number of different sequence permutations in a primer Probes are the exception to this recommendation since
should not be more than 512, therefore this example would the probe binds to the newly synthesized template after
not be an optimal degenerate-base primer. A redesign to extension rather than before, as for other probe systems.
a different location would offer a potential solution. In the • For quantitative studies using Dual-Labeled Probes, aim for
example shown in Figure 6.8, the primer contains 2 bases the probe to be positioned close to the 3’ of the forward
with potential mismatches. However, these each have a single primer but not overlapping (around five bases); for SNP
alternative base, resulting in 4 oligos in the mixed synthesis detection, position a Dual-Labeled Probe or Molecular
and the wobbles are located in the 5’ region of the primer. Beacon in the center of the amplicon and the SNP in the
These factors offer a much higher chance of success than the center of the probe.
primer presented in Figure 6.7.
• Avoid a guanidine at the 5’ end of probes, next to the
reporter, as this causes quenching.

36 [Link]
PCR/qPCR/dPCR Assay Design
• Ensure there are fewer Gs than Cs in the probe sequence. Probe Modifications
• Avoid runs of the same base (<4) and palindromic When probes are located over a region of sequence with
sequences. undesired heterogeneity, ambiguous bases are managed
• Ensure that the probe cannot adopt secondary structure. as described for PCR primers. In addition, it is also possible
• Ensure that the probe cannot hybridize to the primers. to incorporate modified nucleotides into qPCR probes, a
common example is the addition of a Locked Nucleic Acid®
• When designing probes for multiplex reactions, ensure (LNA®) base. LNA is a modified RNA nucleotide. The ribose
that there are no potential interactions between any of the moiety of LNA is modified with an extra bridge connecting the
probes and primers. 2’ oxygen and 4’ carbon (see Chapter 5). The bridge “locks” the
ribose in the 3’-endo conformation. LNA can be mixed with
Molecular Beacons DNA or RNA bases in the oligonucleotide wherever desired.
After a suitable probe region has been selected, The LNA modification results in increased thermal stability
complementary stems are added to the 5’ and 3’ ends to create allowing for shorter probes to be designed with the equivalent
the Molecular Beacon structure20. The example below shows Tm to a longer, non-modified equivalent probe. LNA-containing
the addition of a stem sequence (in red) to a Dual-Labeled sequences are more specific than oligos comprised of
Probe to create a Molecular Beacon (Figure 6.9 adapted from DNA alone and ideally suited to SNP detection. Additional
Thelwell 200021). applications of LNA modifications include designing oligos
MTHFR Forward BPF 5´-CTGACCTGAAGCACTTGAAGG-3´ for analysis of difficult sequences, such as viruses, where a
Primer high degree of variability can make it difficult to design a
MTHFR Reverse BPR 5´-ATGTCGGTGCATGCCTTCAC-3´ generic assay22.
Primer
The 5’ of a Dual-Labeled Probe, Molecular Beacon or
MTHFR TaqMan MT 5´-FAM TGCGGGAGCCGATTT Quencher -3´
Scorpions® Probe is labeled with a fluorophore, usually 6-FAM™
MTHFR Molecular MMB 5´-FAM GCGAGTGCGGGAGCCGATTTCTCGC Quencher -3´
Beacon for single assays or when multiplexing, typically choosing
these in the order FAM, HEX™/JOE™, Cyanine 5 (it is critical to
Figure 6.9. Adaptation of a Dual-Labeled Probe Assay to a Molecular Beacon
Format. Nucleic acids research by Oxford University Press. Reproduced with permis-
determine compatibility of the label with the instrument). The
sion of Oxford University Press in the format reuse in a book/e-book via Copyright 3’ of a Dual-Labeled Probe or Molecular Beacon and the 3’ end
Clearance Center. of the internal stem region of a Scorpions® Probe are modified
with a quencher molecule. Historically, the dye TAMRA was
Scorpions® Probes used as an acceptor for FAM emissions, resulting in FAM
The Scorpions® Probe requires assembly of the probe with a quenching. Developments in dark quencher technology have
forward primer such that they adopt the structure: 5’ dye- resulted in widespread adoption of Black Hole Quenchers® and
stem–probe-stem–quencher–blocker–primer. The primer and the more recent introduction of the Sigma Onyx Quencher™
probe must be on opposite strands since the probe binds to collection (see Chapter 5).
the newly created template that is on the same strand as the
primer. The example shown in Figure 6.10 shows the addition Template Controls
of label, quencher, PCR blocker and stem sequences to a One advantage of using relatively short-length amplicons
Dual‑Labeled Probe to create a Scorpions® Probe (adapted that are typically less than 150 bases, is that it is then possible
from Thelwell 200021). to synthesize a long oligonucleotide that may be used as a
synthetic amplification target. Use of such a target may help in
MTHFR Forward BPF 5´-CTGACCTGAAGCACTTGAAGG-3´
Primer development and optimization of assays where the intended
MTHFR Reverse BPR 5´-ATGTCGGTGCATGCCTTCAC-3´ target may be rare or in short supply, for example in the
Primer inhibition control assay SPUD23 (see Appendix A) or infectious
MTHFR TaqMan MT 5´-FAM TGCGGGAGCCGATTT Quencher -3´ disease detection studies19.
MTHFR Scorpions MS 5´-FAM CCCGCGG AAATCGGCTCCCGCA CCGCGGG Quencher
HEG CTGACCTGAAGCACTTGAAGG-3´

Figure 6.10. Adaptation of a Dual-Labeled Probe Assay to a Scorpions® Probe


Format. Nucleic acids research by Oxford University Press. Reproduced with permis-
sion of Oxford University Press in the format reuse in a book/e-book via Copyright
Clearance Center.

PCR Technologies: A Technical Guide 37


Chapter 6

Oligo Synthesis and Handling Reverse-phase HPLC


When ordering custom oligos for use in PCR applications, As the oligo length increases, the proportion of truncated
decisions must be made regarding the desired yield/scale of sequences tends to increase. Not all of these impurities will be
synthesis, purity and required modifications. Each of these removed by RP1 and thus for longer oligos, such as artificial
factors impacts on the other, e.g., a higher level of purification amplicon template oligos or labeled probe oligos, HPLC or
will result in better quality oligonucleotide but at the cost of PAGE purification is recommended. Reverse-phase, high
a reduction in overall yield. Tables 6.4, 6.5 and 6.6 provide performance liquid chromatography (RP-HPLC) operates on
guidance as to the synthesis scale and expected yield of the same principle as a reverse-phase cartridge. However,
oligonucleotides manufactured by Sigma. the higher resolution allows for higher purity levels. HPLC is
an efficient purification method for oligos with fluorophores,
such as qPCR probes, as their intrinsic lipophilicity provides
Oligonucleotide Purification excellent separation of product from contaminants.
When DNA is synthesized, each nucleotide is coupled to the Furthermore, RP-HPLC is a method of choice for larger scales
growing chain sequentially, beginning from the 3’ end of the due to the capacity and resolving properties of the column.
sequence. In each coupling cycle, a small percentage of the The resolution based on lipophilicity will decrease as the
oligo chains will not be extended, resulting in a mixture of full- length of the oligo increases. Therefore, RP-HPLC is usually not
length product and truncated sequences. recommended for purifying products longer than 50 bases.
Although longer oligos (up to 80 bases) can be purified using
After the oligo is cleaved from the support and the protecting
this method, the purity and yields may be adversely affected.
groups are removed, purification is used to separate the
full-length product from the truncated sequences. In general,
the purity required for a specific application depends on the
Anion-exchange HPLC
potential affect from the presence of truncated oligomers. Anion-exchange separation is based on the number of
For some applications, it is crucial that only the full-length phosphate groups in the molecule. The anion-exchange
(n) oligo be present. For others, such as PCR primers, the purification method involves the use of a salt-gradient elution
presence of shorter oligos (n-1,n-2,...) may not affect the on a quaternary ammonium stationary phase column or a
experimental results. similar structure. The resolution is excellent for the purification
of smaller quantities. This technique can be coupled with
Desalt Purification purification by RP-HPLC, adding a second dimension to the
separation process. Anion-exchange HPLC is limited by oligo
The desalting procedure removes residual by-products
length (usually up to 40mers). The longer the oligonucleotides,
that are remaining from the synthesis, cleavage and de-
the lower the resolution on the anion-exchange HPLC column
protection steps.
and therefore the lower the purity of the target oligo.
For many applications, including PCR, desalt purification is
acceptable for oligos that are no more than 35 bases long, as PolyAcrylamide Gel Electrophoresis (PAGE)
the overwhelming abundance of full-length oligo outweighs The basis of the PAGE separation is charge over molecular
any contributions from shorter products. Oligos required weight, leading to good size resolution, resulting in purity
for cloning or greater than 35 bases in length require an levels of 95–99% full-length product. Yields from PAGE
additional method of purification, such as Reverse-Phase are lower than from other methods due to the complex
Cartridge Purification (RP1), HPLC, or PAGE (depending procedures required for extracting oligos from the gel and
on length). the removal of the vast majority of truncated products. This
technique is recommended when a highly purified product
Reverse-phase Cartridge Purification (RP1) is required. PAGE is the recommended purification for longer
Separation on a reverse-phase cartridge removes a high oligos (≥50 bases).
proportion of truncated sequences. The difference in
hydrophobicity between full-length product and truncated Table 6.4. Expected Yield for Standard Oligos with Consideration of
sequences is used as the basis of the separation. While the Purification Method.
full-length oligo is retained on the column, the truncated Standard Oligos (OD/µg)*
sequences are washed off. The desired full-length product is Scale (µmol) Desalt Cartridge HPLC PAGE
then eluted and removed from the cartridge. 0.025 3/90 NA NA NA
0.05 5/150 1/30 1/30 0.5/15
0.2 12/360 3/90 2.5/75 1/30
1.0 40/1,200 12/360 13/390 5/150
10 400/12,000 NA 130/3,900 NA
15 600/18,000 NA 190/5,700 NA
*Guarantee is for 20mers or longer. Shorter oligos may have fewer ODs.

38 [Link]
PCR/qPCR/dPCR Assay Design
Table 6.5. Expected Yield for Modified Oligos with Consideration of 4. Vestheim, H., Jarman, S.N. Blocking primers to enhance PCR amplification
of rare sequences in mixed samples - a case study on prey DNA in
Purification Method. Antarctic krill stomachs. Front Zool 2008; 5: 12
Standard Oligos (OD/µg)* 5. Taft, R.J., Pheasant, M., Mattick, J.S. The relationship between non-protein-
Scale (µmol) Desalt Cartridge HPLC PAGE coding DNA and eukaryotic complexity. Bioessays 2007;29: 288-299
0.05 2/60 0.4/12 0.4/12 0.2/6 6. Taft, R.J., Pang, K.C., Mercer, T.R., et al. Non-coding RNAs: regulators of
0.2 5/150 1/30 1/30 0.4/12 disease. J Pathol 2010; 220: 126-139
1.0 16/480 5/150 5/150 2/60 7. Beck, D., Ayers, S., Wen, J., et al. Integrative analysis of next generation
10 160/4,800 N/A 52/1,560 N/A sequencing for small non-coding RNAs and transcriptional regulation in
15 240/7,200 N/A 76/2,280 N/A Myelodysplastic Syndromes. BMC Med Genomics 2011; 4: 19
*Guarantee is for 20mers or longer. Shorter oligos may have fewer ODs. 8. Ponjavic, J., Oliver, P.L., Lunter, G., et al. Genomic and transcriptional
Note: Post-synthesis modifications may yield 50% less than the above stated values. co-localization of protein-coding and long non-coding RNA pairs in the
developing brain. PLoS Genet 2009; 5: e1000617
Table 6.6. Guaranteed Amounts for qPCR Probes. 9. Ponting, C.P., Oliver, P.L., Reik, W. Evolution and functions of long
noncoding RNAs. Cell 2009; 136: 629-641
qPCR Probes
10. Carninci, P., Kasukawa, T., Katayama, S., et al. The transcriptional landscape
Detection Chemistry Quantity (OD)
of the mammalian genome. Science 2005; 309: 1559-1563
Dual-Labeled Probes 1 3 5 10
11. Rozowsky, J., Wu, J., Lian, Z., et al. Novel transcribed regions in the human
Molecular Beacons 1 3 5 10
genome. Cold Spring Harb Symp Quant Biol 2006; 71: 111-116
LightCycler Probes 0.1 0.25 1.5 15
12. Kapranov, P., Cheng, J., Dike, S., et al. RNA maps reveal new RNA classes
Scorpions® Probes 1 5 10 N/A and a possible function for pervasive transcription. Science 2007; 316:
All probes are purified by RP-HPLC. Inquire for 50 and 100 OD quantities. 1484-1488
13. Kato, M., Slack, F.J. microRNAs: small molecules with big roles - C. elegans
to human cancer. Biol Cell 2008; 100: 71-81
Oligonucleotide Preparation 14. Tijsterman, M., Plasterk, R.H. Dicers at RISC; the mechanism of RNAi. Cell
DNA oligonucleotides provided dry are ready for use upon 2004; 117: 1-3
re-suspension. It is recommended that oligonucleotides are re- 15. Benes, V., Castoldi, M. Expression profiling of microRNA using real-time
quantitative PCR, how to use it and what is available. Methods 2010; 50:
suspended in a weak buffer such as TE (10 mM Tris, pH 7.5–8.0, 244-249
1 mM EDTA). In applications where TE is not suitable, sterile 16. PCR Technologies: Current Innovations. 3 ed. Edited by Nolan and Bustin,
nuclease-free water may be used. However, high-grade water CRC Press; 2013
may be slightly acidic and is not recommended for long-term 17. Shi, R., Chiang, V.L. Facile means for quantifying microRNA expression by
storage of oligonucleotides. real-time PCR. Biotechniques 2005; 39: 519-525
18. Balcells, I., Cirera, S., Busk, P.K. Specific and sensitive quantitative RT-PCR of
A 100 µM stock solution may be obtained by using the miRNAs with DNA primers. BMC Biotechnol 2011; 11: 70
following guideline: Take the number of nanomoles (nmol) 19. Heath, Ashley R., Deluge, Norha, de Amorim, Maria Galli, et al.
provided (information found on the tube label and/or quality Development and use of qPCR assays for detection and study of
assurance document supplied with the oligo) and multiply neglected tropical and emerging infectious diseases. In: Tania Nolan,
Stephen A Bustin, eds. PCR Technologies: Current Innovations 3rd Edition
by 10. The result provides the number of microliters of liquid
ed CRC Press; 2013
to add to the tube to achieve a final concentration of 100 µM.
20. Tyagi, S., Kramer, F.R. Molecular beacons: probes that fluoresce upon
For example, if the oligo yield is 43.5 nmol, the volume to add hybridization. Nat Biotechnol 1996; 14: 303-308
for 100 µM stock is 435 µL. Note that this is equivalent to a 21. Thelwell, N., Millington, S., Solinas, A., et al. Mode of action and
stock solution of 100 pmol/µL. The stock solution may then application of Scorpion primers to mutation detection. Nucleic Acids Res
be further diluted as necessary, based upon the application 2000; 28: 3752-3761
requirements. For PCR, 10 µM or 20 µM working concentration 22. Petersen, M., Wengel, J. LNA: a versatile tool for therapeutics and
genomics. Trends Biotechnol 2003; 21: 74-81
is typically used. Store the stock solution in aliquots at –20 °C
23. Nolan, T., Hands, R.E., Ogunkolade, W., et al. SPUD: a quantitative PCR
and avoid multiple freeze–thaw cycles. assay for the detection of inhibitors in nucleic acid preparations. Anal
Biochem 2006; 351: 308-310
References
1. Little, S. Amplification-refractory mutation system (ARMS) analysis of
point mutations. Curr Protoc Hum Genet 2001;Chapter 9
2. Ferrie, R.M., Schwarz, M.J., Robertson, N.H., et al. Development,
multiplexingand application of ARMS tests for common mutations in the
CFTR gene. Am J Hum Genet 1992; 51: 251-262
3. Liu, J., Huang, S., Sun, M., et al. An improved allele-specific PCR primer
design method for SNP marker analysis and its application. Plant Methods
2012; 8: 34

PCR Technologies: A Technical Guide 39


OligoArchitect™ Primer and Probe Design Solutions from
Sigma® Life Sciences. Visit our OligoArchitect gateway at
[Link]/probedesignonline
Sample Purification and Quality Assessment

Chapter 7:
Sample Purification and Quality Assessment

Introduction Chaotropic Agents


The availability of simple methods for purification of DNA and A chaotropic agent is a substance which denatures proteins,
RNA has greatly facilitated the analysis and characterization of DNA, or RNA by disrupting the three dimensional structure
the genome and gene expression. There is a demand to isolate of the molecule. Chaotropic agents interfere with stabilizing
DNA and RNA rapidly and conveniently from a variety of intra-molecular interactions that are mediated by non-
cellular sources, including cells and tissues from mammalian, covalent forces such as hydrogen bonds, van der Waals
plant and bacterial cultures. Conventional approaches to DNA forces and hydrophobic effects. Commonly used chaotropic
isolation and purification are based on multi-step procedures agents include urea (6–8 M), guanidine HCL (6 M) and lithium
involving phenol/chloroform, anion exchange, or silica gel perchlorate (4.5 M). Guanidine thiocyanate is a potent protein
exchange systems. Purification of RNA typically involves denaturant that is stronger than guanidine HCl and is often
chaotropic salt and phenol/chloroform with a further oligo-dT used during the isolation of intact ribonucleic acid to eliminate
purification step if mRNA is required. RNase activity. Many RNA isolation protocols include the
addition of mercaptoethanol, in addition to a chaotrope,
The quality of the template material that is included into a
to provide a reducing environment that denatures the four
PCR or RT reaction has a profound effect upon the reliability
disulfide bridges formed between the eight cysteine residues
of the resulting data1. It is critical that the quality of the target
of Ribonuclease A (RNase A). The combination of a chaotropic
material is determined and reported2 and it is preferable to use
agent and a reducing agent such as mercaptoethanol causes
the highest quality nucleic acid possible. This chapter contains
the ribonuclease to unfold and completely lose its activity.
an in depth analysis of the effect of target quality on resulting
qPCR and RT-qPCR data with consideration of both purity
and integrity. Extraction of Genomic DNA
Nucleic Acid Purification Crude Preparation
The Extract-N-Amp™ kits (Sigma) can be used to extract
Nucleic acid purification is the first requirement for most
PCR-ready genomic DNA (gDNA), rapidly and efficiently, from
experiments utilizing molecular biology. DNA and RNA
almost any sample type, using a simple, one-tube protocol
samples are often obtained via “crude” preparations. These
that takes 15 minutes or less, depending on the sample.
purification methods can be rapid and direct and are
The Extract-N-Amp Kits have been used to extract gDNA
especially useful when samples are being used in PCR/RT-PCR
from samples such as whole blood, hair follicles, mouse
where only a small amount of DNA or RNA is required. Some
tails snips, tissue-culture cells, buccal swab cells, Drosophila
applications require a sample that is purified via conventional
melanogaster, various plants and seeds. Unlike full purification
methods; the final application will dictate the best method to
procedures, this approach avoids mechanical disruption,
select. When the nucleic acid from biological material needs
organic extraction, column purification, or precipitation of the
to be intact, pure, concentrated and without inhibitors of
DNA. The kits contain reagents for extracting and amplifying
downstream enzymatic reactions, the extraction procedures
DNA which may be used in many downstream applications,
require addition of chaotrophic agents.
including PCR/qPCR analysis.

PCR Technologies: A Technical Guide 41


Chapter 7

Purification of Genomic DNA The isolation of RNA is challenging because of the ubiquitous
presence of ribonuclease enzymes (RNases) in cells and
DNA can be isolated from almost any cellular or tissue source. tissues, which rapidly degrade RNA. Therefore, RNase inhibitors
Purification of gDNA requires removing it from the cell while are included during the purification process. The most
protecting against degradation. Isolation procedures must common method for purification is guanidinium thiocyanate-
also be gentle enough to protect the long DNA strands from phenol/chloroform extraction. This is the principle behind
mechanical stress. The sample is first harvested in a buffer TRI Reagent®, which is a monophase solution containing
such as phosphate buffered saline (PBS), usually containing phenol and guanidine thiocyanate. The tissue or cell sample
a detergent such as Triton™ X-100 or Sodium dodecyl is homogenized or disrupted in the TRI Reagent, chloroform
sulphate (SDS) to lyse the cells and solubilize proteins and is mixed with the lysate and then the mixture is separated
lipids. Proteinase K is added to separate clumped cells and into three phases by centrifugation. The aqueous phase
tissues and inactivate enzymes by proteolytic digestion. containing the RNA is removed and the RNA is precipitated
Ethylenediaminetetraacetic acid (EDTA) is a chelator that acts using isopropanol. GenElute RNA isolation kits (Sigma) capture
as a scavenger for metal ions in solution and is added to DNA the RNA onto silica resin following cell lysis. GenElute kits use
purification buffers to remove magnesium ions (Mg2+). Mg2+ guanidine thiocyanate and 2-mercaptoethanol to inactivate
is an essential co-factor for DNases, therefore removal of Mg2+ RNases when isolating total nuclear and cytoplasmic RNA.
inactivates DNases, preventing DNA degradation. RNase is In the presence of guanidine thiocyanate, proteins dissolve
often included to degrade the RNA present in the cells. readily, cellular structures disintegrate and nucleoproteins
After lysing the cells and degrading the RNA, proteins and dissociate from nucleic acids as protein secondary structure is
lipids, the DNA must be separated from the remaining lost. Furthermore, since guanidine thiocyanate is more potent
remnants of these materials. The classical purification methods than guanidine HCL, RNases are permanently denatured.
use phenol/chloroform3 to remove the proteins, leaving Lysates are spun through a filtration column to remove cellular
DNA and other water-soluble materials behind. TRI Reagent® debris and shear DNA. The filtrate is then applied to a high
(Sigma) uses an adaptation of this method. Alternatively using capacity silica column to bind total RNA, followed by washing
systems such as the GenElute™ (Sigma) gDNA purification and elution with RNase free water or buffer.
kits, DNA is adsorbed onto silica-based membranes (in single Of the total RNA sample, the majority is rRNA (~80%) while
column and 96-well formats), in the presence of chaotropic the mRNA fraction is only 2–5%. For some procedures, it
salts, which disrupt protein structure. When purifying DNA may be desirable to purify the mRNA from the vastly more
from plant material, the tissue must first be mechanically abundant rRNA and tRNA. The GenElute mRNA Kits (Sigma)
disrupted by grinding in liquid nitrogen, whereas whole blood provide convenient procedures for isolating polyadenylated
or bacteria are pre-incubated with enzymes to ensure efficient mRNA from previously prepared total RNA or directly from
cell lysis and DNA release. The DNA is washed while bound mammalian cells and tissues. For direct mRNA preparation,
to the membranes and then eluted by changing the salt cells or tissues are disrupted with SDS/proteinase K digestion
concentration and is subsequently released with detergent to release RNA and eliminate RNases. Oligo dT30 covalently
and a chaotropic agent. Proteins, polysaccharides and cell linked to 1 μm polystyrene beads is then used to capture
debris are eliminated with a precipitation procedure followed polyadenylated mRNA by hybridization. The polystyrene beads
by centrifugation through a filtration column. remain suspended during hybridization, eliminating the need
for mixing or rocking. The mRNA-bead complexes are washed
Purification of Total RNA on a microcentrifuge spin filter and then the purified mRNA
is eluted.
Purification of cellular RNA is required for studies of gene
expression or other cellular functions that are regulated by Many of the extraction methods used for purification of “total
RNA. Total RNA is the RNA that is transcribed from cellular RNA” specifically select larger molecules and so are not suitable
DNA (gDNA and mitochondrial DNA, mtDNA) and generally for isolation of smaller ncRNAs, including miRNAs. There are
refers to a sample containing: Ribosomal, transfer and specifically designed kits for purification of fractions of smaller
messenger RNA (rRNA, tRNA and mRNA) and does not include RNA species, which may be selected when these are the
microRNA (miRNA) or smaller non-coding RNAs (ncRNA). template of interest.
Total RNA is the fraction of interest which is isolated for gene
expression analysis.

42 [Link]
Sample Purification and Quality Assessment
Purification of Micro RNA (miRNA) and Non-coding Nucleic Acid Quantification
RNA (ncRNA) UV Spectroscopy
Purification of miRNA and other, smaller ncRNA molecules is Nucleic acids have traditionally been quantified by measuring
more challenging due to their short lengths. It is important UV absorption using a spectrophotometer. The absorbance of
to select an appropriate RNA isolation method that retains a diluted sample of DNA or RNA is read at 260 nm and 280 nm.
small RNA and avoid using a total RNA purification kit The Optical Density (OD) at 260 nm is used to determine
unless the manufacturer specifically states that total RNA the RNA or DNA concentration in a solution using the Beer-
includes small RNAs <100 bases. Extraction methods for Lambert law, which predicts a linear correlation between
ncRNA target differences between RNA molecules and any absorbance and concentration.
other contaminating factors, using specific column binding
or precipitation. RNAzol® (Sigma) is an acidic guanidine Beer-Lambert Law
thiocyanate-phenol mixture that disrupts cells and tissues
and, with the addition of chloroform or bromochloropropane, A = εbc
separates all RNA species from proteins and DNA. Purification A = absorbance
methods then allow separate preparation of small RNA,
b = path length of the cuvette in cm (typically 1 cm)
mRNA or total RNA samples such that each of these fractions
can be analyzed in parallel in downstream applications. The c = analyte concentration
miRPremier® microRNA Isolation kits (Sigma) are silica-based ε = extinction coefficient
bind-wash-elute kits specifically designed for small RNA
recovery. The miRPremier kit uses a salting out approach to For RNA, ε = 40 μg/mL
remove larger molecules before binding small RNA to the For DNA, ε = 50 μg/mL
column, because the amount of ethanol needed to bind small
RNA to silica (silicon dioxide) will also precipitate proteins An OD at 260 nm (A260) reading of 1.0 is equivalent to
and other macromolecules, creating a viscous suspension approximately 40 μg/mL of pure RNA and 50 μg/mL of pure
that can clog columns and prevent efficient recovery of RNA. double-stranded DNA. However, the Beer-Lambert law is only
An alternative approach to circumvent this problem is to valid for OD readings up to 2 and the stated OD/concentration
use a pre-clearing step to remove macromolecules, such as relationship relies upon the samples being pure. Evidently,
by extracting with RNAzol or a pre-binding column, so that contaminating substances with absorption at 260 nm or
sufficient alcohol can be added to bind small RNA without 280 nm will affect the estimated OD reading. Pure RNA has an
clogging the RNA binding column. A260/A280 of 2.1, whereas pure DNA will have an A260/A280 of 1.8.

Table 7.1. The Effect of Contaminants on A260/A280 Ratio.


Nucleic Acid Sample Quality Assessment Double-stranded DNA
Expected A260/A280 Ratio
1.7-1.9
Sample handling and nucleic acid extraction procedures are RNA 1.8-2.0
variable, therefore it is critical to define a reliable protocol for pH Impact on Ratio
analysis of sample quality and quantity and to include details DEPC water (pH 5-6) 1.6
of this analysis in publications2. The quantity of RNA is largely Nuclease free water (pH 6-7) 1.85
determined by the yield of rRNA, whereas the quality of RNA TE (pH 8) 2.14
is determined by the purity (absence of inhibitors) and the Contaminant Impact on Ratio
integrity of the RNA molecules. However, when measuring Phenol contamination ↓ ratio
the quality of a sample the purity and integrity influence the High protein contamination ↓ ratio
results; it is difficult to determine the purity and integrity of a Guanidine isothiocyanate contamination ↓ ratio
sample of low concentration and the presence of impurities
can interfere with quantification. The OD of potentially contaminating substances such as
proteins, chaotrophic salts and phenol can also be determined
There are a number of techniques that may be used to assess if absorbance of the sample is measured at 280 nm and
nucleic acid quantity and quality but none of these, alone, 230 nm (A280 and A230, respectively). In this way, a ratio of
provide all of the information required to describe a sample A260/A280 and A260/A230 may be used as an indicator of sample
fully. Therefore, it is important to consider a suite of options purity. However, it should be noted that the determination of
to ensure that sample quality will not influence the final protein contamination in DNA is very insensitive when using
analysis data1. this approach4.

PCR Technologies: A Technical Guide 43


Chapter 7
Additionally, pH and the ionic strength of the buffer also Effect of phenol contamination: Phenol has a very
disturb the OD reading. It has been shown that there is strong effect on the quantification of RNA. At 0.5% phenol
significant variability in the A260/A280 ratio when different contamination of a RNA sample at 50 ng/μL, the measured
sources of water are used to perform the spectrophotometric concentration is over three times higher. This strong disturbing
determinations. For example, variation in the pH of water effect of phenol on the quantification of RNA is due to the
between pH 5.4 to 7.5–8.5 used for suspending RNA contaminating absorption peak at 270 nm. At very low RNA
significantly increased RNA A260/A280 ratios from approximately concentrations, below 10 ng/µL, this contaminating peak is
1.5 to 2.05. often confused for RNA. However, RNA absorbance is always
at 260 nm and never at 270 nm, therefore if the peak is at
It is important that both the A260/A280 ratio and the A260/A230
270 nm, it is due to a contamination. After RNA has been
ratios are close to 2.0 (Table 7.1).
isolated using a method based on phenol, the erroneous
overestimation of RNA concentration is a serious problem. This
TRIS, Ethanol and Isopropanol Contamination is particularly the case when the RNA is of low concentration.
Effect of TRIS contamination: TRIS contamination does not
influence the absorbance spectrum of RNA/DNA significantly. Automated UV Spectrophotometry
Effect of ethanol contamination: Ethanol does not have While conventional UV spectrophoresis required measure-
a significant effect on the absorbance spectrum of RNA/ ments to be carried using relatively high volumes of sample,
DNA when measured in TE pH 8.0. However, when the there are now systems such as the NanoDrop® 2000 UV-Vis
measurement is made in pure water, the A260/A280 ratio Spectrophotometer that are automated and support highly
may be reduced and so a ratio lower than 2.0 may indicate accurate analyses of extremely small sample sizes. The sample
ethanol contamination. retention systems eliminate the need for cuvettes and capil-
Effect of isopropanol contamination: Isopropanol does laries, which decreases the amount of sample analyzed to
not have a significant effect on the absorbance spectrum between 0.5 μL and 2 μL. The NanoDrop provides a scan of
of RNA/DNA when measured in TE pH 8.0. However, when the absorbance from about 200 nm to 350 nm, which is the
the measurement is made in pure water, the A260/A280 ratio relevant region for determining RNA/DNA concentration
can be reduced and so a ratio lower than 2.0 may indicate and purity.
isopropanol contamination.
Fluorescence-based Nucleic Acid Quantification
Protein, Guanidine Isothiocyanate and Phenol Systems
Contamination The use of fluorescent dyes to quantify nucleic acids
Effect of protein contamination: A sample containing a is an alternative to absorbance spectrophotometry6,7.
contamination of 0.01% BSA can show an almost normal Determination of nucleic acid concentration using fluorescent
absorbance spectrum, although the A260/A280 ratio may methods utilizes the binding of small molecules or dyes
fall below 1.9 (RNA) or 1.7 (DNA), which is a warning that to nucleic acids and measures the subsequent changes
something is contaminating the sample. At 0.5% BSA, the in fluorescence characteristics. Although more expensive
absorbance spectra appear abnormal and this is a clear than absorbance spectrophotometry, fluorescence-based
indication that there is a significant level of contamination in quantification is more sensitive, precise and may be specific for
the sample. Therefore, high concentrations of protein may be the nucleic acid of interest.
detected by abnormal A260/A280 ratios but low and moderate Since fluorometers measure fluorescence in relative rather
amounts are not. than absolute units, the measurement is first calibrated with
Effect of guanidine isothiocyanate contamination: Guanidine a known concentration of a standard nucleic acid solution
isothiocyanate has little influence on the A260/A280 ratio, with characteristics similar to the sample to be measured.
therefore, guanidine isothiocyanate has a small effect on the Following calibration, a single measurement can establish the
quantification of RNA. However, the presence of guanidine concentration of nucleic acid in the solution, but typically a
isothiocyanate has a very strong effect on the A260/A230 ratio; standard curve will be required to ascertain the linearity of the
at a 0.5% contamination, the A260/A230 ratio drops below 0.5. assay in the range measured.
Samples with suspected guanidine contamination should
be avoided since this would have a deleterious effect on
downstream enzymatic reactions.

44 [Link]
Sample Purification and Quality Assessment
Automated systems such as the QuBit® 2.0 fluorometer
1 2 3 4
(Life Technologies) can be used with a range of different
fluorescence based quantification assays for the measurement
of nucleic acid concentration in solution. The assays
demonstrate a wide dynamic range for detection and are
capable of accurately analyzing small samples.
28S rRNA
It is critical to observe that the OD reading is a measure of
absorption and cannot be used as a complete evaluation 18S rRNA
of sample quality. Similarly fluorescent-based systems
provide a measure of quantity and not quality. For example,
these cannot be used as a test for sample integrity and a
suitable analysis must also be performed, such as a capillary Figure 7.1. Evaluation of RNA integrity by agarose gel analysis. Samples of total
electrophoresis, gel resolution, or the 3’/5’ ratio assay (as RNA (2 μg) were fractionated on a 1% agarose gel in TBE buffer and stained with
ethidium bromide. Lanes 1 and 2 show RNA of high quality while lanes 3 and 4
described below). show degraded RNA.

However, gel electrophoresis is an insensitive method


Gel Electrophoresis and Capillary Nucleic for determination of sample integrity and requires large
Acid Quality Analysis Systems concentrations of sample. When working with small samples
there is rarely a sufficient amount to run gel electrophoresis
Gel Electrophoresis and also perform all desired experiments. Since this approach
relies on human interpretation of gel images, it is subjective,
RNA, although thermodynamically stable, is rapidly digested hardly comparable from one lab to another and the resulting
in the presence of almost ubiquitous RNase enzymes. As a data cannot be processed digitally.
result, shorter fragments of RNA commonly occur in a sample,
which can potentially compromise the results of downstream Some of these issues are addressed by the analysis of total RNA
applications. The degradation process of RNA is only partly by automated capillary electrophoresis.
understood and is dependent on the type of RNase that is
present. Also, the quality of RNA from a given extraction can Capillary Nucleic Acid Quality Analysis Systems
vary extensively and needs to be under constant surveillance. Nucleic acid samples can be analyzed and compared using
Therefore, it is important to determine the integrity of the instrumentation such as the Agilent 2100 BioAnalyzer or
RNA samples. Bio-Rad Experion. Using these systems, electrophoretic traces
In order to evaluate potential degradation, electrophoretic are used to assign numerical integrity values or integrity
methods have been applied that separate the samples categories.
according to the size of the comprised molecules. Historically, These instruments use a lab-on-a-chip approach, combining
RNA integrity has been evaluated using agarose gel capillary electrophoresis with fluorescent detection. The
electrophoresis stained with ethidium bromide, which electrophoretic process carried out on the chip is based on
produces a defined banding pattern. Total RNA run on a traditional gel electrophoresis principles that have been
denaturing agarose gel displays two distinct ribosomal miniaturized, which reduces sample consumption and
fragments corresponding to either 18S or 28S for eukaryotic separation time.
RNA or 16S and 23S for prokaryotic RNA and additional
The chip accommodates wells for samples, gel and an external
fragments of smaller RNA species. Traditionally, the intensity
standard (fragment size ladder). During manufacturing, micro-
of these rRNA bands on denaturing agarose gels have been
channels are fabricated in glass to create interconnected
used to calculate a ratio that served as an indication of RNA
networks amongst the wells. These micro-channels are then
integrity. RNA is considered to be of high quality when the
filled with a sieving polymer and fluorescence dye. Electrodes
ratio of eukaryotic 28S:18S band intensity is about 2.0.
are inserted in the wells and the chip becomes an integrated
Figure 7.1 shows an example of total RNA evaluation by electrical circuit.
ethidium bromide-stained agarose gel electrophoresis. For
Charged bio-molecules such as DNA or RNA are driven
good quality total RNA, the two largest rRNAs appear as
through the matrix in response to a voltage gradient. Due
discrete bands at approximately 5 kb and 2 kb and the upper
to a constant mass-to-charge ratio and the presence of a
band should have approximately twice the intensity of the
sieving polymer matrix, the molecules are separated by size
lower. The mRNA may appear as a light smear or may barely be
such that smaller fragments migrate faster than larger ones.
evident, mostly between the two rRNA bands.

PCR Technologies: A Technical Guide 45


Chapter 7
Dye molecules intercalate into nucleic acid strands and suitable for a given experiment. Figure 7.2 shows the Agilent
these complexes are detected by laser-induced fluorescence. BioAnalyzer traces for two RNA samples. No difference was
Data is then translated into electronic gel-like images and detected in the yield of several rare mRNA targets in cDNA
electropherograms. generated with one-step RT-qPCR using gene-specific primers.
However, the same mRNA targets were detected up to 2 cycles
The Agilent 2100 BioAnalyzer is used in conjunction with
later, indicating 4-fold less mRNA, in the lower integrity sample
the RNA 6000 Nano and the RNA 6000 Pico LabChip kits.
(11, RIN = 7.0) than in the higher quality sample (9, RIN = 9.8)
This bio-analytical device is based on a combination of
when using two-step RT-qPCR with oligo-dT to prime the RT.
microfluidic chips, voltage-induced size separation in gel
filled channels and laser-induced fluorescence (LIF) detection Electropherogram Virtual Gel
on a miniaturized scale. Twelve samples can be processed
sequentially while consuming very small amounts of each
sample. RNA molecules are stained with an intercalating dye
and detected by means of LIF. Data are archived automatically
and available as electropherograms, gel-like images and in
tabular format.
The BioAnalyzer has a good linear dynamic range and the
RNA 6000 Nano assay can be used to analyze RNA samples of
concentrations ranging from 25 ng/μL to 500 ng/μL. Although
the lower quantitative limit of the RNA 6000 Nano assay is
specified as 25 ng/μL, it is recommended to use at least
50 ng/μL for a meaningful RNA Integrity Number (RIN) Figure 7.2. Electropherogram showing the evaluation of RNA integrity using
calculation. When using lower concentrations, higher sample the Agilent 2100 BioAnalyzer. Samples of total RNA preparations (~150 ng) were
to sample variances of the RIN may be observed. The Pico fractionated on a RNA 6000 Nanochip and resolved using the Agilent 2100. Integrity
was evaluated and ascribed a RIN.
assay can be used to determine RNA integrity for samples of
concentrations in the range 50 pg/μL to 5 ng/μL. Sample quality is critical and therefore must be verified before
The Agilent 2100 BioAnalyzer software is used to evaluate the samples are used in qPCR assays. It has been clearly
the proportion of RNA detected before, between and after demonstrated that analysis of degraded RNA samples may
the rRNA peaks in order to determine a relative integrity result in poor quality data1, although this is not always the
number (RIN) for the RNA sample. Intact RNA has a RIN of case8 and is partly dependent on RT protocol (see Chapter 8)9.
10, whereas completely degraded RNA has a RIN of 1. In this Although the capillary systems are a great improvement
way, interpretation of an electropherogram is facilitated and over conventional gel electrophoresis, they are specialized
comparison of samples is possible. pieces of equipment, expensive and are not amenable to
Partially degraded RNA (RIN <9) may yield satisfactory results high throughput. In addition, it has been observed that the
in RT-qPCR but it is likely that this depends upon the targets RIN may not be the panacea measurement that would be
analyzed, degree of sensitivity required and the RT strategy. A desired. Figure 7.3 shows samples which have been subjected
RT-qPCR strategy that uses two steps with oligo-dT to prime to incubation on bare human skin for 1 minute, unexpectedly
reverse transcription and PCR primers near the 5’-end of a showing apparently no degradation when the total RNA was
long cDNA will require much higher integrity samples than analyzed using an Agilent BioAnalyzer. Using an alternative
a strategy that uses one-step RT-qPCR with gene-specific method to determine degradation, these were seen to contain
primers. The effect of different RT strategies and their tolerance degraded transcripts (see below).
of degraded templates is discussed in detail (see Chapter 8). [FU]
In addition, higher sample integrity will be required to detect
a rare rather than an abundant mRNA target. Therefore, the
effect of template degradation on the ratio of targets of 100

different abundance (e.g., test and reference genes) should


also be considered. The correlation between RIN and RT-qPCR
0
success should be determined empirically for each assay.
Although the RIN tremendously facilitates the assessment of 20 25 30 35 40 45 50 55 60 [s]
the integrity of RNA preparations and makes it much easier Figure 7.3. Electropherogram of total RNA (~150 ng) resolved by capillary electro-
to compare samples or RNA isolation procedures, it is not yet phoresis using the Agilent 2100 BioAnalyzer. The RNA had been incubated on a
possible to determine in advance whether the RNA may be naked human hand for 1 minute prior to analysis. Analysis RIN of 10 indicated that
the RNA was apparently high quality and intact.

46 [Link]
Sample Purification and Quality Assessment
For this reason it is important to apply caution to interpretation component of the RIN algorithm) is not a reliable indicator of
of RIN and other automatically generated measures of sample the integrity of the mRNA. However, the reliability of the 3’/5’
integrity and consider an additional, transcript-specific assay as a measure of overall sample quality depends upon the
investigation. One such approach relies on measurement of a rate at which individual transcripts degrade11. To examine this,
target using two independent assays. The integrity assay relies RNA extracted from HT29 cells was subjected to degradation
on measuring the ratio of the quantities of the target located by incubation for 72 hr at room temperature, or alternatively
towards the 5’ and at the 3’ of the same transcript (Figure 7.4)10. for 2 hr at 62 °C. All sample quality was analyzed using the
This provides a relative measure of transcript-specific RNA Agilent 2100 BioAnalyzer. Assays were also designed to the
integrity (for a 3’/5’ assay protocol, see Appendix A). 3’ and 5’ regions of 13 ubiquitously expressed genes and the
FAM HEX
quantity of these targets was determined in the purified, high
5’ assay 3’ assay
quality undegraded RNA sample (HT29) using both assays for
AA each gene (Figure 7.6A).
RIN vs Integrity
Figure 7.4. Diagram to represent the 3’/5’ integrity assay. cDNA is produced from
total RNA using oligodT primed RT. Two qPCR assays are designed to target the
same transcript and the probes are labeled with different fluorophores, to facilitate
multiplex detection. If the RNA is intact, detection of 5‘ and 3’ assays should be
equal, whereas if the RNA is degraded there would be a higher detection of the 3’
assay relative to the 5’ assay.

In this way, the 3’/5’ ratio assay is used to evaluate the quality
of RNA samples. The use of this approach is demonstrated
in Figure 7.5, by testing the state of the GAPDH transcript
(the specific targets under examination should be tested in
any given experiment) in the RNA sample that was shown
in Figure 7.3. After an oligo-dT primed cDNA synthesis, the
GAPDH transcript is quantified using both a 5’ and 3’ assay. If
the RNA is intact an equal concentration is expected using Figure 7.6A. RNA Quality Determination using 3’/5’ Assay a) RNA samples from
each assay (ratio = 1), whereas if the RNA is degraded a higher HT29 cells with RIN approximately 10 were reverse transcribed using oligo-dT and
the 3’/5’ ratio (y axis) determined for each of 13 genes (X axis). There is a general
copy number is expected for the 3’ assay relative to the 5’ assay. 3’ bias in quantification when both assays are used for the same target and the
5’ RNA is high quality. The degree of bias differs between genes, thus influencing the
3’ determination of ratios between genes, such as when normalizing to a reference
40
gene. (Data kindly provided by Prof. Stephen Bustin, UK.)
Cq=36
35
Cq=27 RIN vs Integrity
30
25
HEX
20
FAM
15
10
5
0
Intact 1’ Degradation

Figure 7.5. Demonstration of 3’/5’ Assay for Identification of Degraded RNA Samples.
Although the Agilent 2100 BioAnalyzer analysis returned a RIN of 10 for both of
these RNA samples, the 3’/5’ assay was used to demonstrate a 9 Cq (approximately
1,000-fold) loss in the 5’ assay for the sample after incubation for 1 minute on the
human hand (1’ degradation) while the 3’ remained constant.

Analysis of the RNA using the Agilent 2100 BioAnalyzer led to Figure 7.6B. RNA samples from HT29 cells with RIN approximately 7 were reverse
the conclusion that the RNA shown in Figure 7.3 was intact, transcribed using oligo-dT and the 3’/5’ ratio (y axis) determined for each of 13
recording a RIN of 10 for both the RNA after 1’ incubation on genes (X axis). There is a strong 3’ bias in quantification when both assays are used
for the same target and the RNA is high quality and a clear 3’ shift from the ratio
the naked human hand and the same purified sample prior demonstrated in Figure 7.6A. The degree of the shift differs significantly between
to degradation. When applying the 3’/5’ assay, the 3’ assay genes, indicating that different genes degrade at different rates. (Data kindly
showed the same Cq for both samples, whereas the 5’ assay provided by Prof. Stephen Bustin, UK.)
shows a loss of 9 cycles, indicating 1,000-fold loss of GAPDH 5’
and that the transcript is degraded. This observation supports
the demonstration that the status of the rRNA (a significant

PCR Technologies: A Technical Guide 47


Chapter 7
RIN vs Integrity
Contamination
Within the context of PCR assays, the significant forms of
contamination are nucleic acid template that is inappropriately
present in the sample, which can also be detected along with
the specific target and result in a false positive, or material
which can inhibit downstream reactions, causing false
negatives or lower estimates of template concentration.

Template Contamination
PCR assays are especially vulnerable to amplicon contamina-
tion with the specific target sequence of interest because the
process of PCR generates copies of the amplicon exponen-
Figure 7.6C. RNA samples from HT29 cells with RIN approximately 5 were reverse
transcribed using oligo-dT and the 3’/5’ ratio (y axis) determined for each of 13
tially. Consequently, the process of performing a PCR assay
genes (X axis). There is a wide spread of data for replicates. (Data kindly provided by produces the perfect contaminant for future PCR assays. In
Prof. Stephen Bustin, UK.) a molecular biology laboratory, it is essential to separate the
When using high quality RNA, the data for replicates are space in which the reaction is set up and run from the post-
very close, but it is clear that for many genes there is a bias PCR analysis area where the PCR product will be analyzed and
in the assay of up to 10 fold, usually towards the 3’ with a further manipulated. It is preferable, where possible, to use
more dramatic 100-fold bias seen for UBC. This may reflect separate rooms with dedicated equipment and laboratory
degradation or differential detection by the assays due to coats such that nothing from the post-PCR analysis space is
template folding or other RT-PCR influencing factor. Some ever in contact with the clean, (pre-PCR) space. Many labora-
targets appear to have a 5’ bias in detection which may be tories also introduce further controls for personnel access to
due to assay efficiency differences or other components of these areas to prevent reaction carry over. Quantitative PCR
the RT-qPCR assay. The assays were then used to quantify assays are particularly vulnerable to amplicon contamina-
the same targets using cDNA from RNA with RIN of 7.3 and tion because they are capable of detecting a single template
5.3 (Figures 7.6B and 7.6C, respectively). There were clear molecule and contaminating template will confound measure-
signs of degradation when using RNA samples of moderate ments of quantity.
degradation (RIN 7), with most genes showing a 3’ shift of In addition to PCR generation of the specific amplicon, care
between 10 and 1,000-fold indicating degradation of these is needed in the laboratory setup to ensure that original
transcripts between the 3’ and 5’ assays. Interestingly, three template material is not transferred from one sample to
genes showed a 5’ shift which may indicate that degradation another (cross-contamination) or, in the case of analysis of
has resulted in a conformation change making the RT or 5’ human samples, that material is not introduced from the
qPCR more efficient. Since the changes for each gene are personnel performing the analysis.
different it is clear that a ratio between genes measured
Adopting a standard experimental procedure with appropriate
using RIN 9 RNA would differ significantly from that measured
controls to identify potential sources of contamination is
using RIN 7 RNA. When using RNA of RIN 5 there is a higher
highly recommended.
degree of variability and the 3’/5’ ratio for each gene
averages around 1. Since an average of 3’/5’ =1 would also
be expected from high quality intact RNA, it is recognized
Contamination of RNA with gDNA
that this system is applicable for integrity determination of When analyzing RNA, it is important to ensure that there
RNA samples of moderate to apparently no degradation is no gDNA contamination. Enzymatic treatment of the
and is an improvement when used in addition to gel or samples with DNase I in solution is recommended for
capillary electrophoresis. removing contaminating gDNA and is particularly important
for investigations of intron-less genes or when the assay
The observation of 5’ bias in the assays was intriguing.
design does not distinguish between the gDNA and cDNA
In theory, for assays of identical efficiency, it should not
sequences. Wherever possible, it is advisable to design assays
be possible to generate more 5’ than 3’ amplicon. Clearly
over the intron/exon boundary such that only the processed
additional factors are affecting the differential performance
mRNA sequences can be amplified and/or detected. This
of these assays. A further sample quality consideration is the
does not always prevent amplification from gDNA, as there
presence of contaminants, which may inhibit or even enhance
are sequences that exist as processed pseudo genes which
RT or qPCR performance and whether these may be gene-
are effectively genomic cDNA sequences (see Chapter 6). It
target specific.
is also worth considering that DNA exists in the reagents and
potentially, can cause contamination issues12.

48 [Link]
Sample Purification and Quality Assessment

Inhibition An Integrated Example: Analysis of RNA


The presence of inhibitors differentially affects qPCR assays to
different targets13. Therefore, the presence of inhibitors in a
Sample Quality
sample can result in complex perturbations of the true data. Each of the sample quality control methods described
Since each assay is affected differently, the resulting ratios previously is used to determine a specific feature of the
between gene of interest (GOI) and reference gene quantities sample. This section contains a description of an example
may not reflect the true abundance of each gene, leading to workflow that may be applied to samples, with a description of
incorrect estimates of relative target quantities or difficulties in the data that each quality control test provides. The presented
interpreting genotyping assays. investigation is neither exhaustive nor provided as a definitive
standard operating procedure; it is merely provided as an
PCR inhibitors that are commonly introduced during example of a possible quality control procedure.
experimental processes include; tris, ethanol, isopropanol,
EDTA, the reverse transcriptase enzyme, guanidine Five RNA samples have been prepared and are labeled
isothiocyanate and phenol. sequentially A to E. These were analyzed using the NanoDrop
and were found to be of very similar concentration (around
One system that can be used to detect inhibitors is the SPUD 100 ng/μL). The A260/A280 ratio was recorded twice using
assay14 (Figure 7.7). Using this method, an artificial amplicon two independent readings for each sample (Figure 7.8) and
(derived from a potato nucleic acid sequence lacking was found to be approximately 1.9 in all cases, suggesting
homology with any other known sequence) is subjected to samples of high quality and without contaminants as would
qPCR in the presence of either water (amplification control; be detected at A280 nm, it is noteworthy that an A230 nm
Figure 7.7 sample a) or the test sample (Figure 7.7 samples reading is absent from this analysis. An analysis using capillary
b and c). If the test sample does not contain an inhibitor of electrophoresis (the Agilent 2100 BioAnalyzer) reveals a
the SPUD assay, the quantification cycle (Cq) recorded for different picture (Figure 7.9). Samples A and B are of high
the amplification control and test sample will be the same. quality (RIN 10 and concentration 110 ng/μL in agreement
However, if the test sample contains an inhibitor, the Cq will be with NanoDrop reading), sample C is highly degraded
increased (a detailed protocol for the test is provided as the (RIN 2.4, concentration 62 ng/μL is half the concentration
SPUD Protocol, Appendix A). determination of the NanoDrop) and samples D and E are
high quality (RIN 9.1 and 9.5, respectively) but of lower
concentration than samples A and B (30 ng/μL and
SPUD 43 ng/μL, respectively). The information from the two methods
Reaction 1 of measurement is somewhat complementary because the
Cq (SPUD + Water) = 24 NanoDrop does not reveal the degradation. However, it is also
in conflict because the concentration of the samples D and E
differ significantly. This would be cause for concern and should
a
A trigger further investigations. While capillary electrophoresis
b
is a powerful tool for sample evaluation, it is relatively low
Fluorescence (dRn)

throughput and not available to all researchers. An alternative


c test for sample integrity is the 3’/5’ analysis. This test was
applied to samples A–E using equal concentrations according
to the NanoDrop reading. When these samples were tested
Cycles
using this approach, it was clear that the RNA of samples A
Reaction 2
(Figure 7.10A) and B (data not shown, identical to sample A)
were intact, whereas that for sample C was highly degraded
Cq (SPUD + sample) = 26 (Figure 7.10B). Note that for sample C the Cq for both the
(Phenol from extraction reagent)
5’ and the 3’ assays has shifted significantly to higher values
Figure 7.7. Representation of the SPUD assay. In this case, the difference in Cq demonstrating a loss of specific target relative to samples A
between the sample c and the control sample a shows presence of an inhibitor. and B. The profile for samples D and E was not in accordance
with expectations (Figure 7.10C shows sample D, data is not

PCR Technologies: A Technical Guide 49


Chapter 7
shown for sample E but was similar) since the 5’ assay has a wavelengths were not tested). Samples A and B were of high
lower Cq than the 3’ indicating more 5’ signal than 3’ in a cDNA integrity without detected inhibitors, sample C was highly
sample produced from oligo-dT priming. The alternative degraded (capillary electrophoresis and 3’/5’ assay) without
explanation is that these samples contain an inhibitor which detected inhibitors and samples D and E were intact but
affects the 3’ assay more than the 5’. To test this theory, the contained PCR inhibitors (3’/5’ and SPUD).
SPUD assay was run on all samples (Figure 7.11). There is no 2.5
evidence of an inhibitor in samples A to C but both samples
2 A
D and E show inhibition of the SPUD assay, with sample D

(A260/A280)
B
1.5
causing the assay to fail completely. C
1 D
Using all of the information, it can be concluded that there
0.5 E
was an equal concentration of nucleic acid material in each
0
sample (NanoDrop) and the samples contained undetectable 1 2
contaminants that absorbs at 280 nm (protein) (other Figure7.8. NanoDrop Quality Assessment (A260/A280).

Conc: 110 ng/µL Conc: 110 ng/µL Conc: 62 ng/µL


Ratio: 2.5 Ratio: 2.5 Ratio: 0.0
RIN: 10 RIN: 10 RIN: 2.4

Conc: 30 ng/µL Conc: 43 ng/µL


Ratio: 2.7 Ratio: 2.6
RIN: 9.1 RIN: 9.5
Figure 7.9. Agilent 2100 BioAnalyzer Analysis of RNA Samples A–E.

50 [Link]
Sample Purification and Quality Assessment
Delta Rn vs Cycle
GAPDH 5’
Samples A, B, C
E
GAPDH 3’

Figure 7.11. SPUD Analysis of Samples A–E.

Figure 7.10A. GAPDH 3’/5’ Multiplex Assay RNA Sample.


References
1. Vermeulen, J., De, P.K., Lefever, S., et al. Measurable impact of RNA quality
GAPDH 5’
on gene expression results from quantitative PCR. Nucleic Acids Res 2011;
39: e63
GAPDH 3’ 2. Bustin, S.A., Benes, V., Garson, J.A., et al. The MIQE guidelines: minimum
information for publication of quantitative real-time PCR experiments.
Clin Chem 2009; 55: 611-622
3. Sambrook, J., Russell, D.W. Purification of nucleic acids by extraction with
phenol:chloroform. CSH Protoc 2006; 2006
4. Glasel, J.A. Validity of nucleic acid purities monitored by 260nm/280nm
absorbance ratios. Biotechniques 1995; 18: 62-63
5. Wilfinger, W.W., Mackey, K., Chomczynski, P. Effect of pH and ionic
strength on the spectrophotometric assessment of nucleic acid purity.
Biotechniques 1997; 22: 474-481
6. Huberman, J.A. Importance of measuring nucleic acid absorbance at
240 nm as well as at 260 and 280 nm. Biotechniques 1995; 18: 636
Figure 7.10B. GAPDH 3’/5’ Multiplex Assay Sample C.
7. Manchester, K.L. Use of UV methods for measurement of protein and
nucleic acid concentrations. Biotechniques 1996; 20: 968-970
GAPDH 5’ 8. Fleige, S., Walf, V., Huch, S., et al. Comparison of relative mRNA
quantification models and the impact of RNA integrity in quantitative
real-time RT-PCR. Biotechnol Lett 2006; 28: 1601-1613
9. Bustin, Stephen A., Nolan, Tania. Analysis of mRNA Expression bu Real-
Time PCR. In: Nick Saunders, Martin Lee, eds. Real Time PCR; Advanced
GAPDH 3’
Technologies and Applications. Norfolk UK: Caister Academic Press; 2013:
51-88
10. Nolan, T., Hands, R.E., Bustin, S.A. Quantification of mRNA using real-time
RT-PCR. Nat Protoc 2006; 1: 1559-1582
11. Newbury, S.F., Smith, N.H., Higgins, C.F. Differential mRNA stability controls
relative gene expression within a polycistronic operon. Cell 1987; 51:
1131-1143
12. Witt, N., Rodger, G., Vandesompele, J., et al. An assessment of air as a
source of DNA contamination encountered when performing PCR. J
Biomol Tech 2009; 20: 236-240
Figure 7.10C. GAPDH 3’/5’ Multiplex Assay Sample D. 13. Huggett, J.F., Novak, T., Garson, J.A., et al. Differential susceptibility of PCR
reactions to inhibitors: an important and unrecognized phenomenon.
BMC Res Notes 2008; 1: 70
14. Nolan, T., Hands, R.E., Ogunkolade, W., et al. SPUD: a quantitative PCR
assay for the detection of inhibitors in nucleic acid preparations. Anal
Biochem 2006; 351: 308-310

PCR Technologies: A Technical Guide 51


OligoArchitect™ Primer and Probe Design Solutions from
Sigma® Life Sciences. Visit our OligoArchitect gateway at
[Link]/probedesignonline
Reverse Transcription

Chapter 8:
Reverse Transcription

Introduction 300

One approach to the analysis of gene expression is to measure 250


the concentration of mRNA of a gene. There are several 200 A
challenges to such analyses, such as the differences in half- B
life between different transcripts, the temporal patterns of 150 C
transcription and the lack of correlation between mRNA and D
100 E
protein. To analyze RNA using a PCR-based method, cDNA
must be produced using reverse transcription (RT). This 50
process utilizes a reverse transcriptase enzyme and dNTPs.
0
The RT step may be performed on total RNA, such that a

n
op

n
op

er

ec
oA zer

ec
ee

rio
ee

rio

lyz

Sp
Sp
Dr
Dr

ly
global cDNA representation of many transcripts is produced

gr

gr

pe

pe

na
na
no
no

bo

bo

Ex

Ex

oA
Na
Na

Ri

Ri
(usually via a two-step protocol) or in a gene-specific approach

Bi
Bi
in which only the RNA of interest is converted to cDNA (usually Figure 8.1. The concentration of five samples of total RNA (A–E) was measured
following a one-step protocol). using Nanodrop, conventional UV spectrophotometry, Bio-Rad Experion, the Agilent
2100 BioAnalyzer (all duplicate measurements) or Ribogreen (single measurement).
Since it has been demonstrated that the two-step RT reaction As can be seen, the absolute concentration as well as the relative concentration
is not always linear with respect to input RNA and cDNA yield1, varied between the samples. This was because sample C was degraded and
samples D and E contained EDTA, which caused inaccurate measurements in the
it is important to determine and control the total amount of Experion and BioAnalyzer systems.
RNA extracted and included in RT reactions. Measuring the
concentration of RNA presents uncertainty and the absolute
value is dependent on the instrument or system used to make Reverse Transcription Linearity
the measurement. As can be seen in Figure 8.1, there is a large The relative concentration of total RNA can influence the
variability between concentration measurements of 5 samples efficiency of the RT and the concentration of cDNA produced
of RNA (A–E) (see Chapter 7) when using the Nanodrop, from a given transcript. Therefore, it is desirable to include the
conventional UV spectrophotometry, Ribogreen, the Agilent same or a very similar concentration of RNA into all two-step
2100 BioAnalyzer, or the Bio-Rad Experion. Note that the cDNA synthesis reactions, unless the RT system has been
presence of EDTA (samples D and E), which would inhibit verified to have a linear response. As can be seen in Figure 8.2,
downstream RT and PCR, and degradation (sample C) have using a conventional RT protocol, the 100-fold dilutions of
different effects on concentration measurements depending input RNA do not result in a corresponding 100-fold difference
on which system is used. This observation is illustrative of the in cDNA yield for the templates tested. Interestingly, the data
importance of performing additional quality control steps prior presented are duplicate qPCR run on duplicate RT reactions. As
to using samples in downstream reactions (see Chapter 7). shown, the lack of linearity is reproducible between the two
RT reactions.

PCR Technologies: A Technical Guide 53


Chapter 8

RNA Serial Dilution 100 ng to 1 pg


Reverse Transcription Priming
6000 The choice of primers to be used to initiate reverse
transcription can greatly affect RT-qPCR results. For one-step
5000
RT-qPCR, gene-specific primers are used. When performing
Fluorescence (dR)

4000
a two-step assay, a reverse gene-specific primer, oligo-dT,
random hexamers, nonamers, decamers, dodecamers or
3000 pentadecamer2 or a combination of oligo-dT and random
primers may be used. Gene-specific priming is usually
2000
run in separate reactions for each target RNA. These
1000 separate reactions may have very different efficiencies, thus
complicating comparisons between RNA concentrations. On
0
the other hand, when using gene-specific primers, all of the
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles
RT product will encode the gene of interest and may allow
quantification of very low abundance mRNAs that could
Figure 8.2. Total RNA was diluted through 100-fold and reverse transcribed using not be detected using nonspecific RT primers. To avoid the
two-step random priming; two independent RT reactions were performed. β-actin
was detected in duplicate qPCRs for each RT reaction. The RT is reproducible, potentially high inter-assay variations in RT that can occur with
but cDNA yield is not proportional to input RNA concentration. Therefore, if the gene-specific primers, nonspecific primers may be used to
experimental restraints require that a variable concentration of RNA is included in generate a pool of cDNA. Separate qPCR assays for each target
the RT, it is critical to verify that the protocol and reagent combination result in a
linear response. can be performed subsequently with aliquots from the cDNA
pool. If all qPCR targets are near the 3’-end of polyadenylated
In the example shown in Figure 8.3, the Sigma ReadyScript® mRNAs, oligo-dT is a suitable primer choice. On the other
RT reagent was used to reverse transcribe total RNA from a hand, if the qPCR targets are more than a few kilobases from
2-fold and a 10-fold serial dilution of template using a two- the 3’-end or if the RNA is not polyadenylated, random primers
step protocol and a combination of oligo-dT and random will result in more reliable detection. If the relative 3’ location
priming (described below). The CANX gene was detected in of qPCR targets varies or the desired transcripts contain a
both dilution series with a direct proportionality to the input combination of polyadenylated and non-polyadenylated
RNA concentration. RNAs, a mixture of oligo-dT and random oligomers will give
the best results
2-Fold Dilution of RNA 10-Fold Dilution of RNA
Amplification Amplification
3000 3000 Reverse Transcription Priming for Two‑step RT
2500 2500 Reactions
2000 2000 Two approaches are commonly utilized for two-step RT
priming; oligo-dT and random priming. The oligo-dT method
RFU

RFU

1500 1500

1000 1000 relies on hybridization of an oligodT (usually 15mer) to the


500 500
poly-A tail, present on the 3’ end of the majority of mRNA
molecules, to prime and selectively reverse transcribe mRNA.
0 0
0 10 20 30 40 This approach,
0 10 while20conceptually
30 very simple,
40 has associated
Cycles Cycles
challenges: The oligo-dT primer binding is not specific to
10-Fold Dilution of RNA mRNA at the reaction temperatures used for the RT, thus the
Amplification
oligo-dT will bind nonspecifically to other regions of RNA.
3000
Additionally, stretches of rRNAs are also detected because AT-
2500
rich regions in these molecules are primed by oligo-dT. Some
2000 mRNAs, like those encoding histones, do not contain poly A
tails and might not be represented within the resultant cDNA.
RFU

1500

1000 The second method uses random priming. Random primers


500 consist of random sequences, frequently of hexamers (6mer)
0
or nonamers (9mer). These are used to prime the RT reaction,
40 0 10 20 30 40 leading to synthesis of cDNA fragments of varying length,
Cycles
which represent the original RNA. Random primers hybridize
Figure 8.3. ReadyScript® RT reagent was used to reverse transcribe total RNA from along the length of the transcript and tend to be more tolerant
a 2-fold and a 10-fold serial dilution. The gene CANX was detected in both dilution
series resulting in a direct proportionality to the input RNA concentration (data from of secondary structure than oligo-dT or gene-specific priming.
student groups attending an EMBL Advanced qPCR Workshop).

54 [Link]
Reverse Transcription
To benefit from the advantages of the respective techniques,
some protocols call for a combination of both primer types.
Reverse Transcription Efficiency
A specific primer to the target sequence may also be used in It is generally assumed that all the RNA/mRNA in a RT reaction
a two-step RT protocol but is more often used in a one-step is converted to cDNA and that all transcripts are converted in
procedure (see below). a 1:1 ratio or proportionally to the starting RNA concentration.
Recent studies have been performed to investigate each of
Reverse Transcription Priming for One‑step RT these assumptions. It is clear that that the amount of RNA
that is converted into cDNA is highly variable. The two-step
Reactions RT process is variable and specifically dependent on RNA
In a one-step RT protocol, gene-specific primers are used to concentration, enzyme, buffer composition and priming
reverse transcribe a single target. The design of the gene- protocol. Since the process is variable, it is important to
specific primer is critical; it must lie within an open, accessible maintain as many constant conditions as possible1,3,5.
region of the mRNA target when predicted at the temperature For two-step RT reactions, in general it is necessary to aim
of the RT reaction. Under these conditions there is a linear for the same input RNA concentration as well as to keep the
relationship between input RNA and cDNA (Figure 8.4). This priming conditions, RT enzyme and buffer constant. When
primer may be (and usually is) common to the PCR primer. a constant input concentration cannot be determined, it is
advisable to use a one-step process, include a carrier such
1
as Polyethylene Glycol (PEG)6, or select a commercial kit that
has been validated to result in a linear response, such as
ReadyScript® RT (Sigma).
Fluorescence (dRn)

The choice of priming strategy influences both the absolute


0.1 yield and ratio of different cDNA targets from a total RNA
sample. Figure 8.5 shows the cDNA copy number yield for
three different genes (shown by the color of the histogram)
in a RNA sample that has also been subjected to controlled,
0.01 enzymatic degradation. It is clear that the different priming
methods result in different absolute copy numbers and ratios
between the samples. In addition gene specific priming
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 appears to be more tolerant of RNA degradation than
Cycles
oligo‑dT priming.
Figure 8.4. Total RNA was diluted through a serial 10-fold dilution series and a 106
one-step RT-qPCR performed to detect GAPDH. Each reaction was performed in 105
triplicate. This resulted in a linear relationship between the RNA concentration 104
and the cDNA yield (image courtesy of Prof. Stephen Bustin, Anglia Ruskin 103
Copy Number

University, UK). 102 Gene-specific


101
Priming
Reverse transcription is a highly variable process and all steps 100

must be considered to keep reaction components as constant 106


as possible. Performing a one-step RT-qPCR reaction reduces 105
104
the number of pipetting steps required and will reduce error. 103
It may, therefore, be the method of choice if small differences 102 Oligo-dT
Copy Number

101 Priming
need to be measured and accuracy is paramount. However, 100
the contrary consideration is that the determination of the 106
gene of interest (GOI) to reference gene ratio (see Chapter 10) 105
104
requires two separate one-step RT reactions rather than a 103
single cDNA from a two-step reaction and the two targets 102 Random
101
cannot be detected using a multiplex qPCR approach. Priming
100
1 2.5 5 7.5 1 2.5 5 7.5 1 2.5 5 7.5
Min
Figure 8.5. Total RNA was incubated on a naked human hand for the times
indicated (1, 2.5, 5 and 7.5 min). cDNA was prepared using gene specific, random
or oligo-dT priming. The copy number of three genes was determined, as indicated
by the purple, turquoise and orange histograms. It is clear that the different priming
strategies influence the detection of each gene with oligo-dT priming resulting in
no detection of gene 3 (orange) which is clearly apparent in the RNA sample since
it is detected using gene specific priming (data provided by Prof. Stephen Bustin,
Anglia Ruskin University, UK).

PCR Technologies: A Technical Guide 55


Chapter 8
The temperature used for RT reactions may affect specificity, product after one-step RT-qPCR when RT was performed
especially when hybridizing gene-specific primers. Primers with Moloney Murine Leukemia Virus-Reverse Transcriptase
that can form a strong 3’-duplex will hybridize more readily at (MMLV-RT) at 45 °C (Figure 8.6B) than they did when RT was
lower temperatures. Since RT enzymes can extend from a DNA performed at 37 °C (Figure 8.6A). Similarly, performing two-
primer on a DNA template, primer-dimer formation may start step RT-qPCR with a nonspecific primer for RT and Hot Start
during the RT step. Increasing RT incubation temperature to Taq polymerase for qPCR resulted in less primer-dimer product
the highest temperature at which the enzyme is fully active or (Figure 8.6D) than using one-step RT-qPCR with gene specific
using a high-temperature enzyme may reduce the amount of primers that could form a 3’-duplex (Figure 8.6B).
primer-dimer product. The primers used in Figure 8.6 resulted
in significantly more specific product relative to nonspecific

1400
300 A) 1300 B) nonspecific
1-step qRT-PCR nonspecific 1200 1-step qRT-PCR product specific
10 U MMLV RT product 1100 20 U MMLV RT product
37 °C, 30 min 1000 45 °C, 30 min

Fluorescence, -R’(T)
900
Fluorescence, -R’(T)

200 800
700
600
500
specific 400
100 product 300
200
100
0
-100
0 -200
-300
56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (°C) Temperature (°C)

12000
D)
C) specific specific
300 11000 2-step qRT-PCR
1-step qRT-PCR product product
10000 200 U MMLV RT
2 U MMLV RT
37 °C, 50 min
45 °C, 30 min 9000
Fluorescence, -R’(T)
Fluorescence, -R’(T)

8000
200
7000

6000

5000
100
4000
nonspecific product 3000

2000
nonspecific product
0 1000

56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (°C) Temperature (°C)

Figure 8.6. Optimization of RT. (A–C) Melt curves of RT-qPCR products produced with one-step or (D) two-step RT-qPCR. Reactions A–C each contained 10 µL of Sigma’s
SYBR® Green JumpStart™ Taq ReadyMix™, 0.02 µL of Reference Dye, both gene-specific primers at 0.4 µM, and 10 ng human total RNA in a final volume of 20 µL. Gene-
specific primers were 5’-CGGGCTTCAACGCAGACTA-3´and 5´-CTGGTCGAGATGGCAGTGA-3´ for c-fos (Accession NM_005252). Reactions A and B also contained 20 units
of MMLV- RT, whereas reaction C contained 2 units. Reaction A was incubated at 37 °C for 30 min before qPCR, whereas B and C were incubated at 45 °C for 30 min before
qPCR. In D, the RT reaction contained 1x MMLV buffer (Sigma product code D8559), 0.5 mM dNTPs, 1 µM Oligo-dT, 0.8 units/µL RNase inhibitor, 200 units MMLV-RT, and 10
ng human total RNA in a final volume of 20 µL. The reaction was incubated at 25 °C for 10 min, 37 °C for 50 min, and 80 °C for 10 min. 2 µL of the RT reaction product were
added to qPCR containing 10 µL of Sigma’s SYBR® Green JumpStart™ Taq ReadyMix™ 0.02 µL of Reference Dye, and both gene-specific primers at 0.4 µM as for the one-step
reactions (A–C). All qPCR reactions were incubated at 94 °C for 3 min to denature, then for 40 cycles of 94 °C for 15 sec and 60 °C for 1 min.

56 [Link]
Reverse Transcription
The amount of RT enzyme per reaction can also affect RT-qPCR References
results. As shown in Figure 8.6, one-step reactions with 2 units 1. Nolan, T., Hands, R.E., Bustin, S.A. Quantification of mRNA using real-time
of MMLV-RT (Figure 8.6C) were more specific than reactions RT-PCR. Nat Protoc 2006; 1: 1559-1582
with 20 units (Figure 8.6B). Two-step RT-PCR using oligo-dT 2. Stangegaard, M., Dufva, I.H., Dufva, M. Reverse transcription using random
pentadecamer primers increases yield and quality of resulting cDNA.
or random primers for RT, resulted in greater specificity than Biotechniques 2006; 40: 649-657
one-step RT-PCR (Figure 8.6D). This could be attributed to 3. Stahlberg, A., Hakansson, J., Xian, X., et al. Properties of the reverse
the fact that the gene-specific primers are not present during transcription reaction in mRNA quantification. Clin Chem 2004; 50:
the low temperature RT reaction, thus preventing formation 509-515
of nonspecific products. Higher concentrations of RT may 4. Stahlberg, A., Kubista, M., Pfaffl, M. Comparison of reverse transcriptases in
give better results in two-step reactions, but because the RT gene expression analysis. Clin Chem 2004; 50: 1678-1680
enzyme can interfere with Taq DNA polymerase activity7, the 5. Tichopad, A., Kitchen, R., Riedmaier, I., et al. Design and optimization of
reverse-transcription quantitative PCR experiments. Clin Chem 2009; 55:
amount of RT product transferred to qPCR should be limited to 1816-1823
no more than 10% of the final reaction volume. The exception 6. Kubista, M., Andrade, J.M., Bengtsson, M., et al. The real-time polymerase
to this recommendation would be when using ReadyScript, chain reaction. Mol Aspects Med 2006; 27: 95-125
in which 25% of the PCR volume can be RT reaction without 7. Chandler, D.P., Wagnon, C.A., Bolton, H., Jr. Reverse transcriptase (RT)
affecting the PCR efficiency. inhibition of PCR at low concentrations of template and its implications
for quantitative RT-PCR. Appl Environ Microbiol 1998; 64: 669-677
This description of the variables that are inherent in the 8. Bustin, S.A., Benes, V., Garson, J.A., et al. The MIQE guidelines: minimum
RT process demonstrates that the determination of gene information for publication of quantitative real-time PCR experiments.
expression from RT is dependent on the RT method used, Clin Chem 2009; 55: 611-622
the quantity and quality of the samples, in addition to the
consideration of template quantity and should be carefully
reported, as described in the MIQE guidelines8 (see Chapter 3).

PCR Technologies: A Technical Guide 57


Quantify Gene Expression.
Save time and money with ready-to-order, predesigned
KiCqStart® Primers from Sigma® Life Science.

Bioconvenient.
Available through Sigma’s state-of-the-art gene
search tool, KiCqStart Primers are perfect for
two-step and one-step SYBR® Green I RT-qPCR.
Together with our ReadyScript™ cDNA Synthesis
Mix and KiCqStart SYBR Green qPCR ReadyMix™
for two-step reactions, Sigma ensures the success
of every SYBR qPCR assay—every time.

Analyze your sequence now


[Link]/ksprimers
Assay Optimization and Validation

Chapter 9:
Assay Optimization and Validation

Introduction • Optimizing Probe Concentration

Assay optimization and validation are essential, even when • Optimizing Reaction Components and Multiplex
Conditions
using assays that have been predesigned and commercially
obtained. Optimization is required to ensure that the assay is • Validating Performance with a Standard Curve and Melt
as sensitive as is required and that it is specific to the target Curve Analysis
of interest. For example, pathogen detection or expression
profiling of rare mRNAs require high sensitivity; SNP detection
requires high specificity and viral quantification needs
Validating Primer Design
both high specificity and sensitivity. Assays requiring high Validation of primer design is particularly important when
specificity are particularly vulnerable when performed without adopting primers from a previous publication or using a
optimization and adequate controls. Similarly, when multiple commercially supplied assay. The primer design can be
targets are to be detected simultaneously in multiplex reviewed with respect to the assay design guidance provided
reactions, assay conditions must be optimized to detect all in Chapter 6. It is critical to ensure that:
targets equally. Validation provides the data required to justify • Primers are homologous to the desired target sequence.
the continued use of the assay in further research projects1.
• The reverse complement primer is correct. Carefully
There are a number of factors that can be altered to obtain check reverse complement base orders (using
optimum assay performance and thereby lead to higher [Link]
molecular sensitivity, specificity and precision. Assays • Appropriate splice variants are detected.
purchased from skilled commercial providers still require
validation within the laboratory in which they are being used. • SNPs have been avoided unless required for the assay.
Claims relating to the performance of assays should be verified • The oligos and amplicon do not adopt a secondary
under the conditions of the study, including test samples, structure.
specific reagents and the instrument of choice. • There is low potential for the oligos of the reaction to
An assay that has been designed such that all desirable hybridize to each other.
design criteria were met (see Chapter 6, Assay Design) is The ability of primers to hybridize to one another, especially
likely to perform well under a wide range of conditions. at the 3’-end, may lead to primer extension during PCR and
However, all assays have a set of optimal conditions and the formation of target-independent products, known as
these are dependent on the instrument, selected reagents primer dimers. Whenever primer dimer products are produced
(buffer conditions), primer concentration and/or annealing and amplified, they divert reaction components away from
temperature (Ta), magnesium concentration and even ramp synthesis of the desired product, thereby reducing assay
rate. Since it is usual to run the assay on a selected instrument efficiency and sensitivity. Therefore, primer dimers are an
and under standard buffer conditions, most optimization issue in reactions using both probe-based and SYBR Green I
procedures are focussed on modification of primer binding dye-based detection. With dye-based detection such as SYBR
kinetics using primer concentration or annealing temperature Green I, primer dimers also affect assay specificity because the
(Ta)/melting temperature (Tm). nonspecific DNA-binding dye will bind to the primers and be
Regardless of whether the target is DNA (qPCR) or RNA detected along with the desired product. Therefore, primers
(RT-qPCR), the following preliminary steps will help ensure that are likely to form primer dimers should be avoided.
successful quantification: To determine the potential for primer-dimer formation,
use primer design software to analyze duplex formation.
• Validating Primer Design
OligoArchitect ([Link]/probedesignonline) provides
• Optimizing Primer Concentrations details of the strength of self-dimer and cross dimer
• Optimizing Primer Annealing Temperature hybridization (Figure 9.1). Any 3’-terminal dimers formed by

PCR Technologies: A Technical Guide 59


Chapter 9
either the primer hybridizing with itself or with its partner, Optimizing Primer Concentrations
must be very weak (∆G ≥ –2.0 kcal, Figure 9.1). Any primer
with both a terminal ∆G < –2.0 kcal and an extendable 3’-end When using probe-based qPCR, satisfactory results are often
(5’-overlap) should be avoided. The strongest overall dimer obtained using final concentrations of both primers at 500 nM
should be unstable (∆G ≥ –6.0 kcal). To avoid strong 3’-terminal and the probe at 250 nM, especially if the PCR target is
dimers while maintaining specificity, choose primers that have abundant and maximum sensitivity is not required. Somewhat
2 G or C residues in the last 5 bases, 1 G or C in the last 3 bases lower primer concentrations, between 200 nM and 400 nM, are
and an A or T at the 3’-end (Figure 9.1). typically better when using SYBR Green I dye-based detection
to minimize nonspecific amplification and when optimizing
multiplex reactions. To verify that standard conditions are
suitable for use, conduct a standard curve analysis (see Assay
Evaluation). If the detection is linear, reproducible and the
gradient is between –3.2 and –3.5 over the range of target
concentrations expected in samples, it may not be necessary
to optimize primer and probe concentrations further.
Some of the indications that an assay is not well-optimized
are; that it lacks reproducibility between replicates and is
generally inefficient and insensitive. Assay performance is
usually tested at a range of primer concentrations, for example,
from 50–800 nM, using each primer at each concentration
(Figure 9.2; for a full protocol, see Appendix A, Protocols;
Primer Optimization).
b–d. Dilute fwd primers

a. 8 µM 4 µM 2 µM 1 µM 0.5 µM
fwd fwd fwd fwd fwd

e. Dispense fwd primers


1 2 3 4 5 6 7 8 9 10 11 12
a. 8 µM
b–d. Dilute rev primers

f. Dispense rev primers

rev A

4 µM B
Figure 9.1. Analysis of primers for primer-dimer potential. Primer sequences were rev
analyzed with OligoArchitect design software to determine their ability to form 2 µM C
rev
duplexes. A self dimer and cross dimer potential is shown for the best primer
option. 1 µM D
rev

Multiplex qPCR will give the best results if all primers in the 0.5 µM
rev
E

reaction have similar melting temperatures (Tm difference F


≤ 2 °C) and do not form strong 3’-duplexes (∆G ≥ –2.0 kcal). G

Optimizing Primer Concentrations and Annealing H

Temperature (Ta) Figure 9.2. Primer optimization example. Layout of 8-tube strips (top and left side)
and PCR plate for diluting and dispensing primers.
When optimizing assay conditions using primer concentration,
a fixed Ta (usually 60 °C) is selected and the optimal conditions The combination of concentrations yielding the lowest Cq,
for each primer are addressed independently. This is critical lowest variation in replicates and a negative NTC is chosen
when designing an assay to be run in multiplex, since all (see Figure 9.3)2.
reactions must run at the same annealing temperature, and
is a tactic that can also be used to rescue poorly performing
assays for which an alternative design is unavailable. A
technically simpler approach is to select a fixed primer
concentration and then optimize the Ta selecting the best
result for those primers in combination. This is the preferred
approach when using several assays and dsDNA-binding dye
detection, such as SYBR® Green I. However, this approach does
require an instrument that can simultaneously run reaction
programs utilizing different Ta options.

60 [Link]
Assay Optimization and Validation
A) All Primer Concentrations 50 nM to 600 nM – Same Target Concentration the sensitivity is unacceptable in multiplex reactions. Decrease
3000
primer concentrations for those primer pairs that result in low
2800

2600
Cq values and/or increase concentrations for those that yield
2400 high Cq values, within the range of 50–500 nM.
2200

2000
Optimizing Primer Annealing Temperature
Fluorescence (norm)

1800

1600 Quantitative PCR assays are generally performed using


1400
two- or three-step temperature cycling programs, typically
1200

1000
with 35–40 cycles. Two-step reactions cycle between two
800 temperatures, usually 95 °C (typically for 10–15 sec) and 60
600 °C (typically for 30–60 sec or 5–10 sec under fast conditions).
400
Two-step temperature reactions are selected when running
200

0
Dual-Labeled Probe (TaqMan or hydrolysis) assays because
ΔCq = 22 the lower temperature elongation promotes exonuclease
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Cycle activity of the DNA polymerase and discourages displacement


of the probe. This would be the favored cycling condition
B) Optimization of a Well-designed Primer Pair protocol for performing many different assays under the same
70
UBC Primer Optimization parameters. However, the disadvantage of using the two-step
65

60
method is that it reduces the potential options for primer
55
design and limits assay optimization to primer concentration
50 alone because no annealing temperature (Ta) optimization
Fluorescence

45 is possible.
40

35
100/50 A three-step cycling protocol is preferable when the target
30
50/50
sequences are complex and either the chosen primers are
25 50/400
difficult to optimize or the detection system in use is not
20 200/400
15
dependent on the use of a hydrolysis probe. Three-step
10 Δ Cq = 9 50/100
strategies cycle between: 95 °C (typically for 10 sec), an
400/400
5 annealing temperature (between 55 °C and 65 °C, typically for
5 10 15 20
Cycle
25 30 35 40
10–20 sec or 5 sec under fast conditions) and 72 °C (typically
for 20–30 sec or 15–20 sec under fast conditions). In this case,
Figure 9.3. Results from a PCR primers concentration optimization from a SYBR
Green I dye assay. A) Established guidelines recommend that a variety of forward (F)
the Ta may be optimized to further improve assay performance
and reverse (R) primer concentrations are tested. In this example 50 nM to 600 nM using the following protocol:
was tested in combination to determine the optimal concentration for the assay.
In this experiment, there is an enormous difference in Cq due to different primer • Start at the low end of the Ta range to be tested, which
concentrations, illustrating how this can impact the final data (data from Jens is determined by the Ta of the primers, and increase the
Stolte, EMBL). B) This experiment shows optimization of a well-designed assay and temperature stepwise in gradual increments (usually
variability due to primer concentration. The 400 nM forward and reverse primer
combination was chosen as optimal because this combination represented the testing between 55 °C and 65 °C). Some instruments have
lowest primer concentrations that reproducibly yielded the earliest Cq values while gradient blocks that facilitate temperature optimization in
retaining a sigmoidal curve. a single run.
If one target in a multiplex reaction is significantly more • Test each reaction product for specificity, either by post-
abundant than the other(s) or if one primer pair yields a much PCR melt curve analysis or agarose gel electrophoresis, as
lower Cq than the other(s), amplification of that target may described below.
dominate the reaction, using up reaction components before
other targets are detectable. Adjusting the concentrations
• The optimal annealing temperature is the one that results
in the lowest Cq, a negative NTC, a melt curve analysis
of primers may allow for a more balanced amplification of all revealing detection of a specific product and high
targets. To determine if such adjustments will be beneficial, reproducibility between replicate reactions.
prepare standard curves (see Assay Evaluation) that cover
the range of targets expected for each primer pair alone If the annealing temperature is too low, the reaction will be
(singleplex) and with all primers combined (multiplex). If nonspecific. However, if the temperature is too high, the
multiplex and singleplex reactions give similar results, the stringency may affect reaction efficiency, resulting in a lack
primer concentrations are suitable. On the other hand, of amplification or very high Cq values, very poor yields and
optimizing primer concentrations is likely to improve results if low reproducibility.

PCR Technologies: A Technical Guide 61


Chapter 9
An example of a temperature optimization is shown in C) A Comparison of KiCqStart Primers Performance to Custom Design
Figure 9.4. In this case (Figure 9.4A), identical reactions CANX in LuminoCt
Ta 61.7
CANX in KiCqStart
Ta 58.4
were run on a gradient PCR block such that the annealing
temperature was between 47.8 °C and 71.7 °C. Annealing at
64.8 °C and 61.7 °C results in identical Cq values but the slightly BD
lower temperature produces a higher yield of product, as KS
KS BD
evidenced by a higher end point fluorescence and a reaction
with apparently higher efficiency (indicated by the gradient
of the amplification plot). The absolute determination of KS Cq=22.5 BD Cq=23 KS Cq=22.5 BD Cq=23
efficiency requires a standard curve assessment (see Assay
Evaluation) or use of single tube efficiency determination
Figure 9.4. Primer optimization using Ta. A) A range of annealing temperatures was
algorithms3,4. The second part of the figure (Figure 9.4B) shows tested for identical reactions. Annealing at 64.8 °C and 61.7 °C results in identical Cq
a comparison between the behavior of primers under identical values and high reproducibility between replicates, but the slightly lower tempera-
reaction conditions but in different reagent mixes. Here, it is ture produced a higher yield of product. B) Two identical reactions were set up in
different reagent mixes (LuminoCt® SYBR® Green qPCR ReadyMix™or KiCqStart®
clear that the buffer composition influences the reproducibility SYBR® Green qPCR ReadyMix™) and a primer temperature gradient run. The optimal
of the assay and the range of temperatures over which temperature differed in each mix and there was less variation between data when
stable data is achieved. Finally, two independent assays were reactions were run in KiCqStart reagents. C) Two primer pairs to the same target
(KS and designed using Beacon Designer, BD) were run in different reaction mixes.
designed to the same target gene and these were optimized It can be seen that the optimal annealing temperature is different in the different
in each buffer. As is shown Figure 9.4C, each buffer required reagents (61.7 °C in LuminoCt and 58.4 °C in KiCqStart) to yield similar results from
a different optimal temperature to yield comparable Cq data the primers.

from the two primer pairs (61.7 °C in LuminoCt and 58.4 °C in Although most commercial assays are supplied with standard
KiCqStart, both Sigma reagents). PCR assay conditions, individual assays may benefit from
A) TBP gene Ta gradient (LuminoCt Reagents Fast Cycling) further optimization to identify conditions that are specific
7500
Ta for the particular primer combination. This may be due to
primer dimers, nonspecific amplification, or sub-optimal
7000
6500

6000
61.7
reaction efficiency under the default conditions selected.
Upon completion of optimization, assay efficiency should
5500 64.8
5000
Fluorescence (norm)

58.4
4500 be calculated by applying the chosen conditions to the
4000

3500 measurement of a series of standards and preparing a


3000
55.2 standard curve (see Assay Evaluation). It is possible that, even
2500

2000 after optimization, the efficiency may still be sub-optimal, and


1500
1000
in the worst case scenario, a new assay may be required.
47.8–52.4
The range of tolerable efficiency values should be defined
500

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 by the user prior to beginning the optimization process.


Cycle
Ideally, the efficiency should be >95%. However, it is possible
to perform accurate measurements with assays which have
B) KiCqStart Sybr Green Primers Ta Optimization
KS primers CANX in LuminoCt KS primers CANX in KiCqStart
efficiencies of <90% and, as with primer design, the target
sequence may dictate that the target cannot be amplified
with a higher efficiency. Nevertheless, when using an assay
with a lower efficiency, it is likely that the precision and limit
of detection will be affected. Under these circumstances, it is
essential to use appropriate discretion when interpreting and
reporting data1.

Fast Cycling Protocol, Ta Gradient

62 [Link]
Assay Optimization and Validation

Optimizing Probe Concentration increases the rate of DNA hybridization, enabling efficient
hybridization during the rapid cycling conditions used by
A final concentration of 250 nM probe may be used for most many instruments. Optimization of MgCl2 concentrations
assays. However, if maximum sensitivity is not required, becomes more important when running multiplex reactions.
lower concentrations of probe may suffice, thereby reducing
the assay cost. To optimize the probe conditions, test it at Salts, such as KCl or (NH4)2SO4, will also change DNA duplex Tm,
several concentrations, ranging from 50 to 500 nM final, in but the effect is less drastic for these monovalent cations.
combination with the optimized concentrations of primers Graphed Samples 0.5

and the lowest concentration of target nucleic acid that 0.25


is expected to be included in the final experiments. The

Fluorescence
0
lowest concentration of probe that allows the most sensitive
detection (Cq ≤ 30 with best reproducibility) may be used. –0.25

–0.5

Optimizing Reaction Components and –0.75


10 20 30 40

Multiplex Assays
Melting Curve Graph
Cycle

There are some assays that are particularly sensitive to buffer/

Fluorescence
reaction conditions. For these assays further modification
of reaction buffers by optimization of MgCl2 concentration,
addition of PCR enhancers (Mueller in PCR Technologies;
Current Innovations, 20135) or adjustment of instrument 70 75 80 85
ramp rates can result in improved performance. In addition Temperature

to the assay optimization guidelines provided in the previous Figure 9.5. Effects of magnesium concentration.
sections, these factors are particularly important when
The effects, shown in Figure 9.5, are magnified when
optimizing multiplex reactions.
performing multiplex PCR. Running multiple reactions
concurrently introduces competition for reagents and
Optimizing Mg2+ Concentration exacerbates any sub-optimal conditions, creating major
changes in PCR efficiency.
Magnesium plays several roles in PCR. It is a required
divalent cationic counter-ion for dNTPs and a co-factor for
all polymerases. Divalent cations strongly affect DNA double Ramp Rates
strand hybridization. Increasing magnesium concentration There are rare occasions when a difficult reaction requires
raises the stability, or melting temperature, of a DNA duplex. further modification. When all other options have been
It follows that high magnesium levels increase the affinity exhausted, it may be possible to recover a lost situation by
of primers toward hybridization, including mis-priming empirical testing and modification of the PCR ramp rate.
events and primer-primer interactions. The mis-primed DNA
duplexes become substrates for the DNA polymerase, in
effect creating side products and sapping PCR efficiency. Probe Fluorophore and Quencher Selection
Therefore, the concentration of MgCl2 has an impact on both When running multiplex assays, it is also important to
the specificity and yield of PCR because magnesium affects maximize the spectral separation of the multiple emissions
the hybridization of the primer to the target, the processivity from different fluorophores to facilitate signal isolation and
of Taq DNA polymerase, as well as the rate of hydrolysis by the data analysis. Therefore, fluorophores with narrow, well-
exonuclease moiety when used for probe cleavage in qPCR. resolved bandwidths that are widely separated are useful
Hence, insufficient MgCl2 results in poor yields due to low for multiplex applications. However, in reality the choice
polymerization rate of DNA polymerase, compromised primer of fluorophore is restricted by the optical system of the
binding and inefficient probe cleavage. If the concentration instrument. Chapter 5 contains further information pertaining
of MgCl2 is too high, the specificity of the reaction will be to selection of fluorophores and quenchers.
compromised because this will lead to greater stability of
nonspecific primer hybridization.
In contrast to conventional PCR assays which use 1.5–2 mM
standard MgCl2 concentrations, hydrolysis probe qPCR assays
require higher concentrations of around 3–5 mM to achieve
efficient cleavage of the probe. The presence of MgCl2 also

PCR Technologies: A Technical Guide 63


Chapter 9

Guidelines for Optimization of Quantitative both RNA and RT enzyme (Figure 9.6). DNA amplification
is regarded as acceptable in qPCR if the Cq values for no-RT
Reverse Transcription PCR (RT-qPCR) reactions are at least 5 cycles greater than those for reactions
with RT6. However, if there are fewer than 5 cycles between Cq
When performing RT-qPCR, it is not only important to consider
values for reactions with and without RT, DNA amplification
the guidelines for standard qPCR as discussed previously and
may contribute to mRNA quantification.
optimize the RT as discussed in Chapter 8, but also to address
the following points that are specific to the RT step: A B
MW + – + – +/– RT
• Verify RNA Quality (see Chapter 7).
• Confirm that Primers Span or Flank Long Introns (see 2,000
Chapter 6). 1,500

• Optimize Reverse Transcription (see Chapter 8). 1,000


750
• Verify No-Reverse Transcriptase (No-RT) Control Data.
500

Confirm that Primers Span or Flank Long Introns 300 294


150 191
While most gDNA is eliminated from the sample during 50
RNA purification, no procedure removes all of the DNA.
Since PCR is capable of amplifying a single molecule of DNA, Figure 9.6. Evaluation of no-RT controls. RT-PCR products produced in the presence
(+) or absence (–) of RT enzyme were fractionated on an ethidium bromide-stained
contaminating DNA is amplified as well as RNA when using 2% agarose gel in TBE. Primers for the mRNA target in A flank a 1 kb intron. The
RT-qPCR. If the target mRNA is fairly abundant (hundreds mRNA target in B aligns with several genes, at least one of which is a pseudogene
or thousands of copies per cell), the resulting signal from that lacks the intron between the primers used for RT-PCR and, therefore, gives a
product of the same size with and without RT enzyme.
contaminating amplification of DNA will be negligible in
comparison to the products from the RNA; however, if the When the DNA contamination of the RNA is contributing
target mRNA is moderately abundant or rare (<100 copies/ significant signal to the experiment, the RNA should be
cell), signal arising from DNA amplification can lead to digested with an RNase-free or amplification-grade DNase I,
erroneously high estimates of mRNA levels. To avoid DNA before RT-qPCR to allow reliable mRNA quantification. Note
amplification during RT-qPCR, where possible, use primers that on-column DNase digestion (a procedure offered with
that either flank an intron that is not present in the mRNA many commercially available RNA purification kits in which
sequence or that span an exon-exon junction (see Chapter 6). a DNase digestion is performed while the RNA is bound
If the gene of interest does not contain introns, if the intron to a silica column) is less effective at eliminating DNA than
positions are unknown, or if there are no suitable primers that digestion in solution after eluting RNA from the column. As a
span or flank introns, it may be necessary to digest input RNA result, on-column (OC) DNase digestion may not be sufficient
with an RNase-free or amplification-grade DNase I. The data for RT-qPCR (Figure 9.7). No-RT controls should be conducted
from no-RT controls can be used to determine whether or not with DNase-digested RNA to verify that the digestion was
further digestion with DNase I is needed. successful and sufficient. In the example shown in Figure 9.7,
OC DNase digestion is sufficient to detect reliably the target
Verify No-reverse Transcriptase (No-RT) Control Data mRNA. It would not be sufficient to quantify reliably a much
less abundant mRNA if greater sensitivity was required.
Regardless of whether the primers span or flank introns,
the specificity of RT-qPCR assays should be tested in Note that different types of cells and tissues, as well as
control reactions that do not contain reverse transcriptase different growth conditions, produce significantly different
(no-RT control) to evaluate potential amplification from concentrations of specific mRNAs. In addition, different RNA
contaminating DNA. As described in Chapter 6, DNA purification methods yield different amounts of contaminating
sequences with short introns (≤1 kb) may be successfully DNA. As a result, reactions with and without reverse
amplified in RT-PCR. Many genes have additional copies, or transcription should be performed at least once with each
pseudogenes, that lack one or more introns. As a result, the new starting material, RNA preparation method, or assay.
DNA contributions to resulting data from RT-PCR assays should
be tested by performing a reaction that contains the RNA
sample but no RT enzyme, alongside reactions containing

64 [Link]
Assay Optimization and Validation
5 the number and approximate size of the products. An assay
with high specificity will result in a single melt peak at a
4 high temperature in reactions containing only target with
nothing, or very little, detected in the no-template controls
(Figure 9.8A). If the melt curve has more than one major peak,
Fluorescence (dRn)

3
as in Figures 9.8B and 9.8C, the identities of the products can
be further investigated by resolving them on an ethidium
2
bromide-stained agarose gel. As shown in Figures 9.8D
and 9.8E, reactions B and C contain excessive amounts of
1 primer-dimer or other nonspecific products. Lowering the
primer concentrations will often reduce the amount of
nonspecific products. If nonspecific products are still detected
0
in significant amounts with low primer levels, it is best to
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles redesign the primers.
Figure 9.7. Comparison of on-column DNase digestion (OC) with post-preparation A) B) C)
DNase digestion. Total RNA was prepared from 30 mg pieces of mouse liver with
either the Sigma GenElute™ Total RNA Kit or a column purification procedure
from an alternative supplier, both according to the manufacturers’ instructions.
Two RNA samples were prepared with the respective manufacturer’s on-column
DNase product and two were prepared without DNase digestion. After purifica-
tion, aliquots of the four RNA samples prepared without on-column DNase were
digested with Sigma’s Amplification Grade DNase I according to the manufacturer’s
instructions. Equal proportions of all were used in one-step RT-qPCR. Fluorescence
plots for two of the RNA samples are shown. Similar results were obtained with both D) E) F)
manufacturers’ products and only the procedure requiring the post purification
DNAse treatment removed all gDNA.

Assay Evaluation
Once the assay has been optimized so that the most sensitive
conditions have been identified, it is important to determine
Figure 9.8. Evaluation of melt curves. Melt, or dissociation, curves showing a sharp
the assay specificity, efficiency and technical dynamic range. peak of specific product at >80 °C with very little nonspecific product at lower
temperatures (A) or significant amounts of nonspecific, lower melting product
Determine Specificity Using Melt Curve Analysis (B and C). D to F show PCR products from as shown on the melt curves A to C,
respectively, resolved on ethidium bromide-stained 2% agarose gels.
Specificity can be determined by the use of a melt curve
analysis. Performing a melt curve requires incorporation of a An example of a melt curve analysis revealing gDNA and
reporter dye such as SYBR Green I dye or the use of a non- NTC primer-dimer contamination of RNA is shown in
hydrolyzing probe such as a Molecular Beacon or Scorpions® Figure 9.9. In Figure 9.9A, a specific product is evident from
Probe (see Chapter 5). After the amplicon is produced during the test reactions and a smaller product, melting at lower
qPCR, it is subjected to incubation at increasing temperatures, temperature, is present in the NTC. This is indicative of the
usually between 55 °C to 95 °C. However, the user should verify formation of primer-dimers in the absence of template. This
that the theoretical melt point of their amplicon falls within is commonplace and is only a concern when these primer-
this range since this will be dependent upon the size and dimer products are evident in the test samples as shown in
GC content. The experimental Tm will vary slightly between Figure 9.8. The example in Figure 9.9B shows detection of the
different runs and reagents, primarily due to variations in unprocessed gDNA gene in a DNA sample using the same
MgCl2 and other ion concentrations. assay (in this case, primers were located in exons spanning
the intron) that had also been used for mRNA detection. The
The change in fluorescence is determined and plotted as products are distinguished by their melt profile with the gDNA
rate of change of fluorescence vs. temperature. Since SYBR product melting at a higher temperature because this also
Green I is a nonspecific dye that binds to any double-stranded contains the intron.
DNA, it is important to verify that the qPCR produces only
the desired product when using this detection chemistry.
Melt, or dissociation, curve analysis can be used to determine

PCR Technologies: A Technical Guide 65


Chapter 9
The determination of the technical dynamic range and
Specific Product efficiency of an assay from a standard curve is illustrated in
(from RNA)
A Figure 9.10. In this example, the template has been diluted
Non-specific Product through a 10-fold series of 11 logs and so a theoretical
(from gDNA)
detection limit is demonstrated as 3 copies (lowest Cq),
although the precision of this measurement is clearly
determined by the reproducibility, which is relatively low at
B such high cycles.

Primer dimer (non-specific)

Fluorescence (dR)
Figure 9.9. Example of a melt curve analysis A) primer dimers in no template control
and B) the amplification across the intron of gDNA. Theoretical Sensitivity

Specificity is critically important when designing assays


3×1010 target 3 target
for genotyping. These are often probe assays and require copies copies
discrimination of a single base difference such as when Cycles

differentiating between Single Nucleotide Polymorphisms Measured Dynamic Range


(SNPs). In this case, it is critical to test each probe in Cq variation at assay limit

a single reaction against a template that is known to Figure 9.10. An example of high reproducibility and wide range of detection using
contain the specific matched sequence and against the a serial dilution of linearized plasmid. Eight replicates were run for each dilution
mismatched sequence. and amplification of the target detected using SYBR Green I dye. Quantification is
possible between 3×1010 and 3 copies.

Determination of Efficiency and Limit of Detection Assay efficiency is determined by measurement of the
The most effective means to measure assay performance is gradient of a standard curve that is a plot of the log of the
via the construction of a standard curve from a serial dilution target concentration against the Cq (Figure 9.10). An assay
of template. Assay efficiency can be measured as a factor with an efficiency of 100% would demonstrate doubling at
of the standard curve gradient. A wide range of sample each cycle (E=2) and a gradient of –3.323.
concentrations is run, ensuring that these reach a limiting Efficiency can be calculated according to the equation:
dilution, thus allowing determination of the technical assay
Efficiency = 10(–1/slope) –1. Note: the software for many
dynamic range from the same experiment.
instruments provides an efficiency measure as a percentage.
Any suitable template material is appropriate for these This value is the percentage of E=2; therefore, an efficiency
technical determinations of assay performance. Selection of a of 95% equates to E=1.9
standard, transferable reference material allows for inter- and
The slope = m and is determined from the standard curve of
intra-laboratory validation. Therefore, this stage of validation
equation y=mx+C.
can be carried out on linearized or nicked plasmid (supercoiled
DNA does not amplify efficiently and results in low C is the theoretical intercept on the y-axis and provides a
reproducibility), cloned fragment or synthetic oligo. However, relative measure of the sensitivity of the assay.
it must be recognized that validation on these targets is a Slopes between –3.1 and –3.6 result in efficiencies between
measure of the assay function and does not accommodate 90% and 110% and are typically accepted, but it is important
variability introduced by the complexity of a biological sample. to strive for as close to 100% as the assay will permit. The data
presented in Figure 9.11 are illustrative of the normal range
of variation in efficiency and sensitivity of a series of different
assays. This serves to demonstrate how important it is to report
these data in publications1,6-8.

66 [Link]
Assay Optimization and Validation
45.00
The value of R2, or how well the data fit on the standard curve
straight line, is a measure of reproducibility and is influenced
40.00
by pipetting accuracy and by the dynamic range of the assay.
35.00
Therefore, when assessing assays, it is critical to use a minimum
30.00 of three technical replicates for each dilution. If R2 is ≤0.985,
25.00 the assay may not give reliable results because reproducibility
Cq

20.00 between replicates is poor. If one, or more, points at the lowest


levels of input nucleic acid are shifted away from the linear
15.00
region of the plot, it is likely that the measured concentration
10.00
exceeds assay sensitivity. If one, or more, points at the highest
5.00 copy number of input nucleic acid are shifted away from the
0.00 linear region of the plot, it is likely that the reaction is saturated
1.00 0.50 0.25 0.13 0.06 0.03
and that the concentration of target exceeds the useful assay
Log Quantity
range. Alternatively, if several random points are above or
Figure 9.11. An example of efficiency determination and comparison of several, below the line, pipetting accuracy or assay optimization may
potential reference genes. As can be seen, these have very different efficiencies
and sensitivities (data provided by students attending an Advanced qPCR
be a problem. Verify that the tips fit the pipette properly and
workshop, EMBL). that the volume dispensed is reproducible and verify primer
optimization as described above.
Alternative approaches to standard curve efficiency calculation
have been proposed. These methods report the efficiency The standard curve is an essential tool for validation of
of single reactions within the tube. These approaches rely multiplex reactions. Running multiple reactions concurrently
on algorithms to model the amplification plot curves and so introduces competition for reagents and exacerbates any non-
are dependent on the number of cycles over which there is optimal conditions, creating major changes in PCR efficiency.
an increase in fluorescence. These are most likely to succeed Figure 9.12 demonstrates this point. The efficiency curves for
when the measurement is made using a DNA-binding dye or two primer/probe targets were performed individually and
Scorpions® Probes since these assays yield a greater change in then in multiplex. The graph shows that while the individual
fluorescence per cycle. While this type of approach potentially reactions (dark blue and green lines) give relatively similar
offers an ideal alternative to standard curves, the latter is still efficiencies and sensitivities (y-axis values), running the
the more common method used for assay evaluation. This reactions together dramatically changes the sensitivity and
is because standard curves not only provide an estimation efficiency of the multiplex reaction.
of efficiency, but also provide additional information about
working dynamic range, sensitivity and reproducibility and are
conceptually easier to apply9.

PCR Technologies: A Technical Guide 67


Chapter 9
CMYC (fam) single
Singleplex vs Duplex, 8/9/2005 CMYC (fam) duplex
CD C20 (JOE) single
CD C20 (JOE) duplex
Linear (CMYC (fam) single)
Linear (CMYC (fam) duplex
Linear (CD C20 (JOE) single
Linear (CD C20 (JOE) duplex
CDC multiplex
y = -3.1601x + 45.67
R2 = 0.9736

CDC single
Cq

y = -2.3993x + 31829
R2 = 0.9648

cmyc duplex
y = -3.4387x + 30.482
R2 = 0.9863

cmyc single
y = -3.2114x + 29.872
R 2 = 0.9939

Log ng DNA
Figure 9.12. Singleplex Reaction vs Duplex Reaction.

References
1. Bustin, S.A., Benes, V., Garson, J.A., et al. The MIQE guidelines: minimum
information for publication of quantitative real-time PCR experiments.
Clin Chem 2009; 55: 611-622
2. Nolan, T., Hands, R.E., Ogunkolade, W., et al. SPUD: a quantitative PCR
assay for the detection of inhibitors in nucleic acid preparations. Anal
Biochem 2006; 351: 308-310
3. Ramakers, C., Ruijter, J.M., Deprez, R.H., et al. Assumption-free analysis of
quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett
2003; 339: 62-66
4. Ruijter, J.M., Ramakers, C., Hoogaars, W.M., et al. Amplification efficiency:
linking baseline and bias in the analysis of quantitative PCR data. Nucleic
Acids Res 2009; 37: e45
5. PCR Technologies: Current Innovations. 3 ed. Editors Nolan and Bustin,
CRC Press; 2013
6. Nolan, T., Hands, R.E., Bustin, S.A. Quantification of mRNA using real-time
RT-PCR. Nat Protoc 2006; 1: 1559-1582
7. Bustin, S.A. Why the need for qPCR publication guidelines?--The case for
MIQE. Methods 2010; 50: 217-226
8. Huggett, J. and Bustin, S.A. Standardisation and reporting for nucleic acid
quantification. Accredit Qual Assur 2011; 399-405
9. Ruijter, J.M., Pfaffl, M.W., Zhao, S., et al. Evaluation of qPCR curve analysis
methods for reliable biomarker discovery: bias, resolution, precision, and
implications. Methods 2013; 59: 32-46

68 [Link]
Data Analysis

Chapter 10:
Data Analysis

PCR/qPCR Qualitative Analysis Amplification


plot
Plateau

After a traditional PCR has been completed, the data are


Log-
analyzed by resolution through an agarose gel or, more linear

(R, dR, Rn, or dRn)


phase
recently, through a capillary electrophoresis system. For some Threshold

Fluorescence
applications, a qPCR will be run with the end-point data used Detection limit
for analysis, such as for SNP genotyping. In each case, end- Baseline

point data provides a qualitative analysis after the PCR has


reached plateau phase. In some cases, it may be possible to
analyze end-point data to make a semi-quantitative analysis of Cq
the PCR yield, but quantitative measurements are more often Cq Cq Cycle #
made using qPCR and analysis of quantification cycle values
Figure 10.1. The components of amplification plots. This graph shows the increase
(Cq)1 values. of fluorescence with the number of cycles for different samples. The threshold is
set above the detection limit but well below the plateau phase during which the

qPCR Data Analysis


amplification rate slows down.

A common approach is to use the fluorescence intensity


Throughout this guide, the factors that contribute to variations during early cycles, such as between cycles 5 to15, to
in the measurement of nucleic acid using PCR or qPCR have identify a constant and linear component of the background
been highlighted. Each of these factors should be optimized fluorescence. This is then defined as the background or
to result in an assay that provides the closest possible value baseline for the amplification plot. Due to transient effects,
to the actual quantity of gene (target) in the reaction. The it is advisable to avoid the first few cycles (e.g., cycles 1 to 5)
result of these processes is the generation of a set of Cq for baseline definition because these often show reaction
values for each target in each sample. The process of deriving stabilizing artefacts. The more cycles that are used for the
and analyzing those Cq values to provide reliable data that baseline correction, the better the potential accuracy of the
represent the biological story is presented in this chapter. linear component of the baseline variations. Many instrument
software packages allow manual setting of the cycles to be
Deriving Accurate Cq Values considered for baseline definition. These functions should be
explored by the user and the temptation to accept default
Baseline Correction settings strongly resisted.
A Cq value is determined for each target in each sample. An example of the effect of baseline setting is shown in
Different analysis packages that are associated with different Figure 10.2. As can be seen, Cq values and the apparent shape
instruments, have alternative approaches for determining the of the amplification plot are affected by accurate baseline
Cq (and also use alternative names, e.g., Ct, Cp, take off point). It setting. In the example, the baseline for the curve labeled C3
is beyond the scope of this guide to delve into the fine details has been incorrectly adjusted manually so that the baseline
of all of these algorithms. However, qPCR measurements that cycles calculated from the data in cycles 5 to cycle 31.
are based on amplification curves are sensitive to background This causes the curve to dip blow the zero baseline level
fluorescence. The background fluorescence may be caused (Figure 10.2A) with a Cq of 28.80. To correct this, the raw data,
by a range of factors, which include choice of plasticware, R, are viewed and the last cycle of the linear background (the
remaining probe fluorescence that is not quenched, light last cycle before amplification) is identified. In Figure 10.2B,
leaking into the sample well and differences in the optical this can be seen to be cycle 22. The baseline is correctly set
detection for a given microtiter plate well. In well-designed to be zero between cycle 5 and cycle 22 (Figure 10.2C),
assays, the background is low when compared to the and the amplification plot is then corrected (Figure 10.2D).
amplified signal. However, variation in background signal may The corrected Cq is 26.12. Therefore, note that there was a
hinder quantitative comparison of different samples. Therefore, substantial difference between the Cq values with the incorrect
it is important to correct for background fluorescence and correct baselines settings, demonstrating that setting the
variations that cause differences in the baseline (Figure 10.1). correct baseline is an important component of data analysis.

PCR Technologies: A Technical Guide 69


Chapter 10
A)

B)
Amplification Plots

End of horizontal baseline

Figure 10.2A–B. A) Typical example of data dropping below the zero normalized fluorescence reading when the baseline setting is incorrect (blue amplification plot).
B) Raw data of the same amplification plots showing the limit of the linear baseline and that the data are not at fault.

C)

D)
Amplification Plots

Figure 10.2C–D. C) The limits of the start and end of the baseline are defined using the appropriate software settings. D) Application of the corrected baseline setting results
in good quality data.

the signal to increase above the baseline if the original copy


Setting the Threshold number is low and fewer cycles if the copy number is high.
Although some researchers advocate mapping individual Since the baseline is set at the limit of detection for the system,
amplification plot to estimate amplification efficiency and measurements at the baseline would be very inaccurate.
target quantities in measured samples2,3,4, the original and Therefore, rather than measuring to the intensity of minimum
most common approach to deriving the Cq is to use a fluorescence that the system can detect, a higher fluorescence
threshold. The wide adoption of this approach is likely to be is selected and an artificial threshold is introduced.
due to the threshold method being a simple and effective
The selection of the threshold intensity requires adherence to
quantification method.
some fundamental principles. It is important that the threshold
The principle behind the threshold method is that; in order is set at a fixed intensity for a given target and for all samples
to visualize the associated fluorescent signal from the qPCR that are to be compared. If there are too many samples to fit
amplification, the signal must increase so that it is above the on a single plate, then an inter-plate calibration scheme must
detection limit of the instrument (and therefore, the baseline; be adopted, e.g., inclusion of a replicated control that serves
see Figure 10.1). The number of cycles required for this to as an inter-plate control or a standard curve serial dilution. In
occur is proportional to the initial starting copy number of theory, the threshold can be set anywhere on the log-linear
the target in the sample. Hence, more cycles are required for phase of the amplification curve. However, in practice, the

70 [Link]
Data Analysis
log-linear phase of the amplification may be disturbed by the The process of threshold setting is demonstrated in
background fluorescence baseline drifting, the plateau phase, Figure 10.3. In Figure 10.3A, the amplification plots are viewed
or differences in assay efficiency and therefore amplification on a Y axis log scale, thus providing a visual expansion of
plot gradient at higher cycles. It is recommended that the the log phase of amplification and presenting this as a linear
threshold is set as follows: portion of the amplification plot. The threshold is set at the
highest fluorescence intensity (refer to Y axis) that is within
• Sufficiently above the background fluorescence baseline to
this log phase and where all amplification plots are parallel.
be confident of avoiding the amplification plot crossing the
The scale is then returned to the linear view (Figure 10.3B)
threshold prematurely due to background fluorescence .
showing the highest setting that fulfils the threshold setting
• In the log phase of the amplification plot where it is requirements. Alternatively the threshold may be set at the
unaffected by the plateau phase (this is most easily lower end of this log phase (Figures 10.3C and 10.3D). As long
seen by viewing the amplification plots on a log view, as the log phase of the amplification plots are parallel, the ΔCq
Figure 10.3A). between samples is unaffected by the threshold setting.
• At a position where the log phases of all amplification plots
are parallel.

A) Amplification Plots B) Amplification Plots

30000
10000
Fluorescence (dR)

Fluorescence (dR)

20000

1000

10000

100

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles Cycles

C) Amplification Plots D) Amplification Plots

30000
10000
Fluorescence (dR)
Fluorescence (dR)

20000

1000

10000

100

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40

Cycles Cycles

Figure 10.3 The threshold setting influences the absolute Cq recorded and can influence ΔCq between samples. A). Using a log vs linear plot of the data, the threshold is set
at the highest fluorescence intensity but where the amplification plots show parallel log phases. B). The threshold setting is maintained from A) and is displayed on the linear
vs linear plot. C). Using a log vs linear plot of the data, the threshold is set at the lowest fluorescence intensity but where the amplification plots show parallel log phases.
D). The threshold setting is maintained from C) and is displayed on the linear vs linear plot. In each case, the ΔCq values between samples are the same.

PCR Technologies: A Technical Guide 71


Chapter 10
The requirement for a threshold setting at a position where of the relative quantity of target in each sample are highly
the log-linear phases of the amplification plots are parallel dependent on the setting of the threshold (Figure 10.4)
becomes more pertinent when data at higher cycles are because the amplification plots are not parallel.
included in the analysis. The threshold setting procedure that
was described for the data in Figure 10.3 was repeated on a Table 10.1. Dependence of Relative Cq Values on the Position of the
data set of higher Cq and the results presented in Figure 10.4. Threshold Setting.
The resulting Cq data in Table 10.1 serve to illustrate the Threshold 1 Threshold 2 Threshold 3
variability in the Cq, and more importantly, the ΔCq values Cq value ΔCq (1) Cq value ΔCq (2) Cq value ΔCq (3)
for three amplification plots with three threshold settings 30.67 28.77 32.33

(Figure 10.4). The ΔCq values and therefore the estimate 37.38 6.71 35.17 6.4 39.31 6.98
35.03 4.36 32.99 4.22 36.88 4.55

A) Amplification Plots B) Amplification Plots

30000
10000

Fluorescence (dR)
Fluorescence (dR)

20000

1000

10000

100

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles Cycles

C) Amplification Plots D) Amplification Plots


30000

10000
Fluorescence (dR)

Fluorescence (dR)

20000

1000

10000

100

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles Cycles

Figure 10.4 The analysis that was performed and demonstrated in Figure 10.3 was repeated using a different data set. In this case, the amplification plots are not parallel
due to a difference in efficiency of the reaction at high Cq. The lowest settings for A) and B) result in different ΔCq values than the highest settings for C) and D) (Summarized
in Table 10.1).

72 [Link]
Data Analysis

qPCR Quantification Strategies oligonucleotide standard or linearized plasmid carrying the


standard sequence. Once a suitable construct or amplicon is
Accurate baseline and threshold setting is imperative for identified, a standard curve of serial dilutions is generated. The
reliable quantification. After setting each of these, a Cq value is Cq for the target is determined for each of the standards and
generated and this is used as the basis for quantification. The plotted against the concentration or relative concentration/
quantity of target in a given sample is then determined using dilution factor on a log scale. This results in a standard
either a standard curve or relative/comparative quantification. curve that is then used to determine the concentrations of
test samples by comparison of the Cq values derived from
Standard Curve Quantification amplification of the unknown samples. When using a standard
curve for quantification, the threshold setting must be kept
As the name implies, standard curve quantification requires constant for determination of Cq for the standard and for
the use of a standard curve to determine quantities of targets the samples on the same plate. The threshold can differ
in test samples. All quantities determined for samples are, between plates.
therefore, relative to the quantity assigned to the standard
curve. This requires running additional, external standards
alongside every set of sample reactions. The choice of material Relative/Comparative Quantification
for the standard curve is important for eliminating potential Relative or comparative quantification uses the difference in
differences in quantification due to differences between Cq as a determinant of the differences in concentration of the
assay efficiencies in the samples and in the standards. The target sequence in different samples. Rather than measuring
primer binding sites of the external standards must be the quantities of target per sample as with the standard curve
same as those in the target, contain sequences that are the method, this leads to sets of data showing fold changes
same as the target, have similar complexity and be handled between samples.
in as similar a manner as possible. Therefore, when measuring
the concentration of a target in cDNA, it is preferable to In the original form of this approach5, the efficiency of all of the
measure the same cDNA in a serial dilution of a control assays was assumed to be 100%, leading to the assumption
sample. However, for some studies there are practical reasons that a Cq difference of 1 (ΔCq = 1) was as the result of a 2-fold
that prevent this, so it is important to reproduce the sample difference in target. To determine a fold change in the target
conditions as closely as possible, e.g., by adding gDNA or gene of interest (GOI), the data must also be referenced to
from a species unrelated to the test species, to an artificial a loading control (reference gene, ref; see the following for a
discussion regarding data normalization).
Fluorescence (dR)

1.0

0.8

0.6

0.4

0.2
3×1010 target
copies
0.0
3 target
copies
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles

Figure 10.5. Construction of a Standard Curve. The Cq recorded for each sample of a dilution series is plotted on a log linear scale against the relative concentration.

PCR Technologies: A Technical Guide 73


Chapter 10
In Equation 1, the ratio of the GOI, after correction to the ref
gene, in 2 samples (A relative to B) is measured as: 2 (assuming
Normalization
100% efficient reactions) raised to the power of the differences The major objective of most PCR-based experiments is to
in the Cq values for the GOI divided by 2 raised to the power of address the basic question of whether the target is present
the differences in the Cq values for the ref gene in the sample (unknown, UNK). At the very simplest level, this
is answered by running a gel and examining the fragments
for the presence or absence of the desired GOI. When the
fragment is present, the confirmation of fragment size gives
reassurance of a positive result. However, when absent,
Equation 1. Original (Livak) Relative Quantification Model. there is the potential of a false negative result. Therefore, it is
However, as illustrated in Chapter 9, the efficiencies of critical to repeat the test assay and also perform at least one
reactions vary considerably and this can have a large impact additional PCR to serve as a loading and positive PCR control.
on data. Therefore, the assumptions in Equation 1 were The universal, inhibition control assay, SPUD (see Chapter 7),
addressed (Equation 2)6, so that the differences in reaction can be used to support confidence in a negative result. An
efficiencies could be incorporated into the analyses. In this alternative approach is to run an assay that is specific to a
case, the amplification factor 2 is replaced by the actual reference gene or genes. Traditionally, PCR assays detecting
efficiency of the PCR (as determined by a standard curve the reference genes, GAPDH, 18S ribosomal RNA, or β actin
analysis; see Chapter 9) were run alongside those for the GOI and the resulting
fragments visualized on a gel. GAPDH, 18S ribosomal RNA, and
β actin are constitutively expressed and were therefore used
as loading controls in semi-quantitative analyses. However, it
soon became apparent that these genes are not ubiquitously
Equation 2. Efficiency Adapted (Pfaffl) Relative Quantification Model expressed at the same concentration in all cells, regardless of
experimental design. Therefore, the need arose for a stable
As an example of using the efficiency adapted (Equation 2)
reference when the objective was to measure relative nucleic
relative quantification model, a set of Cq values are presented
acid concentrations, usually cDNA but also gDNA when, for
in Table 10.2. The efficiency for the GOI is 1.8 and for the ref
example, examining the copy number variation of a gene.
gene 1.94.
Normalization is the process of correcting technical
Table 10.2. Worked Example to Calculate Fold Change (Ratio) measurements to a stable reference in order to examine
Using Cq Differences. true biological variation. There are many methods for
EΔCq GOI normalizing technical differences which means that the
Sample Cq GOI Δ Cq GOI
E
ΔCq GOI
Cq Ref ΔCq Ref E ΔCq Ref
EΔCq Ref appropriate approach for the specific experiment must
1 34 18 be selected and validated7. It is critical to recognize that
2 26 8 110.2 17 1 1.94 56.8 adoption of inappropriate normalization techniques may be
more detrimental to the overall analytical process than not
This is a very simple example of a study with the requirement
normalizing at all8.
to measure the fold difference between one gene in two
samples and after normalization to a single reference gene.
The ratio shows the fold change of the GOI in sample 2
The Effect of Sample Quality On Assay Normalization
relative to sample 1, after correction to the single Ref gene. The effect of sample integrity and purity on target quantity
However, it has become apparent that selection of a single, measurements by qPCR and RT-qPCR was discussed at
suitable reference gene is often impossible and, therefore, length (Chapter 7, Sample Quality Control and Chapter 8,
more sophisticated approaches for normalization have Reverse Transcription). It was demonstrated that inhibitors
been suggested. in the sample and RNA degradation have a differential effect
on the measurement of a given target9. Inhibitors effect
the measurement of any target but to a different degree,
depending on the assay design. Degradation of total RNA
effects the measurement of mRNA and miRNA10, again
being highly dependent on the overall experimental design.
Therefore, it is critical to consider the effect of template

74 [Link]
Data Analysis
concentration on the RT reaction and the effect of the sample measured by qPCR by comparing the copies of HER-2 with
quality on data after normalization. Normalization will not another genomic target that is acting as a control.
counter the effect of low quality assays or samples (see
When measuring gene expression, reference genes are targets
Chapter 9).
with mRNA concentrations that do not change as a result of
the experiment. An example study would be one in which the
Normalization Approaches effect on the expression of gene X is being measured after
Ideally, normalization methods counteract variability that may addition of a mitogenic compound to a cell monolayer. A
be introduced during the multi-step process that is required reference point is required in order to measure the change in
to perform a qPCR analysis (Figure 10.6). However, applying gene X. Therefore, another gene (or genes) that are known not
normalization at any one stage in the process may not control to be affected by the mitogen in question is also measured.
for technical error and/or bias that was, or will be, introduced This provides the researcher with the immediate challenge of
at an earlier or later stage, respectively. Normalization methods finding a mRNA target that is not affected by the experimental
are not mutually exclusive and so adopting a combination of procedure, before being able to study the GOI. This process of
controls is recommended11. validation of reference genes is fundamental for an accurate
measurement of the GOI. The most widely used approach to
Factors Process
normalization is to ignore this process and normalize the gene
Sample
Sampling expression data to a single, unvalidated reference gene. This
Storage practice is not recommended and is in direct opposition to
Quality the MIQE guidelines1. The quantification of mRNA by RT-qPCR
Extraction
has routinely been compromised by the incorrect choice of
Normalization

reference genes. It is not acceptable to follow the relatively


Nucleic Acid common practices of using a reference gene because the
Storage
primers are in the freezer already, it was used historically on
Yield
RT Northern blots, it is used by a colleague, or used in another
Quality laboratory for a different experiment. Reference genes need
Inhibitors to be validated under specific experimental scenarios to be
qPCR assured that the reference gene in question is not affected
Figure 10.6 qPCR is a multistep process and each step must be controlled. Normal- by the experiment. If this validation is not carried out and the
ization must be considered within a series of controls. reference gene is affected by the experiment, the results could
be incorrect and subsequent interpretations are likely to result
The objective of normalization is to provide a stable reference
in meaningless data8.
point against which the measurements can be referred;
therefore, the choice of normalization factor must be a There is a range of scientific literature describing different
measurement which is stable throughout the experiment. This methods for normalization7-14 as well as a plethora of
may be stable reference gene(s), or one of the alternatives, publications describing the protocols required to identify the
such as cell number, tissue mass, RNA/DNA concentration, most appropriate normalizer genes for a given experimental
an external spike12, or a representative measure of the global scenario. While in the past, a key question was whether to
expressed genes. select single or multiple reference genes, lower running
costs means that current best practices have moved towards
measuring multiple reference genes.
Reference Gene Selection Selection of stable reference genes requires the analyst to
Reference genes are targets whose quantity does not change evaluate the stability of qPCR for a number (usually 10 to 20
as a result of the experiment. When quantifying DNA copy genes) of candidate mRNA targets7 on a subset of samples
number variation in which the number of copies of the that represent the test and control mRNAs. A full protocol
sequence of interest may change, the measurement is simply is provided in Appendix A, Protocols, of this guide and may
normalized by targeting an alternative genomic region be used in combination with different analytical methods
that is known not to change. An example of how this may using programs such as REST15, GeNorm14, Bestkeeper16, or
be applied is when measuring Human Epidermal Growth NormFinder17. This procedure is described in more detail in the
Factor Receptor 2 (HER-2) genomic amplification13. HER-2 following section, Analysis of Reference Gene Stability.
genomic instability is a prognostic indicator in breast cancer
and accurate measurement of HER-2 amplification status
is important in patient management. HER-2 status can be

PCR Technologies: A Technical Guide 75


Chapter 10

Analysis of Reference Gene Stability Table 10.3. Example Reference Gene Panel for Validation of Reference
Genes. For accurate performance it is important to avoid reference gene
The reference gene is literally the pivot point for qPCR relative candidates that are co-regulated.
quantification assays. It is therefore critical for the reliability
Reference Gene Accession No.
of the entire assay that the reference gene is stable. If the
1 18S NR_03286
reference gene expression varies between samples, the 2 ACTB NM_001101
variation will be directly transferred to the quantification 3 ATP5B NM_001686
results and the added variability may obscure the desired 4 B2M NM_004048
observable biological effect or, even worse, may create an 5 CANX NM_001024649
entirely artificial appearance of a biological effect, one that 6 EIF4A2 NM_001967
is unrelated to the actual gene of interest. For these reasons, 7 CAPDHa NM_002046
it is strongly recommended that several safety measures are 8 GAPDHb NM_002046
followed to render reference gene variability insignificant and 9 GUSB NM_000181
make measures of biological effects as significant as possible. 10 PPIA NM_021130
11 SDHA NM_004168
Arguably, the most important safety measure is to use not 12 TBP NM_003194
only one, but two or more, reference genes. The expression of 13 TUBB NM_178012
several reference genes can be averaged to reduce technical 14 UBC NM_021009
variability due to normalization. This can be useful to improve 15 YWHAZ NM_003406
significance in measurements of small biological effects.
However, more importantly, two or more reference genes The list of reference gene candidates shown in Table 10.3 was
provide mutual controls for maintained stability and control specifically chosen to select genes that belong to different
for unexpected occurrences that may influence the expression functional classes, reducing the chance that the genes may
levels of one of the reference genes. With a single reference be co-regulated. A notable exception is GAPDH, which is
gene, there is a risk that unexpected influences of gene present here in two versions. Although this does not affect this
expression may be undetected in the assay. analysis, it is best practice is to avoid multiple entries of genes
that may be suspected of being co-regulated.
Another safety measure is to use more than one method of
identifying stable reference genes. The following is an example The first algorithm to be demonstrated is geNorm. This
to illustrate several aspects of reference gene normalization, provides an evaluation of gene stabilities by calculating a
including a possible advantage of using both geNorm and gene stability measure called the M-value, which is based
NormFinder methods on the same data set. on pairwise comparisons between the analyzed reference
gene candidate and all other reference gene candidates in
Table 10.3 holds a list of reference gene candidates that were
the data set. It is performed in an iterative fashion, meaning
evaluated during a workshop that Sigma previously conducted
that in this example, the procedure is first performed on all
with EMBL. Samples were collected from a human cell culture
15 reference gene candidates, the least stable is removed,
in two different treatment groups. This data set will be used to
the process is repeated on the remaining 14, the second least
demonstrate aspects of reference gene validation.
stable candidate is removed, and so on until two reference
Both the NormFinder and geNorm algorithms have been genes remain.
developed with the assumption that testing a multitude of
There may be times when identification of the most stable
reference gene candidates can be used to rank the stability
reference gene may be particularly challenging. One case
of individual reference gene candidates. The assumption may
may be when all reference gene candidates perform poorly.
be true if, for example, all reference gene candidates vary
Another case may be if all reference gene candidates perform
stochastically around stable expression levels. However, this
well. To distinguish between these two cases, a useful
may not necessarily be true in reality. To avoid misleading
guideline is that reference genes with an M-value below 0.5
results, it is therefore prudent to avoid regulated and in
may be considered stably expressed.
particular co-regulated reference gene candidates.
The second algorithm to be demonstrated is NormFinder,
which is a freely available reference gene analysis package (see
Appendix B, Additional Resources). The underlying algorithm
takes a ANOVA-like approach to reference gene stability
evaluation in that the whole and subgroups are analyzed for
variations. One advantage of this is that the obtained measures
are directly related to gene expression levels. A standard

76 [Link]
Data Analysis
deviation of 0.20 in Cq units therefore represents about 15% The bar diagrams shown in Figure 10.7 illustrate reference
variation in copy number expression levels of the particular genes ranked according to their respective stability measures
reference gene candidate. using both algorithms. In addition, a graph showing the
accumulated standard deviation from NormFinder indicates
For convenience, in this demonstration, both of these analysis
that a combination of up to the three best reference genes
packages are accessed using GenEx (MultiD) data analysis
may yield stability improvements.
software, but they are also available as independent packages
(see Appendix B, Additional Resources).
geNorm NormFinder

Genes Genes

Figure 10.7. Bar diagrams showing stability measures: M-values for geNorm and standard deviations for NormFinder. In addition, a graph showing the accumulated standard
deviation from NormFinder indicates that a combination of up to the three best reference genes may yield stability improvements. The data set was generated from assays
designed for the reference gene candidates shown in Table 10.3 and measured on a human cell culture in two different treatment groups. Notice that, in this instance, the
reference gene stability algorithms geNorm and NormFinder do not agree about the best reference genes.

Figure 10.8. Mean centered expression profile of the reference gene candidates of the two samples in each treatment group. Samples 1 and 2 belong to the first treatment
group and samples 3 and 4 belong to the second treatment group. Expression profiles of SDHA and CANX are indicated in red. Expression profile of UBC is indicated in
yellow. The table lists the measured Cq values in the data set.

PCR Technologies: A Technical Guide 77


Chapter 10
Due to the deviating expression profiles, it is possible that The analysis of data in this example serves to illustrate
SDHA and CANX are regulated by the different treatment that using geNorm and NormFinder in parallel allows for
alternatives and therefore, are not suitable as reference identification of co-regulated reference gene candidates and
genes. Removing these from the data set and repeating the that removing these genes from further studies provides a
analysis results in agreement between both algorithms and final identification of reference genes that can be adopted
that the best choice of reference genes is EIF4A2 and ATP53 with more confidence than after using a single analysis.
(Figure 10.9). In the NormFinder calculation of accumulated Identification and selection of stable reference genes leads to
standard deviations, it is also apparent that the addition of greater security of data analysis.
more reference genes does not improve stability.
A) B) Alternative Normalization Methods
While normalization to reference genes is the most common
method for assay normalization, there are situations where
this approach is not suitable, such as when a large number
of genes in a heterogeneous group of samples is to be
compared, or when profiling miRNA. In these scenarios it is
necessary to adopt an alternative strategy.

Normalization to Tissue Mass or Cell Number


Measurement of cell number or tissue mass to use as a
normalization factor is not as simple as it may first appear. Cell
culture experiments are relatively easy to normalize based on
cell count. However, addition of a treatment might impact cell
morphology, complicating the ratio of cell number to total
RNA/genes expressed when compared with a control culture.
Genes The experimental treatmentGenesmay result in the production
of extra cellular matrix causing differences in nucleic acid
B) extraction efficiencies.
Biological tissues can be highly heterogeneous within and
between subjects, with more variation being apparent
when healthy tissue is compared with diseased tissue.
Even apparently less complex tissues, such as blood, can
differ considerably in cell count and composition such that
gene expression varies considerably between apparently
healthy donors18.
Any delays in the processes used to purify nucleic acid will
result in alterations in the measured RNA. For example,
delays in processing peripheral blood mononuclear cells and
extracting RNA from cells, results in considerable changes in
gene expression19. The methods underlying the extraction
procedures are also major sources of technical variation. Even
the isolation process selected for sampling blood derived cells
Genes and RNA purification result in differences in apparent gene
Figure 10.9. Inspection of the expression profiles and measured Cq values expression profiles20.
(Figure 10.8) raised concern that SDHA and CANX may be co-regulated in the
applied assay. The co-regulation may disrupt reference gene stability algorithms.
Therefore, the first normalization consideration is to ensure
Bar diagrams showing stability measures: A) M-values for geNorm and B) standard that collection and processing is absolutely identical for all
deviations for NormFinder. The data set is the same as the one used in Figure 10.8 samples. It is then critical to perform sufficient quality control
except that the data for SDHA and CANX have been removed. Notice that with this
reduced data set the reference gene stability algorithms geNorm and NormFinder
to be certain of the sample concentration, integrity, and purity
do agree about the best reference genes. (see Chapter 7 and associated protocols in Appendix A).

78 [Link]
Data Analysis
Normalization to RNA Concentration Biological and Technical Replicates
As a minimum, an estimation of template concentration The purpose of normalization is to avoid systematic errors and
(DNA for qPCR or RNA for RT-qPCR) is important and, as to reduce data variability for the eventual statistical analysis.
mentioned in Chapter 7, it is critical to ensure that the Another important aspect of setting up data for statistical
same instrument is used for all measurements because the analysis is the use of data replicates.
determination of nucleic acid concentration is also variable
Biological replicates are absolutely necessary for statistical
and technique dependent.
analysis. Statistical significance levels are often set at a 5%
When measuring total RNA concentration, the vast majority significance cut-off. For biological effects close to such a
of the sample is composed of rRNA, with only a small fraction significance level, it may be necessary to have at least 20
consisting of the mRNA of interest when examining gene biological replicates to determine the assays significance level
expression, or the sncRNA when examining gene expression (1:20 corresponding to 5%). In fact, it has been suggested that
regulation. This means that if the rRNA concentration increases at least 50 times the number of observations are required
a small amount but the mRNA remains constant, the total RNA to be recorded for an accurate estimate of significance25,
concentration will increase. The mRNA concentration must i.e., on the order of a thousand biological samples. Naturally,
increase a significant amount to cause an apparent increase practical limitations seldom allow for biological replicates at
in the total RNA concentration. Hence, rRNA concentration these levels. Furthermore, accurate estimates of the number
is an unreliable measure of the mRNA concentration, but for of necessary biological replicates to meet a given significance
many protocols, equal RNA concentration is required to ensure level also depend on the level of variability of the data.
accurate reverse transcription (see Chapter 8). Nevertheless, it is important to realize that a common mistake
is to underestimate the necessary number of biological
Normalization to Global Gene Expression replicates to be able to arrive at reliable conclusions. It is
When measuring large numbers of targets, the analyst can recommended to perform an initial pilot study to evaluate
estimate the global mean of the total gene expression and the assay’s inherent variability and the potential size of the
identify regulated RNA sequences that deviate from this observable biological effect in order to have a good basis to
mean. This approach is conventionally used for normalization estimate the necessary number of biological replicates26.
of gene expression arrays. It is a valuable alternative to using Technical replicates are not used directly for the statistical
reference genes and may be preferable where many targets analysis. Instead, technical replicates are used to backup
are being measured. samples (in case some samples are lost in the technical
Another recently explored approach is the measurement handling process) and to improve assessment of data
of endogenously expressed repeat elements (ERE) that are accuracy. Technical replicates can improve data accuracy
present within many of the mRNAs. Many species contain if the assumption holds true that they vary stochastically
these repeat elements (ALU in primates, B elements in mice), around the accurate measurement at each stage of the
which can provide an estimation of the mRNA fraction. technical handling process. The average of the technical
Measurement of these target sequences has been shown replicates is closer to the accurate measurement. The effect
to perform as conventional normalizing systems9 (Le Bert, of averaging technical replicates can be illustrated by noting
et al., in preparation) and may offer a universal solution or an the size of the confidence interval in a simulated data set
alternative for complex experiments where stable reference with a predetermined variability, i.e., standard deviation set at
gene combinations are unavailable. one. As seen in Table 10.4, the confidence interval becomes
smaller with an increasing number of technical replicates
(samples), indicating a more precise estimate of the accurate
Normalization of miRNA Data measurement. Furthermore, the narrowing of the confidence
As yet there have been no reports of a miRNA universal interval is most dramatic at the low number of technical
reference gene. Therefore, the selection of normalization replicates. Increasing the replicate number from 2–3 decreases
system is still rather empirical. When possible, stable invariant the confidence interval from 8.99–2.48, i.e., a more than 3-fold
miRNAs may be identified from genome-wide approaches, improvement of the precision in the estimate of the accurate
i.e., microarrays. Small nucleolar RNAs (snoRNAs) have also measurement. While additional replicates continue to improve
been used as reference genes. Global gene expression is also the estimate of the accuracy of the measurement, the effect
a useful method of normalizing miRNA expression when a is at a decreasing magnitude. Therefore, it is apparent that in
stable reference is unknown and several hundred targets have cases where technical handling variability is an issue, it may be
been analyzed21,22,23. This method is more appropriate for those a great advantage to use triplicates rather than duplicates.
using approaches resulting in capture of all miRNAs as cDNA in
a multiplexed form, e.g., Exiqon and miQPCR systems (refer to
Castoldi et al. in PCR Technologies, Current Innovations24).

PCR Technologies: A Technical Guide 79


Chapter 10
Table 10.4. Size of Confidence Intervals of Estimated Means analysis techniques may be employed repeatedly in order to
Normalized to a Standard Deviation of 1 and an α Confidence Level support one or several hypotheses. The exploratory study is
of 5%. The confidence interval becomes smaller with an increasing thus very flexible to the specifics of any scientific question.
number of technical replicates samples, indicating a more precise estimate However, the repeated probing of hypotheses testing on
of the accurate measurement at higher number of replicate samples. one data set may lead to issues that undermine statistical
Confidence Intervals of Estimated Means conclusions. This is due to multiple testing, which refers to the
Samples Cl (α=0.05 and SD=1) fact that a statistical test with several independent hypotheses
2 8.99 is more likely to yield a positive significance and that the
3 2.48 chances of this increases as additional hypotheses are tested,
4 1.59 even if the underlying probability distributions are identical.
5 1.24 To avoid misleading statistical results, the exploratory study is
10 0.72 therefore often combined with a confirmatory study.
20 0.47
The requirements for a confirmatory study are based on
50 0.28
much stricter statistical criteria. First, the hypothesis of study,
Technical replicates can be collected at several stages including criteria for significance, needs to be defined before
throughout the sample handling process, including RNA the collection of data and before the analysis. In addition, the
extraction, reverse transcription and qPCR detection. If data set for analysis needs to have been collected exclusively
technical replicates are detected at several stages, a nested for this purpose. It is statistically incorrect to reuse the data set
experimental design is generated. A pilot study that takes from the exploratory study in the confirmatory study since that
advantage of a nested experimental design may help to data set would inherently favor the proposed hypothesis. The
identify sample handling stages that contribute the most to end result of the confirmatory study is a rejected or accepted
technical handling errors and an optimal sampling plan can be hypothesis according to the pre-stated criteria.
calculated based on this information27.
Statistical Tests
Statistical Analysis and Data Visualization For statistical testing, the likelihood that an observed
Scientific analysis of biological data centers on the formulation phenomenon occurred by random chance is analyzed. This is
and testing of hypotheses. The formulation of a hypothesis called the Null hypothesis28. If the observed phenomenon is
requires a detailed understanding of the conditions and rare according to the Null hypothesis, the conclusion is that it
variables of the assay. Successful testing of a hypothesis is unlikely that the Null hypothesis is valid. The Null hypothesis
involves careful execution and an appropriate experimental is rejected and the likelihood of the alternative hypothesis as
design to maximize the desired observable signal while significant is accepted.
minimizing technical variability. In this context, it is useful to The estimated likelihood that the observed phenomenon
distinguish between exploratory and confirmatory studies occurred by random chance is called the p-value. The
(Figure 10.10). p-value is measured in a range from 0 to 1, or equivalently,
Data Collection
in percentage units. The statistical criteria for a confirmatory
Hypothesis, including
Criteria for Significance study include an alpha cut-off under which calculated p-values
Analysis on one Data Set Redefine Data Set or would indicate significance for the observed phenomenon. An
with one Method Select another Method
New Data Collection alpha cut-off of 5% is commonly used, although this must be
adjusted to fit desired and necessary criteria that are specific to
Analysis According to
Hypothesis
the subject of study.
Interesting? No
Many algorithms have been developed for calculating
Yes No
Valid
According to
p-values under various assumptions and for different
Criteria? purposes. A common algorithm is the Student’s t-test. The
Define Hypothesis
Yes Student’s t-test is used to calculate a p-value based on the
Hypothesis Rejected Hypothesis Accepted
difference in the mean values between two groups of data.
The main assumption of Student’s t-test is that the two
Figure 10.10. Flowchart illustrating operations involved in exploratory and confir- groups of data are independent and conform to normal
matory statistical analyses. The left-hand side of the figure, before the dashed arrow, distributions. An advantage of the Student’s t-test is that it
shows operations in an exploratory statistical study. The right-hand side of the
is powerful, compared to nonparametric statistical tests29.
figure, after the dashed arrow, shows operations in a confirmatory statistical study.
A non-parametric test that is equivalent to the Student’s
The purpose of the exploratory study is to analyze data with t-test may be one of the most well-known non-parametric
one or several different techniques in order to substantiate statistical tests; the Wilcoxon rank-sum test (sometimes called
a hypothesis. The data set may be redefined and/or different Mann-Whitney U test; not to be confused with Wilcoxon

80 [Link]
Data Analysis
signed-rank test which is used to compare two paired groups). The presence of the SEM can be recognized in the equation
Non‑parametric statistical tests, such as the Wilcoxon rank- for the confidence interval as the ratio between the standard
sum test, have an advantage over parametric statistical tests, deviation (SD) and the square root of the number of samples
such as the Student’s t-test, in that they do not depend on (N) and thus it is evident that the confidence interval is
prior assumptions of the data set distributions. A Kolmogorov- based upon the SEM. The lower limit of the confidence
Smirnov’s test for normal distribution may be used to decide interval is constructed by subtracting the SEM multiplied by
whether to apply the Student’s t-test or one of the non- a percentile of a t-distribution from the mean. The upper limit
parametric tests of the confidence interval is constructed by adding the SEM
multiplied by a percentile of a t-distribution from the mean.
In addition to the choice of algorithm for p-value calculation,
The confidence level of the confidence interval is set by the
data sets that are fed into the p-value calculation algorithm
confidence level associated with the critical value t*; typically a
may be manipulated to facilitate observation of desired
95% confidence level.
properties in the data set. The combination of raw data
manipulation steps and choice of p-value calculation Figure 10.11 shows a bar graph with error bars denoting the
algorithm is part of building a hypothesis model. 95% confidence interval within each experimental group,
highlighting the uncertainty associated with the mean
There is a high level of freedom in building hypothesis models
estimate for an example gene expression in samples from
in the exploratory phase of a statistical analysis and this is an
different organs after treatment with several drug doses. In
important part of scientific inquiry. However, a hypothesis
addition, the t-test statistical significance p-values are shown
is never proven using a scientific, statistical approach. A
for the difference in gene expression between the control
correct scientific approach is to formulate a Null hypothesis,
samples and each of the three different samples from different
use an independent (preferably a newly collected) data set,
drug dose responses, indicated by means of an asterisk
and accept or reject the Null hypothesis according to the
notation. It is customary to have one asterisk correspond to
confirmatory study flowchart (Figure 10.10).
a p-value below 0.05, two asterisks correspond to a p-value
below 0.01 and three asterisks correspond to a p-value
Visualization Techniques for below 0.001.

Univariate Analysis 2
Gene Expression Dose Response

Just as there are many analysis methods available, there 1.8


are also many data visualization techniques from which to 1.6
1.4
choose. For univariate data analysis, a simple bar diagram with 1.2 Dose 0

associated error bars is an appropriate visualization technique. 1


Dose 1
Dose 2
Even though this is a common and simple visualization 0.8 Dose 3
0.6
technique, there are issues that are worth emphasizing.
0.4
First, error bars may illustrate different sources of variability; 0.2
the inherent variability of the data (the standard deviation, 0
SD) or the precision by which the mean value has been Organ 1 Organ 2 Organ 3 Organ 4

determined. Secondly, the precision by which the mean value Figure 10.11. Fold change (log2) expression of a gene of interest relative to a pair
has been determined can be illustrated in different ways, of reference genes, relative to the expression in the sample with lowest expression
within each organ type. Bar heights indicate mean expression of the gene in several
but it ultimately depends on a combination of the inherent samples in groups of non-treated (Dose 0) samples or samples treated at one of
variability of the data together with the number of samples (N) three different drug doses (Dose 1, Dose 2, and Dose 3). Error bars indicate 95%
and in its raw form, it is called the standard error of the mean confidence interval estimates of the mean expressions. One asterisk indicates statis-
tically significant difference between the means of a treated sample set compared
(SEM, Equation 1): to the mean of the non-treated sample set to 5%; two asterisks indicate statistically
SD significant difference to 1%; three asterisks indicate statistically significant difference
SEM = (Equation 1)
to 0.1%.
N
PCR Technology, Current Innovations-3rd ed. by Taylor and Francis Group LLC Books.
Equation 10-1. SEM Reproduced with permission of Taylor and Francis Group LLC Books in the format
reuse in a book/e-book via Copyright Clearance Center.
However, the SEM is not a very intuitive measure and it is not
straight forward to compare SEM’s from different experiments Given that the asterisk notation hides the absolute value of
in a meaningful way. A more popular way of illustrating the p, it is often encouraged to include a table with the absolute
precision of the estimated mean and indicating statistical values of p, as shown in the example in Table 10.5. One reason
significance in a graphical way, is the confidence interval (CI, behind this is that a p-value of for example 0.032 is only slightly
Equation 2): more “significant” than a p-value of 0.055. Borderline cases like
SD SD this can lead to some confusion when deciding precisely what
CI = (Cq − t * ⋅ ) to (Cq + t * ⋅ ) (Equation 2)
cut-off to use when classifying data as significant. In realistic
N N
Equation 10-2. Cl
cases, a p-value of 0.051 could be just as significant as a p-value

PCR Technologies: A Technical Guide 81


Chapter 10
of 0.049, yet a strict (although fundamentally arbitrary) cut-off each representation (bar) only illustrates one variable, gene
of 0.05 would classify one as significant and the other not. expression, relative to fixed measures of the other variables. For
multivariate data analysis techniques, hierarchical clustering
Table 10.5. Significance Estimates of Difference of Means. The means and principal component analysis are good options for
of the expression of a gene of interest from a treated sample set are data representation.
compared to the means of the non-treated samples and expressed relative
to expression data for two reference genes. Data are presented relative to
the sample with the lowest expression for each organ type (data shown in Hierarchical Clustering
Figure 10.12). Student’s t-test was used to produce the p-values. One of the easiest and useful methods to characterize data
Gene Expression p-values is by plotting the data in a scatterplot (for example plotting
Organ 1 Organ 2 Organ 3 Organ 4 measured Cq values of one gene against the corresponding
Dose 1 vs Dose 0 0.70274 0.00034*** 0.78194 0.05551 Cq values of another gene for a set of biological samples in
Dose 2 vs Dose 0 0.01379* 0.00295** 0.20956 0.07582 a 2D plot). Plots in one or two dimensions are conveniently
Dose 3 vs Dose 0 0.03180* 0.00157** 0.61582 0.00075*** visualized by human eyes. Plots in three dimensions
may also be possible with appropriate tools, but higher
However, there is a variant of the bar diagram visualization
dimensional plots are significantly harder to visualize.
that takes advantage of the confidence interval of the
However, for exploratory studies, the data set is inherently
difference between means to avoid many, if not all, of the
multidimensional and scatterplots of whole data sets may
disadvantages of traditional bar diagrams (Tichopad et al. in
thus become impractical. From a qPCR data set, there may be,
PCR technologies, Current Innovations24). With the confidence
for example, several genes and/or several types of biological
interval of the difference between means, it is possible to
samples represented.
estimate directly the statistical significance with associated
error bars while at the same time highlight biological effect A popular, alternative way of characterizing and visualizing
size and data variability. Figure 10.12 shows the variant with data from exploratory studies is to analyze measures
the confidence interval of the difference between means of distances between data points in the scatterplot.
of the data used in Figure 10.11. Notice that confidence Different distance measures exist, including Euclidean,
intervals that do not encompass the zero difference between Manhattan and Pearson correlations. With computational
means correspond to significant results at the confidence power, it is straightforward to calculate distances, even for
level corresponding to the p-value cut-off (5% in Figure 10.11 multidimensional data of much higher dimensionality than
and Table 10.5). three dimensions. For agglomerative hierarchical clustering,
the following iterative process is performed: 1) Find the two
Gene Expression Diff No Dose–Doses closest objects and merge them into a cluster; 2) Define the
1
new cluster as a new object through a clustering method;
0.5 3) Repeat from 1) until all objects have been combined into
clusters30. Alternatives for clustering methods include Ward’s
0 diff 1:0 method, Single linkage and Average linkage31. A dendrogram
diff 2:0
-0.5 diff 3:0 is often used to visualize results from hierarchical clustering.
Interpretation of hierarchical clustering dendrograms of qPCR
-1
data often results in conclusions about gene expression profile
-1.5 similarities. In an exploratory study, these similarities may then
Organ 1 Organ 2 Organ 3 Organ 4
be used to formulate hypotheses about gene expression co-
Figure 10.12. Bar diagram showing the difference between means of the non- regulation, which may be accepted or rejected in subsequent
treated sample set (Dose 0) and one of the treated sample sets (Dose 1, Dose 2 or confirmatory studies. The advantages of hierarchical
Dose 3) in the data set from Figure 10.11. Error bars show the confidence interval
of the difference between means. Error bars that do not cross the x-axis indicate the clustering dendrograms include the clarity by which similarity
corresponding means comparison is statistically significant to 5% in a t-test. relationships are visualized. On the other hand, the strong
PCR Technology, Current Innovations-3rd ed. by Taylor and Francis Group LLC Books. emphasis on similarity measures may be perceived as
Reproduced with permission of Taylor and Francis Group LLC Books in the format
reuse in a book/e-book via Copyright Clearance Center.
limiting with respect to formulating hypotheses, since similar
expression profiles may be redundant attributes in hypotheses.
Multivariate data are data collected on several variables for It may be of higher value to identify sets of expression profiles
each sampling unit. The data used in Figures 10.11 and that complement each other in a specific combination, to
10.12 are multivariate in that they depend on variables such answer the desired hypothesis.
as dose and organ type. However, the statistical analyses in
Figures 10.11 and 10.12 are nevertheless univariate in that

82 [Link]
Data Analysis

Principal Component Analysis References


1. Bustin, S.A., Benes, V., Garson, J.A., et al. The MIQE guidelines: minimum
Another popular, alternative way to characterize and visualize information for publication of quantitative real-time PCR experiments.
data from exploratory studies is to take advantage of the Clin Chem 2009; 55: 611-622
information contained in the whole, multidimensional 2. Guescini, M., Sisti, D., Rocchi, M.B., et al. A new real-time PCR method to
overcome significant quantitative inaccuracy due to slight amplification
data set, select desired properties and project it to a lower inhibition. BMC Bioinformatics 2008; 9: 326
dimensional scatterplot, such as a 2D or 3D plot. This can be 3. Rutledge, R.G., Stewart, D. Critical evaluation of methods used to
achieved using principal components analysis (PCA)32,33,34, 35. determine amplification efficiency refutes the exponential character of
Here, the original coordinate system of the data set (i.e., the real-time PCR. BMC Mol Biol 2008; 9: 96
expression profiles measured by qPCR) is transformed onto a 4. Rutledge, R.G., Stewart, D. A kinetic-based sigmoidal model for the
new multidimensional space where new variables (principal polymerase chain reaction and its application to high-capacity absolute
quantitative real-time PCR. BMC Biotechnol 2008; 8: 47
components: PC or factors) are constructed. Each PC is a
5. Livak, K.J., Schmittgen, T.D. Analysis of relative gene expression data using
linear combination of the subjects in the original data set. By real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods
mathematical definition, the PC’s are extracted in successive 2001; 25: 402-408
order of importance. This means that the first PC explains 6. Pfaffl, M.W. A new mathematical model for relative quantification in real-
most of the information (variance) present in the data, the time RT-PCR. Nucleic Acids Res 2001; 29: e45
second less and so forth. Therefore, the first two or three PC 7. Dheda, K., Huggett, J.F., Bustin, S.A., et al. Validation of housekeeping
coordinates (termed scores) can be used to obtain a projection genes for normalizing RNA expression in real-time PCR. Biotechniques
2004; 37: 112-119
of the whole data set onto a conveniently small dimension,
8. Dheda, K., Huggett, J.F., Chang, J.S., et al. The implications of using an
suitable for visualization in a 2D or 3D plot. By using the inappropriate reference gene for real-time reverse transcription PCR data
first two or three PCs for representation, the projection that normalization. Anal Biochem 2005; 344: 141-143
accounts for the most variability in the data set is obtained. 9. Vermeulen, J., De, P.K., Lefever, S., et al. Measurable impact of RNA quality
Variance from experimental design conditions is expected on gene expression results from quantitative PCR. Nucleic Acids Res 2011;
to be systematic, while confounding variance is expected 39: e63
to be random, so this representation may be desired under 10. Ibberson, D., Benes, V., Muckenthaler, M.U., et al. RNA degradation
compromises the reliability of microRNA expression profiling. BMC
appropriate conditions. Biotechnol 2009; 9: 102
As previously noted for hierarchical clustering, the 11. Huggett, J., Dheda, K., Bustin, S., et al. Real-time RT-PCR normalization;
interpretation of qPCR PCA often results in conclusions strategies and considerations. Genes Immun 2005; 6: 279-284
about gene expression profile similarities. Although PCA and 12. Mitsuhashi, M., Tomozawa, S., Endo, K., et al. Quantification of mRNA
in whole blood by assessing recovery of RNA and efficiency of cDNA
hierarchical clustering may yield complementary insights into synthesis. Clin Chem 2006; 52: 634-642
gene expression co-regulation patterns, both techniques focus 13. Whale, A.S., Huggett, J.F., Cowen, S., et al. Comparison of microfluidic
on gene expression profile similarities. This places limitations digital PCR and conventional quantitative PCR for measuring copy
on the types of hypotheses that can be found in exploratory number variation. Nucleic Acids Res 2012 ;40: e82
studies using these techniques alone. To expand on the reach 14. Vandesompele, J., De, P.K., Pattyn, F., et al. Accurate normalization of
of generated hypotheses in exploratory studies, a hypothesis- real-time quantitative RT-PCR data by geometric averaging of multiple
internal control genes. Genome Biol 2002; 3: RESEARCH0034
driven approach to multivariate analysis was recently proposed
15. Pfaffl, M.W., Horgan, G.W., Dempfle, L. Relative expression software tool
(Bergkvist et al., in. PCR Technologies; Current Innovations24). (REST) for group-wise comparison and statistical analysis of relative
Hypothesis-driven, custom-designed algorithms may identify expression results in real-time PCR. Nucleic Acids Res 2002; 30: e36
biologically relevant hypotheses that may otherwise be missed 16. Pfaffl, Michael W. ATCPTPN. Determination of stable housekeeping
by commonly used techniques for multivariate data analysis. genes, differentially regulated target genes and sample integrity:
BestKeeper – Excel-based tool using pair-wise correlations. Biotechnology
Letters 2004; 26: 509-515

PCR Technologies: A Technical Guide 83


Chapter 10
17. Andersen, C.L., Jensen, J.L., Orntoft, T.F. Normalization of real-time 25. Manly, B. Randomization, Bootstrap and Monte Carlo Methods. Methods
quantitative reverse transcription-PCR data: a model-based variance in Biology 2nd ed Chapman Hall; 1998:
estimation approach to identify genes suited for normalization, applied 26. Kitchen, R.R., Kubista, M., Tichopad, A. Statistical aspects of quantitative
to bladder and colon cancer data sets. Cancer Res 2004; 64: 5245-5250 real-time PCR experiment design. Methods 2010; 50: 231-236
18. Eady, J.J., Wortley, G.M., Wormstone, Y.M., et al. Variation in gene 27. Tichopad, A., Kitchen, R., Riedmaier, I., et al. Design and optimization of
expression profiles of peripheral blood mononuclear cells from healthy reverse-transcription quantitative PCR experiments. Clin Chem 2009; 55:
volunteers. Physiol Genomics 2005; 22: 402-411 1816-1823
19. Barnes, Michael G., Grom, Alexei A., Griffin, Thomas A., et al. Gene 28. Fisher, R.A. The design of experiments. 8th edition ed. Hafner: Edinburgh;
Expression Profiles from Peripheral Blood Mononuclear Cells Cells are 1966
Sensitive to Short Processing Delays. Biopreservation and Biobanking
29. Motulsky, H. Intuitive Biostatistics. Oxford University Press, New York, 1995
2010; 8: 153-162
30. Ward, J.H. Hierarchical grouping to optimize an objective function.
20. Debey, S., Schoenbeck, U., Hellmich, M., et al. Comparison of different
Journal of Amer Statist Assoc 1963; 58: 236-244
isolation techniques prior gene expression profiling of blood derived
cells: impact on physiological responses, on overall expression and the 31. Lance, G.N., Williams, W.T. A general theory of classificatory sorting
role of different cell types. Pharmacogenomics J 2004; 4: 193-207 strategies, I. Hierarchical Systems. The Computer Journal 1966; 9: 373-380
21. Mestdagh, P., Van, V.P., De, W.A., et al. A novel and universal method for 32. Jolliffe, I.T. Principal Component Analysis. 2 ed 2002:
microRNA RT-qPCR data normalization. Genome Biol 2009; 10: R64 33. Rao, C.R. The use and interpretation of principal components analysis in
22. Mestdagh, P., Derveaux, S., Vandesompele, J. Whole-genome RT-qPCR applied research. 1964
microRNA expression profiling. Methods Mol Biol 2012; 815: 121-130 34. Hotelling, H. Analysis of a complex statistical variable into principal
23. D’haene, B., Mestdagh, P., Hellemans, J., et al. miRNA expression profiling: component. J Edu Psy 1933; 24: 417-520
from reference genes to global mean normalization. Methods Mol Biol 35. Pearson, K. On lines and planes of closest fit to systems of points in space.
2012; 822: 261-272 Phil Mag 1901; 2: 559-572
24. PCR Technologies: Current Innovations. 3 ed. Edited Nolan and Bustin,
CRC Press; 2013

84 [Link]
Troubleshooting

Chapter 11:
Troubleshooting

As with any technique, it is critical that all of the processes of When switching master mix products, it is critical to
the PCR, RT-PCR/RT-qPCR are fully understood so that data are recognize that some assays are particularly sensitive to buffer
reliable and any problems can be addressed with confidence. composition/annealing temperature (Ta)/primer concentration
When developing a troubleshooting protocol, it is important combinations. Changing any one of these may result in
to be open to any possible sources of error, however different performance. Therefore, all assays should be verified
insignificant they may seem, to explore each potential in selected master mixes and on all desired instruments before
problem independently (if two assays are failing, try to treat making radical changes. It is also essential to review the
each separately and not assume that there is a single reason), instructions provided with each master mix since these specify
to recognize the value of your time and to be pragmatic the recommended conditions that are optimized for the given
about getting the assays working without necessarily having enzyme, Hot Start mechanism and buffer components.
a full understanding of what went wrong. Most importantly,
JumpStart™ Taq ReadyMix™ (Sigma) doesn’t work as well as a
troubleshooting is simply a logic problem and like any skill,
Problem similar product from a different supplier
improves with practice and experience.
Possible • An incorrect initial incubation of 95 °C for 15 min was used as the Hot
Start/denaturation protocol before cycling (inappropriately applying
Causes

Developing a Troubleshooting Protocol


a standard Hot Start protocol conventionally used for chemically
inactivated enzymes).
• The primer optimization conditions differ slightly between

Potential Sources of Error and/or Problems Diagnostic


ReadyMixes.
• Check the thermocycling profile.
Operator Error Test • Check reaction conditions are optimal for the primers.
Unfortunately there are endless possibilities for operator
Solution • An initial incubation of 3 min at 94 °C is sufficient to activate JumpStart
Taq; longer incubations will partially inactivate the enzyme (specific
error with ever more creative mistakes being developed as Hot Start protocol for antibody inactivated JumpStart Taq).

the established ones are solved. More often than not, the • Adjust primer concentration or annealing temperature (T ). a

sources of these errors remain unidentified. The first step in


any troubleshooting procedure is to check the protocol and Sigma’s PCR ReadyMix works for PCR but not for qPCR, but
Problem equivalent products from a different supplier work well
then repeat the experiment. Checking the protocol (refer
to Appendix A, Protocols, of this guide) and even asking a
Possible • REDTaq® ReadyMix was used for real-time qPCR.
colleague (preferably an experienced molecular biologist) to
Causes • Ainstrument
ReadyMix that does not contain a reference dye was used on an
with a reference dye requirement or an inappropriate
review the experimental plan is important. The cautionary tale concentration was included.

of the postdoctoral fellow who ran several failing PCRs before • Aa probe
ReadyMix designed for use with probes was used without including
in the reaction.
realizing that the dNTPs were missing from the PCR master
mix is a reminder that even the best over-worked scientists are
Diagnostic • Check ReadyMix choice and color of qPCR mix.
Test
vulnerable to simple errors. Solutions • Use appropriate ReadyMixes for the desired PCR application. Red dye
will interfere with fluorescence detection in most qPCR instruments.
Master Mix
It is good laboratory practice to ensure that sufficient reaction
Mistakes or problems with the master mix blend of reaction
master mix is prepared for all samples that are to be run
components may be the source of a catastrophic failure of
together. Ensure that all components are carefully thawed and
amplification in all samples and positive controls. Before
mixed well and that the experiment master mix is very well
repeating the experiment, all components should be checked
mixed before aliquoting to samples. This is particularly relevant
along with the concentrations. If a new batch of reagent is
to some of the 2× buffers such as KiCqStart® that are more
being used, it is a useful precaution to run the new against
viscous than normal PCR buffers.
the old before launching into a major series of experiments.

PCR Technologies: A Technical Guide 85


Chapter 11

Oligos Design of Assay (RT and qPCR)


Oligos may cause problems if they are; an incorrect sequence Assay design was described in Chapter 6. When
or poorly designed, run at a sub-optimal concentration, troubleshooting an assay, ensure that the design has been
sub-optimal Ta, or are inadequately labeled or quenched (for verified. Confirm that the PCR/qPCR primer and amplicon
probes). An assay run under sub-optimal conditions for the position is consistent with the RT priming protocol. For
oligo, or using a poor design may yield some data, however example, ensure that assays applied to cDNA that was
this may not reflect the genuine biology under consideration. prepared after oligo-dT priming are situated towards the 3’
On receipt of a lyophilized oligo it is critical to: of the transcript. Ensure that the sequence information is
reliable and that appropriate splice variants and SNPs have
1. Verify the sequence
been considered.
2. Ensure that all DNA is resuspended prior to use
3. Confirm the solution is the concentration expected The assay is insensitive and the amplification plots look
Problem abnormal (Figure 11.1)
Re-suspension of the oligo is facilitated by heating the oligo to Possible • The assay design is inappropriate.
90 °C for 5 min and then mixing well. Repeated cycles of freeze Causes • The probe is inadequately labeled.
thaw can also affect oligo performance and therefore all oligos • The assay requires optimization.
at a stock concentration (usually 100 μM) should be aliquotted Diagnostic • Check assay design (request a design review by the Sigma Custom
and stored at –20 °C, or –80 °C for the long term. Test Products technical team).

During the troubleshooting phase it is critical to verify that


• Check background fluorescence readings on raw data/
multicomponent plot.
the correct sequence was ordered by returning to the target • Verify optimization.
sequence and confirming that the oligo sequences are Solutions • Inreveals
the example shown in Figure 11.1A, the check of assay design
a probe design with significant secondary structure which
indeed present. Ensure that the oligo quality was correct would lead to the observed effects (Figure 11.1B). The ideal solution is
by contacting the oligo vendor. Measure the working to re-design the assay if possible. When absolutely necessary, designs
requiring oligos with secondary structure may be rescued by addition
concentration of the oligo and visually inspect fluorescent of <10% final reaction volume of betaine or DMSO to reaction buffers
molecules to confirm that these are labeled. Test the primers and further optimization.
of probe assays in a SYBR® Green I qPCR mix to verify
amplification. Consider optimizing primer concentrations or Ta 0.08

(see Chapter 9). When using a probe for the first time, collect
fluorescent data for as many potential wavelengths as possible 0.07

so that any potential leakage of signal between channels is


0.06
observed and mistakes in labeling can be detected.
Fluorescence

0.05
Inadequate Optimization
The effect of assay optimization was described and 0.04

demonstrated in Chapter 9. When an assay fails or is


0.03
performing sub-optimally, yet there are no mistakes
in the design or operating procedures, it may benefit 0.02
from optimization of experimental conditions. When
troubleshooting, test the primers at 100 nM, 500 nM and 0.01

900 nM final concentration and/or Ta between 55 °C to


0
70 °C (using a temperature gradient) to identify whether 5 10 15 20 25 30 35 40
the assay will improve with further optimization. Cycles

Figure 11.1A. The assay has an unusual amplification plot profile with a pronounced
drift of the baseline.

Figure 11.1B. The sequence for the probe that was included in the assay was
entered into mfold folding prediction software. It is clear that the probe could
adopt a stable folded structure in solution and this is likely to result in the
observed problem.

86 [Link]
Troubleshooting
Template Template quantity is also an important consideration.
The effect of template quality on assay performance was Including too much or too little template into the PCR will
described in Chapter 7. Template quality encompasses result in failed reactions and qPCR amplification plots that
consideration of quantity, integrity and the presence of appear abnormal. Figure 11.3A shows a reaction containing
inhibitors. It is critical to ensure that RNA quality is matched a 10-fold serial dilution of artificial oligo template. The lower
to the most appropriate RT priming protocol (see Chapter 8) dilutions are too concentrated for the reaction to be efficient
and to use the best quality template possible. Similarly, or for the instrument to effectively process the baseline data
the quantity of RNA that is added to RT reactions must be (Figure 11.3B), resulting in abnormal amplification plots and
within the scope of the protocol and, in many cases, this unreliable data.
should be the same for all reactions. ReadyScript® is a notable
A) Amplification Plots
exception to this guideline because adoption of this reagent
and protocol yields a linear cDNA concentration that is
proportional to the input RNA quantity. When troubleshooting 0.2

Fluorescence (dRn)
a sample which is yielding a higher than expected Cq, run the
SPUD assay or dilute the sample through a 1:5 or 1:10 dilution
series and repeat the assay (Figure 11.2) to identify samples 0.1

which contain inhibitors.


0.0
The Cq data for dilutions of the standard curve are irregularly
Problem spaced (Figure 11.2)
• The assay design is inappropriate leading to inefficient priming.
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Possible Cycles

Causes • There are errors in the dilutions of the template for the standard curve.
• The sample contains an inhibitor. B)
9000
Amplification Plots

• Check
Fluorescence, R (Multicomponent View)

Diagnostic ΔC between each dilution (Table 11.1 shows interpretation


q
8000
Test data for Figure 11.2).
• Check assay design. 7000

• Repeat assay on a freshly prepared serial dilution.


• The
6000

Solutions ΔC between each dilution of the data shown in Figure 11.2


q
decreases, tending towards the expected 3.3 cycles for a 10-fold 5000

dilution (Table 11.1). This indicates that the amplification becomes


4000
more efficient when diluted template is used, an observation that is
consistent with the sample containing an inhibitor. 3000

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
0.5
Cycles

0.4 Figure 11.3. A) Amplification of a 10-fold serial dilution of an artificial template with
specific primers and a FAM-labeled probe. The Cq is very low for the concentrated
samples, the amplification plots are not regularly spaced and are abnormal.
Fluorescence (dRn)

0.3 B) Shows the raw data for these amplification plots. The reactions containing
the highest concentration of target also have a significantly higher background
107 106 105 104 fluorescence and minimal fluorescence yield through the reaction.
0.2

Assay PCR Program


0.1 NTC
The PCR cycling conditions must be suitable for both
0.0
the experiment and the reagents (e.g., see Master Mix).
Acceptance of default instrument settings without verification
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles is inadvisable.
Figure 11.2. Amplification of a 10-fold serial dilution of a DNA template. The repli-
cates are precise but the ΔCq is inconsistent, decreasing with increasing dilutions. Instrument Failure
The data also shows a positive signal in the no template control (NTC) indicating Instrument faults can have an insidious onset and can,
contamination or primer dimer formation and that the dilutions to less than 105
copies have identical data to the NTC.
therefore, be difficult to diagnose. To prevent expensive
repair costs, ensure that all operators of instruments are
Table 11.1. Cq Differences Recorded for a 10-fold Serial Dilution of fully trained and initially supervised. Some instrument faults
Template (shown in Figure 11.2) cause catastrophic failures, resulting in no amplification or
Dilution ΔCq fluorescent data while others distort data or treat samples in
107  106 5.4 a non-uniform manner creating artificial differences between
106  105 5.0 identical biological samples. The use of control samples
105  104 3.6 with control assays is invaluable for troubleshooting. When
an instrument fault is suspected, a reliable, optimized assay

PCR Technologies: A Technical Guide 87


Chapter 11
should be run in all wells. This uniformity check will reveal • Amplification Plots (check replicates and amplification
problems that are specific to regions of the instrument as well plot profile)
as separate assay and instrument issues. • Standard Curves (gradient and R2)/dilution series
• Melting/Dissociation Plots (SYBR Green I dye, Molecular
Troubleshooting Examples Demonstrating Beacons, Scorpions® Probes)

the Use of the Diagnostic Tools • Raw data/multicomponent views

After running a well-planned PCR there are several diagnostic Control Samples/Reactions
tools available for troubleshooting:
The use of controls is strongly recommended. It is almost
• Control samples and assays impossible to troubleshoot a failed assay without information
• End-point gel/SYBR Green I dye reagent from an appropriate suite of controls.

Possible Reasons for a Possible Reasons for a


Control Example Material Expected Result Positive Result Negative Result
Positive sample A sample known to contain the assay Positive Correct Assay failure. Any positive data from
sequences, e.g., RNA/gDNA expressing/ other samples is unreliable.
containing the target.
Positive assay control Any nucleic acid compatible with the PCR Positive Correct Assay failure. Any positive data from
assay design, e.g., an artificial oligo- other samples is unreliable.
nucleotide or plasmid containing the PCR
amplicon.
Negative control A sample known not to contain the assay Negative The assay is non- specific or there was Correct
sequences, e.g., RNA/gDNA not expressing/ contamination of the control during PCR
not containing the target. preparation.
Contamination Negative Water Negative The primers are self dimerising resulting Correct
assay control (No Template in primer dimer product or there was
Control NTC) contamination of the control during PCR
preparation.

Possible Reasons for a Possible Reasons for a


RT-specific Controls Example Material Expected Result Positive Result Negative Result
Minus RT enzyme negative RNA sample and all components of the Negative The sample contains gDNA. The reaction Correct
control RT reaction with the exception of the RT became contaminated during set up. The
enzyme. This should be performed on all primers formed primer dimer products.
samples to verify that they do not contain Analyze in conjunction with NTC.
sequences that amplify under the PCR
conditions without the need for RT, e.g.,
gDNA contamination.

Genotyping-specific Possible Reasons for a Possible Reasons for a


Controls Example Material Expected Result Positive Result Negative Result
Assay specific positive
target.
Wild Type (WT) template detected with
WT assay and mutant target detected with
Positive Correct • There was an error during assay
preparation.
mutant assay.
• The assay needs re-designing.
• There is a problem with one of the
component oligos.
• The assay requires further
optimization.
Assay specific negative
target
WT template detected with mutant assay
and mutant target detected with WT assay.
Negative (or
relatively high
• The reaction was contaminated
during set up.
Correct

Cq compared to
positive control). • The assay is nonspecific and requires
optimization or re-designing.
Assay heterozygote control Heterozygote template or a 1:1 blend of
each homozygote detected with WT assay
Positive with both
assays.
Correct • There was an error during assay
preparation.
and with mutant assay.
• The assay needs re-designing.
• There is a problem with one of the
component oligos.
• The assay requires further
optimization.
• Analyze results alongside single
template/assay controls.

88 [Link]
Troubleshooting
The positive control amplifies but there are no amplification Is the
Problem results from a sample known to contain target (Figure 11.4A) Yes PCR experiment No Correct plan

• Sample concentration inappropriate.


plan correct?
Possible
Cause • Inhibition in the test sample. Repeat experiment

Diagnostic • Test amplification with a diluted sample. Spike the reaction with a low
level of exogenous target and test for amplification of the exogenous Has this
Test PCR No PCR assay design
target (see Chapter 8; follow the SPUD Protocol, Appendix A). ☺ No Verify design
Product Product previously been used in silico
Solutions • Add up to 0.3% BSA to the PCR (Figure 11.4B) or purify the input
nucleic acid.
successfully?

Yes

A) • Check primer
3 Was the Has this oligo concentration
same master mix used Yes synthesis been used No • Test a new
Standard qPCR mix DNA diluted 1:25 previously ? previously ? synthesis of primers

DNA diluted 1:125 No • Check sample quantity


2 • Ensure there are no inhibitors in
Fluorescence (dRn)

• Test assay in original Yes the sample


master mix
DNA diluted 1:5 • Optimize primers in
• Ensure RNA is not degraded
• Check RT protocol is appropriate
new master mix
for assay design location
• Check biology expectations for
1 PCR No PCR
Product
☺ expected yield of target; e.g., a
Product low expressed gene may not be
detected by gel staining (stain gel
after running)

0 Undiluted DNA & NTC Figure 11.5. The basic troubleshooting process for PCR.
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40

B)
Cycles When a qPCR experiment completely fails, the first step is
to check assay design, the oligo sequences and the QC data
qPCR mix + 0.3% BSA
from the oligo manufacturer. Although the assay may have
failed, qPCR multicomponent/raw data can be used to provide
DNA diluted 1:5 DNA diluted 1:25
further information. Figure 11.6A shows the raw data plot
Fluorescence (dRn)

for two assays containing either a 6-FAM™ or a HEX™ (VIC®)


DNA diluted 1:125
labeled probe. Although both assays show amplification, the
HEX signal is approximately half of that of the FAM signal. Since
Undiluted DNA
this is an inherently weaker dye, this is a normal observation.
The agarose gel analysis (Figure 11.6B) shows both reactions
yield a similar concentration of products, supporting the
NTC observation that the qPCR Cq values are similar.
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 A) B)
Cycles Setup Instrument Results
Multicomponent
Well: A13
Figure 11.4. A) Undiluted template fails to amplify whereas dilutions show Multicomponent Plot Name
FAM
improved amplification efficiency. B) Addition of 0.3% BSA to the qPCR mix 16000 HEX
SigmaRox
supports amplification from the undiluted template. 14000
Background
MSE

Investigations into a completely failed assay can be 12000

difficult because there is little information to work with for


Fluorescence

10000

troubleshooting. Since many assay failures are the result of 8000

some catastrophic error, the first check should be to verify 6000

the experiment set up and then repeat the PCR. If this fails, 4000

the troubleshooting process is dependent on information 2000

regarding each component of the experiment (Figure 11-5). 0


Time (1/2s)

Figure 11.6. A) The raw data plots of a duplex assay containing a FAM and a HEX-
labeled probe. The FAM probe naturally yields higher fluorescence. B) The agarose
gel showing that equal quantities of product were produced in each reaction and
confirms the qPCR Cq observation.

Examination of the raw data is a useful check to verify that


the probe is labeled correctly and was added to the reaction.
Figure 11.7 shows the raw data for the amplification of
three targets in a triplex experiment. The probes specific to
each target are labeled with FAM, HEX and TAMRA. The HEX

PCR Technologies: A Technical Guide 89


Chapter 11
and TAMRA probes show a low background and efficient 1.0
Amplification Plots
amplification, however the FAM signal is consistently high 0.9

throughout the experiment and there is no evidence 0.8


SYBR

of amplification. This is consistent with too high probe 0.7

Fluorescence (dRn)
concentration in the reaction or a fault with the probe such 0.6

that there is no initial quenching of the signal. In such cases 0.5

the probe concentration and assay design should be verified, 0.4

ensuring that the probe has a compatible label and quencher 0.3

and, if required, a new probe tested. 0.2


Probe
0.1

0.0

-0.1
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles

Figure 11.8. Identical reactions were run containing either a qPCR probe or SYBR
Green I dye (as indicated). The SYBR Green I reaction was approximately eleven
cycles more sensitive and yielded much higher end-point fluorescence. This is
indicative of a fault in the probe or problem with the probe design (data kindly
provided by Prof. Stephen Bustin, UK).

Validating Probe Labeling


The raw data or multicomponent plot is a useful diagnostic
tool to investigate whether the appropriate concentration
of probe has been included into the reaction and that the
Figure 11.7. A triplex reaction was used to detect three targets using probes labeled
probe is adequately labeled and quenched. Figure 11.9 shows
with FAM, HEX and TAMRA. The HEX and TAMRA probes yielded amplification from the multicomponent plot for a reaction containing 3 probes.
the targets but the FAM probe showed no amplification. Examination of the raw The first two generate amplification plots and background
data revealed that the background fluorescence was exceptionally high and no
difference was observed throughout the reaction. This is consistent with too high a
fluorescence is evident. There is no data from the third
probe concentration in the reaction or a faulty probe with inadequate quenching. probe and an examination of the raw data reveals that the
background fluorescence is equivalent to the water blank
If the original experiment relied upon probe detection the control which does not contain any probe. Therefore, this data
assay should be repeated using SYBR Green I reagents, is the result of absence of fluorescence in the reaction. This
including a positive and negative control (but not precious would be due to an error during set up in which the probe
samples). Alternatively the products of a failed reaction was not included or that the probe was not labeled.
can be checked on an ethidium bromide stained agarose
gel. Adopting the SYBR Green I approach for repeating Amplification Plots
Samples a and b
Targets 1, 2, 3
the experiment is preferable because it avoids the risk of 26000 1
contamination and provides a repeat experiment to verify 24000
Fluorescence, R (Multicomponent View)

22000
the initial failure. If the SYBR Green I experiment provides 20000

data, it is possible that the original probe failure was due to 18000
2
either a technical error or probe fault. To differentiate between 16000

14000
experimental error or a fault with the probe, repeat the probe 12000

experiment; if the reaction fails again, replace the probe. This 10000

approach can be adopted to investigate reactions that are 8000

6000
producing poor data. In the example shown in Figure 11.8, the 4000 3 and water
probe reaction was sub-optimal and when compared to the 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
blank
Cycles
reaction run using SYBR Green I, it can be seen that the probe
signal does not reflect the experiment. In such cases the assay Figure 11.9. Three genes were detected in the same template sample. Two
design should be verified and a new probe tested. reactions resulted in amplification (1 and 2), however the 3rd was negative. An
examination of the multicomponent view reveals that the background fluorescence
for the 3rd reaction is equivalent to the water control indicating an absence
of signal.

90 [Link]
Troubleshooting
A further check of the probe labeling can be performed (Figure 11.10B) such that the fluorescent yield is measured
using a DNase I digestion. This must be performed with with respect to time or alternatively, the initial and end point
extreme care to ensure that probe and primer stocks are not (after 10 min) reading provide sufficient information. When
contaminated with enzyme, which would lead to catastrophic performing this test it is important to compare the data to a
results. An aliquot of a failing probe (Figure 11.10A) equivalent probe that is functioning well and has the same fluorescent
to that included in a reaction, e.g., 300 nM is incubated with label and quencher (Figure 11.10B).
and without DNase I. This can be carried out in real time

A) B)
15000 Probe 1
14000
0.5
13000

Fluorescence, R (Multicomponent View)


12000
0.4
Fluorescence (dRn)

11000

0.3 10000

9000

0.2 8000
Probe 2 has less than
7000 half the label intensity
of Probe 1
0.1 6000

5000
0.0 Probe 1 and Probe 2
4000
no enzyme control
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 10 20 30 40
Cycles Cycles

Figure 11.10. A) Two templates were detected using different probes, both FAM labeled. While detection using one probe resulted in a high fluorescent signal, the second
was much weaker. B) A control and a test probe (300 nM) were incubated at 37 °C in a real time instrument in DNase I buffer in the presence or absence of DNase I enzyme.
The fluorescent release from probe 1 was approximately twice that from probe 2, demonstrating that probe 2 labeling was inadequate.

Low or absent fluorescence in both the test sample and in the positive control. The correct PCR product is visible on the gel
Problem and the design is verified
SYBR Green Dye-Based Detection Probe Detection
Possible Bad SYBR Green I binding dye. • High/low background fluorescence. • Degraded probe.
Cause • Incorrect probe concentration. • Poor probe labeling.
• Incorrect collection of fluorescent data.
Diagnostic • Compare fluorescence of the SYBR Green I binding • Check the raw fluorescence (multicomponent plot). • Digest 5 fmoles of probe with DNase I. Collect
Test dye mix ±1 µg DNA.
• Fluorescence should increase at least 10,000 units fluorescent yield using all wavelengths.
• Fluorescence should be at least 10,000 units higher
with DNA added than without.
between cycles 1 and 40. • Fluorescence should be at least 10,000 units greater
than without DNase digestion.
Solutions Purchase new SYBR Green I binding dye or a new • Use correct concentration. Purchase a new probe.
qPCR mix with SYBR Green binding dye.
• Purchase a new probe.

PCR Technologies: A Technical Guide 91


Chapter 11

Amplification Plots
The structure of the amplification plots and the reproducibility Similarly, the amplification plots in Figure 11.12A are clearly
of technical replicates provide a wealth of information abnormal and could not be used as they are presented. An
regarding the quality of the qPCR assay and may also provide amplification plot which dips below zero dR (Figure 11.12A)
the first warning indications that all is not as it should be. is a classic indication of inappropriate baseline settings having
The amplification plots in Figure 11.11A are non-typical, very been applied. Examination of the raw data for this reaction
noisy and would be difficult to interpret accurately. A further (Figure 11.12B) shows that the actual amplification plots
examination of the dR fluorescence values reveals that the have a normal profile, confirming that the analyzed data are
end-point fluorescent yield is only 400 units, indicating that the result of an instrument software issue. The appropriate
the reaction is inadequate but the amplification plots have baseline can be deduced from the raw data and applied in the
been generated by the instrument software and autoscaled. software. In this case cycles 6 to 16 represent the initial linear,
Similarly, the data in Figure 11.11B have a pronounced foxtail baseline phase of the reaction and when applied, result in
(decreasing curve) at the beginning of the profile, before normal amplification plots (Figure 11.12C).
increasing again after a baseline section. The appearance of A)
the foxtail is consistent across two reactions, but one reaction
has a much lower end-point (Figure 11.11C) resulting in an 2000

amplified, relative foxtail.

Fluorescence (dRn)
1000
A) 400 400

300
Fluorescence (dRn)

–1000

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
200 Cycles
B)
13000

12000
100
11000
Fluorescence, R (Multicomponent View)

10000

9000
0
8000

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 7000
Cycles
6000

B) 5000

4000

3000

2000
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles
C)

1000 0.6

0.5
Fluorescence (dRn)

0.4

0.3

C)
0.2
14000
0.1

0.0

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles

Figure 11.12. A) Amplification plots were clearly abnormal with a section of the
profile dipping below the baseline. B) Examination of the raw data plot reveals that
the reaction data are as expected. C) Setting the instrument baseline according
to the appropriate cycles restores the normal profile to the data of analyzed
amplification plots

Figure 11.11. A) Amplification plots that are noisy due to autoscaling by the instru-
ment software of poor data with low fluorescence. B) Reactions yielding low end
point dR have a pronounced initial foxtail. C) The foxtail is seen as a normal effect
when in proportion to the high quality assay.

92 [Link]
Troubleshooting
The amplification plot profile can also be interpreted to give
information about the quality of the assay and optimization.
Figure 11.13 shows the attempted amplification of a 10‑fold
serial dilution of template with each concentration run in
duplicate qPCR. The reproducibility between replicates is
poor, the cycle difference (ΔCq) between the data is not
constant and it is not 3.323 cycles, as expected for a 10-fold
serial dilution. Examination of the amplification plots, with
consideration to this being a standard curve, reveals that the
assay is below standard and could not be used for analysis.
The reasons would need further investigation but could be the
result of; poor assay design (see Chapter 6), sub-optimal assay
conditions (see Chapter 9), or poor pipetting (repeat assay). Figure 11.14. During a standard qPCR the data suddenly spike upward with a
non-typical profile.

Declining or hooked fluorescence plots


Problem (Figure 11.15)
0.1 Possible As PCR product accumulates, the complimentary strand competes with
Cause the primer and/or probe for annealing to template.
Fluorescence (dRn)

Diagnostic See Figure 11.15.


Tests
0.01
Solutions Disregard it if the Cq is not affected.

200 200
180 180
PCR Base Line Subtracted CF RFU

160 160
0.001 140 140
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 120 120
Cycles
100 100
Figure 11.13. A cDNA sample was diluted through a 10-fold serial dilution and the 80 80
specific template detected using duplicate qPCR for each dilution. The replicates are 60 60
poor, indicating a problem with pipetting or with assay optimization. 40 40
20 20
The fluorescence plots suddenly spike upwards 0 0
Problem (Figure 11.14). –20 –20
Possible Bad reference dye or instrument error (e.g., door was opened during run). –40
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48
–40
Cause Cycle
Diagnostic • Disable reference dye normalization or look at the results for ΔR
(fluorescence increase from cycle 1 to 40) instead of ΔRn (the relative Figure 11.15. The hooked amplification plot profile may occur in later reactions
Tests
fluorescence increase after normalization to the reporter dye intensity). as a result of competitive hybridization between the complementary strand and
• For instruments which can tolerate analysis without the reference dye,
the plots should become corrected if fluorescence is not normalized to
primer/probe.

an inactive reference dye.


• Spikes in raw data or ΔR indicate an instrument error.
Solutions • Smooth ΔR amplification plots: Purchase a new reference dye. Always
protect dye from light during storage.
• Spike persists in ΔR: Repeat run, if the problem persists seek
engineering help for instrument.

PCR Technologies: A Technical Guide 93


Chapter 11

Dissociation/Melt Curves Test


Samples
The dissociation or melt curve analysis is run after the qPCR
and is an analysis tool that is used in conjunction with DNA-
binding dyes (such as SYBR Green I) or non-degrading probes Postive
Control
such as Molecular Beacons or Scorpions® Probes, to verify that
a single product has been amplified. After PCR amplification,
the resulting amplicon is incubated at increasing temperatures
and the changes in fluorescent signal are detected as the DNA No Template
Control
transitions between double-stranded and single-stranded
states. When the reaction contains a single amplicon, this
melts uniformly and the plot of dF/dT (rate of change of
fluorescence with respect to temperature) shows a single
peak. Examination of the melt curve is particularly effective
when combined with data from controls. Figure 11.16A shows
the post qPCR melt profile for a series of experimental test 70 72 74 76 78 80 82 84 86 88 90 92 94
samples, the positive control and the no template control. Temperature (°C)
The melt profile for the test samples is identical to the positive Figure 11.16A. A positive control, test reaction and NTC were amplified and then
control and each of these show a single peak for the dF/dT. subjected to post-PCR melt analysis. There is product evident in the NTC that melts
The melt profile for the no template control has a broader at a lower temperature and with a broader melt peak, consistent with primer
dimer formation.
profile and a lower Tm. These observations are both consistent
with the presence of primer dimers being apparent in the 10-fold serial dilutions

NTC
negative control. This is confirmed using an ethidium bromide
stained agarose gel (Figure 11.16B) which also shows that the
primer dimers become apparent when the template is present
at low concentration. This causes an over estimate of the amplicon
target when detected in samples of low target concentration. primer dimer
Therefore, the assay should be optimized or re-designed. In
contrast, Figure 11.16C shows that the melt profile for the Figure 11.16B. Primer dimers are evident on a gel resolution of these samples
product in the no template control is identical to the melt (along with others), with primer dimer formation being inversely proportional to
input template concentration.
profile for the positive control and test sample. This is a clear
indication of contamination of the no template control with 4000

template during the experiment set up. The final example


demonstrates the recognition of amplification of target from
gDNA that is present in a cDNA sample (Figure 11.16D). The 3000

amplicon derived from gDNA is longer and, therefore, has a Positive Control/
Fluorescence, -R’ (T)

higher Tm than that from cDNA. Test Sample

2000

NTC
1000

58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (ºC)

Figure 11.16C. An example of applying melt curve analysis to identify reaction


contamination in the NTC.

94 [Link]
Troubleshooting
0.8

0.7

Amplification of -RT
0.6 control indicates gDNA
0.5
Fluorescence (dRn)

0.4

0.3
Dissociation Curve
0.2
700

600
0.1

500
0.0

Fluorescence, -R’ (T)


400
2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34
Cycles 300

200

100

–100
54 56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (°C)

Figure 11.16D. Identifying a larger amplicon that has resulted from PCR of gDNA.

Problem Multiple Tm peaks in melt profile data


A) B)
Single Product on a Gel
(Figure 11.17) Multiple Products on a Gel – – + + +/– Dnase (gDNA detection)
Possible Localized AT or GC-rich regions
or short repeats in PCR product
• The primers are non- specific and are
producing multiple products.
+ – + – +/– RT (gDNA detection)
Cause
causing imperfect reannealing
of amplicon with apparently • The Mg concentration in the
2+

reaction is too high or the annealing


different melt profiles.
temperature is too low. mRNA product
Diagnostic Check sequence of amplicon for BLAST primer sequences against the
Tests AT or GC-rich regions or repeats. sequence of the source organism to
verify single target.
Solutions This is not a problem if the gel
analysis shows that all product
• Titrate the Mg to determine the
2+

optimum concentration.
is specific. Continue to use the
primers. • Perform annealing temperature
gradient to select the optimum
70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (ºC)
annealing temperature for the PCR.
• Design unique primers. Figure 11.17. A) A melt profile and B) agarose gel analysis of a SYBR green I reaction.
Although the melt profile suggests products of varying Tm, the gel image indicates
that a single amplicon is present. This is indicative of an amplicon sequence that
contains AT or GC rich regions or a repetitive element resulting in irregular melting

PCR Technologies: A Technical Guide 95


Chapter 11

Serial Dilution of Template/Standard Curves C) 35

Regardless of whether the experimental design includes the


30
requirement for a standard curve for eventual quantification,
detecting a serial dilution of suitable template is a powerful 25
approach to assay validation and troubleshooting.

Cq
20
Detection of a serial dilution allows the experimental linear
dynamic range of the assay to be defined. Figure 11.18A
15
shows a standard curve with low concentration data points
that do not fit the linear profile. The most usual reason for
10
this pattern of data is that primer dimers have been formed
in samples of low concentration (as shown in Figure 11.18B). 5
This is the standard curve generated from the data shown in –5 –4 –3 –2 –1 0
Figure 11.2. Figure 11.18C shows a standard curve with highly Log of DNA Dilution
concentrated samples falling out of the linear range. The most Figure 11.18C. The samples with high concentrations of template do not lie on the
usual reasons for this are template inhibition of the reaction or standard curve. This is typical of reactions that are inhibited by template concentra-
that the baseline settings are inappropriate. tion or due to incorrect baseline setting.

A) The standard curve is also used to measure the efficiency


40
of the reaction across the dynamic range of dilutions. Care
38 must be taken to ensure that all points used for efficiency
calculations lie on the line. Reactions should be as close to
36 100% efficient as possible and those with apparently high
(>110%) or low (<85%) efficiency investigated further.
34
Problem PCR efficiency <80% (Figure 11.19)
Cq

32
Possible Sub-optimal PCR conditions. Poorly designed primers.

30
Causes
Diagnostic Check the primer design. Test the PCR mix with a set of primers known to
Test work well and a positive control template.
28
Solutions • Optimize PCR conditions.
26 • Prepare or purchase fresh PCR mix.
24
• Design new primers.
–3 –2 –1 0
3
Log of DNA Dilution

B)
Standard Curve
Fluorescence (dRn)

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40
Cycles

Figure 11.19A. A template nucleic acid was diluted through a 10-fold series. The
amplification plots have an abnormally shallow gradient and the ΔCq is 4 cycles
rather than the expected 3.3.

Figure 11.18. A) The data points relating to the lower concentrations of target do
not lie on the standard curve. B) This is typical of a reaction resulting in primers
dimers as illustrated. In this case there is no observed increase in Cq for the samples
at low concentration.

96 [Link]
Troubleshooting
Standard Curve 24
23
Log fit values
22
FAM Standards, RSq:0.997

Cq (R Multicomponent View)
FAM, Y = -6.481*LOG(X) + 23.20, Eff. = 42.7% 21
20
36 19
18
34
17
32 16
15
Cq (dRn)

30
14
28 13
12
26 0.001 0.01 0.1 1
Initial Quantity (relative)
24

22 Log fit values


20
0.1 1
FAM Standards, RSq:0.997
Initial Quantity (nanograms) FAM, Y = -2.644*LOG(X) + 13.36, Eff. = 138.9%
Figure 11.19B. The gradient of a standard curve plot of Cq against quantity is used
to calculate the efficiency of the reaction Figure 11.20B. The gradient of a standard curve plot of Cq against quantity is used
to calculate the efficiency of the reaction which is close to 140%.
Problem PCR efficiency is greater than 120% (Figure 11.20) 13000

Possible • Excessive primer-dimer. 12000

Causes • Pipetting is inaccurate. 11000

• Inhibition. 10000

Diagnostic • Evaluate dissociation plot as shown in Figure11.20. 9000

• Test pipette calibration.


Fluorescence, -R’(T)

Tests 8000

• Check the ΔC between dilutions. An inhibitor in the sample


q
is indicated if this is decreasing, confirm using the SPUD assay
7000

6000
(see Appendix A).
• Try lower primer concentrations.
5000

Solutions
• With
4000
RT-PCR, try using less RT enzyme, doing 2-step and/or using a 3000
higher incubation temperature for the RT step.
• Ensure
2000
pipettes are calibrated. If the pipettes are properly calibrated,
1000
practice pipetting accurately.
• Purify sample. Use a higher dilution in the assay. 0

56 58 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88 90 92 94
Temperature (°C)
0.8

Figure 11.20C. An examination of the melt curve profile reveals that the samples
0.7
of lower concentration (yellow and blue traces) also contain signal from amplified
primer dimers (peak at lower Tm).
0.6
Fluorescence (dRn)

0.5

0.4

0.3
5-fold serial dilutions
ΔCq < 1.5
0.2

0.1

0.0

2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles

Figure 11.20A. A template nucleic acid was diluted through a 10-fold series. The
ΔCq between amplification plots is 1.5 cycles rather than 3.3.

PCR Technologies: A Technical Guide 97


Chapter 11

Troubleshooting Case Studies 4


Amplification Plot

A Failing Probe Assay 2

∆RN
A probe-based assay was designed to detect EIFB1 in human 1

cDNA samples but shows no amplification. The initial reactions 0

were run on an ABi StepOne instrument using compatible 0 2 4 6 8 10 12 14 16 18 20


Cycle
22 24 26 28 30 32 34 36 38 40 42

reagents. An attempt was made to optimize primers using a


range of concentrations from 200 nM to 900 nM (Figure 11.21) Figure 11.21. Primers to EIFB1 were tested at concentrations between 200 nM and
900 nM. No amplification was observed under any condition (Sigma oligos and ABi
but with no improvement. The assay design was verified and reagents on ABi StepOne Plus).
found to be appropriate to the target and, in silico, it was
predicted that this was a high quality assay. New primers
were synthesized and run alongside an aliquot of the original
synthesis using a different operator, SYBR Green I reagents
(therefore different reagents) and instrument (an Eppendorf
Realplex) (Figure 11.22). While adopting this approach we
were mindful that the primary objective was to solve the
problem, while the secondary objective was to explain the
failure. This reaction yielded equivalent amplification from
both batches of primers. At this stage it appeared that the
reaction problem lay with the probe and therefore a new
probe was synthesized and both batches were compared
by the second operator on the Realplex instrument using
LuminoCt® reagents from Sigma (different reagents to Figure 11.22. Two batches of primers to EIFB1 were compared in SYBR Green I
reagent; the original failing batch and a new batch. (Sigma oligos and reagents on
those originally tried) (Figure 11.23). Both probes yielded
Eppendorf Realplex instrument). Both sets of primers supported amplification.
amplification data, the new probe appearing slightly better
than the original although it is noteworthy that the original
probe had been posted between test labs and therefore was
at room temperature, in solution for several days. At this stage
it was clear that both the original and replacement assays
functioned when run by the second operator in LuminoCt
reagents on the Realplex instrument.
Therefore, the remaining reasons for the original failure were
considered to be:
• Operator: the experiment was repeated several times by Figure 11.23. Two batches of primers and probes to EIFB1 were compared in
Sigma LuminoCt reagent; the original failing batch and a new batch. (Sigma oligos
an experienced scientist and, therefore, this was considered and reagents on Eppendorf Realplex instrument). Both sets of oligos supported
an unlikely explanation. amplification.

• Instrument: could have some issues since some other


Amplification Plot
Sigma LuminoCt

assays were failing. 10


1

• Reagents: easiest explanation to test. The LuminoCt 0.1


0.01
reagents were compared to the existing reagents using Original
∆RN

0.001
0.0001
both oligo batches on the ABi StepOne instrument, by the 0.00001

first operator. The reaction failed with the original reagents 0.000001
0.0000001
0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42
but gave good amplification with LuminoCt (Figure 11.24). Cycle

Figure 11.24. The EIFB1 primer and probe assay was run in two different reagents
(Original ABi or Sigma LuminoCt). Data was only acquired from this assay when run
in Sigma LuminoCt reagents.

98 [Link]
Troubleshooting
The Reaction Efficiency Was Incorrect and Variable 0.5
FAM/BHQ1 vs FAM/OQA

A test was carried out on a serial dilution of an artificial 0.45

oligo, using a standard primer and probe assay. The assay 0.4
FAM-BHQ1 Tube E
had originally been developed and optimized on a different 0.35 FAM-OQA Tube E

0.3 FAM-BHQa Tube F


instrument but the strange dilution effect was not expected FAM-OQA Tube F

∆R
0.25
when transferred to a different test lab and instrument FAM-BHQ1 Tube G
0.2 FAM-OQA Tube G
(Figure 11.25A). All assay conditions were re-optimized to 0.15
FAM-BHQ1 Tube H

be specific to the new lab but with no change to the data. 0.1
FAM-OQA Tube H
FAM-BHQ1 Tube I
The operator observed that the effect was more pronounced 0.05
FAM-OQA Tube I

when the assay was repeated within a few hours, using the 0
1 6 11 16 21 26 31 36
same dilution series. As part of the troubleshooting process, Cq
the assay was run on a different instrument by a different
operator who again, generated the expected standard curve. Figure 11.25B. An artificial oligo template was diluted 10-fold (these are the
dilutions that are detected in Figure 11.25A) and left at 4 °C for several hours before
This lead to the suggestion that the initial problem was due being detected using a specific probe-based assay. There are inconsistent differ-
to; operator error, instrument failure, or some subtle variation ences between the amplification plots which are exacerbated by the time between
in experimental procedure. Since both operators are highly dilution and testing.
experienced and the instrument was functioning well for other FAM/BHQ1 vs FAM/OQA
experiments, the subtle differences option was examined. An 0.5

important clue was the observation of the variability in data 0.45

from the same dilution series after a period of storage of the 0.4
FAM-BHQ1 Tube E
samples at 4 °C (Figures 11.25A and 11.25B). This lead to an 0.35
FAM-OQA Tube E

examination of the tubes used for the dilution series and a test 0.3 FAM-BHQa Tube F
∆R

FAM-OQA Tube F
0.25
of alternatives. After switching to Eppendorf 1.5 mL reaction FAM-BHQ1 Tube G
0.2 FAM-OQA Tube G
tubes for the dilution series, the predicted standard curve was 0.15
FAM-BHQ1 Tube H

generated (Figure 11.25C), demonstrating that it is essential 0.1


FAM-OQA Tube H
FAM-BHQ1 Tube I

that molecular biology, low retention plasticware is selected 0.05


FAM-OQA Tube I

for PCR and that these assays are sensitive to subtle variations 0
1 6 11 16 21 26 31 36
in protocol. Cq

FAM/BHQ1 vs FAM/OQA Figure 11.25C. An artificial oligo template was diluted 10-fold into molecular
0.45
biology grade tubes (Eppendorf ) and then detected using a specific probe-based
0.4 assay. There are consistent differences between the amplification plots, as expected.
0.35
FAM-BHQ1 Tube E
0.3
Summary—A Troubleshooting Protocol
FAM-OQA Tube E
FAM-BHQa Tube F
0.25 FAM-OQA Tube F
∆R

0.2
FAM-BHQ1 Tube G
FAM-OQA Tube G
• Check quality of sample (degraded material will cause
0.15 FAM-BHQ1 Tube H erroneous results).

FAM-OQA Tube H
0.1 FAM-BHQ1 Tube I Check RT protocol is compatible with design (e.g., an
FAM-OQA Tube I
0.05
Oligo-dT primed RT must have a qPCR assay in the 3’ 1 kb
0
1 6 11 16 21 26 31 36 of sequence).
Cq
• Check assay design.
Figure 11.25A. An artificial oligo template was diluted 10-fold and detected using
a specific probe based assay. There are inconsistent differences between the • Check all controls.
amplification plots. • Check primers using SYBR green I dye/run a gel.
• Ensure correct software settings (baseline, dye detection,
concentrations for standards).
• Ensure ROX concentration is applicable for instrument (and
not interfering with multiplex).
• Check background fluorescence levels.
• Check probe labeling with DNase I assay or repeat
probe synthesis.

PCR Technologies: A Technical Guide 99


OligoArchitect™ Primer and Probe Design Solutions from
Sigma® Life Sciences. Visit our OligoArchitect gateway at
[Link]/probedesignonline
Regulatory Agencies and Conclusions

Chapter 12:
Regulatory Agencies and Conclusions

Regulatory Landscape Overview Table 12.1. Examples of Key Regulatory Agencies.


Governing
While many PCR assays are developed for research applications
Regulatory Agency Territory Governing Authority
there are further considerations for those that are being World Health Organization United Nations Responsible for providing leadership
developed to become diagnostic assays or to be performed (WHO) system on global health matters, shaping
the health research agenda, setting
in support of: Biologics License Application (BLA), New Drug norms and standards, articulating
Application (NDA), Premarket Approval (PMA), 510(K) or evidence-based policy options,
providing technical support to
other regulatory filing. These will need to be validated and countries and monitoring and
performed in accordance with the regulated environment. assessing health trends.
The regulated environment requires quality assurance group International Conference for USA, EU and Recommending ways to achieve
Harmonization of Technical Japan greater harmonization in the
oversight and that work is carried out in compliance with Requirements for Registration interpretation and application
quality systems under the appropriate regulations. This is of Pharmaceuticals for of technical guidelines and
Human Use (ICH) requirements for pharmaceutical
dependent on the purpose for which the PCR-based assay product global registration.
is used. International Organization for World Governing almost all aspects of
Standardization (ISO) (currently 164 technology and manufacturing.
There are multiple regulations that are governed by several countries)
international and country-specific agencies, covering different Food and Drug USA Responsible for regulation and
products and industries. For example, qPCR based assays Administration (FDA) supervision of safety of food, drugs,
medical devices, cosmetics and
are the most sensitive for detection of residual DNA that is veterinary products.
considered to be an impurity and remains after manufacturing Environmental Protection USA Regulating protection of human
Agency (EPA) health and the environment.
of biopharmaceuticals or vaccines that are produced using
The European Agency for EU Evaluation of medicines for human
live systems such as microbial or mammalian cell cultures. The the Evaluation of Medicinal use
requirements for assay sensitivity can vary from product to Products (EMA)
product due to differences in the dose and the size of the host Australia Therapeutic Goods Australia Regulatory authority for therapeutic
Administration (TGA) goods.
genome. However, varying amounts of residual DNA may be
Medicines and Healthcare UK Responsible for regulating all
suggested as acceptable by different regulatory agencies, e.g., Products Regulatory Agency medicines and medical devices in the
less than 100 pg/dose by U.S. Food and Drug Administration (MHRA) UK by ensuring they work and are
acceptably safe.
(FDA)1 but less than 10 ng/dose by the World Health
Ministry of Health, Labor, and Japan Regulating maximum residue limits
Organization (WHO)2 and European Agency for the Evaluation Welfare (MHLW) for agricultural chemicals in foods,
of Medicinal Products (EMEA)3. At the same time, regulations basic food and drug regulations,
standards for foods, food additives,
are changing with the progress of the industry, analysis of etc.
more data and efforts for harmonization. Examples of the key
agencies are presented in Table 12.1. Examples of the most common regulations that are governing
PCR based assays include Good Laboratory Practice (GLP),
Good Manufacturing Practice (GMP), or Clinical Laboratory
Improvement Amendments (CLIA) regulations.
GLP regulations are often mistaken for general good laboratory
practices, for example those addressing the use of protective
clothing such as gloves and lab coats or the use of standard
operating procedures. In reality, GLP is a set of regulations

PCR Technologies: A Technical Guide 101


Chapter 12
addressing performance of “the non-clinical safety testing of
test items contained in pharmaceutical products, pesticide
Assay Validation
products, cosmetic products, veterinary drugs as well as In addition to the evaluation of the assays, as discussed in
food additives, feed additives, and industrial chemicals”4. GLP Chapter 6, assays that are used in regulated environments
regulations direct how these laboratory studies are planned, must be taken through analytical validation and
performed, monitored, recorded, reported and archived. documentation in accordance with ICH guidelines that
are recommended for adoption by the regulatory bodies
World Health Organization defines GMP as the aspect of of the European Union, Japan and USA6 for registration of
quality assurance that ensures that medicinal products are pharmaceuticals for human use. Diagnostic assays need to
consistently produced and controlled to the quality standards be validated in compliance with CLIA/College of American
appropriate to their intended use and as required by the Pathologists (CAP) requirements. Generally, these regulations
product specification. GMP defines quality measures for both have similar requirements for assay validation but also each
production and quality control and defines general measures has specific differences that need to be considered during
to ensure that processes necessary for production and testing assay validation protocol design.
are clearly defined, validated, reviewed and documented, and
that the personnel, premises and materials are suitable for ICH guidelines Q2(R1)6 address typical validation
the production of pharmaceuticals and biological products, characteristics which should be considered and they have
including vaccines. U.S. Food and Drug Administration been applied to bioanalytical method validations, including
(FDA) refer to cGMP as “systems that assure proper design, PCR-based methods, in EMEA guidelines issued in 20117.
monitoring and control of manufacturing processes and The guideline focuses on the validation of the bioanalytical
facilities. This includes establishing strong quality management methods generating quantitative concentration data used for
systems, obtaining appropriate quality raw materials, pharmacokinetic and toxicokinetic parameter determinations.
establishing robust operating procedures, detecting and Guidance and criteria are given on the application of these
investigating product quality deviations and maintaining validated methods in the routine analysis of samples from
reliable testing laboratories”5. animal and human studies.
As defined by CDC, the Clinical Laboratory Improvement The main characteristics of a bioanalytical method that are
Amendments of 1988 (CLIA) regulations include federal essential to ensure the acceptability of the performance and
standards applicable to all U.S. facilities or sites that test human the reliability of analytical results are: Selectivity (specificity),
specimens for health assessment or to diagnose, prevent, or lower limit of quantification, the response function and
treat disease. CDC, in partnership with Centers for Medicare & calibration range (calibration curve performance—linearity
Medicaid Services (CMS) and FDA, supports the CLIA program and range), accuracy, precision, matrix effects, stability of the
and clinical laboratory quality. The CMS regulates all laboratory analyte(s) in the biological matrix and stability of the analyte(s)
testing (except research). The objective of the CLIA program is and of the internal standard in the stock and working solutions
to ensure high quality laboratory testing. and in extracts under the entire period of storage and
processing conditions.
Rapid technology development coincides with quick changes
in instrumentation and analysis software. That creates an The guidelines address criteria for acceptance during
additional opportunity and pressure for pursuing the newest validation and analytical runs, as well as key components
developments. Researchers supporting different phases for reports. CLIA and CAP requirements for diagnostic assay
in the drug or development process (discovery versus validation have slight differences. CAP requires parameters
manufacturing, for example) will have different needs and 1–6 to be evaluated for both FDA cleared and Laboratory
sets of requirements for reagents, instruments and software Developed Tests (LDT) assays, while CLIA allows for FDA
based on the regulatory environment that also will need to cleared tests to be evaluated according to parameters 1–4
be considered during experimental design. While researchers only. At the same time, CLIA has an additional “other” category
doing discovery in a non-regulated environment can work that is defined as “any other performance characteristic
with “research use only” reagents, equipment and software required for test performance”.
and adopt new advances in technology, translational scientists Regulatory Parameters
working with assays supporting clinical trials are required
to work within regulatory constraints. This difference is also 1. Reportable Range
apparent in the case of diagnostic assay development and the 2. Precision
significant burden of validation requirements can be a limiting 3. Accuracy
factor in the choice of platforms and reagents. 4. Reference Range
5. Analytical Sensitivity
6. Analytical Specificity
7. Other

102 [Link]
Regulatory Agencies and Conclusions
There is often confusion regarding terminology, particularly Evaluated together with other clinical data tests support a
pertaining to assay validation versus qualification. personalized choice of appropriate therapy since different HCV
genotypes respond differently to available drugs.
Prior to validation, each assay should undergo a set of
assay optimization experiments that will establish assay Table 12.2. PCR-based Medical Devices Cleared or Approved by
performance. These data will be used for establishing the FDA in 2013.
assay validation protocol. Well-conducted optimization
Device Name Companion Diagnostic Date
experiments will greatly reduce the chance of assay failure
therascreen® EGFR RGQ PCR Kit– Yes, GILOTRIF® (afatinib) is a drug 7/12/2013
during validation. P120022 used to treat patients with NSCLC
Abbott RealTime HCV Genotype II; No, laboratory test that can 6/20/2013
Assay Validation: Full set of evaluation experiments (for Abbott RealTime HCV Genotype II determine certain genetic types
the parameters listed above) performed in accordance Control Kit; and Uracil-N-Glycosylase of the hepatitis C virus (HCV)
(UNG)–P120012
with a validation protocol to demonstrate and document
THxID®–BRAF Kit for use on the Yes, Mekinist® (tramatenib) and 5/29/2013
performance of an assay and set specifications and criteria of ABI 7500 Fast Dx Real-Time PCR Tafinlar® (dabrafenib) are drugs
acceptance for expected assay performance during testing. Instrument–P120014 used to treat patients with
advanced (metastatic) melanoma
Assay Qualification: Assay qualification is a reduced set of cobas® EGFR Mutation Test–P120019 Yes, TARCEVA® (erlotinib) is a drug 5/14/2013
evaluation experiments that mostly focus on demonstrating used to treat patients with NSCLC

that an established assay will produce expected results for Despite fast technological advances, regulatory approval
the intended role (for example, specific type of samples process for new assays may take several years and currently
or conditions). PCR-based applications are taking a more prominent role in
assays that are passing the approval process and replacing
Approved Tests classical methods, such as culture, not only in the diagnostic
arena but also for release testing of biologics.
PCR-based techniques are considered by industry and
regulatory agencies as one of the “gold standard” technologies The MycoTOOL® PCR Mycoplasma Detection Kit-based test
that are used for validation of results obtained by different was approved by FDA on November 1st, 2012. It is the first
assays and technologies when applicable, during 510(k) and commercially available Mycoplasma PCR test approved by
PMA applications. For example, for validation of array-based FDA that can replace conventional and time-consuming
genotyping assays or platforms, polymorphism, genotype call mycoplasma detection assays (culture methods as well as
validation can be performed by PCR amplification of the target indicator cell culture method) for the testing of biologics and
region followed by sequencing and/or by detection with qPCR biopharmaceuticals12. This test can be performed in a few
probe or primer-specific assays. There are multiple regulatory hours and replaces up to 28 days processing, thus significantly
guidelines that address specific assay types. improving time for lot release of biopharmaceuticals and
vaccines.
The majority of PCR-based tests that are being approved for
diagnostics are focusing on detection of viral agents and
mutations associated with genes involved in cancer pathways. Conclusions
During the initial nine months of 2013, four out of 22 FDA Polymerase Chain Reaction (PCR) based methods are powerful
approved medical devices and tests were PCR-based assays techniques that can provide scientifically sound data, even
(18%), all of them were supporting personalized medicine within the budget constraints that researchers are currently
and three out of four were companion diagnostic tests experiencing. This manual provides an introduction to PCR,
(Table 12.2)8-11. By identifying patients who have particular qPCR, RT-PCR and digital PCR with an overview of technical
mutations, such as EGFR exon 19 deletion or exon 21 (L858R) options and related applications, alongside guidance for
substitution in non-small-cell lung carcinoma (NSCLC) cells, troubleshooting PCR-based data. This handbook has been
the test results are used to stratify the subpopulation of designed to support scientists who have different degrees
patients who will have a higher chance of responding to of familiarity with PCR-based methods and serve as an
GILOTRIF®, a drug that is directed towards blocking abnormal introduction to the technology, a reference guide and a tool
function of the mutant EGFR protein. for daily use for researchers in academic, as well as industrial
and diagnostic laboratories.
Laboratory tests that are applied to identifying which
particular strain of Hepatitis C virus (HCV) the patient is Different PCR-based methods are used by the scientific
infected with9 are an important factor in ensuring better community and the choice of technique adopted is based on
treatment outcomes for patients with chronic HCV infections. application, which range from a classical end-point PCR when

PCR Technologies: A Technical Guide 103


Chapter 12
a fast and simple “yes” or “no” answer is needed, to digital PCR be a simple separation into one place to store reagents
to detect rare mutations. As summarized in Chapter 1, PCR- and set up the master mix for PCR reactions with addition
based technology is mature and well established; significant of template and controls (“pre-PCR area”) and a second
knowledge has been accumulated over the last four decades place for re-amplification and data generation (“post-PCR
and thousands of scientific papers are being published every area”). This approach is commonly adopted in a research
month that use PCR-based techniques. That number has laboratory setting. At the opposite extreme, separation
continued to grow linearly over the last 20 years, as can be would include a combination of dedicated, segregated
seen in Figure 12.1. differentially pressurized rooms with separate air handling
PubMed Publication Count
systems, dedicated personnel, equipment, gowns and a
30000 unidirectional workflow. These separation methods are more
often adopted in production and diagnostic environments14.
25000
It can be challenging to ensure segregation in a small research
20000 laboratory where space is limited and equipment cannot be
dedicated. In this case, the focus must be on stringent cleaning
15000
procedures before, after and between the steps, use of filtered
10000
pipet tips, bench top workstations, and maximum possible
physical separation. These measures can produce successful
5000 results. However, additional controls need to be incorporated
into experiments to demonstrate lack of cross-contamination.
0
1960 1970 1980 1990 2000 2010 2020 An example workflow is presented in Figure 12.2.
Figure 12.1. The number of records published per year (1971–2012) resulting from a
search of NCBI PubMed database13 when the key word “PCR” was used. Nucleic Acid Master Mix
Reagent Storage
Extraction Preparation
As with every technology, PCR-based methods have
Negative Pressure Positive Pressure
limitations. This manual provides information, strategies,
comparisons of different detection systems and analysis
methods (see Chapter 10) to assist researchers in the
appropriate evaluation of these limitations and to design an Template Detection
PCR
Addition Analysis
optimal experiment. As described in Chapter 5, there are
different strengths for each qPCR detection chemistry method Negative Pressure Positive Pressure

and these need to be considered during the experimental Figure 12.2. Example of a Laboratory Workflow: Division of functional areas and the
design to balance sensitivity, specificity, cost of reagents workflow direction in the PCR assay process.
and resources and time available for assay optimization. The
The importance of the quality of template and choice of
same consideration should be applied when evaluating
appropriate QC assays is discussed in Chapters 7 and 8.
experimental design using individual vs. multiplex assays.
Comparing RNA samples that have undergone different
This manual also provides options for appropriate degrees of degradation can lead to erroneous biological
experimental design and workflow. All steps in the process, conclusions about RNA expression signatures. Similarly,
from the quality of the sample to data analysis method, as well different samples may have different concentrations of
as a choice of normalizing genes for determination of relative inhibitors that will impact RT or PCR efficiency and may
RNA expression, must be considered and addressed during produce false-negative results or inaccurate ratios of
experimental design to reduce variability. A primary concern expression. For example, there is a vast diversity of sample
when working with PCR is to control for cross contamination types that are being interrogated with PCR-based techniques;
to avoid false positive results because these techniques are multiple environmental samples tested to evaluate biodiversity
highly sensitive. or to detect pathogens, different human and animal tissues
There are different approaches to the laboratory set up and bodily fluids to evaluate RNA expression signatures or
that can assist in addressing that concern, including use DNA vaccines. Each of these can have a plethora of unique
of proper laboratory practices with a focus on cleaning, inhibitors that may impact different assays in the same sample
physical segregation with dedicated equipment and gowns to a variable degree.
and a unidirectional workflow. Proper cleaning must be Different biological questions can be answered by utilizing
performed with nucleic acid destroying agents such as a multiple workflows, reagents, instruments and applications,
simple 10% bleach solution and UV irradiation (not to be as discussed throughout this guide. The choice of an optimal
replaced with common hospital disinfectants like Amphyl® technique, reagent, method of analysis, types and number of
that only have antimicrobial properties). Segregation can replicates and controls will be dependent on multiple factors

104 [Link]
Regulatory Agencies and Conclusions
and constraints of individual projects as well as the researcher’s References
experience and personal preferences. However, as discussed 1. Points to consider in the manufacture and testing of monoclonal
in Chapters 3 and 4, significant emphasis must be placed on antibody products for human use (1997). U.S. Food and Drug
Administration Center for Biologics Evaluation and Research.
maintaining compliance with MIQE guidelines15 through all J Immunother. 1997 May; 20(3): 214-43.
phases of the experiment to assure scientific integrity of the 2. Griffiths, E. WHO requirements for the use of animal cells as in vitro
data and validity of biologic conclusions that will withstand substrates for the production of biologicals: application to influenza
the test of time and follow up experiments16. vaccine production. In: Brown F, Robertson JS, Shcild GC, Wood JM,
editor. Inactivated Influenza Vaccines Prepared in Cell Culture. Dev Biol
Stand. Basel, Karger, 1999 vol 98, pp 153-157.
Next-generation Sequencing 3. European Union (2001) Position statement on the use of tumourigenic
cells of human origin for the production of biological and
All PCR-based techniques are applied to targeting known biotechnological medicinal products, The European Agency for the
sequences, as discussed in Chapter 6. While sequencing Evaluation of Medicinal Products: Evaluation of medicinal products for
methods can generate and detect “unknown” sequence, PCR- human use. CPMP/BWP/1143/00.
based amplification is an important step in the generation of 4. OECD Principles of Good Laboratory Practice (as revised in 1997)”. OECD
Environmental Health and Safety Publications (OECD) 1. (1998).
template for massively parallel sequencing (MPS). Quantitative
5. Facts About Current Good Manufacturing Practices (cGMPs). http://
PCR approaches are used for QC and optimization of DNA [Link]/Drugs/DevelopmentApprovalProcess/Manufacturing/
libraries and this is a key step in the generation of high-quality [Link].
data. This approach is highly sensitive and requires a very small 6. Validation of Analytical Procedures: Text and Methodology Q2(R1). ICH
amount of material, compared to other methods. In addition, Harmonized Tripartite Guideline. Current Step 4 version Parent Guideline
qPCR evaluation assures a high efficiency and thus cost dated 27 October 1994 (Complementary Guideline on Methodology
dated 6 November 1996, incorporated in November 2005).
effectiveness of sequencing data. PCR is also a corner stone
7. Guideline on bioanalytical method validation 21 July 2011 EMEA/CHMP/
for template generation for popular technologies used for re- EWP/192217/2009 Committee for Medicinal Products for Human Use
sequencing of DNA and RNA. These applications are supported (CHMP).
by design tools that allow multiplexing of over 6,000 primers 8. therascreen® EGFR RGQ PCR Kit - P120022 Approval Letter: [Link]
per pool and 10 ng of starting material, making interrogation [Link]/cdrh_docs/pdf12/[Link].
of limited human samples such as FFPE material feasible. 9. Abbott RealTime HCV Genotype II; Abbott RealTime HCV Genotype II
Control Kit; and Uracil-N-Glycosylase (UNG) - P120012. Approval Letter:
However, together with the trend of reduction of cost of [Link]
MPS and increase in depth of coverage per sample, next- 10. THxID® - BRAF Kit for use on the ABI 7500 Fast Dx Real-Time PCR
generation sequencing instruments are rapidly evolving. Instrument - P120014. Approval Letter: [Link]
RNASeq applications are approaching not only sequence cdrh_docs/pdf12/[Link].
determination, but also quantification of transcripts and new 11. cobas® EGFR Mutation Test - P120019 Approval Letter: [Link]
[Link]/cdrh_docs/pdf12/[Link].
platforms are approaching sequencing of single molecules
12. Roche’s Rapid Mycoplasma Detection Test MycoTOOL Receives FDA
without amplification. When the technology reaches this Acceptance for Release Testing of Biopharmaceutical Roche Product.
point, it may well replace PCR-based diagnostics (rapid point PR Newswire Clinical Trials/Medical Discoveries News <img src=”http://
of care detection of infectious pathogens or known cancer [Link]/public/img/[Link]” alt=”PR Newswire”
mutations such as in EGFR gene for example). However, that align=”center” class=”nitflogo” /— PENZBERG, Germany, December 19,
2012 PENZBERG, Germany, December 19, 2012 /PRNewswire/.
is still in the future. PCR-based applications continue as a
13. NCBI PubMed database [Link]
significant work engine supporting research, development
14. Centre for Disease Control and Prevention. Good laboratory Practices for
and diagnostics. Molecular Genetic Testing for Heritable Disease and Conditions. Morbidity
and Mortality Weekly Report, June 2009, Vol. 58, p.1-37, No. RR-6 [Link].

Additional Technical Support gov/mmwr.


15. Bustin,S.A., et al., The MIQE guidelines: minimum information for
This guide is provided to researchers to address the publication of quantitative real-time PCR experiments. Clin. Chem. 2009,
55: 611-622.
most common PCR related questions. In addition to the
16. Bustin, S.A. et al., The need for transparency and good practices in the
troubleshooting guide in Chapter 11, the Sigma-Aldrich qPCR literature. Nature Methods 2013, 10, 1063-1067.
scientific group and technical support team is also available to
assist with further support, troubleshooting or, in cases such
as when follow up experiments need to be conducted in a
regulated environment, outsourcing to reference laboratories.
Our goal is to enable our customers to succeed.

PCR Technologies: A Technical Guide 105


OligoArchitect™ Primer and Probe Design Solutions from
Sigma® Life Sciences. Visit our OligoArchitect gateway at
[Link]/probedesignonline
Protocols

Appendix A:
Protocols

Introduction the confidence interval continues to decrease (1.24 at five


replicates and 0.72 at ten replicates and so on). However,
This section contains examples of basic PCR/qPCR/dPCR the most dramatic decrease of the confidence interval, as
protocols that can be used as the foundation for explorations we have seen, occurs at the lower number of replicates, for
into some of the concepts described in the theoretical example increasing from two to three replicates. A reduction
chapters of this guide. Included are detailed protocols for of technical variability can be of dramatic importance for
assay quality control, in addition to more general protocols establishing statistical significance of the final results. Therefore
that provide a good practical basis for adaptation to specific it is recommended to use triplicates or more replicates of the
PCR‑based studies. samples under analysis, when possible.
Another way to address technical variability is to use reference
Experimental Design genes for normalization. The fundamental idea underlying the
Scientific analysis of biological data centers on the formulation use of reference genes is the assumption that they will follow
and testing of hypotheses. The formulation of a hypothesis and experience the same technical handling as the genes that
requires detailed understanding of the conditions and are the subjects of the study. Furthermore, it is assumed that
variables of the experiment. Successful testing of a hypothesis the expression of the reference gene is stable in the various
involves careful execution and an appropriate experimental samples used in the study. When these assumptions are valid,
design to maximize the desired observable signal while the detection of reference gene expression may be used
minimizing technical variability. to normalize gene expression in different samples and thus
One way to address technical variability is to use replicates reduce the potential impact of technical variability on the end
in the analysis. By using sample replicates for experimental result. However, these assumptions are not always valid and
measurements, the resulting measurements can be averaged careful validation of reference genes is, therefore, necessary for
to arrive at estimates of observable values that are more robust each specific experimental design.
and less vulnerable to random technical errors. Replicates are The key to statistical analysis is sampling. Sampling means
also used to give a measureable estimate of the variability that a limited number of samples are obtained from each
introduced by technical handling. In a nested experimental group or population, but these are used to draw conclusions
design, replicates are used in several of the technical handling about the complete population. Therefore, samples must be
steps, creating a tree-structure of replicates. The nested representative of the entire population. It is important that
experimental design thus allows both detailed analysis of sampling is random from the entire population.
contributions of each component of technical variability
and increased precision by averaging of replicates for the One illustrative anecdote relates to a researcher who had a
end result1,2. peculiar problem. He wanted to test the effect of different
drugs on the expression of a particular gene in mice. The
The higher number of replicates increases the potential of problem was that he always saw significant differences in
reducing overall technical variability by averaging. This can be the gene expression, no matter which drug he tested. This
illustrated by comparing the confidence intervals of simulated didn’t seem realistic and so a biostatistician was brought
cases with standardized variability. The confidence interval in as a consultant and quickly noticed that the negative
estimates the mean based upon a given confidence level control mice were always bred in a cage in a back corner of
(typically 95%) and it is usually assumed that the variability is the lab, whereas the drug treated mice were always bred
characterized by a standard deviation of unity (1). With only in a cage near a window of the lab. This is an example that
two replicates the confidence interval under these conditions illustrates that the mice were not randomly sampled from the
is 8.99, indicating a wide interval and thus a poor estimate lab space and therefore the observed effect was due to an
of the position of the true mean. With three replicates the undesired systematic sampling bias rather than due to a real
confidence interval is reduced drastically, by more than 3-fold, treatment effect.
to 2.48. With further increases in the number of replicates,

PCR Technologies: A Technical Guide 107


Appendix A
In contrast to the technical replicates, the biological samples Technical Considerations
are not averaged to reduce variability during data analysis, but
instead used directly in the statistical analysis. The number of Appropriate laboratory practice is important for all PCR-
biological samples dictates the level of significance that can be based techniques. Accurate and careful sample handling and
accomplished. For example at a limit of significance of 5%, we preparation helps to reduce carry-over contamination from
expect a purely random sample to indicate significance once one experiment to the next, as well as cross-contamination
every 20th time of testing. To rank samples near the limit of between samples. The following guidelines will help minimize
significance it would be necessary to test at least 20 biological the possibility of contamination:
samples. Furthermore, in order to determine the significance • Select the most appropriate gloves4.
with sufficient precision it is recommended that at least 50 • Change gloves frequently.
times that number of biological samples are recorded3. To
determine precision at these levels is often not economical or • Use dedicated pipettes specifically for master mix
practically feasible when organisms are the biological sample. preparation and for working with nucleic acids.
Nevertheless, this example illustrates the importance of using • Use pipette tips with shaft guards and aerosol barriers.
a large number of biological samples. In order to accomplish • Use sterile, nuclease-free water and dedicated reagents
significant and meaningful results, careful consideration (use a single aliquot per experiment session).
is needed to collect sufficient number of representative
biological samples. • Use screw-cap tubes for dilutions and reaction master
mix setup.
A pilot study is a good method for evaluating the number of
necessary biological samples. A pilot study may use a limited
• Wipe down all workstations with dilute solutions of bleach
or similar cleaning aids.
number of biological samples and some technical replicates
at different stages throughout the technical handling • Prepare samples on a clean bench with a UV-lamp-
procedure. By running the pilot study using a limited number equipped hood.
of samples and replicates it may be possible to perform the • Keep the thermal cycler area away from the sample
pilot study inexpensively and establish optimal parameters for preparation station.
the subsequent full-blown study. Not only will it be possible • Thaw all reagents on ice (unless otherwise specified) and
to establish the number of biological samples necessary mix and spin carefully before use.
(based on the evaluated inherent variability of the data and
the amplitude of the biological response signal), but it can • Prepare master mixes of all reagents that are sufficient
also determine, for example, which moment in the technical for all samples (prepare an extra 10% to ensure sufficient
handling procedure introduces the most technical variability material, e.g., if 10 samples including controls are required,
(and target this stage for more technical replicates in the prepare a master mix for 11 reactions).
full study) and it can also identify and validate appropriate • Ensure cDNA is generated using random priming or oligo-
reference genes and suitable controls. dT priming and diluted before using it in PCR/qPCR (see
Protocol 10 unless using a one-step protocol, which is
described in Protocols 11 and 12).

108 [Link]
Protocols
Controls Loading PCR/qPCR plates
It may appear to be cost effective to neglect controls in When using a PCR plate, follow a plate schematic system to
favor of samples, but in the long term, experimental validity ensure that the reaction mix, samples and controls are added
is compromised and attempts to troubleshoot will be futile. to the correct wells. Briefly spin the reaction plate or tubes
In any experiment, appropriate controls serve two major to collect the samples at the bottom and to remove bubbles
purposes; ensuring the experimental results are a result of before running the reactions.
the test procedure and providing diagnostic data when an
There is debate as to whether to first load the sample or the
experiment fails.
reaction mix into the plate. Since opinions are divided, the
The actual definition of “appropriate control” will be governed choice will be personal preference, but there are several things
by the specifics of the experiment. Some suggestions include: to keep in mind.
• Positive control: A sample of DNA or cDNA known to When loading the master mix (containing all reaction
contain the target sequence of interest. If the amplicon components except DNA target) first, there is reduced chance
is short (<130 bases), an artificial oligo that matches the of cross contamination of sample from well to well and a
target of interest can be used as a positive control. single tip can be used safely. However, most conventional
• Negative control: A sample of DNA or cDNA that does not reactions consist of 15–25 μL with 2–5 μL of DNA template.
This means that when adding the template to the wells there
contain the target sequence of interest.
is little opportunity to check sample loading. One solution is
• Water/contamination control or No Template to cover the plate with a clean film and pierce the seal to add
Control (NTC): A water or NTC is a useful control to add to the sample, thus pierced wells can be tracked during plate
the plate as a monitor of potential contamination of the loading. In contrast, if the small volume of sample is added to
reactions with template. the wells before the master mix, it is possible to verify visually
• RT minus control: To identify contaminating genomic that each well contains sample and the volume is correct.
DNA (gDNA) in mRNA samples, each RNA sample is However, prior to the subsequent addition of master mix, the
incubated in a RT reaction mix that does not contain samples must be collected into the bottom of the wells and
RT enzyme. addition of master mix must be performed carefully to prevent
The final results of an experiment are only valid if the carry-over template contamination.
accompanying controls also show the correct results.

PCR Technologies: A Technical Guide 109


Appendix A

Protocol 1: OligoArchitect Assay Design


Efficient qPCR relies on good assay design. Since the invention The two alternatives thus complement each other. The
of PCR, many parameters have been identified as important consultative design service provides extensive capabilities and
for assay quality, such as estimates of oligo temperature personal assistance. OligoArchitect Online provides an easy-to-
characteristics, GC content and folding properties. Empirical use solution under your direct control.
evidence has been used to demonstrate the value of each
parameter and there are now assay design algorithms Login and Registration
that predict good assay designs with high confidence. The The OligoArchitect Online design tool is available by clicking
high number of parameters and the complexity of their the “Online Design” button at [Link]/probedesignonline.
relationships make using software tools a huge advantage, The homepage has detailed information about design
rather than attempting assay design manually. Fortunately, parameters and version capabilities. Registration is completed
there are now tools available online that are free of charge and by adding a few contact details and choosing a password.
yet incorporate the most advanced design algorithms. Sigma
Life Science provides OligoArchitect™ Online, free of charge Once logged in, there are several options available to load the
(Figure P1‑1). OligoArchitect Online is powered by Beacon target sequence. First, select the type of detection chemistry
Designer™ (PREMIER Biosoft International). Beacon Designer is from the tabs at the top of the page. Options include SYBR
well-known in the qPCR community and is often considered Green I, Dual-Labeled Probe, Molecular Beacon, LightCycler®
to be the best design software available. OligoArchitect Online Probe and Scorpion® Probe (Figure P1‑2). After selecting the
contains many features (including the capability to design desired detection chemistry, either enter an accession number
oligos modified with LNA®) of Beacon Designer, although not or copy-paste the target sequence itself. After entering an
all. In this protocol, the capabilities of OligoArchitect will be accession number, simply click “Search” to run a design or the
demonstrated to find SYBR® Green I, End-point-PCR, Dual- “Load Sequence” button to populate the target sequence
Labeled Probe, Multiplex and SNP assay designs. window with the desired target sequence (this is only
necessary to add a SNP).

Figure P1-1. Consultative and Online Design Alternatives.

Sigma offers both online and consultative assay design


services. The team that supports the consultative assay designs
is experienced and has access to many state-of-the-art assay
design tools, including full versions of Beacon Designer.
Consultative designs may be required to analyze sequence
alignments, to design for conserved regions, or to design for Figure P1-2. SYBR Green I Assay Design.
specific targets. The consultative design team also utilizes
tools to find designs across exon junctions, though this can be Human GAPDH will be used as the target for the SYBR
replicated manually using the online tool (directions can be Green I Assay demonstration. Enter the accession number of
found on the web page). These are examples of capabilities human GAPDH (NM_002046) and load the target sequence
within consultative designs that go beyond the capabilities (Figure P1‑2). Click the “Search” button to use the default set of
of the online tool, though the online tool is upgraded at parameters to obtain design results. The result is presented in
regular intervals. two ways. First, the sense and anti-sense primers are indicated

110 [Link]
Protocol 1: OligoArchitect Assay Design
with blue and red fonts, respectively, in the target sequence.
Second, the primers are listed below the target sequence
window together with GC content, temperature characteristics
and other oligo properties (Figure P1‑3). The property “Rating”
is the estimate that is calculated by the design algorithm for
the design quality. Ratings above 50 are considered “good” and
normally pass the algorithm criteria for approval to use. Ratings
above 75 are listed as “best” and, thus, give extra confidence in
the design quality.
Clicking the “View All Results” button allows the user to
consider other alternative designs (Figure P1‑4). This may be
useful if the user has specific preferences that are not covered
by the design parameters. Selection of the design is done by
toggling the check box on the left-hand side of the design
parameters table. Once satisfied with the selection, results
can be exported to a local Microsoft® Excel file by clicking Figure P1-4. Alternative Primer Options.
“Export for Synthesis” or entered directly into the Sigma online
ordering tool for immediate ordering by clicking “Place an
Order for Synthesis”.
End-point PCR Assay Design
Like SYBR Green I assay designs, end-point PCR assay designs
are also based on two, usually non-modified, oligos that prime
PCR amplification events. The difference is that amplification
detection occurs by identification on a gel or by a fragment
analysis instrument for end-point PCR. This means that the
length of the amplification product may need to be larger than
for SYBR Green I qPCR assays. To modify the amplicon length,
rather than clicking on “Search” immediately (as described
above), the “Primer Parameters” link is opened, then scroll
down and adjust the parameter for “Amplicon Length” from the
default setting to a range from 300 to 2,000 nucleotides long
(Figure P1‑5) before selecting “Search”. In the example of the
human GAPDH (NM_002046) design, the resulting assay has
an amplicon of 352 nucleotides long (Figure P1‑6).

Figure P1-3. Primer Selection Indicated by Red and Blue Fonts.

Figure P1-5. Adjusting Design Parameters for End-point PCR Detection.

PCR Technologies: A Technical Guide 111


Appendix A

Figure P1-6. Longer Amplicon Indicated by Primers (Blue and Red) Suitable for
End-point PCR. Figure P1-7. Adding Target Sequence for Dual-Labeled Probe Design.

Dual-Labeled Probe Design


Together with SYBR Green I assay designs, Dual-Labeled Probe
assay designs are the most common. Dual-Labeled Probe
assays have the potential to be more sensitive and specific
than SYBR Green I assays, although the additional oligo and
modifications usually make these assays more expensive.
To perform the design using OligoArchitect, switch to “Dual-
Labeled Probe” detection chemistry among the tabs at
the top of the page (Figure P1‑7). Add the human GAPDH
(NM_002046) target sequence as described in the SYBR
Green I design example above and click “Search” to generate
new assay results. Again, the sense and anti-sense primers
are indicated with blue and red font, respectively, in the
target sequence. Additionally, we now also have the probe
oligo indicated with purple font in the target sequence
(Figure P1‑8).
Figure P1-8. Assay Design Showing Two Primers in Red and Blue and the Dual-
Labeled Probe in Purple.

The potential to design multiplex assays is another advantage


of Dual-Labeled Probe assays, when compared to SYBR Green
I assays. Therefore, click “View All Results” and there is now also
the option to have the design result “Save for Multiplexing”
(Figure P1‑9).

112 [Link]
Protocol 1: OligoArchitect Assay Design
increases exponentially with the number of oligos in the assay.
Therefore, it is prudent to avoid higher orders of multiplex
assay, if possible, considering other limitations of the assay.

Figure P1-9. Selecting Dual-Labeled Probe Assays for Multiplex Analysis.

Multiplex Assay Design


After selecting “Save for Multiplexing” in the OligoArchitect
Online tool, a window is presented that allows the assays
that have been saved for multiplex analysis to be inspected.
The “View Multiplex Oligos” leads to another window where
the predicted risks of undesirable oligo cross reactions
can be viewed. In the case of the GAPDH assay, there are Figure P1-11. Potential Oligo Interactions for Two Genes in Multiplex.
three potential, undesirable oligo cross reactions predicted
(Figure P1‑10).

Figure P1-10. Predicting Oligo Interactions in Multiplex Reactions.

Having saved the GAPDH design for multiplex, click the


“Back” button until returning to the window where another
target sequence is added to the analysis. In this example,
human HPRT1 (NM_000194) is loaded. Click “Search” to
obtain the design results. Click “View All Results” and “Save for
Multiplexing”. Now there are saved assays for both GAPDH and
HPRT1 and their multiplex compatibility can be evaluated.
Select “View Multiplex Oligos” to reveal that, in this case, there
are 14 potential, undesirable oligo cross reactions predicted
(Figure P1‑11).
The procedure described above was repeated to add human
GUSB (NM_000181) to the multiplex assay. With three target
genes in the multiplex, there are 35 undesirable oligo cross
reactions predicted (Figures P1‑12A, P1‑12B, and P1‑12C). Figure P1-12A. Potential Oligo Interactions for Three Genes in Multiplex.
In general, the risk of undesirable, oligo cross interactions

PCR Technologies: A Technical Guide 113


Appendix A

SNP Assay Design


Another common application for qPCR is SNP genotyping.
OligoArchitect Online handles SNPs easily by allowing users
to type in the position and mutant base below the target
sequence window. For the presented example, the target
sequence for human GUSB gene and a SNP site rs202210104
is used. The mutant position is 201, and the SNP is a T>C
variation. Click the “Add SNP” button to activate the entered
SNP. The activation of the selection is visually indicated by
a green tick mark that appears on the right side of the SNP
information (Figure P1‑13).

Figure P1-12B. Potential Oligo Interactions for Three Genes in Multiplex (cont’d).

Figure P1-13. Entering SNP Information to Target Sequence.

Click “Search” to proceed with the assay prediction routine. In


this example, there is a highlighted message indicating that
“No Probe found: 84 rejected (Gs > Cs: 84)” (Figure P1‑14).
This is a relatively common warning. The reason for this error
message is that one of the characteristics of a good design
is that the number of Gs should be less than the number
of Cs for a good probe design (see Chapter 6). The solution
for this concern is to encourage the design algorithm to
find a suitable probe on the opposite strand of the target
sequence. Click “Back” and then open the details of the “Probe
Parameters >>”. Scroll down and note that “Design Sense
Probe” is activated under the section “Output Options”. Change
this to “Design Anti-sense Probe” by toggling the appropriate
radio button (Figure P1‑15). Click “Search” again to engage the
Figure P1-12C. Potential Oligo Interactions for Three Genes in Multiplex (cont’d).
design algorithm prediction routine. This time the search has
yielded resulting designs with the probe targeting the anti-
sense strand of the target sequence (Figure P1‑16).

114 [Link]
Protocol 1: OligoArchitect Assay Design

Figure P1-16. Successful Anti-sense Probe Design.

Figure P1-14. Error Message Indicating that No Suitable Probe Could be Summary
Designed (Gs > Cs). In this protocol, the application of OligoArchitect Online
has been demonstrated for the design of primers suitable
for use with SYBR Green I and end-point-PCR assays; Dual-
Labeled Probes for single as well as multiplex assays and
assays targeting a specific SNP. More features are available
within OligoArchitect Online that are beyond the scope of
this protocol, including application of Molecular Beacons,
LightCycler® Probes and Scorpions® Probes. For specific
capabilities outside those available in OligoArchitect Online,
consult the Sigma Custom Products design teams.
Oligo technical team: Oligotechserv@[Link]
Consultative design team: [Link]/probedesignonline

Figure P1-15. Design Parameters Showing Selection of Sense and Anti-sense


Probe Design.

PCR Technologies: A Technical Guide 115


Appendix A

End-point PCR Protocols


During PCR assay preparation, nonspecific amplification can users to minimize nonspecific amplification while increasing
occur due to binding of PCR primers to nonspecific templates target yield and specificity. Two alternative methods are
and from formation of primer dimers which result from using presented to control amplification of the specific product,
other primer molecules as templates. The protocols presented these are enzyme and dNTP mediated Hot Start PCR.
in this section both adopt controlled PCR activation to allow

Protocol 2: Antibody–Enzyme Mediated Hot Start PCR


When using hot start Taq DNA polymerase, the enzyme • PCR tubes and plates:
remains inactive until heated. Hot Start DNA polymerase • Individual thin-walled 200 µL PCR tubes
control is achieved by chemical or antibody modification of (Sigma Z374873 or P3114)
the enzyme. Chemically modified hot start enzymes require up
to 10 minutes activation whereas antibody mediated hot start • Strip tubes, 200 µL (Sigma Z374962)
enzymes are activated within 1 minute. • 96-well plates (Sigma Z374903)
JumpStart­™ Taq DNA Polymerase (Sigma) is an antibody • 384-well plates (Sigma Z374911)
inactivated, Hot Start enzyme. During the initial denaturation • dNTP mix, 10 mM each of dATP, dCTP, dGTP, and dTTP
step of the PCR, the antibody is also denatured and dissociates (Sigma D7295).
from the DNA Polymerase, therefore enzyme activity is
restored. The resulting PCR exhibits a higher specificity
• Enzyme and buffer; review Table P2-1 to select the optimal
reagents for the experiment.
and yield5.
• If using gel electrophoresis for PCR product analysis, a
Equipment DNA size marker is usually required. Select the appropriate
marker based upon PCR amplicon size (Figure P2‑17).
• Pipettes dispensing volumes from <1 to 200 μL
Product DirectLoad™ Step DirectLoad™ PCR DirectLoad™
• Benchtop microcentrifuge Name Ladder, 50 bp 100 bp Low Ladder 1 kb DNA Ladder
• Thermal cycler (Cat. No.) (D3812) (D3687) (D3937)
Size Range 50 bp–3,000 bp 100 bp–1,000 bp 500 bp–10,000 bp
Appropriate Analysis Equipment Picture of — 3,000 — 1,000 — 10,000

• Electrophoresis equipment — 900 — 8,000


Ladder — 2,000 — 800 — 6,000
— 5,000
— 700 — 4,000
• UV transilluminator — 900
1,000
800
— 600
— 500
— 3,000
— 2,500

• Alternative PCR product analysis system — 700


— 600
— 500 — 400
— 2,000
— 1,500
450
— 400
Supplies — 300
— 200
350
250
150
— 300
— 1,000

• Sterile filter pipette tips — 100 — 500


— 50
— 200
• Sterile 1.5 mL screw-top microcentrifuge tubes
(Sigma CLS430909)

— 100

(1.5% gel) (2% gel) (0.75% gel)

Figure P2-17. Resolution of DNA Size Standards Through Agarose Gel.

Table P2-1. Hot Start DNA Polymerase Enzymes and Buffers (Sigma).
Hot Start DNA Polymerase
Standard Format–Separate Components ReadyMix–Premixed PCR Master Mix
Separate MgCl2
Containing MgCl2 (for MgCl2 Optimization) Containing MgCl2
With red dye for direct Clear formulation Clear formulation Clear formulation With red dye for direct
load on gels without dye without dye without dye load on gels
JumpStart™ REDTaq® DNA JumpStart™ Taq DNA JumpStart™ Taq DNA JumpStart™ Taq JumpStart™ REDTaq®
Polymerase Polymerase, with MgCl2 Polymerase, without MgCl2 ReadyMix™ ReadyMix™
Cat. No. D8187 Cat. No. D9307 Cat. No. D4184 Cat. No. P2893 Cat. No. P1107

116 [Link]
Protocol 2: Antibody–Enzyme Mediated Hot Start PCR
• PCR grade water (Sigma W1754 or dispense Sigma W4502 Table P2-2B. Reaction Master Mix Components for ReadyMix Format
into 20 mL aliquots and freeze; use a fresh aliquot for each Hot Start DNA Polymerases.
reaction). Final Concentration Master Mix Volume (μL)
• DNA/cDNA template: Component (in a 25 μL Reaction) per Single 25 μL Reaction
JumpStart Taq ReadyMix (2×) 1× 12.5
• cDNA reaction diluted 1:10 to detect medium to
Forward/reverse primer 50–500 nM 0.1 to 1
highly expressed targets or between 1:2 to 1:5 for (10 μM stock)
rare transcripts. PCR grade water Up to 20 μL Up to 20

• gDNA 10 ng to 100 ng.


b. Combine reaction components into a 1.5 mL
• Primers diluted to working concentration (10 µM working microcentrifuge tube on ice.
stocks are appropriate for most assays but multiplex blends
3. Mix the reaction master mix by carefully pipetting up and
may require mixing of 100 µM stocks).
down, ensuring that all mix is expelled from the pipette tip
• Custom oligos can be designed according to the and then pulse or centrifuge briefly to collect the sample at
OligoArchitect Online (see Protocol 1) and can be the bottom of the tube.
ordered at [Link]/oligos.
4. Aliquot 20 μL of master mix into the required number of
200 μL thin-walled PCR tubes (label/number the tubes
Method containing samples, including replicates and controls).
1. Leaving the DNA polymerase on ice or at –20 °C, thaw
5. Add 5 μL of the DNA template sample (containing a total
the remaining reaction components on ice, vortex to mix
of 10 ng to 100 ng gDNA or dilute a cDNA sample 1:2 to
(except the enzyme), centrifuge briefly and replace on ice.
1:10) to reach a final reaction volume of 25 μL.
2. Set up PCR reactions:
6. Spin the PCR tubes and place into a thermal cycler with a
a. Prepare a master mix containing all reaction heated lid.
components with the exception of the DNA/cDNA
7. Determine the appropriate Ta for the primers. A good first
template (Tables P2‑2A or P2‑2B).
test can be performed using a Ta that is 5 °C lower than the
Calculate the master mix required by multiplying Tm of the primer with the lowest Tm.
amounts by the number of reactions needed, including
8. Determine the required thermal cycling protocol with
controls and then add 10% to ensure a sufficient
reference to Table P2-3.
quantity for all samples.
9. End the PCR with an incubation at 72 °C for 10 min to
Table P2-2A. Reaction Master Mix Components for Standard ensure that all products are full length.
Format Hot Start DNA Polymerases.
Table P2-3. PCR Cycling Conditions for Use with Antibody Inactivated
Final Concentration Master Mix Volume (μL) Hot Start DNA Polymerases.
Component (in a 25 μL Reaction) per Single 25 μL Reaction
PCR buffer (10×) 1× 2.5 Hot Start Cycling Conditions Temp (°C) Time
Magnesium chloride (50 mM)* 2.5 mM 1.25 Initial Hot Start/denaturation 95 1 min
Forward/reverse primer 50–500 nM 0.1 to 1 Steps 1–3 are repeated through 25–50 cycles
(10 μM stock) Step 1 95 30 sec
dNTP mixture (10 mM of each 0.2 mM 0.5 Step 2 48-60 30 sec
nucleotide)
Step 3 72 30 sec to 2 min*
Taq DNA polymerase (5 U/μL) 0.05 units/μL 0.25
PCR Completion 72 10 min
PCR grade water Up to 20 μL Up to 20
*Note: Elongation time is dependent upon amplicon size: 30 sec for up to 500 bp. Add 1 min for
*Note: Magnesium chloride is added separately if not already in the PCR buffer or when previous each additional 1 kb.
optimization has revealed a requirement for a higher concentration.
10. Analyze a 10 µL aliquot of the completed reaction by
agarose gel electrophoresis, with visualization on a
transilluminator or other chosen analysis method.

PCR Technologies: A Technical Guide 117


Appendix A

Protocol 3: dNTP-Mediated Hot Start PCR


Hot Start dNTPs are modified with a thermolabile protecting
group at the 3’ terminus. The presence of this modification
Use Guidelines
blocks nucleotide incorporation by DNA polymerase until 1. Both native and recombinant Taq DNA polymerases work
the nucleotide protecting group is removed during a well in conjunction with hot start dNTPs in all applications
heat activation step. When standard cycling protocols are tested. Hot Start dNTPs are also shown to successfully
employed, a 0–10 minute initial denaturation step at 95 °C block extension by mesophilic enzymes, such as Klenow
facilitates activation. In many PCR applications, Hot Start DNA polymerase.
dNTPs directly replace the natural nucleotides. Although using 2. PCR buffers with a pH range from 8–9 can be used for
the Hot Start dNTP Mix, containing the modified nucleoside PCR setup (observed during extensive evaluation by
triphosphates of dA, dC, dG and dT is recommended. It has Sigma‑Aldrich research and development team).
been observed that replacement of just one or two natural 3. For standard thermal cycling protocols, 2.5 mM MgCl2,
nucleotides with Hot Start dNTPs is sufficient to prevent 400 µM Hot Start dNTPs and 1.25 units of Taq DNA
nonspecific amplification 6,7. Hot Start dNTPs are available as polymerase is recommended. For improved performance,
a blended mix or as a set of individual CleanAmp™ dNTPs the Hot Start dNTP concentration can be increased up to
(Sigma DNTPCA2 or DNTPCA10). 800 µM. For every additional 0.2 mM concentration of Hot
This protocol provides directions for performing standard Start dNTPs, add at least an additional 1.0 mM of MgCl2
thermal cycling, single and multiplexed target detection (from (observed during extensive evaluation by Sigma-Aldrich
2 to 7 targets) and fast thermal cycling end-point PCR. research and development team; see Chapter 8).
4. Hot Start dNTPs have been validated for production of
Hot Start dNTP Handling amplicons up to 2 kb in length (see Chapter 8).
Hot Start dNTPs are similar to natural dNTPs and are stable 5. When using cDNA as the template, purify the product
in aqueous buffer at pH 8–10.5 and at –20 °C for at least one using a commercially-available clean-up kit to remove
year. When stored incorrectly, the major point for degradation unincorporated nucleotides. When using cDNA without
of both natural and Hot Start dNTPs is the triphosphate purification, this should be no more than 1/10th of the
chain. Much like natural dNTPs, extra care should be taken reaction volume of the PCR.
not to expose Hot Start dNTPs to prolonged temperatures 6. In multiplex reactions where four or more targets are
above –20 °C. to be amplified, the addition of KCl up to 100 mM final
Restrict exposure of the Hot Start dNTP stock solution to less concentration will improve results (see Chapter 8).
than 24 hours TOTAL at room temperature. Aliquot stocks to
avoid more than 20 freeze–thaw cycles. Equipment
1. The Hot Start dNTP Mix is provided as a concentrated 2 µM
• Pipettes dispensing volumes from <1 to 200 μL
or 10 µM solution of dATP, dCTP, dGTP and dTTP. The dNTP • Benchtop microcentrifuge
sets are provided as a 10 µmol solution of each individual • Thermal cycler
dNTP. The dNTPs can be diluted into a PCR buffer solution
and frozen at –20 °C in smaller aliquots to ensure stability Appropriate Analysis Equipment
for at least one year.
• Electrophoresis equipment
2. The dNTPs can be stored for up to 15 days at 4 °C as the
dNTP stock solution.
• UV transilluminator
3. Hot Start dNTPs should not be stored at room temperature.
• Alternative PCR product analysis system
They should be thawed at room temperature or on ice (not
by heating); mixed by vortexing and pulse centrifugation
and then stored on ice during PCR set-up or aliquoting
manipulations.

118 [Link]
Protocol 3: dNTP-Mediated Hot Start PCR
Supplies Table P3-4A. Reaction Master Mix Components for Hot Start dNTPs
Using Standard Cycling Conditions.
• Sterile filter pipette tips Volume (µL) per
• Sterile 1.5 mL screw-top microcentrifuge tubes Component Final Concentration Single 25 µL Reaction
(Sigma CLS430909) 10× PCR Buffer without MgCl2 1× 2.5
• PCR tubes and plates, select one of the following to match MgCl2 (25 mM) 2.5 mM 2.5
desired format: Forward Primer (10 µM) 20–500 nM 0.04 to 0.1
Reverse Primer (10 µM) 20–500 nM 0.04 to 0.1
• Individual thin-walled 200 µL PCR tubes Hot Start dNTP solution 0.4 mM 1
(Sigma Z374873 or P3114) Taq DNA polymerase 5 units/µL 0.05 units/µL 0.25
• Strip tubes, 200 µL (Sigma Z374962) PCR grade water Up to 20 µL

• 96-well plates (Sigma Z374903) Note: Cat. No. D4545 includes Taq DNA polymerase (D6677), 10× PCR buffer (P2317) and
25 mM MgCl2.
• 384-well plates (Sigma Z374911)
• CleanAmp™ dNTPs (Sigma DNTPCA2 or DNTPCA10). Table P3-4B. Reaction Master Mix Components for Hot Start dNTPs
Enzyme and compatible buffer, for example one of Using Fast Cycling Conditions.
the following: Volume (µL) per
• D4545 (Sigma) which is supplied with a 10× PCR buffer Component Final Concentration Single 25 µL Reaction
10× PCR Buffer without MgCl2 1× 2.5
and separate MgCl2
MgCl2 (25 mM) 4.0 mM 4
• D1806 (Sigma) which is supplied with a 10× PCR buffer Forward Primer (10 µM) 20–500 nM 0.04 to 0.1
containing MgCl2 Reverse Primer (10 µM) 20–500 nM 0.04 to 0.1
Hot Start dNTP solution 0.4 mM 1
Method Taq DNA polymerase 5 units/µL 0.20 units/µL 1
PCR grade water Up to 20 µL
1. With the exception of the Hot Start dNTPs and DNA
polymerase, thaw the reaction components, vortex to mix, Note: Cat. No. D4545 includes Taq DNA polymerase (D6677), 10× PCR buffer (P2317) and
25 mM MgCl2.
centrifuge briefly and store on ice.
2. Prepare Hot Start dNTPs: Table P3-4C. Reaction Master Mix Components for Hot Start dNTPs for
a. Thaw at room temperature or on ice. Muliplexed Reactions.
b. Vortex and pulse centrifuge to thoroughly mix. Volume (µL) per
Component Final Concentration Single 25 µL Reaction
c. If necessary, remove an aliquot of the stock solution
10× PCR Buffer without MgCl2 1× 2.5
and dilute with water or buffer (pH 8–10.5) to desired MgCl2 (25 mM) 2.5 mM 4
working concentration. Forward Primer (10 µM) 20–500 nM 0.04 to 0.1
3. Prepare a master mix containing all components except for Reverse Primer (10 µM) 20–500 nM 0.04 to 0.1
the DNA template sample. Add each of the components as Hot Start dNTP solution 0.4 mM 1
shown in Tables P3-4A, P3-4B or P3-4C (select appropriate Taq DNA polymerase 5 units/µL 0.05–0.10 units/ µL 0.25–0.5
experiment and cycling conditions; multiply amounts by PCR grade water Up to 20 µL
the number of reactions needed) in a microcentrifuge Note: Cat. No. D4545 includes Taq DNA polymerase (D6677), 10× PCR buffer (P2317) and
tube, on ice. 25 mM MgCl2.

4. Mix the master mix gently to protect the enzyme by


pipetting up and down (do not vortex). Pulse spin if
necessary.
5. Aliquot 20 µL of reaction master mix into each thin-walled
PCR tube.

PCR Technologies: A Technical Guide 119


Appendix A
6. Add 5 µL of the appropriate template DNA to each 20 µL
aliquot of master mix for a final reaction volume of 25 µL.
7. Cap, label and pulse spin PCR tubes. Collect reaction
solution at bottom of tube.
8. Place the tubes into a thermal cycler with a heated lid and
perform the appropriate cycling conditions (Tables P3-5A
and P3-5B).
Table P3-5A. PCR Cycling Conditions for Use with Hot Start dNTPs
Under Standard Cycling Conditions and for Multiplexing.
Hot Start dNTP Standard Cycling Conditions Temp (°C) Time
Initial Hot Start/denaturation 95 5 min
Steps 1–3 are repeated through 30–40 cycles
Step 1 95 10 sec
Step 2 48–60 1 to 30 sec
Step 3 72 30 sec to 2 min*
Final elongation 72 10 min

*Note: Dependent upon amplicon size: 30 sec for up to 500 bp. Add 1 min for each
additional 1 kb.

Table P3-5B. PCR Cycling Conditions for Use with Hot Start dNTPs
Under Fast Cycling Conditions.
Hot Start dNTP Fast Cycling Conditions Temp (°C) Time
Initial Hot Start/denaturation 98 5min
Steps 1–2 are repeated through 30–40 cycles
Step 1 95 5 sec
Step 2 65 5 sec

9. Analyze a 10 µL aliquot of the completed reaction by


agarose gel electrophoresis or alternative PCR analysis
system.

120 [Link]
Protocol 4: SYBR Green I Dye Quantitative PCR

Quantitative PCR Protocols


Although quantitative PCR uses the same basic concept as are generally smaller and are detected indirectly using an
traditional PCR, the reactions differ in that the amplicons additional dye or labeled probe or primer.

Protocol 4: SYBR Green I Dye Quantitative PCR


In Chapters 1–12 of this guide, the requisite components • Forward and reverse primers diluted to working
and quality control requirements for qPCR experiments concentration (10 µM working stocks):
were described in detail. With those in mind, the following • Custom oligos can be ordered at [Link]/oligos.
is a protocol that can be used as a basic template for qPCR
incorporating SYBR Green I DNA binding dye that is amenable • Predesigned gene expression primers are also available
to modification and applicable for use as validation for a set of for model organisms (KiCqStart® SYBR® Green Primers,
primers. Optimization of primer concentration and annealing KSPQ12012, [Link]/ksprimers).
temperature using SYBR Green I dye are described in further • Sterile filter pipette tips
detail in Protocols 13 and 14, respectively. • Sterile 1.5 mL screw-top microcentrifuge tubes
(Sigma CLS430909)
Equipment • PCR tubes and plates, select one to match desired format:
• Pipettes dispensing volumes from <1 to 200 μL • Individual thin-walled 200 µL PCR tubes
• Benchtop microcentrifuge (Sigma Z374873 or P3114)
• Quantitative PCR instrument • Plates
• Laminar flow hood for PCR set up (optional) - 96-well plates (Sigma Z374903)
- 384-well plates (Sigma Z374911)
Supplies • Plate seals
• DNA/cDNA template: First strand cDNA reaction diluted - ThermalSeal RTS™ Sealing Films (Sigma Z734438)
1:10 to detect a medium to highly expressed targets or
1:2 to 1:5 for rare transcripts. 10 ng to 100 ng gDNA. - ThermalSeal RT2RR™ Film (Sigma Z722553)
• KiCqStart® SYBR® Green ReadyMix™ (Sigma KCQS00/
KCQS01/KCQS02/KCQS03 – depending on instrument or
alternative qPCR SYBR Green Reaction Mix, refer to qPCR
selection tables (Tables P4-6A, P4-6B and P4-7).
• PCR grade water: PCR grade water (W1754 or W4502) as
20 mL aliquots; freeze; use a fresh aliquot for each reaction.

PCR Technologies: A Technical Guide 121


Appendix A
Table P4-6A. SYBR Green PCR Mix Selection Guide.
Hot Start ReadyMixes (Taq, Buffer, dNTPs, Reference Dye, MgCl2)
KiCqStart® SYBR® Green qPCR KiCqStart® SYBR® Green qPCR KiCqStart® SYBR® Green qPCR KiCqStart® SYBR® Green qPCR
ReadyMix™, ReadyMix™ Low Rox , ReadyMix™ with ROX, ReadyMix™ for iQ,
Cat. No. KCQS00 Cat. No. KCQS01 Cat. No. KCQS02 Cat. No. KCQS03
Compatible Instruments: Compatible Instruments: Compatible Instruments: Compatible Instruments:
• Bio-Rad CFX384™ • Applied Biosystems 7500 • Applied Biosystems 5700 • Bio-Rad iCycler iQ™
• Bio-Rad CFX96™ • Applied Biosystems 7500 • Applied Biosystems 7000 • Bio-Rad iQ™5
• Bio-Rad MiniOpticon™ • Fast Applied Biosystems ViiA 7 • Applied Biosystems 7300 • Bio-Rad MyiQ™
• Bio-Rad MyiQ™ • Stratagene Mx3000P® • Applied Biosystems 7700
• Bio-Rad/MJ Chromo4™ • Stratagene Mx3005P™ • Applied Biosystems 7900
• Bio-Rad/MJ Opticon 2 • Stratagene Mx4000™ • Applied Biosystems 7900 HT Fast
• Bio-Rad/MJ Opticon® • Applied Biosystems 7900HT
• Cepheid SmartCycler® • Applied Biosystems StepOnePlus™
• Eppendorf Mastercycler® ep realplex • Applied Biosystems StepOne™
• Eppendorf Mastercycler® ep realplex2 s
• Illumina Eco qPCR
• Qiagen/Corbett Rotor-Gene® 3000
• Qiagen/Corbett Rotor-Gene® 6000
• Qiagen/Corbett Rotor-Gene® Q
• Roche LightCycler® 480
Table P4-6B. Table P4-7. Reference Dye Concentration and Instrument
Hot Start ReadyMixes (Taq, Buffer, dNTPs, Reference Dye, MgCl2) Compatibility (when using qPCR reagents with a separate reference dye).
SYBR Green JumpStart Taq ReadyMix SYBR® Green JumpStart™ Taq ReadyMix™ for Final Reference µL of Reference Dye
for High Throughput qPCR Quantitative PCR, Capillary Formulation
Cat. No. S9194 Cat. No. S1816
Instrument Dye Concentration (per 20 µL Reaction)
Applied Biosystems 5700 1× 0.2
Compatible Instruments: Compatible Instruments:
• Applied Biosystems 5700 • Roche LightCycler® 480 Applied Biosystems 7000 1× 0.2

• Applied Biosystems 7000 Applied Biosystems 7300 1× 0.2

• Applied Biosystems 7300 Applied Biosystems 7500 0.1× 0.02

• Applied Biosystems 7700 Applied Biosystems 7500 Fast 0.1× 0.02

• Applied Biosystems 7900 Applied Biosystems 7700 1× 0.2

• Applied Biosystems 7900 HT Fast Applied Biosystems 7900 1× 0.2

• Applied Biosystems 7900HT Applied Biosystems 7900 HT Fast 1× 0.2

• Applied Biosystems StepOnePlus™ Applied Biosystems 7900HT 1× 0.2

• Applied Biosystems StepOne™ Applied Biosystems StepOnePlus™


Applied Biosystems StepOne™


0.2
0.2
Applied Biosystems ViiA 7 0.1× 0.2
Bio-Rad CFX384™ not used -
Bio-Rad CFX96™ not used -
Bio-Rad MiniOpticon™ not used -
Bio-Rad/MJ Chromo4™ not used -
Bio-Rad/MJ Opticon 2 not used -
Bio-Rad/MJ Opticon™ not used -
Cepheid SmartCycler® not used -
Eppendorf Mastercycler® ep realplex not used -
Eppendorf Mastercycler® ep realplex2 s not used -
Illumina Eco qPCR not used -
Qiagen/Corbett Rotor-Gene® 3000 not used -
Qiagen/Corbett Rotor-Gene® 6000 not used -
Qiagen/Corbett Rotor-Gene® Q not used -
Roche LightCycler® 480 not used -
Stratagene Mx3000P® 0.1X 0.02
Stratagene Mx3005P™ 0.1X 0.02
Stratagene Mx4000™ 0.1X 0.02

122 [Link]
Protocol 4: SYBR Green I Dye Quantitative PCR
Method 4. Setup reactions:
Assays run in KiCqStart ReadyMix are optimal when using a a. For NTC reactions, add 5 μL of water to the reaction
higher primer concentration than in conventional PCR. In the tubes.
protocols below, 450 nM final concentration is used. This has b. For experimental reactions, add 5 μL of cDNA/gDNA
been observed to be the optimal concentration for several solution to the reaction tubes.
independent assays. However some assays may benefit from c. Visually confirm that all tubes or wells contain sample at
further optimization and procedures for this are described in the bottom at the correct volume.
Protocols 13 and 14. d. Carefully aliquot 15 μL of reaction master mix into each
1. Place all reaction components on ice. qPCR tube or plate well.
2. Mix and briefly centrifuge to collect contents at the bottom e. Cap tubes or seal the PCR plate and label (according to
of the tube. instrument requirements). (Make sure the labeling does
3. Prepare sufficient master mix to run all samples in not obscure instrument excitation/detection light path.)
duplicate. f. Mix reactions well and spin if needed.
a. Include duplicate No Template Negative Controls (NTC). 5. Run samples according to the cycling protocol in
b. Calculate amount of reagents to mix. Add 10% volume Table P4‑9 and repeat the run of steps 1–3 for 40 cycles.
to allow for pipetting error. (Note: These conditions are specific for FAST cycling
protocols).
c. Mix well, avoiding bubbles.
Table P4-9. Fast PCR Cycling Conditions.
Table P4-8. Reaction Master Mix for KiCqStart Reagents. FAST Cycling Conditions Temp (°C) Time (sec)
Target Final Volume (µL) per Initial Hot Start/denaturation 95 30
Reagent Concentration Single 20 μL Reaction Steps 1–3 are repeated through 40 cycles
2× KiCqStart SYBR Green qPCR ReadyMix 1× 10 Step 1 95 5
Forward primer (10 µM stock) 0.45 µM 0.9 Step 2 58 15
Reverse primer (10 µM stock) 0.45 µM 0.9 Step 3 72 10
PCR grade water - 3.2
Note: Use standard dissociation curve protocol (data collection)

6. Refer to qPCR instrument manual and Chapter 10 for


guidance on data analysis.

PCR Technologies: A Technical Guide 123


Appendix A

Protocol 5: qPCR Using a Single Detection Probe


In Chapters 1–12 of this guide, the requisite components • Plate seals
and quality control requirements for qPCR experiments - ThermalSeal RTS™ Sealing Films (Sigma Z734438)
were described in detail. With those in mind, the following
- ThermalSeal RT2RR™ Film (Sigma Z722553)
is a protocol that can be used as a basic template for qPCR
incorporating a detection probe that is specific to a single
target. In these reactions, primers and probe are included at
Method
a final concentration of 200 nM and are run using LuminoCt® 1. Defrost all reaction components on ice, taking care to
ReadyMix™. Detailed optimization protocols for primer protect the probe from exposure to light.
concentration and annealing temperature are presented 2. Calculate the number of reactions required to enable
separately (see Protocols 13 and 14). samples and controls to be run in duplicate. Include two
No Template Controls (NTC).
Equipment 3. Prepare a master mix for all reactions according to
• Quantitative PCR instrument Table P5‑10 (calculate volumes for each reaction and
add 10% to allow for pipetting error). Mix well, avoiding
• Microcentrifuge bubbles.
• Laminar flow hood for PCR set up (optional)
Table P5-10. Master Mix for Single Probe qPCR.
Supplies Volume (µL) per Single
Reagent 20 μL Reaction
• DNA/cDNA template: cDNA reaction diluted 1:10 to detect 2× LuminoCt qPCR ReadyMix 10
a medium to highly expressed targets or 1:2 to 1:5 for rare
Forward primer (10 µM stock) 0.4
transcripts. 10 ng to 100 ng gDNA.
Reverse primer (10 µM stock) 0.4
• LuminoCt® ReadyMix™ (Sigma L6669) Probe (10 µM stock) 0.4

• PCR grade water: PCR grade water (W1754 or W4502) as PCR grade water 3.8

20 mL aliquots; freeze; use a fresh aliquot for each reaction.


4. Add 5 μL of water to the NTC reaction tubes.
• Forward and reverse primers diluted to working
5. Add 5 μL of cDNA/gDNA solution to the appropriate
concentration (10 µM working stocks are suitable for single
tubes/wells.
probe reactions but more concentrated stocks are needed
for multiplex). 6. Visually check that all tubes/wells contain sample at the
bottom at the correct volume.
• Specific target detection probe (see Chapter 10) diluted to
7. Aliquot 15 μL template master mix remaining from step 3
working concentration (10 µM working stocks are suitable
for single probe reactions but more concentrated stocks into the PCR tubes.
are needed for multiplex). 8. Cap tubes or seal the PCR plate and label (according to
instrument requirements). (Make sure the labeling does not
• Custom oligos can be ordered at [Link]/oligos.
obscure instrument excitation/detection light path.)
• Sterile filter pipette tips
9. Centrifuge briefly and visually check that all tubes/wells
• Sterile 1.5 mL screw-top microcentrifuge tubes contain sample at the bottom and at the correct volume.
(Sigma CLS430909)
10. Run samples according to the two-step protocol
• PCR tubes and plates, select one to match desired format: (Table P5‑11), repeating steps 1–2 through 40 cycles
• Individual thin-walled 200 µL PCR tubes (Note: These conditions are specific for FAST cycling
(Sigma Z374873 or P3114) protocols).
• Plates
- 96-well plates (Sigma Z374903)
- 384-well plates (Sigma Z374911)

124 [Link]
Protocol 5: qPCR Using a Single Detection Probe
11. Note: For reactions containing Scorpions® Probes or
Molecular Beacons, a three-step protocol (Table P5-12)
may result in more efficient/sensitive detection. When
adopting this protocol, the annealing temperature of
step 2 can be optimized (see Protocol 14). Cycle steps 1–3
through 40 cycles.
12. See Chapter 10 and the instrument manual for guidance
on data analysis.
Table P5-11. Fast PCR Cycling Conditions.
FAST Cycling Conditions Temp (°C) Time (sec)
Initial Hot Start/denaturation 95 30
Steps 1 and 2 are repeated through 40 cycles
Step 1 95 5
Step 2 60 30

Table P5-12. Three-step PCR Cycling Conditions for Use with


Scorpions® Probes or Molecular Beacons.
3-step Cycling Conditions (for Use with Scorpions®
Probes or Molecular Beacons) Temp (°C) Time (sec)
Initial denaturation 95 30
Steps 1–3 are repeated through 40 cycles
Step 1 95 5
Step 2 (select optimized Ta) 58 15
Step 3 72 10

PCR Technologies: A Technical Guide 125


Appendix A

Protocol 6: Multiplex qPCR


In Chapters 1–12 of this guide, the requisite components
and quality control requirements for qPCR experiments
Method
were described in detail. With those in mind, the following 1. Defrost all reaction components on ice, taking care to
is a protocol that can be used as a basic template for qPCR protect the probes from exposure to light.
incorporating up to four detection probes. In these reactions, 2. Calculate the number of reactions required to enable
primers and probe are included at a final concentration of samples and controls to be run in duplicate. Include two
200 nM and are run using LuminoCt® ReadyMix™ (Sigma). No Template Controls (NTC).
However multiplex experiments require optimization and it is 3. Prepare a probe blend and a primer blend using
advisable to test the assay combinations by adding each to the Tables P6‑13A and 13B as a guide. For reactions requiring
multiplex sequentially. A detailed assay optimization protocol 2 or 3 probes, adjust to the total volume (with PCR grade
for each single assay is described in Protocols 13 and 14. water). After optimizing primer concentration, adjust
primer concentrations/volumes accordingly. The volumes
Equipment stated in Tables P6‑13A and 13B are sufficient to run 250
• Quantitative PCR instrument reactions, scale up accordingly for more reactions.
• Microcentrifuge Table P6-13A. Volume Of Stock Probe to Blend for 200 nM Final
• Laminar flow hood for PCR set up (optional) Concentration in Each Reaction. Amend volumes in the blend following
optimization.
Supplies Probe (100 µM) Volume (µL)
• DNA/cDNA template: cDNA reaction diluted 1:10 to detect Target 1
Target 2
10
10
a medium to highly expressed targets or 1:2 to 1:5 for rare
Target 3 10
transcripts. 10 ng to 100 ng gDNA.
Target 4 10
• LuminoCt® ReadyMix™ (Sigma L6669). PCR grade water 60

• PCR grade water: PCR grade water (W1754 or W4502) as


20 mL aliquots; freeze; use a fresh aliquot for each reaction. Table P6-13B. Volume of Stock Primers to Blend for 200 nM Final
Concentration in Each Reaction. Amend volumes in the blend following
• Forward and reverse primers concentration stocks (100 µM
optimization.
working stocks are suitable for use in multiplex reactions).
Forward Primer Volume Reverse Primer Volume
• Specific target detection probes (see Chapter 6) (100 µM) (µL) (100 µM) (µL)
concentration stocks (100 µM working stocks are suitable Target 1 10 Target 1 10
for use in multiplex reactions). Target 2 10 Target 2 10
• Custom oligos can be ordered at [Link]/oligos. Target 3 10 Target 3 10

• Sterile filter pipette tips


Target 4
PCR grade water
10 Target 4 10
20
• Sterile 1.5 mL screw-top microcentrifuge tubes
(Sigma CLS430909) 4. Prepare a master mix for all reactions according to
Table P6‑14 (calculate volumes for each reaction
• PCR tubes and plates, select one to match desired format:
and add 10% to allow for pipetting error). Mix well,
• Individual thin-walled 200 µL PCR tubes avoiding bubbles.
(Sigma Z374873 or P3114)
Table P6-14. Master Mix for Mulitplex Probe qPCR.
• Plates
Volume (µL) per
- 96-well plates (Sigma Z374903) Reagent Single 20 μL Reaction
- 384-well plates (Sigma Z374911) 2× LuminoCt qPCR ReadyMix 10

• Plate seals Probe Mix (Table P6-13A) 0.4


Primer mix (Table P6-13B) 0.4
- ThermalSeal RTS™ Sealing Films (Sigma Z734438) PCR grade water 4.2
- ThermalSeal RT2RR™ Film (Sigma Z722553)

126 [Link]
Protocol 6: Multiplex qPCR
5. Add 5 μL of water to the NTC reaction tubes.
6. Add 5 μL of cDNA/gDNA solution to the appropriate
tubes/wells.
7. Aliquot 15 μL template master mix remaining from step 4
into the PCR tubes.
8. Cap tubes or seal the PCR plate and label (according to
instrument requirements). (Make sure the labeling does not
obscure instrument excitation/detection light path.)
9. Centrifuge briefly and visually check that all tubes/wells
contain sample at the bottom at the correct volume.
10. Run samples according to the two-step protocol
(Table P6‑15), repeating steps 1–2 through 40 cycles.
(Note: These conditions are specific for FAST cycling
protocols).
11. For reactions containing Scorpions® Probes or Molecular
Beacons, a three-step protocol (Table P6‑16) may result
in more efficient/sensitive detection. When adopting this
protocol, the annealing temperature of step 2 can be
optimized. Cycle steps 1–3 through 40 cycles.
Table P6-15. Fast PCR Cycling Conditions.
FAST Cycling Conditions Temp (°C) Time (sec)
Initial Hot Start/denaturation 95 30
Steps 1–2 are repeated through 40 cycles
Step 1 95 5
Step 2 60 30

Table P6-16. Three-step PCR Cycling Conditions for use with


Scorpions® Probes or Molecular Beacons.
3-Step Cycling Conditions (for Use with Scorpions®
Probes or Molecular Beacons) Temp (°C) Time (sec)
Initial denaturation 95 30
Steps 1–3 are repeated through 40 cycles
Step 1 Denature 95 5
Step 2 Anneal (select optimized Ta) 58 15
Step 3 Extend 72 10

PCR Technologies: A Technical Guide 127


Appendix A

Protocol 7: dPCR
dPCR is a relatively new technology and each platform and
application has specific requirements (see Chapter 4 for
Sample Requirements
further details). The protocols are specific for each system • Template Quality: Template should be high quality purified
and are provided, with excellent support, by the instrument gDNA free from inhibitors. It is recommended to digest
manufacturers. Therefore, the information provided below is template gDNA with appropriate restriction endonucleases
a starting point from which specific assays can be developed (1 µg DNA/40 µL reactions) and heat inactivate enzymes
or optimized. after digestion at 65 °C for 20 minutes. Following heat
inactivation, the template DNA should be diluted at least
Bio-Rad QX100 System 7.5× to ensure proper template partitioning.

The Bio-Rad digital droplet system is based on oil • Template Quantity: The amount of template to be
emulsification technology and uses a standard 96-well plate included in each experiment depends on the relative
format. Each sample is partitioned into 20,000 reactions, abundance of the target gene and the amount of droplets
yielding a total of 1.9 million reactions per plate. Reactions are partitioned. The Bio-Rad ddPCR system partitions reactions
set up using Dual-Labeled Probes containing a 5’ fluorescent into 20,000 droplets and it is therefore recommended to
label and a 3’ quencher, standard to qPCR reactions. The use 100 ng gDNA in a 20 µL reaction when the target gene
droplet reader is capable of reading end-point fluorescent is represented by a single copy. It may be necessary to
signals in the FAM and HEX channels allowing reactions to be reduce input DNA in cases where the target gene exceeds
multiplexed with 2 targets per sample. 8 copies per diploid sample.
[Link]
Requirements literature/bulletin_6277.pdf
• QX100 Droplet Generator (186-3002; Bio-Rad) Standard Protocol
• QX100 Droplet Reader (186-3003; Bio-Rad) A 20× primer/probe mix is prepared as described below. The
• C100 Touch Thermal Cycler with 96-well Fast Reaction standard ddPCR master mix is a 25 µL mix that includes the
Module (185-1196; Bio-Rad) aforementioned primer/probe mix, template DNA and 2×
• Semi skirted 96-well PCR plate (Eppendorf Cat# 951020362) ddPCR super mix.
• Bio-Rad 2× ddPCR supermix (186-3010; Bio-Rad) Table P7-17. dPCR Primer and Probe Mix.
• Droplet generation oil (186-3005; Bio-Rad) 20× Primer/Probe Mix Volume (μL) per 100 μL
• Cartridge holder (186-3051; Bio-Rad) 100 µM F1 primer 10
100 µM R1 primer 10
• 8-chamber cartridges (186-3008; Bio-Rad) 100 µM labeled probe 5
• Rubber gaskets (placed over cartridge to create vacuum PCR grade water 75
seal; 186-3009; Bio-Rad)
• Pierceable foil heat seal (181-4040; Bio-Rad) Table P7-18. dPCR Reaction Master Mix.
• Primers and probes(100 μM stocks): Available from Volume (μL) per Single
[Link]/oligos Reagent 25 μL Reaction
2× ddPCR super mix 12.5
20× Primer/Probe Mix 1.25
Template (100 ng/µL) 1
PCR grade water 10.25

128 [Link]
Protocol 7: dPCR
Samples are loaded into an 8 chamber cartridge using 20 µL
of the prepared qPCR sample followed by 70 µL of droplet
generation oil in the adjacent wells. A rubber gasket is
stretched across the top of the chambers to ensure a vacuum
seal. Each 8 chamber cartridge is loaded onto the QX100
droplet generator producing 20,000 droplets per sample.
Using a 50 µL multichannel pipette, 40 µL of the generated
droplets are transferred to a 96-well plate and heat sealed
with pierceable foil. The plate is placed in a thermal cycler
using standard 2-step qPCR thermal cycling conditions with
a 50% (3 °C/sec) ramp rate. Prior to running thermal cycling
conditions, it is recommended to test new primer/probe
sets using a temperature gradient to optimize the anneal/
extend temperature.

Table P7-19. dPCR Cycling Conditions.


dPCR Cycling Conditions Temp (°C) Time (sec)
Initial Hot Start/denaturation 95 600
Steps 1–2 are repeated through 40 cycles
Step 1 94 30
Step 2 60 60
Step 3 98 600
Step 4 12 infinity

Following thermal cycling, the plate is loaded onto the QX100


droplet reader and end-point reactions are analyzed using
Quantasoft™ software.
[Link]
bulletin_6277.pdf

PCR Technologies: A Technical Guide 129


Appendix A

Protocol 8: The SPUD Assay for Detection of Assay Inhibitors


The SPUD assay is one option for identification of inhibitors
that may be present in RNA or DNA samples. The assay is
Reagents
particularly useful when a large number of samples are to be • cDNA/gDNA (or other sample for inhibitor test) diluted
analyzed or when targets are present at low copy number as for use in qPCR (usually 1:10). For the purposes of the
making dilution of the sample impractical. The test is used following example protocol, cDNA is referred to as the
to avoid false negatives and to lend greater confidence to test sample. However, any material may be monitored for
reporting of data based on a negative result. inhibitory compounds. In this example, the amplification is
monitored using SYBR Green I detection but a probe may
The SPUD assay consists of an artificial template and two be used as an alternative (listed as optional probe) and the
primers that are specific to the template and is run in the reagents should be amended to a suitable probe detection
presence of SYBR® Green I dye or a template specific probe. master mix (e.g., LuminoCt qPCR ReadyMix, Sigma L6669).
During the assay, the SPUD template is amplified, resulting in
a characteristic Cq. Alongside this control reaction, the artificial • KiCqStart SYBR Green I ReadyMix (Sigma KCQS00/KCQS01/
template is spiked into samples and measured in comparison KCQS02/KCQS03—see Table P4-6A to select appropriate
to the control. In the presence of a clean sample, the Cq will reagents for the instrument) or LuminoCt qPCR ReadyMix
remain the same as the SPUD control whereas in the presence (Sigma L6669) if a probe is used for detection.
of a contaminated sample, the Cq will shift to higher cycles. • PCR grade water: PCR grade water (W1754 or W4502) as
20 mL aliquots; freeze; use a fresh aliquot for each reaction.
Equipment • Forward and Reverse primers for SPUD assay (stock at
• Quantitative PCR instrument 10 μM; see Table P8-20). Optional SPUD probe FAM-
TGCACAAGCTATGGAACACCACGT-BHQ1 for use with a
• Microcentrifuge probe compatible LuminoCt® ReadyMix™ (Sigma L6669).
• Laminar flow hood for PCR set up (optional) • SPUD template oligo diluted to approximately 20,000
copies/μL from a stock concentration of 100 μM: Dilute
Supplies 100 μM through 1:10 dilution series and test the 6th to
• Sterile filter pipette tips 10th dilution for the concentration that yields a Cq of
• Sterile 1.5 mL screw-top microcentrifuge tubes approximately 25. Dilute template from a 1:1,000× stock for
(Sigma CLS430909) each test.
• PCR tubes and plates, select one to match desired format: Table P8-20. SPUD Assay Oligo Sequences.
• Individual thin-walled 200 µL PCR tubes Primer Sequence (5’-3’)
(Sigma Z374873 or P3114) SPUD Template AACTTGGCTTTAATGGACCTCCAATTTTGAGTGTGCACAAGCTATGGAA
CACCACGTAAGACATAAAACGGCCACATATGGTGCCATGTAAGGATGAATGT
• Plates
SPUD Forward AACTTGGCTTTAATGGACCTCCA
- 96-well plates (Sigma Z374903) SPUD Reverse ACATTCATCCTTACATGGCACCA
- 384-well plates (Sigma Z374911)
• Plate seals
- ThermalSeal RTS™ Sealing Films (Sigma Z734438)
- ThermalSeal RT2RR™ Film (Sigma Z722553)

130 [Link]
Protocol 8: The SPUD Assay for Detection of Assay Inhibitors
Method
1. Place all reaction components on ice.
2. Mix and then centrifuge briefly to collect contents at the
bottom of the tube.
3. Determine the total number of samples to be tested in
duplicate and also allow for two No Test Sample Controls.
4. Prepare master mix for all samples and controls according
to Table P8-21 allowing 10% extra to allow for pipetting
error. Mix well.
Table P8-21. qPCR Master Mix for SPUD Inhibitor Test.
Volume (µL) per
Reagent Single 25 μL Reaction
2× KiCqStart ReadyMix 12.5
SPUD Primer F (10 μM stock) 0.25
SPUD Primer R (10 μM stock) 0.25
SPUD template (pre diluted to 20,000 copies/µL) 1
Reference dye (instrument specific, see Table P4-7) 1
PCR grade water 5

5. Aliquot 20 μL of SPUD qPCR master mix into the sample


tubes/wells. If using a PCR plate, follow a plate schematic to
ensure that the reagents, samples and controls are added
to the right wells.
6. Aliquot 5 μL cDNA sample into qPCR tubes/wells and 5 μL
water to the No Test Sample Control tubes/wells.
7. Cap tubes or seal the PCR plate and label. (Make sure the
labeling does not obscure instrument excitation/detection
light path.)
8. Run samples using the two-step protocol provided below,
repeating steps 1–2 for 40 cycles.
Table P8-22. qPCR Cycling Conditions for SPUD Inhibitor Test.
Cycling Conditions Temp (°C) Time (sec)
Initial Hot Start/denaturation 95 30
Steps 1–2 are repeated through 40 cycles
Step 1 95 5
Step 2 60 20

Note: Use standards dissociation curve protocol (data collection)

PCR Technologies: A Technical Guide 131


Appendix A

Protocol 9: The 3’/5’ Assay for Analysis of RNA Integrity


The 3’/5’ integrity assay is a potential first step in the • Plate seals
identification of RNA degradation. The assay is particularly - ThermalSeal RTS™ Sealing Films (Sigma Z734438)
useful when a large number of samples are to be analyzed or
- ThermalSeal RT2RR™ Film (Sigma Z722553)
when the degradation is less than that detected by capillary
systems but still sufficient to effect qPCR analyses. • cDNA generated using an Oligo-dT method diluted 1:10
(see Protocol 10, Reverse Transcription).
One or more target RNA sequences are selected, and in this
example GAPDH is used9. Two assays are designed along • 3’ and 5’ assay forward and reverse primers for target gene
the length of the target such that one is located close to the (human GAPDH sequences are used as an example) at
3’ UTR and the second is approximately 1 kb upstream. cDNA 50 μM (Table P9-23).
is generated using reverse transcription from an anchored • 3’ and 5’ Amplicon specific probes at 10 μM (Table P9-23).
oligo-dT primer. Following amplification by qPCR, the products
Table P9-23. Oligonucleotide Sequences for 3’/5’ Assay Using Human
from each assay are quantified and the ratio of the quantities
GAPDH as an Example.
is compared to that derived from a sample using high quality
RNA. Degradation of the template results in a relative decrease Primer/Probe Sequence
in product, especially with assays near the 5’ end of the target GAPDH 5’ Forward GTGAACCATGAGAAGTATGACAAC
GAPDH 5’ Reverse CATGAGTCCTTCCACGATACC
gene. This results in an increase in the 3’/5’ ratio.
GAPDH 3’ Forward AGTCCCTGCCACACTCAG
In the following test, the optimized conditions for the example GAPDH 3’ Reverse TACTTTATTGATGGTACATGACAAGG
assays are provided. It may be necessary to alter these GAPDH 5’ Probe [FAM]CCTCAAGATCATCAGCAATGCCTCCTG[BHQ1]
conditions following optimization of assays to the targets GAPDH 3’ Probe [JOE] or [HEX] — instrument specific
CCCACCACACTGAATCTCCCCTCCT[BHQ1]
that are more appropriate for the experiment (see Chapter 9
and Protocols 13 and 14 that describe the process of assay
optimization and validation). Method
1. Place all the reaction components on ice to defrost.
Equipment 2. Mix and then centrifuge briefly to collect contents at the
• Quantitative PCR instrument bottom of the tube.
• Laminar flow hood for PCR set up (optional) 3. Calculate the number of reactions required, running
two reactions per test sample and also two No Template
Reagents Controls (NTC). Calculating the requirements for the
• cDNA prepared using anchored oligo-dT (Sigma O4387) number of reactions plus 10% extra to allow for pipetting
priming (Sigma HSRT100 or STR1). error (Table P9-24).
• LuminoCt ReadyMix for Quantitative PCR (Sigma L6669). 4. Prepare master mix that is sufficient for all samples and
controls according to Table P9-24. Mix well and centrifuge
• PCR grade water: PCR grade water (W1754 or W4502) as
briefly to collect contents at the bottom of the tube.
20 mL aliquots; freeze; use a fresh aliquot for each reaction.
Table P9-24. qPCR Master Mix for the 3’/5’ Integrity Assay.
Supplies Volume (µL) per Single
• Sterile filter pipette tips Reagents 25 μL Reaction
• Sterile 1.5 mL screw-top microcentrifuge tubes 2× LuminoCt ReadyMix
Primer 3’ F (50 μM stock)
12.5
0.15
(Sigma CLS430909)
Primer 3’ R (50 μM stock) 0.15
• PCR tubes and plates, select one to match desired format: Primer 5’ F (50 μM stock) 0.15
• Individual thin-walled 200 µL PCR tubes Primer 5’ R (50 μM stock) 0.15

(Sigma Z374873 or P3114) Probe 3’ (10 μM stock) 0.5


Probe 5’ (10 μM stock) 0.5
• Plates Reference dye (optional) 1.0
- 96-well plates (Sigma Z374903) PCR grade water 4.9

- 384-well plates (Sigma Z374911)

132 [Link]
Protocol 9: The 3’/5’ Assay for Analysis of RNA Integrity
5. Aliquot 20 μL of qPCR master mix into the PCR tubes/wells.
If using a PCR plate, follow a plate schematic to ensure that
the reagents and controls are added to the correct wells.
6. Add 5 μL cDNA sample into qPCR tubes/wells.
7. Cap tubes or seal the PCR plate and label. (Make sure the
labeling does not obscure instrument excitation/detection
light path.)
8. Samples should be run according to the three-step
protocol provided in Table P9-25. Following the initial hot
start, steps 1–3 are repeated through 40 cycles.
Note: The conditions on Table P9-25 are optimal for the
human GAPDH example assay given. However it may be
appropriate to run alternative assays using the two-step
protocol as described in Table P5-11, Protocol 5.

Table P9-25. qPCR Cycling Conditions for the 3’/5’ Integrity Assay.
Cycling Conditions Temp (°C) Time (sec)
Initial Hot Start/denaturation 95 30
Steps 1–3 are repeated through 40 cycles
Step 1 95 5
Step 2 55 15
Step 3 72 10

PCR Technologies: A Technical Guide 133


Appendix A

Reverse Transcription
Reverse transcription (RT) is the process of converting RNA to The following experiments can be used as basic RT protocols
cDNA using a reverse transcriptase enzyme and dNTPs. that can be modified to suit particular requirements. It is
customary to either prepare cDNA using a two-step process
The RT step may be performed on total RNA such that a global
with subsequent dilution of the cDNA prior to adding it to
cDNA is produced that is representative of all of the RNA
the PCR/qPCR, or to prepare a one-step reaction where both
transcripts in the sample (usually via a two-step protocol), or in
processes are carried out sequentially.
a gene-specific approach such that only the RNA of interest is
converted to cDNA (usually following a one-step protocol).

Protocol 10: Standard Reverse Transcription Protocol (Two-step)


Equipment Reaction
• Standard PCR instrument or heating block 1. Determine the number of reactions required, including
controls. Calculate the volumes of each component
• Laminar flow hood for RT set up (optional) required for all reactions (allow 10% extra for pipetting
errors) and combine reagents according to Table P10-26
Reagents using 0.2 mL tubes or a 96-well plate sitting on ice. If using
• RNA (stock solution approximately 1 μg/μL). a PCR plate, follow a plate schematic to ensure that the
• ReadyScript® two-step cDNA synthesis kit (Sigma RDRT). reagents are added to the correct wells.
Alternative reverse transcription kits can also be used in Table P10-26. ReadyScript® cDNA Synthesis Reaction Master Mix.
conjunction with oligo-dT primers and/or random primers.
Volume (µL) per
• PCR grade water: PCR grade water (W1754 or W4502) as Reagent Single 20 μL Reaction
20 mL aliquots; freeze; use a fresh aliquot for each reaction. ReadyScript® cDNA Synthesis Mix (5× RT blend) 4
Total RNA template—variable (1 μg to 10 pg) 1
Supplies PCR grade water 15

• Sterile filter pipette tips 2. After sealing each reaction, vortex gently to mix contents.
• Sterile 1.5 mL screw-top microcentrifuge tubes Centrifuge briefly to collect components at the bottom of
(Sigma CLS430909) the reaction tube.
• PCR tubes and plates, select one to match desired format: 3. Incubate reaction mix according to Table P10-27.
• Individual thin-walled 200 µL PCR tubes Table P10.27. ReadyScript® cDNA Synthesis Reaction Temperature
(Sigma Z374873 or P3114) Incubation Profile.
• Plates Temperature (°C) Time (min)
- 96-well plates (Sigma Z374903) 25 5
42 30
- 384-well plates (Sigma Z374911)
85 5
• Plate seals or caps 4 Hold
- ThermalSeal RTS™ Sealing Films (Sigma Z734438)
4. After completion of cDNA synthesis, use 1:5 to 1:10 of the
- ThermalSeal RT2RR™ Film (Sigma Z722553)
first-strand reaction (2–4 μL) for PCR amplification.
Method Note: when using ReadyScript® reagents, 2–4 μL undiluted
cDNA can be added to PCR without causing inhibition.
Preparation If desired, cDNA product can be diluted with 10 mM Tris-
1. Place ReadyScript® kit components and RNA samples HCl (pH 8.0), 0.1 mM EDTA and stored at –20 °C.
on ice.
2. Mix and then centrifuge briefly to collect contents at the
bottom of the tube.

134 [Link]
Protocol 11: Reverse Transcription Protocol (One-step SYBR Green I Dye Detection)

Protocol 11: Reverse Transcription Protocol (One-step


SYBR Green I Dye Detection)
Equipment 3. Prepare a master mix for each reaction and control
requiring RT enzyme plus 10% extra to allow for pipetting
• Quantitative PCR instrument error according to Table P11-28.
• Laminar flow hood for RT-qPCR set up (optional) 4. Prepare a master mix for each control requiring NO RT
enzyme plus 10% extra to allow for pipetting error referring
Reagents to Table P11-28 but replacing the enzyme with PCR
• RNA (stock approximately 1 μg/μL) grade water.
• SYBR Green Quantitative RT-PCR kit (Sigma QR0100) Table P11-28. Reaction Master Mix for One-step SYBR Green I RT-PCR.
• PCR grade water: PCR grade water (W1754 or W4502) as Volume (µL) per
20 mL aliquots; freeze; use a fresh aliquot for each reaction. Reagents Single 25 μL Reaction
• Forward and reverse PCR primers at 10 µM working stocks: 2× SYBR Green Quantitative RT-PCR Buffer, Sigma QR0100
Reference dye (optional) Instrument-specific, see Table P4-7
12.5
0.025
• Custom oligos can be ordered at [Link]/oligos. Primer F (10 μM) 1.125
Primer R (10 μM) 1.125
Supplies PCR grade water 9.1

• Sterile filter pipette tips MMLV RT enzyme 0.125

• Sterile 1.5 mL screw-top microcentrifuge tubes 5. Add 1 μL total RNA (250–2500 ng total per reaction)
(Sigma CLS430909) to each PCR tube. If using a PCR plate, follow a plate
• PCR tubes and plates, select one to match desired format: schematic to ensure that the reaction mix, samples and
• Individual thin-walled 200 µL PCR tubes controls are added to the correct wells.
(Sigma Z374873 or P3114) 6. Add 24 μL master mix to each well, adding the No RT mix
to the minus RT control samples.
• Plates
7. After sealing each reaction or the plate, vortex gently to
- 96-well plates (Sigma Z374903)
mix contents.
- 384-well plates (Sigma Z374911)
8. Centrifuge briefly to collect components at the bottom of
• Plate seals the reaction tubes.
- ThermalSeal RTS™ Sealing Films (Sigma Z734438) 9. Set the real-time qPCR according to Table P11-29.
- ThermalSeal RT2RR™ Film (Sigma Z722553)
Table P11-29. RT PCR Cycling Parameters for One-step SYBR Green I
Method RT-qPCR.
Cycling Conditions Temp (°C) Time
In the example given below, the primer concentrations can be
First strand synthesis 42–44 30 min
adjusted according to the results of optimization procedures Denaturation/RT inactivation 94 30 sec
(see Protocols 13 and 14 and Chapter 9). Steps 1–3 are repeated through 40 cycles
1. Place kit components and RNA samples on ice. Step 1 95 5 sec
Step 2 55 15 sec
2. Mix and then centrifuge briefly to collect contents at the
Step 3 72 10 sec
bottom of the tube.
10. Run post-reaction melt analysis.

PCR Technologies: A Technical Guide 135


Appendix A

Protocol 12: Reverse Transcription Protocol (One-step


Probe Detection)
In some cases it is preferable to measure the target transcript
directly, without preparing cDNA from the entire RNA sample.
Method
Such situations may include measurements on highly 1. Place kit components and RNA samples on ice.
degraded RNA or when there is limiting sample. 2. Mix and then centrifuge briefly to collect contents at the
bottom of the tube.
Equipment 3. Refer to Table P12-30 to prepare a master mix that is
• Quantitative PCR instrument sufficient to analyze each sample and controls in duplicate
plus prepare 10% extra to allow for pipetting error.
• Laminar flow hood for PCR set up (optional)
4. Refer to Table P12-30 to prepare a master mix that is
Reagents sufficient to analyze the NO RT enzyme samples and
controls in duplicate plus prepare 10% extra to allow for
• RNA (Stock, approximately 1 μg/μL) pipetting error, replacing the RT enzyme with PCR grade
• Quantitative RT-PCR Ready Mix (Sigma QR0200) water.
• PCR grade water: PCR grade water (W1754 or W4502) as Table P12-30. Reaction Master Mix for One-step Reverse
20 mL aliquots; freeze; use a fresh aliquot for each reaction. Transcription, Probe Detection.
• Forward and reverse primers concentration stocks (10 µM Volume (µL) per
working stocks are suitable for use in single reactions Reagent Single 25 μL Reaction
whereas 100 µM working stocks are suitable for use in Quantitative RT-PCR 2X Buffer, Cat. No. QR0200 12.5
multiplex reactions). Ref dye (optional). Instrument specific, see Table P4-7. 0.025

• Specific target detection probes (see Chapter 6) *Primer F (10 μM)


*Primer R (10 μM)
1.125
1.125
concentrated stocks (10 µM working stocks are suitable for
*Probe (10 μM) 0.625
use in single reactions whereas 100 µM working stocks are
PCR grade water 8.475
suitable for use in multiplex reactions).
MMLV RT enzyme 0.125
• Custom oligos can be ordered at [Link]/oligos.
*The primer and probe concentrations given are suitable for an entry test of the assay but should
be adjusted according to the results of optimization.
Supplies
5. Add 1 μL RNA (250-2500ng) to each reaction tube,
• Sterile filter pipette tips replacing with water for No Template Controls.
• Sterile 1.5 mL screw-top microcentrifuge tubes 6. Add 24 μL appropriate reaction master mix (from steps 3
(Sigma CLS430909) and 4) to each well. If using a PCR plate, follow a plate
• PCR tubes and plates, select one to match desired format: schematic to ensure that the reaction mix, samples and
• Individual thin-walled 200 µL PCR tubes controls are added to the correct wells.
(Sigma Z374873 or P3114) 7. After sealing each reaction, vortex gently to mix contents.
• Plates Centrifuge briefly to collect components at the bottom of
the reaction tube.
- 96-well plates (Sigma Z374903)
8. Set the real time qPCR instrument program according to
- 384-well plates (Sigma Z374911) Table P12-31.
• Plate seals
Table P12-31. PCR Conditions for One-step RT-qPCR.
- ThermalSeal RTS™ Sealing Films (Sigma Z734438)
Cycling Conditions Temp (°C) Time
- ThermalSeal RT2RR™ Film (Sigma Z722553) First Strand Synthesis 42-44 30 min
Denaturation/RT inactivation 94 30 sec
Steps 1–3 are repeated through 40 cycles
Step 1 94 5 sec
Step 2 55 15 sec
Step 3 72 10 sec

136 [Link]
Protocol 13: Primer Concentration Optimization

Optimization of qPCR Conditions


Optimization of qPCR conditions is important for the as well as inefficient and insensitive assays. The two main
development of a robust assay. Indications of poor approaches are optimization of primer concentration and/or
optimization are a lack of reproducibility between replicates annealing temperatures.

Protocol 13: Primer Concentration Optimization


One approach to optimizing primer concentrations is to create Notes for this Protocol
a matrix of reactions. This is used to test a range of concentra-
tions for each primer against different concentrations of the
• cDNA is generated using a random primer or oligo-dT
priming method and diluted 1:10 for use, but any suitable,
partner primer. In the example provided in this protocol, a
alternative template may be used.
6×6 matrix testing six concentrations (e.g., 50 nM to 800 nM) is
demonstrated. The quantities stated in this protocol will allow • All samples are run in duplicate according to the plate
each condition to be run in duplicate. layout (Figure P13-18).
Forward Primer (nM)
Equipment 50 100 200 400 600 800

Reverse Primer (nM)


• Quantitative PCR instrument 50
100
• Laminar flow hood for PCR set up (optional) 200

Reagents 400
600
• Suitable assay template, e.g., cDNA diluted 1:10, gDNA, or 800
synthetic oligo template. NTC
• KiCqStart SYBR® Green ReadyMix™ (Sigma KCQS00/ Figure P13-18. Schematic Representation of the Primer Optimization Plate Layout.
KCQS01/KCQS02/KCQS03—depending on instrument, see
Table P4-6 for instrument compatibility).
Method
• PCR grade water: PCR grade water (W1754 or W4502) as
Note: 2.0 μL of each primer will be added to the reaction
20 mL aliquots; freeze; use a fresh aliquot for each reaction.
of 20 μL total volume. For this reason, primer stocks are 10
• Forward and reverse primers concentration stocks (10 µM times the required concentration to achieve the desired final
working stocks). concentration.
• Custom oligos can be ordered at [Link]/oligos. 1. Using the 10 μM primer stock, make a dilution of both
primer stocks to 0.5, 1, 2, 4, 6 and 8 μM as shown in
Supplies Table P13-32.
• Sterile filter pipette tips Table P13-32. Primer Dilution Scheme for Primer Concentration
• Sterile 1.5 mL screw-top microcentrifuge tubes Optimization.
(Sigma CLS430909)
Final Volume (μL) Volume (μL) Total
• PCR tubes and plates, select one to match desired format: Concentration (μM) H2O 10 μM Stock Volume (μL)
0.5 47.5 2.5 50
• Individual thin-walled 200 µL PCR tubes
1 45 5 50
(Sigma Z374873 or P3114)
2 40 10 50
• Plates 4 30 20 50
- 96-well plates (Sigma Z374903) 6 20 30 50
8 20 80 100
- 384-well plates (Sigma Z374911)
• Plate seals 2. Prepare a qPCR master mix according to Table P13-33
- ThermalSeal RTS™ Sealing Films (Sigma Z734438) (Note: Template and cDNA are added separately in step 5).
Mix well.
- ThermalSeal RT2RR™ Film (Sigma Z722553)

PCR Technologies: A Technical Guide 137


Appendix A
Table P13-33. Reaction Master Mix for Primer Concentration
Optimization.
Volume (µL) per Volume (µL) for
Reagents Single 20 μL Reaction Whole Plate
(84+10% pipetting error)
2× KiCqStart SYBR® Green qPCR 10 924
ReadyMix
PCR grade water 3 277.2
Reference dye (Optional) 1 92.4
Template, e.g., cDNA 2 *
(diluted 1:5 to 1:10 of stock)
Forward primer 2 *
Reverse primer 2 *

*Note: Do not add cDNA and primers until step 5.

3. Remove 184.8 μL (for 12× NTC) of master mix from step 2


into a separate tube to use for setting up the No Template
Control (NTC).
4. Add 26.4 μL of dH2O to the NTC mix in step 3 (to replace
template).
Note: Set NTC mix on ice for later use.
5. Add 158.4 μL of cDNA template to the remaining master
mix from step 2. Set master mix on ice.
6. Add 2.0 μL of appropriate reverse primer dilutions into the
PCR plate according to Figure P13-18; also adding 800 nM
concentration to the NTC row.
7. Add 2.0 μL of appropriate forward primer dilutions into the
PCR plate according to Figure P13-18.
8. Aliquot 16 μL master mix from step 5 into the PCR plate in
the wells corresponding to test positions.
9. Aliquot 16 μL master mix from step 4 into the PCR plate for
NTC reactions.
10. Seal plates and label. (Make sure labeling does not obscure
instrument excitation/detection light path).
11. Run samples according to the two-step protocol in
Table P13-34. Steps 1 and 2 are repeated through 40 cycles
and followed by a dissociation curve analysis.
Table P13-34. PCR Cycling Conditions for Primer Concentration
Optimization.
Cycling Conditions Temp (°C) Time (sec)
Initial denaturation/Hot Start 95 30
Steps 1–2 are repeated through 40 Cycles
Step 1 95 5
Step 2 60 30

Note: Use standard dissociation curve protocol (data collection).

138 [Link]
Protocol 14: Primer Optimization Using Temperature Gradient

Protocol 14: Primer Optimization Using Temperature Gradient


One approach to assay optimization is to determine the • Plates
optimum annealing temperature (Ta) of the primers by testing - 96-well plates (Sigma Z374903)
identical reactions containing a fixed primer concentration,
- 384-well plates (Sigma Z374911)
across a range of annealing temperatures. This can be
achieved if a qPCR instrument with a temperature gradient • Plate seals
block is available. In the format presented in this protocol, - ThermalSeal RTS™ Sealing Films (Sigma Z734438)
primers are included at a final concentration of 450 nM, and - ThermalSeal RT2RR™ Film (Sigma Z722553)
the gradient is orientated across the X axis of the block such
that all columns are subjected to the same Ta (i.e., 12 different Notes for this Protocol
temperatures). In other instruments, the gradient is down the • cDNA is generated using random priming or oligo-dT
column such that all rows have the same Ta (i.e., 8 different priming method and diluted 1:10 for use, but any suitable,
temperatures). The following protocol can be applied to either, alternative template may be used.
albeit after minor modifications.
• All reactions are run in duplicate as technical replicates.
Equipment • If using a PCR plate, follow a plate schematic (e.g., shown
in Figure P14-19) to ensure that the reaction mix, samples
• Quantitative PCR instrument with integrated gradient and controls are added to the correct wells.
block control function
• Laminar flow hood for PCR set up (optional) Method
1. Prepare a master mix for 56 reactions according to
Reagents Table P14-35. Mix well, avoiding bubbles.
• cDNA diluted 1:5-1:10, gDNA 10ng, synthetic oligo (10,000 Table P14-35. Reaction Master Mix for Ta Optimization.
copies) or other suitable template for optimization.
Volume (µL) per Volume (µL) for
• KiCqStart SYBR® Green ReadyMix™ (Sigma KCQS00/
Reagents Single 20 μL Reaction 56 Reactions
KCQS01/KCQS02/KCQS03; instrument specific, see
KiCqStart SYBR® Green qPCR 10 560
Table P4-6). ReadyMix 2×

• PCR grade water: PCR grade water (W1754 or W4502) as Forward primer (10 µM)
Reverse primer (10 µM)
0.9
0.9
50.4
50.4
20 mL aliquots; freeze; use a fresh aliquot for each reaction.
PCR grade water 4.2 235.2
• Forward and reverse primers concentrated stocks (10 µM
working stocks: GOI). 2. Remove 448 μL of master mix from step 1 (i.e., half ) into a
• Custom oligos can be ordered at [Link]/oligos. separate tube for setting up the No Template Control (NTC)
reactions.
Supplies 3. Add 112 μL of template to the remaining master mix from
• Sterile filter pipette tips step 2. Set Template master mix on ice.
• Sterile 1.5 mL screw-top microcentrifuge tubes 4. Add 112 μL of water to the other half of the master mix
from step 2. Set NTC master mix on ice.
(Sigma CLS430909)
5. Aliquot 20 μL Template master mix from step 3 into two
• PCR tubes and plates, select one to match desired format:
rows of the PCR plate labeled GOI.
• Individual thin-walled 200 µL PCR tubes
6. Aliquot 20 μL NTC master mix from step 4 into two rows of
(Sigma Z374873 or P3114)
the PCR plate labeled NTC.

PCR Technologies: A Technical Guide 139


Appendix A
7. Cover plates and label. (Make sure the labeling does not
obscure instrument excitation/detection light path.)
8. Run samples according to the three-step protocol below
(Note: These conditions are specific for FAST cycling
protocols) ensuring that the annealing temperature
has been defined on a gradient between the lowest
and highest that would be appropriate for the primers
(example shows 54–70 °C). Steps 1–3 are repeated through
40 cycles. A standard dissociation curve is run after
amplification.
Table P14-36. FAST qPCR Cycling Conditions for Ta Optimization.
FAST Cycling Conditions Temp (°C) Time (sec)
Initial denaturation/Hot Start 95 30
Steps 1–3 are repeated through 40 cycles
Step 1 95 5
Step 2 54–70 (gradient) 15
Step 3 72 10

Note: Use standard dissociation curve protocol (data collection).

Temperature Gradient
54 TM TM TM TM TM TM TM TM TM TM 70
GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1
GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1 GO1
NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC
NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC NTC

Note: The distribution of the samples and controls across the temperature gradient. If the
instrument has a temperature gradient that varies vertically down the plate column, the samples
and controls will need to be re-arranged accordingly.

Figure P14-19. Plate Layout for Ta Optimization With Identical Ta for Each Column.

140 [Link]
Protocol 15: qPCR Reference Gene Selection

Protocol 15: qPCR Reference Gene Selection


Analysis of gene expression data requires a stable reference • Plate seals
or loading control. This reference is usually one or more - ThermalSeal RTS™ Sealing Films (Sigma Z734438)
reference genes. Suitable reference genes are those which
- ThermalSeal RT2RR™ Film (Sigma Z722553)
are unaffected by differences in samples and experimental
treatments and these must be determined for each Notes for this Protocol
experimental model. When performing a trial to select stable
reference genes it is critical that the genes selected are from
• cDNA is generated using ReadyScript® RT kit incorporating
a combination of random and oligo-dT priming (see
different biological pathways and that their expression is
Protocol 10 and Chapter 8).
independently regulated. Ideally all reference gene candidates
are tested on a selection of five test and five control samples. • If using a PCR plate, follow a plate schematic to ensure that
the reaction mix, samples and controls are added to the
Equipment correct wells.

• Quantitative PCR instrument • Test a wide range of genes that may be potential reference
genes. These should be expressed in different functional
• Laminar flow hood for PCR set up (optional) gene pathways. A selection of potential KiCqStart SYBR
Primers for some model organisms ([Link]/ksprimers)
Reagents is given in Table P15-37. OligoArchitect ([Link]/
• cDNA diluted 1:100 (the more dilute cDNA is usually probedesignonline) is a suitable design tool for alternative
sufficient to detect highly expressed reference genes, for primer designs (see Protocol 1 and Chapter 6).
medium expressed genes use 1:10 dilution).
Table P15-37. Potential Reference Gene Candidates and KiCqStart
• KiCqStart SYBR Green ReadyMix™ (Sigma KCQS00/ Product Codes.
KCQS01/KCQS02/KCQS03—depends on instrument, see
Table P4-6). Reference Gene Mouse Human Rat
CANX M_Canx_1 H_CANX_1 R_Canx_1
• PCR grade water: PCR grade water (W1754 or W4502) as HPRT1 NA H_HPRT1_1 R_Hprt1_1
20 mL aliquots; freeze; use a fresh aliquot for each reaction. PGK1 M_Pgk1_1 H_PGK1_1 R_Pgk1_1

• Forward and reverse primers for test reference genes TBP


YWHAZ
M_Tbp_1
M_Ywhaz_1
H_TBP_1
H_YWHAZ_1
R_Tbp_1
R_Ywhaz_1
(stock at 10 μM). Note: a suitable list of genes is provided
ATP5B M_Atp5b_1 H_ATP5B_1 R_Atp5b_1
in Table P15-37. These are available as KiCqStart Primers,
SDHA M_Sdha_1 H_SDHA_1 R_Sdha_1
which are pre-designed assays as shown (the sequences of
TUBB2B NA H_TUBB2B_1 R_Tubb2b_1
the primers are provided with product delivery).
UBC M_Ubc_1 H_UBC_1 R_Ubc_1

Supplies PPIA
GUSB
NA
M_Gusb_1
H_PPIA_1
H_GUSB_1
R_Ppia_1
R_Gusb_1
• Sterile filter pipette tips GAPDH NA H_GAPDH_1 NA

• Sterile 1.5 mL screw-top microcentrifuge tubes TUBA1A


ACTB
NA
M_Actb_1
H_TUBA1A_1
H_ACTB_1
R_Tuba1a_1
R_Actb_1
(Sigma CLS430909)
• PCR tubes and plates, select one to match desired format:
• Individual thin-walled 200 µL PCR tubes
(Sigma Z374873 or P3114)
• Plates
- 96-well plates (Sigma Z374903)
- 384-well plates (Sigma Z374911)

PCR Technologies: A Technical Guide 141


Appendix A

Method
1. Calculate the number of reactions required for
each reference gene. Prepare sufficient mix for two
reactions per sample. For example if testing 5 test and
5 control samples, two No Template Controls (NTC) =
22 reactions. Calculate sufficient for 10% extra to allow for
pipetting error.
2. Prepare qPCR master mix for each Reference Gene primer
pair according to Table P15-38. Do not add cDNA to the
master mix. Mix well and avoid bubbles.
Table P15-38. qPCR Master Mix for Reference Gene Selection.
Volume (µL) per Single
Reagents 20 μL Reaction
2× KiCqStart SYBR Green qPCR ReadyMix 10
Forward primer (10 μM) 0.9
Reverse primer (10 μM) 0.9
PCR grade Water 3.2

3. Add 15 μL of master mix to the defined tubes/wells.


4. Add 5 μL of appropriate template (sample or water for NTC
to the defined tubes/wells).
5. Cap tubes or seal plates and label. (Make sure the labeling
does not obscure instrument excitation/detection light
path.)
6. Run reactions according to the three-step protocol below
(Table P15-39). Steps 1–3 are repeated through 40 cycles.
7. See Chapter 10 to analyze data and determine the most
stable reference gene or combination of genes.
Table P15-39. PCR Cycling Conditions for Reference Gene Selection.
Cycling Conditions Temp (°C) Time (sec)
Initial denaturation/Hot Start 95 30
Repeat steps 1–3 through 40 cycles
Step 1 95 5
Step 2 58 10
Step 3 72 15

Note: Use standard dissociation curve protocol (data collection).

142 [Link]
Protocol 16: qPCR Efficiency Determination
Protocol 16: qPCR Efficiency Determination
Once an assay has been optimized, it is important to verify
the reaction efficiency. This information is important when
Supplies
reporting and comparing assays. In this example protocol, the • Sterile filter pipette tips
assay efficiency is compared over a wide and narrow dynamic • Sterile 1.5 mL screw-top microcentrifuge tubes
range of cDNA concentrations. In practice, it is common to (Sigma CLS430909)
select a single range to test depending on the expected range • PCR tubes and plates, select one to match desired format:
of target in the samples, so the protocol given can be adjusted
according to the requirements of the experiment. In this • Individual thin-walled 200 µL PCR tubes
example the efficiency is calculated using both 10-fold and (Sigma Z374873 or P3114)
2-fold dilution series. The standard curve should encompass • Plates
the expected range of expression for the genes of interest - 96-well plates (Sigma Z374903)
Note that the proportionality of the cDNA yield with respect to - 384-well plates (Sigma Z374911)
RNA input is linear when using the ReadyScript® RT kit, so this • Plate seals
experiment can be adapted to RT-qPCR if using that system
- ThermalSeal RTS™ Sealing Films (Sigma Z734438)
by 1) diluting the RNA and running the RT reactions and 2)
then running qPCR on each of the resulting cDNA samples - ThermalSeal RT2RR™ Film (Sigma Z722553)
(see Chapter 8 for examples). However, this is not always the
case and does not apply for all Reverse Transcription kits or Notes for this Protocol
protocols. This should be verified before adapting this protocol • cDNA is generated using random priming or oligo-dT
to an alternative kit method (see Protocol 10). The RT product is diluted to
prepare the standard curves (1:2 and 1:10 are given as
Equipment examples). RNA can also be diluted and cDNA synthesized
from each dilution using the ReadyScript® kit or a one-step
• Quantitative PCR instrument RT-qPCR approach can be adopted by diluting RNA and
• Laminar flow hood for PCR set up (optional) following the one-step RT-qPCR approach in Protocols 11
and 12. Alternatively, DNA templates can be substituted
Reagents such that the expected Cq range is within Cq 15 to Cq 38.
• DNA to be used as the standard curve template (e.g., cDNA, • Each concentration of the serial dilutions will be run as
gDNA or a synthetic template). duplicate reactions.
• KiCqStart SYBR® Green ReadyMix™ (Sigma KCQS00/
KCQS01/KCQS02/KCQS03—depends on instrument, see Method
Table P4-6). 1. Prepare a qPCR master mix that is sufficient for 40
• PCR grade water: PCR grade water (W1754 or W4502) as reactions following Table P16-40. This allows for extra to
20 mL aliquots; freeze; use a fresh aliquot for each reaction. accommodate pipetting errors since 32 reactions will be
run (Table P16-41).
• Forward and reverse primers for test genes (stock at
10 μM). Table P16-40. Reaction Master Mix for Generation of 1:2 and
1:10 Standard Curve.
Volume (µL) per Volume (µL) for
Reagents Single 20 μL Reaction 40 Reactions
2× KiCqStart SYBR Green qPCR 10 400
ReadyMix
Forward primer (10 µM) 0.9 36
Reverse primer (10 µM) 0.9 36
PCR grade water 3.2 128

PCR Technologies: A Technical Guide 143


Appendix A
2. Dilute the DNA through a series of 1:10 and 1:2 covering
7 dilution points for each series (see Table P16-41, Plate
Layout for DNA Dilution).
3. Add 5 μL of appropriate template dilution to the defined
wells (see Table P16-41, Plate Layout for DNA Dilution).
Table P16-41. Diagram of the First Four Columns of a 96-well Plate
Layout Showing the Position of Standard Curve Template Dilutions.
Dilution stated is relative to the original stock solution. When using an
artificial template it is possible to calculate copy number (relative to
OD readings).
Plate Layout for DNA Dilution
Plate
Column 1 2 3 4 Rest of Plate
A 1 1 1 1
B 0.1 0.1 0.5 0.5
C 0.01 0.01 0.25 0.25
D 0.001 0.001 0.125 0.125
E 0.0001 0.0001 0.0625 0.0625
F 0.00001 0.00001 0.03125 0.03125
G 0.000001 0.000001 0.015625 0.015625
H NTC NTC NTC NTC

4. Add 15 μL of master mix to each well (see Table P16-41).


5. Cap tubes or seal the plate and label. (Make sure the
labeling does not obscure instrument excitation/detection
light path).
6. Run samples according to the two-step protocol below.
Steps 1–2 are repeated through 40 cycles. Follow
amplification with a standard dissociation curve analysis.
Table P16-42. PCR Cycling Conditions for Standard Curve Generation.
Cycling Conditions Temp (°C) Time (sec)
Initial denaturation/Hot Start 95 30
Steps 1–2 are repeated through 40 cycles
Step 1 95 5
Step 2 60 30

Note: Use standard dissociation curve protocol (data collection).

144 [Link]
Protocol 17: qPCR Gene Expression/Copy Number Analysis Using SYBR Green I Dye Detection

Protocol 17: qPCR Gene Expression/Copy Number Analysis Using


SYBR Green I Dye Detection
Measuring a target quantity relative to one or more stable
reference genes using SYBR Green I dye detection is a
Supplies
common application of qPCR. Below is a standard protocol • Sterile filter pipette tips
that can be adapted to specific experimental needs. • Sterile 1.5 mL screw-top microcentrifuge tubes
(Sigma CLS430909)
Experimental Objectives • PCR tubes and plates, select one to match desired format:
After optimization of the qPCR assays for both target and • Individual thin-walled 200 µL PCR tubes
reference genes, these are used to measure the quantity of (Sigma Z374873 or P3114)
target. A ratio is determined between the quantity of the gene
• Plates
of interest (GOI) and the stable reference gene(s) as described
in Chapter 10. In this example, a standard curve is used for - 96-well plates (Sigma Z374903)
determination of copy number. However, a relative quantity - 384-well plates (Sigma Z374911)
can also be determined without a standard curve by using the • Plate seals
alternative Comparative Quantification analysis method (see
Chapter 10). If this approach is adopted, the standard curve - ThermalSeal RTS™ Sealing Films (Sigma Z734438)
is omitted but a calibrator sample is included alongside all - ThermalSeal RT2RR™ Film (Sigma Z722553)
test samples. Standard primer concentrations and annealing
temperatures are included in the protocol but these should be Notes for this Protocol
adapted based on results from optimization experiments (see • cDNA is generated using random priming or oligo-dT
Protocols 13 and 14). method (see Protocol 10).
• Dilute forward and reverse primers to 10 μM or to an
Equipment appropriate concentration determined as a result of
• Quantitative PCR instrument optimization (see Protocols 13 and 14).

• Laminar flow hood for PCR set up (optional) • If using a PCR plate, follow a plate schematic to ensure that
the reaction mix, samples and controls are added to the
Reagents correct wells.

• gDNA 10ng to 100ng or cDNA to be used as template • All tests will be run as duplicate reactions.
(diluted 1:2 for low expressed genes to 1:10 to 1:100 for
medium to high expressed genes).
• KiCqStart SYBR® Green ReadyMix™ (Sigma KCQS00/
KCQS01/KCQS02/KCQS03—depends on instrument, refer
to Table P4-6).
• PCR grade water: PCR grade water (W1754 or W4502) as
20 mL aliquots; freeze; use a fresh aliquot for each reaction.
• Forward and reverse primers for test genes (stock at
10 μM).

PCR Technologies: A Technical Guide 145


Appendix A

Method
1. Prepare a different qPCR master mix for each primer pair
to be run. Prepare sufficient mix for the samples, standard
curve reactions (described as six dilutions below), No
Template Controls, all in duplicate plus calculate an extra
10% to allow for pipetting error.
For example, if there are five test samples, prepare a mix for
samples (5×2) plus standard curve (6×2) plus No Template
Control (NTC) (1×2) = 24 reactions. Therefore prepare a mix
for 26.4 or 27 reactions per primer pair.
Table P17-43. Reaction Master Mix for SYBR Green I Detection.
Volume (µL) per Single
Reagents 20 μL Reaction
2× KiCqStart SYBR Green qPCR ReadyMix 10
Forward primer (10 μM) 0.9
Reverse primer (10 μM) 0.9
PCR grade water 3.2

2. Prepare a 1:10 fold (or suitable dilution for the experiment)


serial dilution of suitable standard curve template/cDNA so
that there is 20 μL template of each dilution (six dilutions
in total).
3. Add 5 μL of appropriate template serial dilution (standard
curve), sample test cDNA or water (NTC) to the defined
tubes or wells.
4. Add 15 μL of master mix to each tube or well.
5. Cap tubes or seal the PCR plate and label. (Make sure the
labeling does not obscure the instrument excitation/
detection light path.)
6. Run samples according to Table P17-44.
7. See Chapter 10 for guidance on data analysis.
Table P17-44. PCR Cycling Conditions for Standard Curve Generation.
Cycling Conditions Temp (°C) Time (sec)
Denaturation/hot start 95 30
Steps 1–2 are repeated through 40 cycles
Step 1 95 5
Step 2 60 30

Note: Use standard dissociation curve protocol (data collection).

146 [Link]
Protocol 18: qPCR Gene Expression/Copy Number/SNP Analysis Using Probe Detection

Protocol 18: qPCR Gene Expression/Copy Number/SNP Analysis


Using Probe Detection
The most common application for qPCR is the measurement • Forward and reverse primers for test and reference genes
of a gene transcript or copy number quantity relative to one (stock 10 μM).
or more reference genes using probe detection. The reactions
may be designed such that each target is detected as a single
• Probe for each target (stock 10 μM) using different
fluorescent labels for different targets (e.g., FAM for GOI and
reaction (simplex) or such that all probes can be added to HEX/JOE for REF).
a single reaction to detect multiple targets simultaneously
(multiplex). It is essential that multiplex assays are designed to Supplies
be compatible with each other (see Chapter 6). When using
probes for SNP or mutation analysis both probes, i.e. specific to • Sterile filter pipette tips
mutant and wild type targets are added to the reaction along • Sterile 1.5 mL screw-top microcentrifuge tubes
with a single set of primers. (Sigma CLS430909)
After optimization of the assays for both target and reference/ • PCR tubes and plates, select one to match desired format:
control genes, these are used to measure the quantity of • Individual thin-walled 200 µL PCR tubes
target. A ratio is determined between the quantity of gene (Sigma Z374873 or P3114)
of interest (GOI) and the reference gene as described in • Plates
Chapter 10.
- 96-well plates (Sigma Z374903)
In this protocol, the probe is included at 250 nM and the
- 384-well plates (Sigma Z374911)
primers at 450 nM. However, it is advisable to optimize these
conditions and adjust the reaction volumes accordingly. For a • Plate seals
multiplex reaction, add all primers and probes to the reaction - ThermalSeal RTS™ Sealing Films (Sigma Z734438)
mix. It may be necessary to use a more concentrated stock for - ThermalSeal RT2RR™ Film (Sigma Z722553)
oligos or prepare a concentrated oligo blend (see Protocol 6).
Notes for this Protocol
Equipment • cDNA is generated using random priming or oligo-dT
• Quantitative PCR instrument method (see Protocol 10).
• Laminar flow hood for PCR set up (optional) • If using a PCR plate, follow a plate schematic to ensure that
the reaction mix, samples and controls are added to the
Reagents correct wells.
• cDNA/gDNA undiluted for standard curve. • All tests are run as duplicate reactions.
• Sample cDNA diluted 1:10, gDNA 10 ng per analysis. • The protocol shows detection of 2 genes (e.g., GOI and
ref gene).
• LuminoCt qPCR ReadyMix (Sigma L6669) .
• PCR grade water: PCR grade water (W1754 or W4502) as
20 mL aliquots; freeze; use a fresh aliquot for each reaction.

PCR Technologies: A Technical Guide 147


Appendix A

Method
1. Prepare a different qPCR master mix for each primer pair to
be analyzed. Calculate sufficient mix for the standard curve
reactions (described as six dilutions below), No Template
Controls (NTC) and for each sample, all in duplicate plus an
extra 10% to allow for pipetting errors (Table P18-45).
Note: Adjust water volume to accommodate addition of
additional primers and probes for multiplex reactions or
add blended, concentrated stocks (see Protocol 6).
Table P18-45. Reaction Master Mix for Probe Detection.
Volume (µL) per Single
Reagents Reaction 25 μL
2× LuminoCt qPCR ReadyMix 12.5
Forward primer GOI (10 μM) 1.125
Reverse primer GOI (10 μM) 1.125
Forward primer REF (10 μM) 1.125
Reverse primer REF (10 μM) 1.125
Probe GOI (10 μM) 0.625
Probe REF (10 μM) 0.625
PCR grade water 1.75

2. Prepare a 1:10-fold dilution (or suitable dilution) of suitable


standard curve template so that there is 20 μL of each
dilution (six dilutions in total).
3. Add 5 μL of appropriate template serial dilution (standard
curve), template, controls template or water (NTC) to the
defined tubes or wells.
4. Add 20 μL of master mix to each tube/well.
5. Cap tubes or seal the PCR plate and label. (Make sure the
labeling does not obscure the instrument excitation/
detection light path.)
6. Run samples according to Table P18-46 ensuring that data
are collected for all probe labels.
7. See Chapter 10 for data analysis.
Table P18-46. PCR Cycling Conditions for Muliplex Target
Quantification.
Cycling Conditions Temp (°C) Time (sec)
Denaturation/Hot Start 95 30
Steps 1–2 are repeated through 40 cycles
Step 1 95 5
Step 2 60 30

148 [Link]
Protocol References

Protocol References

1. Kitchen, R.R., Kubista, M., Tichopad, A. Statistical aspects of quantitative 6. Koukhareva, I., Lebedev, A. 3’-Protected 2’-deoxynucleoside
real-time PCR experiment design. Methods 2010; 50: 231-236. 5’-triphosphates as a tool for heat-triggered activation of polymerase
2. Tichopad, A., Kitchen, R., Riedmaier, I., et al. Design and optimization of chain reaction. Anal Chem 2009; 81: 4955-4962.
reverse-transcription quantitative PCR experiments. Clin Chem 2009; 55: 7. Koukhareva, I., Haoqiang, H., Yee, J., et al. Heat activatable 3’-modified
1816-1823. dNTPs: synthesis and application for hot start PCR. Nucleic Acids Symp Ser
3. Manly, B. Randomization, Bootstrap and Monte Carlo Methods. Methods (Oxf ) 2008; 259-260.
in Biology 2nd ed Chapman Hall; 1998: 8. PCR Technologies: Current Innovations. 3 ed. Edited Tania Nolan and
4. Francis, A. Glove me Tender. The Scientist 15th May, 2000: Stephen Bustin CRC Press; 2013.
5. Kellogg, D.E., Rybalkin, I., Chen, S., et al. TaqStart Antibody: “hot start” PCR 9. Nolan, T., Hands, R.E., Bustin, S.A. Quantification of mRNA using real-time
facilitated by a neutralizing monoclonal antibody directed against Taq RT-PCR. Nat Protoc 2006; 1: 1559-1582.
DNA polymerase. Biotechniques 1994; 16: 1134-1137.

PCR Technologies: A Technical Guide 149


OligoEvaluator™
The online oligonucleotide sequence
calculator from Sigma® Life Science.

Bioflexible.
Whether you need to know molecular weight
and melting temperature or the correct
resuspension and dilution volumes, OligoEvaluator
has the functionality to help you make critical
experimental decisions. Together with our custom
oligonucleotide portfolio, Sigma ensures the
success of every assay — every time.

Analyze your sequence now


[Link]/oligocalculator
Books, Seminars and Tools

Appendix B:
Additional Resources

Books, Seminars and Tools


Recommended Textbooks MIQE Guidelines
• A-Z of Quantitative PCR, edited Stephen Bustin, IUL Press . • MIQE: Assay Design Considerations
[Link] • MIQE: Sample Derived Inhibitors
Biotechnology/dp/0963681788 • MIQE: RNA Quality Considerations
• PCR Technology: Current innovations 3rd Edition edited • MIQE: RNA Quantity and RT Considerations
Tania Nolan and Stephen Bustin, CRC Press.
[Link] PCR Animation
• The PCR Revolution. Basic Technologies and Applications, [Link]
ed Stephen Bustin, Cambridge University Press. biology/pcr/learning-center/[Link]
[Link]
life-sciences/molecular-biology-biochemistry-and- Assay Design Tools
structural-biology/pcr-revolution-basic-technologies- Assay design is a worthwhile investment of time and effort.
and-applications There are several complimentary design services provided
by oligo manufacturers and independent websites that
Recorded Seminars support the design of a custom assay and will provide all the
A series of short seminars covering all aspects of MIQE information regarding the assay design.
compliant qPCR has been recorded and available at
[Link]/qpcrseminars • OligoArchitect
Sigma’s OligoArchitect ([Link]/probedesignonline)
These seminars include basic qPCR topics and a specific provides two options. The first is OligoArchitect Online, a
series covering aspects of the MIQE guidelines: software design tool with a wide range of options. If the
design requires a more specific or specialized capability,
qPCR Topics the second option is to request technical services to
• Primer and Probe Design perform the design via OligoArchitect Consultative. The
• An Introduction to qPCR Concepts project would then be designed by an expert molecular
biologist.
• Selecting a qPCR Basic Detection Chemistry
• Choosing a Fluorophore/Quencher Combination
• OligoEvaluator
Sigma’s OligoEvaluator ([Link]/oligocalculator) is a
• Chemistries for More Challenging qPCR Assays DNA sequence calculator that provides values for major
• MIQE Concepts physical properties, such as molecular weight, as well as
calculates re-suspension and dilution volumes of dry oligos
• Reference Gene Validation
and stock solutions, respectively.
• Data Analysis Guidelines
• Beacon Designer
Provides a software package for purchase
[Link]

PCR Technologies: A Technical Guide 151


Appendix B
• CpG Islands and Primer Design • Reverse Complement Sequences
Analysis of CpG islands and primer design Automatic generation of reverse complement sequences
[Link] [Link]
[Link] • Sequence Alignment
• DNA Sequence After Bisulfite Treatment [Link]
[Link]
BiConverter/[Link] Predesigned Assays
• Ensembl • In addition to the KiCqstart Primers libraries,
Information about transcript variants [Link] there are also public
[Link] databases of PCR/qPCR assays that scientists have pre-
designed:
• Gene Sequences Including CpG Island Location [Link]
[Link] [Link]
• Information Regarding MIQE Guidelines [Link]
[Link]/miqe
[Link]/
• Virus Primers
[Link]
• In silico PCR The aim of this database is to enable scientists that require
UCSC In silico PCR specific diagnostic PCR assays, free access to the latest
[Link] validated virus detection assays and protocols. In particular
• Mfold Webserver supporting laboratories in developing countries that
[Link] may otherwise be unable to source them independently.
Encouraging labs to use standardized diagnostic PCR
• Molecular Beacons
assays is the principal core aim of this site.
[Link]
• mRNA to Genomic DNA Alignment Tool Software
Useful for design of primers spanning introns • GenEx
[Link] Information about purchasing GenEx data analysis software
• NCBI GenBank for Sequence Location [Link]
[Link] • geNorm
[Link] To download geNorm reference gene analysis software
• NCBI Primer Design Tool [Link]
[Link] • NormFinder
• Oligonucleotide Properties Calculator To download the NormFinder reference gene analysis
[Link] software
html [Link]
uncategorised/13-normfinder-software
• Primer3
[Link] or • qbase+ and geNorm
[Link] Information about purchasing qbase+ and geNorm data
analysis software
• Primer BLAST Directions
[Link]
[Link]
qbase-software
primers/

152 [Link]
Books, Seminars and Tools
General Information • NCBI Probe Database
Contains basic, well-illustrated tutorials of different probe
• AutoPrime technologies and their uses in research and medicine.
[Link] [Link]
• Genome Web doc/[Link]
[Link]
• Online Discussion Groups
• qPCR and REST Data Analysis Such as the Facebook groups MIQE Users Forum (Facebook
All things qPCR and REST data analysis login required)
[Link]/ [Link]
• MIQE Users Forum • MIQE_qPCR and qPCR Technology Hub
LinkedIn groups MIQE Users Forum [Link]
[Link]
3897295?trk=my_groups-b-grp-v (Real Time qPCR and
• Textbooks
A series of technical textbooks
Digital PCR dPCR and NGS) [Link]
• miRNA Analysis Sigma-Aldrich provides these links as a courtesy for our
A collection of resources for miRNA analysis miRNAtool customers. Inclusion on this list does not imply endorsement
[Link] or validation of applications or results.
Sigma-Aldrich will neither collect nor make available any data,
analysis or content information.

PCR Technologies: A Technical Guide 153


Appendix B

Products and Support


BioReliance Custom qPCR Probes
BioReliance provides testing and manufacturing services to Whether your application is gene expression analysis,
pharmaceutical and biopharmaceutical companies that span genotyping, pathogen detection, or other, Sigma’s wide
the product cycle from early pre-clinical development to selection of reporter and quencher dyes will support all major
licensed production. Our goal is to advance the development qPCR detection chemistries, including Dual-Labeled Probes,
and delivery of healthcare and consumer products by Molecular Beacons, LightCycler® Probes and Scorpions® Probes.
providing the highest quality testing, development and Add Locked Nucleic Acid® (LNA®) to your probe or Molecular
manufacturing services in partnership with clients worldwide. Beacon for increased thermal stability and hybridization
For established biotechnology and pharmaceutical companies, specificity.
outsourcing to BioReliance streamlines product development
and reduces time to market. The Company also enables For more information, visit
emerging and clinical stage companies who may lack the staff, [Link]/probes
expertise and financial resources to conduct many aspects of
product development in-house. Extract-N-Amp™ PCR Kits
Sigma’s Extract-N-Amp PCR technology provides all the
For more information, visit
reagents necessary to extract DNA from a wide variety of cells
[Link] and tissues and amplify targets of interest by PCR. A novel
extraction method eliminates the need for long enzymatic
CleanAmp™ dNTP digestions or homogenization. The kit also includes a specially
CleanAmp dNTPs are modified nucleoside triphosphates that formulated hot start PCR ReadyMix™ for amplification directly
block DNA polymerase nucleotide incorporation. CleanAmp from the extract. The kit contains validated protocols to extract
dNTPs are activated by the initial heating step and subsequent and amplify genomic DNA from a variety of starting materials.
denaturing steps in typical hot start PCR cycling conditions.
For more information, visit
This process limits the amount of activated dNTPs during
each cycle of PCR, allowing for more specific and efficient
[Link]/extractnamppcrkits
amplification of the desired product and also reducing or
completely avoiding mis-priming or primer dimer formation. GenElute™ Endotoxin-free Plasmid Prep Kit
CleanAmp dNTPs provide a more affordable solution than hot This line of kits offers a simple, rapid, cost effective method for
start enzymes for a variety of PCR-based applications. isolating endotoxin-free plasmid DNA from recombinant E. coli
cultures. Endotoxins (also known as lipopolysaccharides or
• Cat. No. DNTPCA1: Hot Start dNTP mix for improved PCR.
LPS) are often co-purified with plasmid DNA and significantly
• Cat. No. DNTPCA2: Modified dNTP set for Hot Start PCR, reduce transfection efficiencies in endotoxin-sensitive cell
2 μmol of each dNTP lines. High-quality, endotoxin-free DNA is ready for immediate
• Cat. No. DNTPCA10: Modified dNTP set for Hot Start PCR, use for the most demanding applications, including
10 μmol of each dNTP transfection into endotoxin-sensitive cells.

Custom DNA and RNA Oligos For more information, visit


[Link]/plasmid
As the world’s leading supplier of custom DNA and RNA
oligonucleotides, Sigma provides an unrivalled product
portfolio, including a wide selection of synthesis scales, GenElute™ Genomic DNA Kits
modifications and format options to fit all of your PCR and The GenElute Genomic DNA Purification Kits provide a simple
qPCR research needs. and convenient method to isolate pure, high molecular weight
DNA from a variety of mammalian sources. These kits use a
For more information, visit silica-based membrane, specially selected for genomic DNA
[Link]/oligos purification. Mini and 96-well formats are available.

For more information, visit


[Link]/genomicdnakits

154 [Link]
Products and Support
GenElute™ HP Plasmid Prep Kits LuminoCt® qPCR ReadyMix™
GenElute™ HP Plasmid Prep Kits offer a simple, rapid, cost LuminoCt qPCR ReadyMix is designed to deliver unsurpassed
effective solution for plasmid preparation from E. coli cultures. assay speeds without sacrificing accuracy, precision, or
These kits combine silica-based membrane technology and sensitivity. Inclusion of JumpStart™ Taq antibody in the
the convenience of spin or vacuum format. The recovered ReadyMix eliminates polymerase activity at ambient
plasmid DNA is ready for immediate use in applications such temperatures without causing the performance issues
as restriction digest, cloning, PCR, transfection and sequencing. associated with chemically modified hot start Taq. This allows
Mini, 96-well, Midi, Maxi and Mega formats are available. for very rapid activation of the Taq and delivers unparalleled
assay sensitivity, while allowing for benchtop reaction setup.
For more information, visit
[Link]/hpplasmid • Cat. No. L6669: For fast probe-based quantitative PCR

KiCqStart® Primers LuminoCt® SYBR® Green qPCR ReadyMix™


LuminoCt SYBR Green qPCR ReadyMix is designed to deliver
Compatible with any thermal cycler, KiCqStart Primers are
unsurpassed assay speeds without sacrificing accuracy,
ready-to-order, pre-designed primer pairs for quantifying gene
precision, or sensitivity Inclusion of JumpStart™ Taq antibody
expression by SYBR® Green I RT-qPCR. To comply with MIQE,
in the ReadyMix eliminates polymerase activity at ambient
they have been developed using sophisticated bioinformatics
temperatures without causing the performance issues
tools and validated in silico to avoid off-target amplification
associated with chemically modified Hot Start Taq. This
and all sequences are provided at purchase. KiCqStart Primers
allows for very rapid activation of the Taq and delivers assay
are available as up to three ranked sets of forward and reverse
sensitivity, while allowing for benchtop reaction setup.
primer pairs for all genes from common model organisms.
• Cat. No. L6544: For fast SYBR Green quantitative PCR
For more information, visit
[Link]/ksprimers MISSION® siRNA
Our MISSION line of siRNA are designed utilizing the Rosetta
KiCqStart SYBR Green qPCR ReadyMix™ siRNA Design Algorithm and provide a guarantee of ≥75%
KiCqStart SYBR Green qPCR ReadyMix is a 2× concentrated, knockdown on 2-out-of-3 sequences per gene.
ready-to-use reaction cocktail that contains all components,
except primers and template, for real-time quantitative Custom siRNA
PCR (qPCR). This unique combination of proprietary buffer, High quality and cost-effective custom siRNA sequence design
stabilizers and KiCqStart Taq DNA Polymerase delivers available for your unique or custom sequence through our
maximum PCR efficiency, sensitivity, specificity and robust free in-house design service. Choose from a wide range of
fluorescent signal using fast, or conventional, cycling protocols modifications, purifications and quantities to tailor to your
with SYBR Green I qPCR. specific needs.
Different real-time PCR systems employ different strategies For more information, visit
for normalization of fluorescent signals and correction of
well-to-well optical variations. It is critical to match the
[Link]/customsirna-eu
appropriate qPCR reagent to your specific instrument. Sigma
offers a variety of reagents to accommodate your instrument MISSION esiRNA
requirements. MISSION esiRNAs are endoribonuclease-prepared siRNA
pools comprised of a heterogeneous mixture of siRNAs that
• Cat. No. KCQS00: For Bio-Rad, Cepheid, Eppendorf, all target the same mRNA sequence. These multiple silencing
Illumina, Corbett, and Roche systems triggers lead to highly specific and effective gene silencing
• Cat. No. KCQS01: Low ROX™, for ABI and Stratagene while providing lower off-target effects. MISSION esiRNA are
instruments, available individually (pre-designed or custom), as custom
• Cat. No. KCQS02: with ROX™ for ABI instruments arrayed panels, or genome scale libraries that target either
human or mouse genes.
• Cat. No. KCQS03: iQ™, with fluorescein for Bio-Rad systems
For more information, visit
[Link]/esirna

PCR Technologies: A Technical Guide 155


Appendix B
MISSION miRNA Mimics MystiCq® microRNA qPCR Assay Primer
Human miRNA mimics are available in a ready-to-use miRBase The MystiCq microRNA qPCR Assay Primer is an integral part
version 17 library or choose from over 1,900 individual mimics. of the MystiCq microRNA qPCR Assay System. It has been
Custom mimics are available for all species, including the designed to target specific microRNAs with the MystiCq
current miRBase version content. Our mimics utilize a unique Universal PCR primer and the MystiCq microRNA SYBR Green
design and modification to significantly reduce possible sense qPCR ReadyMix on cDNA templates generated by the MystiCq
strand off-target effects. microRNA cDNA Synthesis Mix kit.
For more information, visit For more information, visit
[Link]/mimics [Link]/mysticq

MISSION Pre-designed siRNA MystiCq® microRNA SYBR® Green qPCR ReadyMix™


The most complete collection of pre-designed siRNA for The MystiCq microRNA SYBR Green qPCR ReadyMix is one of
human, mouse and rat. Multiple sequences are available for the integral components of the MystiCq microRNA qPCR Assay
every gene, with rankings to indicate performance. Sequences System. This ReadyMix is a specially-formulated 2× concentrate
are updated with each version of NCBI RefSeq. with an antibody-based Hot Start Taq DNA polymerase and all
For more information, visit the optimized components needed for highly specific, reliable
[Link]/missionsirna and reproducible microRNA qPCR assays. Simply add together
the specific MystiCq microRNA qPCR Assay Primer, the MystiCq
Universal PCR primer and cDNA template generated by the
MystiCq® microRNA cDNA Synthesis Mix MystiCq microRNA cDNA Synthesis Kit. Since there are different
Starting with total RNA, or samples pre-enriched or microRNAs, methods used for fluorescent normalization on different real-
the MystiCq microRNA cDNA Synthesis Mix kit contains all the time PCR instruments, there are platform MystiCq microRNA
components necessary to convert mature microRNAs into SYBR Green qPCR ReadyMixes available.
cDNA templates for qPCR. Since microRNAs are not naturally
polyadenylated, the first step in the cDNA synthesis process is • Cat. No. MIRRM00: Formulated for systems that do not
to polyadenylate the microRNAs through a poly(A) polymerase require normalization
reaction. Next, the ReadyScript® reverse transcriptase, an oligo- • Cat. No. MIRRM01: Low ROX™ formulation for miRNA
dT adapter primer and other required reagents are added RT-qPCR
to convert the polyadenylated microRNAs into cDNA. The • Cat. No. MIRRM02: with ROX™, formulation for miRNA
adapter primer includes a unique sequence at the 5’ end that RT-qPCR
is complementary to the sequence of the MystiCq Universal
PCR Primer. The kit also contains a Positive Control Primer that
• Cat. No. MiRRM03: Formulation for miRNA RT-qPCR on
iQ Bio-Rad platforms
is specific to SNORD44, a small nucleolar RNA that is widely
expressed in most human tissues. Sufficient amounts of the
Poly(A) Tailing Buffer and the MicroRNA cDNA Reaction mix
OligoArchitect™ Online
are included in the kit to allow for the inclusion of no poly(A) OligoArchitect Online is a free, robust qPCR assay design tool
polymerase and no reverse transcriptase control reactions. To powered by the industry standard Beacon Designer™ platform
analyze individual microRNAs, use the MystiCq Universal PCR from PREMIER Biosoft. In addition to providing primer and
Primer (which targets the adapter primer sequence) together probe homology searching and template secondary structure
with the MystiCq microRNA qPCR Assay Primer and the analysis, additional features of OligoArchitect Online include
MystiCq microRNA SYBR Green qPCR ReadyMix. automatic retrieval of template sequences, visualization of the
template with positional display of regions of interest, design
• Cat. No. MIRRT: MystiCq® microRNA cDNA Synthesis Mix quality ratings and tools for alternative and multiplex designs.

For more information, visit


[Link]/probedesignonline

156 [Link]
Products and Support
OligoEvaluator™
OligoEvaluator is a free, online calculator of oligonucleotide
sequence analysis, re-suspension and dilution requirements
that is powered by PREMIER Biosoft. In addition to providing
information such as melting temperature and molecular
weight, additional features include secondary structure
analysis and BLAST searching.

For more information, visit


[Link]/oligocalculator

ReadyScript® cDNA Synthesis Mix


ReadyScript® cDNA Synthesis Mix is a sensitive and easy-to-
use solution for two-step RT-PCR. This 5× concentrated mix
provides all necessary components (except RNA template) for
first-strand synthesis including: buffer, dNTPs, MgCl2, primers,
RNase inhibitor protein, ReadyScript® reverse transcriptase and
stabilizers. ReadyScript® is a RNase H(+) derivative of MMLV
reverse transcriptase, optimized for reliable cDNA synthesis
over a wide dynamic range of input RNA concentrations.
The unique blend of oligo (dT) and random primers in the
ReadyScript® cDNA Synthesis Mix works exceptionally well
with a wide variety of targets. It is optimized for the production
of targets <1 kb in length. ReadyScript® cDNA Synthesis Mix
produces excellent results in both real-time and conventional
RT-PCR.
• Cat. No. RDRT: Complete reagent for first strand cDNA
synthesis for RT-qPCR

PCR Technologies: A Technical Guide 157


Design Your Probe Online with OligoArchitect™

Sigma is pleased to offer OligoArchitect for all of your primer and probe design requirements. OligoArchitect is complimentary
and includes both our online design tool (complete a design by yourself ) and our consultative service (have an expert
complete a design for you).

Enter the Gateway


Our OligoArchitect Online v4.0 design
tool is powered by the industry standard
Beacon Designer™ (PREMIER Biosoft).
To start here, visit
[Link]/probedesignonline

When You Need a Consultant


For complex and demanding
applications, utilize our consultative
service to ensure the success of your
PCR, qPCR, or other assays.
With personal consultation from our
expert, technical support scientists, your
request, including all sequences and
data analysis, will be MIQE compliant
and usually returned to you within
24 hours.
If required, you will also receive follow-
up assay optimization, data analysis
assistance, and troubleshooting support.

158 [Link]
Design Your Probe Online with OligoArchitect™
Do Your Own Design
Open the design tool with the click of a
button.
Reference documents found here
include a Glossary of Parameters and the
Exon Design Protocol. Both are available
in PDF format.
This tool has been enhanced for a third
time and is now able to create designs
with Locked Nucleic Acid® (LNA®).

Login or Register with Us


Are you ready to start? Register as a new
user and choose your area.
Returning users can login and proceed.
To start here, visit
[Link]

Easy to Use
Type in the name of your assay, enter
your sequence, and click Search (see
Protocol 1).
All reported sequences, associated
properties, and assay parameters
are available for export to Excel and
convenient email ordering.

PCR Technologies: A Technical Guide 159


Trademarks

The following trademarks and registered trademarks are accurate to the best of our knowledge at the time of publicaton.
Trademarks noted as registered are registered in the United States and possibly other jurisdictions. For the latest information on
a specific product, see our website, [Link], or consult individual manufacturers.

Agilent Technologies, Inc. — Mx3000P®, Mx3005P®, Mx4000™ Microsoft Corporation — Excel®, Microsoft®
Applied Biosystems — VIC® Molecular Research Center, Inc. — RNAzol®, TRI Reagent®
BioMark Technologies Inc. — BioMark™ OSI Pharmaceuticals, Inc. — TARCEVA®
bioMérieux Société anonyme à conseil Polyplus Transfection — ZNA®
d’administration — THxID®
Premier Biosoft International — Beacon Designer™
Bio-Rad Laboratories, Inc. — Bio-Rad®, CFX384™, CFX96™,
Qiagen Group — Rotor-Gene®, Scorpions®, therascreen®
Chromo4™, ddPCR™, Droplet Digital™, iQ™, MiniOpticon™, MyiQ™,
Opticon™, QX100™ Quanta BioSciences Inc. — KiCqStart®, MystiCq®
Bio-Rad QL, Inc — Quantasoft® RainDance Technologies, Inc. — RainDrop™
Biosearch Technologies, Inc— BHQ®, Black Hole Quencher®, Roche Diagnostics GmbH — MycoTOOL®
Cal Fluor®, Quasar® Roche Diagnostics Operations, Inc. — cobas®
Boehringer Ingelheim International GmbH — GILOTRIF® Roche Molecular Systems, Inc. — LightCycler®, Roche®, TaqMan®
Cepheid, Inc. — SmartCycler® Sigma-Aldrich Co. LLC — BlueView™, DirectLoad™,
Eppendorf AG — Eppendorf®, Mastercycler® Extract-N-Amp™, GenElute™, JumpStart™, LuminoCt®, miRPremier®,
MISSION®, OligoArchitect™, OligoEvaluator™, Onyx Quencher™, OQ™,
Excel Scientific, Inc. — ThermalSeal RT2RR™,
ReadyMix™, ReadyScript®, REDTaq®
ThermalSeal RTS™
The Dow Chemical Company or an affiliated company
Exiqon A/S — LNA®, Locked Nucleic Acid™
of Dow — Triton®
GE Healthcare — Cy®
Thermo Fisher Scientific, Inc. — NanoDrop®
GlaxoSmithKline LLC — Mekinist®, Tafinlar®
TriLink BioTechnologies, Inc. — CleanAmp™
Lehn & Fink, Inc. — Amphyl®
Life Technologies — Applied Biosystems®, FAM™, HEX™,
JOE™, OpenArray®, Oregon Green®, QuantStudio®, QuBit®,
Rhodamine Green™, ROX™, StepOne ™, StepOnePlus™, SYBR®,
TAMRA™, TET™, Texas Red®

160 [Link]
OligoArchitect™ Online v4.0
The most comprehensive online qPCR Assay
Design Tool from Sigma® Life Science.

Bioconfident.
OligoArchitect Online is now able to create
designs with Locked Nucleic Acid™ (LNA®) for
Dual-Labeled Probes, Molecular Beacons, and
LightCyler® Probes. Together with our custom
qPCR probes portfolio, Sigma ensures the
success of every qPCR assay—every time.

Design your qPCR assay now


[Link]/probedesignonline
Sigma-Aldrich ® Worldwide Offices
Argentina Germany Malaysia Spain
Free Tel: 0810 888 7446 Free Tel: 0800 51 55 000 Tel: (+60) 3 5635 3321 Free Tel: 900 101 376
Tel: (+54) 11 4556 1472 Free Fax: 0800 64 90 000 Fax: (+60) 3 5635 4116 Free Fax: 900 102 028
Fax: (+54) 11 4552 1698 Tel: (+49) 89 6513 0 Tel: (+34) 91 661 99 77
Fax: (+49) 89 6513 1169 Mexico Fax: (+34) 91 661 96 42
Australia Free Tel: 01 800 007 5300
Free Tel: 1800 800 097 Hungary Sweden
Tel: (+36) 1 235 9055 Free Fax: 01 800 712 9920
Free Fax: 1800 800 096 Tel: (+46) 8 742 4200
Tel: (+61) 2 9841 0555 Fax: (+36) 1 235 9068 Tel: (+52) 722 276 1600
Fax: (+46) 8 742 4243
Fax: (+61) 2 9841 0500 Fax: (+52) 722 276 1601
India
Switzerland
Austria Telephone The Netherlands
Free Tel: 0800 80 00 80
Tel: (+43) 1 605 81 10 Bangalore: (+91) 80 6621 9400 Tel: (+31) 78 620 5411
New Delhi: (+91) 11 4358 8000 Free Fax: 0800 80 00 81
Fax: (+43) 1 605 81 20 Fax: (+31) 78 620 5421 Tel: (+41) 81 755 2511
Mumbai: (+91) 22 4087 2364
Belgium Pune: (+91) 20 4146 4700 New Zealand Fax: (+41) 81 756 5449
Tel: (+32) 3 899 13 01 Hyderabad: (+91) 40 3067 7450 Free Tel: 0800 936 666 Thailand
Fax: (+32) 3 899 13 11 Kolkata: (+91) 33 4013 8000 Free Fax: 0800 937 777 Tel: (+66) 2 126 8141
Brazil Fax Tel: (+61) 2 9841 0555 Fax: (+66) 2 126 8080
Free Tel: 0800 701 7425 Bangalore: (+91) 80 6621 9550 Fax: (+61) 2 9841 0500
New Delhi: (+91) 11 4358 8001 United Kingdom
Tel: (+55) 11 3732 3100
Mumbai: (+91) 22 2579 7589 Norway Free Tel: 0800 717 181
Fax: (+55) 11 5522 9895
Pune: (+91) 20 4146 4777 Tel: (+47) 23 17 60 00 Free Fax: 0800 378 785
Canada Hyderabad: (+91) 40 3067 7451 Tel: (+44) 01747 833 000
Fax: (+47) 23 17 60 10
Free Tel: 1800 565 1400 Kolkata: (+91) 33 4013 8016 Fax: (+44) 01747 833 574
Free Fax: 1800 265 3858 Poland
Tel: (+1) 905 829 9500 Ireland United States
Tel: (+48) 61 829 01 00
Fax: (+1) 905 829 9292 Free Tel: 1800 200 888 Toll-Free: 800 325 3010
Free Fax: 1800 600 222 Fax: (+48) 61 829 01 20
Toll-Free Fax: 800 325 5052
Chile Tel: +353 (0) 402 20370 Portugal Tel: (+1) 314 771 5765
Tel: (+56) 2 495 7395 Fax: + 353 (0) 402 20375 Fax: (+1) 314 771 5757
Free Tel: 800 202 180
Fax: (+56) 2 495 7396
Israel Free Fax: 800 202 178 Vietnam
People’s Republic of China Free Tel: 1 800 70 2222 Tel: (+351) 21 924 2555 Tel: (+84) 8 3516 2810
Free Tel: 800 819 3336 Tel: (+972) 8 948 4222 Fax: (+351) 21 924 2610 Fax: (+84) 8 6258 4238
Tel: (+86) 21 6141 5566 Fax: (+972) 8 948 4200
Fax: (+86) 21 6141 5567 Russia Internet
Italy
Free Tel: 800 827 018 Tel: (+7) 495 621 5828 [Link]
Czech Republic
Tel: (+39) 02 3341 7310 Fax: (+7) 495 621 6037
Tel: (+420) 246 003 200
Fax: (+420) 246 003 291 Fax: (+39) 02 3801 0737 Singapore
Denmark Japan Tel: (+65) 6779 1200
Tel: (+45) 43 56 59 00 Tel: (+81) 3 5796 7300 Fax: (+65) 6779 1822
Fax: (+45) 43 56 59 05 Fax: (+81) 3 5796 7315
Slovakia
Finland Korea Tel: (+421) 255 571 562
Tel: (+358) 9 350 9250 Free Tel: (+82) 80 023 7111 Fax: (+421) 255 571 564
Fax: (+358) 9 350 92555 Free Fax: (+82) 80 023 8111
Tel: (+82) 31 329 9000 South Africa
France
Fax: (+82) 31 329 9090 Free Tel: 0800 1100 75
Free Tel: 0800 211 408
Free Fax: 0800 031 052 Luxembourg Free Fax: 0800 1100 79
Tel: (+33) 474 82 28 88 Tel: (+32) 3 899 1301 Tel: (+27) 11 979 1188
Fax: (+33) 474 95 68 08 Fax: (+32) 3 899 1311 Fax: (+27) 11 979 1119

Enabling Science to Order/Customer Service: [Link]/order World Headquarters


Technical Service: [Link]/techservice 3050 Spruce St.
Improve the Quality of Life St. Louis, MO 63103
Development/Custom Manufacturing Inquiries safcglobal@[Link]
(314) 771-5765
Safety-related Information: [Link]/safetycenter [Link]

©2014 Sigma-Aldrich Co. LLC. All rights reserved. SIGMA, SAFC, SIGMA-ALDRICH, ALDRICH and SUPELCO are trademarks of Sigma-Aldrich Co. LLC, registered in the US and other countries. FLUKA is a trademark of
Sigma-Aldrich GmbH, registered in the US and other countries. Sigma-Aldrich, Sigma, Aldrich, Supelco, Fluka and SAFC brand products are sold by affiliated Sigma-Aldrich distributors. Purchaser must determine QXN
the suitability of the product(s) for their particular use. Additional terms and conditions may apply. Please see product information on the Sigma-Aldrich website at [Link] and/or on the reverse 81636-510152
side of the invoice or packing slip. 1064

You might also like