(Lecture Notes in Electrical Engineering 444) Hao Liu, Cunjiang Song, Arthur Ram (Eds.) - Advances in Applied Biotechnology_ Proceedings of the 3rd International Conference on Applied Biotechnology (I
(Lecture Notes in Electrical Engineering 444) Hao Liu, Cunjiang Song, Arthur Ram (Eds.) - Advances in Applied Biotechnology_ Proceedings of the 3rd International Conference on Applied Biotechnology (I
Hao Liu
Cunjiang Song
Arthur Ram
Editors
Advances
in Applied
Biotechnology
Proceedings of the 3rd International
Conference on Applied Biotechnology
(ICAB2016), November 25–27, 2016,
Tianjin, China
Lecture Notes in Electrical Engineering
Volume 444
Arthur Ram
Editors
Advances in Applied
Biotechnology
Proceedings of the 3rd International
Conference on Applied Biotechnology
(ICAB2016), November 25–27, 2016, Tianjin,
China
123
Editors
Hao Liu Arthur Ram
College of Biotechnology Institute of Biology Leiden
Tianjin University of Science Leiden University
and Technology Leiden
Tianjin The Netherlands
China
Cunjiang Song
College of Life Sciences
Nankai University
Tianjin
China
v
vi Contents
1 Introduction
Tianjin. The isolated phage was further characterized, including morphology, burst
size, latent time, genome size and host range. The data of this study may provide
valuable information for the prevention of phage infection in the production of the
fermented Chinese cabbage.
MRS medium was composed of 20 g/L glucose, 10 g/L peptone, 8 g/L beef
extract, 4 g/L yeast extract, 5 g/L sodium acetate, 2 g/L ammonium citrate, 0.2 g/L
MgSO4, 0.05 g/L MnSO4, 2 g/L KH2PO4, and 0.1% Tween-80 [11]. MRS
(pH = 5.0) and MRS (pH = 6.4) were used for lactic acid bacteria (LAB) isolation
and cultivation, respectively. Broth was used for liquid cultures, 1.5% solid agar
medium was used for bacteria plating, and 0.5% semi-solid agar medium was used
for phage plaque-forming assays. Both plates and liquid cultivations were statically
incubated at 30 °C.
The isolated LAB strains were used as indicator for isolating phage from the
fermented Chinese cabbage samples. In brief, added 1 mL samples to 100 mL
MRS medium, and incubated at 30 °C for 48 h to enrich phages. The phages were
isolated by the double-layer plating technique. The propagation of phage was done
as previously described in order to obtain high titer lysates [13]. Phage lysate was
filtered through a 0.2 lm-pore size sterile filter and stored at 4 °C for future use.
Isolation and Characterization of a Virulent Phage H6 Infecting … 5
The phage preparations was further treated with DNase I (1 lg/mL) and RNase A
(1 lg/mL) at 37 °C for 30 min. The treated lysate was washed ten times with
0.1 mol/L ammonium acetate solution (pH = 7.0) using the 100 kD Amicon filters.
The retained phage solution was used directly for negative staining as described
previously [14]. Photographs were taken with a JROL1011 transmission electron
microscope operating at 100 kV.
As described previously [15], spotting assay was conducted to determine the sen-
sitivity of the isolated phages to the host strains. The double-layer method was used
to further confirm the above results.
The 100 mL phage lysate was used for phage DNA extraction using the
phenol-chloroform method described previously [16]. Purified phage genomic
DNA was subjected to digestions with several restriction endonucleases, including
EcoRI, EcoRV, XbaI, HindIII, SmaI, StuI and BamHI, respectively. The genome
size was estimated by compilation of DNA fragment sizes resulting from the seven
restriction enzymes digestion profiles.
Purified phage particles were further filtered through the Amicon-100 filter, and
washed three times with 0.1 mol/L ammonium acetate solution (pH = 7.0). Treated
phage particles were subjected to SDS-PAGE directly, and the gel stained with
Coomassie Blue R-250.
One-step growth experiment was carried out according to the previous descriptions
[17]. In brief, 50 mL bacterial cells were incubated to mid-exponential-phase
(OD600 = 0.5–0.6) and harvested by centrifugation at 6000 rpm for 10 min.
6 K. Huang et al.
The pellet was resuspended in 0.5 mL fresh MRS medium and mixed with 0.5 mL
phage solution (1 106 pfu/mL). Phage was allowed to adsorb for 1 min and the
mixture was subjected to centrifuge immediately at 13,000 rpm for 30 s to remove
free phage particles. The treated pellet was resuspended in 100 mL fresh MRS
medium and the culture was continuously incubated at 30 °C. Samples were taken
at 15 min intervals and phage titre was determined by the double-layer plate
method. The latent period was deduced from the triphasic curve. The burst size of
phage was calculated by dividing the phage titers at the plateau phase by the
infective centers number at the latent phase.
The logarithmic cultures of the strain J68 were mixed with the phage lysate at
different MOIs (MOI = 100, 10, 1, 0.1, 0.01, 0). The 96-well plate was filled with
the 300 lL mixture per well, and the value of OD600 was measured at 2 h intervals
by ELISA reader (GS40A24).
3 Results
Eight isolated strains from the fermented Chinese cabbage samples were confirmed
the identity by analyzing their 16S rDNA gene sequence. The resulted sequences
were deposited to GenBank and aligned to search for the most similar sequences. In
final, six collected strains were validated to be Lactobacillus brevis, other two
strains belonged to Lactobacillus plantarum.
L. brevis J68 was used as indicator strain for virulent bacteriophages screening from
the fermented Chinese cabbage samples. A phage was eventually isolated and
named H6. Its plaques were circular, clear and transparent with smooth edge,
showing 1–2 mm in diameter. At the MOI = 0.01, titer of phage H6 reached
1 109 pfu/mL in MRS and 5 109 pfu/mL in MRS with CaCl2 (2.375 g/L).
Isolation and Characterization of a Virulent Phage H6 Infecting … 7
The susceptibility to phage H6 was investigated with isolated strains from fer-
mented Chinese cabbage samples and other strains, they included six L. brevis, six
L. plantarum, two Lactobacillus vaginalis, nine Lactobacillus reuteri, two
Weissella cibaria, one Lactobacillus curvatus and one Lactobacillus johnsonii. We
found that all six L. brevis strains were sensitive to phage H6, and other strains all
were resistant to phage H6. The sequences of 16S rDNA showed that there were
differences among six L. brevis strains. The result indicated that phage H6 might
have a broad host range and was capable of infecting multiple isolates of
Lactobacillus brevis, however, phage H6 didn’t infect lactic acid bacteria from
other genera.
The treated phage solution was used directly for negative staining. Images of phage
H6 were developed using transmission electron microscope (Fig. 1). The obtained
image showed that phage H6 had an icosahedra head of 93.3 nm in diameter and a
long contractile tail about 166.6 nm in length, and it was classified as a lytic phage
of Myoviridae in Caudovirales.
Phage H6 was amplified and its genomic DNA was extracted. Purified genomic
DNA was digested with several restriction endonucleases, including EcoRI,
EcoRV, XbaI, HindIII, SmaI, StuI and BamHI, as subsequently subjected to elec-
trophoretic analyses (Fig. 2). Based on the digestion profiles of EcoRI, EcoRV,
XbaI, and HindIII, the genome size was determined to be approximately at the
range of 59.6–61.2 kb. The restriction enzymes analysis also indicated that phage
H6 was a dsDNA virus.
Purified phage particles were subjected to SDS-PAGE and proteomic patterns were
obtained after Coomassie Blue R-250 staining (Fig. 3). Totally, six protein bands
were displayed on the gel with the molecular weights ranging approximately from
30 to 60 kD.
One-step growth experiment was performed to determine the latent time and burst
size of phage H6. As inferred from the triphasic curve (Fig. 4), the latent period was
about 90 min and the burst size was about 40.4 pfu/infection center.
The lysis ability of phage H6 to the Lactobacillus brevis J68 was measured at
different MOIs. As shown in Fig. 5, with the increase of phage titeres, the bacte-
riostatic ability of phage H6 gradually strengthened. At the MOI = 1, the growth of
strain J68 appeared to decline in the 10th hour; the strain J68 hardly grew at the
MOI = 10 or 100.
4 Discussion
linear or circular. The analysis of phage H6 structural proteins showed that there
was a huge protein band at 60 kD, we speculated that it contains several protein
bands and this assumption can be verified by mass spectrometry. The data from this
study can provide more information about L. brevis bacteriophages. The objectives
of this study were to provide more formulation in order to prevent infection of
bacteriophages in fermented Chinese cabbage.
Acknowledgements This work was partly supported by The National Natural Science
Foundation of China (Grants 31370205 and 30970114).
References
1. Pederson CS, Albury MN (1969) The sauerkraut fermentation. New York State Agricultural
Experiment Station Technical Bulletin 824. Geneva, New York
2. Lee JS, Heo GY, Lee JW, Oh YJ, Park JA, Park YH, Pyun YR, Ahn JS (2005) Analysis of
kimchi microflora using denaturing gradient gel electrophoresis. Int J Food Microbiol
102(2):143–150
3. Plengvidhya V, Breidt F Jr, Lu Z, Fleming HP (2007) DNA fingerprinting of lactic acid
bacteria in sauerkraut fermentations. Appl Environ Microbiol 73(23):7697–7702
4. Medina E, Pérez-Díaz IM, Breidt F, Hayes J, Franco W, Butz N, Azcarate-Peril MA (2016)
Bacterial ecology of fermented cucumber rising pH spoilage as determined by
nonculture-based methods. J Food Sci 81(1):M121–M129
5. Chen YS, Wu HC, Lo HY, Lin WC, Hsu WH, Lin CW, Lin PY, Yanagida F (2012) Isolation
and characterisation of lactic acid bacteria from jiang-gua (fermented cucumbers), a
traditional fermented food in Taiwan. J Sci Food Agric 92(10):2069–2075
6. Lu Z, Breidt F, Plengvidhya V, Fleming HP (2003) Bacteriophage ecology in commercial
sauerkraut fermentations. Appl Environ Microbiol 69:3192–3202
7. Yoon S-S, Barrangou-Poueys R, Breidt F, Klaenhammer TR, Fleming HP (2002) Isolation
and characterization of bacteriophages from fermenting sauerkraut. Appl Environ Microbiol
68(2):973–976
8. Lu Z, Perez-Diaz IM, Hayes JS, Breidt F (2012) Bacteriophage ecology in a commercial
cucumber fermentation. Appl Environ Microbiol 78(24):8571–8578
9. Kleooen HP, Holo H, Jeon SR, Nes IF, Yoon SS (2012) Novel Podoviridae family
bacteriophage infecting Weissella cibaria isolated from Kimchi. Appl Environ Microbiol 78
(20):7299–7308
10. Yan P, Chai Z, Xue W, Chang X, Kong D, Zhang H (2009) Lactic acid bacteria diversity in
fermented cabbage estimated by culture-dependent and -independent. Wei Sheng Wu Xue
Bao 49(3):383–388
11. De Man JC, Rogosa M, Sharpe ME (1960) A medium for the cultivation of lactobacilli.
J Appl Bacteriol 23(1):130–135
12. Gürtler V, Stanisich VA (1996) New approaches to typing and identification of bacteria using
the 16S–23S rDNA spacer region. Microbiology 142(Pt 1):3–16
13. Jaomanjaka F, Ballestra P, Dols-lafargue M, Le Marrec C (2013) Expanding the diversity of
oenococcal bacteriophages: insights into a novel group based on the integrase sequence. Int J
Food 166(2):331–340
14. Nugent KM, Cole RM (1977) Characterization of group H streptococcal temperate
bacteriophage phi 227. J Virol 21(3):1061–1073
12 K. Huang et al.
15. Yang H, Liang L, Lin S, Jia S (2010) Isolation and characterization of a virulent
bacteriophage of Acinetobacter baumannii. BMC Microbiol 10:131; PMID: 20426877;
1471-2180-10-131
16. Sambrook J, Russell DW (2001) Molecular cloning. CSHL Press, New York
17. Chow JJ, Batt CA, Sinskey AJ (1988) Characterization of Lactobacillus bulgaricus
bacteriophage ch2. Appl Environ Microbiol 54(5):1138–1142
18. Jung JY, Lee SH, Kim JM, Park MS, Bae JW, Hahn Y, Madsen EL, Jeon CO (2011)
Metagenomic analysis of kimchi, a traditional Korean fermented food. Appl Environ
Microbiol 77(7):2264–2274
19. Yoon S-S, Barrangou-Poueys R, Breidt F, Fleming HP (2007) Detection and characterization
of a lytic Pediococcus bacteriophage from the fermenting cucumber brine. J Microbiol
Biotechnol 17:262–270
20. Moineau S, Levesque C (2005) Control of bacteriophages in industrial fermentation. In:
Kutte E, Sulakvelidze A (eds) Bacteriophage: biology and applications. CRC Press, Boca
Raton, pp 286–296
Molecular Cloning and Biochemical
Characterization of Oligo-1,6-Glucosidases
from Bacillus subtilis and Bacillus
licheniformis
1 Introduction
Escherichia coli JM109, P. pastoris strain GS115 and vector pPIC9K were
obtained from Invitrogen (Carlasbad, CA).
The described method [6] was used to measure the activities of oligo-1,6-gluco-
sidases from B. subtilis and B. licheniformis.
pH optima of BsOG and BlOG were analyzed by incubating them for 15 min at
37 °C as described above.
The optimal reaction temperatures of BsOG and BlOG were determined at
temperatures ranging from 15 to 70 °C at pH 6.8.
Hydrolysis of isomaltotriose and IMOs by BsOG and BlOG were performed and
analyzed as described above except that isomaltotriose were dissolved in 0.2 M
phosphate buffer (pH 7.0) to a final concentration of 4 mM and that samples were
withdrawn at different times for HPLC analysis.
3 Results
BsOG and BlOG were pre-incubated in 0.2 M phosphate buffer (pH 7.0) at 50 °C,
and the residual activities were measured at the indicated times. Incubation at 50 °C
for 20 min, BsOG and BlOG activity were not detected.
The relative activities of BsOG and BlOG at various pHs were measured with two
different buffer systems at 37 °C. The effects of pH over a range of 4.0–10.0 on the
activities of BsOG and BlOG. The optimal pH of BsOG and BlOG were 7.0 and
6.5. BsOG had a relatively broad pH optimum ranging from 6.0 to 9.5. The opti-
mum pH range of BlOG was 5.5–7.5.
The ability of BsOG and BlOG to hydrolyze various di- and maltooligosaccharides,
as well as a-glucan polymers, such as amylose and amylopectin, was determined.
As shown in Table 1, both BsOG and BlOG hydrolyzed isomaltose, isomaltotriose,
isomaltulose, panose, sucrose, amylopectin and maltodextrin, and exhibited weak
activity against amylose. However, no activity was observed toward maltose and
maltotriose. BsOG and BlOG also exhibited a-1,2-glucosidase activity on sucrose,
in accord with the substrate specificity of isomaltase from S. cerevisiae [2]. This
restricted substrate specificity indicated that these two enzymes were oligo-1,6-
glucosidases [7]. Oligo-1,6-glucosidase prefers isomaltotriose, and hyrolyzes IMOs
and dextran [7]. On the other hand, S. cerevisiae isomaltase preferentially cleaves
Molecular Cloning and Biochemical Characterization … 17
isomaltose and methyl a-D-glucopyroside, but does not act on isomaltotriose and
isomaltotetraose [8]. These differences in the specificities for substrate chain-length
may be partly accounted for by the differences in the shapes of the active sites.
Fig. 1 The hydrolysis process of isomaltotriose by BsOG and BlOG. a BsOG; b BlOG; down
triangles isomaltotriose; up triangles panose; closed squares glucose; circles isomaltose. The
initial concentration of isomaltotriose was set as 100%. The error bars indicate standard deviations
Fig. 2 HPLC profiles of IMOs hydrolyzed by BsOG and BlOG for different times. a BsOG;
b BlOG; red and light blue lines represent the samples that were hydrolyzed for 1 and 4 h,
respectively. Green line represents IMOs
Molecular Cloning and Biochemical Characterization … 19
HPLC analysis showed only three products in each digest of IMOs (Fig. 2). One
was shown to be glucose, which was the sole product from isomaltose. Another was
identified as maltose from panose. The third product was isomaltose from isoma-
ltotriose. The hydrolysis modes of panose and isomaltotriose suggested that the
linkage to be split in each isomaltosaccharide was at the non-reducing terminal [7].
We found that isomaltotriose in IMOs was nearly completely converted into iso-
maltose and glucose after hydrolyzed by BsOG for 4 h, only a small amount of
panose left. When IMOs was hydrolyzed by BlOG, isomaltose and isomaltotriose
were rapidly converted into glucose, while panose was hydrolyzed into maltose and
glucose. At the end of the reaction, isomaltotriose was almost completely hydro-
lyzed and only a small quantity of panose and isomaltose left.
References
5. Jespersen HM, MacGregor EA, Henrissat B, Sierks MR, Svensson B (1993) Starch- and
glycogen-debranching and branching enzymes: prediction of structural features of the
catalytic (b/a) 8-barrel domain and evolutionary relationship to other amylolytic enzymes.
J Protein Chem 12:791–805
6. Suzuki Y, Yuki T, Kishigami T, Abe S (1976) Purification and properties of extracellular
a-glucosidase of a thermophile, Bacillus thermoglucosidius KP 1006. Biochim Biophys Acta
(BBA)-Enzymol 445:386–397
7. Suzuki Y, Aoki R, Hayashi H (1982) Assignment of a p-nitrophenyl-a-D-glucopyranoside-
hydrolyzing a-glucosidase of Bacillus cereus ATCC 7064 to an exo-oligo-1,6-glucosidase.
Biochim Biophys Acta (BBA)-Protein Struct Mol Enzymol 704:476–483
8. Yamamoto K, Miyake H, Kusunoki M, Osaki S (2010) Crystal structures of isomaltase from
Saccharomyces cerevisiae and in complex with its competitive inhibitor maltose. FEBS J
277:4205–4214
9. Watanabe K, Kitamura K, Iha H, Suzuki Y (1990) Primary structure of the oligo-l,6-
glucosidase of Bacillus cereus ATCC7064 deduced from the nucleotide sequence of the
cloned gene. Eur J Biochem 192:609–620
Transcriptomic Analysis of CYP Genes
in Rhizopus nigricans and Identification
of the Steroid 11a-Hydroxylase Candidate
Genes
Jianguo Zhao, Pengcheng Sui, Ruijie Wang, Ziyin Zhang, Fuping Lu,
Zhengxiang Wang and Xiaoguang Liu
1 Introduction
R. nigricans remains to be identified even though it has been used for commercial
steroid hydroxylation reactions for over half of a century since the discovery of its
ability to perform selective 11a-hydroxylation of progesterone in 1952 [9]. It is
expected that the cloning and identification of the steroid 11a-hydroxylase gene in
R. nigricans will aid in the engineering of more efficient industrial strains for steroid
11a-hydroxylation reactions.
In the present study, we took advantage of the power of RNA-sequencing
technology and also the fact the fungal steroid 11a-hydroxylase is a member of the
cytochrome P450 superfamily to establish the list of CYP genes expressed under
biotransformation conditions, then used quantitative RT-PCR to determine the
highly induced CYP genes to identify steroid 11a-hydroxylase candidate genes in
R. nigricans.
2.1 Materials
The filamentous fungus N. nigricans TCCC41047 from the microbial strain col-
lection of the applied microbiology lab of Tianjin University of Science and
Technology was routinely maintained on potato dextrose agar (PDA) slants.
final concentrations of 1 and 0.03 mg/ml for each treatment, incubated for 24 h at
28 °C with shaking at 180 rpm, and one milliliter fermentation broth was extracted
with ethyl acetate and analyzed by thin layer chromatography (TLC).
Total RNAs were isolated using Trizol reagents (Promega, USA) from R. nigricans
TCCC41047 cultures treated with 0.01% (W/V) EP for 6 h and without EP respec-
tively. After the RNA integrity and purity were assessed by the NanoDrop (NanoDrop
Technologies, USA), RNA samples were delivered to BGI-Beijing (Beijing
Genomics Institute) for sequencing using Illumina HiSeq™ 2000 (Illumina, Inc.
USA) (http://www.genomics.cn/index) for transcriptome sequencing BGI.
The returned RNA sequencing data were analyzed to identify expressed CYP genes
under substrate induction. A set of prediction algorithms were used to identify the
full length of Open Reading Frames (ORFs) of CYP genes, including ORF Finder
(http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The catalytic domains of predicted
CYPs were identified by InterProScan (http://www.ebi.ac.uk/Tools/InterProScan).
The sequences of CYP genes were analyzed to identify their similarity to known
putative sequences using NCBI BLAST (http://blast.ncbi.nlm.nih.gov/).
Reverse transcription of the first cDNA strand was performed using 3 lg of the
total RNA with PrimeScript Reverse Transcriptase (TaKaRa, Dalian, PR China) in
a 20 ll reaction volume according to the manufacturer’s instructions. To quantify
expression levels of expressed CYP genes under induction and no-induction, real-
time quantitative PCR (qRT-PCR) was performed as follows: the total volume of
PCR reaction is 20 µl containing 10 µl of Master Mix with SYBR (Solarbio,
Beijing, China), 300 nmol/l of both primers (Table 1) and 1 µl of cDNA template.
The qRT-PCR amplification parameters comprise denaturation (95 °C, 10 min), 40
cycles of denaturation (95 °C, 30 s) and annealing (60 °C, 30 s) (Applied
Biosystems, USA). The transcript level of glyceraldehyde-3-phosphate dehydro-
genase gene (GAPDH) was used as an internal control and relative to a calibrator, is
given by amount of target = 2−ΔΔCT [10].
Primers for real-time PCR reactions were as follows (Table 1):
24 J. Zhao et al.
Fig. 1 TLC assay of induction of steroid 11a-hydroxylase activities in R. nigricans by EP. The
detailed biotransformation procedure was described in materials and methods. 1 Authentic EP, 2 non-
induction + EP + cycloheximide, 3 substrate induction for 6 h, followed by EP + cycloheximide, 4
Authentic C11a-OH EP
Since we demonstrated that the steroid 11a-hydroxylase was expressed only under
EP induction, real-time RT-PCR was employed to determine the degree of
expression induction of the 14 CYP genes, and a GAPD gene was used as an
internal control. As shown in Tables 2 and 3 genes (Unigene11442, Unigene3103
and Unigene612) were highly induced after 6 h EP treatment, thus establishing
these three CYP genes are the 11a-hydroxylase candidate genes in R. nigricans.
26 J. Zhao et al.
4 Conclusions
Acknowledgments This work was financially supported by a grant from the National High
Technology Research and Development Program of China (863 Program) (No. 2011AA02A211).
References
1. Ayer DE, Schlage CA, Flynn GL (1976) Anti-inflammatory steroid. US Pat 3980 778
2. Salvador, Jorge AR, et al (2012) Anticancer steroids: linking natural and semi-synthetic
compounds. Nat Prod Rep 30(2):324–374
3. Mahat SB, Garai S (1997) Advances in microbial steroid biotransformation. Steroids 62:
332–345
4. Zeelen FJ (1990) Pharmaceutical chemistry of steroids. Elsevier, Amsterdam
5. Žakelj-Mavrič M, Belič I (1987) Hydroxylation of steroids with 11a-hydroxylase of Rhizopus
nigricans. J Steroid Biochem 28(2):197–201
6. Sonomoto K, Hoq MM, Tanaka A, Sukui S (1983) 11b-Hydroxylation of cortexolone
(Reichstein compound S) to hydrocortisone by Curvularia lunata entrapped in photo-cross-
linked resin gels. Appl Environ Microb 45(2):436–443
7. Donova MV, Egorova OV (2012) Microbial steroid transformations: current state and
prospects. Appl Microbiol Biotechnol 94:1423–1447
8. Breskvar K, Hudnik-Plevnik T (1981) Inducibility of cytochrome P-450 and of NADPH-
cytochrome c reductase in progesterone treated filamentous fungi Rhizopus nigricans and
Rhizopus arrhizus. J Steroid Biochem 14:395–399
9. Murray HC, Peterson DH (1952) Oxygenation of steroids by Mucorales fungi. US Pat
2602 769
10. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time
quantitative PCR and the 2−ΔΔCT method. Methods 25:402–408
11. Irrgang S, Schlosser D, Schmauder HP (1992) The steroid 15a-hydroxylase of Penicillium
raistrickii i477 is inducible. Biotechnol Lett 14:33–38
12. Lin YY, Smith LL (1970) Microbial hydroxylations: VIII. Induction of steroid hydroxylases
of Curvularia lunata by 19-nortestosterone analogs. Biochim Biophys Acta 218:526–531
Identification of Genes Encoding
Receptors for Six Pseudomonas
aeruginosa Phages
Jiajia You, Xiaoli Cui, Li Sun, Xiaojing Yang and Hongjiang Yang
1 Introduction
enterocolitica serotype O:3 [12]. Several Salmonella phage receptors are including
FhuA, TolC, BtuB, OmpC, Vi capsular antigen, LPS, and flagella [13]. The
receptor of Vibrio cholera phage CTXU is TCP pili. Phage fs1, fs2, VGJ, and KSF
recognize MSHA pili as the receptor. In P. aeruginosa, phage receptors include
LPS and pilus [14–19].
In this study, the receptors of 6 previously isolated P. aeruginosa phages were
studied by constructing the Tn5G transposon insertion library of P. aeruginosa
PAK. The phage resistant mutants were characterized and the disrupted genes were
identified with inverse PCR. The results will provide the basis of the potential
applications of the P. aeruginosa phages.
Genomic DNA was extracted from the phage-resistant mutants with the phenol-
chloroform extraction method [25]. The restriction enzymes TaqI enzyme was used
to digest the purified genomic DNA at 65 °C for 4 h. After purification, the
digested DNA was ligated with T4 DNA ligase at 16 °C for 12 h. The ligation
product was subsequently used as templates for amplification using the primers
OTn1 and OTn2 listed in Table 2. The sequences obtained from the PCR products
were analyzed by searching the database in GenBank of NCBI.
Identification of Genes Encoding Receptors for Six … 31
The target genes disrupted in the phage-resistant mutants were amplified using the
primers listed in Table 2, the products were cloned the vector pUCP18, and the
resulting recombinant plasmids were transformed into the corresponding phage-
resistant mutants. With the spotting assay, the phage sensitivity of the transformants
was tested as described previously [26].
The ability of swimming and swarming was analyzed according to the method
previously described [27]. Briefly, one single colony was inoculated in 5 ml LB
medium. The overnight culture was transferred into fresh LB medium and cultured
to the logarithmic phase. Take 1 ll culture and drop on the surface of the casein
medium with 0.3% agar. After standing at desktop for 30 min, the plates were
incubated at 37 °C for 8–12 h.
3 Results
Host ranges of P. aeruginosa phages O1, O2, K1, K2, K3, and C10 were deter-
mined by spotting assay. Sixteen clinical P. aeruginosa strains were included in the
assay. With the tested strains, phage K1 and O2 displayed the same host ranges and
the other phages showed different host ranges (Table 3).
Identification of Genes Encoding Receptors for Six … 33
To further analyze phage receptors, the Tn5G transposon insertion banks of PAK
were constructed and used in the screening of the phage-resistant mutants. After
verifying with the double-player plate method, totally 23 mutants were selected,
including 6 strains resistant to phage O1, 8 strains resistant to phage O2, 2 strains
resistant to phage K1, 1 strain resistant to phage K2, 4 strains resistant to phage K3,
and 2 strains resistant to phage C10 (Fig. 1).
The adsorption efficiency was tested between phage-resistant mutants and the
corresponding phages. As shown in Fig. 1, all adsorption rates were significantly
lower than the parent strain PAK, ranging from 13.84% to 55.41% (Fig. 1). The
results implied that all the isolated phage-resistant mutants had their phage recep-
tors impaired.
34 J. You et al.
Fig. 1 Adsorption rates of the isolated phage-resistant mutants. PAK was used as control
With the spotting assay, the isolated phage-resistant mutants were discriminated by
testing the sensitivity to the six phages. The majority of them showed the same
patterns as the other members isolated from the same group with a few exceptions,
including RO1-4 and RO1-6, RK1-1, and RK3-1 (Table 4). The results suggested
the six phages may share common phage receptors.
With inverse PCR, totally 10 different genes were found disrupted in the 23 phage-
resistant mutants (Table 1). In the mutants resistant to phage O1, four genes were
found disrupted, including wbpO gene encoding UDP-glucose/GDP-mannose
dehydrogenase-like protein, wbpR gene encoding a glycosyltransferase, wbpL gene
encoding a glycosyl transferase group 4-like protein, and wbpV gene encoding a
NAD dependent epimerase/dehydratase-like protein. All mutants resistant to phage
O2 had the gene wzy disrupted and it encoded an O-antigen polymerase [28]. In the
mutants resistant to phage K1, RK1-1 had Tn5G inserted in the gene PAK_04826,
Identification of Genes Encoding Receptors for Six … 35
Fig. 2 Confirmation of the phage-resistant mutants. The recombinant plasmids carry the
corresponding genes, pXL1201 carrying wzy gene, pXL1503 carrying wbpO gene; pFJ501
carrying wbpV gene, pXL1509 carrying PA4367 gene, pXL1502 carrying wbpL gene, pXL1511
carrying PA5004 gene; pXL1504 carrying wbpR gene, pZM1502 carrying wbpT gene, and
pXL1511 carrying PA5001 gene
The target genes disrupted in the phage-resistant mutants were amplified and cloned
into the plasmid pUCP18. The resulting constructs were transformed into the
mutants to test the phage sensitivity of the transformants. As shown in Fig. 2, all the
cloned target genes can trans-complement the disrupted genes and restore the phage
sensitivity individually.
Gene bifA encodes a phosphodiesterase and can degrade the intracellular second
messenger c-di-GMP. In bifA mutant, the elevated c-di-GMP level inhibits the
swarming motility of bacterial cells [29]. The bifA mutant displayed the least
mobility ability, and the marginal region of the colony was much smaller than the
strain RK1-1/pXL1509 and the parent strain PAK (Fig. 3).
Identification of Genes Encoding Receptors for Six … 37
4 Discussion
Phage adsorption is the first step in the phage infection. P. aeruginosa phages
recognize a variety of molecules on the cellular surface as receptors to initiate the
infection process, such as flagella, pili, and LPS. LPS is composed of three parts,
including lipid A, core polysaccharide, and O antigen which has two different
forms, CPA (common polysaccharide antigen) and OSA (O-specific antigen). OSA
is L-heteroglycan, formerly called B-band. Multiple gene clusters are involved in
the biosynthesis of LPS. In our work, the disrupted gene wbpV, wbpR, wbpP,
wbpO, ssg, and wbpL direct involved in biosynthesis LPS [23]. The gene wbpL
encoded the enzyme that involved in synthesis of the O-antigen side chain of LPS.
Those gene were found related to the synthesis of phage receptors, demonstrating
that all the six P. aeruginosa phages recognize LPS as their receptors, though it’s
possible that the phages may recognize the different structures of LPS during the
adsorption step.
Among the ten disrupted genes, bifA gene was the only exception not directly
involved in the biosynthesis pathway of LPS. BifA is predicted to be a c-di-GMP
phosphodiesterase controlling the concentration of the second messenger c-di-GMP
which affects cell motility, extracellular polysaccharide production, and biofilm
formation [27]. The bifA mutant has the increased level of c-di-GMP, which leads
the increased synthesis of a polysaccharide produced by the pel locus and decreased
synthesis of OSA LPS [30]. And that’s may be the reason the bifA mutant is
resistant phage K1 infection.
In conclusion, all the six P. aeruginosa phages recognize LPS as their receptors.
The minor difference in the host ranges may imply different phages adsorb to the
different structures of LPS.
Acknowledgements This work was partly supported by The National Natural Science
Foundation of China (grant 31370205 and 30970114).
References
1 Introduction
H.-L. Liu
Key Laboratory of Industrial Fermentation Microbiology,
Ministry of Education, Tianjin University of Science and Technology,
Tianjin Economic-Technological Development Area (TEDA),
Tianjin 300457, People’s Republic of China
R.-M. Wang T.-F. Wang (&)
Key Laboratory of Shandong Microbial Engineering,
QILUUniversity of Technology, Jinan, Shandong, People’s Republic of China
e-mail: [email protected]
E.coli BL21(DE3), restriction enzymes, T4 DNA ligase, agarose gel DNA purifi-
cation kit were purchased from TaKaRa (Dalian, China). DNA sequencing and
primer synthesis were performed by Sangon Biotech (Shanghai, China) Co. Ltd.
The Pseudomonas putidaATCC47054 containing the treS gene was obtained from
American Type Culture Collection (ATCC; Manassas, VA, USA). All the chemi-
cals used in this study were purchased from Sinopharm Chemical Reagent Co. Ltd.
(Shanghai, China) unless otherwise specified. The strains, plasmids, and oligonu-
cleotides used in this study are summarized in Table 1.
The DNA fragments containing treS gene from Pseudomonas putida ATCC47054
were prepared with bacteria genome DNA extracting kit. The primer pair (P1/P2,
P3/P4 as shown in Table 1) were designed and synthesized for amplification of the
High Efficiency Expression of Trehalose Synthase in … 43
treS gene (gi = 1042893, NCBI). By using these primers, the treS gene was
amplified using pfu DNA polymerase by polymerase chain reaction (PCR) (2720
Thermal Cycler, Applied Biosystems, Foster, CA) and purified by using a QIA
quick polymerase chain reaction purification Kit (Qiagen, Valencia, CA). The PCR
products were cloned into pET15b and pET22b and transformed into E.coli DH5a
and screened. The DNA sequencing was performed to ensure no mutations
occurred during PCR. The purified pET15b-treS and pET22b-treS vector contain-
ing treS gene fragments were respectively digested by NdeI/BamHI and BamHI/
XhoI and respectively chem-transformed into E.coli BL21(DE3) for expression of
TreS. The pET15b expression vector containing N-terminal six His-tag used in the
experiments was generated for cytoplasmic expression of TreS under control of the
T7 lac promoter. The pET22b expression vector containing C-terminal six His-tag
was for periplasmic space expression of TreS under control of the T7 lac promoter.
The recombinant E.coli BL21(DE3)/pET15b-treS and E.coli BL21(DE3)/pET22b-
treS were obtained and named BL01 and BL02, respectively.
The culture sample was appropriately diluted with sterile water, the cell suspension
were centrifuged at 4 °C and 8000 g for 10 min and washed two times by sterile
water. The cell pellet was fastly dried for determining dry cell weight of per unit
44 H.-L. Liu et al.
volume. The cells were harvested by centrifugation at 8000 g for 10 min at 4 °C.
The wet cell pellet was suspended in 10 mmol/L potassium phosphate buffer (pH
7.5) and cells were cyclically disrupted two times by high-pressure homogenizer
(APV-2000, Germany) at 880 bar. The insoluble cell debris were removed by
centrifugation at 8000 g for 20 min 4 °C. The recombinant TreS was purified
using nickel-nitrilotriacetic acid affinity chromatography (Ni-NTA, Qiagen) as the
manufacturer recommended. The purified enzymes were analyzed on 15%
SDS-PAGE and protein concentration was determined by the method of Bradford
using BSA as a standard.
The optimal pH was determined by measuring the activity of purified TreS at pH
3.0–10.0 (pH 3.0–6.0, 20 mM citrate buffer; pH 6.0–8.0, 20 mM sodium phosphate
buffer; pH 7.0–9.0, 20 mM Tris-HCl buffer; and pH 9.0–11.0, 20 mM sodium
carbonate buffer). The optimal temperature of purified TreS in 10 mM sodium
phosphate buffer (pH 8.0) was measured at 10–65 °C by using maltose substrate.
The pure TreS in various pH values of buffer (as shown above) was incubated at
25 °C for 60 min to determine the pH stability. An equal volume of 10 mM sodium
phosphate buffer (pH 8.0) was added to maintain the pH at 8.0. The TreS in 10 mM
phosphate buffer (pH 8.0) was incubated at 10–65 °C for 60 min and then chilled in
ice water immediately for 5 min to determine the thermal stability.
The mixture reaction suspension was diluted to 10 times and centrifuged at 4 °C
and 12,000 g for 10 min. After removal of insoluble fraction, the supernatant was
filtrated by 0.45 lm filter membrane. The content of trehalose was identified by
high pressure liquid chromatography (HPLC, Shimadzu-GL Sciences, Japan). One
unit (U) of TreS was defined as the amount of enzyme required to produce 1 lmol
trehalose per hour.
Luria-Bertani (LB) medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L NaCL) was
used for flask cultures. The recombinant BL01 and BL02, stored at −80 °C, were
revived in 250 mL Erlenmeyer flasks containing 50 mL LB medium with 50 lg
ampicillin and grown at 37 °C and 200 rpm on rotary shakers for 10 h. Primary
seed culture (1 mL) was used to inoculate two 100 mL secondary LB medium and
grown for a further 8 h in a rotary shaker at 37 °C and 200 rpm. When the cell
density reached approximately 3.0 OD600nm, the culture temperature was slowly
cooled down and lactose was added to induce TreS expression for another 7 h.
Shake flask cultivation was performed in different culture conditions in order to find
optimal induction and growth conditions. To check the effects of the inducer
(lactose) concentration, induction temperature, induction pH and induction time on
the soluble intracellular expression of TreS, the recombinant BL01 was induced by
final concentration 4 g/L lactose at different temperature (22, 24, 27, 30, 34 and
High Efficiency Expression of Trehalose Synthase in … 45
37 °C) and different pH (pH 6.0, pH 6.5, pH 7.0, pH 7.5 and pH 8.0. During shake
flask cultivation, samples were taken for analysis of cell density and enzyme
activity of unit cell dry weight. All experiments were conducted at least in triplicate.
Aliquots (25 lL) from frozen cell banks of BL01 were used to inoculate 50 mL
primary seed culture with 50 lg ampicillin and grown at 37 °C for 10 h. Primary
seed culture (10 mL) was used to inoculate 100 mL secondary seed cultures with
100 lg/mL ampicillin and grown for a further 8 h at 37 °C. 200 mL secondary seed
cultures were used to inoculate 2.6 L defined mediumin the reactor vessel of a 5-L
bioreactor (Shanghai Bailun Co. Ltd). The optimized batch fermentation medium
was glucose 35 g/L, NH4Cl 5 g/L, K2HPO43HO 8 g/L, KH2PO4 (3 g/L), peptone
(7.5 g/L), yeast extract (5 g/L), MgSO47H2O (1.5 g/L), trace elements (0.5 mL/L),
and ampicillin (100 mg/L). Trace elements (400) was composed of CoCl26H2O
(1 mg/mL), MnCl24H2O (6 mg/mL), CuCl22H2O (0.6 mg/mL), H3BO3
(1.2 mg/mL), Na2MoO42H2O (1 mg/mL), Zn(II)acetate2H2O (5.2 mg/mL) and Fe
(III) citrate(40 mg/mL). Batch fermentation was carried out in fermentation medium
with initial glucose concentration of 35 g/L. Agitation was regulated at 800 rpm to
keep the dissolved oxygen nature with a constant sterile air flow rate 1 vvm or
maintain dissolved oxygen at between 20–30% by stirring and passing into the
oxygen. pH was maintained at 7.0 ± 0.2 by automatic pH control with additions of
250 g/L sodium hydroxide solution, and pH was maintained at 8.0 ± 0.2 by 10%
H3PO4 phosphoric acid solution. The temperature was controlled by a heating sleeve
and an integrated cooling system to 37 °C for cell growth, and 27 °C for induction
expression of TreS. Sampling was done every 2 h for analysis of residual glucose
concentration, acetic acid concentration, dry well weight (DCW) and the enzyme
activity of TreS after induction.
High maltose syrup (about 90.5 ± 1.2% maltose, 3.3 ± 0.8% glucose, 1.3 ± 0.2%
maltotriose, 4.5 ± 0.5% other polysaccharides) was used as substrate for its low
cost and easy available. High maltose syrup was mixed reaction with cell disrup-
tionsolution containing TreS (200 ± 10.0 U/g maltose) for 0–24 h with 100 rpm
agitation rate at 50 °C in a 10 L bioconversion tank. The weight % (w/v) of
trehalose was analyzed by HPLC (Shimadzu-GL Sciences, Japan). The apparatus
was equipped by an inertsil-NH2 column (4.6 250 mm, Shimadzu) at 40 °C.
Separation was achieved by pumping acetonitrile: water (75:25 v/v) through the
column at a flow rate of 1.0 mL/min for 20 min. The trehalose content in the
46 H.-L. Liu et al.
sample was identified by comparing with the HPLC curves produced by the tre-
halose standard (Sigma Co., St. Louis, USA) of various concentrations. The weight
conversion of trehalose (%) is ratio of the weight (g) of trehalose and the weight
(g) of maltose in high maltose syrup.
3 Results
100 mM phosphate buffers (pH 8.0) for 60 min, using 100 g/L maltose as a sub-
strate. To examine the thermal stability of TreS, the TreS were preincubated at
various temperatures (20–60 °C) for 60 min at pH 8.0. the residual activities were
measured at 25 °C. The optimal enzyme activity temperature was 25 °C, and was
relatively stable from 15 to 40 °C as shown in Fig. 2. But when the reaction
temperature was over 40 °C, and with the extension of time, the enzyme activity of
TreS decreased rapidly.
In order to better meet the scale-up application of recombinant TreS. The equal
amounts of purified TreS was added into phosphate buffer solution (pH 8.0) for
conversion reaction. The substrate maltose concentration in conversion system was
adjusted to 300, 200, 150, 100, 50 g/L, and the system temperature was controlled
at 20, 25, 30, 35, 40, 45, 50, 55 and 60 °C, and the conversion time was 12 h. The
yield of trehalose was analyzed by HPLC, and the conversion rate of maltose to
trehalose was compared. The results were as shown in Fig. 3. When the substrate
48 H.-L. Liu et al.
Fig. 3 The maltose conversion rate curves in different substrate high maltose syrup concentration
as with different temperature
maltose concentration was 50–100 g/L, the conversion ratio was firstly increased
and then decreased with the increase of system temperature, when the system
temperature was higher than 40 °C, the conversion rate decreased rapidly. When
the substrate maltose concentration was between 150–200 g/L, the conversion rate
was higher at 10–30 °C, with the increase of system temperature, the conversion
rate was slightly decreased. When the substrate maltose concentration was 300 g/L,
with the increase of system temperature, the conversion rate tends to balance, and
the conversion rate was over 58% at 50 °C. This reaction temperature is conducive
to prevent microbial contamination of conversion system. This phenomenon
showed that high substrate concentration of maltose syrup is beneficial to the
thermal stability of TreS. Therefore, the enzyme activity unit of TreS was defined as
the amount of enzyme required to produce 1 lmol trehalose per hour at 50 °C and
pH 8.0, when the substrate maltose concentration was 300 g/L.
For increasing the solution expression of TreS, the induction conditions were
optimized in LB medium. As shown in Fig. 2, the pH value of the medium was
gradually increased with the growth of BL01 in the LB medium of different initial
pH values. The occurrence of this phenomenon may be caused by the release of
High Efficiency Expression of Trehalose Synthase in … 49
ammonium ions in amino acids and so on. This phenomenon is good for the
stability of enzyme activities in the later stage of fermentation, because the optimal
pH of TreS was 8.0. The recombinant BL01 fermented for 6 h in pH constant LB
medium, and the fermentation temperature 37 °C, induction temperature 27 °C and
induction time 7 h by final concentration 4 g/L lactose, the growth curves as shown
in Fig. 4, the enzyme activity of unit dry cell weight as shown in Fig. 5. The results
showed that the growth of recombinant BL01 was optimal in pH 7.0–7.5, and the
enzyme activity of unit dry cell weight was optimal in pH 8.0. Under this condi-
tions, the enzyme activity could reach 17,730 ± 673 U per gram dry cell weight.
So neutral environment was conducive to the growth of BL01, and the partial
alkaline environment (pH 8.0) was conducive to the expression of TreS.
The recombinant BL01 fermented for 6 h at 37 °C in LB medium of constant pH
7.0, and induced for 7 h using final concentration 4 g/L lactose at different tem-
perature, the growth curves as shown in Fig. 6, and the enzyme activity as shown in
Fig. 7. The results showed that the induction temperature at 27–30 °C was not only
beneficial to the growth of the bacteria, but also was beneficial to increase the
enzyme activity of unit dry cell weight. When the induction temperature was at 22
or 24 °C, the biomass of BL01 was decreased firstly and then increased slowly, and
the biomass and enzyme activity was lower at the end of induction. When the
temperature was at the 34 or 37 °C, the cell growth rate was faster, the final OD600
value was higher in the same fermentation time. But with extension of induction
time, the enzyme activity of unit dry cell weight was lower than 27–30 °C, and cell
autolysis in the late stage of induction. Although the amount of bacteria at
50 H.-L. Liu et al.
Fig. 6 The enzyme activity curves of BL01 unit dry cell weight with different fermentation pH
27–30 °C induction was slightly lower than that of 34 and 37 °C, but the enzyme
activity of unit dry cell weight was relatively higher, and avoided cell autolysis. So
the induction temperature 27–30 °C was the optimal choice for high efficiency
soluble expression of TreS in BL01.
High Efficiency Expression of Trehalose Synthase in … 51
Fig. 7 The OD600 curves of BL01 growth with different induction temperature
Upscalling of active TreS production in BL01 was performed firstly in batch fer-
mentation. Seed culture (200 mL) was inoculated into a 5 L fermentor with 2.6 L
culture medium for fermentation. The pH was automatically controlled at 7.0 by
adding NaOH solution (5 M) before induction, and the pH was naturally increasing
to pH 8.0 after induction, and was automatically controlled at 8.0 ± 0.5 by adding
10% phosphoric acid solution. The temperature was maintained at 37 °C before
induction and 27 °C after induction. The ventilation quantity was controlled at
1 vvm, and stirring speed was controlled at 800 rpm. When the dissolved oxygen
increased rapidly from the lowest, adding 4 g/L final concentration lactose into
culture medium for 7 h induction and the dissolved oxygen (DO) level was
maintained 15–20% of saturation by cascading the agitation speed (100–400 rpm)
and aeration rate (0.5 vvm). Figure 8 showed that dissolved oxygen in fermentor
decreased close to zero at fermentation 6 h, and dissolved oxygen rised rapidly the
continued after 2 h, and the content of reducing sugar in the medium was reduced
to 1.67 ± 0.4 g/L by HPLC analysis. At this time, the lactose was added to induce
for avoiding the metabolism of glucose repression. As the dry cell weight growth
curve shown, the maximum dry cell weight can be reached 10.1 ± 0.4 g/L, and the
dry cell weight was 9.64 ± 0.38 g/L after induction. The acetic acid curve in Fig. 9
showed that and the acetic acid content in fermentation broth was rising with
recombinant bacteria growth, and reached 8.65 ± 0.11 g/L at 9 h. Subsequently,
acetic acid content has a downward trend, because the carbon source reduced in
culture medium, the recombinant bacteria use acetic acid as carbon. Acetic acid
52 H.-L. Liu et al.
content was still greater than 7 g/L at the end of fermentation, this is the main cause
of cell autolysis in the induction process. Figures 10 and 11 showed that the
enzyme activity of unit dry cell weight began to increase rapidly from 2 h in the
induction process, and the enzyme activity of unit dry cell weight tended to be
stable at 7 h, and the highest enzyme activity reached 39,866 ± 1420 U per gram
dry cell weight. the pH value showed an upward trend with extension of induction
time during induction.
Oxygen represents an important regulatory stimulus in aerobic bacteria. To
obtain the optimal growth of E.coli resulting in high yields of active TreS, oxygen
saturations of about 10 and 50% and a lack of oxygen were analyzed. Fermentation
with an oxygen level of about 20% resulted in a dry cell weight of
15.68 ± 0.33 g/L before induction and 12.6 ± 0.48 g/L after induction. the
enzyme activity of about 38,967 ± 1223 U per gram dry cell weight. The 10%
oxygen saturation during the fermentation process was responsible for a massive
loss of enzyme activity although a dry cell weight of 9.68 ± 0.93 g/L was reached.
An increase of the oxygen level to 40% yielded very high dry cell weight of
15.98 ± 0.73 g/L, whereas the enzyme activity reached nearly the same value as
fermentation at 20% oxygen saturation. The maximum content of acetic acid in the
fermentation broth reached 2.76 ± 0.13 g/L in 20% oxygen saturation, far less than
the uncontrolled oxygen fermentation. So using 20% oxygen saturation during
batch fermentation higher dry cell weight and higher enzyme yield could be
achieved.
Fig. 8 The enzyme activity curves of BL01 unit dry cell weight with different induction
temperature
High Efficiency Expression of Trehalose Synthase in … 53
Fig. 10 The enzyme activity of BL01 unit dry cell weight in with different fermentation time
54 H.-L. Liu et al.
Fig. 11 The TreS SDS-PAGE of BL01 under the same cell mass with different fermentation time
The recombinant cells containing TreS were crushed by high pressure homoge-
neous machine. Then the cell disruption was directly used to convert high maltose
syrup for 24 h with 60 rpm agitation rate at 50 °C and pH 8.0. The content of
trehalose was analyzed by HPLC. In order to improve the yield of trehalose in
conversion system, the effects of temperature and pH on enzyme activity were
studied respectively. As shown in Fig. 12, the highest production of trehalose was
193.5 ± 5.0 g/L at pH 8.0 for 24 h with 300 g/L high maltose syrup as substrate.
Under this condition, the trehalose conversion rate can reach 64.5 ± 1.6%. The
yield of trehalose was decreased when the temperature was higher than 60 °C or
lower than 45 °C. The reason why the trehalose yield reduced below 45 °C may be
caused by protease degradation in cell lysate or pH descent for microbial con-
tamination, while the low yield of trehalose when the temperature was higher than
60 °C may be caused by enzyme denaturation. The results showed that higher
reaction temperature (50 °C) not only reduced microbial contamination, but also
promoted the yield of trehalose. Therefore, this temperature was beneficial for
industrial production in our process. As shown in Fig. 13, the highest trehalose
yield was reached 193 ± 2.0 g/L at 50 °C for 24 h with 300 g/L maltose as sub-
strate, and 64.3 ± 0.6% maltose was converted into trehalose. Meanwhile, the TreS
was highly stable over a broad pH range of 6.5–8.5, retaining more than 92% of its
original yield. Above all, the optimal conditions of converting maltose into tre-
halose was 50 °C, pH 7.5–8.0 and 300 g/L maltose as substrate.
High Efficiency Expression of Trehalose Synthase in … 55
Fig. 12 The yield curves of trehalose under the same substrate high maltose syrup concentration
(300 g/L) with different reaction temperatures
Fig. 13 The yield curves of trehalose under the same substrate high maltose syrup concentration
(300 g/L) with different reaction pH values
56 H.-L. Liu et al.
4 Discussion
In recent years, the production enterprises of high maltose syrup was gradually
increasing, the price of high maltose syrup was reduced gradually because of
enterprise competition and market oversupply. So this pathway of converting
maltose into trehalose has been considered to be an effective way to bring economic
benefits for enterprises and a convenient and economical biocatalyst process for
industrial production of trehalose. However, scale-up production of TreS is still a
main limited factors for large-scale production of trehalose. In this study, we have
solved the problem by constructing recombinant E.coli that expressed soluble TreS,
which promoted the industrialization pace. The high level expression of recombi-
nant TreS in E.coli, the production of trehalose by recombinant TreS were the
objects of these investigations.
In order to obtain high enzyme activity of unit dry cell weight, induction con-
ditions were optimized. Solubility is a key issue for the production of recombinant
protein in heterologous expression systems. Soluble recombinant proteins are often
properly folded, functional and easier to purifiy than aggregated proteins from
inclusion bodies. We have developed a strategy to drive the expression of TreS in
BL01. Our strategy was designed for expression of TreS under the control of the T7
lac promoter. Our data show that we have achieved the expression of TreS as an
intracellular soluble in the BL01. This results were achieved at a growth temper-
ature of 37 °C and at a growth pH of 7.0, induction temperature of 27 °C, induction
pH of 8.0, induction lactose final concentration of 4 g/L, induction time of 7 h. The
enzyme activity of unit dry cell weight reached 3.9 104 U per gram dry cell
weight.
In order to reduce the purification cost of recombinant TreS and the loss of
enzyme activity in the purification process, the cells lysis solution of BL01 was
directly used to product trehalose, and the application of crude enzyme avoided the
tedious purified steps of TreS. More than 64% maltose using substrate high maltose
syrup concentration 300 g/L can be converted into trehalose at 50 °C, and pH 8.0
for 24 h in a 10 L reaction system.The research showed that 300 g/L maltose
concentration as substrate has a protective effect on TreS, which improves the
temperature tolerance and thermal stability of TreS. The high conversion temper-
ature not only avoided microbial contamination, but also save energy and reduce
consumption.
In this study, TreS was expressed in BL01 intracellular by lactose induction,
which avoided the use of IPTG, so the production process of trehalose was safe
without any chemical addition. The production process of TreS using the break
fluid of recombinant E.coli BL21(DE3) is a new technological breakthrough. It will
provide a new direction for the industrial production of trehalose. We expect such
high efficient and green process can be widely applied in industrial production.
High Efficiency Expression of Trehalose Synthase in … 57
5 Acknowledgments
This work was supported by the National Nature Science Foundation of China
(No. 31501413), Shandong higher education research project (J14LE02), and the
Foundation (No. 2016IM005) of Key Laboratory of Industrial Fermentation
Microbiology of Ministry of Education and Tianjin Key Lab of Industrial
Microbiology (Tianjin University of Science & Technology).
References
1. Elbein AD, Pan YT, Pastuazak I, Carroll D (2003) New insights on trehalose: a
multi-functional molecule. Glycobiology 13(4):17–27
2. Whatmore AM, Reed RH (1990) Determination of turgor pressure in Bacillus subtilis: a
possible role for K+ in turgor regulation. J Gen Microbiol 136(12):2521–2526
3. Carpinelli J, Kraemer R, Agosin E (2006) Metabolic engineering of Corynebacterium
glutamicum for trehalose over production: role of the TreYZ trehalose biosynthetic pathway.
Appl Environ Microbiol 72(3):1949–1955
4. Murphy HN, Stewart GR, Mischenko VV, Apt AS, Harris R, McAlister MS, Driscoll PC,
Young DB, Robertson BD (2005) The OtsAB pathway is essential for trehalose biosynthesis
in Mycobacterium tuberculosis. J Biol Chem 280(15):14524–14529
5. Higashiyama T (2002) Novel functions and applications of trehalose. Pure Appl Chem
74(7):1263–1269
6. Kempf B, Bremer E (1998) Uptake and synthesis of compatible solutes as microbial sTreSs
responses to high-osmolality environments. Arch Microbiol 170(5):319–330
7. Rueda B, Miguelez EM, Hardisson C, Manzanal MB (2001) Changes in glycogen and
trehalose content of Streptomyces brasiliensis during growth in liquid cultures under
sporulating and non-sporulating conditions. FEMS Microbiol Lett 194(2):181–185
8. Crowe LM (2002) Lessons from nature: the role of sugar in anhydrobiosis. Com Biochem
Physio A-molecular Integr Physiol 131(3):505–513
9. Duong T, Barrangou R, Russell WM, Klaenhammer TR (2006) Characterisation of the tre
locus and analysis of trehalose cryoprotection in Lactobacillus acidophilus NCFM. Appl
Environ Microbiol 72(2):1218–1225
10. Rao V, Gao F, Chen B, Jacobs WR Jr, Glickman MS (2006) Trans-cyclopropanation of
mycolic acids on trehalose dimycolate suppresses Mycobacterium tuberculosis induced
inflammation and virulence. J Clin Invest 116(6):1660–1667
11. Schwendeman SP, Constantino HR, Gupta RK, Siber GR, Klibanov AM, Langer R (1995)
Stabilization of tetanus and diphtheria toxoids against moisture induced aggregation. Proc
Natl Acad Sci USA 92(24):11234–11238
12. Jain NK, Roy I (2008) Role of trehalose in moisture induced aggregation of bovine serum
albumin. Eur J Pharm Biopharm 69(3):824–834
13. Crowe JH, Leslie SM, Crowe LM (1994) Is vitrification sufficient to preserve liposomes
during freeze drying. Cryobiology 31(4):355–366
14. Guo N, Puhlev I, Brown DR, Mansbridge J, Levine F (2000) Trehalose expression confers
desiccation tolerance on human cells. Nat Biotechnol 18(2):168–171
15. Eroglu A, Russo MJ, Bieganski R, Fowler A, Cheley S, Bayley H, Toner M (2000)
Intracellular trehalose improves the survival of cryopreserved mammalian cells. Nat
Biotechnol 18(2):163–167
16. Eroglu A, Toner M, Toth TL (2002) Beneficial effect of microinjected trehalose on the
cryosurvival of human oocytes. Fertil Steril 77(1):152–158
58 H.-L. Liu et al.
17. Lee JH, Lee KH, Kim CG, Lee SY, Kim GJ, Park YH, Chung SO (2005) Cloning and
expression of aTreS from Pseudomonas stutzeri CJ38 in Escherichia coli for the production
oftrehalose. Appl Microbiol Biotechnol 68:213–219
18. Yue M, Wu XL, Gong WN, Ding HB (2009) Molecular cloning and expression of a novel
TreS gene from Enterobacter hormaechei. Microb Cell Fact 8:34
19. Wu X, Ding H, Yue M, Qiao Y (2009) Gene cloning, expression, and characterization of a
novel TreS from Arthrobacter aurescens. Appl Microbiol Biotechnol 83(3):477–482
20. Kim TK, Jang JH, Cho HY, Lee HS, Kim YW (2010) Gene cloning and characterization of a
TreS from Corynebacterium glutamicum ATCC13032. Food Sci. Biotechnol 19(2):565–569
Functional Modification
of the Substrate-Binding Site
for Isomaltulose Production Based
on Predicted Structure of Sucrose
Isomerase from Pantoea dispersa UQ68 J
1 Introduction
H. Liu X. Xing F. Lu Y. Li
College of Biotechnology, Tianjin University of Science & Technology,
Tianjin 300457, China
H. Liu X. Xing F. Lu Y. Li (&)
Key Laboratory of Industrial Microbiology, Ministry of Education,
College of Biotechnology, Tianjin University of Science and Technology,
Tianjin 300457, China
e-mail: [email protected]
The Sim1 was cloned into pET22-b vector, E. coli DH5a was used for genetic
manipulation, and E. coli BL-21 (DE3) was used for the expression of Sim1 and its
mutants. Bacterial strains and plasmids used in this study are summarized in
Table 1. The mutants were further confirmed by DNA sequencing.
The sequence from the P. dispersa UQ68 J (Gene accession number AY223549)
has a 1797-bp of open reading frame (ORF) encoding 598 amino acids residues.
The amino acids residues of Sim1 include the predicted 33-amino-acid signal
peptide, and PCR primers were designed for cloning the Sim1 gene (without
noncoding regions and signal sequences) into expression vector of pET-22b. The
forward primer (5′-CGC GGA TCC AAT GGC AAC GAA TAT AGA-3′) included
a BamH I restriction site and a start codon. The reverse primer (5′-CCC AAG CTT
GTT CAG CTT ATA GAT CCC GG-3′) included a Hind III restriction site and a
stop codon. The wild-type Sim1 was set up in 5 mL of LB medium with 50 lg/mL
of Ampicillin in 30-mL test tubes. Cells were grown at 37 °C with shaking at 250
rev/min. Isopropyl-b-D-thiogalactopyranoside (IPTG) was added to a final con-
centration of 0.5 mM until an OD600 of 0.6–0.8 is reached, and the cultures was
continued to incubate for 12 h at 20 °C. After the incubation, an appropriate vol-
ume of culture was used for protein quantification, sodium dodecyl sulfate poly-
acrylamide gel electrophoresis (SDS-PAGE), and quantification of the conversion
efficiency from sucrose to isomaltulose and trehalulose.
20 lL of samples were injected into the TSK gel Amide-80 (TOSOH) column
(4.6 mm 25 cm) for measurement of the sugar composition in the reaction
products. The isocratic mobile phase was acetonitrile: water (90:10), and the
temperature was 80 °C [16, 17]. All sugar quantification data presented below were
obtained by this method, and calibration against a dilution series of sugar standards
was performed for every sample batch. One unit of activity is defined as the amount
of enzyme required to catalyze formation of 1 lmol of isomaltulose in 1 min under
assay conditions [15].
The effect of pH and temperature to enzyme activity was evaluated between pH
4.0 and 9.0 and 20–60 °C using 0.1 mM of sodium citrate (pH 4.0–6.0), sodium
phosphate (pH 6.0–8.0), and Tris-HCl (pH 8.0–9.0) buffers. Heat inactivation of the
enzyme was examined at 30, 40, 50, and 60 °C.
The conversion of sucrose was carried out in the test tube containing 10 mL of 50%
sucrose solution and 1 mL of enzyme at 35 °C in the shaking water bath for 4–6 h,
the reactions were stopped by boiling for 10 min [16, 17]. To study the effects of
mutants on product formation, the same amount of enzymes of wild type and
mutants were incubated separately with the 10 mL of 50% sucrose at 25–45 °C
intervals, and the products were subjected to HPLC analysis as described above.
Fig. 1 The effect of the pH (a), temperature (b) and sucrose concentration (c) to Sim1
The activity decreased rapidly when the temperature was over 50 °C. Sim1 was
active at pH 4.5–8.0, and the high activity was observed at pH 5.5–6.5 (Fig. 1b).
Sim1 showed the maximal isomaltulose conversion concentration at 50% substrate
sucrose (Fig. 1c). Therefore, the best conversion condition of isomaltulose is 50%
of sucrose solution at 40 °C and pH 6.0.
The stability of Sim1 were investigated. It exhibited the pH stability was well at
pH 4.5–6.5, and more than 80% of the maximal activity was retained (Fig. 2a). The
enzyme activity was examined at different storage temperatures, and 80% of the
enzyme activity was retained when the enzyme was incubated at 20–50 °C for
30 min. However, there is only 32% residual activity at 55 °C (Fig. 2b).
Four products catalyzed by Sim1 were analyzed with HPLC and saccharides were
identified by comparison with standards. Figure 3 showed the HPLC results of the
reaction products catalyzed by Sim1. Four products (isomaltulose, trehalulose,
glucose, and fructose) were identified by the method described above. We calcu-
lated the relative percentage of individual sugar based on its peak area.
64 H. Liu et al.
Dispersa UQ68 J, which was previously reported to show the high efficiency and
specificity for production of isomaltulose from sucrose, has a sucrose isomerase
gene that was different from other characterized SI family members previously [18].
The protein sequence alignment of Sim1 exhibited 64–74% with/without the signal
peptide to other known SIs encoding sequences.
The sequence of Sim1 revealed that it is different from those of other species. It
contains a 1698-bp ORF encoding 565 amino acids, excluding a 33-amino-acid
signal sequence (GenBank accession number AY223549). The protein sequence of
the Sim1 was submitted in NCBI, it showed that the sucrose isomerase from
Klebsiella sp. LX3 is the highest similarity sequence as the model structure. The
obtained 3D structure of the Sim1 was energy minimized using Smart Minimizer
algorithm (Discovery Studio 3.0, default parameters) until the potential energy of
the system became constant. The 3D structure of the Sim1 was simulated based on
the crystal structure of Klebsiella sp. LX3 isomaltulose synthase (PDB ID: 1M53).
The structural model of Sim1 obtained by energy minimization showed the relative
positions of a-helices and b-sheets in the 3D structure of the proteins (Fig. 4a). The
predicted 3D model of Sim1 seemed to share a conserved barrel (a/b)8 domain for
sucrose-binding and glycosidase activities with all other SIs and glycosidase [19,
20]. A “RLDRD” motif in proximity to the active site is also well conserved in the
predicted 3D model of Sim1. This motif is considered to be responsible for sucrose
isomerization. The substrate sucrose was located over the TIM barrel and was
bound to the residues D69, R206, D208, E262, R292, R300, H335, D336, E395,
and R423 through hydrogen bonds. It also formed hydrophobic interaction with
F152, and F264 (Fig. 4b).
Functional Modification of the Substrate-Binding Site for … 65
Fig. 4 The simulated 3D structure. a The simulated 3D structure of the P. dis Sim1; b The
interaction between sucrose and Sim1. The sucrose was modeled based on the alignment of Sim1
and sucrose isomerase NX-5 (PDB ID: 4HPH)
It was reported that the specificity for major product formation was regulated not
only by the “RLDRD” motif [21], but also by some other region(s) or other key
residues surrounding the binding site. Table S3 includes residues in these enzymes
that vary from the residues in other SIs particularly close to the “RLDRD” motif.
The F296 was located behind “RLDRD” motif in Sim1. However, it was not
conserved in the isomerase family. Isomerase enzymes from Klebsiella sp.,
E. rhapontici, P. rubrum and P. mesoacidophila showed aspartic residue. There is
tyrosine residue from P. mesoacidophila at this position. Therefore, Y296 was
replaced with aspartic, glutamic, phenylalanine, and histidine, respectively (Y296D,
Y296E, Y296F, and Y296H). The P297 was replaced with aspartic and glutamic.
The Q299 was replaced with glutamic, aspartic, asparagine, and knocking down,
respectively (Q299E, Q299D, Q299N, DQ299). The sim1 mutants kept the similar
activity to wild type (Table 2).
The Sim1 was cloned into pET22-b vector, and overexpressed in BL21(DE3).
Furthermore, the culture conditions were determined. To investigate Sim1’s activity
and the importance of residues located behind “RLDRD” motif at active site, the
mutants of Sim1 kept the similar activity with the wild type. However, the
replacement of Q299 to glutamic acid (Q299E) increased the percentage of iso-
maltulose and decreased the percentage of trehalulose in the reaction products,
while the mutants has minor impact on the formation of productions compared with
wild-type. It is interesting that the mutant of deleting Q299 showed the contrary
phenomenon to Q299E. It decreased the conversion percentage of isomaltulose, but
increased trehalulose in the reaction products. It is suggested that the conserved
Q299 is important for the products specificity at the active site. On the other hand,
the replacement of Tyrosine 296 to Aspartic enhanced the percentage of glucose
and fructose in the reaction production by about 2-fold.
66 H. Liu et al.
Fig. 5 a The docking simulation of isomaltulose (yellow orange) and trehalulose (green) to the
Sim wide-type. b The hydrogen bond between isomaltulose and Q299 of Sim1
To explain the product specificity of SIs, isomaltulose and trehalulose were docked
into the binding site of Sim1 using the CDOCKER protocol in Accelrys Studio (DS
3.5). The docking results are listed in Table 2. The isomaltulose and trehalulose
products were well docked in the active site (Fig. 5). Q299 could form hydrogen
bond with the fructofuranose moiety of isomaltulose at substrate-binding site rather
than trehalulose, which preferred to bind isomaltulose. Q299E was considered to
strengthen the hydrogen bond interaction between isomaltulose and Glutamine. The
simulated model is consistent with the experimental data (Table 2). In Table 3, the
calculated binding energy of isomaltulose bond to Sim1 is higher than that of
trehalulose. In the docking simulation of Sim1 mutants with isomaltulose, Q299E
(48.68 kJ/mol) exhibited higher binding energy than wild-type (45.33 kJ/mol), and
DQ299 (43.64 kJ/mol). Furthermore, DQ299 (42.08 kJ/mol) exhibited higher
Functional Modification of the Substrate-Binding Site for … 67
binding energy than Sim1 (39.04 kJ/mol), and Q299E (36.87 kJ/mol) in docking
simulation of those with trehalulose. Furthermore, sim1 (DQ299) broke down the
charge balance because the negative charge of glutamine was missing. Therefore, it
could affect the binding ability with sugar molecular and change the product
specificity. The analysis of binding energy to isomaltulose and trehalulose are also
consistent with the experimental data that the isomaltulose is more suitable for
binding to the substrate-binding site of Sim1.
Our molecular docking simulation and experimental data studies demonstrated
the loop 296–299 of Sim1, as well as the mutants of Q299E, DQ299, and Y296D
showed significant difference on product specificity. This research will provide a
platform for solving the problem of converting sucrose to isomaltulose and tre-
halulose effectively.
References
10. Cho MH, Park SE, Lim JK et al (2007) Conversion of sucrose into isomaltulose by
Enterobacter sp. FMB1 an isomaltulose-producing microorganism isolated from traditional
Korean food. Biotechnology 29:453–458
11. Ahn SJ, Yoo JH, Lee HC et al (2005) Enhanced conversion of sucrose to isomaltulose by a
mutant of Erwinia rhapontici. Biotechnol Lett 25:1179–1183
12. Ren B, Li S, Xu H et al (2011) Purification and characterization of a highly selective sucrose
isomerase from Erwinia rhapontici NX-5. Bioprocess Biosyst Eng 34:629–637
13. Watzlawick H, Mattes R (2009) Gene cloning protein characterization and alteration of
product selectivity for the trehalulose hydrolase and trehalulose synthase from “Pseudomonas
Mesoacidophila” MX-45. Appl Environ 75:7026–7036
14. Karnaouri AC, Topakas E, Christakopoulos P (2014) Cloning, expression, and characteri-
zation of a thermostable GH7 endoglucanase from Myceliophthora thermophila capable of
high-consistency enzymatic liquefaction. Appl Micro Biotechnol 98:231–242
15. Holub I, Gostner A, Theis S et al (2010) Novel findings on the metabolic effects of the low
glycaemic carbohydrate isomaltulose (Palatinose™). Brit J Nutr 103:1730–1737
16. Li S, Cai H, Qing Y et al (2011) Cloning and characterization of a sucrose isomerase from
Erwinia rhapontici NX-5 for isomaltulose hyperproduction. Appl Biochem 163:52–63
17. Jonker D, Lina BA, Kozianowski G (2002) 13-Week oral toxicity study with isomaltulose
(Palatinose) in rats. Food Chem Toxic 40:1383–1389
18. Kawai K, Okuda Y, Yamashita K (1985) Changes in blood glucose and insulin after an oral
palatinose administration in normal subjects. Endocrinol Jpn 32:933–936
19. Uitdehaag JC, Mosi R, Kalk KH (1999) X-ray structures along the reaction pathway of
cyclodextrin glycosyltransferase elucidate catalysis in the alpha-amylase family. Nat Struct
Mol Biol 6:432–436
20. Lipski A, Watzlawick H, Ravaud S et al (2013) Mutations inducing an active-site aperture in
Rhizobium sp. sucrose isomerase confer hydrolytic activity. Acta Crystallogr Sect D Biol
Crystallogr 69:298–307
21. Nakayama A, Yamamoto K, Tabata S (2001) Identification of the catalytic residues of
bifunctional glycogen debranching enzyme. J Biol Chem 276:28824–28828
Construction of the Escherichia
coli-Bacillus subtilis Shuttle Vector pBE2R
and Identification of the Critical Residues
Involved in the Autoprocessing
of the Propeptide of the Alkaline Protease
1 Introduction
The serine alkaline protease, secreted from a wide variety of Bacillus species, is an
important industrial enzyme and a model system for protein engineering. The
alkaline protease can be widely used in washing powders and dehairing hides for its
high activity and stability. The alkaline protease generally secreted extracellular for
the purpose of scavenging nutrients is specific for aromatic or hydrophobic resi-
dues, such as tyrosine, phenylalanine and leucine. However, they are highly sen-
sitive to phenyl methyl sulphonyl fluoride and diisopropyl-fluorophosphate. The
Bacillus-originated alkaline proteases are mesophilic enzymes with a molecular
weight range of 15–30 kDa and an isoelectric point near pI 9. They reflect high
activity at 50–70 °C, however, the activity were reduced significantly at low
temperature, like 20 °C [1].
Directed evolution has rapidly emerged as a powerful strategy for improving the
characteristics of various enzymes in a targeted manner. To generate large gene
variant libraries, it is possible to optimize an enzyme for its specific applications
through combining error-prone PCR or DNA shuffling with the high-throughput
screening which is used to select the specific properities of an enzyme, such as
thermostability, catalytic activity and substrate specificity [2]. Therefore, it is
available to improve the activity of the alkaline protease at low temperature through
the directed evolution. The construction of the mutant library was a key step in the
process of the alkaline protease directed evolution. In this report, a new Escherichia
coli-Bacillus subtilis shuttle vector pBE2R was constructed to establish a platform
for the high-throughput screening of the alkaline protease in the process of the
alkaline protease directed evolution.
The alkaline protease derived from Bacillus alcalophilus TCCC11263 can be
expressed successfully in B. subtilis WB600 by using the pBE2R vector [3]. Apart
from this, in the process of construction of the pBE2R vector we found that the
correct cleavage of the propeptide after secretion was significant for the formation
of the functional protein. As other subtilisins, the B. alcalophilus TCCC11263
alkaline protease of 380 residues is synthesized as an inactive precursor that is
composed of a 27 residues signal peptide for protein secretion, a 84 residues
propeptide for folding and formation of the active protease and a 269 residues
mature peptide for the catalytic protein. The signal peptide is cleaved as the protein
crosses the inner membrane, and the propeptide remains covalently attached until
the protein is secreted from the cell [4]. The propeptides are relatively common in
Bacillus secretory proteins, and they are divided into two different kinds, long and
short [5]. The propeptide region generally functions as a facilitator of folding,
stability, and even secretion of the protein. In most cases, the propeptide domain is
cleaved from the enzymatic domain autocatalytically to release an active protease.
Removal of the propeptide by autocleavage during processing is crucial for the
secretion and production of subtilisins [6]. Takahashi et al. [7] showed that the
autoprocessing efficiency of a subtilisin E mutant with altered specificity for acid
residues was improved by substituting the autoprocessing site Tyr-1 with Asp or
Glu. Grande et al. [8] reported that insertion within a 9-amino-acid region in the
propeptide caused dramatic reduction in LasA enzymatic activity. All mutant
proLasA proteins were still secreted, but extracellular stability was low due to
clustered insertions within the propeptide. However, little is known about the
critical residues involved in the autoprocessing of the B. alcalophilus alkaline
protease. Therefore, another primary goal of this study was to identify the critical
residues correlated to the autocleavage of the propeptide of the B. alcalophilus
alkaline protease.
P43 promoter is a strong promoter containing two overlapping promoters which are
recognized in vitro by r55- and r37-containing RNA polymerase holoenzymes
from B. subtilis [9]. The 317 base pair length fragment P43 promoter was released
from the plasmid pWB980 by digestion with EcoR I and KpnI. The fragment was
isolated by gel purification and inserted into the MCS of the pBE2 vector direc-
tionally. Cohesive ends ligation of both fragments resulted in the plasmid pBE2a.
Then the DNA fragment containing signal peptide and pro-peptide of alkaline
protease derived from B. alcalophilus TCCC11263 was amplified by the
Polymerase Chain Reaction (PCR). Based on the DNA sequence of the alkaline
protease (aprE) of B. alcalophilus reported on NCBI, a primer pair (Psp1 and Psp2)
(Table 1) with indicated engineered restriction sites were designed to amplify the
signal peptide and pro-peptide gene (sp).
The KpnI-BamH I fragment of the PCR product was inserted into pBE2a
directionaly, forming plasmid pBE2R. Then the pBE2R was transformed into
E. coli DH5a. The pBE2R was sent to Shanghai Sangon Biological Engineering
Technology & Services Co., Ltd for DNA sequencing.
The mature peptide encoding gene of alkaline protease was introduced into the
pBE2R to detect the function of the new shuttle vector. A primer pair (Pmp1and
Pmp2) (Table 1) were designed to amplify the mature peptide encoding gene. The
BamH I-SalI fragment of the PCR product of the mature peptide (mp) was intro-
duced into pBE2R directionaly to generate pBE2R-mp. Then the recombinant
plasmid was transformed into B. subtilis WB600 to express the alkaline protease.
Four pairs primers were designed to amplify the fragment of signal and
pro-sequences of alkaline protease with the different insertional positions of
restriction site around the region between propeptide and mature peptide. The
BamH I-SalI fragments of PCR products were inserted into the pBE2a to construct
plasmids containing different insertional positions. According to the insertional
position, The recombinant plasmids were named pBE2a∷Rs109, pBE2a∷Rs110,
pBE2a∷Rs111, pBE2a∷Rs112, respectively. The mature peptide encoding gene was
amplified by PCR. Then the PCR products were introduced into the recombinant
plasmids described above, generating plasmids pBE2a∷Rs109-mp′, pBE2a∷Rs110-
mp′, pBE2a∷Rs111-mp′ and pBE2a∷Rs112-mp′. Meanwhile, a recombinant plas-
mid pBE2a-apr containing the signal and pro-sequences, as well as the mature
sequence of the alkaline protease was constructed without the insertion of restric-
tion site at the junction between propeptide and mature peptide. Then these
recombinant plasmids were transformed into the B. subtilis WB600 to express the
alkaline protease. The skim milk plate containing Kanamycin (30 µg/mL) was used
to screen the mutants preliminarily.
The SDS-PAGE was employed to detect the relative content of the extracellular
proteins. The hosts were cultured in 100 mL LB medium containing Kanamycin
(30 µg/mL) at 37 °C for 48 h. Supernatants and the cells were harvested by cen-
trifugation at 4 °C and 5000g for 10 min, respectively. Supernatants were precip-
itated with 100% TCA at −20 °C for 5–10 min and then 4 °C for 12 h. Centrifugating
at 4 °C and 5000g for 10 min to collect the precipitate. The precipitate was washed
by acetone for three times and volatiled thoroughly. Then the precipitates were dis-
solved with the 1 loading buffer before they were boiled. The cells collected by
centrifugation described above were suspended with 40 µL of distilled water and
10 µL of 1 loading buffer. Then the solutions were boiled at 100 °C for 20 min
before loading. SDS-PAGE was performed in a 30% polyacrylamide gel.
3 Results
6000bp pBE2
1000bp
P43
250bp
74 R. Wei et al.
6000bp pBE2a
1000bp
Pro-sequence
250bp
The new constructed shuttle vector pBE2R can be used in the directed evolution of
the alkaline protease. The mutational gene encoding mature peptide of the alkaline
protease produced by error-prone PCR and DNA shuffling can be inserted into the
MCS of pBE2R with the connection of BamH I. Therefore, the pBE2R provided a
convenient tool for the high-throughput screening of the forward mutation in the
directed evolution of the alkaline protease.
In the process of pBE2R construction, we found that the insertional position of
BamH I which was located at the junction between the propeptide and mature peptide
had a significant effect on the activity of the alkaline protease. It was indicated that the
inactive protease was due to the aborting autoprocessing of the propeptide after
secretion. Five recombinant plasmids pBE2a∷Rs109*pBE2a∷Rs112 and pBE2a-
apr were constructed to detect the critical residues involved in the autoprocessing of
the propeptide. Then the mature peptide encoding gene amplified by PCR was ligated
to the pBE2a∷Rs109*pBE2a∷Rs112 to generate pBE2a∷Rs-mp′ respectively.
Construction of the Escherichia coli-Bacillus subtilis Shuttle … 75
Finally, the plasmids pBE2a∷Rs-mp′ and pBE2a-apr were transformed into B. subtilis
WB600 to express the alkaline protease.
It was observed that the proteolytic ring could be produced by the hosts carrying
pBE2a-apr and pBE2a∷Rs112 but could not by the others carrying
pBE2a∷Rs109*pBE2a∷Rs111. The results showed that the activity of the alkaline
protease produced by the hosts carrying pBE2a-apr and pBE2a∷Rs112-mp′ could
be detected and were parallel. While the activity of the protease produced by the
hosts carrying pBE2a∷Rs109-mp′*pBE2a∷Rs111-mp′ could not be detected
(Table 2). The determination of the activity of AprE was consistent with the results
of the proteolytic ring.
To determine if there are mutations in the coding domain of the alkaline protease
which couldn’t produce the proteolytic ring. DNA sequencing was used to detect
the mutation in the mature peptide encoding gene which was probably produced by
PCR. However, the results of the DNA sequencing revealed that there was no
mutation in the coding region of the mature peptide. The protein electrophoresis
was employed to determine if the insertions adversely affected the secretion of the
alkaline protease. The electrophoresis result of the intracellular protein showed that
no increased accumulation of 41-kDa proAprE protein was observed in cell
(Fig. 4a). The results of the extracellular protein electrophoresis showed that there
was no obvious difference in the secretion level between the two active proteases
which were produced by the hosts carrying pBE2a-apr and pBE2a∷Rs112-mp′,
respectively, while there was a great difference between the active protease and the
inactive protease. The active proteases, a 38-kDa protein bond could be detected in
the hosts producing inactive proteases, while the mature peptide which is 29-kDa in
molecular mass was not detected (Fig. 4b). The results described above implied that
the mutant proAprE protein resulted from the different insertions of BamH I
appeared to be secreted normally but abnormally in autoprocessing of the
propeptide outside of the cell.
In our experiments, the insertion occured at the residues 109, 110, 111 and 112,
respectively (Table 3). The insertion of the restriction sites between propeptide and
mature peptide might interfere with the recognition of the autoprocessing site so
that the pro-peptide couldn’t be cleaved from preproenzyme correctly. It was
deduced from the experimental results described above that the amino acids
Fig. 4 The SDS-PAGE results of the intracellular and extracellular protein from different
Samples. a The SDS-PAGE result of the intracellular protein. The strains examined were as
follows 1–5 hosts carrying pBE2a∷Rs109-mp′*pBE2a∷Rs112-mp′ and pBE2a-apr, respectively;
6 protein marker. b The SDS-PAGE result of the extracellular protein. 1 Protein marker; the strains
examined were as follows: 2–3 hosts carrying pBE2a-apr and pBE2a∷Rs112-mp′; 4–6 hosts
carrying pBE2a∷Rs109-mp′*pBE2a∷Rs111-mp′; 7 host of carrying pBE2 (negative control)
“TTMA” which located at the junction between propeptide and mature peptide, as
well as its arranging sequence were critical in autoprocessing of the propeptide. The
autoprocessing would be disturbed when this amino acid sequence was destroyed.
4 Discussion
Acknowledgements This work was supported by the National Natural Science Foundation of
China (No. 21176190). We thank professor Sui-Lam Wong (University of Calgary, Canada) for
providing the pWB980 plasmid kindly. We also thank NanKai University for providing the pBE2
plasmid kindly.
References
1. Gupta R, Beg Q, Lorenz P (2002) Bacterial alkaline proteases: molecular approaches and
industrial applications. Appl Microbiol Biotechnol 59:15–32
2. Bryan PN (2001) Protein engineering of subtilisin. Biochim Biophys Acta 1543:203–222
3. Siezen RJ, Leunissen JAM (1997) Subtilases: the superfamily of subtilisin-like serine
proteases. Protein Sci 6:501–523
4. Kessler E, Safrin M, Gustin JD, Ohman DE (1998) Elastase and LasA protease of
Pseudomonas aeruginosa are secreted with their propeptides. J Biol Chem 273:30225–30231
78 R. Wei et al.
5. Simonen M, Palva I (1993) Protein secretion in Bacillus species. Microbiol Rev 57(1):109–
137
6. Hsu CC, Tsai YC, Chang YS, Lisw SH, Mei HC (2002) Mutational analysis of the
autoprocessing site of subtilisin YaB-G124A. Biochem Biophys Res Commun 291:165–169
7. Takahashi M, Hasuura Y, Nakamori S et al (2001) Improved autoprocessing efficiency of
mutant subtilisins E with altered specificity by engineering of the pro-region. J Biochem
130:99–106
8. Grande KK, Gustin JK, Kessler E et al (2007) Identification of critical residues in the
propeptide of LasA protease of Pseudomonas aeruginsa involved in the formation of a stable
mature protease. J Bacteriol 189(11):3960–3968
9. Wang PZ (1984) Doi RH Overlapping promoters transcribed by Bacillus subtilis r55- and
r37-RNA polymerase holoenzymes during growth and stationary phases. J Biol Chem 259
(13):8619–8625
10. Barequet IS, Ben SGM, Kessler E et al (2004) Pseudomonas aeruginosa LasA protease in
treatment of experimental staphylococcal keratitis. Antimicrob Agents Chemother 48:1681–
1687
11. Cunningham EL, Mau T, Truhlar SME et al (2002) The proregion N-terminal domain
provides specific interactions required for catalysis of alpha-lytic protease folding.
Biochemistry 41:8860–8867
12. Chang AK, Park JW, Lee EH et al (2007) The N-terminal propeptide of Vibrio vulnificus
extracellular metalloprotease is both an inhibitor of and a substrate for the enzyme. J Bacteriol
189(19):6832–6838
13. Falzon L, Patel S, Chen YJ et al (2007) Autotomic behavior of the propeptide in
propeptide-mediated folding of prosubtilisin E. J Mol Biol 366:494–503
14. Shinde U, Inouye M (2000) Intramolecular chaperones: polypeptide extensions that modulate
protein folding. Semin Cell Dev Biol 11:35–44
15. Pulido M, Saito K, Tanaka S et al (2006) Ca2+-dependent maturation of subtilisin from a
hyperthermophilic archaeon, Thermococcus kodakaraensis: the propeptide is a potent
inhibitor of the mature domain but is not required for its folding. Appl Environ Microbiol 72
(6):4154–4162
Effects of ATF2 Overexpression
with BAT2 Deletion on the Higher
Alcohols and Esters in Beer Yeast
Xiaoer Liu, Jia Xu, Li Pi, Cuiying Zhang and Dongguang Xiao
1 Introduction
In the yeast fermentation process, the by-products, carbon dioxide and alcohol form
a unique beer flavor. The by-products include higher alcohols, esters, phenolic
compounds and so on [1]. Among them, esters and higher alcohols are two of the
most important groups of volatile flavor compounds. As we all known, beer
alcohols and esters are generated in the main fermentation stage. However, levels of
higher alcohols in the fermentation solution are often too high for favorable beer
development, while beer yeast strains display low capacity for ester production.
Thus, development of methods by which to decrease the generation of higher
alcohols and increase the production of aromatic esters in beers, particularly
through the use of industrial brewer’s yeast, is of great importance.
Alcohol acetyltransferases (AATases), which catalyze the transformation of
alcohols and acetyl-coenzyme A into acetate esters, are key enzymes involved in
ester synthesis [2–4]. Three types of AATases (namely, AATase, AATase I, and
AATase II) have been studied, and they are encoded by the ATF1, Lg-ATF1, and
ATF2 genes respectively [5–9]. Several researchers have reported that, compared to
ATF1, overexpression of ATF2 caused slight increase in the process of synthesis of
ester. Similarly, Lg-ATF1 has a very limited role in the synthesis of volatile esters
[10–12]. In the previous study, the ester production was observed to increase
significantly when overexpressed ATF1 in beer yeast, which leaded to the dishar-
mony of beer flavor [13]. Overexpression of ATF2 in industrial brewer’s yeast is
observed for appropriately increasing the production of ester, thus beer flavor
behave more harmonious.
Higher alcohols, also known as fusel alcohols, include propyl alcohol, isoamyl
alcohol, isobutyl alcohol, active amyl alcohol and so on. About 80% outputs of
higher alcohols are formed during the primary fermentation. Higher alcohols are
one of the inherent flavor ingredients of beer, and the coordination between all
kinds of higher alcohols can make beer palate soft and unique taste [14]. In the
amino acid catabolism pathway, knocking out the amino acid transaminase
(BCAT), which is encoded by BAT1 and BAT2 gene, can reduce the concentration
of isobutanol and isoamyl alcohol [15]. The product of the BAT2 gene has been
previously reported to play an important role in the production of higher alcohols
than the BAT1 gene [16].
In this article, the brewing yeast strain with part BAT2 allele insteaded by ATF2
gene was constructed to improve a moderate amount of acetate content and reduce
higher alcohol content. Our data show that ATF2 overexpression and BAT2 deletion
can improve the acetate ester content in beer while significantly reducing its iso-
amyl alcohol content. The results in this article are useful in future developments in
the beer industry.
Escherichia coli DH5a, the parental strain Saccharomyces cerevisiae S5, and
plasmid pUC-BBAK, pUC-PIA2K were obtained from the Microbiological Culture
Collection Center of Tianjin Industrial Microbiology Key Laboratory, Tianjin
University of Science and Technology, People’s Republic of China.
Plasmid pUC-BBAK contained two homology DNA fragments of upstream and
downstream of BAT2 gene and loxP-kanMX-loxP gene disruption cassette, named
BA, BB and K, respectively. Plasmid pUC-PIA2K was used in the preparation of
the PGKP-PGKT expression cassette and the ATF2 expression genes. The ATF2
gene was connected between the promoter and the terminator, the direction is
consistent with them.
E. coli DH5a used for the preparation and construction of the plasmid, was
grown at 37 °C in Luria-Bertani medium (1% Bacto-tryptone, 0.5% yeast extract,
and 0.5% NaCl). Ampicillin was added to the medium at a final concentration of
100 lg mL−1 to select positive E. coli transformants. The parental strain S. cere-
visiae S5 was usually cultured in YPD medium (1% yeast extract, 2%
Bacto-peptone, and 2% glucose). G418 was added to the medium at a final con-
centration of 100 lg mL−1 to select positive yeast transformants. The optimum
growth temperature of S. cerevisiae was 30 °C. During fermentation, the yeast cells
were cultured in wort medium. Wort medium was prepared from crushed malt and
distilled water according to the ratio of material to water 1:4, and saccharification
was performed according to certain routes with sugar meter adjusted to 10 °Brix.
All of the solid media used in this study contained 2% agar.
Effects of ATF2 Overexpression with BAT2 Deletion … 81
The DNA operation in this study was performed according to the standard proce-
dure described by Ausubel [17]. In-Fusion DNA ligase, TaKaRa LA Taq DNA
polymerase, 5000 DNA Marker, 15,000 DNA Marker and restriction enzymes were
used for DNA manipulation, and these reagents were purchased from the TaKaRa
Biotechnology.
The polymerase chain reaction (PCR) primers used in this work are listed in
Table 1. A 3379-bp PGKp-ATF2-PGKt fragment was amplified via PCR from the
plasmid pUC-PIA2K, which contained ATF2 gene (1608-bp) under the control of
phosphoglycerate kinase I gene promoter and terminator (1771-bp). A 5309 bp
BB-pUC19-BA-KanMX fragment was amplified via PCR from the plasmid
pUC-BBAK, which contained the homology arms BA (488-bp) and BB (522-bp)
and loxP-kanMX-loxP fragment (1613-bp). The recombinant plasmid pUC-PABBK
was obtained from the ligation of PGKp-ATF2-PGKt fragment and
BB-pUC19-BA-KanMX fragment reacted for 30 min with the use of In-Fusion
DNA ligase under 50 °C.
First of all, the yeast cells were cultured in tube containing 7 mL wort medium and
static cultured for 24 h in 30 °C incubator. The culture was added to the 150 mL
triangle bottle containing 45 mL wort medium with 10% inoculation quantity, and
static cultured for 24 h in 16 °C incubator. Then 15 mL of the culture was trans-
ferred into 250 mL triangle bottle containing 135 mL wort medium, and static
cultured 7–9 days in 10 °C incubator. Weight lost of Carbon dioxide was detected
every 12 h, until the data is less than 0.2 g.
After fermentation, samples were filtered and distilled from the wort medium, then
used for GC analysis. Analysis was performed on an Agilent 7890C GC system.
Capillary column was 30 m 320 lm 0.5 lm and column temperature was
75 °C. The temperature of the flame ionization detector (FID) was adjusted to
230 °C, the injector temperature was 200 °C, and the split ratio was 20:1. Nitrogen
was used as the carrier gas, and the injection volume was 1.0 lL. Butyl acetate was
used as the internal standard. A specific amount of each of the analytes was mea-
sured and used as a standard for machine calibration. Ethyl acetate, amyl acetate,
isoamyl acetate, isobutanol and isoamyl alcohol were purchased from Merck.
Weight lost of Carbon dioxide, residual sugar, alcohol degree, appearance fer-
mentation degree and real fermentation degree were referred from People’s
Republic of China country.
with In-Fusion DNA ligase. For PCR verification, the 6005-bp size of a fragment
(Fig. 3a) would be gotten with the primers BA-U and BB-D. For enzyme digestion
verification, the 8691-bp size of a fragment (Fig. 3b) would be gotten using the
restriction enzyme Nco I.
The transformation fragment PABBK was amplified via PCR from the plasmid
pUC-PABBK and integrated into the homologous genome of the S5 strain via LiAc
transformation (Fig. 4). The resulting transformants were screened on YPD plates
containing 0.50 mg mL−1 G418 [18]. The strain S5-L was selected as the correct
recombinant after PCR analysis using the primer pairs U-①, D-① and U-②, D-②,
separately (Fig. 5).
84 X. Liu et al.
The fermentation performance of S5 and S5-L were detected. The results (Table 2)
showed that there was no significant difference in the basic fermentation perfor-
mances of the engineered strains S5-L and the parental strain S5.
Effects of ATF2 Overexpression with BAT2 Deletion … 85
After fermentation, the esters and higher alcohols in parental strain and engineering
strain were determined by GC analysis. The results showed that the content of
acetate esters in engineering strain S5-L was improved than that of the parental
strain S5. The content of ethyl acetate in engineering strain S5-L reached
86 X. Liu et al.
Table 2 Fermentation performances of the parental strain and the engineered strain
Yeast Weight Ethanol (%, Residual Appearance Real appearance
strains loss of CO2 v/v, 20 °C) sugar fermentation fermentation
(g) (g L−1) degree (%) degree (%)
S5 6.6 ± 0.20 4.27 ± 0.23 8.5 ± 0.32 67.90 ± 0.55 58.27 ± 0.40
S5-L 6.6 ± 0.15 4.12 ± 0.02 9.33 ± 0.80 66.22 ± 0.70 57.62 ± 0.38
Results are averages from three parallel independent experiments. Values are means ± SD from
three different tests
Table 3 Content of volatile compounds in the parental strain and engineering strain
Yeast Ethyl acetate Isoamyl acetate Isoamyl alcohol Isobutanol Propanol
strains (mg L−1) (mg L−1) (mg L−1) (mg L−1) (mg L−1)
S5 5.92 ± 0.38 – 60.74 ± 0.40 11.35 ± 0.33 12.23 ± 0.16
S5-L 7.60 ± 0.47 – 51.49 ± 0.45 8.30 ± 0.58 9.72 ± 0.37
Results are averages from three parallel independent experiments. Values are means ± SD from
three different tests. “–” represents not detected
7.60 mg L−1, which was 1.28-fold of that of the parental strain S5. Isoamyl acetate
in engineering strain and parental strain was not detected. It was probably the result
of that the content of isoamyl acetate was lower than the GC detection. After
fermentation, the content of isoamyl alcohol in the engineering strain S5-L was
reduced to 51.49 mg L−1, which was 84.77% of that of the parental strain S5.
Isobutanol and propanol were reduced to 8.30 and 9.72 mg L−1, which was 73.13%
and 79.47% of that of the parental strain S5 (Table 3), respectively.
4 Conclusion
In this work, with the action of PGK promoter, ATF2 gene, which encodes the
AATase II, was overexpressed to increase acetate content. On the other hand, BAT2
gene, which encodes the amino acid transaminase, was knocked out to decrease the
content of higher alcohols. The results of the final fermentation showed that ethyl
acetate content was moderate increased while higher alcohols concentrations were
effectively reduced. In this paper, the ester content has been improved, but there’s
still a lot of work to do in order to achieve better results.
References
1. Styger G, Prior B, Bauer FF (2011) Wine flavor and aroma. J Ind Microbiol Biotechnol
38:1145–1159
2. NordstrÖm K (1963) Formation of ethyl acetate in fermentation with brewer’s yeast IV:
metabolism of acetyl coenzyme A. J Inst Brew 69:142–153
Effects of ATF2 Overexpression with BAT2 Deletion … 87
3. NordstrÖm K (1964) Formation of esters from alcohols by brewer’s yeast. J Inst Brew
70:328–336
4. NordstrÖm K (1962) Formation of ethyl acetate in fermentation with brewer’s yeast III:
participation of coenzyme A. J Inst Brew 68:398–407
5. Fujii T, Nagasawa N, Iwamatsu A, Bogaki T, Tamai Y, Hamachi M (1994) Molecular
cloning, sequence analysis and expression of the yeast alcohol acetyltransferase gene. Appl
Environ Microbiol 60:2786–2792
6. Fujii T, Yoshimoto H, Nagasawa N, Bogaki T, Tamai Y, Hamachi M (1996) Nucleotide
sequence of alcohol acetyltransferase genes from lager brewing yeast, Saccharomyces
carlsbergensis. Yeast 12:593–598
7. Yoshimoto H, Momma T, Fujiwara D, Sone H, Kaneko Y, Tamai T (1998) Characterization
of the ATF1 and Lg-ATF1 genes encoding alcohol acetyltransferases in the bottom fermenting
yeast Saccharomyces pastorianus. J Ferment Bioeng 86:15–20
8. Yoshimoto H, Fujiwara D, Momma T, Tanaka K, Sone H, Nagasawa N, Tamai T (1999)
Isolation and characterization of the ATF2 gene encoding alcohol acetyltransferase II in the
bottom fermenting yeast Saccharomyces pastorianus. Yeast 15:409–417
9. Lilly M, Bauer FF, Lambrechts MG, Swiegers JH, Cozzolino D, Pretorius IS (2006) The
effect of increased yeast alcohol acetyltransferase and esterase activity on the flavour profiles
of wine and distillates. Yeast 23(9):641–659
10. Nagasawa N, Bogaki T, Iwamatsu A, Hamachi M, Kumagai C (1998) Cloning and nucleotide
sequence of the alcohol acetyltransferase II gene (ATF2) from Saccharomyces cerevisiae
Kyokai No. 7. Biosci Biotechnol Biochem 62:1852–1857
11. Lilly M, Lambrechts MG, Pretorius IS (2000) Effect of increased yeast alcohol acetyltrans-
ferase activity on flavour profiles of wine and distillates. Appl Environ Microbiol 66:744–753
12. Verstrepen KJ, Van Laere SDM, Vanderhaegen BMP (2003) Expression levels of the yeast
alcohol acetyltransferase genes ATF1, Lg-ATF1, and ATF2 control the formation of a broad
range of volatile esters. Appl environ microbiol 69(9):5228–5237
13. Cui-Ying Z, Yu-Lan L, Ya-Nan Q, Jian-Wei Z, Long-Hai D, Xue L, Dong-Guang X (2013)
Increased esters and decreased higher alcohols production by engineered brewer’s yeast
strains. Eur Food Res Technol 236:1009–1014
14. Stewart GG (2005) Esters: the most important group of flavor-active beer compounds. Proc
Congr Eur Brew Conv 30:100–101
15. Yoshimoto H, Fukushige T, Yonezawa T et al (2002) Genetic and physiological analysis of
branched-chain alcohols and isoamyl acetate production in Saccharomyces cerevisiae. Appl
Microbiol Biotechnol 59(4):501–508
16. Eden A, Van Nedervelde L, Drukker M et al (2001) Involvement of branched-chain amino
acid aminotransferases in the production of fusel alcohols during fermentation in yeast. Appl
Microbiol Biotechnol 55(3):296–300
17. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1994)
Current protocols in molecular biology. Wiley, New York
18. Schiestl RH, Gietz RD (1989) High efficiency transformation of intact yeast cells using single
stranded nucleic acids as a carrier. Curr Genet 16(5–6):339–346
Study on a Staphylococcal Tat Signal
Peptide Guided EGFP Translocation
in E. coli
1 Introduction
A variety of protein transport systems have been found in bacteria for decades.
Based on their structure, the signal peptide can be mainly divided into the following
kinds: Sec (Secretion Translocation Pathway), Tat (Twin Arginine Translocation)
[1], LIP (Lipoprotein), Com (type IV pili structure), and ATP-binding cassette
(ABC) signal peptide [2]. To date, Sec pathway is widely used for exogenous
protein secretion in genetic engineering, but Sec transport system can only secrete
unfolded or partially folded proteins [3]. However, Tat signal peptide secretion
system can secrete the correctly-folded protein to the outside of the cell [4, 5]. Tat
pathway was first found in E. coli. Bolhuis et al. found that two integral cytoplasmic
membrane proteins, TatB and TatC, consist a structural and functional unit of the
twin-arginine translocases in E. coli. In the field of genetic engineering, it can be
used to secrete heterologous proteins that cannot be transported by Sec transloca-
tion pathway [6]. Currently, it has become a focus of protein transportation research
in the world due to its feature to help translocate fully folded proteins across the
bacterial plasma membrane [7].
Green fluorescent protein (GFP) can be well expressed as a reporter protein in a
large number of prokaryotic [8] and eukaryotic cells without affect by the biolog-
ical, tissue or genotype [9]. In addition, GFP possesses a small molecular weight
(ca. 27 kDa), and does not affect the property and function of other fused proteins
[4]. Thus, the target protein can be fused with GFP for the localization analysis
[10]. Moreover, its expression has the advantages of easy detection, high sensi-
tivity, stable fluorescence, non-toxic to cells, among others. Therefore, GFP can be
Q.-X. Zhou J. Zhang M.-N. Wang W.-H. Yang J. Zhang Q. Gao (&)
Key Laboratory of Industrial Fermentation Microbiology,
Ministry of Education, College of Biotechnology, Tianjin University
of Science and Technology, Tianjin 300457, People’s Republic of China
e-mail: [email protected]
directly used for the determination of living cells characteristics, and is widely used
in various research fields of the life sciences [11].
In this study, the enhanced green fluorescent protein (EGFP) was used as a
reporter protein to study the protein secretion properties by Tat pathway in E. coli
[12]. A Tat signal peptide from Staphylococcus carnosus TM300 [7, 13, 14] was
ligated with EGFP gene to construct the Tat-EGFP fusion gene. The EGFP and
fused Tat-EGFP (EGFPs) were employed to investigate its role in EGFP translo-
cation in E. coli host.
E. coli DH5a was obtained from the preservation of Tianjin Municipal Industrial
Microbiology Key Laboratory, Tianjin, China. Staphylococcus carnosus TM300 and
plasmid pBT2 (Cmr, Ampr) were kindly offered by Professor Dr. Friedrich Goetz of
the Department of Microbial Genetics, Eberhard-Karls-Universitaet, Tuebingen,
Baden-Wuerttemberg, Germany. The plasmids pBT2-ETG encoding the Tat-EGFP
fusion protein with a Tat signal peptide of iron-dependent peroxidase EfeB (GenBank
ID: CAL29117.1) in S. carnosus TM300 and pBT2-ET-EGFP only encoding EGFP
gene without signal peptide were constructed in our previous work [12–14].
LB broth (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl) was employed for the
cultivation of E. coli. The solid LB medium was prepared by the addition of 20 g/L
agar. The ampicillin resistance was used for the screening of the recombinants at
final concentration of 100 lg/mL.
The NheI and BamHI restriction enzymes, T4 DNA ligase and low molecular
weight proteins marker were purchased from Fermentas Inc., (Burlington, Ontario,
Canada). 2 Taq PCR Mastermix, plasmid extraction kit, 1 kb DNA Ladder and
DNA Marker III were bought from Tiangen Biotech (Beijing) Co., Ltd., (Beijing,
China). Lysozyme (20,000 U/mL), EGFP antibody, PVDF film and Color
Developing Reagent (DAB) kit were bought from Beyotime Biotechnology
Research Institute (Nantong, Jiangsu, China). Cell lysis buffer was composed of
Study on a Staphylococcal Tat Signal Peptide Guided … 91
0.8 mg/mL lysozyme, 20% sucrose, 50 mmol/L Tris and 1 mmol/L EDTA (pH
8.0). All other reagents were analytical or biological grade.
For the extraction of EGFPs (EGFP and Tat-EGFP), single recombinant colonies of
E. coli DH5a/pBT2-ET-EGFP and E. coli DH5a/pBT2-ETG were respectively
grown in 50 mL LB broth at 180 r/min and 37 °C for 16 h. The cell pellets were
harvested by centrifugation at 12,000 r/min and 4 °C for 15 min. Proteins in the
culture broth were treated with 10% trichloroacetic acid (TCA) for 12 h at 4 °C. The
cells were resuspended in 2 mL PBS buffer, disrupted by sonication, and recovered
the supernatant from cell fragments by centrifugation as the cytoplasm fraction.
The fermentation broth of E. coli was centrifuged at 12,000 r/min and 4 °C for
10 min, then the cell precipitate was washed twice with PBS (pH 7.4) for collec-
tion. Then the cell lysis buffer was added to fully suspend the bacterial cells on ice
bath for 30 min. The supernatant after centrifuge was the periplasm protein fraction.
The culture broth of E. coli was centrifuged, and the supernatant was extracted
and then mixed with 10% TCA precipitation, kept statically at 4 °C overnight. The
precipitation was washed once with 100–80% acetone, and then the proteins in the
fermentation broth was precipitated by centrifugation, and dried at room tempera-
ture as the fermentation broth fraction.
The expression of the EGFPs in the cells and fermentation broth of E. coli
DH5a/pBT2-ET-EGFP and E. coli DH5a/pBT2-ETG was observed by fluores-
cence microscopy [OLYMPUS (China) Co., Ltd., Beijing, China], and analyzed by
SDS-PAGE and Western blot.
3 Result
By dropleting the E. coli transformant culture broth on the slide surface with cover
glass, fluorescence was observed under a fluorescent microscope. In Fig. 1, E. coli
DH5a/pBT2-ET-EGFP and E. coli DH5a/pBT2-ETG cells emitted green
92 Q.-X. Zhou et al.
Fig. 2 Fluorescence spectrophotometer determination for EGFPs of various E. coli host. a The
periplasm extract; b the fermentation broth
fluorescence, but the control E. coli DH5a not. The results indicated that both
EGFPs genes were able to be expressed in E. coli DH5a host.
In this work, whether the expressed EGFPs can be translocated into the periplasm
and fermentation broth from various E. coli hosts were further detected by Western
blot. The Western blot experiment here also exhibited the same result as
SDS-PAGE, i.e. both EGFP and Tat-EGFP were correctly expressed in the cyto-
plasm of E. coli hosts, but only Tat-EGFP was expressed in the periplasm (Fig. 4),
and none of them could be transported into the fermentation broth (data not shown).
M 1 2 3 4 M 1 2 3 4
(a) (b)
Fig. 4 Western blot analyses of EGFPs in E. coli. a intracellular. M: protein marker; 1: E. coli
DH5a/pBT2-ETG; 2: E. coli DH5a/pBT2-ET-EGFP; 3: E. coli DH5a/pBT2; 4: E. coli DH5a;
b periplasm. M: protein marker; 1: E. coli DH5a; 2: E. coli DH5a/pBT2; 3: E. coli
DH5a/pBT2-ET-EGFP; 4: E. coli DH5a/pBT2-ETG
94 Q.-X. Zhou et al.
4 Conclusion
To our best knowledge, this is the first report that the constructed Tat-EGFP was
successfully translocated in the periplasm E. coli DH5ɑ host by a Tat signal peptide
from S. carnosus TM300, but EGFP not. Our results revealed that the heterologous
staphylococcal Tat signal peptide is recognized by the E. coli host, and exerts a
positive role in the transmembrane secretion of Tat-EGFP, which sheds the light as
a novel pathway for the secretion of the heterologous proteins in E. coli and
probably other bacteria.
Acknowledgements This work was financially supported by the National Natural Science
Foundation of China (31370075, 31101275 and 61603273), the Undergraduate Laboratory
Innovation Fund of Tianjin University of Science and Technology of China (1504A304X) and the
Youth Innovation Fund of Tianjin University of Science and Technology of China
(2014CXLG28).
References
11. Chen Y, Müller JD, Ruan QQ et al (2002) Molecular brightness characterization of EGFP
in vivo by fluorescence fluctuation spectroscopy. Biophys J 82(1):133–144
12. Yu C, Zheng X, Zhu Y et al (2011) Construction of tat-gfp fusion gene and its expression in
Staphylococcus carnosus. Biotechnol Bull 8:203–207
13. Xu B, Cheng Y, Wang L et al (2015) Construction of Eschericha coli-Staphylococcus shuttle
vector for EGFP expression and potential secretion via Tat pathway. Lect Notes Electr Eng
333:171–180
14. Gao Q, Xu B, Cheng Y et al (2014) GFP translocation of twin-arginine secretion pathway in
Staphylococcus carnosus. J Tianjin Univ Sci Technol 5:1–5
A Novel GH10 Xylanase Xyn13-3
from Alkaline Soil: Gene Cloning
and Heterogenous Expression
Haiyan Qiu, Zhongyuan Li, Hui Wang, Shuang Li and Tongcun Zhang
1 Introduction
Hemicelluloses are the second most abundant plant polysaccharides in nature. Due to
their potential role as sustainable energy sources, hemicelluloses are increasingly
becoming an important concern [1]. The main chain of xylan is constituted with
xylose unit through the b-1,4-linkage, and it is usually substituted with varying levels
of L-arabinofuranosyl, galactosyl, acetyl, glucuronyl, and 4-O-methylglucuronyl
groups [2]. Among them, xylanase plays a crucial role in the hydrolysis of the xylan
back-bone [3], in which xylanase cleaves the b-1,4-glycosidic bond between xylose
residues to release xylooligosaccharides. A great potential for some biotechnological
applications in many biotechnological application especially in food, bioconversion,
pulp and paper industries [4]. Due to the increasing demand for xylanase production,
exploring new enzyme sources has been a hot topic in recent years [5]. Therefore, we
tried to explore some novel alkaline xylanase from alkaline soil, in this study, a novel
xylanase of family 10 (Xyn13-3) was obtained from the metagenomic DNA of
alkaline soil and it was heterologously expressed in Pichia pastoris GS115.
E. coli DH5a and the vector PMD-19T (TaKaRa, Dalian, China) were used for
gene cloning. Pichia pastoris GS115 and vector pPIC9 used for gene expression
were purchased from Invitrogen (Carlsbad, CA, USA). Reagents and chemicals
used for DNA manipulation were purchased from ThermoFisher Scientific
(Shanghai, China).Yeast Nitrogen Base (YNB) with amino acids was purchased
from Solarbio (Beijing, China). All yeast culture media were prepared according to
the Yeast Protocols Handbook.
Alkaline soil was obtained from the coastal saline area in Tianjin (China) and stored
in −20 °C. The pH was measured by pH meter (SevenEasy, Shanghai). About 1 g
soil sample was firstly grinded by liquid nitrogen, and the metagenomic DNA was
extracted by CTAB-SDS method [6]. The crude DNA was purified by DNA
purification kit (Solarbio, Beijing, China), and was detected by nucleic acid
electrophoresis.
The xylanase gene Xyn13-3 was obtained by Touch-down PCR and TAIL-PCR
methods. Firstly, the conserved sequence of Xyn13-3 was amplificated by
Touch-down PCR with primers GH10F and GH10R according to Wang et al. [7]. The
Nucleotide fragment was sequenced by GENEWIZ, Beijing, China. The full gene
sequence was amplificated using Tail-PCR method with the six specific primers
designed based on the conserved sequence. The primers used in the study were shown
in Table 1. The sequence was assembled by Vector NTI7.0 (Invitrogen), and was
blasted by BLASTX (https://blast.ncbi.nlm.nih.gov/Blast.cgi).
A Novel GH10 Xylanase Xyn13-3 from Alkaline Soil … 99
The full-length gene sequence of Xyn13-3 was digested with EcoRI and NotI,
ligased with pPIC9 vector, transformed into E. coli DH5a, verified by restriction
digestion, which was then linearized by PmeI and transformed into P. pastoris
GS115 competent cells by electroporation. The transformants were screened and
induced by methanol according to the instructions of Pichia expression kit
(Invitrogen). The recombinant protein Xyn13-3 was secreted into the medium and
collected by centrifugation, and subjected to the enzyme activity assay [8]. The
transformant with the highest activity was fermented in a 1-L flask for optimization
of the induction time. The recombinant protein Xyn13-3 was purified by nickel
affinity chromatography (GE Healthcare, Uppsala, Sweden) with 10–500 mM
imidazole in buffer [9, 10]. The protein fraction corresponding to different imida-
zole concentration were collected and subjected to sodium dodecyl sulfate (SDS)-
polyacrylamide gel electrophoresis (PAGE; 12% separation gel and 5% spacer gel).
The protein concentration was determined using Bradford protein assay kit
(BioRad) [11].
A partial gene fragment of 250 bp was amplified by Touch-down PCR, and was
cloned into pMD-19T for sequencing. The flanking region was amplified with
TAIL-PCR using the nested internal primers which were designed based on the
250 bp core region. Based on the analysis by Vector NTI 7.0 and FGENESH, the
complete ORF of Xyn13-3 consisted of 1020 bp (Fig. 1). The mature protein
100 H. Qiu et al.
consisted of 339 residues with a calculated molecular mass of 36.97 kDa. Xyn13-3
had no predicated N-glycosylation site. BlastP search indicates that Xyn13-3 belongs
to GH family 10 and its amino acid sequence showed the highest identity (61%) with
the reported GH10 xylanase from Trichoderma gamsii (XP_018659952.1).
MEGA software was used to build Xyn13-3 and other GH10 family xylanase
phylogenetic tree, in order to understand the evolutionary relationship between
Xyn13-3 and other GH10 family xylanase, the results are as shown in Fig. 2. The
xylanase has closely related to the genetic relationship with xylanase which orig-
inated from Trichoderma gamsii (XP_018659952.1).
The full-length sequence of gene Xyn13-3 was cloned into pPIC9 to obtain the
recombinant plasmid pPIC9-Xyn13-3 (Fig. 3). The recombinant protein Xyn27-1
was purified to homogeneity at 200 mM imidazole with a molecular weight of
39.97 kDa (Fig. 4), a little larger than the calculated molecular mass, which might
be attribute to the His6-tag. The specific activity of purified Xyn13-3 measured by
DNS method was 135.24 U/mg.
A Novel GH10 Xylanase Xyn13-3 from Alkaline Soil … 101
79 Trichoderma harzianum
48 Trichoderma virens Gv29-8
99
Trichoderma gamsii
99 Trichoderma reesei QM6a
Colletotrichum graminicola M1.001.fa
0.050
4 Conclusion
Xylanase is the most critical xylan degrading glycoside hydrolases, xylan could be
degraded into oligosaccharides, which could be further degraded to xylose by
glucosidase and other side-chain Hydrolase. In this study, a novel GH family 10
Xyn13-3 from the genomic DNA of Alkaline Soil was cloned and successfully
expressed in Pichia pastoris GS115. The deduced proteins showed low identities
with known fungal xylanases which originated from Trichoderma gamsii (61%).
The specific activity of purified Xyn13-3 measured by DNS method was
135.24 U/mg. This is a new xylanase that needs further investigation to characterize
its use. In order to improve the activity of the recombinant xylanase, severals factors
for the optimization of induced culture will be studied, including induction timing,
induced time, inducer concentration and inducing temperature, as well as the fol-
lowing study on enzymatic properties which can provide worthful theory data for
application.
References
6. Brady SF (2007) Construction of soil environmental DNA cosmid libraries and screening for
clones that produce biologically active small molecules. Nat Protoc 2:1297–1305
7. Wang G, Luo H, Meng K (2011) High genetic diversity and different distributions of glycosyl
hydrolase family 10 and 11 xylanases in the goat rumen. doi:10.1371/journal.pone.0016731
8. Teng C, Jia H, Yan Q et al (2011) High-level expression of extracellular secretion of a beta—
xylosidase gene from Paecilomyces thermophila in Escherichia coli. Bioresour Technol
102:1822–1830
9. Sharma M, Chadha BS (2010) Purification and characterization of two thermostable xylanases
from Malbranchea flava active under alkaline conditions. Bioresour Technol 101:8834–8842
10. Tseng MJ, Yap MN (2002) Purification and characterization of two cellulase free xylanases
from an alkaliphilic Bacillus firmus. Enzyme Microb Technol 30:590–595
11. Li Z, Xue X, Zhao H et al (2014) A C-terminal proline-rich sequence simultaneously
broadens the optimal temperature and pH ranges and improves the catalytic efficiency of
glycosyl hydrolase family 10 ruminal xylanases. Appl Environ Microbiol 80:3426–3432
Exploitation of a KU70-Deficient Mutant
for Improving Gene Deletion Frequency
in Aspergillus niger
1 Introduction
widely existed with a variety of biological functions [8] and involved in a number
of important cell metabolism, such as DNA replication, DSBs repair, transcription
regulation [9]. When the kusA gene is destroyed in A. niger, which is a homologous
sequence of ku70, the gene-targeting frequency of the gene-deleted strain was
increased to 80% and the sensitivity to UV and X-Ray increased as well [10].
In this study, we deleted the ku70 gene fragment to inhibit its non-homologous
end of the link and improved the transformation efficiency of Agrobacterium
tumefaciens in A. niger. It can be a convenient way for us to study the filamentous
fungi in Genetic Engineering.
2.1 Material
Construction of the ku70 deletion cassette and PCR verification were shown in
Figs. 1 and 2, respectively. The deletion cassette containing the hygromycin
resistance gene (hyg) was designed to replace the ku70 gene coding region
according to a method of double-crossover homologous recombination. Briefly, a
955-bp fragment of the 5′-flanking region (the deletion cassette left arm) and
another 874-bp fragment of the 3′-flanking region (the deletion cassette right arm)
were amplified from the genomic DNA using primer pairs P3/P4 and P5/P6
(Table 2), respectively, and served as homologous arms for the recombination
event. The right arm fragment and plasmid p60 were respectively digested with PstI
and HindIII, the two linear fragments were linked by T4 DNA ligase to create the
intermediate plasmid p80-R. The left arm fragment and plasmid p80-R were
108 L. Yin et al.
digested with KpnI and BamHI, respectively; the two linear fragments were linked
by T4 DNA ligase to generate the deletion plasmid p80 (5′-flanking region-hyg
gene-3′-flanking region).
The constructed plasmid p80 was transformed into A. tumefaciens AGL1 by electric
transformation [14]. The electroporational parameters were as follows: plasmid
1.2 lL, A. tumefaciens 70 lL, electric shock 0.5 s at 2.5 kV.
The A. tumefaciens AGL1 that carried plasmid 80 were cultured untill OD600
reached 0.8 in induction medium. Then, 200 lL A. tumefaciens AGL1 and 200 lL
A. niger spores were added on 0.45 lm cellulose acetate membrane which placed in
induction medium with 200 lmol/L AS and 100 lg/L Kanamycin. The co-culture
was performed in 25 °C for 48 h [15, 16].
Exploitation of a KU70-Deficient Mutant for Improving … 109
The genomic DNA of A. niger was extracted from mycelia that grew on PDA media
by the cetyltrimethylammonium bromide method [17]. The BLAST method was
used to survey the whole genomic sequences of A. niger CBS 513.88 to search for
an ku70-like gene [18, 19]. PCR was carried out to amplify the homolog of the
ku70-like gene using a pair of pI and pII primers. The protocol and results were
shown in Table 3 and Fig. 2, respectively.
The result of ku70 gene purification recovery was shown in Fig. 3. The DNA
sequences of ku70 gene of A. niger CGMCC 10142 was assigned with GenBank
110 L. Yin et al.
Fig. 2 The PCR test of left arm, right arm, full length and restriction enzyme analysis of p80.
a M 5000 bp DNA marker; lane 1 PCR product was amplified by using p80 as template with the
primers P3/P4; lane 2 PCR product amplified by using p80 as template with the primers P5/P6;
b M 10,000 bp DNA marker; lane 1 PCR product was amplified by using p80 as template with the
primers P3/P6; c M 10,000 bp DNA marker; lanes 1,2 restriction enzyme analysis of p80 amplified
with KpnI/HindIII
accession numbers XM001396771 and the homeology was 99.75% between the
augmented sequence after identified by sequencing appraisal and nucleotide
sequence reported in Genbank.
Exploitation of a KU70-Deficient Mutant for Improving … 111
A Neighbor-Joining tree was constructed from the amino acids sequences encoding
ku70 gene of the same 22 fungi of filamentous fungi and sacchromyces classes
which were used to construct phylogenetic tree of ku70 gene (Fig. 4). According to
the phylogenetic tree, Aspergillus niger strain CGMCC10142 have the closest
relation compare to the other strains incorporated filamentous fungi and saccha-
romyces. The distantly regarding ku70 gene from saccharomyces was showed the
farthest relation are Candida ablicans strain SC 5314 and Pichia farinosa strain
CBS 7064.
The plasmid p80 was transformed into A. niger CGMCC 10142 by AMAT, and 35
transformants were obtained on CM plates containing 250 lg/mL hygromycin. All
of transformants were verified by PCR of deletion cassette gene and hygromycin
resistant in Fig. 5. The results demonstrated that transformant was the ku70 gene
knockout mutant therefore named as Dku70.
15th passage culture from the transformant was amplified in Fig. 6. The result
indicated that Dku70 was genetically stable.
112 L. Yin et al.
Fig. 4 Phylogenetic tree constructed from ku70 gene amino acid sequence
Fig. 5 The PCR test of A. niger transformation of ku70 deletion. M 5000 bp DNA marker; lane 1
negative control; lane 2 3240 bp PCR product amplified by using Dku70 as template wit, the
primers P1/P7; lane 3 2375 bp PCR product amplified by using Dku70 as template with the
primers P2/P8; lane 4 1400 bp fragment of hyg amplified by using p80 as template with
the primers P1/P2; lane 5 1400 bp fragment of hyg amplified using transformant as template with
the primers P1/P2
Exploitation of a KU70-Deficient Mutant for Improving … 113
Fig. 6 The PCR test of A. niger transformation. M 5000 bp DNA marker; lane 1 PCR product
amplified by using the genome of 1st Dku70 subculture as template with the primers P1/P7; lane 2
PCR product amplified by using the genome of 10th Dku70 subculture as template with the
primers P1/P7; lane 3 PCR product amplified by using the genome of 15th Dku70 subculture as
template with the primers P1/P7; lane 4 PCR product amplified by using the genome of 10th
Dku70 subculture as template with the primers P2/P8; lane 5 PCR product amplified by using the
genome of 15th Dku70 subculture as template with the primers P2/P8
The result of Reduce-Representation Genome Sequencing showed that the hyg had
a unique insertion site in 68,064 at An15. It is consistent within the locus of
CBS513.88 ku70 gene (GenBank No: ANI_1_420134) in 679,864–682,385.
The strain of Dku70 and original strain CGMCC 10142 were infected by plasmids
p10, p74, p81 and p90 which preserved in our laboratory, respectively. The
transformants were selected in the plate form containing 150 lL/mL hyg after
incubating 72 h at 35 °C. The numbers of transformants were counted in Table 4,
and partial transformants verification as shown in Fig. 7. The result indicated that
strain Dku70 had a higher efficiency comparing with original strain CGMCC 10142.
114 L. Yin et al.
Fig. 7 The PCR test of A. niger transformation. a M 5,000 bp DNA marker; lane 1–8 1400 bp
fragment of hyg amplified by using the genome of CGMCC Dcs as template with the primers
P1/P2; b M 5000 bp DNA marker; lane 1–19 1400 bp fragment of hyg amplified by using the
genome of CGMCC Daox 1 as template with the primers P1/P2; c M 5000 bp DNA marker; lane
1–17 550 bp fragment of G418 amplified by using the genome of CGMCC Dtps A as template
with the primers P9/P10; d M 5000 bp DNA marker; lane 1–15 550 bp fragment of G418
amplified by using the genome of CGMCC Dpd as template with the primers P9/P10
4 Conclusion
References
3. Krappmann S (2007) Gene targeting in filamentous fungi: the benefits of impaired repair.
Fungal Biol Rev 21:25–29
4. Kück U, Hoff B (2010) New tools for the genetic manipulation of filamentous fungi. Appl
Microbiol Biotechnol 86:51–62
5. Weld RJ, Plummer KM, Carpenter MA, Ridgway HJ (2006) Approaches to functional
genomics in filamentous fungi. Cell Res 16:31–44
6. Walker JR, Corpina RA, Goldberg J (2001) Structure of the Ku heterodimer bound to DNA
and its implications for double-strand break repair. Nature 412:607–614
7. Lieber MR (2010) The mechanism of double-strand DNA break repair by the nonhomologous
DNA end-joining pathway. Ann Rev Biochem 79:181–211
8. Daley JM, Palmbos PL, Wu D et al (2005) Nonhomologous end joining in yeast. Ann Rev
Genet 39:431–451
9. Ninomiya Y, Suzuki K, Ishii C et al (2004) Highly efficient gene replacements in Neurospora
strains deficient for nonhomologous end-joining. Proc Natl Acad Sci U S A 101:12248–
12253
10. Meyer V, Arentshorst M, El-Ghezal A et al (2007) Highly efficient gene targeting in the
Aspergillus niger kusA mutant. J Biotechnol 128:770–775
11. Lazo GR, Stein PA, Ludwig RA (1991) A DNA transformation-competent Arabidopsis
genomic library in Agrobacterium. Nat Biotech 9:963–967
12. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor
13. Atlas RM (1997) Handbook of microbiological media, 2nd edn. CRC Pr I Llc, pp 283–284
14. Haq I, Ali S, Iqbal J (2003) Direct production of citric acid from raw starch by Aspergillus
niger. Process Biochem 38:921–924
15. de Groot MJA, Bundock P, Hooykaas PJJ et al (1998) Agrobacterium tumefaciens-mediated
transformation of filamentous fungi. Nat Biotechnol 16:839–842
16. Sugui JA, Chang YC, Kwon-Chung KJ (2005) Agrobacterium tumefaciens-mediated
transformation of Aspergillus fumigatus: an efficient tool for insertional mutagenesis and
target gene disruption. Appl Environ Microbiol 71:1798–1802
17. Shao YC, Ding YD, Zhao Y et al (2009) Characteristic analysis of transformants in T-DNA
mutation library of Monascus ruber. World J Microbiol Biotechnol 25(6):989–995
18. Yuan LX, van der Kaaij RM, van den Hondel CA et al (2008) Aspergillus niger genome-wide
analysis reveals a large number of novel alpha-glucan acting enzymes with unexpected
expression profiles. Mol Genet Genomic 279:545–561
19. Cheng Z, Xue YF, Zhang YL et al (2009) Recombinant expression and characterization of
Thermoanaerobacter tengcongensis thermostable a-glucosidase with regioselectivity for
high-yield isomaltooligosaccharides synthesis. J Microbiol Biotechnol 19:1547–1556
Biotransformation to Produce Boldenone
by Pichia pastoris GS115 Engineered
Recombinant Strains
Rui Tang, Peilin Ji, Ying Yu, Xu Yang, Mengjiao Liu, Kaiyuan Chen,
Yanbing Shen and Min Wang
1 Introduction
Steroid medications are used widely in clinical applications and form an important
and large category in the pharmaceutical industry. Boldenone (BD) is androgenic
anabolic steroid; which increases nitrogen retention, protein synthesis, appetite and
stimulates the release of erythropoietin in the kidneys. Boldenone undecylenate is
often prescribed for patients that have lost muscle mass due to extended periods of
bed rest or bouts with significantly diminished muscle mass. In addition, Boldenone
is a popular drug for administration in various animals and extensively used in the
cattle and meat production industry.
Traditionally, boldenone is obtained from 4-AD by chemical synthesis [1, 2]
with many by-products, low quality and low yield. In contrast to chemical syn-
thesis, biotransformation provides an alternative method for the production of
steroid medicine intermediates and has been used extensively as a common and
economical process in the pharmaceutical industry [1, 3, 4]. The methods of BD
biosynthesis usually use AD as the substrate, through the D1-dehydrogenation and
the reduction reaction of C17-one to C17-alcohol. While most of natural
microorganisms do not have the capability of high expressing 17Hsd and
3-ketosteroid-D1-dehydrogenase at the same time. This bottlenecks seriously limit
the wide industrial application of microbial transformation to produce BD. While
recently P. pastoris GS115 was found to be capable of transforming the C17-one to
C17-alcohol of steroids, indicating that P. pastoris GS115 contain the gene for
17Hsd, but its 3-ketosteroid-D1-dehydrogenase has low activity. The construction
of genetically engineered recombinant strains for bacterial KstDs is usually insol-
uble [5–10]. The expression of KstDF from Aspergillus fumigatus in P. pastoris was
found to be the only case that was soluble [6]. And the KsdD2 from R. rhodochrous
DSM43269 was found to have strong D1-dehydrogenation [9].
In this work, a 3-ketosteroid-D1-dehydrogenase KsdD2 from R. rhodochrous
DSM43269 was successfully expressed intracellularly in P. pastoris GS115. The
engineered recombinant strains P. pastoris GS115 pPIC3.5K-ksdd2 was found to
be capable of transforming AD to both ADD and BD. The transformation of AD to
ADD and BD is certainly the result of synergism between exogenous KsdD2 and
endogenous 17Hsd. In this way, BD could be obtained by biotransformation from
AD. Thus we have established a green BD biosynthetic pathway, and provided
theory basis for the wide industrial application of microbial transformation to
produce BD.
The method used for TLC and HPLC analysis of androst-4-ene-3,17-dione (AD),
androst-1,4-ene-3,17-dione (ADD) and boldenone (BD) concentrations was in
accordance with our previous study [13]. Samples extracted with ethyl acetate were
detected by TLC and HPLC. TLC was performed on a TLC plate (Merck, KGaA;
20 20, 0.25 mm, Germany), developed by petroleum ether/ethyl acetate (4:6v/v),
and visualized by spraying with 20% H2SO4 and heating at 100 °C for about 5 min
until the colors developed. HPLC was carried out with an Agilent 1260 HPLC
instrument equipped with a C18 column (ZORBAX Eclipse Plus C18, 3.5-Micron,
150 mm 4.6 mm) and a UV/visible detector. AD, ADD and BD were monitored
at 254 nm and the mobile phase composed of methanol and water (70:30, v/v). The
flow rate was 1 mL/min and the column temperature was 30 °C.
The complete sequence of the ksdd2 gene from R. rhodochrous DSM43269 was
obtained by PCR. The resulting fragment containing 1713 bp nucleotides is a
complete open reading frame. Sequence analysis revealed that the sequence of the
ksdd2 ORF uses ATG as the start codon and the G+C content (%) of the ksdD2 is
69.06 mol%. Also, a possible ribosomal binding site (GAAAGG) sixteen nucleo-
tides upstream was found. The ksdd2 gene consists of 1713 nucleotides and
encodes a deduced protein of 571 amino acids. The molecular weight of KsdD2
was estimated to be 60.63 kDa, and the pI value was calculated to be 5.54 by the
ExPASy compute pI/Mw program algorithm (http://www.expasy.org/cgi-bin/
protparam).
The putative N-terminal FAD-binding motifs in the KsdD2 was consistent with
the sequence as previously described [14], GSG(A/G)(A/G)(A/G)X17E (Fig. 1).
Online analysis software showed that KsdD2 has two transmembrane segments,
120 R. Tang et al.
(a)
(b)
Fig. 1 Conserved sequence and the analysis of transmembrane region in KsdD2; a N-terminal
FAD-binding motif of the putative KsdD2; b the analysis diagram of transmembrane region by
TMHMM
40
20
0
0 0.5:1 1:1 1.5:1 2:1
Molar ratio (HP-β-CD:AD)
Biotransformation to Produce Boldenone … 123
reducing the biotoxicity of substrates, CDs have been widely used to obtain a higher
bioconversion efficiency [1, 17, 18]. In this study, the biotransformation of AD was
conducted with HP-b-CD, its solubility and conversion rate in P. pastoris GS115
pPIC3.5K-ksdd2 were improved, the conversion efficiency of AD on ADD and BD
with different molar ratios of HP-b-CD were investigated as below.
As shown in Fig. 5, AD conversion rate increased obviously with the increase of
HP-b-CD concentration to some extent. When its molar ratio increased to 1:1, the
AD conversion rate reached the maximum 56.76%. So we selected 1:1 as the
optimized molar ratio in AD conversion.
4 Conclusions
Acknowledgements This work was supported by National Natural Science Foundation of China
(No. 21276196, 21406167), Key Project of Chinese Ministry of Education (213004A) and the
Tianjin College students’ innovative entrepreneurial training plan (201410057106).
References
5. Choi KP, Molnar IJ, Yamashita M (1995) Purification and characterization of the
3-ketosteroid-D1-dehydrogenase of Arthrobacter simplex produced in Streptomyces lividans.
J Biochem 117(5):1043–1049
6. Chen MM, Wang FQ, Lin LC et al (2012) Characterization and application of fusidane
antibiotic biosynethsis enzyme 3-ketosteroid-D1-dehydrogenase in steroid transformation.
Appl Microbiol Biotechnol 96:133–142
7. Molnar I, Choi KP, Yamashita M et al (1995) Molecular cloning, expression in Streptomyces
lividans, and analysis of a gene cluster from Arthrobacter simplex encoding 3-ketosteroid-D1-
dehydrogenase, 3-ketosteroid-D5-isomerase and a hypothetical regulatory protein. Mol
Microbiol 15:895–905
8. Morii S, Fujii C, Miyoshi T (1998) 3-Ketosteroid-D1-dehydrogenase of Rhodococcus
rhodochrous sequencing of the genomic DNA and hyperexpression purification, and
characterization of the recombinant enzyme. J Biochem 124:1026–1032
9. Liu Y, Shen YB, Qiao YQ et al (2016) The effect of 3-ketosteroid-D1-dehydrogenase
isoenzymes on the transformation of AD to 9a-OH-AD by Rhodococcus rhodochrous
DSM43269. J Ind Microbiol Biotechnol 43:1303–1311
10. Wagner M, Atrat PG, Wagner B et al (1992) Overexpression of a Rhodococcus erythropolis
protein in Escherichia coli with immunological identity to the Rhodococcus
steroid-1-dehydrogenase. Immunoelectron microscopic localization and electrophoretic
studies. J Basic Microbiol 32:269–277
11. Wei W, Fan SY, Wang FQ et al (2014) Accumulation of androstadiene-dione by
overexpression of heterologous 3-ketosteroid D1-dehydrogenase in Mycobacterium neoau-
rum NwIB-01. World J Microbiol Biotechnol 30:1947–1954
12. Shao ML, Zhang X, Rao ZM et al (2015) Enhanced production of androst-1, 4-Diene-3,
17-Dione by Mycobacterium neoaurum JC-12 using three-stage fermentation strategy.
PLoS ONE 10(9):1–13
13. Xie RL, Shen YB, Qin N et al (2015) Genetic differences in ksdD influence on the ADD/AD
ratio of Mycobacterium neoaurum. J Ind Microbiol Biotechnol 42:507–513
14. van der Geize R, Hessels GI, van Gerwen R et al (2002) Molecular and functional
characterization of the kstD2 gene of Rhodococcus erythropolis SQ1 encoding a second
3-ketosteroid-D1-dehydrogenase isoenzyme. Microbiol 148:3285–3292
15. Singer Y, Shity H, Bar R (1991) Microbial transformation in a cyclodextrin medium. Part 2.
reduction of androstenedione to testosterone by Saccharomyces cerevisiae. Appl Microbiol
Biotechnol 35:731–737
16. Marina VD, Olga VE, Vera MN (2005) Steroid 17b-reduction by microorganisms–a review.
Process Biochem 40(7):2253–2262
17. Wang M, Zhang LT, Shen YB et al (2009) Effects of hydroxypropyl-b-cyclodextrin on
steroids 1-en-dehydrogenation biotransformation by Arthrobacter simplex TCCC 11037.
J Mol Catal B Enzym 59:58–63
18. Zhang LT, Wang M, Shen YB et al (2009) Improvement of steroid biotransformation with
hydroxypropyl-b-cyclodextrin induced complexation. Appl Biochem Biotechnol 159(3):642–
654
The Prokaryotic Expression
of Cyclin-Dependent Kinase 2,
and the Establish of Its Inhibitor
Screening System
Yuan Yuan, Meile Gao, Huan Liu, Tingting Ruan, Weiran Xie,
Meng Wu, Xin Qu, Zhen Liu, Peng Yu and Yuou Teng
1 Introduction
Cyclin dependent kinases (CDKs) are serine/threonine protein kinases and play
essential roles in the intracellular control of the cell division [1, 2], including
CDK1, CDK2, CDK4, CDK6 and different Cyclins (A, B, D and E). At least there
are twenty different CDKs and Cyclins have been reported in mammalian cells [3].
CDKs-Cyclins complex can boost the interphase to mitosis of cell cycle in a
continuous and orderly manner [4, 5]. Meanwhile the abnormal regulated of
CDKs-Cyclins is indispensible ingredient in biological characteristics of tumour an
important. The increased expression of Cyclin or CDK have been observed in
various cancers such as stomach and lung cancer [6]. As the star of CDKs family,
CDK2 causes much attention for its close relationship with cancer [7–9]. The
activation of CDK2 can accelerate the cell cycle progression. Therefore, CDK2 as
an effective target for anti-cancer has attracted the attention of many researchers.
The monomer of CDK2 does not show any activity, but the complex of CDK2 and
Cyclin is the activation type. In addition, a huge number of work committed to
develop small molecule inhibitors of CDK2-Cyclins complex [10]. In this study, we
mainly constituted the prokaryotic expression and screening system of
CDK2-Cyclin A.
There are over 300 crystal structure of CDK2 monomers or binding with its
various inhibitor in PDB-database, more than the sum of other members of CDKs.
CDK2 monomer consists of 298 amino acids, which has the similar structure with
the classical protein kinase- a typical dual-stack synthetic lobed structure [11].
CDK2 has four cavities: one competitive site called ATP binding site, two
non-competitive sites, and ATP non-competitive sites (ANS) or allosteric binding
sites, which appear when conformational changed after Cyclin binds CDK2, also
called cell cycle protein binding site (CBG), which can be used as a small molecule
inhibitor docking target [12].
Small molecule inhibitors of CDK2 have been discovered with the development
of the structure of CDK2 and Cyclin A. The chemical structures of the CDK2
inhibitors include purine, pyrimidine, flavonoids, indole and its derivatives, imi-
dazole and pyridine, pyrazine and pyridine, pyrazine and thiazine ketones, piper-
acillin, pyrazine, butyric acid lactone [13]. The first stage of the CDK2 inhibitors
are flavopiridol, purine ((R)-roscovitine), SNS-032 [6] and PHA-793887. However,
the adverse pharmacological properties and low specificity made them interrupt in
phase II and phase III clinical. Indolocarbazole analogy, indirubin and its deriva-
tives, pyrazine and other 13 kinds of small molecule inhibitors are undergoing
clinical trials [14]. Roscovitine, a classic CDK inhibitor, can work by directly
binding the ATP binding domain of CDK. As reported, Roscovitine potently
inhibits CDK2/Cyclin A with IC50 of 0.7–1.5 lM [15]. In this study, Roscovitine
was used as a positive control to identify the successful establishment of CDK2
inhibitor screening system.
CDK2 full-length cDNA was amplified by the cell of K562, which was used as a
template for PCR amplification of the region in the open reading frame encoding
the human CDK2. PCR amplification was performed using 25 ng of template DNA,
0.1 ng of the appropriate primers [5′-GCCGAATTCATGGAGAACTTCCAA-3′
(5′-primer) and 5′-GCCTCGAGTCAGAGTCGAA GATG-3′(3′-primer)],
1 lL 1.0 U/lL KOD DNA polymerase, 5 lL 10 KOD-plus Buffer, 5 lL 2 mM
dNTP and 2 lL 25 mM-MgSO4 in a final reaction volume of 50 lL. The mixture
reaction was subjected to amplification for 35 cycles (95 °C, 0.5 min; 58 °C,
1 min; 72 °C, 1.5 min) with a thermal cycler. After amplification, PCR products
were cleaved with Eco RI and Xho I and ligated between the corresponding
restriction sites of the vector pET-28a. This vector has a His-tag coding sequence
and can produce a C-terminal 6 His-tag fusion protein. Then the ligation product
was transformed into E. coli. Top 10. Through further bacteria liquid polymerase
chain reaction, we confirmed positive transformants and then utilized EndoFree
Plasmid Mini Kit (CW Bio) to extract CDK2 plasmids for gene sequencing. Correct
transformants were used to induce the expression of CDK2 and Cyclin A protein.
The Prokaryotic Expression of Cyclin-Dependent Kinase 2 … 127
To express the recombinant human CDK2/Cyclin A, E. coli BL21 (DE3) Plyss cells
were grown in solid LB medium (1.5% agar, 1% bactotryptone, 0.5% yeast extract,
1% NaCl) containing 10 mg/mL Kanamycin at 37 °C overnight to obtain single
colonies. Then the single colonie was used to inoculate a 5 mL LB medium
pre-culture, containing the appropriate antibiotic and was then grown at 37 °C
overnight. The culture was used to inoculate 50 mL of LB medium at 37 °C to
OD600 at 0.6–0.8. Isopropyl b-D-1-thiogalactopyranoside (IPTG) was then added to
a final concentration of 0.1 mM and cells were further incubated for 12 h at 25 °C.
Following induction, cells were collected by centrifugation (5,000 g for 5 min),
the supernatant was decanted, and the cell pellet was suspended in lysis buffer
containing 50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 5 mM DTT and 10 mM
imidazole and broken with a noise isolating tamber (Ningbo Scienfz Biotechnology
Co, LTD). The lysate was then centrifuged at 5000 g for 5 min at 4 °C to remove
cell debris. The CDK2/Cyclin A proteins supernatants were loaded on a
Ni-Sepharose TM 6 Fast Flow at 4 °C overnight. After that the Ni-beads were
eluted three times by an elution liquid of 250 mM imidazole. The fractions con-
taining CDK2/Cyclin A protein was then pooled and concentrated by dialysis
(46 mM Na2HPO412H2O, 3 mM NaH2PO42H2O, 0.1 mM NaCl and 10% ml
Glycerin) at 4 °C overnight.
All data were expressed as mean ± S.D. Results were analyzed by one-way analysis
of variance (ANOVA), and significant differences were determined by post hoc
Tukey test using SPSS 21.0 software. Both *P < 0.05 and **P < 0.01 are compared
to blank group in Fig. 3a, and both *P < 0.05 and **P < 0.01 are compared to
DMSO control group in Fig. 3b. P < 0.05 was considered as significant.
Fig. 1 Western blot result of CDK2 protein. Lane M is multicolor protein marker; Lane S1 is cell
sample before adding 0.1 mM IPTG; Lane S2 is the cell sample after adding 0.1 mM IPTG; Lane
S3 is the cell sample after adding lysis buffer; Lane S4 is the supernatant sample after sonication;
Lane S5 is the precipitate sample after sonication; Lane S6 is the supernatant sample after binding
Ni-Beads; Lane S7 is the protein sample after elution; Lane S8 is the beads sample after elution;
Lane S9 is the purified protein sample after dialysis
The size of CDK2 gene fragment is 897 bp and its protein size is 39 KDa. The
prokaryotic expression system of BL21 was applied to induce expression of the
target proteins. When the OD600 value reached 0.6–0.8, 0.1 mM IPTG was added
as an inducer at 25 °C for 12 h. The result of western blot analysis was used to
identify the molecular weight and purity of CDK2 (Fig. 1).
The size of Cyclin A gene fragment is 1299 bp and its protein size is 55 KDa. The
expression and purification procedure of Cyclin A protein was the same as CDK2.
The result of western blot analysis was used to identify the molecular weight and
purity of Cyclin A (Fig. 2).
As is shown in Figs. 1 and 2, the expression of CDK2 and Cyclin A increased
significantly after IPTG induction, and a part of soluble CDK2 and Cyclin A protein
appeared in supernatant by cell disruption and centrifugation. Then the supernatant was
combined with the Ni-Beads, imidazole elution and dialysis for protein purification. It
was found that 250 mM imidazole could be capable of eluting target protein for the first
time and the eluted Ni-Beads had little residues of CDK2 and Cyclin A protein.
In order to confirm whether the preliminary purified CDK2 and Cyclin A protein
was activated or not and eliminate the possibility of only one enzyme worked which
130 Y. Yuan et al.
Fig. 2 Western blot result of Cyclin A protein. Lane M is multicolor protein marker; Lane S1 is
cell sample before adding 0.1 mM IPTG; Lane S2 is the cell sample after adding 0.1 mM IPTG;
Lane S3 is the cell sample after adding lysis buffer; Lane S4 is the supernatant sample after
sonication; Lane S5 is the precipitate sample after sonication; Lane S6 is the supernatant sample
after binding Ni-Beads; Lane S7 is the protein sample after elution; Lane S8 is the beads sample
after elution; Lane S9 is the purified protein sample after dialysis
lead to the inhibitory effects in kinase test system, this study would be divided into
4 groups totally, including the blank, CDK2 group, Cyclin A group and CDK2 and
Cyclin A group (Fig. 3a).
The results in Fig. 3a showed that CDK and Cyclin A protein were purified by
the above method. The light values did not reveal significant decrease in any single
kinase control group compared with kinase test group, which means a single kinase
cannot exert function and consume ATP. When different concentrations of
Roscovitine was added into the system (Fig. 3b), light values rose with the increase
of the inhibitor concentration, proving that CDK2 kinase must be activated by
Cyclin A to play a role. IC50 value of Roscovitine was 1.87 lM, calculating
through linear regression equation which was obtained according to RLU results.
The IC50 value of Roscovitine in our system is in agreement with the reported [15].
The above results show that the CDK2 kinase inhibitors screening platform
in vitro was successfully constructed.
CDKs play significant roles not only in regulation of cell cycle progression but also
in a wide variety of vital physiological processes including neuronal and tran-
scription functions [16]. Their deregulation associated with overexpression,
amplification or mutation of the specific CDK or Cyclin proteins have been reported
in various human cancers [17–20]. This suggests that developing novel CDKs
inhibitors is conducive to the development of pharmacological agents for the
treatment of cancer.
In this study, the prokaryotic expression system of CDK2 and Cyclin A was
inaugurated. The soluble expression protein was inaugurated by plasmid
pET-28a/CDK2 and pET-28a/Cyclin A in Escherichia coli BL21 with 0.1 mM
IPTG at 25 °C for 12 h. The protein was purified by Ni-beads and eluted by
The Prokaryotic Expression of Cyclin-Dependent Kinase 2 … 131
* : p<0.05 vs Blank
**: p<0.01 vs Blank
(a) 60000
* *
Blank
CDK2
40000 CyclinA
CDK2+CyclinA
RLU
20000
**
0
nk
A
K
lin
lin
la
yc
yc
B
C
2+
K
D
C
5 µg /mL enzyme concentration
*: p<0.05 vs DMSO
(b) **: p<0.01 vs DMSO
60000
Blank
DMSO
40000 10nM
* ** ** 0.1µM
RLU
1µM
20000 10µM
100µM
0
M
nM
nk
SO
µM
1µ
1µ
0µ
la
10
M
10
0.
10
B
concentrations
Fig. 3 The results of RUL between four test groups. a The reagents used in the screening system
are as followed: 2.5 lM ATP, 0.004 lg/mL Histone H1, 5 lg/mL CDK2 and Cyclin A proteins in
kinase test group while only one of kinases were added into the system in CDK or Cyclin A
control group, and kinases were replaced by assay buffer in blank control group. b The results of
RUL between different concentrations of Roscovitine. Five different concentrations of inhibitors
were designed to confirm whether there are concentration-dependent between inhibitors and
kinases or not, and DMSO, the solvent of inhibitors were existed as control group
Acknowledgements The authors sincerely thank the financial support from the financial support
from National Natural Science Foundation of China (31301142), Tianjin Natural Science
Foundation of China (12JCYBJC31600 and 11JGYBJC14300) and International Science &
Technology Cooperation Program of China (2013DFA31160).
132 Y. Yuan et al.
References
Junpeng Wang, Yan Zhao, Tao Liu, Ting Wang, Chao Han,
Qian Mao, Ning Chen and Yanjun Li
1 Introduction
L-Threonine is an essential amino acid that is widely used in animal feeds, human
foods, and the pharmaceutical and cosmetics industries [4]. The global demand
for L-threonine is around 0.7 million tons annually and China has become the biggest
L-threonine producer with a proportion of 60% of the world’s production. Currently,
L-threonine is produced mainly through fermentation by Escherichia coli.
L-threonine, which belongs to the aspartic family of amino acids, is synthesized
from the direct precursor oxaloacetate. There are three ways for supplying
oxaloacetate in biological systems: namely the carbon dioxide fixation through
anaplerotic reaction, the TCA cycle and the glyoxylate shunt. In bacteria, the ana-
plerotic reaction includes the carboxylation of phosphoenolpyruvate (PEP) catalyzed
by PEP carboxylase (Ppc) and/or the carboxylation of pyruvate catalyzed by pyru-
vate carboxylase (Pyc). In Rhodocacter capsulatus, Pyc is the only enzyme involves
the anaplerotic reaction [6], while the carbon dioxide is only fixed with pyruvate
catalyzed by Ppc in E. coli [2]. In a few bacteria such as Corynebacterium glu-
tamicum, both Pyc and Ppc function in the carboxylation reactions, although Pyc
contributes to more than 90% of the oxaloacetate supply [7].
In E. coli, the oxaloacetate is mainly synthesized through TCA cycle, which
implies that strengthening of the anaplerotic reaction might be a feasible approach
for increasing oxaloacetate supply and consequently enhancing L-threonine syn-
thesis. Zelle et al. [11] investigated the effects of Pyc and Ppc overexpression on
succinate production, and found that overexpression of Pyc not only increased the
flux towards succinate production, but decreased the accumulation of the
by-product lactate. The experiments conducted by Chao and Liao [1] indicated that
overexpression of Ppc in E. coli reduced glucose uptake rate by 30% in aerobic
condition. Similarly, Gokarn et al. [3] found that the glucose consumption rate
decreased by 14% when Ppc was overexpressed in anaerobically cultured E. coli.
From these results, it can be conclude that the enhancement of Ppc activity is not a
reasonable way, since its substrate PEP is also needed during the process of glucose
uptake via PTS system. Therefore, this study expressed the heterologous Pyc in an
L-threonine producer, E. coli THRD, to investigate the influence on L-threonine
fermentation.
The E. coli THRD is the producer of L-threonine and stored at the Culture
Collection Center of Tianjin University of Science and Technology. Strains and
plasmids used in this work are listed in Table 1.
The genomic DNA of B. subtilis 168 and C. glutamicum 13032 was used as
template to amplify the gene pycA, respectively. Primers pycA-pTrc99a-S and pycA-
pTrc99a-A were used to clone the gene fragment of pycA from B. subtilis. The
amplified fragment was purified from agarose gel, digested with Kpn I and Sal I and
subsequently inserted into the Kpn I-Sal I site of pTrc99a vector to yield pTrc99a-
pycAbsu. The plasmids pTrc99a-pycAcgl and pWSK29-pycA were constructed sim-
ilarly with the corresponding primers and restriction sites indicated in Table 2.
There plasmids were then transformed into the competent cells of E. coli THRD
treated with CaCl2.
Effects of Heterologous Pyruvate Carboxylase Expression … 135
The genomic integration of pycAbsu in E. coli THRD was performed using Red
and FLP-mediated recombination method. Upstream and downstream regions of
pykF fragments were obtained by PCR using the primer pair pykF-up-S and pykF-
up-A, and pykF-down-S and pykF-down-A, respectively. The Cmr gene (about
1000 bp in length) was obtained using primers pKD3-S and pKD3-A with helper
plasmid pKD3 as template. The pycAbsu fragment was amplified using primers
pycA-S and pycA-A with genomic DNA of B. subtilis 168 as template. Splicing by
overlap extension was used to fuse the fragments up- and downstream of the pykF,
Cmr genes and pycAbsu with the primers pykF-up-S and pykF-down-A. In order to
remove the Cmr gene from the integrated locus, cells were transformed with
plasmid pCP20 carrying the FLP recombinant gene. Mutant sequences were veri-
fied by PCR and the subsequent sequencing.
The strain E. coli THRD carrying pTrc99a, pTrc99a-pycA and pTrc99a-pycAcgl was
cultured in LB media at 37 °C, 200 rpm until the OD600 reached about 0.6, when a
final concentration of 0.1 mmol/L IPTG was added to induce the protein synthesis.
After 8 h’s induction, the cells were harvested and washed twice with deionized
water. The suspension cells were then ultrasonically lysed and centrifuged. Both the
supernatants and precipitates were mixed with the sample buffer, boiled for 3 min,
and then separated on 12% SDS/PAGE gels.
Cell growth was measured by monitoring the optical density at 600 nm (OD600) and
dry cellular weight (DCW) was calculated from previously determined calibration
curve. One unit of OD600 was considered to be equal to 0.37 g of DCW.
L-threonine was quantified by HPLC involving pre-column derivatization. The
samples were diluted and derivatized with 2,4-dinitrofluorobenzene, and measured
by HPLC (1200 series, Agilent Technologies, USA) equipped with an
Agilent ZORBAX Eclipse AAA column (4.6 mm 150 mm, 5 lm) and an
Agilent 1200 G1329A auto sampler. Elution was performed using a gradient of
reagent A (50% acetonitrile v/v) and reagent B (0.05 M CH3COONa, pH 6.4) at a
flow rate of 1.0 mL/min. UV absorption was measured at 360 nm and the column
temperature was maintained at 33 °C.
Glucose concentration was measured using a biosensor analyzer (SBA-40E,
Institute of Biology, Shandong Academy of Sciences, Jinan, China). The yield (%)
of L-threonine was calculated based on the glucose consumed.
3 Results
2000
1000
500
0
THRD THRD/pWSK29-pycA THRD/pTrc99a-pycA
60 14 35
L-threonine titer
Biomass
50 Yield 12 30
L-threonine titer (g/L)
Biomass (g DCW/L)
10 25
40
Yield (%)
8 20
30
6 15
20
4 10
10 2 5
0 0 0
cA 99a 9 A
9-py Trc SK2 -pyc
R D/p
W
W SK2 HRD/p T r c99a
TH D/p T D/p
THR THR
Fig. 3 Effect of pycA expression on L-threonine fermentation (biomass, L-threonine titer and
yield)
shake-flask fermentation indicated that the heterologous expression of Pyc with low
copy number plasmid pWSK29 was beneficial to the accumulation of L-threonine
and that whit high copy number plasmid pTrc99a had a role in promoting bacterial
growth.
In previous study, we found that deletion of pykF that encodes pyruvate kinase
significantly improved L-threonine titer and yield of E. coli THRD [10]. Since the
expression of Pyc with low copies was beneficial for L-threonine accumulation, we
proposed that the integration of pycA into the chromosome might be also useful for
L-threonine fermentation. Therefore, we integrated pycA in the locus of pykF, and
investigate the influence on L-threonine fermentation. The biomass, L-threonine titer
and yield of THRD, THRDDpykF and THRD pykF::pycA at the end of fermentation
(28 h) are shown in Fig. 4.
As you can see from Fig. 4, the biomass, L-threonine titer and yield of
THRDDpykF was significantly higher than that of THRD, respectively. The bio-
mass of THRD pykF::pycA was slightly less than that of THRD (10.03 g DCW/L),
while the titer (37.64 g/L) and yield (28.95) of L-threonine was significantly higher,
respectively. The titer and yield of L-threonine of THRD pykF::pycA was compa-
rable to that of THRDDpykF, respectively, although the biomass of the former was
obviously lower. The results revealed that the heterologous expression of pycA on
the basis of knockout of pykF did not further improved L-threonine synthesis.
60 14 35
L-threonine titer
Biomass 12 30
50 Yield
L-threonine titer (g/L)
Biomass (g DCW/L)
10 25
40
Yield (%)
8 20
30
6 15
20
4 10
10 2 5
0 0 0
THRD THRDΔ pykF THRD pykF::pycA
Fig. 4 Effect of pykF deletion and pycA integration on L-threonine fermentation (biomass, L-
threonine titer and yield)
142 J. Wang et al.
4 Discussion
References
1 Introduction
ATAs reversibly catalyze the transfer of an amino group from an amino com-
pound to a ketone compound using the cofactor pyridoxal 5′-phosphate (PLP) two
half reactions following a typical ping pong bi bi kinetic. In the first half reaction,
the amino group of the amino donor is transferred to the PLP to form
pyridoxamine-5′-phosphate (PMP) and the corresponding ketone product is
released. In the second half reaction, the amino group is transferred from the PMP
to the amino acceptor, while the cofactor is recycled to PLP and the product is
released (Fig. 1).
ATAs are divided into two groups, (R)- and (S)-ATAs, according to the chirality
at the amino carbon atom of the substrate. In particular, R-stereospecific ATA
(R-ATA) is quite valuable, and the first (R)-stereoselective ATA identified from
Arthrobacter sp. KNK168 (FERM-BP-5228) [R-ATA] by enrichment screening
shows activity on secondary amine and methyl ketones or small cyclic ketons [8]
and was successfully applied to the asymmetric synthesis of several kinds of chiral
amines, such as (R)-dimethoxyamphetamine (DMA) and so on. Codexis and Merck
& Co. created a variant of an R-ATA allowing industrial-scale synthesis of sita-
gliptin, which is an active ingredient for type-2 diabetes. The improved enzyme,
designated as ATA-117-Rd11, gave a 13% increase in yield, a 53% increase in
productivity and a 19% reduction in total cost, as compared to the chemical
approach conventionally used to synthesize sitagliptin [9]. Recently, a research
group determined the crystal structures of R-ATA form Arthrobacter sp. KNK168
(Ab-R-ATA) and demonstrated the mechanism of the substrate recognition and
substrate specificity of R-ATAs. The active-site residue Arg138 functions in the
dual substrate recognition that is a unique characteristic of ATAs. The recognition
mechanism means to recognize both hydrophilic and hydrophobic substrates in the
same active site. Moreover, the structures of ATA-117-Rd11 and the G136F mutant
of Ab-R-ATA revealed the mechanism that the mutations in both enzymes resulted
in a change of substrate specificity and showed that a loop near the active catalytic
site was a new target region for the rational design, allowing to change the substrate
specificity of R-ATAs. These findings would lead to the rational design of R-ATAs
based on the structural information to develop novel biocatalysts useful for the
production of a diverse range of chiral amine compounds, which would accelerate
the industrial uses of chiral-amine synthesis using R-ATAs.
Gabaculine (5-amino-1,3-cyclohexadienylcarboxylicacid) is a neurotoxic natural
product from Streptomyces toyocaenis and is known to be a covalent inhibitor for
A Crystal Structure of the R-Amine Transaminase … 147
The diffraction data was indexed, integrated and scaled with XDSme [11]. Initial
phasing of the two diffraction data set was conducted by molecular replacement
using MOLREP [12] in the CCP4 [13]. The search model was the crystal structure
of Ab-R-ATA. Molecular replacement was performed using a resolution range from
20 to 3.0 Å. The initial phase was refined using Refmac5 [14] then examined using
Coot [15]. mCPP was added on the basis of 2Fo-Fc and Fo-Fc electron density
maps. The final manual fitting and structure refinement was also completed in Coot
and validated with the Ramachandran plot drawn by the PROCHECK program.
After incubation with the gabaculine, sample changed from yellow to colourless. It
was supposed that Ab-R-ATA had been inhibited by gabaculine in this condition.
By streak seeding, crystals grew in 4 days. The crystallization drops were prepared
by mixing 1.5 lL sample (15 mg/ml) and 1.5 lL reservoir solution (0.2 M mag-
nesium chloride, 0.1 M Bis-Tris pH 6.5, 18% PEG 3350).
Crystal structure analysis of the ATA from Arthrobacter with bound gabaculine
was carried out to obtain detailed insight into substrate recognition and enantios-
electivity. The crystals of the complex of Ab-R-ATA and gabaculine belonged to
space group P42212. The unit cell and the other crystallographic data collection
statistics are shown in Table 1. Matthew coefficient value indicted that there is one
molecule per asymmetric unit. The initial phase was also determined by molecular
replacement using the crystal structure of Ab-R-ATA as search model. The electron
density of mCCP was observed (Fig. 2), which is consistent with the results of
UV-visible spectroscopy. Thus, mCCP was added into the corresponding electron
density. Manual structure construction and refinement were finished using Refmac5
and Coot. The refinement statistics are given in Table 1. The Ramachandran plot
showed that 96.3 and 100% of u-w pairs lie in the most favored and additionally
allowed regions, respectively.
The resulting crystal structure could be solved and refined to a resolution of
1.7 Å and the asymmetric unit contains one monomer like the wild type.
A comparison of the complex and Ab-R-ATA structures showed that they were
very similar, with an r.m.s.d. of 0.38 Å. However, the N-terminal region (residues
1–28) of the complex was not possible to build due to the absence of continuous
electron density. In addition, there were much fewer water molecules in the com-
plex than Ab-R-ATA structure. It is indicated that the N-terminal loop may adopt an
extended conformation and partially shield the active site from the bulk solvent.
The mCPP adduct formed by gabaculine and PLP was observed in the active site
of Ab-R-ATA, which will contribute to understanding the binding pockets. The
mCPP adduct is located in the center of the active site of the enzyme and directs to
the S pocket constituted by the side chains of residues Val69, Thr283 and Ala284
A Crystal Structure of the R-Amine Transaminase … 149
with a close distance (<4.5 Å) (Fig. 3), which probably interact with the methyl
group of MBA. The L pocket constituted by the side chains of Tyr67, His62 and
Trp192 from the adjacent subunit locates on the opposite side of the S pocket.
This L pocket of Ab-R-ATA can accommodate the phenyl group of substrates (R)-
MBA, which is the model substrate used for the research of ATAs. Based on the
information obtained from the crystal structure of this complex, it is indicated that
the shape of the two pockets and the relative position of the L pocket and the small
pocket determines the enantioselectivity of the ATAs.
150 L. Guan et al.
4 Conclusion
The crystal structural analysis could provide lots of information for the rational
design of proteins. Thus, it is a powerful tool in the protein-engineering field. The
crystal structure of the complex of mCCP and Ab-R-ATA reported here provided
essential information and insight into the substrate recognition and revealed the
A Crystal Structure of the R-Amine Transaminase … 151
References
Nomenclature
AHBA 3-amino-5-hydroxy benzoic acid
RF Rifamycins
RSM Response surface methodology
CCD Central composite design
ANOVA Analysis of variance
PBD Plackett-Burman design
1 Introduction
Rifamycins (RF), a group of antiobiotics of the ansamycin family [1], are clinically
important antibacterial agents active against gram-positive bacteria. Several
semisynthetic rifamycins variants (for example, rifampin and refapentine) have
been used clinically for the treatment of tuberculosis and other bacterial infections.
Rifamycins A, B, C, D, E, G, L, O, S, SV, W, X and Y are known to be produced
by the soil actinobacterial species Amycolatopsis mediterranei ATCC13685 [2],
while S.tolypophorous produces O and S [3], S.albovinaceous and Nocardia asiatica
produce B, Micromonospora chalcea produces SV, Nocardia mediterranei produces
R and production of RF- P and Q by a mutant of Nocardia mediterranei has been
reported [4]. 22-187 strain as a new isolate was obtained in our ansamycins
antibiotic producers screening program by targeting the conserved regions of
AHBA (3-amino-5-hydroxybenzoic acid) synthase gene from streptomyces [5]. On
the basis of chemotaxonomic and phylogenetic analysis of 16S rDNA sequences,
the isolate is related most closely to Amycolatopsis kentuckyensis.RF-SV and B
(Fig. 1) were chemically identified from 22-187 fermentation broth [5].
Amycolatopsis mediterranei 22-187 was grown on the YMG medium [5]. The seed
culture preparation and fermentation was carried out as described [5].
Optimization of Culture Medium for Rifamycin SV … 157
Plackett-Burman design was chosen to study the effects of the most important
components in the media. Then a central composite design (CCD) was performed to
optimize the critical components and maximize the RF-SV productivity.
Based on a Plackett-Buramn factorial design, each factor was examined at 2
levels: low and high factors were coded as −1 and +1, and the center point was
coded as 0. Table 1 illustrates the factors investigated, as well as the levels of each
factor used in the experimental design. The response chosen was the production of
RF-SV as peak area in HPLC analysis under RT 14.471 (supplementary Fig. 2a).
In order to fit empiric second-order polynomial model, a central composition
design with five coded levels was performed (Table 2). The quadratic model for
predicting the optimal point was expressed according to following equation:
X X X
Y ¼ b0 þ bixi þ biix þ bijxixj
where Y is the response variable, b0 is the value of the fixed response at the central
point of the experiment, which is the point (0,0); bi and bii the linear and quadratic
coefficients of a factor Xi, respectively; bij is the interaction coefficient between two
factors Xi and Xj.
The Design Expert software (version 6.0.10, stat-ease, inc., Minneapolis, USA)
was used for regression and graphical analysis of the experimental data. The sta-
tistical and analysis of the model was performed in the form of analysis of variance
(ANOVA). The determination coefficient R2 measures the goodness of fit of
regression model. It also includes the t-value for the estimated coefficients and
associated probabilities.
Optimization of Culture Medium for Rifamycin SV … 159
Eight medium components were tested using the Plackett-Burman Design (PBD).
Fifteen experiments were carried out that were the result of the combination of the
variables at the high (+1) and low (−1) level,and three experiments in the
center-point conditions (experiments 3, 6 and 10). The experiment design matrix
and the results are shown in Table 3. The results from the PBD were analyzed using
analysis of variance (ANOVA) (Table 4). The non-significant coefficients were
eliminated on the basis of p-values after examining the coefficients. It was observed
from Table 4, that positively effect RF-SV production by Amycolatopsis mediter-
ranei 22-187 were KH2PO4, glucose and peptone concentrations in media, whereas
KNO3 presence showed negative effect [p-values (p > 0.05)]. The interaction
between ammonium citrate and MgSO4 could have a positive effect on RF-SV
productrion. A coefficient of determination (Adj R2) value of 0.9868 showed that
the obtained data is highly reliable. Hence, in the subsequent experiment, glucose
and peptone were selected and optimized using CCD. In contrast, the content of
KNO3 was eliminated. KH2PO4, Ammonium citrate and MgSO4 concentrations
were kept at high value.
The ANOVA results showed that this model is appropriate. It also suggested that
RF-SV production was primarily determined by the linear and quadratic terms of
peptone and glucose of the model and no significant interaction existed between the
two factors. The Eq. 1 for RF-SV production showed negative linear effect and
positive quadratic effect. The three-dimensional graph obtained from the calculated
response surface was showed in Fig. 3a and the contour plot in Fig. 3b.
Three-dimensional response surface plot and the contour plot of peptone and glu-
cose concentrations against RF-SV production can further explain the results of the
statistical and mathematical analyses. It is evident from the three-demension plot
that RF-SV production reached its maximum at a combination of coded level of X1
and X2 at −0.99 and −0.082, respectively. The contour plot predicted a maximum
response of RF-SV production at the point when the concentrations of glucose and
162 M. Xu et al.
Fig. 3 a Three-demension plot for RF-SV production as a function of peptone and glucose
concentrations. b the contour plot of peptone and glucose (g/100 ml) against RF-SV productivity
peptone were 11.02 and 0.98% (w/v). The maximum RF-SV production should be
reached to 14.72 105 (HPLC peak area) by prediction from RSM analysis. To
confirm these results, optimal medium was verified and compared with the initial
medium. The average RF-SV production was 13.96 105 (HPLC peak area) from
triple-duplicated experiments and was two folds higher than in the initial medium.
But the production of RF-B (detected by HPLC analysis under RT 11.526 as shown
in supplementary Fig. 2(B)) was remained the same as in initial medium. The
optimal medium composition for RF-SV production by Amycolatopsis mediterranei
22-187 was finalized as follows (%): citrate NH4(0.5%), K2HPO4 (0.1%), MgSO4
(0.1%), CaCO3(0.5%), glucose (11.02%), peptone (0.89%).
4 Conclusion
Acknowledgements This study was financially supported by the Municipal Science and tech-
nology program of Tianjin (Grant number: 12JCYBJC31800). It was also supported by the
National High Technology Research and Development Program (2012AA022108) and the pro-
gram for Changjiang Scholars and Innovative Research Team in University(IRT1166).
Optimization of Culture Medium for Rifamycin SV … 163
References
1. Dewick PM (2009) Medicinal natural products: a biosynthetic approach, 3rd edn. Wiley,
Chichester, p 656
2. Schupp T, Taxier P, Auden JAL (1981) New rifamycins produced by a recombinant strain of
Nocardia mediterranei. J Antiobiot 34(8):965–970
3. Martinelle E, Antonini P, Crichio R, Lancini G, White RJ (1978) Rifamycin R, a novel
metabolite from a mutant of Nocardia meditarranea. J Antibiot 31(10):949–951
4. Crichio R, Antonini P, Sartori G (1980) Biosynthesis of rifamycins P, Q and verde novel
metabolites from a mutant of Nocardia mediterranea. J Antibiot 33(8):842–856
5. Zhang H, Linzhuan W, Aiming L, Guizhi S, Feng H, Qiuping L, Yuzhen W, Huanzhang X,
Qunjie G, Yiguang W (2009) PCR screening of 3-amino- 5-hydroxybenzoic acid synthase gene
leads to identification of ansamycins and AHBA-related antibiotic producers in Actinomycetes.
J Appl Microbiol 106:755–763
6. Montgomery DC (1997) Design and analysis of experiments. Wiley, New York
Optimization of Processing Parameters
of Stabilizers After Enzymes Hydrolysis
for Cloudy Ginkgo Juice
1 Introduction
Ginkgo biloba, dating back 300 million years, is a living fossil. Ginkgo seeds are
nutritious, contain starch, protein, lipid, pectin, amino acid, vitamins, trace elements
and abundant phenolic compounds and have been used as food and herbal medi-
cation in china for several thousand years [1]. Ginkgo biloba is wildly grown in
China and the yields of ginkgo seeds are rich. However, they are not made full use.
In the daily life, fruit juice is regular consumed, especially cloudy juice. The
sensory qualities of cloudy juice are important factors for consumer acceptance
[2, 3]. On processing juice, enzymatic hydrolysis is used to obtain higher yield and
improved stability [4–6]. Ginkgo juice is studied recently, but there are many
sediments in it because of its abundant starch. The major sensory problem is the
generation of a large of sediments in ginkgo juice storage. In order to produce stable
ginkgo juice, enzymes were used to hydrolyze starch, after that the juice was
centrifuged to remove sediment [7]. On the processing, ginkgo juice only has little
solids. In other way, stabilizers were added into the juice to improved stability, but
the ginkgo juice produced could not stay stability for long time.
So the experiment is studied to improve the ability of ginkgo cloudy juice. We
find that if stabilizers are added into the juice after enzymes hydrolysis, ginkgo juice
would be more stable(data unpublished). Therefore, the aim of this study was to
investigate the effect of stabilizers (CMC, pectin and SA) dosage after enzymes
hydrolysis on ginkgo cloudy juice and optimize the process conditions by RSM.
Ginkgo seeds were purchased from Tancheng city Shandong province. From the
pre-experiment we know that the water content is 55.88% (w/w), the protein
content is 5.85% (w/w) and the starch content is 28.30% (w/w).
Medium temperature a-amylase and neutral protease were purchased from Ruiyang
Biotechnology Company, Jiangsu, China. CMC, pectin and SA were purchased
from Quankang Food Ingredients Company, Jinan, China.
Ginkgo juice was shaken and certain quality juice was removed to centrifuge tube,
the juice was centrifuged at 3000 rpm for 30 min to measure the quality of sedi-
ments. The ratio of sediments quality and juice quality was considered a measure of
centrifugal sedimentation rate.
RSM was used in designing this experiment. A Design-Expert V8.0 was used to
generate the experimental designs, statistical analysis and regression model. The
independent variables were the dosage of CMC (x1).the dosage of pectin (x2), the
dosage of SA (x3). Each independent variable had coded levels of −1, 0 and 1. The
experimental designs of the coded (x) and actual (X) levels of variables are shown
in Table 1. The response (y) is centrifugal sedimentation rate (%).
The response function (y) was related to the coded variables (xi, i = 1, 2, 3) by a
second-degree polynomial (1) using the method of least squares.
Table 1 The RSM experimental design (in coded level of three variables) employed for
processing ginkgo cloudy juice with CMC, pectin, SA
Experim-ent CMC (g/100 mL Pectin (g/100 mL SA (g/100 mL ginkgo
number ginkgo juice) ginkgo juice) juice)
X1(x1) X2(x2) X3(x3)
1 0.13(1) 0.1(0) 0.11(1)
2 0.07(0) 0.18(1) 0.01(−1)
3 0.13(1) 0.18(1) 0.06(0)
4 0.01(−1) 0.1(0) 0.01(−1)
5 0.13(1) 0.1(0) 0.01(−1)
6 0.01(−1) 0.18(1) 0.06(0)
7 0.07(0) 0.1(0) 0.06(0)
8 0.07(0) 0.1(0) 0.06(0)
9 0.07(0) 0.02(−1) 0.11(1)
10 0.13(1) 0.02(−1) 0.06(0)
11 0.01(−1) 0.02(−1) 0.06(0)
12 0.07(0) 0.1(0) 0.06(0)
13 0.07(0) 0.1(0) 0.06(0)
14 0.01(−1) 0.1(0) 0.11(1)
15 0.07(0) 0.18(1) 0.11(1)
16 0.07(0) 0.02(−1) 0.01(−1)
17 0.07(0) 0.1(0) 0.06(0)
168 H. Yu et al.
The experimental results on the effect of the dependent variables namely CMC
dosage, pectin dosage and SA dosage on the response functions are shown in Table 2.
The corresponding R2 and coefficients of the variables in the models are shown
in Table 3. The closer the value R2 is to unity, the better the empirical model fits the
actual data. The value R2 for centrifugal sedimentation rate (after enzymes
hydrolysis) and for centrifugal sedimentation rate (no enzymes hydrolysis) were
0.9472 and 0.9574, indicating that the regression models explained the reaction
well. The probability (p) values of all regression models were less than 0.05.
From Table 3, it is observed that the quadratic terms of CMC dosage (p 0.001),
pectin dosage (p 0.01) and SA dosage (p 0.001) had a significant effect on
centrifugal sedimentation rate. CMC dosage and SA dosage had a negative inter-
action effect (p 0.05).
Figure 2a describes that the dependence of centrifugal sedimentation rate with
CMC dosage and pectin dosage at fixed SA dosage. From Fig. 2a, it is clear that at
constant pectin dosage and SA dosage, centrifugal sedimentation rate decreased
with CMC dosage at the beginning then increased gradually. Likewise, with the
increase of pectin dosage, the centrifugal sedimentation rate decreased gradually
first, then increased.
Figure 2b presents the variation of centrifugal sedimentation rate with CMC
dosage and SA dosage at constant pectin dosage. It is evident that at a fixed CMC
dosage and pectin dosage, the centrifugal sedimentation rate of ginkgo juice
decreased with SA dosage at the beginning and then increased.
Fig. 2 Response surface diagram for centrifugal sedimentation rate (after enzymes hydrolysis) of
ginkgo juice as a function of a CMC dosage and pectin dosage (the SA dosage was kept constant
at the central point which was 0.06 g/100 mL ginkgo juice) and b CMC dosage and SA dosage
(the pectin dosage was kept constant at the central point which was 0.10 g/100 mL ginkgo juice).
X1 was CMC dosage (g/100 mL ginkgo juice). X2 was pectin dosage (g/100 mL ginkgo juice).
X3 was SA dosage (g/100 mL ginkgo juice)
It is clear from Table 3 that the linear term of SA dosage (p 0.05) had a negative
effect on centrifugal sedimentation rate. The quadratic terms of CMC dosage (p
0.001), pectin dosage (p 0.01) and SA dosage (p 0.001) had a significant
effect on centrifugal sedimentation rate. CMC dosage and SA dosage had a negative
interaction effect (p 0.05).
Figure 4a describes that the dependence of centrifugal sedimentation rate with
CMC dosage and pectin dosage at determined SA dosage. From Fig. 4a, it is shown
that at constant pectin dosage and SA dosage, centrifugal sedimentation rate
Optimization of Processing Parameters of Stabilizers … 171
Fig. 3 Superimposed contour plots for optimization of centrifugal sedimentation rate (after
enzymes hydrolysis) when SA dosage was kept constant at central point (0.06 g/100 mL ginkgo
juice) (a) and CMC dosage and SA dosage (the pectin dosage was kept constant at the central point
which was 0.10 g/100 mL ginkgo juice) (b). X1 was CMC dosage (g/100 mL ginkgo juice). X2
was pectin dosage (g/100 mL ginkgo juice). X3 was SA dosage (g/100 mL ginkgo juice)
Fig. 4 Response surface diagram for centrifugal sedimentation rate (no enzymes hydrolysis) of
ginkgo juice as a function of a CMC dosage and pectin dosage (the SA dosage was kept constant
at the central point which was 0.06 g/100 mL ginkgo juice) and b CMC dosage and SA dosage
(the pectin dosage was kept constant at the central point which was 0.10 g/100 mL ginkgo juice).
X1 was CMC dosage (g/100 mL ginkgo juice). X2 was pectin dosage (g/100 mL ginkgo juice).
X3 was SA dosage (g/100 mL ginkgo juice)
decreased with CMC dosage at the beginning then increased gradually. With the
increase of pectin dosage, the centrifugal sedimentation rate decreased gradually
first, then increased.
Figure 4b presents the variation of centrifugal sedimentation rate with CMC
dosage and SA dosage at constant pectin dosage. It is evident that at a certain CMC
dosage and pectin dosage, the centrifugal sedimentation rate of ginkgo juice
decreased with SA dosage at the beginning and then increased.
172 H. Yu et al.
Figure 5 shows the superimposed contour plot of centrifugal sedimentation rate (no
enzymes hydrolysis) keeping the SA dosage constant at the central point and
keeping pectin dosage constant at the central point. The zone of optimization, as
shown in the superimposed contour plot, depicts CMC dosage to be in the range of
0.05–0.09 g/100 mL ginkgo juice, pectin dosage in the range of 0.06–
0.12 g/100 mL ginkgo juice and SA dosage between 0.03 and 0.07 g/100 mL
ginkgo juice.
Keeping the CMC dosage constant as firmed from Fig. 5, the best combination
of response functions, SA dosage was determined. The process variables for best
combination of response functions were CMC dosage 0.07 g/100 mL ginkgo juice,
pectin dosage 0.09 g/100 mL ginkgo juice and SA dosage 0.05 g/100 mL ginkgo
juice.
4 Conclusion
Using RSM, the optimum condition was obtained. These were CMC dosage
0.07 g/100 mL ginkgo juice, pectin dosage 0.09 g/100 mL ginkgo juice and SA
dosage 0.05 g/100 mL ginkgo juice (the optimum condition was the same between
“after enzymes hydrolysis” and “no enzymes hydrolysis” processing for ginkgo
juice).
Enzymes complete the hydrolysis of starch into low-molecular substances rel-
ative to starch. After that, put stabilizers into ginkgo juice, these low-molecular
substances in juice are more stable. By this experiment, it is known that the lowest
centrifugal sedimentation rate is 5.70% for “after enzymes hydrolysis” and 24.44%
for “no enzymes hydrolysis” processing. From these two figures, it is clear that if
ginkgo juice is enzymes hydrolyzed first and then put into stabilizers, we can get
much more stable ginkgo juice. For this, you can store ginkgo juice for longer time
with little sedimentation.
Acknowledgements This work was supported by the Excellent Middle Aged and Young
Scientist Award Foundation of Shandong Province (No. BS2011SW029) and a Project of
Shandong Province Higher Educational Science and Technology Program (No. J13LE01) and
Science and technology development project of Shandong Province (No. 2014GSF121039).
References
1. Fu XH, Li F, Xu CQ, Wei X (1997) Studies on growth of fruits and components of endosperm
in seeds of Ginkgo biloba cv. Jiangsu DafoShou. GuangXi Plant 17(3):263–269
2. Cameron R (1997) Citrus tissue extracts affect juice cloudy stability. J Food Sci 62:242–245
3. Rubico SM, Resurreccion AVA, Frank JF, Beuchat L (1987) Suspension stability, texture, and
color of high temperature treated peanut beverage. J Food Sci 52(6):1676–1679
4. Abastasakis M, Lindamood JB, Chism GW, Hansen PMT (1987) Enzymatic hydrolysis of
carrot for extraction of a cloud-stable juice. Food Hydrocolloids 1:247–261
5. Pilnik W, Voragen GJ (1993) Pectic enzyme in food and vegetable juice manufacture. In:
Enzymes in food processing. Academic Press, New York, pp 367–371
6. Reiter M, Stuparic M, Neidhart S, Carle R (2003) The role of process technology in carrot juice
cloudy stability. Lebensmittle-Wissenschaft Und Technologie 36:165–172
7. Zhang H, Wang Z, Xu S-Y (2007) Optimization of processing parameters for cloudy ginkgo
(Ginkgo biloba Linn.) juice. J Food Eng 80:1226–1232
Characterization of Recombinant
Dioxygenase from Bacillus thuringiensis
Ning Xue, Zhixiang Li, Lei Zhao, Jie Ma, Qingyang Xu,
Chenglin Zhang and Ning Chen
1 Introduction
In this study, IDO encoding gene tido from B. thuringiensis TUST-1 was cloned
and expressed in Escherichia coli BL21(DE3). Then enzymatic characteristics of
the recombined IDO including Km and Vmax, optimum temperature and pH as well
as thermostability was studied.
E. coli BL21(DE3) and Bacillus thuringiensis TUST-1 were stored in our lab.
Plasmid pET-His (laboratory stock) were used for gene cloning and expression,
respectively.
PCR production of tido was extracted with gel extraction kit [TAKARA Biotech
(Dalian) Co., Ltd.]. The fragment was digested by BamH I and EcoR I and was cloned
Characterization of Recombinant Dioxygenase … 177
into the corresponding restriction site of pET-His, generating in pET-tido. Then the
recombinant plasmids were transformed to E. coli BL21(DE3), resulting EB-tido.
IPTG (0.1 mmol/L, final concentration) was added when EB-tido was grown in
LB medium[with kanamycin (50 lg/mL)] to the midexponential stage. The cells
continued to be cultured for another 4 h. The cells were harvested by centrifuging
and broken with sonication. Cell lysates were separated into soluble and insoluble
fractions by centrifugation at 10,000g for 30 min. The expression of recombinat
TIDO was confirmed by sodium dodecyl sulfate polyacrylamide gel electrophoresis
(SDS-PAGE). Protein bands were visualized in gels by staining with coomassie
brilliant blue R 250.
The 6His tagged TIDO was purified using a Ni2+-NTA affinity column. And
the enzyme concentration was determined by the BCA assay kit (Bio-Rad, USA).
Tido was successfully amplified from B. thuringiensis TUST-1. The sequence of the
gene and its encoding products was analyzed, which showed that the gene was
723 bp in length and encoded a 240-amino acid protein. The gene exhibited
99.31% (718/723) and 98.33% (236/240, L28F, V38L, L157W, A224F) similarity
with nucleotides and amino acids of ido that we cloned before [14]. The different
amino acid sequence might endow the enzyme distinctive characteristics, compared
to the ido from B. thuringiensis TCCC 11826.
1.5
1/V/(min•mg/µmol )
0.5
0
-0.006 -0.004 -0.002 0 0.002 0.004 0.006 0.008 0.01
1/S/(L/µmol)
Recombinant TIDO was purified and kinetics of the enzyme activity was examined.
As shown in Fig. 3, the Michaelis-Menten equation for the enzyme was 1/V = 73.770
[1/S] + 0.438, in which the Km and Vmax value for L-isoleucine was 0.168 mmol/L
and 2.283 lmol/min/mg, respectively. The result indicated that TIDO exhibited
higher affinity to L-isoleucine and catalytic rate than IDO from B. thuringiensis TCCC
11826 (0.18 mmol/L and 2.10 lmol/min/mg, respectively) [14].
180 N. Xue et al.
Relative activity(%)
70
45
20
-5
10 20 30 40 50 60 70
Temperature(˚C)
95
Relative activity(%)
E = -4.811 t + 110.0
70
45 E = -3.012 t + 86.75
20
-5
0 2 4 6 8 10 12 14 16
Time(h)
Relative activity(%)
70
45
20
-5
4 6 8 10
pH
decreased. So the optimal pH for recombinant TIDO was 8.0, which was higher
than that of IDO from B. thuringiensis TCCC 11826 (7.0 °C) [14].
4 Conclusion
The gene tido from B. thuringiensis TUST-1 was successfully cloned and
expressed. Homology alignment of tido and ido from B. thuringiensis TCCC 11826
showed that tido exhibited higher similarity to the latter gene. Enzyme kinetic
analysis result showed that Km and Vmax value of for tido L-isoleucine was
0.168 mmol/L and 2.283 lmol/min/mg, respectively, indicating that TIDO exhib-
ited higher affinity to L-isoleucine and catalytic rate than IDO from B. thuringiensis
TCCC 11826. The optimal temperature and pH for TIDO was 30 °C and 8.0,
respectively. This work will lay theoretical foundation and practical basis on the
microbial manufacture technology of 4-HIL and other amino acid derivatives.
Acknowledgements This work was supported by National High Technology Research and
Development Program 2013AA102106), by the National Natural Science Foundation of China
(31300069); Tianjin Municipal Science and Technology Commission (grant No. 15JCTPJC62800);
Tianjin Undergraduate Training Program for Innovation and Entrepreneurship (201510057063).
China Postdoctoral Science Foundation Funded Project (2017M61170) and Innovation training
program for college students in Tianjin(201710057039) need to be added as the last two supported
project.
References
1. Fowden L, Pratt HM, Smith A (1973) 4-Hydroxyisoleucine from seed of Trigonella foenum-
graecum. Phytochemistry 12(7):1707–1711
2. Al-Habori M, Raman A (1998) Antidiabetic and hypocholesterolaemic effects of fenugreek.
Phytother Res 12(4):233–242
182 N. Xue et al.
Jie Ma, Zhixiang Li, Lei Zhao, Qingyang Xu, Chenlin Zhang,
Xixian Xie and Chen Ning
1 Introduction
time, expression time and induction temperature was investigated and optimized.
These results may be useful for the industrial production of optically active amino
acids, as well as 4-HIL
750bp
186 J. Ma et al.
Fig. 2 Identification of
recombinant plasmids M 1
digested by restricted
endonuclease. M marker; lane
1 pEThis-ido digested by
BamH I and Hind III
3000bp
750bp
Fig. 3 Identification of
recombinant strains.
M 1
M marker; lane 1 ido PCR
product
750bp
Temperature is an important factor for the growth of bacteria and protein expres-
sion. In this study, 0.15 mmol/L IPTG was added into the medium, then expressing
in different temperature (20, 25, 28, 32, 37, 42 °C). As shown in Fig. 6, along with
188 J. Ma et al.
the increased of induced temperature, first of all the protein bands increased
extremely and then slowly. Low temperature could inhibit the activity of intra-
cellular enzyme activity and influence the growth of bacteria, which is an important
reason for reducing protein expression. However, high temperature could inactivate
intracellular coenzyme. Therefore, 37 °C is the most appropriate temperature for
protein expression, which was used in subsequent expression experiments.
As a limiting factor for protein expression, expression time plays an important role
in protein production. In order to increase the protein production of IDO-expressing
strain E. coli BL21(DE3)/pEThis-ido, 0.15 mmol/LIPTG was added into the
medium at 4 h and expression times were adjusted different gradient(1–7 h). As
shown in Fig. 8, at the early stage, protein production increased with expression
time. However, after 6 h it did not increase with the enhancive expression time. The
results indicated that 6 h is the most appropriate expression time for protein
expression.
31.0
22.0
14.4
Optimization of Condition for Recombinant L-Isoleucine … 189
31.0
22.0
14.4
4 Conclusions
Acknowledgements This work was supported by National High Technology Research and
Development Program 2013AA102106), by the National Natural Science Foundation of China
(31300069); Tianjin Municipal Science and Technology Commission (grant No. 15JCTPJC62800).
China Postdoctoral Science Foundation Funded Project (2017M61170) and Innovation training
program for college students in Tianjin (201710057039) need to be added as the last two supported
project.
References
Over the last few decades, finding best practices on how to decrease fish meal
consumption and improve the protein utilization by fish has became an environ-
mental and economical goal for the sustainable development of aquaculture feed
industry [1, 2]. Accordingly, many studies have been designed to evaluate and
promote the protein-sparing feasibility of lipid and carbohydrates in fish diets [3, 4].
However, it is worth noting that fish, in their complex living environment, create a
“glucose intolerant” predisposition, resulting in poorer ability to utilize carbohy-
drate as energy sources than protein and lipids [5, 6]. Consequently, finding the
most efficient way to improve access to carbohydrate has became a vital subject of
fish nutrition research.
Of the cultivation process, besides focusing on feed quality, feeding strategy is
one of the key factors influencing growth and feed conversion, such as feeding
rhythm, feeding regime, feeding rate, feeding frequency, feeding methods and so on
[7, 8]. Among those, feeding frequency has close correlation with the ability to use
carbohydrates [8, 9]. Previous study has indicated that weight growth rate (WGR),
feed efficiency (FE), and protein efficiency ratio (PER) of tilapia (Oreochromis
niloticus O.aureus) were significantly higher in fish fed 44% starch at a feed
frequency of 6 meal/d in comparison to those fed at 2 meal/d [10].
Common carp (Cyprinus carpio), an omnivorous fish, are native to Asia. The
recent study mainly focused on the aspect of its requirement of protein [11, 12].
Although the protein-sparing of dietary carbohydrate [13] or feed frequency [14]
has been well demonstrated in common carp, most studies concerned mainly on one
or other of two factors, and the interaction effect of two factors on growth and feed
Common carp with an initial weight of (55.37 ± 3.35) g were obtained from
Tianjin Huanxin Aquatic Breeding Farm. Fish were acclimated to the experimental
conditions and fed a commercial formulated feed (32% protein, supplied by
Tianxiang Aquatic Co. Ltd.) for 2 weeks in the 3 m 3 m 1.5 m cages before
the beginning of feeding trial. 50 common carp per cage randomly selected and
assigned into the 18 cages (1 m 1 m 1.5 m). Water quality parameters during
the experimental period were pH 7.8 ± 0.2, temperature 26.5–30.5 °C, dissolved
oxygen 6.0–8.0 mg/L and total ammonia nitrogen <0.2 mg/L. Feeding frequencies
were two meals a day at 08:00 and 17:00, and four meals a day at 08:00, 11:00,
14:00 and 17:00. Feeding was conducted manually at a daily ration size 4% of the
initial body weight by the same person during the 8-week feeding trial.
Protein Sparing Effect of Carbohydrate on Growth Performance … 193
At the end of the trial, the common carp were counted and weighted under moderate
anesthesia (MS-222 at 100 lg/kg) after a 24-h fasting period. Total length
(0.01 cm) of 45 fish per diet (15 fish per cage) were measured randomly, and whole
fish (0.01 g) of them were weighed for determination of condition factor (CF).
Blood samples were extracted from the caudal vein, and immediately centrifuged at
4500 rpm for 15 min at 4 °C, and the obtained serum was stored at −80 °C until
the biochemical criterion determinations were made. After blood collection, the
individual intestines and hepatopancreas were quickly excised, and hepatopancreas
194 Z. Fan et al.
(0.01 g) were weighed for the calculation of hepatosomatic index (HSI). After
washed thoroughly with chilled physiological saline (0.85% w/v NaCl), tissue
samples were stored at −80 °C for further analysis.
Tissues were quickly thawed, and weighed samples were automatically homoge-
nized applying an electric homogenizer with a metal pestle on ice. Hepatopancreas
for the glycogen assays was rapidly thawed, and promptly hydrolyzed in alkaline
liquor at the ratio of 1:3 (w:v) with no centrifugation step. For the digestive
enzymes and carbohydrate metabolic enzymes, tissue samples were homogenized
in 9 volumes of ice-cold physiological saline (0.85% w/v NaCl). Homogenates
were centrifuged at 3500 rpm for 15 min at 4 °C (Thermo Fisher Scientific ST 16R
centrifuge), and the resulting supernatants were aliquoted and stored at −80 °C until
subsequent analysis.
Specific growth rate ðSGR; %=dÞ ¼ 100% ½lnðWt Þ lnðW0 Þ=t ð1:3Þ
where Nt and N0 are the final and initial body number, Wt and W0 are the final and
initial body weight (g), t-time of rearing (days), L-fish body length (cm), F-total
feed intake (g), P-content of dietary protein (g) and Wg-liver weight (g).
Results were subjected to two-way analysis of variance (ANOVA), followed by
a Duncan’s test to delineate significance among fish groups using SPSS 16.0
software (SPSS Inc., Chicago, IL, USA). For all analyzes, significant levels were
set at P < 0.05 unless otherwise stated. All data are represented as means ± SD.
2 Results
Growth parameters and feed utilization were presented in Table 2. Weight growth
rate (WGR), specific growth rate (SGR), and protein efficiency ratio (PER) were
generally decreased with increasing dietary carbohydrate levels, but no significant
difference was observed (P > 0.05), whereas WGR, SGR, and PER of fish fed
4 meal/d were significantly higher than those of fish fed 2 meal/d (P < 0.05). Feed
conversion ratio (FCR) tended to increase with increasing dietary carbohydrate
levels, whereas FCR tended to decrease with increasing feeding frequencies
although no significant difference was observed (P > 0.05).
As can be seen from Table 3, hepatosomatic index (HSI) of fish fed 4 meal/d was
significantly lower than that of fish fed 2 meal/d (P < 0.05). Besides, HIS of fish fed
diet C5P32 was significantly lower than that of fish fed diet C20P28 in term of diet
196 Z. Fan et al.
Table 2 Growth parameters and feed utilization of common carp reared at 2 feeding frequencies
(2 and 4 meal/d) and fed with three diets (C5P32, C10P30 and C20P28) (means ± SD)
Diet Feeding WGR (%) SGR (%/d) FCR (g/g) PER (g/g)
frequencies
C5P32 4 258.10 ± 13.61a 2.97 ± 0.11a 1.67 ± 0.09c 1.87 ± 0.10a
C10P30 4 243.92 ± 42.23ab 2.85 ± 0.34ab 1.80 ± 0.33bc 1.77 ± 0.31ab
C20P28 4 239.06 ± 43.33ab 2.81 ± 0.35ab 1.84 ± 0.33bc 1.73 ± 0.31ab
C5P32 2 193.55 ± 3.90bc 2.42 ± 0.04abc 2.22 ± 0.05abc 1.40 ± 0.03bc
C10P30 2 168.33 ± 30.88c 2.18 ± 0.30c 2.62 ± 0.51a 1.22 ± 0.21c
C20P28 2 187.04 ± 42.82bc 2.32 ± 0.39bc 2.38 ± 0.51ab 1.36 ± 0.31bc
Main effects
C5P32 225.83 2.70 1.95 1.64
C10P30 206.12 2.51 2.21 1.50
C20P28 213.05 2.58 2.11 1.54
4 247.03a 2.87a 1.77 1.79a
2 182.97b 2.32b 2.41 1.33b
P value
Feeding frequency 0.00 0.00 0.70 0.00
Diet 0.60 0.56 0.15 0.59
Interaction 0.83 0.80 0.98 0.84
All values are expressed as mean values (n = 3) ± SD, and different alphabets in the same column
denote significant difference (P < 0.05)
composition (P < 0.05). Condition factor (CF) was significantly higher in fish fed
4 meal/d compared with that of fish fed 2 meal/d, but unaffected by diet compo-
sition (P > 0.05). It is worth noting that HIS was significantly affected by the
interaction of diet composition and feed frequency. The highest HIS was found in
fish fed with diet C10P30 at 2 meal/d group.
Table 4 Protease activities (lg/ml) in intestine of common carp reared at 2 feeding frequencies (2
and 4 meal/d) and fed with three diets (C5P32, C10P30, and C20P28) (means ± SD)
Diet Feeding frequencies Foegut Midgut Hindgut
C5P32 4 147.18 ± 7.13 172.19 ± 52.22abc 86.56 ± 7.24
C10P30 4 168.26 ± 34.11 185.78 ± 20.84a 134.08 ± 9.69
C20P28 4 157.88 ± 28.42 123.04 ± 5.55c 105.71 ± 7.81
C5P32 2 105.37 ± 44.59 158.99 ± 16.32abc 85.80 ± 3.41
C10P30 2 128.53 ± 46.33 183.12 ± 6.58bc 92.71 ± 7.73
C20P28 2 107.40 ± 48.58 134.40 ± 21.70bc 89.74 ± 6.34
Main effects
C5P32 137.86 165.59a 81.41
C10P30 136.82 184.44a 111.91
C20P28 132.64 128.72b 99.22
4 157.78a 160.34 108.78
2 113.76b 158.84 89.42
P value
Feeding frequency 0.04 0.90 0.58
Diet 0.98 0.01 0.52
Interaction 0.66 0.71 0.41
All values are expressed as mean values (n = 3) ± SD, and different alphabets in the same column
denote significant difference (P < 0.05)
198 Z. Fan et al.
As can be seen from Table 5, amylase activities in foregut and hindgut of fish were
not affected by either diet composition or feed frequency (P > 0.05). Amylase
activities in midgut of fish maintained at a feed frequency of 4 meal/d were sig-
nificantly lower than those of fish at 2 meal/d (P < 0.05). Besides, amylase activ-
ities in midgut of fish were significantly affected by diet composition with the
lowest observed in fish fed with diet C20P28 (P < 0.05).
As can be seen from Table 6, fish fed at a feed frequency of 2 meal/d exhibited
significantly higher lipase activities in midgut when compared with fed at 4 meal/d
(P < 0.05). However, there was no significant difference in lipase activities in
midgut among fish fed three different carbohydrate levels (P > 0.05). Lipase
activities in foregut and hindgut of fish increased first and then decreased as dietary
carbohydrate levels increased, but the difference was not significant (P > 0.05).
Besides, lipase activities in foregut and hindgut were unaffected by feed frequency
(P > 0.05).
Table 5 Amylase activities (lg/ml) in intestine of common carp reared at 2 feeding frequencies
(2 and 4 meal/d) and fed with three diets (C5P32, C10P30, and C20P28) (means ± SD)
Diet Feeding Foegut Midgut Hindgut
frequencies
C5P32 4 100.82 ± 31.90 101.36 ± 50.90bc 68.95 ± 23.64
C10P30 4 124.28 ± 40.70 130.16 ± 35.90ab 83.66 ± 63.16
C20P28 4 119.72 ± 57.60 60.54 ± 21.91c 75.97 ± 48.57
C5P32 2 128.83 ± 48.87 149.17 ± 16.57ab 121.72 ± 16.59
C10P30 2 157.81 ± 64.91 175.15 ± 26.79a 124.79 ± 26.15
C20P28 2 148.85 ± 39.94 90.63 ± 49.44bc 107.11 ± 49.70
Main effects
C5P32 115.88 139.66a 105.34
a
C10P30 146.26 138.25 104.26
C20P28 134.29 63.08b 91.54
4 114.94 89.02a 86.19
2 145.16 138.32b 127.87
Feeding frequency
Diet 0.84 0.02 0.06
Interaction 0.87 0.01 0.90
Feeding frequency 0.34 0.46 0.87
All values are expressed as mean values (n = 3) ± SD, and different alphabets in the same column
denote significant difference (P < 0.05)
Protein Sparing Effect of Carbohydrate on Growth Performance … 199
Table 6 Lipase activities (lg/ml) in intestine of common carp reared at 2 feeding frequencies
(2 meal/d and 4 meal/d) and fed with three diets (C5P32, C10P30, and C20P28) (means ± SD)
Diet Feeding Frequencies Foegut Midgut Hindgut
C5P32 4 332.64 ± 11.19 63.48 ± 19.02 27.57 ± 11.86
C10P30 4 435.60 ± 18.08 90.82 ± 12.23 85.00 ± 11.47
C20P28 4 98.83 ± 16.41 69.69 ± 11.33 64.37 ± 11.95
C5P32 2 89.51 ± 12.41 175.97 ± 10.74 88.13 ± 16.31
C10P30 2 172.90 ± 19.06 184.03 ± 11.79 89.60 ± 54.63
C20P28 2 339.79 ± 11.24 135.27 ± 12.38 84.21 ± 16.62
Main effects
C5P32 211.08 119.72 57.85
C10P30 304.252 135.43 87.30
C20P28 219.31 102.48 72.94
4 289.03 74.67a 58.98
2 200.74 131.76b 86.41
Feeding frequency
Diet 0.34 0.04 0.32
Interaction 0.65 0.58 0.67
Feeding frequency 0.07 0.19 0.67
All values are expressed as mean values (n = 3) ± SD, and different alphabets in the same column
denote significant difference (P < 0.05)
3 Discussion
remains in fish body, thus enhancing the digestion ability and the assimilation
efficiency of food. Secondly, the previous study reported that for fish, the key to
absorbing the dietary carbohydrate was the absorption percent within 2 h. Thus,
increasing feeding frequency, under the case of feeding on fixed ration, might be
advanced to effectively regulate the carbohydrate absorption rate to boost the uti-
lization ability of fish for high-carbohydrate diets. In the aspect of diet composition,
WGR, SGR, PER of common carp tended to decrease with increasing dietary
carbohydrate levels, but no significant difference was observed. This may suggest
that increasing dietary carbohydrate levels inhibit growth and feed conversion of
common carp to some extent. Similar results on Acipenser gueldenstaedtii were
reported by Cui [18]. Further studies concerned how to improve the utilization
ability of fish for dietary carbohydrate in common carp ought to be designed.
The liver occupies a very important position in the metabolism of carbohydrate,
lipid, protein and other nutrients, and is also an important nutrient storage sites,
which is why the hepatosomatic indexes (HSI) of fish is treated as very sensitive
indicators for the long-term and the short-term nutrition way [19]. In the present
study, HSI of common carp was significantly affected by the interaction of dietary
carbohydrate levels and feeding frequencies. Firstly, HSI of fish fed 4 meal/d were
significantly lower than those of fish at 2 meal/d except fish fed with diet C20P28.
Secondly, when analyzed by feeding frequency, improvements in HIS of common
carp were observed. At 4 meal/d group, HIS of fish fed with diet C5P32 was
significantly lower than that of fish fed with diet C20P28. Previous study on
Pelteobagrus fulvidraco have also reported that HSI tended to decrease with
increasing feeding frequency [20]. In fish biological study, condition factor (CF) is
regarded as a measure of evaluating growth and feeding intensity of fish [21]. CF of
common carp, in the present study, was significantly affected by feeding frequency.
Irrespective of dietary composition, improvement in CF was found in fish fed
4 meal/d compared with those fed 2 meal/d. Whilst independent of feeding fre-
quency, CF of common carp tended to increase with increasing dietary carbohy-
drate levels. Similar findings were also found in Acipenser gueldenstaedtii [18].
This coupled with HIS obtained may demonstrate that, under feeding on fixed
ration, appropriate increasing feeding frequency can reduce the proportion of the
body organs and promote the increase of the body length. This may testify that the
protein-sparing effect of carbohydrate can be enhanced by appropriate increasing
feeding frequency on the other side. However, it is a remarkable fact that
improvement in HSI and CF of common carp was observed in fish offered
high-carbohydrate diet. This may suggest that more dietary protein or carbohydrate
might be transformed into lipid or glycogen which is accumulated in the liver or
viscera.
Digestion is the first limiting factor, which have an effect on utilizing dietary
carbohydrate for growth. In the present study, intestinal digestive enzyme activities
were significantly affected by dietary carbohydrate levels and feeding frequencies to
some extent. Firstly, independent of dietary composition, improvement in protease
activities was found in fish fed 4 meal/d in comparison to those fed 2 meal/d,
whereas amylase and lipase activities tended to decrease with increasing feeding
Protein Sparing Effect of Carbohydrate on Growth Performance … 201
frequency. Among these, protease activity of foregut, amylase and lipase activities
of midgut were significantly affected by feeding frequency. The present study may
suggest that under feeding fixed ration, appropriate increasing feeding frequency
would produce the dietary restriction; whilst fish are able to increase the secretion of
digestive enzymes or improve the digestive enzyme activities to enhance nutrient
absorption under the case of the dietary restriction. This was also certificated by
increasing protease activity of midgut with increasing feeding frequency in the
present study. Similar findings on Acipenser gueldenstaedtii were observed [18].
Secondly, irrespective of feeding frequency, protease and amylase activities of fish
fed with diet C5P32 and C10P30 were significantly higher than those of fish fed
with diet C20P28. Different results were observed in Larimichthys crocea [22], and
Silurus meridionalis [23]. That might be attributed to the difference of feeding
habits, growth phase, dietary carbohydrate sources and so on. However, further
studies should be needed to reveal this.
4 Conclusion
The present study suggests that the growth and the digestive abilities of midgut of
common carp are significantly affected by dietary carbohydrate levels and feeding
frequencies. An increase of feeding frequency from 2 to 4 meal/d can improve the
growth and intestinal digestive enzyme activity of common carp and enhance the
carbohydrate utilization and boost the protein-sparing effect of dietary carbohy-
drate. Meanwhile, increasing carbohydrate level from 5 to 10% leads to the
improvements of protease and amylase activities of midgut. Therefore, it is rec-
ommended that common carp should be fed at 4 meal/d, and the carbohydrate
content of the dietary can be appropriately increased to 5–10%.
Acknowledgements This study was supported by the Tianjin Research Program of Application
Foundation and Advanced Technology (No. 14JCQNJC15100), the Key Technology R&D
Program of Tianjin (No. 13ZCZDNC00900), and the National Natural Science Foundation of
China (No. 31402313). We would also like to acknowledge Tianjin Tianxiang Aquatic Co. Ltd. for
provide the farming equipment and supplements, and LI Jinghui YIN Shuai, ZHANG Zhiyuan,
ZHANG Tengxian, LIN Chengli and WANG Anqi from Tianjin Agriculture University for their
assistance with sampling and index determine.
References
1. Ai CX, Tao QY (2013) The replacement of fish meal—the technical strategy of development
of aquatic compound feed in the case of the high price of fish meal. Feed Ind 34(10):1–7
2. Dong SL(2011) High efficiency with low carbon: the only way for China aquaculture to
develop. J Fish China 35(10): 1595–1600
3. Fan Z, Ling JH, Cheng ZY et al (2015) Protein sparing effect of lipid diets for common carp
(Cyprinus carpio). Adv Eng Res 45:357–368
202 Z. Fan et al.
4. SunJ H, Fan Z, Cheng ZY et al (2016) Effects of dietary corn starch supplemental level on
growth performance, digestive enzyme activities and serum biochemical indices of common
carp. Chin J Anim Nutr 28(4):1152–1159
5. Stone DAJ (2003) Dietary carbohydrate utilization by fish. Rev Fish Sci 11(4):337–369
6. Wilson RP (1994) Utilization of dietary carbohydrate by fish. Aquaculture 124:67–80
7. Biswas G, Thirunavukkarasu AR, Sundaray JK, Kailasam M (2010) Optimization of feeding
frequency of Asian seabass (Lates calcarifer) fry reared in net cages under brackishwater
environment. Aquaculture 305:26–31
8. Wang H, Li Y, Chen K et al (2008) Research progress of feeding rhythm and feeding regime
for aquatic animal. Feed Ind 29(24):17–20
9. Tung PH, Shiau SY (1991) Effects of meal frequency on growth performance of hybrid tilapia
Oreochromis niloticus O. Aureus, fed different carbohydrate diets. Aquaculture 92:
343–350
10. Shiau SY (1997) Utilization of carbohydrates in warm water fish-with particular reference to
tilapia, Oreochromis niloticus O.aureus. Aquaculture 151:79–96
11. Guo L, Jing RZ, Cheng ZY et al (2013) Preliminary study on the effects of reducing dietary
protein of common Carp (Cyprinus carpio). Feed Ind 34(8):41–45
12. Zhang BL, Gao MZ, Cheng ZY et al (2015) Effects of reducing dietary protein level on
growth performance, body composition and immunity of common carp (Cyprinus carpio).
Feed Res 8:49–55
13. Li JN, Xu QY, Wang CA et al (2015) Effects of different dietary carbohydrates and
carbohydrate levels on GH/IGF-I mRNA expression and the fish body composition of
juvenile mirror carp (Cyprinus carpio). J Shanghai Ocean Univ 24(4):489–495
14. Deng ZW (2015) Effects of feeding frequency on feeding and growth of juvenile FFRC.
J Fujian Fish 37(1):68–72
15. Dwyer KS, Brown JA, Parrish C, Lall SP (2002) Feeding frequency affects food consumption,
feeding pattern and growth of juvenile yellowtail flounder (Limanda ferruginea). Aquaculture
213:279–292
16. Silva CR, Gomes LC, Brandao FR (2007) Effect of feeding rate and frequency on tarnbaqui
(Colossoma macropomum) growth, production and feeding costs during the first growth phase
in cages. Aquaculture 264:135–139
17. Sun RJ, Zhang WB, Xu W et al (2013) Effects of dietary protein level and feeding frequency
on the growth performance, body composition and protein metabolism of juvenile large
yellow croakers Pseudosciaena crocea R. Acta Hydrobiol Sin 37(2):281–289
18. Cui C (2014) Effects of light, dietary carbohydrate and feeding strategy on growth of Russian
sturgeon. East China Normal University, Shanghai
19. Peres H, Oliva-Teles A (1999) Effect of dietary lipid level on growth performance and feed
utilization by European seabass juveniles Dicentrarchus labrax. Aquaculture 179(1):325–334
20. Fang w (2010) Food intake and feeding strategy of yellow catfish Pelteobagrus fulvidraco.
Huazhong Agricultural University, Wuhan
21. Froese R (2006) Cube law condition factor and weight-length relationships: history,
meta-analysis and recommendations. J Appl Ichthyol 22(4):241–253
22. Wang MQ, Huang WW, Zhou PP et al (2015) Effects of dietary protein and wheat starch
levels on growth performance, hepatic glycolysis and gluconeogenic keyn enzymes activities
in large yellow croaker (Larimichthys crocea Richardson). J Fish China 39(11):1691–1701
23. Gao M, Luo YP, Cao ZD (2006) Effect of dietary carbohydrate on digestive enzyme activities
in southern catfish (Silurus meridionalis Chen) juveniles. J Southwest China Norm Univ (Nat
Sci) 31(2):120–123
Engineering of Industrial Aspergillus
ochraceus Strains for Improved Steroid
11a-Hydroxylation Efficiency
via Overexpression of the
11a-Hydroxylase Gene CYP68J5
Xingwei Yang, Fan Wu, Xiangjiang Hou, Benfeng Lin, Ruijie Wang,
Fuping Lu, Zhengxiang Wang, Bin Zeng and Xiaoguang Liu
1 Introduction
Aspergillus ochraceus TCCC41060 was obtained from the microbial strain col-
lection of the applied microbiology lab of Tianjin University of Science and
Technology (TUST). TCCC41060 is an industrial strain used for the commercial
preparation of 11a-hydroxy-16,17a-epoxyprogesterone, a key intermediate for the
production of a series of glucocorticoids. The fungus was routinely maintained on
potato dextrose agar (PDA) or in steroid transformation medium (STM) (20 g/l
glucose, 20 g/l yeast extract, 20 g/l tryptone, pH 5.8). The plasmids pB-TrpC and
pBluescript II KS+ vector were obtained from the microbial strain collection of the
applied microbiology lab of TUST and plasmid pAg1-h3-ble was kindly provided
by Prof. Hao Liu (College of Biotechnology, TUST). Unless noted, all enzymes for
DNA molecular manipulations in this study were purchased from the TaKaRa
(Dalian, China) and all primers were synthesized by AuGCT (Beijing, China).
Fig. 2 The schematic diagram for the construction of CYP68J5 exprssion vectors: pB-CYP68J5-
TrpC
206 X. Yang et al.
Transformation was carried out as follows: (1) an aliquot of 200 µl of the proto-
plasts suspension was added to a 10 ml microcentrifuge tube, followed by gently
mixing with 5–10 µg of linearized plasmid and 100 µl of PEG solution (300 g/l
PEG 8000; 50 mM CaCl2; 10 mM Tris-HCl; pH7.5; Sangon Biotech) and incu-
bating for 30 min on ice; (2) PEG solution (2 ml) was added, gently mixed with the
protoplasts and then kept at room temperature for 5 min before the addition of STC
(4 ml) and (3) the transformation mixture was then added to 50 ml liquid regen-
eration medium (PDA containing 0.6 M KCl and 30 lg/ml bleomycin; Solarbio)
and plated on PDA plates. Transformants started to appear after incubation at 28 °C
for 3–5 days and were transferred to PDA slant containing bleomycin (30 µg/ml).
Selected transformants were propagated for 3–5 generations to assess their mitotic
stability before being verified by PCR amplification of the ble gene with the primer
set (forward: 5′-CCAATGGCTCATAGTACCAG-3′, reverse: 5′-GACCTAGAC
TTCAGGTTGTC-3′).
A. ochraceus was grown for 6 days in PDA slants at 28 °C, conidia were collected
and inoculated (106/ml) into 50 ml STM in a 250 ml flask and cultivated for
22–24 h at 28 °C with shaking at 180 rpm. Then predetermined amounts of sub-
strate 16,17a-epoxyprogesterone (EP) was added and allowed transformations to
proceed at 28 °C on the rotary shaker. The samples were extracted with ethyl
acetate, dried and dissolved in acetonitrile and analyzed by HPLC.
ðmHEP MWHEPÞ
Conversion rate ð%Þ ¼ 100%
mEP MWEP
where mEP and mHEP are the weights of EP and HEP, respectively; MWEP and
MWHEP are the molecular weights of EP and HEP, respectively [10].
The statistical analyses were performed using GraphPad Prism 5.0 (GraphPad, San
Diego, CA). All quantitative data were expressed as mean ± SD for each
condition.
208 X. Yang et al.
Fig. 3 The relative expression level of CYP68J5 gene in the recombinant strains (CYP68J5-
TrpC-1 and CYP68J5-TrpC-2) as well as in the recipient strain TCCC41060. Total RNA was
extracted from Aspergillus ochraceus mycelia treated with 16,17a-epoxyprogesterone (EP) for 3 h
induction and quantitative RT-PCR was used to quantify the relative expression levels of CYP68J5
Engineering of Industrial Aspergillus ochraceus Strains … 209
To improve the entry of EP into the fungal cells, Tween-80 was used to optimize
11a-hydroxylation of 16,17a-epoxyprogesterone to better evaluate the transfor-
mation potential of the recombinant strains. As shown in Fig. 4c, sharp increases in
210 X. Yang et al.
Fig. 4 The time-course of substrate conversion profiles of the recombinant strains (CYP68J5-
TrpC-1 and CYP68J5-TrpC-2) and the control strain TCCC41060 under: a 2 g/l of EP;
b conversion of at various EP concentrations for 48 h; c 20 g/l of EP with various amounts of
Tween 80 supplement for conversion of 48 h; and d 20 g/l of EP supplemented with 1.5 g/l of
Tween 80
EP conversion rates for all strains tested were observed with increased Tween-80
concentrations from 0.2 to 1.5 g/l with constant EP concentrations of 20 g/l.
However, a further increase in the concentration of Tween-80 resulted in declined
conversion rates. As shown in Fig. 4d, with 20 g/l of EP as substrate supplemented
with 1.5 g/l of Tween 80, the current production strain TCCC41060 achieved the
highest conversion rates at 60 h (80%), whereas recombinant strain CYP68J5-
TrpC-2 showed the highest conversion rates (92%) at 48 h, a 12% increase com-
pared with TCCC41060. Importantly, the time required for the two recombinant
strains to achieve the highest conversion rates is 12 h shorter than that of the control
strain, demonstrating that the two recombinant strains CYP68J5-TrpC have much
higher hydroxylation efficiency than the production strain TCCC41060.
Engineering of Industrial Aspergillus ochraceus Strains … 211
4 Conclusion
Acknowledgements This work was supported by National High-tech Research and Development
Program of China (863 Program) (no. 2011AA02A211) and Natural Science Foundation of China
(no. 21206127).
References
1. Carballeira JD, Quezada MA, Hoyos P et al (2009) Microbial cells as catalysts for
stereoselective red–ox reactions. Biotechnol Adv 27:686–714
2. Črešnar B, Petrič Š (2011) Cytochrome P450 enzymes in the fungal kingdom. Biochim
Biophys Acta 1814:29–35
3. Donova MV, Egorova OV (2012) Microbial steroid transformations: current state and
prospects. Appl Microbiol Biot 94:1423–1447
4. Girvan HM, Munro AW (2016) Applications of microbial cytochrome P450 enzymes in
biotechnology and synthetic biology. Curr Opin Chem Biol 31:136–145
5. Ceen EG, Dunnili P, Herrmann JPR (1988) Two-liquid phase reactor studies of 11a-
hydroxylation of progesterone by Aspergillus ochraceus. Biotechnol Bioeng 31:743–746
6. Wu DX, Guan YX, Wang HQ et al (2011) 11a-Hydroxylation of EP by Rhizopus nigricans in
a biphasic ionic liquid aqueous system. Bioresour Techn 102:9368–9373
7. Bihari V, Goswami PP, Rizvi SHM et al (1985) Studies on immobilized fungal spores for
microbial transformation of steroids: 11a-hydroxylation of progesterone with immobilized
spores of Aspergillus ochraceus G8 on polyacrylamide gel and other matrices. Biotechnol
Bioeng 27:1392
8. Ohlson S, Larsson PO, Mosbach K (1979) Steroid transformation by living cells immobilized
in calcium alginate. Appl. Microbiol Biot 7:103–110
9. Suzanne BL, Clayton RA, Easton AM et al (2003) Aspergillus ochraceus 11 alpha
hydroxylase and oxidoreductase. US Patent 20030148420A1
10. Sripalakit P, Wichai U, Saraphanchotiwitthaya A (2006) Biotransformation of various natural
sterols to androstenones by Mycobacterium sp. and some steroid-converting microbial strains.
J Mol Catal B-enzym 41:49–54
11. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time
quantitative PCR and the 2−ΔΔCT method. Methods 25:402–408
Response Surface Methodology
Optimization Extraction
of Polysaccharides from Maca (Lepidium
meyenii) Leaves and Primary
Characterization
Caicai Kang, Liming Zhang, Limin Hao, Huanhuan Ge, Meng Xu,
Jie Cao, Jianyong Yu and Yongwu Yang
1 Introduction
Response surface methodology (RSM) has proved quite an effective method for the
expected purpose. Recently, RSM has been widely used to optimize processes in
many studies, including the extraction of polysaccharides. Box-Behnken design
(BBD), the most impotent and common design of RSM, is helpful to design
experiments, build models, evaluate the effects of factors and searching optimum
condition of factors for desirable responses [1]. At present, the RSM has been
successfully applied to extract Bletillastriata polysaccharides [2].
Maca (Lepidium meyenii), a medicine food homology plant, belongs to the
Brassicaceae family [2]. Maca roots (hypocotyls), the subterranean part, have been
a traditional medicinal agent and dietary staple since pre-Columbian times [3].
Maca roots are consumed worldwide as liquor, pills, soft drinks and candies for its
high nutritional value and multi-functional properties [4]. Reported properties
2.1 Material
Fresh maca leaves were collected from Yunnan Province during the months of
November-December, 2013, and identified by Professor Wenbin Hou, Tianjin
Institute of Pharmaceutical Research, China. The leaves were shade dried, pow-
dered, sieved through 800 lm and stored at room temperature. 1-phenyl-3-methyl-
4-benzene formyl pyrazolone (PMP) was from Solarbio Co. Ltd (Beijing, China).
All of the other chemicals were analytical grade.
All the raw materials were immersed in petroleum ether (b. p. 60–90 °C) to remove
the liposoluble constituents using Soxhlet apparatus. The crude polysaccharides
were extracted from the pretreated maca leaves under extraction conditions and
determined by the phenol-sulfuric acid method [12].
The crude MLPs was obtained under the extraction conditions. The extraction
solution were precipitated by the addition of anhydrous ethanol to a final concen-
tration of 80% (v/v). The precipitate was collected by centrifugation at 4000 rpm
for 20 min, and dissolved with water. After that, proteins were removed by the
Sevag reagent (chloroform: butyl alcohol, 4:1, v/v). The precipitated were washed
with anhydrous ethanol and dissolved with water. After lyophilization, the crude
MLPs were obtained.
The software Design-Expert 8.0 was used to design the experiment, analyze the
data and build the model. Box-Behnken design (BBD) with four independent
variables at three levels was applied to determine the optimal extraction variables.
Liquid-solid ratio (X1), extraction time (X2), extraction temperature (X3) and
extraction number (X4) were selected to design the experimental project using BBD.
Y means the extraction yield of polysaccharides from maca leaves and was taken as
the response of the design experiments. Finally, Y was fitted a second-order model
in order to correlate the response variable to the independent variables. The
non-linear computer-generated quadratic model was given as below:
X
k X
k XX
Y ¼ b0 þ bj Xj þ bjj Xj2 þ bji Xi Xj ð2Þ
j¼1 j¼1 i\j
where Y was the estimated response, and b0, bj, bjj and bji were the regression
coefficients for intercept, linearity, square and interaction. Xi and Xj were the
independent coded variables (i 6¼ j, i and j range from 1 to k), and k was the
number of independent parameters (k = 3 in this study).
216 C. Kang et al.
The crude MLPs were obtained under the finally optimum extraction conditions.
Protein was removed by Sevag method [13] and the protein content was determined
by the method of Bradford test [14]. All measurements were conducted in triplicate.
Then, the crude MLPs were further depigmented by using D101 type macroporous
adsorption resin [15].
The IR spectrum of the crude MLPs was determined using a fourier transform IR
spectrophotometer (FT-IR) (Bruker, Germany). The freeze-dried crude MLPs
powder was grinded with potassium bromide power and pressed into 1 mm pellets
in the frequency range of 4000–400 cm−1.
Values from analysis are expressed as mean ± standard deviation (S.D.). Data sets
with multiple comparisons were evaluated by one-way analysis of variance
(ANOVA) with Duncan’s test. Differences were considered significant at P < 0.05.
3.1.1 Effect of Water to Raw Material Ratio on the Crude MLPs Yield
The ratio of water to raw material was an important parameter of the polysaccha-
rides. As the Fig. 1a shown that the yield of the crude MLPs were influenced under
the ratio from 10 to 60. The other extraction conditions were set as follows:
extraction time 60 min, extraction temperature 75 °C and extraction times 1. The
yield of the crude MLPs was increased rapidly with the increase of the ratio from 10
to 30 mL/g, increased gradually at ratios from 30 to 50 mL/g, but, decreased at
ratios above 50 mL/g. Thus, to minimize electricity and time costs, the water to
raw material range of 40–60 mL/g was considered for use in further BBD
experiments.
Extraction time was another factor that would influence the extraction efficiency. As
the Fig. 1b shown that the yield of the crude MLPs were influenced under the time
Response Surface Methodology Optimization Extraction … 217
Fig. 1 Effects of water to raw material ratio (a), extraction time (b), extraction temperature (c),
extraction times (d) on extraction yield of the crude MLPs. Different lower case letters in the same
curve indicate significant differences (p < 0.05). Date shown in mean ± standard deviation
(n = 3)
from 30 to 180 min. Other extraction conditions were set as follows: the ratio of
water to raw material (40 mL/g), extraction temperature 75 °C and extraction times
1. The Fig. 1b illustrated the yield of the crude MLPs increased from 6.46 ± 0.10
to 7.57 ± 0.15% with the extraction time varied from 30 to 120 min and decreased
thereafter, indicating that longer extraction time can lead to thermal instability and
degradation of the polysaccharides. Consequently, extraction time of from 90 to
150 min was used for further BBD experiments.
218 C. Kang et al.
Extraction temperature was another factor that would influence the extraction
efficiency. The yield of the crude MLPs affected by different extraction temperature
was shown in Fig. 1c, when other parameters were fixed at the ratio of water to raw
material (40 mL/g), extraction time 120 min and extraction times 1. As evident
from Fig. 1c, the maximum amount of polysaccharides obtained was 9.32% at
95 °C, the extraction yield increased sharply with extraction temperature from 45 to
95 °C (5.58 ± 0.07 to 9.33 ± 0.07%). This can be explained by the fact that
polysaccharides solubility increases with temperature, thus facilitating polysac-
charides diffusion out of the cells. So, extraction temperature of from 85 to 100 °C
was used for further BBD experiments.
The extraction time was another factor that would influence the extraction effi-
ciency. As shown in Fig. 1d that the yield of the crude MLPs were influenced under
the extraction times from 1 to 5 when the other conditions were 40 (mL/g), 120 min
and 90 °C (the ratio of water to raw material, extraction time and extraction tem-
perature). Figure 1d shows that the yield of the crude MLPs was increased sharply
with the increase of the extraction times from 1 to 2, reaching to 11.8 ± 0.18%
under the extraction times 2, increased gradually at extraction times from 3 to 5.
Thus, to minimize electricity and time costs, the extraction times of from 1 to 3 was
considered for use in further BBD experiments.
On the basis of single factor experiment, using the method of Box-Behnken Design
(BBD) designed four factors three levels center test. Then using the Design-Expert
8.0.6 software based on the yield of the crude MLPs as response value table, test
Design scheme and test results were shown in Table 1.
Response surface plots and contour plots can be obtained according to the
regression model combined with the actual value of the response surface opti-
mization analysis, as shown in Figs. 2 and 3. And the comprehensive analysis can
be concluded that the interaction was between the various factors on the yield of the
crude MLPs.
Response Surface Methodology Optimization Extraction … 219
Table 1 BBD with the experimental values and predicted values for extraction yield of the crude
MLPs
Run Actual (Code) Yield (%)
X1 Water/solid X2 Time X3 Temperature X4 Number Observed Predicted
1 30 (−1) 120 (0) 100 (1) 2 (0) 1.0529 1.0998
2 40 (0) 120 (0) 80 (−1) 3 (1) 1.1037 1.1039
3 40 (0) 150 (1) 100 (1) 2 (0) 1.1737 1.2568
4 30 (−1) 120 (0) 80 (−1) 2 (0) 0.9793 0.8578
5 50 (1) 90 (−1) 90 (0) 2 (0) 1.0442 1.0371
6 30 (−1) 150 (1) 90 (0) 2 (0) 1.0899 1.0496
7 40 (0) 120 (0) 90 (0) 2 (0) 1.1724 1.1491
8 50 (1) 120 (0) 100 (1) 2 (0) 1.1559 1.1718
9 40 (0) 120 (0) 80 (−1) 1 (−1) 0.7295 0.7218
10 40 (0) 120 (0) 90 (0) 2 (0) 1.1625 1.1491
11 50 (1) 120 (0) 90 (0) 1 (−1) 0.7402 0.7628
12 50 (1) 150 (1) 90 (0) 2 (0) 1.0902 1.0271
13 40 (0) 150 (1) 80 (−1) 2 (0) 0.9606 1.0588
14 40 (0) 120 (0) 90 (0) 2 (0) 1.2054 1.1493
15 50 (1) 120 (0) 80 (−1) 2 (0) 1.0073 0.9698
16 30 (−1) 120 (0) 90 (0) 1 (−1) 0.6225 0.6286
17 40 (0) 150 (1) 90 (0) 3 (1) 1.3861 1.3046
18 40 (0) 120 (0) 90 (0) 2 (0) 1.0254 1.1491
19 50 (1) 120 (0) 90 (0) 3 (1) 1.0113 1.1384
20 30 (−1) 90 (−1) 90 (0) 2 (0) 0.8024 0.8275
21 40 (0) 90 (−1) 100 (1) 2 (0) 1.1909 1.1708
22 40 (0) 150 (1) 90 (0) 1 (−1) 0.7931 0.7789
23 30 (−1) 120 (0) 90 (0) 3 (1) 1.0282 1.0967
24 40 (0) 90 (−1) 90 (0) 1 (−1) 0.7189 0.7742
25 40 (0) 120 (0) 100 (1) 3 (1) 1.4358 1.3638
26 40 (0) 90 (−1) 90 (0) 3 (1) 1.1149 1.0833
27 40 (0) 90 (−1) 80 (−1) 2 (0) 0.9306 0.9248
28 40 (0) 120 (0) 90 (0) 2 (0) 1.1824 1.1493
29 40 (0) 120 (0) 100 (1) 1 (−1) 0.9606 0.9058
Fig. 2 Response surface plots (3D) showing the effects of variables on response yield of the crude
MLPs
Fig. 3 Contour plots showing the effects of variables on response yield of the crude MLPs
where Y represents the yield of MLPs, and X1, X2, X3, X4 are water to raw
material ratio, extraction time, extraction temperature and extraction times,
respectively.
The ANOVA was shown in Table 2. P-values were used to check the signifi-
cance of each coefficient, and the smaller P-value means the more significance
relevant coefficient. As shown in Table 2: a model P-value of P < 0.0001 indicated
very high significance of the regression, and the lack of Fit F-value of 1.51 implies
the lack of Fit is not significantly relative to the pure error. Meanwhile, the
determination coefficient R2 (0.9081) and the adjusted R2 (0.8162) were enough
approximate to the model. It also can be found that X3, X4, X21 and X24 were high
significant (P < 0.01), X2 was significant to explain the effect of variables on the
yield of MLPs. And others were not significant to explain the yield of the crude
MLPs.
Table 2 ANOVA for response surface quadratic model analysis of variance table
Source Sum of df Mean F-value P-value Significant
squares square levels
Model 94.46 14 6.75 9.88 <0.0001 ***
A 2.49 1 2.49 3.65 0.0769
B 3.62 1 3.62 5.31 0.0371 *
C 14.8 1 14.8 21.68 0.0004 ***
D 53.07 1 53.07 77.73 <0.0001 ***
AB 1.3 1 1.3 1.9 0.1895
AC 0.042 1 0.042 0.062 0.8077
AD 0.2 1 0.2 0.3 0.5949
BC 0.057 1 0.057 0.083 0.7774
BD 1.31 1 1.31 1.92 0.1875
CD 0.14 1 0.14 0.2 0.6597
A2 9.71 1 9.71 14.22 0.0021 **
B2 1.23 1 1.23 1.81 0.2004
2
C 3.10E−03 1 3.10E−03 4.54E−03 0.9473
D2 9.83 1 9.83 14.4 0.002 **
Residual 9.56 14 0.68
Lack of fit 7.56 10 0.76 1.51 0.3675
Pure error 2 4 0.5
Correlation 104.02 28
Total
R2 0.9081 Adj-R2 0.8162
Note *P < 0.05, significant; **P < 0.01, high significant, ***P < 0.001, very high significance
222 C. Kang et al.
In order to get a profound understanding of the results as shown in Table 2 and the
interactions of the variables, as shown in Figs. 2 and 3, the 3D plots and their
corresponding contour plots depicted the interactions between two variables when
the others were kept at their zero levels. Also the 3D plots and their corresponding
contour plots provided a vivid interpretation of the interaction for two variables and
facilitated the location of optimum experimental conditions. The optimal extractions
of MLPs from maca leaves were as follows: ratio of water to raw material (38 mL/g),
extraction time 150 min, extraction temperature 100 °C and extraction times 3.
Under the above conditions, the maximum predicted yield was 14.24%, which
corresponded fairly well to that of experimental value 14.20 ± 0.25% (n = 3).
The protein content of the crude MLPs obtained by the finally optimum extraction
conditions was 5.63 ± 0.26%. After deproteinization and depigment, the protein
level of the crude MLPs were 0.09% by the Bradford test. The deproteinization rate
was 95.7%.
In order to characterize primarily the crude MLPs, FT-IR analysis was per-
formed. The FT-IR results was shown in Fig. 4. According to the FT-IR analysis,
the strong band at 3445 cm−1 represented the stretching of the hydroxyl group
(O–H), and the band at 2929 cm−1 attributed to the C–H stretching of the CH2 and
CH3 group. The asymmetrical peak at around 1562 cm−1 and symmetrical peak at
1443 cm−1 were due to the carboxyl group in the crude MLPs. The peak at around
1100 cm−1 indicated C–O stretching vibration [16]. Three absorption peaks at
around 1100–1010 cm−1 indicated a pyranose form, which was performance
(1114, 1078 and 1024 cm−1). The crude MLPs was similar to sugar characteristic
absorption peaks in the IR spectrum.
4 Conclusions
In this study, response surface methodology (RSM) was used to optimize extraction
process of polysaccharides from maca leaves. The optimal conditions for MLPs
extraction were as follows: ratio of water to raw material (38 mL/g); extraction
time, 150 min; extraction temperature, 100 °C and extraction times, 3. Under the
optimal extraction condition, the maximum predicted yield of the crude MLPs was
14.4% which was close to the experimental yield 14.2 ± 0.25% (n = 3) and had a
good reproducibility. The FT-IR analysis revealed the general characteristic
absorption peaks of the crude MLPs. These results indicated that the MLPs have
enormous potential value as a novel natural polysaccharides in functional food.
Also the MLPs need further works on polysaccharides structures, pharmacological
activity evaluation, and application studies.
Acknowledgements This research was financially supported by the Research Project of People’s
Liberation Army (No. AX110C002, BX115C007 and HX-04-13-022).
References
1. Wu SH, Gong GL, Wang YY, Li F, Jia SY, Qin FX et al (2013) Response surface
optimization of enzyme-assisted extraction polysaccharides from Dictyophoraindusiata. Int J
Biol Macromol 61:63–68
2. Qu Y, Li CX, Zhang C, Zeng R, Fu CM (2016) Optimization of infrared-assisted extraction of
Bletillastriata polysaccharides based on response surface methodology and their antioxidant
activities. Carbohyd Polym 148:345–353
3. Zha SH, Zhao QS, Chen JJ, Wang LW, Zhang GF, Zhang H, Zhao B (2014) Extraction,
purification and antioxidant activities of the polysaccharides from maca (Lepidium meyenii).
Carbohyd Polym 111:584–587
4. Esparza E, Hadzich A, Kofer W, Mithöfer A, Cosio Eric G (2015) Bioactive maca (Lepidium
meyenii) alkamides are a result of traditional Andean postharvest drying practices. Phytochem
116:138–148
5. Chen JJ, Zhao QS, Wang LW, Zha SH, Zhang LJ, Zhao B (2015) Physicochemical and
functional properties of dietary fiber from maca (Lepidium meyenii Walp.) liquor residue.
Carbohyd Polym 132:509–512
224 C. Kang et al.
6. Uchiyama F, Jikyo T, Takeda R, Ogata M (2014) Lepidium meyenii (Maca) enhances the
serum levels of luteinising hormone infemale rats. J Ethnopharmacol 151:897–902
7. Bai N, He K, Roller M, Lai CS, Bai L, Pan MH (2015) Flavonolignans and other constituents
from Lepidium meyenii with activities in anti-inflammation and human cancer cell lines.
J Agric Food Chem 63:2458–2463
8. Liu H, Jin W, Fu C, Dai P, Yu Y, Huo Q, Yu L (2015) Discovering anti-osteoporosis
constituents of maca (Lepidium meyenii) by combined virtual screening and activity
verification. Food Res 77:215–220
9. Stojanovska L, Law C, Lai B, Chung T, Nelson K, Day S et al (2015) Maca reduces blood
pressure and depression, in a pilot study in postmenopausal women. Climacteric 18:69–78
10. Sandoval M, Okuhama NN, Angeles FM, Melchor VV, Condezo LA, Lao J et al (2002)
Antioxidant activity of the cruciferous vegetable Maca (Lepidium meyenii). Food Chem
79:207–213
11. Li E, Nie SP, Yang C, Qiu ZH, Xie MY (2011) Extraction optimization, characterization and
bioactivity of the crude polysaccharides from Herba Moslae. Carbohyd Polym 83:1201–1206
12. Wang QH, Shu ZP, Xu BQ, Xing N, Jiao WJ, Yang BY, Kuang HX (2014) Structural
characterization and antioxidant activities of polysaccharides from Citrus aurantium L. Int J
Biol Macromol 67:112–123
13. Dubois M, Gilles KA, Hamilton JK, Rebers PT, Smith F (1956) Colorimetric method for
determination of sugars and related substances. Anal Chem 28:350–356
14. Vilkas E, Radjabi NF (1986) The glucomannan system from Aloe vahombe (liliaceae). III.
Comparative studies on the glucomannan components isolated from the leaves. Biochimie 68
(9):1123–1127
15. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254
16. Li C, Huang Q, Fu X, Yue XJ, Liu RH, You LJ (2015) Characterization, antioxidant and
immunomodulatory activities of polysaccharides from Prunella vulgaris Linn. Int J Biol
Macromol 75:298–305
Metabolomic Analysis of Dunaliella salina
upon Concurrent Deprivation of Nitrogen
and Phosphor
1 Introduction
D. salina was cultured in the modified Johnson’s medium [1]. Cells were cultured in
500 mL Erlenmeyer flasks containing 250 mL of medium under 60 lmol m−2 s−1
continuous illumination under 30.0 °C. Cells were inoculated at 2.0 105 cell/ml.
Cultures were manually shaken three times per day. All the cells were cultured for
two 16/8 h light/dark cycles to synchronize the growth phases before inoculation
and thereafter transfer to continuous light conditions. Concurrent nitrogen and
phosphor deprivation was performed according to our previous reports [1].
Cells were quenched with −40 °C 60% (v/v, methanol/water) methanol solution for
5 min. Cells were collected by 4000 rpm centrifugation for 5 min at 4 °C and
washed with 0.5 mol/L NaCl for three times. Cell pellets were put into in liquid
nitrogen and ground into powder. The intracellular metabolites were extracted
according to previously reported methods [3]. Metabolites quenching and extraction
were performed according to previous report [4] and with some modifications. The
fatty acids were extracted according to a modified method [5]. Briefly, 10 mg cell
pellets was suspended in 0.8 mL fatty acid extract (Trichloromethane:methanol,
2:1, v:v) and 10 lL 80 lg/ml internal standard solution nonadecanoic acid was
added, and 1.2 mL FAMES reagent (10% HCl-methanol, m:m) was added into the
samples, and incubated at 80 °C for 1 h. 1 mL hexane was used to extract fatty acid
methyl esters.
Table 1 Metabolites detected by GC-MS of cells cultured under complete media and that
deprived of nitrogen and phosphora
Class Components Ratio (-N-P/CM)
Amino acids N,N-Dimethylglycine 0.75
L-Valine 0.78
l-Alanine 0.63
l-Leucine 1.82
l-Isoleucine 0.85
L-Norvaline 0.56
Serine 0.83
l-Threonine 1.29
L-Serine 0.80
N,O,O-Tris(trimethylsilyl)-L-threonine 1.09
DL-Ornithine 1.32
N-a-Acetyl-L-Lysine 2.46
L-Proline 2.90
Glycyl-l-glutamic acid 1.12
Glutamic acid 1.90
L-Lysine ND in -N-P
Sugars D-(-)-Erythrose ND in CM
L-(-)-Trehalose 1.30
D-Ribose 2.96
D-(-)-Tagatose ND in CM
L-(-)-Sorbose ND in CM
d-Galactose 1.31
D-(+)-Talose 2.66
D-Mannose ND in CM
D-Glucose 5.75
2-Deoxy-D-ribose ND in CM
D-Erythro-Pentose 1.15
D-erythro-2-Pentulose ND in CM
D-Psicofuranose ND in CM
Lactose 1.00
D-Fructose ND in CM
D-Mannose 3.75
Sucrose 6.61
D-(+)-Cellobiose 22.16
Fatty acid Nonanoic acid ND in -N-P
Dodecanoic acid ND in -N-P
Hexadecanoic acid 1.81
trans-9-Octadecenoic acid 0.14
Myristate 1.33
Tetradecanoic acid ND in CM
(continued)
Metabolomic Analysis of Dunaliella salina upon Concurrent … 229
Table 1 (continued)
Class Components Ratio (-N-P/CM)
cis-11-Eicosenoic acid ND in -N-P
cis-13-Eicosenoic acid ND in -N-P
11-Eicosenoic acid ND in -N-P
Decanoic acid ND in -N-P
cis-13-Docosenoic acid ND in -N-P
Docosanoic acid ND in -N-P
Octadecanoic acid 1.17
Oganic acid L-(+)-Lactic acid 2.99
Acetic acid 1.10
Ethanedioic acid 1.22
2,3,4-Trihydroxybutyric acid 1.14
Pentanedioic acid 1.00
Heptanedioic acid ND in CM
Phosphoric acid 2.77
Azelaic acid 1.16
Propanoic acid 0.64
2-Ketoglutaric acid 2.62
Sebacic acid 2.62
1,2,3-Propanetricarboxylic acid 1.38
Deoxycholic acid 0.84
L-Ascorbic acid 2.17
Alcohols Glycerol 0.98
Pentitol 1.06
D-Erythro-Pentitol 1.27
D-(+)-Arabitol 0.62
L-(-)-Arabitol 3.07
Xylitol 1.58
Adonitol 1.34
L-Fucitol ND in CM
d-Mannitol ND in -N-P
D-Sorbitol ND in -N-P
Myo-Inositol 1.51
meso-Erythritol 1.18
Amines Acetamide 0.64
Cadaverine 1.37
3-methylol-methylamine 1.29
Urea 0.96
N-[4-[Bis-amino]butyl] acetamide 1.36
Others Unknown 3 1.36
Unknown 5 1.38
Unknown 6 ND in CM
a
ND not detected
230 H. Lv et al.
Fig. 1 Clustering of metabolites from D. salina cells cultured under complete media and that
deprived of nitrogen and phosphor
Multivariate statistical analysis PCA and PLS were used to study changes in the
intracellular metabolites between nutrients replete and deplete condition. Results
showed that both PCA and PLS have satisfactory predictive and fitting abilities
based on R2X and Q2 which are more than 0.8 (Table 2). The unsupervised
clustering method PCA was used to identify and rank major sources of variance
within the two data sets. Based on similarities and differences in the measured
parameters, PCA was able to cluster biological samples into both expected and
unexpected groups. Samples in different phases were separated clearly on the PCA
score plot (Fig. 2). The first principal component (PC1) accounted for 92.6% of the
total variance between the two experimental groups. The PC1 vs. PC2 of PCA plot
(these two components account for 98.1% of the variance) clearly separates the two
kinds of cultures. These results show that the intracellular metabolic profiles of
concurrent nitrogen and phosphor deprived cells differ significantly. PCA loading
plots were used to analyse the contributions of each metabolite to the principal
components. The contributions of data points were evaluated based on their dis-
tances from the origin point [7]. The potential biomarkers identified by PCA
loading plots were sucrose, glycerol, L-(+)-Lactic acid, DL-Ornithine, hexade-
canoic acid, trans-9-Octadecenoic acid, cis-13-Eicosenoic acid, cis-11-Eicosenoic
acid, L-Proline, suggested that the activities of the related pathways were changes
significantly (Fig. 3).
Metabolomic Analysis of Dunaliella salina upon Concurrent … 231
Fig. 2 PCA score plot of metabolites from D. salina cells cultured under complete media and that
deprived of nitrogen and phosphor
Fig. 3 PCA loading plot of metabolites from D. salina cells cultured under complete media and
that deprived of nitrogen and phosphor
To further investigate the fatty acids profiles, fatty acids were extracted and
esterified by FAMES reagent, and analyzed by GC-MS. A total of 15 kinds of fatty
acids were detected (Table 3). The contents of total fatty acids were increased
significantly and the saturation of fatty acids also increased. These results were
similar to that of single nitrogen deprivation [1]. Among the detected fatty acids, the
most abundant are hexadecanoic acid and 9,12,15-Octadecatrienoic acid.
4,7,10,13,16,19-Docosahexaenoic acid which have special pharmaceutical value
was detected and its content was decreased upon concurrent deprivation of nitrogen
and phosphor.
232 H. Lv et al.
Table 3 Statistical data from PCA and PLS at different culture conditions
FA CX:Y Relative content (%)
-N-P CM
Tridecanoic acid (13:0) 0.55 ± 0.02 0.45 ± 0.02
Hexadecanoic acid (16:0) 28.5 ± 0.7 23.0 ± 0.4
Heptadecanoic acid (17:0) 1.38 ± 0.17 0.81 ± 0.09
P
SFA 30.5 ± 0.9 24.2 ± 0.5
9-Hexadecenoic acid (16:1) 1.70 ± 0.40 2.28 ± 0.04
10-Octadecenoic acid (18:1) ND 0.17 ± ND
7,10-Hexadecadienoic acid (16:2) 3.24 ± 0.11 3.45 ± 0.09
7,10-Octadecadienoic acid (18:2) 0.91 ± 0.04 0.85 ± ND
9,12-Octadecadienoic acid (18:2) 12.2 ± 0.0 11.5 ± 0.1
10,13-Eicosadienoic acid (20:2) ND 0.22 ± 0.01
c-Linolenic acid (16:3) 1.14 ± 0.04 1.22 ± ND
9,12,15-Octadecatrienoic acid (18:3) 38.1 ± 0.7 35.4 ± 0.4
cis-5,8,11-Eicosatrienoic acid (20:3) 2.99 ± 0.06 3.87 ± 0.06
5,8,11,14-Eicosatetraenoic acid (20:4) ND 3.65 ± 0.14
6,9,12,15-Docosatetraenoic acid (22:4) 0.72 ± 0.11 0.75 ± 0.04
4,7,10,13,16,19-Docosahexaenoic acid (22:6) 8.5 ± 0.1 11.7 ± 0.2
P
UFA 69.5 ± 1.8 75.1 ± 1.0
Total FA 711.0 ± 24.0 546.0 ± 13.0
a
ND not detected
4 Conclusion
Acknowledgements This project was supported by the National Natural Science Foundation of
China (No. 31401029). There are no conflicts of interest to declare.
References
3. Weckwerth W, Wenzel K, Fiehn O (2004) Process for the integrated extraction, identification
and quantification of metabolites, proteins and RNA to reveal their co-regulation in
biochemical networks. Proteomics 4:78–83
4. Villas-Boas SG, Hojer-Pedersen J, Akesson M et al (2005) Global metabolite analysis of yeast:
evaluation of sample preparation methods. Yeast (Chichester, England) 22:1155–1169
5. Lee S-Y, Kim S-H, Hyun S-H et al (2014) Fatty acids and global metabolites profiling of
Dunaliella tertiolecta by shifting culture conditions to nitrate deficiency and high light at
different growth phases. Process Biochem 49:996–1004
6. Liu M, Zhong C, Wu X-Y et al (2015) Metabolomic profiling coupled with metabolic network
reveals differences in Gluconacetobacter xylinus from static and agitated cultures. Biochem
Eng J 101:85–98
7. Jalali-Heravi M, Masoum S, Shahbazikhah P (2004) Simulation of 13C nuclear magnetic
resonance spectra of lignin compounds using principal component analysis and artificial neural
networks. J Magn Reson (San Diego, California 1997) 171:176–185
Effect of Yeast Extract on Production
of e-poly-L-lysine by Streptomyces
diastatochromogenes
Fengzhu Guo, Haoran Zheng, Xue Zhang, Yawen Cheng, Zhilei Tan
and Shiru Jia
1 Introduction
2.1 Microorganisms
Streptomyces diastatochromogenes 6#-7 was used for e-PL fermentation and pre-
served in our laboratory.
The strain was maintained on modified Bennett’s agar slant, which contained (per
liter): 10 g glucose, 1 g beef meat extract, 2 g polypepton, 1 g yeast extract, and
20 g agar. The pH was adjusted to 7.7 with 2 M NaOH solution.
Medium M3G was used for both seed culture and production culture throughout
the study, which contained (per liter): 50 g glucose, 5 g yeast extract (Oxoid Ltd.,
England or Angel yeast Co., Ltd.), 10 g (NH4)2SO4, 0.8 g K2HPO43H2O, 1.36 g
KH2PO4, 0.5 g MgSO47H2O, 0.04 g ZnSO47H2O, 0.03 g FeSO47H2O, and the
pH was adjusted to 7.2 with NH4OH solution (24–28%, w/v).
The above media were autoclaved at 121 °C for 20 min, and in each case,
glucose and yeast extract were autoclaved separately.
Effect of Yeast Extract on Production of e-poly-L-lysine … 237
For seed culture, a loopful of the spore from the slant cultures was inoculated into a
500-mL flask containing l00 mL M3G medium and cultured at 30 °C, 180 rpm on
a rotary shaker for 30 h. For shake-flask production with two-stage fermentation,
100 mL M3G in 500-mL Erlenmeyer flask was inoculated with 6% v/v of
pre-cultured seed culture and then cultured at 30 °C, 180 rpm for 96 h. Bead rings
were added in seed medium to control the initial OD600 1.9–2.1.
The fed-batch fermentation was carried out in a 5-L fermentor (B. Braun
Biotech, Germany) with a 3L work volume using a two-stage pH control strategy at
30 °C and agitation 300–1000 r/min, dissolved oxygen (DO) was controlled at
about 30% monitored with a DO electrode. The pH monitored with a pH electrode
was kept 4.0 automatically with aqueous ammonia when pH dropped to below 4.0.
When the consumption rate of glucose decreased significantly, the e-PL fed-batch
fermentation was finished.
The samples were intermittently obtained from the Erlenmeyer flask or 5-L fer-
mentor for analysis. The cells were collected by centrifuged (6000 g, 5 min), and
washed twice with ultra-pure water. The supernatant was used to determine the
e-PL concentration according to the Itzhaki’s method improved by our laboratory
[7, 8]. The concentrations of residual glucose were determined using a biosensor
SBA-40E (Shandong academy of sciences). The pH was determined using an
acidometer (FE20, Mettler Toledo) and biomass accumulation was determined
using dry cell weight analysis.
The aspartokinase (Ask) activity was assayed as described by Hamano et al. [4].
One unit of enzyme activity is defined as the amount of enzyme catalyzing the
formation of 1 lmol aspartyl-b-hydroxamate per minute per g of cell at 30 °C. The
standard assay mixture was consisted of 100 mM Tris–H2SO4 (pH 7.0), 600 mM
(NH4)2SO4, 600 mM hydroxylamine–KOH (pH 7.0), 10 mM ATP, 10 mM
MgSO4, 10 mM aspartic acid–KOH (pH 7.0), and crude enzyme solution in a
0.5 mL volume. The reaction mixtures were incubated for 10 min at 30 °C, and
0.75 mL ferric chloride solution (10% FeCl36H2O and 3.4% trichloroacetic acid in
0.7 N HCl) was added. After centrifugation, the A540 was measured in the super-
natant meanwhile background activity was measured in the absence of aspartic acid.
238 F. Guo et al.
(a) (b)
100 2000
4.0 50 5 1.0
pH
90 Ask
RG
Ask Activity(U/g wet cells)
45
Pls Activity (U/g wet cells)
3.5
Biomass 80 Pls
40 4 0.8 1500
3.0 ε− PL
35 70
Biomass(g/L)
2.5 60
ε− PLg/L
3
RG(g/L)
30 0.6
50 1000
pH
2.0 25
20 2 0.4 40
1.5
15 30
1.0 500
10 1 0.2 20
0.5
5 10
0.0 0 0 0.0 0 0
48h 72h 48h 72h
1200 10
40 140 45
Ask ε−
ε−PL Biomass 40
35 120 1000
Biomass(g/L)
30
25 6
ε−PL (g/L)
80 25
600
pH
20
60 4 20
ε−
15 400
15
40
10 2 10
200
5 20
5
0 0
0 0 0
0 24 48 72 96 120 144
Time(h)
Fig. 2 The changes of e-PL, biomass, pH and key enzyme activities in the process fed-batch
fermentation
activity has the same trend as Ask (shown in Fig. 2). It is not difficult to find that the
activities of Ask and Pls have obviously positive correlation with the concentration
of e-PL and biomass.
Li et al. [10] find that the addition of yeast extract greatly inhibited pyruvate
accumulation, while peptone was shown to be the most favorable nitrogen source
and indicates that nitrogen level plays an important role in the production of
pyruvate. Gorret et al. [11] demonstrated that yeast extract plays an important role
during the whole process of fermentation. It can not only accelerate the cell’s
growth but also directly affects the production and the accumulation of by product.
Because yeast extracts play an important effect during the fermentation and
constituent which from different manufacturers have a slightly different. This article
investigated the effect of yeast extract from different production batches during the
e-PL fermentation to investigate whether it have noticeable influence or not.
These two kinds of yeast extract from the same manufacturer (Oxoid Ltd.,
England) with different production date were defined as group A and group B,
respectively. The yeast extract from another manufacturer (Angel yeast Co., Ltd.)
was named group C, as control group. In order to guarantee the validity and
reliability, each sample was assayed in triplicate wells. The T tests were performed
with SPSS 20.0 software to analysis the experimental results.
According to Table 1, the result shows that there is a significant difference when
adding yeast extract which are from different factories (p < 0.05), yet no significant
240
difference in yeast extract which are from different production date of same factory
(p > 0.05). Furthermore, the production of e-PL was affected by the enzyme
activities.
Aeschlimann et al. [12] discovered that the yeast extract concentration had sig-
nificant effect on the accumulation of e-PL. Therefore, research about the effect of
yeast extract concentration on the fermentation parameters of strain 6#-7 was car-
ried out.
According to the data in Fig. 3a, the effect of yeast extract in e-PL production
performed in a concentration-dependent manner. Strain 6#-7 possessed clearly
higher activities of production of e-PL with 15 g/L yeast extract, with a 6-fold
enhancement compared to group without yeast extract. The results indicated that the
higher concentration of yeast extract, the more favorable to increase the content of
e-PL. However, as shown in Fig. 3b, pH was always maintained at the range of
0.9 3
pH
0.6 2
0.3 1
0.0 0
0 5 10 15 0 5 10 15
Yeast extract concentration(g/L) Yeast extract concentration(g/L)
(c) (d)
50 10
48h
48h 72h
40 72h 8 96h
96h
Biomass(g/L)
30 6
RG(g/L)
20 4
10 2
0 0
0 5 10 15 0 5 10 15
Yeast extract concentration(g/L) Yeast extract concentration(g/L)
3.5–3.7. When the concentration of yeast extract was 0 and 5 g/L, the residual
glucose (RG) barely changed. At the level of 10 and 15 g/L, the RG significantly
decreased to 21 and 11 g/L, respectively (shown in Fig. 3c). In Fig. 3d, the biomass
decreased at different degrees with the increase of yeast extract‚ especially when the
yeast extract was 15 g/L, the biomass decreased the most, which was about 4.4 g/L.
Hence, it can be inferred that cell autolysis may occur during the fermentation.
To further explore the improved e-PL synthetic ability of different concentration
of yeast extract, key enzyme activities (e.g. Ask, Pls, and HSD) were investigated.
Compared with the control group, the levels of Ask had significantly upward
tendency in response to the concentration of yeast extract and reached maximum at
125 U/g (shown in Fig. 4a). According to the data in Fig. 4b, it seems that there
were no evident law between the activity of Pls and yeast extract.
According to the date in Fig. 4c, the activity of HSD present a trend from
increase to decrease and the activity reached its maximum in 72 h when the yeast
extract concentration was 10 g/L.
Comprehensive analysis of Figs. 3 and 4, we can find that the production of
e-PL and enzyme activities increased significantly with the increase of yeast extract
concentration.
72h
Pls Activity(U/g wet cells)
72h 1000
120 96h
96h
105
800
90
75 600
60
400
45
30
200
15
0 0
0 5 10 15 0 5 10 15
Yeast extract concentration(g/L) Yeast extract concentration(g/L)
(c) 70
48h
HSD Activity(U/g wet cells)
60 72h
96h
50
40
30
20
10
0
0 5 10 15
Yeast extract concentration(g/L)
Fig. 4 The influence of different concentrations of yeast extract on key activities of strain 6#-7
Effect of Yeast Extract on Production of e-poly-L-lysine … 243
4 Conclusions
Acknowledgements We are grateful for financial support from the National Natural Science
Foundation of China (Project 21276197), the National High-tech R&D Program (863 Program)
(2013AA102106), the Tianjin science and technology commissioner project (15JCTPJC59700)
and the National Key Technology Support Program (No. 2015BAD16B04).
References
10. Li Y, Chen J, Liang DF et al (2000) Effect of nitrogen source and nitrogen concentration on
the production of pyruvate by Torulopsisglabrata. J Biotechnol 81:27–34
11. Gorret N, Maubois JL, Engasser JM et al (2001) Study of the effects of temperature, pH and
yeast extract on growth and exopolysaccharides production by Propionibacterium
acidi-propionici on milk microfiltrate using a response surface methodology. J Appl
Microbiol 90:788–796
12. Aeschlimann A, von Stockar U (1990) The effect of yeast extract supplementationion the
production of lactic acid from whey permeate by Lactobacillus helveticus. Appl Microbiol
Biotechnol 32:398–402
Comparison of Aroma Compounds
in Sauce-Flavor and Sesame-Flavor “Shan
Zhuang Lao Jiu” Liquors by Headspace
Solid-Phase Microextraction Coupled
with Gas Chromatography-Mass
Spectrometry
1 Introduction
Chinese liquor, one of the oldest distillates, and Whisky, Brandy, Vodka, Rum and
Gin are known as the six main distilled liquors in the world. Meanwhile, Chinese
liquor is a traditional alcoholic beverage and well received by consumers in China.
It is usually fermented from grains, mainly including sorghum, wheat, rice, sticky
rice and corn, etc. After fermentation, the fresh spirit is distilled off and then aged
under controlled conditions. The aged distillate is adjusted to the designated ethanol
concentration and blended to ensure the quality of the final product [1]. Chinese
liquor contains quite a number of volatile compounds which can greatly influence
its flavor and aroma, including acids, esters, alcohols, aldehydes, ketones, hydro-
carbons, pyrazines, phenolic compounds and others. According to their aroma
characteristics, Chinese liquor can be classified into many types [2]. Among them,
sauce-flavor liquor and sesame-flavor liquor are two typical Chinese liquors.
In order to achieve a practical and reliable method for the analysis of various
volatiles in alcoholic beverages, several extraction methods have been developed
and used, such as liquid–liquid extraction (LLE) [2], liquid–liquid micro-extraction
extraction (LLME) [3], solid-phase extraction (SPE) [4], stir bar sorptive extraction
(SBSE) [5], and solid-phase micro-extraction (SPME) [6]. Among, the SPME
method was widely used in the analysis of aroma compounds with its solvent-free,
simple operation, high sensitivity and low sample loading. Due to the difference of
the structure and volatility of the analytes, the different SPME fibers have been
used, including polyacrylate (PA), carboxen/polydimethylsiloxane (CAR/PDMS),
polydimethylsiloxane (PDMS), divinylbenzene/carboxen/polydimethylsiloxane
(DVB/CAR/PDMS), and polydimethylsiloxane/divinylbenzene (PDMS/DVB),
etc. The DVB/CAR/PDMS fiber was more suitable for the analysis of aroma
compounds in alcoholic beverages according to the relevant research [7]. So far,
there were some studies on volatile aroma compounds by SPME in alcoholic
beverages, such as wine [6], Chinese liquor [8], and Chinese rice wine [9].
As a result of the multiple variations, such as raw materials, environment and
manufacturing practices, the wines from the different regions or the same region but
different categories all have unique aroma profiles. “Shan Zhuang Lao Jiu” liquor is
a China liquor produced in Chengde, Hebei, China, and is welcomed by consumers
in the north of China. The objective of this study was to identify aroma compounds,
and to quantitate the key aroma compounds in sauce-flavor and sesame-flavor
“Shan Zhuang Lao Jiu” liquors by HS-SPME-GC-MS to find out the aroma sim-
ilarities and differences of the two liquors. The findings in this study will help to the
further understanding of Chinese liquor.
Chinese liquor samples: sauce-flavor and sesame-flavor “Shan Zhuang Lao Jiu”
liquor samples were supplied by Summer Resort Industrial Group in Chengde city.
Chemicals: acetic acid, butyric acid, hexanoic acid, ethyl acetate, isobutyl
acetate, butyl acetate, isoamyl acetate, ethyl hexanoate, ethyl heptanoate, ethyl
lactate, ethyl caprylate, ethyl butyrate, n-propanol, isobutanol, n-butanol, isoamylol,
phenethyl alcohol and hydrocarbon mixture (C8–C40) were purchased from
Sigma-Aldrich (St. Louis, MO).
Identification was carried out using an Agilent 7890A GC coupled with an Agilent
5975C mass selective detector (MSD). The sample was analyzed on a CP-Wax
column (50 m 250 lm inner diameter, 0.2 lm film thickness). The injector
temperature was 250 °C and the split mode was used (ratio 15:1). The oven tem-
perature was held at 50 °C for 3 min, raised to 70 °C at a rate of 3 °C min−1,
Comparison of Aroma Compounds in Sauce-Flavor … 247
The sample was diluted with ultrapure water to a final concentration of 10% (v/v)
ethanol for analysis. A total of 8 mL diluted sample was put into a 20 mL vial and
spiked with 3 g NaCl, and a small magnetic stirrer was added. The sample was
equilibrated for 10 min and extracted for 50 min at 60 °C with continuous stirring.
The SPME fiber holder equipped with DVB/CAR/PDMS fibre (Supelco, Inc.,
Bellefonte, PA, USA) was used for aroma compounds extraction in this study. After
extraction, the fiber was inserted into the injection port of a GC-MS system (at
250 °C for 5 min).
A total of 120 aroma compounds were identified in the two liquors. Among them,
103 aroma compounds were identified in sauce-flavor liquor and 115 in
sesame-flavor liquor. The total ion chromatograms (TIC) were shown in Fig. 1.
248 F. Liu et al.
Fig. 1 Total ion chromatograms (TIC) of the sauce-flavor liquor (a) and the sesame-flavor
liquor (b)
12 Butyl propionate 1130.8 NDd 0.0301 38 Ethyl pelargonate 1532.1 0.901 1.0457
13 Methyl caproate 1178.3 0.0449 0.0397 39 2-Hydroxy-4-methyl ethyl 1542.1 0.6017 1.0534
valerate
14 Isoamyl isobutyrate 1190 0.0377 0.0506 40 Isobutyl n-octanoate 1550.3 0.1195 0.0686
15 Ethyl hexanoate 1230.1 23.977 26.7196 41 Heptanoic acid-3-methyl 1556.1 0.1406 0.1763
butyl ester
16 Isoamyl butyrate 1262 0.4947 0.4057 42 Isoamyl lactate 1570.3 0.138 0.0836
17 Hexyl acetate 1267 0.1073 0.1133 43 3-Nonene acid ethyl ester 1579.5 NDd 0.2256
18 Isoamyl 2-methyl butyrate 1273.4 0.0275 NDd 44 Hexyl hexanoate 1609 0.426 0.365
19 Ethyl 5-methyl caproate 1281.8 NDd 0.1338 45 Butyl caprylate 1611.3 0.0729 0.0808
20 Ethyl cis-3-hexenoate 1292.2 NDd 0.0308 47 Ethyl caprate 1635.4 3.7062 4.5134
(continued)
249
Table 1 (continued)
250
No Compoundsa RIb Relative contentc (%) No Compoundsa RIb Relative contentc (%)
Sauce-flavor Sesame-flavor Sauce-flavor Sesame-flavor
21 Butyl pentanoate 1310.4 0.0374 0.0696 48 Ethyl benzoate 1659.2 0.3374 0.3277
22 Amyl butyrate 1311.7 0.0510 0.0822 49 Ethyl trans-4-decenoate 1660.8 0.2762 0.2154
23 Propyl hexanoate 1313.8 0.1438 0.263 50 Diethyl succinate 1672.9 0.1182 0.2232
24 Ethyl oenanthate 1329.2 5.5348 7.3111 51 Hexyl oenanthate 1709.5 0.1469 0.1449
25 Hexyl propionate 1333.8 NDd 0.0531 52 Ethyl dodecanoate 1738.6 0.1101 0.129
53 Ethyl phenylacetate 1780.8 1.14 0.9674 7 1-Pentanol 1256.7 0.0462 0.0561
54 Hexyl octanoate 1810.5 NDd 0.4726 8 Hexyl alcohol 1359.3 0.2582 0.1273
55 Phenethyl acetate 1812.3 0.5586 NDd 9 n-Heptanol 1462.2 0.0778 0.0547
56 Ethyl laurate 1842.8 2.7239 2.564 10 1-Octanol 1565.2 0.1487 0.0579
57 Furfuryl caproate 1861.6 0.0362 NDd 11 Nonanol 1667.9 NDd 0.188
58 Isoamyl decanoate 1863.4 0.0515 0.0775 12 1-Decanol 1770.8 0.0518 NDd
59 Ethyl 3-phenylpropionate 1883.5 0.5923 0.4931 13 Phenethyl alcohol 1922 0.3474 0.2247
60 3-phenyl-1-propanol acetate 1943.1 0.0871 0.0292 Acids
61 Ethyl tridecanoate 1946.1 0.0597 0.0537 1 Acetic acid 1465 0.0512 0.0513
62 Phenethyl butyrate 1964.4 0.1778 0.1073 2 Butyric acid 1643.1 0.1163 0.1068
63 Ethyl myristate 2054 2.1095 1.5393 3 Isovaleric acid 1685.1 0.1794 0.1661
64 Ethyl pentadecanoate 2156.6 0.3832 0.2545 4 Hexanoic acid 1863 0.4734 0.2531
65 Phenylethyl caproate 2178.4 0.1166 0.0559 5 Heptoic acid 1976.8 0.0914 0.0638
66 Ethyl palmitate 2260.8 10.262 7.2524 6 Octanoic acid 2087.7 0.1737 0.086
67 Ethyl 9-Hexadecenoate 2286.5 0.3864 0.2288 7 Decanoic acid 2307.8 0.0799 0.0571
68 Ethyl octadecanoate 2468.7 0.039 0.0583 Aldehydes and Ketones
69 Ethyl oleate 2490.4 0.7528 0.6568 1 Acetaldehyde 645.5 0.1051 0.1096
70 Ethyl linoleate 2540.4 1.3786 1.011 2 Isobutyraldehyde 809.7 NDd 0.1328
(continued)
F. Liu et al.
Table 1 (continued)
No Compoundsa RIb Relative contentc (%) No Compoundsa RIb Relative contentc (%)
Sauce-flavor Sesame-flavor Sauce-flavor Sesame-flavor
71 Diisobutyl phthalate 2570.6 0.3596 0.0743 3 Isovaleraldehyde 884.8 0.6684 1.084
Alcohols 4 2-Pentanone 956.3 0.2832 0.5143
1 Acetal 861.7 0.3038 0.3302 5 Isovaleraldehyde diethyl 1069.9 0.6022 1.0331
acetal
2 Propyl alcohol 1036.8 0.2211 0.4261 6 3-Octanone 1250.6 0.0746 0.0681
3 Isobutanol 1096 0.4131 0.2458 7 2-Nonanone 1385.4 0.1098 0.0275
4 n-Butyl alcohol 1145.2 0.1189 0.1342 8 Furfural 1451 0.992 1.5976
5 2-methyl-1-butanol 1210.3 0.7377 0.504 9 Benzaldehyde 1511.9 0.398 0.3564
6 Isoamylol 1212.9 2.2771 1.843 10 Nonanal diethyl acetal 1526.7 0.1139 0.0596
11 2-Undecanone 1596.7 0.1343 0.0678 7 Heptadecane 1699.1 0.0949 0.0713
12 Acetophenone 1646 0.0955 0.065 Others
13 Phenylglyoxylic acid diethyl 1712.3 0.2523 0.2719 1 2-Amyl furan 1219.8 0.0378 0.0449
Comparison of Aroma Compounds in Sauce-Flavor …
acetal
14 cis-Geranylacetone 1854 0.0979 0.054 2 Phenyl ethylene 1243.7 NDd 0.1216
Alkanes 3 Trimethylbenzene 1324.1 NDd 0.0186
1 1,1-diethoxy-3-methylButane 1065.1 0.1341 0.2151 4 Dimethyltrisulfide 1365.6 0.2178 0.1428
2 Dodecane 1200.7 0.0706 0.0478 5 2-ethyl-6-methyl pyrazine 1387.8 NDd 0.0343
3 Tridecane 1300 NDd 0.0199 6 Naphthalene 1730 0.1157 0.1049
4 Tetradecane 1398.9 0.1303 0.1171 7 1,7-Dimethyl naphthalene 1997.8 0.1197 NDd
5 Pentadecane 1499.3 0.1216 0.1202 8 Metacresol 2094.6 0.0334 0.0178
6 Hexadecane 1599.2 0.1354 0.1126
a
All compounds detected by GC-MS were identified by MS spectra and RI comparisons to pure standards
b
Retention index
c
The relative content of each compound was calculated by peak area normalization method
d
251
Not detected
252 F. Liu et al.
The result of quantitative analysis of the key aroma compounds in sauce-flavor and
sesame-flavor “Shan Zhuang Lao Jiu” liquors can be seen in Table 2.
The most important aroma compounds seemed to be esters in Chinese liquor.
The relative content of esters was 87.63% in the two liquors. Among them, ethyl
hexanoate showed the highest content (398.96 and 667.09 mg/L). As we all know,
the quantity relative ratio relationship of esters is crucial to Chinese liquor flavor.
The content ratio of the four main esters (ethyl hexanoate, ethyl acetate, ethyl
butyrate and ethyl lactate) of Chinese liquor was 1: 0.11: 0.24: 0.26 and 1: 0.12:
0.15: 0.38 in the two liquors, respectively. Furthermore, another five important
esters were also quantified. Butyl acetate (2.06 mg/L) was a unique component of
the sesame-flavor liquor. Alcohols were as the main source of auxiliary aroma
agents in Chinese liquor. Isoamyl alcohol showed the highest content (468.59 and
504.82 mg/L) in the two liquors (except for ethanol). Meanwhile, propyl alcohol,
n-butyl alcohol, isobutanol and phenethyl alcohol were also quantified. However,
the content of propyl alcohol (45.50 and 116.74 mg/L) had larger difference, which
could be related to the distillation process. Acids, other some important aroma
components, were the key factors affecting the mouthfeel and after taste of Chinese
liquor. In this study, the content of acids is relative less in the both liquors. Acetic
acid (10.18 and 13.37 mg/L), butyric acid (23.16 and 27.88 mg/L) and hexanoic
acid (94.23 and 66.06 mg/L) were the main acids.
4 Conclusions
The study has revealed the aroma similarities and differences of the two Chinese
liquors. The results showed that a total of 120 aroma compounds were identified in
the two liquors, and the unique components of sauce-flavor and sesame-flavor
liquors were 5 and 17 kinds, respectively. According to the chemical structure,
aroma compounds were grouped as esters, alcohols, acids, aldehydes, ketones,
alkanes, furans, phenols, pyrazines, sulphur-containing compounds and aromatic
Table 2 Quantitative analysis of the key aroma compounds in sauce-flavor and sesame-flavor “Shan Zhuang Lao Jiu” liquors
No Compounds Concentrationa (mg/L) No Compounds Concentrationa (mg/L) No Compounds Concentrationa (mg/L)
Sauce-flavor Sesame-flavor Sauce-flavor Sesame-flavor Sauce-flavor Sesame-flavor
1 Ethyl 41.91 78.62 7 Ethyl 92.10 182.53 13 Isoamylol 468.59 504.82
acetate heptanoate
2 Isobutyl 3.16 4.27 8 Ethyl 107.83 162.23 14 Phenethyl 69.14 58.66
acetate caprylate alcohol
3 Ethyl 95.59 101.55 9 Ethyl 102.31 252.33 15 Acetic acid 10.18 13.37
butyrate lactate
4 Butyl NDb 2.06 10 n-Propanol 45.50 116.74 16 Butyric acid 23.16 27.88
acetate
Comparison of Aroma Compounds in Sauce-Flavor …
compound. The main aroma compounds were esters, alcohols and aldehydes.
However, the content of acids was relatively less in the two liquors. Meanwhile, the
content of some key aroma compounds had great difference. Among them, isoamyl
alcohol showed the highest content in sauce-flavor liquor, while ethyl hexanoate
showed the highest content in sesame-flavor liquor. And butyl acetate was a unique
compound of the sesame-flavor liquor. Therefore, this study demonstrated that
aroma profile was the key factor for flavor and taste of Chinese liquors produced by
the different brewing processes and raw materials.
References
1. Fan W, Qian MC (2006) Identification of aroma compounds in Chinese ‘Yanghe Daqu’ liquor
by normal phase chromatography fractionation followed by gas chromatography/
olfactometry. Flavour Fragr J 21(2):333–342
2. Zhu S, Lu X, Ji K et al (2007) Characterization of flavor compounds in Chinese liquor Moutai
by comprehensive two-dimensional gas chromatography/time-of-flight mass spectrometry.
Anal Chim Acta 597(2):340–348
3. Ferreira V, López R, Cacho JF (2000) Quantitative determination of the odorants of young red
wines from different grape varieties. J Sci Food Agric 80:1659–1667
4. López R, Aznar M, Cacho J et al (2002) Determination of minor and trace volatile compounds
in wine by solid-phase extraction and gas chromatography with mass spectrometric detection.
J Chromatogr A 966:167–177
5. Fan W, Shen H, Xu Y (2011) Quantification of volatile compounds in Chinese soy sauce
aroma type liquor by stir bar sorptive extraction and gas chromatography–mass spectrometry.
J Sci Food Agric 91(7):1187–1198
6. Boutou S, Chatonnet P (2007) Rapid headspace solid-phase microextraction/gas
chromatographic/mass spectrometric assay for the quantitative determination of some of the
main odorants causing off-flavours in wine. J Chromatogr A 1141:1–9
7. Du LP, He TT, Li W (2015) Analysis of volatile compounds in Chinese Laobaigan liquor
using headspace solid-phase microextraction coupled with GC-MS. Anal Methods 7:
1906–1913
8. Fan W, Qian MC (2005) Headspace solid phase micro-extraction (HS–SPME) and gas
chromatography-olfactometry dilution analysis of young and aged Chinese “Yanghe Daqu”
liquors. J Agric Food Chem 53(20):7931–7938
9. Luo T, Fan W, Xu Y (2008) Characterization of volatile and semi-volatile compounds in
Chinese rice wines by headspace solid phase microextraction followed by gas
chromatography-mass spectrometry. J Inst Brew 114(2):172–179
10. Chin HW, Lindsay RC (1994) Mechanisms of formation of volatile sulfur compounds
following the action of cysteine sulfoxide lyases. J Agric Food Chem 42:1529–1536
Optimization the Fermentation Conditions
of Marasmius androsaceus by Desirability
Function Method
1 Introduction
Marasmius androsaceus is one of the most valuable and rare fungus which is
known as Chinese traditional medicinal fungus. M. androsaceusis is also called
“Gui Mao Zhen” in folk and widely distribute in the dense forest in China. It has
many pharmacological effects such as tendon relaxation, pain alleviation, and
antihypertension [1]. Although it possesses many health benefits, only the phar-
macological activities of M. androsaceus which related to analgesic and antioxidant
effects were preliminarily reported [2, 3].
M. androsaceus has been used as a Chinese medicine known as “An Luo Tong”
which has analgesia function and possesses pertinent market demand. Besides, the
fermentation metabolites of M. androsaceus contain abundant active compounds,
such as adenosine, polysaccharide, which contributed to various pharmacological
activities and have gained great attention recently. Therefore, Submerged fermen-
tation, is an efficient way to produce mycelia and bioactive metabolites of fungus,
that has been studied for years in numerous research groups [4–6]. Recently, the
studies on this important fungus are mainly focused on the following aspects,
extraction and isolation of bioactives [7, 8] and some work about optimization
During the optimization process, the mycelium yield, and the concentration of
adenosine, mannitol and intracellular polysaccharide were uniformed into one index
—Da (Ranged: 0–1) based on desirability function [15]. The response values
(y) were transfer to d values (Ranged: 0–1) according to Eq. (1), and then uni-
formed into Da value following as Eq. (2).
^yi ymin
di ¼ ^y [ ymax ; di ¼ 1; ^y\ymin ; di ¼ 0 ð1Þ
ymax ymin
where, nc and nt were the number of calibration and test sets; n was the total
number of the calibration and test sets; MSEc and MSEt were the root mean square
error of the calibration and test set, respectively.
GA was further applied to search optimal culture conditions in test regions. After
a 50 generation evaluation by GA, based on the given range of input parameters,
optimal culture conditions were achieved [21].
Based on the analysis via software SAS V 9.0 and Matlab2012a software, three
parallel experiments for each analysis result were performed to test the selected
fermentation conditions obtained from RSM and ANN-GA respectively. After
comparing, the optimum submerged fermentation conditions of M. androsaceus in
a 500 mL shake flask were achieved.
PB design was used to filtrate the significant variables via a 500 mL shake flask
during Marasmius androsaceus submerge fermentation. Experiments performed the
designed matrix (Table 2). Da value was influenced by culture temperature, rotate
speed, initial pH, inoculum size, inoculum age, culture time, loading volume. After
comparing F-value and P-value, according to the Eq. (4), culture temperature,
rotate speed, inoculum size and culture time played significant influence on
M. androsaceus submerge fermentation (P < 0.05) (Table 3). Furthermore, the
order of each investigating factor was X1 > X2 > X6 > X4 > X8 > X3 > X7 > X5.
Considering the P-value of inoculum size was 0.0435 and the next RSM designed,
we only chose culture temperature, rotate speed and culture time for the next
experiment.
The selected variables including culture temperature, rotate speed and culture time
were optimized by RSM design. The concentrations used in Plackett–Burman
design served as central points, and the experiments were performed following with
the design matrix (Table 4).
Significant F-value (22.3623) and P-value (0.0016), with non-significant lack of
fit (P = 0.2196) suggest that the established model was well adapted to the response
(Table 5). And, the value of coefficient (R2) was 97.58% indicating the well fitness
of the quadratic regression model and nearly 97.58% changes on Da value can be
explained by Eq. (5). Furthermore, the once migration (U1, U2 and U3), interaction
migration (U1 * U2, U1 * U3 and U2 * U3), and quadratic migration (U1 2 , U2 2 and
U3 2 ) showed strong influence on Eq. (5) indicating that the relationship between the
Table 4 The design matrix and the results of Box-Behnken design
Num U1 culture U2 rotate U3 culture Da NUM U1 culture U2 rotate U3 culture Da
temperature (°C) speed (rpm) time (day) temperature (°C) speed (rpm) time (day)
1 −1 (24) 0 (150) −1 (3) 0.3941 9 −1 (24) −1 (100) 0 (6) 0.4348
2 −1 (24) 0 (150) 1 (7) 0.4591 10 1 (28) −1 (100) 0 (6) 0.4301
Optimization the Fermentation Conditions …
selected variables and Da values was rather a simple linear relation. After analyzing
via RSM, the fermentation conditions of M. androsaceus in a 500 mL shake flask
was as follows: initial pH of 6.0, rotating speed of 155 rpm, culture time 6.48 days,
culture temperature 27.4 °C, inoculum size of 5%, inoculum age of 4 days and a
loading volume of 200/500 mL, and the predictive Da value was 0.4762.
Based on the fermentation conditions obtained from RSM and ANN-GA, six
independent verification tests (three for each result) were applied to investigate the
Optimization the Fermentation Conditions … 263
Fig. 1 a The effects of the number of hidden nodes on Dv. b The effects of genetic algebra on
model fitness
similarity between experimental data and model predictive values. The predictive
Da value from RSM via SAS V 9.0 software was 0.4762, and the average exper-
imental value was 0.4427. Comparatively, the predictive Da value from ANN-GA
via Matlab2012a software was 0.5059, and the average experimental value was
0.4941(Table 6). Finally, the optimum submerged fermentation condition of
M. androsaceus in a 500 mL shake flask was obtained after ANN-GA optimization.
4 Conclusions
4 days and a loading volume of 200 mL/500 mL, and the predictive Da value was
0.5059. Our finding reveals that Plackett-Burman design and Box-Behnken design
are effective tools for mathematical modeling and factor analysis of the fermenta-
tion optimization process.
References
16. Leyva A, Quintana A, Sanchez M et al (2008) Rapid and sensitive anthrone-sulfuric acid
assay in microplate format to quantify carbohydrate in biopharmaceutical products: Method
development and validation. Biologicals 36(2):134–141
17. Dong CH, Yao YJ (2008) In vitro evaluation of antioxidant activities of aqueous extracts from
natural and cultured mycelia of Cordyceps sinensis. Lwt-Food Sci Technol 41(4):669–677
18. Chinese Pharmacopoeia Commission (2010) Pharmacopoeia of the People’s Republic of
China, 2010th edn. Chemical Industry Press, Beijing, China
19. Giordano PC, Beccaria AJ, Goicoechea HC (2011) Significant factors selection in the
chemical and enzymatic hydrolysis of lignocellulosic residues by a genetic algorithm analysis
and comparison with the standard Plackett-Burman methodology. Biores Technol 102
(22):10602–10610
20. Fatiha B, Sameh B, Youcef S et al (2013) Comparison of artificial neural network (ANN) and
response surface methodology (RSM) in optimization conditions for lipase from Candida
rugosa on amberjet (R) 4200-cl. Prep Biochem Biotechnol 43(1):33–47
21. Butt MA, Ahmad M, Fatima et al (2015) Ethnomedicinal uses of plants for the treatment of
snake and scorpion bite in Northern Pakistan. J Ethnopharmacol 168:164–181
22. Din MI, Hussain Z, Mirza ML et al (2014) Adsorption optimization of lead (II) using
sacharum bengalense as a non-conventional low cost biosorsent: isothrem anf thermody-
namics modeling. Int J Phytorem 16(9):889–908
Heterologous Expression and Enzyme
Properties of b-mannanase
from Trichoderma reesei in Pichia pastoris
1 Introduction
2 Method
T. reesei Rut C30 (ATCC 56765) was maintained on potato dextrose agar (PDA) at
4 °C and sub-cultured once in every three months. Escherichia coli DH5a was used
for the construction and propagation of recombinant vectors. P. pastoris GS115 and
pPIC9 K (Invitrogen) were used as a host-vector system for protein expression.
The spores of T. reesei Rut C30 were prepared into a suspension with the spore
concentration of 107–108 spores/mL. 1 mL spore suspension was transferred into
250 mL Erlenmeyer flasks with 50 mL basal medium containing Mandel’ s salt
solution supplemented with 0.3% (w/v) glucose as the carbon source and incubated
at 28 °C, 180 rpm for 24 h [15].
The mycelia harvested at 24 h was immediately frozen and grounded to a fine
powder in liquid nitrogen. Total RNA was extracted using RNA prep pure plant kit
(TIANGEN, China). The quality and concentration of the extracted RNA were
determined at 260 nm using a nucleic acid spectrometer (Implen, Germany).
Approximately 500 ng total RNA was treated with gDNA Eraser to remove
genomic DNA and subjected to reverse transcription using a Prime ScriptTMRT
reagent kit (TaKara, China).
Heterologous Expression and Enzyme Properties … 269
The recombinant plasmids were linearized and transformed into P. pastoris GS115
cells. Transformants were screened on MD plate containing 0.04 mg/L biotin and
YPD plates containing Zeocin. The P. pastoris recombinants were identified by
PCR.
The recombinant P. pastoris colonies were inoculated into BMGY medium at
30 °C, 240 rpm for 24 h. The yeast cells were aseptically harvested by centrifu-
gation, resuspended in 25 ml of BMMY medium at 30 °C, 240 rpm for 168 h. At
24 h intervals methanol was added to the culture to maintain a final concentration of
0.5%. The culture supernatant was collected by centrifugation and subjected to
b-mannanase activity assay.
The fermentation broth was centrifuged (5000 g, 5 min, 4 °C) to remove yeast
cells. Then the supernatant was filtered through a 0.22 lm filter, and loaded onto
the Ni-Agarose Resin for 6His-Tagged Proteins (CWBIO, China) according to the
manufacturer’s protocol. The loaded sample was eluted with a step gradient of 40–
300 mM imidazole containing pH 7.9 Tris-HCl and 0.5 mM NaCl, which was
followed by eluting with 500 mM imidazole. Finally the purified sample was
270 Q. Ma et al.
dialyzed using a dialysis membrane (Solarbio, 8–14 kDa molecular-weight cut off)
with 50 mM citrate buffer as the dialysate to remove imidazole.
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was
performed using a 12% (w/v) polyacrylamide gel according to the method of
Laemmli [16]. Protein bands were visualized by staining with Coomassie brilliant
blue R-250.
The optimal pH and temperature were determined using the standard enzyme assay
conditions by changing the pH (3.0–8.0) or temperature (50–90 °C) respectively.
For pH stability assay, the purified enzymes were pre-incubated at 40 °C in citrate
buffer (50 mM, pH 5.0) over the pH range of 3.0–8.0 for 30 min without substrate,
and then the residual enzyme activities were measured. For the determination of
thermal stability, aliquots of purified enzymes were incubated in citrate buffer
(50 mM, pH 5.0) at 60 °C for 24, 48, 72, 96, and 120 h without substrate
respectively. Thermal inactivation was stopped by cooling the samples on ice, and
the residual activities were determined as described above. Each reaction was run in
triplicate.
Kinetic parameters, Km and Vmax, were determined in citrate buffer (50 mM, pH
5.0) containing 0–5 mg/mL LBG or galactomannan at 60 °C for 5 min. The data
were calculated according to the Lineweaver-Burk Method. All experiments were
carried out with three replicates.
OD600
30
20
10
0
0 24 48 72 96 120 144 168 192
Time (h)
the theoretical molecular weight. This is probably due to the glycosylation which is
widely existed in the expression system of P. pastoris, as the literatures mentioned
[17–21].
(a) (b)
120 120
Relative activity (%)
60
80
40
20 60
0
3 4 5 6 7 8 3 4 5 6 7 8
pH pH
than 4.5, the relative activity decreased rapidly. It could be inferred that the
recombinant b-mannanase has a good alkali resistance and a relatively poor acid
resistance.
Different metal ions (5 mM) and EDTA were added to enzyme reaction liquid to
investigate the influence of metal ions on the activity of the recombinant enzyme.
The results were presented in Fig. 5. According to the data, Fe2+, Cu2+, Li2+ and
EDTA have a strong inhibitory effect on the activity of the recombinant
b-mannanase. The influence of EDTA was the most obviously, which made the
activity declined to 38.4%. K+ and Zn2+ promoted the activity of the recombinant
b-mannanase obviously. Fe3+, Ca2+ and Mg2+ also promoted the activity of the
Heterologous Expression and Enzyme Properties … 273
(a) (b)
100
100
90
80
60
80
40 70
20 60
50 60 70 80 90 0 20 40 60 80 100 120
Temperature (°C) Temperature (°C)
(c)
100
Relative activity (%)
80
60
40
20
0
0 10 20 30 40 50 60
Temperature (°C)
80
60
40
20
0
trolCa2+Mg2+ K+Zn2+Fe2+Fe3+Cu2+Mn2+ Li+2Ni2+Co2E+DTA
con
Metal ions
enzyme in different degree. In addition, Ni2+ and Co2+ have little influence on the
activity of the recombinant enzyme.
The kinetic constant of the curve was calculated by linewaver-burk double counting
method. The result was shown in Fig. 6. Through calculation, the Km was
0.5 mg/mL, Vmax was 253.8 IU/mg.
274 Q. Ma et al.
1/[v] (ml.minl/µmol)
3.0
2.5
2.0
1.5
4 Conclusion
The gene of b-mannanase from T. reesei was successfully cloned and expressed in
P. pastoris. The enzyme was used to investigate its enzyme properties. The optimal
pH and temperature of the purified recombinant b-mannanase were 6.0 and 80 °C,
respectively. The enzyme had a high alkali resistance and a relatively poor acid
resistance. It showed higher thermostability at 60 °C than 70 °C. K+, Zn2+, Fe3+,
Ca2+ and Mg2+ promoted the activity of the recombinant b-mannanase in different
degree, while Fe2+, Cu2+, Li2+ and EDTA have strong inhibitory effects on the
activity of the recombinant b-mannanase. The Km and Vmax of the recombinant
b-mannanase were 0.5 mg/mL and 253.8 IU/mg, respectively.
References
9. Xu HR (2008) Domestic and foreign research progress of b-mannanase. Feed Hunan 2:30–32
10. Daskiran M, Teeter R, Fodge D et al (2004) An evaluation of endo-b-D-mannanase
(Hemicellulose) effects on broiler performance and energy use in diets varying in b-mannan
content. Poult Sci 83:662–668
11. Hu WB (2012) Clone, expression and enzyme properties of b-mannanase. Graduation thesis
12. Peterson R, Nevalainen H (2012) Trichoderma reesei RUT-C30-thirty years of strain
improvement. Microbiology 158(1):58–68
13. Arisan-Atac I, Hodits R, Kristufek D et al (1993) Purification, and characterization of a
b-mannanase of Trichoderma reesei C-30. Appl Microbiol Biotechnol 39:58–62
14. Stålbrand H, Siika-aho M, Viikari L (1993) Purification and characterization of two
b-mannanases from Trichoderma reesei. J Biotechnol 29:229–242
15. Mandels M, Reese E (1960) Induction of cellulase in fungi by cellobiose. J Bacteriol
79:816–826
16. Laemmli U (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227:680–685
17. Trimble RB, Lubowski C, Hauer CR et al (2004) Characterization of N- and O-linked
glycosylation of recombinant human bile salt-stimulated lipase secreted by Pichia pastoris.
Glycobiology 14(3):265–274
18. Contreras R, Callewaert NLM, Geysens SCJ (2004) Protein glycosylation modification in
Pichia pastoris. Europe PMC, 2002 506172
19. Zhao L, Geng J, Guo Y et al (2015) Expression of the Thermobifida fusca xylanase Xyn11A
in Pichia pastoris and its characterization. BMC Biotechnol 15(1):1–12
20. Montesino R, Cremata J, Rodríguez M, Besada V, Falcón V, de la Fuente J (1996)
Biochemical characterization of the recombinant Boophilus microplus Bm86 antigen
expressed by transformed Pichia pastoris cells. Biotechnol Appl Biochem 23(Pt 1):23–28
21. Mochizuki S, Hamato N, Hirose M, Miyano K, Ohtani W, Kameyama S, Kuwae S,
Tokuyama T, Ohi H (2001) Expression and characterization of recombinant human
antithrombin III in Pichia pastoris. Protein Expr Purif 23(1):55–65
Reduction of Characteristic Biogenic
Amines Production by Synergistic
Fermentation of Salt-Tolerant Yeast
in Soy Sauce
1 Introduction
with the same volume of 0.4 M perchloric acid solution. All supernatants were
combined and the final volume was adjusted to 25 mL using 0.4 M perchloric acid.
The extract was filtered through Fisher paper 09-804-142J (Beijing Dingguo
Biotechnology Co. Ltd., Beijing, China). One milliliter of each extract was used for
the HPLC analysis followed by derivatization with dansyl chloride.
Derivatization of biogenic amines was carried out as previously described [17, 26].
One milliliter of each extracted sample or standard amine solution was mixed with
200 lL of 2 M sodium hydroxide and 300 lL of sodium hydrogen carbonate. Two
milliliters of a dansyl chloride solution (10 mg mL−1 in acetone) were added to the
mixture and then incubated in water bath at 40 °C for 45 min. One hundred
micro-liters of 250 g L−1 ammonium hydroxide were added to stop the reaction and
to remove residual dansyl chloride. After 30 min incubation at room temperature,
the final volume was adjusted to 5 mL by adding acetonitrile. Finally, the mixture
was centrifuged at 2500g for 5 min and the supernatant was filtered through 0.45
lm-pore-size filter (13 mm, 0.45 lm, Tianjin Jinteng Co., Tianjin, China). The
filtered supernatant was kept at −25 °C until HPLC analysis. All samples were
subjected to HPLC injection for two times.
Biogenic amines in the samples were measured by HPLC using a Shimadzu 20AB
with ultraviolet detector at 254 nm. HPLC column was a Spursil C18 column
(250 mm 5 µm 4.6 mm) and was set to 30 °C during all running procedures,
and the injection volume was 20 lL. Different gradient programs were evaluated to
achieve good resolution of all biogenic amines in the shortest time. The mobile
phase was 0.1 M ammonium acetate (solvent A) and acetonitrile (solvent B) at the
flow rate of 1 mL min−1 with gradient elution. The gradient elution procedure was
65% A + 35% B at 0.01 min, 55% A + 45% B at 5 min, 35% A + 63% B at
10.05 min, 20% A + 80% B at 17.05 min, 10% A + 90% B at 26.25 min and 65%
A + 35% B at 35.00 min. The peak areas of biogenic amines standard solutions
were identified to determine the amine concentrations in mash samples.
For the chromatographic data obtained from HPLC was performed with package
SPSS Statistics 18.0 software.
Reduction of Characteristic Biogenic Amines … 281
Recent research has focused on biogenic amines because of their detrimental effects
on human beings such as migraine, hypertension, hypotension, rash and digestive
problems, which may lead to death in severe cases. Moreover, biogenic amines are
considered potential precursors of carcinogenic N-nitroso compounds [27]. The
content of total biogenic amines in soy mash was analyzed in this study.
The results showed that the level of total biogenic amines in sauce mash was
gradually increased until 120 days and then decreased during the fermentation
process (Fig. 1). The total biogenic amines reached their maximum levels at
120 days, in which S3-5 produced 264.57 mg/kg, while the Z. rouxii and C. ver-
satilis produced 238.96 mg/kg and 176.65 mg/kg biogenic amines, respectively.
The synergetic fermentation of Z. rouxii + C. versatilis generated 117.12 mg/kg
biogenic amines, while Z. rouxii + S3-5 treatment yielded 201.65 mg/kg biogenic
amines. In the control, the total content of biogenic amines increased slowly and
reached its maximum level (60.46 mg/kg) at 150 days. At the end of the fermen-
tation, the total concentration of biogenic amines in soy mash of S3-5, Z. rouxii, C.
versatilis, Z. rouxii + S3-5, Z. rouxii + C. versatilis, and control was 185.12,
122.71, 69.96, 151.14, 65.51 and 45.74 mg/kg, respectively. The level of biogenic
amines began to decline from 5 month [25].
The biogenic amines in the soy mash was higher after yeast strain treatment,
which might be due to the action of yeast decarboxylase [19, 28]. The strongest
capability to produce biogenic amines was S3-5, followed by Z. rouxii + S3-5, Z.
rouxii, C. versatilis, Z. rouxii + C. versatilis. The content of biogenic amines
produced by S3-5 was higher than C. versatilis, which might because genome
shuffling technology not only improves strain tolerance to salt but changes the
metabolic ability of strain. However, the concentration of biogenic amines yielded
by two strains, especially Z. rouxii and C. versatilis, was lower than any one strain.
This suggests that two yeast strains might have opposite effects on generating
biogenic amines. The result was similar to the previous research that biogenic
amine was reduced via co-culture of Lactobacillus plantarum and
Zygosaccharomyces rouxii during the manufacture of Chinese sauerkraut [22].
High levels of tyramine (>100 mg kg−1) can cause adverse effects on human health
[17, 29]. Compared with the control, the content of tyramine after yeast treatment
was significantly higher. The level of tyramine firstly increased and then decreased
until the completion of fermentation (Fig. 2a). The strongest ability to produce
tyramine was Z. rouxii, followed by S3-5, Z. rouxii + S3-5, C. versatilis, Z.
rouxii + C. versatilis, and the concentration of tyramine in soy mash was 64.24,
30.64, 25.02, 20.87 and 19.08 mg/kg at the end of fermentation [25]. The trends of
tyramine production by S3-5 and synergistic fermentation (Z. rouxii + S3-5) were
different from other groups, the content of tyramine increased dramatically at the
beginning of fermentation, and then reached its maximum level. The metabolism
process of tyrosine by S3-5 might be faster than other yeast strains, and thus is easy
to adapt to the high salt environment quickly. In addition, tyramine from the
synergistic fermentation of two yeast strains was lower than one strain at the mid-,
late-fermentation process. It indicates that the synergistic fermentation of yeast
strains could control the content of tyramine in the soy mash.
Fig. 2 Biogenic amines produced by different strains in soy mash. a Tyramine, b Histamine,
c Cadaverine, d Spermidine
Reduction of Characteristic Biogenic Amines … 283
was abruptly increased from 60 to 120 days and then gradually decreased until
180 days (Fig. 2b). The strongest ability to produce histamine was S3-5, followed
by Z. rouxii + S3-5, Z. rouxii, C. versatilis, Z. rouxii + C. versatilis. At the end of
the fermentation, the level of histamine in soy mash after the treatments of S3-5, Z.
rouxii + S3-5, Z. rouxii, C. versatilis and Z. rouxii + C. versatilis was 73.99, 62.61,
18.46, 17.56 and 12.30 mg/kg, respectively [25]. Moreover, the content of his-
tamine produced by S3-5 was stronger than that by C. versatilis and Z. rouxii, that
is because genome shuffling technology not only improves the S3-5 strain to tol-
erance salt stress, but improves the S3-5 strain to synthesize and excrete histidine
decarboxylase or aromatic L-amino acid decarboxylase.
The level of spermidine was remarkably elevated after yeast treatment (Fig. 2d).
The strongest ability to produce histamine was C. versatilis, followed by Z.
rouxii + C. versatilis, Z. rouxii, Z. rouxi + S3-5 and S3-5. At the end of the fer-
mentation, the content of spermidine in soy mash of C. versatilis, Z. rouxii + C.
versatilis, Z. rouxii, Z. rouxii + S3-5 and S3-5 was 15.02, 9.82, 13.67, 11.49 and
9.47 mg/kg, respectively [25]. Moreover, the concentration of histamine produced
by S3-5 was lower than that by C. versatilis and Z. rouxii, this suggests genome
shuffling technology not only improves S3-5 strain to tolerate to salt, but reduces
the strain to synthesize and excrete arginine decarboxylase and spermidine
synthase.
and spermidine; while the most important biogenic amines in the synergistic fer-
mentation mash of Z. rouxii + S3-5 (Fig. 3c) was histamine, followed by cadav-
erine, tyramine and spermidine. These data suggest that the synergistic fermentation
of yeast strains can control the content of BAs, especially tyramine and histamine in
the soy mash.
The level of biogenic amines in soy mash after yeast treatment was higher than
that of the control group. The changes in biogenic amines in high salt liquid soy mash
during fermentation process indicate that a variety of biogenic amines are increased
in the fermentation aging period, which may be due to yeast amino acid decar-
boxylation to form biogenic amines by yeast decarboxylase. The tyramine produced
by Z. rouxii was higher than other strains. The histamine and cadaverine produced by
S3-5 yeast strain was the highest, while spermidine produced by yeast C. versatilis
was higher than other strains. At the end of the fermentation, the total level of
biogenic amines was ranged from 45.74 to 185.12 mg/kg in the soy mash samples.
In the sauce mash, Zygosaccharomyces rouxii appeared in the early fermentation
stage, these strains are the dominant moromi yeast which produce the flavours
ethanol and higher alcohols. While Candida versatilis were detected at the middle
and last stage of brine fermentation, these strains produce phenolic compounds i.e.
4-ethylguaiacol and 4-ethylphenol, which contribute to soy sauce some aroma [31,
32]. These might explain why biogenic amines produced by C. versatilis was lower
than that by Z. rouxii. Moreover, The probable reason for reduction of biogenic
amines by the treatment of yeast strains synergistic fermentation is that the species
of Candida are not active in the moromi at the same time as Zygosaccharomyces
rouxii [33, 34].
The potential formation of biogenic amines is a concern in fermented foods
because of the intense microbial activity [21]. In traditionally manufactured soy
sauce and soybean paste, the added salt limits protease activity, prolonging
Fig. 3 Content of biogenic amines in soy mash after synergistic fermentation of yeast strains.
a S3-5, b Z. rouxii + C. versatilis, c Z. rouxii + S3-5
Reduction of Characteristic Biogenic Amines … 285
fermentation time, therefore, minimizes amine formation [6, 18]. In our study, the
total level of biogenic amines generated by the synergistic fermentation of Z.
rouxii + C. versatilis was lower than that from other strains, which suggest that the
content of biogenic amines could be controlled by the synergistic fermentation of
yeast strains, especially tyramine and histamine. These results may revolutionize
the manufacturing process of sauce soy manufacture by producing a product of
improved quality.
Acknowledgements The project was supported by grants from National Natural Science
Foundation of China (31501449) and the Foundation (No. 2015IM102) of Key Laboratory of
Industrial Fermentation Microbiology of Ministry of Education and Tianjin Key Lab of Industrial
Microbiology (Tianjin University of Science & Technology).
References
13. Rabie MA, Siliha H, el-Saidy S, el-Badawy AA, Xavier Malcata F (2011) Reduced biogenic
amine contents in sauerkraut via addition of selected lactic acid bacteria. Food Chem 129
(4):1778–1782. doi:10.1016/j.foodchem.2011.05.106
14. Cueva C, Garcia-Ruiz A, Gonzalez-Rompinelli E, Bartolome B, Martin-Alvarez PJ,
Salazar O, Vicente MF, Bills GF, Moreno-Arribas MV (2012) Degradation of biogenic
amines by vineyard ecosystem fungi. Potential use in winemaking. J Appl Microbiol 112
(4):672–682. doi:10.1111/j.1365-2672.2012.05243.x
15. Zaman MZ, Abu Bakar F, Jinap S, Bakar J (2011) Novel starter cultures to inhibit biogenic
amines accumulation during fish sauce fermentation. Int J Food Microbiol 145(1):84–91.
doi:10.1016/j.ijfoodmicro.2010.11.031
16. van der Sluis C, Tramper J, Wijffels RH (2001) Enhancing and accelerating flavour formation
by salt-tolerant yeasts in Japanese soy-sauce processes. Trends Food Sci Tech 12(9):322–327.
doi:10.1016/s0924-2244(01)00094-2
17. Lu Y, Chen X, Jiang M, Lv X, Rahman N, Dong M, Gujun Y (2009) Biogenic amines in
Chinese soy sauce. Food Control 20(6):593–597. doi:10.1016/j.foodcont.2008.08.020
18. Guidi LR, Abreu Gloria MB (2012) Bioactive amines in soy sauce: validation of method,
occurrence and potential health effects. Food Chem 133(2):323–328. doi:10.1016/j.foodchem.
2012.01.033
19. Caruso M, Fiore C, Contursi M, Salzano G, Paparella A, Romano P (2002) Formation of
biogenic amines as criteria for the selection of wine yeasts. World J Microb Biot 18(2):159–
163. doi:10.1023/a:1014451728868
20. Spano G, Russo P, Lonvaud-Funel A, Lucas P, Alexandre H, Grandvalet C, Coton E,
Coton M, Barnavon L, Bach B, Rattray F, Bunte A, Magni C, Ladero V, Alvarez M,
Fernandez M, Lopez P, de Palencia PF, Corbi A, Trip H, Lolkema JS (2010) Biogenic amines
in fermented foods. Eur J Clin Nutr 64:S95–S100. doi:10.1038/ejcn.2010.218
21. Wah TT, Walaisri S, Assavanig A, Niamsiri N, Lertsiri S (2013) Co-culturing of Pichia
guilliermondii enhanced volatile flavor compound formation by Zygosaccharomyces rouxii in
the model system of Thai soy sauce fermentation. Int J Food Microbiol 160(3):282–289.
doi:10.1016/j.ijfoodmicro.2012.10.022
22. Wu C, Zheng J, Huang J, Zhou R (2014) Reduced nitrite and biogenic amine concentrations
and improved flavor components of Chinese sauerkraut via co-culture of Lactobacillus
plantarum and Zygosaccharomyces rouxii. Ann Microbiol 64(2):847–857. doi:10.1007/
s13213-013-0724-8
23. Cao X, Hou L, Lu M, Wang C (2010) Improvement of soy-sauce flavour by genome shuffling
in Candida versatilis to improve salt stress resistance. Int J Food Sci Tech 45(1):17–22.
doi:10.1111/j.1365-2621.2009.02085.x
24. Gao XL, Cui C, Zhao HF, Zhao MM, Yang L, Ren JY (2010) Changes in volatile aroma
compounds of traditional Chinese-type soy sauce during moromi fermentation and heat
treatment. Food Sci Biotechnol 19(4):889–898. doi:10.1007/s10068-010-0126-7
25. Qi W, Hou L-H, Guo H-L, Wang C-L, Fan Z-C, Liu J-F, Cao X-H (2014) Effect of
salt-tolerant yeast of Candida versatilis and Zygosaccharomyces rouxii on the production of
biogenic amines during soy sauce fermentation. J Sci Food Agr 94(8):1537–1542. doi:10.
1002/jsfa.6454
26. Ben-Gigirey B, De Sousa J, Villa TG, Barros-Velazquez J (1998) Changes in biogenic amines
and microbiological analysis in albacore (Thunnus alalunga) muscle during frozen storage.
J Food Protect 61(5):608–615
27. Russo P, Spano G, Arena M, Capozzi V, Grieco F, Beneduece L (2010) Are consumers aware
of the risks related to biogenic amines in food. Curr Res Technol Edu Top Appl Microbiol
Microb Biotechnol 1087–1095
28. Goni DT, Azpilicueta CA (2001) Influence of yeast strain on biogenic amines content in
wines: relationship with the utilization of amino acids during fermentation. Am J Enol Viticult
52(3):185–190
Reduction of Characteristic Biogenic Amines … 287
1 Introduction
4-EG, more often described as smoky and sauce flavour, is appreciated in Japanese
style and Chinese traditional fermented soy sauce [1, 2]. The threshold of 4-EG is
reported to be 0.5 mg/L [3], whereas its precursor has a much higher threshold
value of *600 mg/L [4]. Moreover, there have been reported that 1–2 mg/L 4-EG
could promote aroma and flavor of soy product [5, 6]. Therefore, formation of 4-EG
has extremely close relationship with the quality of soy sauce [7].
Chinese soy sauce can be classified into high-salt liquid-state soy sauce and
low-salt solid-state soy sauce base on the raw materials, brine, fermentation tem-
perature and fermentation period. The conventional fermentation process of
high-salt liquid-state soy sauce starts with koji culturing which a solid-state fer-
mentation of Aspergillus species on a mixture of soybeans and wheat, after that,
moromi fermentation which the koji is mixed with saline water (22–23% salt), and
resulting brine solution about 17%, furthermore, about 6 month process time for
high-salt liquid-state soy sauce at 30 °C [8, 9]. The raw material of low-salt
solid-state soy sauce are soy beans and wheat bran. Followed the koji is mixed with
saline water (13–14% salt), the resulting brine solution has a lower salt concen-
tration about 11%, about one month fermentation for low-salt solid-state soy sauce
at 40 °C [10].
In the cell walls of cereals, ferulic acid monomers as well as dimers are esterified
to arabinose residues of arabinoxylans or etherified to lignin surfaces [4]. In the soy
sauce fermentation process, of which raw materials, such as soybeans and wheat or
wheat bran [11], cell wall of cereal was degraded to small molecular weight sub-
stances by degrading enzymes (such as xylanases) secreted by Aspergillus, then
feruloyl esterases destroy ester bond between FA and arabinose residues leading to
release the FA [12]. FA can be decarboxylated to 4-VG followed metabolized to
4-EG though 4-VG reductase produced by yeast [13, 14]. It has been reported that
4-EG could be yielded by Candida versatilis but not Zygosaccharomyces rouxii
[15].
Phenolic compounds are appreciated for their antioxidant activity preventing
human from many diseases associated with oxidative stress [16]. Moreover, the
flavour and quality of soy sauce are attracting consumer attention, because the
condiment has a closely relation with their daily life. Thus, the ability of Candida
versatilis biotransform of FA to 4-VG and of 4-VG to 4-EG by several treatments,
such as initial FA concentration, NaCl concentration and temperature, have been
investigated.
2.1 Chemicals
All chemicals and solvents in analytical grade were purchased from Tianjin
Chemical Reagent Research Institute (Tianjin, China). HPLC grade acetonitrile and
methanol were obtained from Merk (Darmstadt, Germany). Doubly distilled water
for the dilution of samples was purified using a Milli-Q system (Millipore, Bedford,
MA).
Sixteen sauce samples were purchased from local supermarkets. Twelve samples
were brewed by high-salt liquid-state fermentation (HLS) and four samples were
brewed by low-salt solid-state fermentation (LSS). The samples were carried to the
laboratory and stored in a refrigerator at −4 °C until analysis.
Yeast strain Candida versatilis used in this work was kept in our laboratory. Yeast
were inoculated into a resting tube containing a 10 mL YPD medium. After
incubation with shaking at room temperature (30 ± 1 °C) for 24 h, yeast cells were
transferred to 150 ml YPD medium and incubated on a rotary shaker at room
temperature for 20 h. Yeast cells were harvested by centrifugation (5000 g, 5 min,
4 °C) and re-suspended in physiological water (0.9% NaCl). Yeast cell densities
were determined microscopically with a Thoma counting chamber.
Effect of Temperature, NaCl and Ferulic Acid Concentration … 291
Table 1 Levels of NaCl concentration, FA concentration and temperature used for fermentation
Representation NaCl concentration FA concentration Temperature
(g L−1) (g L−1) (°C)
N0F100T30 0 100 30
N9F100T30 9 100 30
N18F100T30 18 100 30
N0F10T30 0 10 30
N0F100T25 0 100 25
N0F200T30 0 200 30
N0F100T40 0 100 40
Analysis of FA, 4-VG and 4-EG was done according to Max [17] with slight
modifications. 100 lL of sample of culture was added to 900 lL of deionized water
and the mixture was filtered through a 0.22 lm micron filter. The samples were
injected into Shimadzu 20AB high performance liquid chromatography with
ultraviolet detector at 280 nm operating at the following conditions: Spursil C18
column (250 mm 5 µm 4.6 mm), column temperature 30 °C, flow rate
1.0 mL/min, injection volume 20 lL and mobile phase A (1% formic acid in
distilled water, v/v) and B (methanol) from 0 to 52% of solvent B for 30 min at a
flow rate of 1 ml/min. The peak areas of standard solutions were identified to
determine the amine concentrations in mash samples. Statistical significance was
determined using the SAS statistical analysis program, version 8.01.
Soy sauce brewed with wheat or wheat bran contains considerable level of FA
which could form 4-EG and 4-VG by yeast decarboxylation. This study aimed to
292 W. Qi et al.
investigate the influence of fermentation parameter on the level of 4-EG and 4-VG.
The content of ferulic acid, 4-vinylguaiacol and 4-ethyl guaiacol were detected by
HPLC (Fig. 1).
The content of FA gradually decreased with increasing of cultivated time
(Fig. 2), the concentration of FA reached its minimum level at different time:
N0F100T30 at 6 days with 14.77 mg L−1, while N9F100T30 and N18F100T30 at 9 days
with 13.24 and 13.34 mg L−1, respectively.
The level of 4-VG increased with decreasing of FA (Fig. 2a). The 4-VG after
N0F100T30 treatment reached its maximum at 9 days with 14.40 mg L−1, while that
after treated with N9F100T30 and N18F100T30 reached their maximum at 12 days
with 15.37 and 16.13 mg L−1, respectively.
The level of 4-EG increased with decreasing of FA concentration and increasing
of 4-VG concentration (Fig. 2b). 4-EG in N0F100T30 increased from 3 days and
maintained a value then reached its maximum after 9 days with 5.39 mg L−1. 4-EG
in N9F100T30 increased from 3 days, and the content was 6.33 mg L−1 at the end of
fermentation. The concentration of 4-EG in N18F100T30 increased from 6 days and
the final content was 7.72 mg L−1.
0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0
2 4.0
3.5
3.0
1
2.5
3
Volts
Volts
2.0
1.5
1.0
0.5
0.0
0 5 10 15 20 25 30 35 40 45 50 55 60
Minutes
Fig. 1 HPLC chromatogram: ferulic acid (1), 4-vinylguaiacol (2) and 4-ethyl guaiacol (3) have
isolated peaks respectively
Concentration (mg/L)
Content of FA (mg/L)
150 20 N0F100T30
N9F100T30
15 N18F100T30
100 N0F100T30
10 N9F100T30
N18F100T30
50 N0F100T30
5
N9F100T30
N18F100T30
0 0
0 1 2 3 4 5 6 7 8 9 10 11 12
Time (d)
Fig. 2 The influence of NaCl concentration on production of 4VG and 4EG: the level of FA (
0%NaCl 9%NaCl 18%NaCl); the level of 4-VG ( 0%NaCl 9%NaCl 18%NaCl); the
level of 4-EG ( 0%NaCl 9%NaCl 18%NaCl)
Effect of Temperature, NaCl and Ferulic Acid Concentration … 293
The content level of 4-VG and 4-EG produced by C. Versatilis cultivated under
both 9 and 18% NaCl was higher than cultivated under salt-free. Phenolic meta-
bolism might be enhanced by appropriate salinity in C. Versatilis. The results of the
research pointed towards the NaCl could affected consumption rate of FA, but not
affected its final content. However, the salt concentration not only influenced the
yield rate of 4-VG and 4-EG but also affected their final content, which was agree
with previous research [15].
250 20 N0F10T30
N0F100T30
200 N0F200T30
15
150 N0F10T30
10 N0F100T30
100 N0F200T30
5 N0F10T30
50 N0F100T30
N0F200T30
0 0
0 3 6 9 12
Time (d)
Fig. 3 The influence of FA concentration on production of 4VG and 4EG: the level of FA (
10 mg/L 100 mg/L 200 mg/L); the level of 4-VG ( 10 mg/L 100 mg/L 200 mg/L);
the level of 4-EG ( 10 mg/L 100 mg/L 200 mg/L)
294 W. Qi et al.
The initial concentration of FA not affected the final generation of 4-EG particularly
[15]. There was slightly impact of precursor that reached a certain concentration on
the final content of 4-EG.
150 20 N0F100T25
N0F100T30
15 N0F100T40
100 N0F100T25
10 N0F100T30
N0F100T40
50 N0F100T25
5
N0F100T30
N0F100T40
0 0
0 3 6 9 12
Time (d)
Fig. 4 The influence of temperature on production of 4VG and 4EG: the level of FA ( 25 °C
30 °C 40 °C); the level of 4-VG ( 25 °C 30 °C 40 °C); the level of 4-EG ( 25 °C
30 °C 40 °C)
Effect of Temperature, NaCl and Ferulic Acid Concentration … 295
The levels of the phenolic compound 4-EG, 4-VG and FA were analyzed in several
brands of two types of soy sauce: high-salt liquid-state soy sauce (HLS) and
low-salt solid-state soy sauce (LSS) (Table 2). In the analyzed soy sauce, phenolic
compounds level of HLS was higher compared to LSS. The soy sauces were found
to contain the following compounds in concentrations: 0.23–4.08 mg L−1 for FA,
0–2.03 mg L−1 for 4-VG, 0–1.12 mg L−1 for 4-EG. The higher levels of FA
possibly arise from the raw material or Aspergillus used. The higher level of 4-VG
and 4-EG possibly arise from the initially brine solution, fermentation temperatures
or yeast strains used.
In summary, 4-VG and 4-EG could be formed from FA metabolized by halo-
tolerant yeasts Candida versatilis, moreover, production of 4-EG and 4-VG
depends on the fermentation conditions. The conversion of FA to 4-EG and 4-VG
to 4-EG by yeast was not very high, the yield of 4-ethylguaiacol and
Table 2 Ferulic acid (FA), Soy FA (mg 4-VG (mg 4-EG (mg
4-vinylguaiacol (4-VG) and sauce L−1) L−1) L−1)
4-ethyl guaiacol (4-EG) levels
in commercial soy sauce: high HLS1 2.96 ± 0.12 0.24 ± 0.02 0.45 ± 0.11
salt liquid state soy sauce HLS2 0.23 ± 0.07 0.11 ± 0.01 ND
(HLS) and low salt solid state HLS3 0.93 ± 0.05 0.13 ± 0.03 ND
soy sauce (LSS) HLS4 4.08 ± 0.25 2.03 ± 0.14 0.35 ± 0.02
HLS5 1.31 ± 0.21 0.85 ± 0.10 0.11 ± 0.06
HLS6 1.38 ± 0.11 0.89 ± 0.06 1.12 ± 0.17
HLS7 1.85 ± 0.12 0.74 ± 0.03 0.01 ± 0.01
HLS8 0.72 ± 0.13 0.94 ± 0.08 0.08 ± 0.01
HLS9 3.32 ± 0.31 0.86 ± 0.09 0.10 ± 0.05
HLS10 0.65 ± 0.03 ND 0.15 ± 0.06
HLS11 1.67 ± 0.11 0.45 ± 0.01 0.72 ± 0.03
HLS12 1.10 ± 0.06 0.84 ± 0.14 0.61 ± 0.12
LSS1 0.31 ± 0.05 0.40 ± 0.06 ND
LSS2 0.39 ± 0.09 0.32 ± 0.07 0.14 ± 0.05
LSS3 0.79 ± 0.03 ND 0.33 ± 0.04
LSS4 0.52 ± 0.07 0.12 ± 0.04 0.20 ± 0.02
296 W. Qi et al.
4-vinylguaiacol on ferulic acid was 20% (w/w), which may because the other
metabolic intermediates generated during this process. Prior study showed that
4-VG can convert to vanillin and vanillic acid [17, 18]. Suggestions for further
research, NMR technology could be used to figure out and identify the metabolites
from 4-EG metabolism.
Acknowledgements The project was supported by grants from National Natural Science
Foundation of China (31501449) and the Foundation (No. 2015IM102) of Key Laboratory of
Industrial Fermentation Microbiology of Ministry of Education and Tianjin Key Lab of Industrial
Microbiology (Tianjin University of Science & Technology).
References
15. van der Sluis C, Stoffelen CJ, Castelein SJ, Engbers GH, ter Schure EG, Tramper J,
Wijffels RH (2001) Immobilized salt-tolerant yeasts: application of a new polyethylene-oxide
support in a continuous stirred-tank reactor for flavour production. J Biotechnol 88:129–139
16. Piazzon A, Forte M, Nardini M (2010) Characterization of phenolics content and antioxidant
activity of different beer types. J Agr Food Chem 58:10677–10683
17. Max B, Carballo J, Cortes S, Dominguez JM (2012) Decarboxylation of ferulic acid to 4-vinyl
guaiacol by Streptomyces setonii. Appl Biochem Biotech 166:289–299
18. Baqueiro-Pena I, Rodriguez-Serrano G, Gonzalez-Zamora E, Augur C, Loera O,
Saucedo-Castaneda G (2010) Biotransformation of ferulic acid to 4-vinylguaiacol by a wild
and a diploid strain of Aspergillus niger. Bioresour Technol 101:4721–4724
Near Infrared Spectroscopic (NIRS)
Analysis of Polysaccharides
and Ergosterol Contents in Tricholoma
matsutake Mycelium by Improved
Chemometric Model
Qiubo Chu, Quan Li, Shuang Hu, Xue Jiang, Yanzhen Wang,
Hao Zeng, Lesheng Teng and Di Wang
1 Introduction
complex multicomponent spectral, which is one of the most widely used multi-
variate calibration methods [10]. Monte Carlo partial least square (MCPLS) is
commonly applied to eliminate abnormal samples and select the number of cali-
bration set [11], which helps to achieve a good improvement model robustness and
improve the model generalization capability [12].
In the present study, NIR spectra combined with PLS were applied to analyze
the contents of polysaccharides and ergosterol in T. matsutake mycelium obtained
from submerged fermentation. During model development, MCPLS was used to
identify the outliers and select the number of calibration set. Various pro-processing
methods including fast Fourier transform (FFT), Savitzky-Golay smoothing, First
derivative and Second derivative were performed on the raw spectra to remove
signal noise.
The content of ergosterol in T. matsutake mycelium was detected via high per-
formance liquid chromatography (HPLC) as reported previously [13].
Near Infrared Spectroscopic (NIRS) Analysis … 301
Using leave-one-out cross validation, the root mean square errors of the
cross-validation (RMSECV) was served as evaluation index shown in Eq. (1.1), and
the initial hidden variables (nLV) was chosen. For calibration set, Eq. (1.1) is used to
calculate root mean square errors of calibration (RMSEC). For prediction set,
Eq. (1.1) is used to calculate root mean square errors of prediction (RMSECP).
sffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
P 2
yp yc
RMSE ¼ ð1:1Þ
n
In the formula, n is the sample quantity, the yp is the experimental value, and the
yr is calculated or predicted value.
Outliers were identified using MCPLS. 50% samples were randomly selected as
calibration set to establish the PLS model, and the rest of the sample as a prediction
set. The calculation was repeated for 10,000 times to make sure each sample has
served as a predictor set. The predictive residual error (PRE) of each sample was
calculated and recorded. The mean of the PRE (MPRE) and the standard deviation
of PRE (SDPRE) were calculated, based on which, samples with high MPRE and
SDPRE were identified as outliers.
In order to prevent over fitting phenomenon, randomly selected 10, 20, 30, 40, 50,
60, 70, 80 and 90% of whole samples as the calibration set for PLS model estab-
lishment. The remained samples serve as prediction set. Following as Eq. (1.2), the
degree of fitting (Df) was calculated, and the process was repeated 5000 times.
When the mean of Df reached to the highest, the number of calibration set was
chosen for further experiments.
c
Df ¼ RMSEC ð1:2Þ
nc þ RMSEP
np þ jRMSEC RMSEPj
302 Q. Chu et al.
All of the above procedures were applied by Matlab 2008a software (Mathwork,
USA).
NIRS has been widely applied in qualitative and quantitative analyses due to its
fasting detection and nondestructive [15, 16]. The chemical properties of subjects
are reflected in NIR spectra. As shown in Fig. 1, the significant spectral variations
appear around 1100–1250 nm, 1650–1800 nm, 2100–2200 nm and 2250–
2350 nm, which indicate the complex of spectrum.
Near Infrared Spectroscopic (NIRS) Analysis … 303
The number of variables existing in NIR spectra is far more than sample numbers.
Outliers among all samples with higher values of MPRE and SDPRE were iden-
tified via MCPLS. During the process of PLS-NIRS quantitative analysis models of
polysaccharides and ergosterol development, 7 outliers were excluded.
MCPLS was applied to select the numbers of calibration set. 90% samples were
served as calibration set for polysaccharides and ergosterol in T. matsutake
mycelium analysis model developing.
Furthermore, among all using samples, a large variability of polysaccharides and
ergosterol contents in T. matsutake mycelium were noted. Statistical analysis for the
calibration and validation sets, data ranges, number of samples and means ±
standard deviations (S.D.) of polysaccharides and ergosterol contents were dis-
played in Table 1
304 Q. Chu et al.
The interactions among molecular groups such as C–H and O–H in T. matsutake
mycelium increased the difficulty for polysaccharides and ergosterol determination.
In order to eliminate the interference of spectra, four pre-processing methods
including FFT, Savitzky-Golay smoothing, First derivative and Second derivative
were performed to remove the background, noise, overlapping bands and baseline
drift [16]. During PLS predictive model developing, according to Da, the values of
nLV, W and nw were optimized. Furthermore, MWPLS was applied to determine the
relationship between the wavelength and Da values (Table 2; Fig. 2).
Based on Da value, 800–2500 nm wavelength variables after Second derivative
pre-processing were selected for developing polysaccharides predictive model. The
optimum nLV, W and nw values were 8, 136 and 5, respectively (Table 2). The
correlation coefficients of calibration set (Rc) 0.9999 and prediction set (Rp) were
0.9863 (Fig. 3) which demonstrated the well fitting and predictive ability of
polysaccharides analysis model. 800–2500 nm wavelength variables after Second
derivative pre-processing were selected for developing ergosterol predictive model.
The optimum nLV, W and nw values were 15, 187 and 30, respectively (Table 2).
The correlation coefficients of calibration set (Rc) and prediction set (Rp) were
0.9999 and 0.9684 (Fig. 4).
Table 2 Results of suitable indexes in PLS models for polysaccharides and ergosterol detection
Components Preprocessing Window Wn nw RMSEC RMSEP Da nLV
methods (g/L) (g/L)
Ergosterol Original 102 5 0.0246 0.02768 3.574 13
spectra
First order 7 119 5 0.0165 0.0251 3.864 10
derivative
Second order 7 187 30 0.0164 0.0230 4.229 15
derivative
FFT 9 34 5 0.0426 0.0423 2.338 13
Savizky-Golay 5 221 5 0.1311 0.1441 0.6405 11
smoothing
Polysaccharide Original 85 5 0.1193 0.1313 7.547 15
spectra
First order 9 136 5 0.1095 0.1091 9.103 15
derivative
Second order 5 136 5 0.0894 0.1009 9.796 8
derivative
FFT 11 85 15 0.2389 0.2384 4.179 15
Savizky-Golay 9 102 15 0.1332 0.1340 7.458 14
smoothing
Near Infrared Spectroscopic (NIRS) Analysis … 305
4 Conclusion
The present study successfully developed predictive models via PLS combined with
NIRS to analyze the contents of polysaccharides and ergosterol in T. matsutake
mycelium. Optimum polysaccharides content analysis model displayed RMSECV
of 0.0894 g/L and Rc of 0.9999, and a good prediction ability with RMSEP of
0.1009 g/L and Rp of 0.9863. For ergosterol contents analysis, the optimum PLS
model also displayed well fitness and predictive ability indicating by higher Rc
(0.9999) and Rp (0.9684), and lower RMSEP value (0.0230 g/L). Our present study
provide a fast, accurate and non-destructive quantitative analysis method to detect
the contents of polysaccharides and ergosterol in T. matsutake mycelium, which
may also performed for quality control of other large fungi.
306 Q. Chu et al.
Conflict of Interest The authors have declared that there is no conflict of interest.
References
Ting Xia, Jiahui Yao, Jiankang Wang, Jin Zhang and Min Wang
1 Introduction
Liver, a vital organ, plays a major role in metabolism and excretion of xenobiotic in
the human body [7]. Liver damage is a major health problem, which is caused by some
toxic chemicals, drugs, excessive alcohol consumption and microbes [8, 9]. Oxidative
stress is associated with liver damage and plays an important role in the pathogenesis
of liver damage [10]. Oxidative stress, a phenomenon related to the aerobic nature of
cellular metabolism, is a redox imbalance between the production of reactive oxygen
species (ROS) and antioxidant defense [11]. Excessive ROS results in many patho-
physiological conditions in the body, and leads to the damage of cell structures [12].
Prevention or impairment of oxidative stress reduces liver damage and constitutes a
therapeutic target to hepatoprotection. In this study, we are interested to investigate the
antioxidant activity and protective effects of SAV on damaged hepatocytes.
In the present study, total phenolic and flavonoid content and antioxidant activity
of SAV with different manufacturers were determined. Then oxidative damage
model induced by H2O2 in HepG2 cell was established. The protective effect of
SAV was investigated in H2O2-treated HepG2 cells. These findings would elucidate
the antioxidant properties of traditional Chinese vinegars, and provide a strategy for
prevention and treatment of liver injury.
Human liver cell line HepG2 was obtained from were cultured in RPMI-1640, 10%
FBS, and 1% penicillin-streptomycin B solution, and incubated at 37 °C in a
humidified atmosphere containing 5% CO2. Cells were treated with SAV at dif-
ferent concentration. An equal volume of phosphate buffered saline (PBS) was used
in the control experiments. Under all conditions we added 20 mM HEPES buffer.
Culture medium was changed every two days.
312 T. Xia et al.
Cell viability was monitored by CCK-8 assay. Cells were seeded in 96-well
microplate and exposed to H2O2 or vinegar. After treatment, cells were added with
10 lL CCK-8 solution, and incubated for 4 h at 37 °C. Absorbance in each well
was quantified at 450 nm using an ELISA reader.
All data were expressed as the mean ± standard deviation (SD). All data were
analyzed by the Student t test or one-way ANOVA procedures using the GraphPad
Prism 5.01 statistical software (GraphPad Software Inc., La Jolla, CA, USA). A P
value less than 0.05 was considered statistically significant.
Phenolic and flavonoid compounds are considered to the most potent and thera-
peutically useful biocompounds since they have antioxidant activity and therapeutic
properties [13]. In this study, total phenolic and flavonoid contents of SAV from
different manufacturers were determined. The results showed that total phenolic
contents of SAV samples ranged between 1.810 mg GAE/g and 5.836 mg GAE/g
(Fig. 1a). The concentration of flavonoids in different vinegar samples was in the
range of 0.332 mg RE/g to 4.554 RE/g (Fig. 1b). The concentration of phenolics
and flavonoids followed the order of B > A > C > D. Total phenolic and flavonoid
contents of B-3 were 5.836 mg GAE/g and 4.554 RE/g, respectively, which were
the highest among all the samples. Therefore B-3 was selected for the subsequent
experiments.
DPPH, ABTS and FRAP are used as the main radicals for testing the antioxidant
activities [14]. In this study, the antioxidant capacities of SAV samples were
evaluated by these three assays. In DPPH assay, the radical scavenging ability of
B-3 was 65.50 ± 1.11%, which has the highest DPPH radical scavenging activity
among all the samples (Fig. 2a). In ABTS assay, the radical scavenging ability of
B-3 was 76.84 ± 2.40%, which showed an effect similar to that in DPPH assay
Antioxidant Activity and Hepatoprotective Activity of Shanxi … 313
Fig. 1 Total phenolic and flavonoid contents of SAV samples. a Total phenolic content was
expressed in terms of gallic acid equivalent (mg GAE/g). b Total flavonoid content was expressed
in terms of rutin equivalent (mg RE/g). Data are means ± SD (n = 3)
(Fig. 2b). Another index for evaluating the antioxidant activity is the reducing
power. Reductive capability is the power to transform Fe3+ to Fe2+, which can be
reflected through the absorbance. As shown in Fig. 2c, The FeSO4 values of
vinegar samples with the same aging time were followed the order:
B-3 > A-3 > C-3 > D-3. Taken together, these results indicated that B-3 showed
the highest antioxidant capability in these vinegar samples. Then, we chose B-3 to
evaluate hepatoprotective effects on HepG-2 cells.
We examined the effect of B-3 on cell viability in human liver cells by using
CCK-8 assay. HepG2 cells were exposed to increasing concentrations of B-3 for
24 h. As shown in Fig. 3, cell viability was not significantly changed when HepG2
cells were treated with 2.5–10 lL/mL vinegar. These results indicated that B-3 had
no toxicity at the tested concentrations and could be studied for potential protective
effects.
H2O2 was used to cause liver injury and accelerate free radical derivatives to
measure the effect of antioxidants and liver protection in vivo [15]. Firstly, H2O2
was used to establish an oxidative injury cell model. HepG2 cells were treated with
different concentrations (0–800 lM) for 6 h. As shown in Fig. 4a, Cell viability
was significantly decreased in a dose-dependent manner. Treatment of 400 lM
H2O2 to hepatocytes resulted in a dramatic (p < 0.05) decrease in the cell viability
314 T. Xia et al.
Fig. 2 Total antioxidant capacity of vinegar samples measured by different methods. Data
represent mean ± SD (n = 3). a DPPH radical scavenging activity. b ABTS radical scavenging
activity. c Ferric reducing antioxidant power
up to about 55%. Then, 400 lM H2O2 treatment for 6 h was chosen to examine the
protective effect of B-3.
Next, Protective effect of B-3 against H2O2-induced hepatotoxicity was detected
by CCK-8 assay. HepG2 cells were pretreated with various concentrations (2.5, 5,
7.5, 10 lL/mL) of vinegar for 24 h, and treated with 400 lM H2O2 for 6 h. As
shown in Fig. 4b, pretreatment with B-3 of prior to H2O2 protected cell death in a
Antioxidant Activity and Hepatoprotective Activity of Shanxi … 315
Fig. 4 Effect of B-3 on cell viability in H2O2 -treated HepG2 cells. a Cells were treated with
increasing concentrations of H2O2 for 6 h. b Cells were pretreated with various concentrations of
vinegar for 24 h, and treated with 400 lM H2O2 for 6 h. Values are means ± SD (n = 3)
dose-dependent manner (p < 0.05). Cell viability was restored up to 90.49% by B-3
pretreatment (10 lL/mL). This result indicates that exposure of hepatocytes to B-3
confers significant protective effects against H2O2.
4 Conclusions
Acknowledgements This work was supported by the National Natural Science Foundation of
China (No. 81600126, No. 31471722 and 31671851), National High Technology Research and
Development Program of China (2013AA102106), Program for Changjiang Scholars and
Innovative Research Team in University (IRT15R49), National Ministry of science and technol-
ogy (2016YFD0400505).
References
1. Samd A, Azlan A, Ismail A (2016) Therapeutic effects of vinegar: a review. Curr Opin Food
Sci 8:56–61
2. Chen FS, Li L, Qu J et al (2009) Cereal vinegars made by solid-state fermentation in China.
Vinegars of the World. Springer, Milan, pp 243–259
316 T. Xia et al.
1 Introduction
Lin-hao Zhang and Lin Zhao have contribute equally to this paper.
2.1 Materials
2.1.1 Strain
(1) CNST solid medium (g/L): MgSO4 7H2O 1.0, KNO3 0.5, Na2HPO4 12H2O
0.65, TE 1 mL, pH adjusted to 7.2. Add 2% agar. Sterilized at 121° for 30 min.
(2) M26 medium (g/L): soybean peptone 2, potato starch 8, glucose 2, yeast extract
2, MgSO4 7H2O 1.0, CaCl2 1.0, EDTA-Fe 1 mL, TE 1 mL, pH adjusted to
7.2. Sterilized at 121° for 30 min.
(3) EMP fermentation medium (g/L): potato starch 2, skim milk powder 1, glucose
2, soybean flour 2, MgSO4 7H2O 1.0, CaCl2 1.0, EDTA-Fe 1 mL, TE 1 mL,
pH adjusted to 7.2. Add 2% XAD-16 macroporous adsorption resin. Sterilized
at 121° for 30 min.
Analysis and Application of the Promotion Action of Methanol … 319
Suction filtration the zymotic fluid by Buchner funnel to interception all resin and
cells, then measure total mass when it was thorough drying in the air
dry oven. Calculate the biomass dry weight according to the formula
DCW = Wtotal mass − Wresin − Wfilter paper.
Small molecules can play a role as inducers in low concentration while at higher
concentration it may have a toxic effect on microorganisms. We add small organic
molecules which selected at the volume ratio of 0.2% concentration, and add them
before inoculate by filtration sterilization. The small organic molecules which we
selected as the inducer of Sorangium cellulosum produce epothilones are relatively
simple and easily soluble in water, the types of small organic molecules we selected
and the promoting effect for the produce of epothilones are showed in Table 1
(+express have stimulative effect for produce epothilones, −express inhibited the
growth of Sorangium cellulosum or decrease the yield of epothilones, 0 express
almost have no effect on the growth and metabolism of Sorangium cellulosum).
DCW were determined at the first 2–6 days of the fermentation culture (Fig. 1).
The value of pH of the fermentation culture was determined at the first 2–6 days
(Fig. 2).
0.32
0.28
DCW(g·L-1 )
0.24
0.16
1 2 3 4 5 6 7
culture days (d)
7.9
7.8
7.7
7.6
pH
7.5
7.4
7.3
control group
7.2
methanol group
7.1
7.0
2 3 4 5 6
Culture days (d)
The value of reducing sugar was determined at the first 2–6 days (Fig. 3).
The results of DCW, pH value and reducing sugar content at the first 2–6 days
of fermentation culture showed that the DCW of the methanol group and control
322 L. Zhang et al.
control group
0.25
Reducing sugar content (g/100mL) methanol group
0.20
0.15
0.10
0.05
0.00
2 3 4 5 6
Culture days(d)
The yield of epothilones was determined at the first 3–7 days (Figs. 4 and 5).
The above results show that the larger D-value are appeared on the first 5 day
and first 6 day which is the stable period of Sorangium cellulosum, in other words,
the maximum facilitation of methanol for produce epothilones is in the stable
period, this is consistent with the prediction of the methanol effect on the secondary
metabolism of the Sorangium cellulosum. One possibility is that the methanol
promote more metabolic pathway of Sorangium cellulosum for the synthesis of
secondary metabolites epothilones through the overexpression of certain genes or
improve the activity of some key enzymes.
Analysis and Application of the Promotion Action of Methanol … 323
500000 Epothilone A
Epothilone B
(Expressed in the peak area)
400000
The yield of epothilone
300000
200000
100000
0
3 4 5 6 7
Culture days (d)
Fig. 4 The D-value of different days between methanol group to control group (a)
300000 Epothilone A
Epothilone B
250000
(Expressed in the peak area)
The yield of epothilone
200000
150000
100000
50000
0
3 4 5 6 7
Culture days (d)
Fig. 5 The D-value of different days between methanol group to control group (b)
324 L. Zhang et al.
After the extraction of the RNA from Sorangium cellulosum which culture in the
fifth day and the reverse transcription, we analyzed the relative expression of the
key enzymes of epothilones synthesis by RT-qPCR, including polyketide synthase
PK1 and PK2, S-adenosylmethionine synthetase (SAMs), alpha ketoglutarate
dehydrogenase (OGDHC) and thioesterase (TE, can be used to measure the yield of
epothilone synthesis). The results showed that the relative expression of TE and
SAMs are larger and improved to a certain extent, increased by 0.71 and 0.67
respectively. As a consequence, the addition of methanol could increase the
expression of specific genes in the two key enzymes or downstream, and the
mechanism of methanol effect on the metabolism of Sorangium cellulosum need to
be further explored and verified.
3000000
Epothilone A
(Expressed in the peak area)
Epothilone B
2500000
The yield of epothilone
2000000
1500000
1000000
500000
Fig. 6 The relationship between the yield of epothilones and methanol dosage
Analysis and Application of the Promotion Action of Methanol … 325
The results showed that the adding amount of methanol in the range of
0–150 lL has a different promote effect on the yield of epothilones, while the
adding amount of methanol is more than 150 lL, the yield of epothilones decreased
gradually with the increase of the concentration of methanol in fermentation liquid
as methanol toxicity was greater than the effect. Notably, the yield of epothilones
contributes close to maximum value with an increase of more than 10% while the
adding amount of methanol in the range of 0–50 lL.
In order to verify the results of the broad experiment on methanol addition, and
considering the adding amount of methanol in range of 0–150 lL (the volume of
fermentation medium is 50 mL) has certain promoting effect, set a gradient of
25 lL while add an addition experiment of 10 lL. The results was shown (Fig. 7).
The experimental results showed that the promoting effect of methanol addition
in range of 10–100 lL is quite reasonable, as a result the amount should be in the
range of intermediate role in value, the most reasonable dosage should be 25 lL
(the volume ratio is 0.05%) addition according to the industrialized production as
well as the sake of security.
1600000
1400000
(Expressed in the peak area)
The yield of epothilone
1200000
1000000
800000
600000
Epothilone A
400000 Epothilone B
200000
Fig. 7 The relationship between the yield of epothilones and methanol dosage
326 L. Zhang et al.
We found that the earlier added methanol to the medium the more obvious pro-
moting the yield of epothilones by adding the volume ratio of 0.05% methanol to
the fermentation medium in different days. Considering simplicity of operation, we
add the volume ratio of 0.05% methanol into the fermentation culture medium after
sterilization.
We tried to pass in the way of adding a certain amount of methanol into the
medium in order to verify whether the methanol added to the fermentation medium
will losing its promotion as it may be utilized by Sorangium cellulosum. The results
are listed in Table 2.
The results showed that the yield of epothilone A and B have no conspicuous
difference between B group and C group, in a word the way of adding methanol by
group B and C have the same effect on epothilones synthetization. In other words,
the methanol in fermentation broth is stabilize enough for persistent promotion on
Sorangium cellulosum produce epothilones, the best way for methanol addition is
adding before inoculate while adding methanol for fed-batch is meaningless.
The yield of epothilone A and B in the fermentation broth can be stably increased
by 15–20% through add methanol as per the proportion of 0.05% volume into the
fermentation medium of Sorangium cellulosum. The higher of the yield means the
better of the metabolism of the fermentation flask, and the production rate will be
higher than 20%. This study gives us a new revelation, the most common methanol
as a simple organic molecule has a larger role in the effects of microbial metabo-
lites, and provide a probability to explore new methods to promote the accumu-
lation of microbial metabolites.
Many small molecules can play a role in the induction of the primary and
secondary metabolism of microorganism, which can regulate the metabolic flux of
microbial metabolites through the expression level of activity of some enzymes or
certain genes, and there are more small molecules have a similar regulating effect to
different microorganisms. When the other conventional methods to improve the
microbial metabolism of the target product yield reaches a certain limit, we can
found the corresponding small molecule inducers through the screening of small
molecule inducers, which have a positive promote role to obtain a higher yield of
target product.
Acknowledgements The work was financially supported by Shandong Provincial Key Research
and Development Program (No. 2015ZDZX05001, 2015ZDXX0502B01, 2015ZDXX0403B01,
2016GGB01409), National Natural Science Foundation (No. 31501396), Shandong Provincial
Natural Science Foundation (No. ZR2012CQ027).
References
1. Meng FX, Li YX, Guo WL et al (2010) Optimization of fermentation medium for epothilones
production with sequential statistical approach. Chem Res Chin Univ 26(1):86–91
2. Park SW, Han SJ, Kimb D-S et al (2007) Improvement of epothilone B production by in situ
removal of ammonium using cation exchange resin in Sorangium cellulosum culture.
Biochem Eng J 37:328–331
3. Kolman A (2005) Activity of epothilones. Curr Opin Invest Drugs 6(6):616–622
4. Regentin R, Frykman S, Lau J et al (2003) Nutrient regulation of epothilone biosynthesis in
heterologous and native production strains. Appl Microbiol Biotechnol 61:451–455
5. Wang DH, Yuan JF, Guo WJ (2012) Mutant and optimization of epothilone B produced by
Sorangium cellulosum. Biotechnology 22(3):70–73
6. Frykman S, Tsuruta H, Lau J et al (2002) Modulation of epothilone analog production
through media design. J Ind Microbiol Biotechnol 28(1):17–20
7. Wang XY, Chen SX (2011) Breeding of high yield strain of epothilone and optimization of
fermentation medium. Chin J Pharm Ind 42(4):258–261
8. Gerth K, Bedorf N, Höfle G et al (1996) Epothilons A and B: antifungal and cytotoxic
compounds from Sorangium cellulosum (Myxobacteria). J Antibiot
9. Reichenbach H (2001) Myxobacteria producers of novel bioactive substances. J Ind Microbiol
Biotechnol 27(3):149–156
10. Tang L, Shah S (2000) Cloning and heterologous expression of the epothilone gene cluster.
Science 287:640–642
11. Julien B, Shah S (2002) Heterologous expression of epothilone biosynthetic genes in
Myxococcus xanthus. Antimicrob Agents Chemother 46:2772–2778
12. Kubicek CP, Messner R, Gruber F et al (1993) The Trichoderma cellulase regulatory puzzle:
from the interior life of a secretory fugus. Enzyme Microb Technol 15(2):90–99
13. Mandels M, Reese ET (1960) Induction of cellulase in fungal by cellobiose. J Bacteriol 79
(6):816–826
14. Li HR (2005) Biology and biotechnology of white rot fungi. Chemical Industry Press, Beijing
15. Sreekrishna K, Brankamp RG, Kropp KE et al (1997) Strategies for optimal synthesis and
secretion of heterologous proteins in the methylotrophic yeast Pichia pastoris, ☆. Gene 190
(1):55–62
Optimization of Solid Fermentation
Process of Bacillus megaterium and Its
Application in Crop Growth
Jinzhao Liu, Lin Zhao, Dong Ma, Xin Sun and Xin-li Liu
1 Introduction
Authors Jinzhao Liu, Lin Zhao and Dong Ma contributed equally to this paper.
Take one of the B. megaterium glycerol tube preserved in the low temperature
refrigerator of −80 °C, and activated at 37 °C on LB nutrient medium for 24 h.
Then vaccinate it into the seed culture medium (per 1 L flask medium 150 mL),
culture 14 h at 37 °C and 200 rpm to acquired shake flask seed liquid.
Crushing the cassava residue, furfural residue, mushroom residue to obtained the
raw material of 50–80 mesh. After mixing the material, adjust the moisture, pH,
121 °C sterilized 20 min. Culture the fermentation material under the appropriate
conditions after inoculation. Regular sampling examination growth conditions,
measured solid matrix of viable cells until spores rate rise to 85% or more.
The experimental design was shown in Table 1 to optimize solid matrix, carbon,
nitrogen, water content and temperature of fermentation [6].
With cassava residue as substrate, 40% moisture, 2 107 CFU g−1 inoculation
amount, orthogonal test was used to test the effect of different contents of glucose,
Optimization of Solid Fermentation Process … 331
corn syrup and different initial pH on the fermentation level and fermentation
process.
Cell growth curve: The above optimized fermentation process was used for solid
fermentation, pH and water content of the samples were measured every 2 h and the
number of viable bacteria was determined by the plate count in 85% and more
mature spore rate.
Test method: Weigh 10 g sample into a clean glass plates, 105 °C bake 2 h to
measure the moisture content. Measure the pH after 5 g samples and 45 mL dis-
tilled water fully stirred [7]. The mixed material was placed into an oven of 60 °C
after fermentation until dry enough, weigh 10 g of dry material into 90 mL sterile
saline, shaking 30 min in shaker and radient dilution coating for plate count [8].
Measured and statistics of the experimental group and control group of pepper yield
per plant, fruit weight, flesh thickness, fruit length and fruit diameter [9] (Table 2).
We analyse the effect of the solid substrate, carbon sources, nitrogen sources,
moisture content, temperature to obtained the optimal fermentation conditions and
analysis the results of the field test.
As Fig. 1 shows, after fermentation with furfural residue, mushroom residue, cas-
sava residue as the matrix, the bacteria content was 13.1 108 CFU g−1,
16.5 108 CFU g−1, 21.6 108 CFU g−1 respectively. After fermentation, the
content of the viable in cassava residue was 30.9% higher than that of furfural
residue, which was 64.9% higher than that of the mushroom residue.
Fig. 1 Effect of solid substrate, carbon source, nitrogen, moisture content, temperature on
fermentation
Optimization of Solid Fermentation Process … 333
Comparing the fermentation results of peptone and amino acid, urea, corn syrup as
nitrogen source shows that corn syrup can be used as the best nitrogen sources with
the fermentation level reached 22.9 108 CFU g−1, compared with the control,
the fermentation level improved 49.6%. Compared with the blank control, the
fermentation level of the experimental group was 49.6% lower than that of the
control group, only reached 6.9 108 CFU g−1, which shows that the urea had a
certain inhibitory effect on the solid fermentation of B. megaterium.
Comparing the fermentation results of 30, 40, 45, 50 and 55% water content, the
highest level of fermentation of B. megaterium is 24.6 108 CFU g−1 when the
water content is 40%. Under the same conditions, the fermentation level increased
by 3.4% than 45% moisture content (23.8 108 CFU g−1) and 117.7% than 30%
moisture content (11.3 108 CFU g−1).
In order to further clarify the fermentation conditions and achieve a higher level of
fermentation, the three factors (carbon source, nitrogen source, pH) and levels of
orthogonal test was carried out. We obtained the optimal fermentation process by
evaluated the fermentation results with viable cells in fermented materials.
The effect of initial pH on the fermentation results was maximum with the range
reached 7600 and the effect of corn syrup was minimum as Table 3 shows.
Therefore,the optimized fermentation density reached 30.9 108 CFU g−1,
Table 4 with the optimum fermentation conditions of 5% of glucose, 10% of corn
syrup and 6.5–7.0 of the initial pH, which increased 26.1% compared with the
initial condition (Figs. 2 and 3).
The whole process of B. megaterium solid fermentation which was designed in this
paper period about 24 h, the cell in 4–8 h propagate fast for the long chain in the
logarithmic growth phase, 8–14 h long chain began to collapse into a single bac-
terium, the pH value increased from 7 to 7.5 due to the rapid growth in 4–14 h of B.
megaterium, after 14 h, the growth come into stable period and began to form
spores, the fermentation ended after 24 h (Figs. 4 and 5).
As Table 5 shows, the microbial fertilizer can significantly improve the pepper
quality of all aspects such as yield of per plant, fruit weight, flesh thickness, fruit
length, fruit diameter, etc. The quality of pepper increases along with the increased
4 Conclusion
In this study, the cassava residue was identified as the solid fermentation medium of
B. megaterium by the culture medium optimization experiment. Determined cas-
sava residue as substrate, 5% glucose, 10% corn syrup, initial pH 6.5–7.0, 40%
initial moisture, 37 °C was the finally optimum condition of solid fermentation of
Optimization of Solid Fermentation Process … 337
Acknowledgements The work was financially supported by Shandong Provincial Key Research
and Development Program (No. 2015ZDZX05001, 2015ZDXX0502B01, 2015ZDXX0403B01,
2016GGX107003), National Natural Science Foundation (No. 31501396), Shandong Provincial
Natural Science Foundation (No. ZR2012CQ027).
References
8. Casillas-Buenrostro RM, Heredia NL, Benesh DAL et al (2012) Efficacy of 3m™ petrifilm™
aerobic count plates for enumerating Bacillus sporothermodurans, and Geobacillus
stearothermophilus, in UHT milk. Int Dairy J 25(2):147–149
9. Cavalcante ÍHL, Cavalcante LF, Dos Santos GD et al (2012) Impact of biofertilizers on
mineral status and fruit quality of yellow passion fruit in brazil. Commun Soil Sci Plant Anal
43(15):2027–2042
10. Cheng L (2013) Short-term effects of organic and inorganic fertilizers on soil microbial
community structure and function. Biol Fertil Soils 49(6):723–733
Comparative Quantitative Analysis
of Probiotic Bacteria During Puer
Tea Pile Fermentation
1 Introduction
Puer tea (puer shucha) is a very popular post-fermented tea in China because of the
distinctive color, savoury flavours and aromas [1]. Different to non-fermentation
tea, puer tea chooses large leafs of Camellia sinensis as raw material, and has a
special manufacturing process called “pile fermentation”, which is a solid-state
fermentation (SSF) with turned over once several days until the color of the tea was
changed into rufous [1]. The pH of tea pile is acidic and the center temperature
could reach to 60 °C [2]. Complex biological transformations are implemented by a
symbiosis of many fermenting microbes (including fungi, yeast and bacteria) and
their kinds of extracellular enzymes, and ultimately the unique flavours and aromas
of puer tea are formed at the end of pile fermentation [1].
Modern clinical medicine has shown that puer tea displays a variety of health
care functions for human body, such as lowering blood pressure [3], preventing
cardiovascular disease [4] and moderating the risk of cancer [5]. These benefits are
not only in relation to the secondary metabolites themselves in puer tea, but also
associated with these fermenting microbes. The specific identity of the microbial
population present in puer tea has been the focus on attention, but to date, the
majority of studies have relied on culture-based analysis. Previous study have
shown fungi, yeast and bacteria were all found in puer tea, fungi Candida and
Aspergillus niger are the dominant microbe in fermentation process [6, 7].
Puer tea samples used in this study were provided by Xinghai Tea Factory in
Yunnan province, China. At this factory, puer leaf samples were turned over once a
week in pile fermentation process to ensure the homogeneity of the fermented tea.
About 100 g puer tea samples of 0, 15, 30, 45 fermentation days were separately
obtained from the same tea pile, all samples were frozen in liquid nitrogen within
5 min, transported to the laboratory on dry ice and then stored at −70 °C until used.
To measure the pH of different tea samples, 1 g of each sample was firstly sus-
pended in 9 ml distilled water and then mixed continuously for 30 min at room
temperature (about 25 °C) [2], and pH of the supernatant for each tea sample was
measured using a glass pH electrode (Starter 2000, Ohaus, USA). To normalize for
different tea samples, 1 mg DNA of plasmid pEGFP-1 harboring enhanced green
fluorescent protein (EGFP) encoding gene (egfp) which is used as reference gene
were firstly added to each tea sample (5 g) and grinded completely with tea by
liquid nitrogen before DNA extraction. To confirm the absence of egfp in puer tea,
egfp was amplified by PCR using the gene specific primers EGFP-F/EGFP-R
(Table 1) and genomic DNA of puer tea without adding plasmid pEGFP-1. The
grinded tea samples were washed by 20 ml washing buffer according to Lyu et al.
[2], and the supernatant was incubated for 5 min in 65 °C, and the strain deposits
were collected by centrifugation at 6000g for 10 min, and genomic DNA of tea
were extracted following a protocol specific for high-molecular-weight
Comparative Quantitative Analysis of Probiotic Bacteria … 341
environmental DNA [14]. The genomic DNA was analyzed by 1% (w/v) agarose
gel electrophoresis and the purity of DNA were determined from the absorbance
ratios of A260/A280 by Ultrospec 2100 pro UV/visible spectrophotometer
(Amersham Biosciences, Uppsala, Sweden).
The specific qPCR primers of universal bacteria and specific-genus qPCR primers of
Bifidobacterium spp., Enterococcus spp., Bacillus spp., Lactococcus spp. and
Lactobacillus group (including Leuconostoc spp., Pediococcus spp., Aerococcus
spp. and Weissella spp.) were summarized in Table 1. The specific qPCR primers for
gene egfp were designed by the Primer3 program [15]. Strains Bifidobacterium
bifidum, Enterococcus faecium A1, Bacillus subtillis, Lactococcus lactis NZ9000
and Lactobacillus plantarum CGMCC No. 8198 obtained in our laboratory were
used as the reference strain for each specific-genus qPCR primer, and Escherichia
coli harboring pEGFP-1 was used as the reference strain for egfp. The specificity of
each qPCR primer was further verified by product sequencing and melting curve
analysis. To avoid the mutual contamination with other primers, each pair primer was
assayed with the other genus reference strains by PCR method and analyzed by
agarose gel electrophoresis. The optimal qPCR reaction mixture consisted of 10 ll
SYBR Green qPCR mastermix (DBI Bioscience, Shanghai, China), 1 ll template,
0.4 ll 50 ROX Reference Dye, 0.5 ll PCR forward/reverse primer (10 lmol l−1),
and 7.6 ll double distilled H2O using ABI 7500 Fast Real-Time PCR System
(Applied Biosystems, Carlsbad, CA), and the optimal qPCR condition for each qPCR
primer was 95 °C for 2 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 30 s,
and 72 °C for 30 s.
The PCR products of each primer with the responding reference strain were purified
by DNA product purification kit (TIANGEN Biotech, Beijing, China), ligated with
PMD19-T vector (TaKaRa, Dalian, China) and sequenced by Genewiz (Beijing,
China), the correct recombinant plasmids were used as the standard plasmid for the
following standard curves generation. The standard plasmids for each qPCR primer
were extracted by Plasmid Mini Kit (Omega Bio-tek, USA) and quantified by A260
measurements. 10-fold dilution series of about 101 to 107 copies for each target
standard plasmid DNA were applied for qPCR analysis. The copy numbers of
Bifidobacterium spp., Enterococcus spp., Lactobacillus group, Bacillus spp.,
Lactococcus spp. and universal bacteria during tea fermentation were quantified by
342
Table 1 qPCR primers for Universal bacteria and probiotic bacteria used in this study
Target Name of primers Sequences for primers (5′-3′) Product size (bp) Efficiency (%) Reference
Universal bacteria Bacteria-F CCTACGGGAGGCAGCAG 193 104.94 [18]
Bacteria-R ATTACCGCGGCTGCTGG
Enterococcus spp. Ent-F CCCTTATTGTTAGTTGCCATCATT 144 101.83 [19]
Ent-R ACTCGTTGTACTTCCCATTGT
Lactobacillus groupa Lacb-F AGCAGTAGGGAATCTTCCA 431 94.28 [20, 21]
Lacb-R CACCGCTACACATGGAG
Lactococcus spp. Lacc-F GCGGCGTGGCTAATACATGC 305 95.22 [22]
Lacc-R CTGCTGCGTCCCGTAGGAGT
Bacillus spp. Bac-F ACGCCGTAAACGATGAGT 424 96.89 [23]
Bac-R GTGTGTAGCCCAGGTCATAA
EGFP EGFP-F ACAAGACCCGCGCCGAGGTGAA 253 94.83 This study
EGFP-R TCGCCGATGGGGGTGTTCTGCT
a
Lactobacillus group including Lactobacillus, Leuconostoc, Pediococcus, Aerococcus and Weissella but not Enterococcus or Streptococcus
S. Li et al.
Comparative Quantitative Analysis of Probiotic Bacteria … 343
qPCR with each target qPCR primer. The PCR condition and reaction mixture were
the same as mentioned above. Fluorescent products were detected at the last step of
each cycle. Each sample was assayed in triplicate. The populations of universal
bacteria and other genera at different time points were calculated by threshold cycle
values based on each standard curves after normalization against gene egfp.
Fig. 1 Verification by agar gel electrophoresis of genomic DNA of puer tea (a) at 0 day (lane 1),
15 days (lane 2), 30 days (lane 3), 45 days (lane 4) and the specificity of qPCR primers for
Enterococcus spp. (b), Lactobacillus spp. (c), Lactococcus spp. (d), Bacillus spp. (e) and gene egfp
(f). Lane M standard molecular size marker; b–f lane 1 PCR product with each reference strain as
template; lane 2 PCR product with sterile water as template; lane 3 PCR product with other
reference strains as template. Lane 4 PCR product with genome DNA of tea samples without
pEGFP-1 as template to evaluate the feasibility of gene egfp as the internal reference gene
linear regression analysis suggested the PCR efficiencies ranged from 94.83 to
104.94% (Table 1).
The copy numbers for universal bacteria and other probiotic bacteria were
obtained from the threshold cycle values based on standard curves after normal-
ization to that of gene egfp. The results showed that the population of universal
bacteria was 7.56 109–3.45 1010 copy g−1 in the puer tea fermentation.
Among the five genera detected, Enterococcus spp. showed 3.43 104–
6.25 105 copy g−1, and Lactococcus spp. showed 1.68 109–2.78 109
copy g−1, which has much more copy numbers than the other two genera
Lactobacillus spp. (4.26 103–5.17 104 copy g−1) and Bacillus
spp. (2.21 10 –2.31 105 copy g−1) according to Fig. 2. These four genera
3
probiotic bacteria all belong to the phylum Firmicutes, which is 20.23% of the total
microbe in puer tea fermentation by metagenomic sequencing analysis and played
the major role in pile fermentation [2]. Genera Enterocooccus, Lactobacillus,
Lactococcus, Leuconostoc, Oenococcus, Pediococcus, Streptococcus, Weissella
and some of Bacillus like Bacillus coagulans are the main genera belong to pro-
biotic bacteria [18]. These results suggested that probiotic bacteria are involved in
puer tea fermentation, which could produce variety of polyphenol oxidase and
peroxidase, which could change catechin polyphenols into benzene quinone, and
then further changed into polypeptide with red color, and benefit for improving the
quality of puer tea and reduce the fermentation time [10]. Only Bifidobacterium
spp. was not detected during the whole fermentation process, and also there were no
reports about the Bifidobacterium spp. in puer tea, although Bifidobacterium
spp. belonged to the phylum Actinobacteria which is up to 30.08% of the microbe
Comparative Quantitative Analysis of Probiotic Bacteria … 345
Table 2 Standard curve equation of qPCR primers of universal bacteria and probiotic bacteria
(Enterococcus spp., Lactobacillus spp., Lactococcus spp., Bacillus spp. and gene egfp) used in this
study
Strains Standard curve equation Variance (R2)
Bacteria Y = −3.1072X + 38.145 0.9968
EGFP Y = −3.523X + 40.147 0.9955
Entq Y = −3.2788X + 39.549 0.996
lacq Y = −3.4946X + 39.844 0.995
laccoq Y = −3.4214X + 44.329 0.997
Bacq Y = −3.3987X + 41.503 0.9959
Fig. 2 pH and copy numbers of universal bacteria and bacteria and four genera at different
fermentation time. pH (a), universal bacteria (b), Enterococcus spp. (c), Lactobacillus spp. (d),
Lactococcus spp. (e), and Bacillus spp. (f). Error bars represent standard deviations of triplicate
measurements
population (about 100 folds) than Lactobacillus spp. and Bacillus spp., which
suggested Lactococcus spp. and Enterococcus spp. were the main probiotic bacteria
and play important role in this puer tea fermentation. This inconsistent result with
previous studies might be due to the use of different puer tea material and pro-
duction condition.
The pH profiles of puer tea sample were acidic during the tea fermentation
(Fig. 2a), the initial pH of the raw material was 6.17, and decreased to pH 5.07 after
15 days’ pile fermentation, and increased to pH 6.28 at 30 days and finally reached
to pH 6.58 at the end of the pile fermentation. During the four different time points,
universal bacteria and four genera also showed different change patterns throughout
fermentation process (Fig. 2). Universal bacteria had a trend of slowly, continually
and simply increasing from 7.56 109 to 3.45 1010 copy g−1 during 45 days
fermentation (Fig. 2b). Different to the universal bacteria, Bacillus spp. increased
slightly from 2.21 103 to 1.55 104 copy g−1 at the first 30 days, but was
found to significantly increase to the maximum in the last 15 days with
2.31 105 copy g−1, which are 104 folds of the abundance of initial stage
(Fig. 2f) which is consistent to the previous reported [19], The other three genera
displayed much more varied change in the 45 days fermentation. Lactobacillus
spp. increased quickly to the maximum copy numbers (4.62 104 copy g−1) in the
first 15 days, and then continue increased to 5.17 104 copy g−1 at the end of
fermentation which is still about 12 folds of that of the initial stage (Fig. 2d).
Enterococcus spp. showed a similar increased trend with Enterococcus spp. in the
first 15 days by about 18 folds from 3.43 104 to 6.25 105 copy g−1, but then
decreased sharply to 1.49 105 copy g−1 at the end of the fermentation which is
almost the same to that of the initial stage (Fig. 2c). Different to the other genera,
Lactococcus spp. firstly maintained from 1.68 109 to 1.90 109 copy g−1 in
first 30 days, and then increased rapidly to 2.78 109 copy g−1 (Fig. 2e). Previous
study has also shown that the bacteria, yeast, mold were all changeable during the
fermentation process [2], which suggests that complex changes are happened in
fermenting microbe community during the puer tea fermentation.
Although Pearson’s correlation analysis suggested that there are no significantly
correlation between pH values and the amount changes of universal bacteria and
Enterococcus spp., Bacillus spp., Lactococcus spp. and Lactobacillus group (data
not shown) during the fermentation, but at the end of the fermentation with pH
6.58, Enterococcus spp., Lactobacillus spp., Lactococcus spp. were all decreased
and only Bacillus spp. reached to the high abundance, which might be due to
Bacillus spp. is much adaptable to neutral pH, but Enterococcus spp., Lactobacillus
spp. and Lactococcus spp. prefer to the acidic environment. In addition, the cor-
relation among the abundance changes of universal bacteria and Enterococcus spp.,
Bacillus spp., Lactococcus spp. and Lactobacillus group were also not significantly.
The synergism and antagonism among the different groups of microbes and even
among different genera within the same group the microbe interactions may be
another affect factor for complex change patterns.
Comparative Quantitative Analysis of Probiotic Bacteria … 347
References
1. Chen Y, Liu B, Chang Y (2010) Bioactivities and sensory evaluation of Pu-erh teas made
from three tea leaves in an improved pile fermentation process. J Biosci Bioeng 109:557–563
2. Lyu C, Chen C, Ge F, Liu D, Zhao S, Chen D (2013) A preliminary metagenomic study of
puer tea during pile fermentation. J Sci Food Agr 93:165–3174
3. Anderson R, Polansky M (2002) Tea enhances insulin activity. J Agric Food Chem 50:7182–
7186
4. Yang D, Hwang L (2006) Study on the conversion of three natural statins from lactone forms
to their corresponding hydroxy acid forms and their determination in Pu-Erh tea.
J Chromatogr A 30:1–2
5. Hayakawa S, Kimura T, Saeki K, Koyama Y, Aoyagi Y, Noro T, Nakamura Y, Isemura M
(2001) Apoptosis-inducing activity of high molecular weight fractions of tea extracts. Biosci
Biotech Biochem 65:459–462
6. Wen Q, Liu S (1991) Variation of the microorganism groups during the pile-fermentation of
dark green tea. J Tea Sci 11:10–16
7. Zhou H, Li J, Zhao L, Han J, Yang X, Yang W, Wu X (2004) Study on main microbes on
quality formation of Yunnan puer tea during pile-fermentation process. J Tea Sci 24:212–218
8. Pace NR (1997) A molecular view of microbial diversity and the biosphere. Science 276:
734–740
9. Raspor P, Goranovic D (2008) Biotechnological applications of acetic acid bacteria. Crit Rev
Biotechnol 28:101–124
10. Monhammad FG, Alireza T (2007) Isolation and characterization of polyphenol oxidase and
peroxidase-producing Bacillus strains from fully fermented tea (Camellia sinensis). World J
Microbiol Biotechnol 23:1327–1332
11. Klayraung S, Okonogi S (2009) Antibacterial and antioxidant activities of acid and bile
resistant strains of Lactobacillus fermentum isolated from miang. Braz J Microbiol 40:
757–766
12. Cho K, Math RK, Islam SM, Lim WJ, Hong SY, Kim JM, Yun MG, Cho JJ, Yun H (2009)
Novel multiplex PCR for the detection of lactic acid bacteria during kimchi fermentation. Mol
Cell Probes 232:90–94
13. Ganesan B, Weimer B, Pinzon J, Dao KN, Rompato G, Brothersen C, McMahon D (2014)
Probiotic bacteria survive in Cheddar cheese and modify populations of other lactic acid
bacteria. J Appl Microbiol 116:1642–1656
14. Brady SF (2007) Construction of soil environmental DNA cosmid libraries and screening for
clones that produce biologically active small molecules. Nat Protoc 2:1297–1305
15. Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist
programmers. Methods Mol Biol 132:365–386
16. Matijašić B, Obermajer T, Rogelj I (2010) Quantification of Lactobacillus gasseri,
Enterococcus faecium and Bifidobacterium infantis in a probiotic OTC drug by real-time
PCR. Food Control 21:419–425
17. Li Z, Zhao H, Yang P, Zhao J, Huang H, Xue X, Zhang X, Diao Q, Yao B (2013)
Comparative quantitative analysis of gene expression profiles of glycoside hydrolase family
10 xylanases in the sheep rumen during a feeding cycle. Appl Environ Microbiol 79:1212–
1220
18. Lubbs DC, Vester BM, Fastinger ND, Swanson KS (2009) Dietary protein concentration
affects intestinal microbiota of adult cats: a study using DGGE and qPCR to evaluate
differences in microbial populations in the feline gastrointestinal tract. J Anim Physiol Anim
Nutr (Berl) 93:113–121
19. Rinttila T, Kassinen A, Malinen E, Krogius L, Palva A (2004) Development of an extensive
set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in
faecal samples by real-time PCR. J Appl Microbiol 97:1166–1177
348 S. Li et al.
20. Walter J, Hertel C, Tannock GW, Lis CM, Munro K, Hammes WP (2001) Detection of
Lactobacillus, Pediococcus, Leuconostoc, and Weissella species in human feces by using
group-specific PCR primers and denaturing gradient gel electrophoresis. Appl Environ
Microbiol 67:2578–2585
21. Heilig HG, Zoetendal EG, Vaughan EE, Marteau P, Akkermans AD, de Vos WM (2002)
Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine
as determined by specific amplification of 16S ribosomal DNA. Appl Environ Microbiol
68:114–123
22. Klijn N, Weerkamp AH, de Vos WM (1995) Detection and characterization of
lactose-utilizing Lactococcus spp. in natural ecosystems. Appl Environ Microbiol 61:788–792
23. Han GQ, Xiang ZT, Yu B, Chen DW, Qi HW, Mao XB, Chen H, Mao Q, Huang ZQ (2012)
Effects of different starch sources on Bacillus spp. in intestinal tract and expression of
intestinal development related genes of weanling piglets. Mol Biol Rep 39:1869–1876
Prediction of Hot Spots in Dimer Interface
of Green Fluorescent Protein
1 Introduction
W. Zhang
Faculty of Fundamental Courses, Tianjin Foreign Studies University,
Tianjin 300204, People’s Republic of China
L. Wang (&) Z. Sun
School of Computer Science and Information Engineering, Tianjin University
of Science and Technology, Tianjin 300457, People’s Republic of China
e-mail: [email protected]
B. Zhang Q. Tang Q. Gao
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education,
College of Biotechnology, Tianjin University of Science and Technology,
Tianjin 300457, People’s Republic of China
The dimer structure of GFP was obtained from the Protein Data Bank (PDB) with
PDB ID: 1GFL. The protein was in the shape of a cylinder, comprising 11 strands
of beta-sheet with an alpha-helix inside and short helical segments on the ends of
the cylinder. The methods that were adopted to predict hot spots in dimer interface
of GFP included HotPoint [11], KFC2 [12], PredHS [13] and Robetta [6]. HotPoint,
KFC2 and PredHS were knowledge-based methods which try to learn the complex
relationship between hot spots and various residue features in training data and
predict new hot spots. Among them, HotPoint was an intuitive efficient method to
determine computational hot spots based on conservation, solvent accessibility and
statistical pairwise residue potentials of the interface residues. KFC2 was a support
vector machine-based method to predict hot spots with features of both sequence
and structure, and included two hot spot predictors KFC2-A and KFC2-B. PredHS
was an effective structure-based hot spot prediction method with focus on using
structural neighbourhood properties, and included two predictors PredHS-SVM and
PredHS-Ensemble. Robetta used a free energy function to calculate the binding free
energy of alanine mutation in a protein-protein complex. The interface residues
with estimated binding free energy (ΔΔG) 1.0 kcal/mol were predicted as hot
spots.
Prediction of Hot Spots in Dimer Interface of … 351
3 Results
A protein interface was defined as a set of amino acids which represents a region
that links two protein chains by non-covalent interactions. As to two residues from
different chains, if the distance between any two atoms belonging to the two
residues, respectively, is less than the sum of their van der Waals radii plus a 0.5 Å
tolerance, these two residues are defined as interface residues [11]. According to the
interface residue definition, there are 16 interface residues in each chain of GFP,
which are illustrated in Fig. 1 in 3D using the PDB file of 1GFL. Notably the
interface residues of the two chains overlapped by 15 residues, and in total 17
unique residues were appeared on the dimer interface of GFP. These residues were
used as candidates for hot spot prediction.
Fig. 1 The protein-protein interface residues in the dimer structure of GFP. The two protein
chains are colored by blue and red, respectively. Their interface residues shown as sticks are
colored by yellow and green, respectively
352 W. Zhang et al.
The residue accessibilities in dimer state are converted into relative accessibilities
by dividing them to maximum accessibility of that residue. As to 10 computational
Table 2 Computational hot Hot spot Number of methods that predict the
spots sorted by the number of residue as a hot spot
prediction methods
Q204 6
F223 6
N146 4
A206 4
Y39 3
S147 3
Y145 2
L207 2
N144 1
S208 1
Fig. 2 The computational hot spot residues in the dimer structure of GFP. The two protein chains
are colored by blue and red, respectively. Their computational hot spot residues shown as sticks
are colored by yellow and green, respectively. Furthermore, we labelled the top four computational
hot spots (Q204, F223, N146 and A206) based on the number of prediction methods
hot spots of 16 interface residues in chain A, their relative accessibilities are sig-
nificantly different from those of computational non-hot spots (one-sided Mann–
Whitney U test, P-value = 1.50 10−3). Figure 3 shows the box plots of relative
accessibilities in different residues.
354 W. Zhang et al.
Fig. 3 Box plots of computational hot spots and non-hot spots with respect to their relative
accessibility. In each box plot, the bottom and top of the box represent the first and third quartiles
individually with the band inside the box being the second quartile. The lower and upper ends of
the whiskers are the lowest datum still within 1.5 IQR (interquartile range, i.e. the difference
between the third and first quartiles) of the first quartile, and the highest datum still within 1.5 IQR
of the third quartile, respectively
4 Discussion
In this work, we identified computational hot spots which are critical for GFP dimer
stabilization. Due to the time consumption and labor intensity in experimental
determination of binding free energy for site-directed mutagenesis, there are still a
limited number of known site-directed mutated residues. Our prediction results
provide candidate residues in the studies of site-directed mutagenesis for GFP
optimization for stability. Furthermore, we found the difference of relative acces-
sibility between computational hot spots and non-hot spots is statistically significant.
Acknowledgements This work was sponsored by the Natural Science Foundation of China
(31370075 and 61603273), Tianjin Research Program of Application Foundation and Advanced
Technology (14JCQNJC00300 and 16JCYBJC18500), Tianjin University of Science and
Technology (2014CXLG28), and Tianjin Foreign Studies University (13QN15).
References
1 Introduction
Mycobacterium neoaurum TCCC 11028 M3 (MNR M3) was obtained from Tianjin
University of Science and Technology Culture Collection Center (TCCC), Tianjin,
China. MNR M3 was used as the template for cloning the pncB gene. The plasmids
pMV261 and pMV306 were used to express the pncB gene. The sequences for the
primers were as follows, which were designed based on the published sequence of
the pncB gene (Gene ID: 17916325):
Sense: 5-CGCGGATCCGAGCACCGCGCTGCTGA-3.
Antisense: 5-CCCAAGCTTTCACCTGGCGGAAACC-3.
The underlined characters indicate the sites of BamH I and Hind III, respectively.
Mycobacterial replicating vector pMV261 and integration vector pMV306 carrying
the Mycobacterium bovis BCG Phsp60 promoter and kanamycin (kan) resistance
were used. The plasmids pMV261 and pMV306 were the common plasmids used in
Mycobacteria for gene expression [10]. The purified DNA was digested with BamH
I and Hind III and ligated into the BamH I–Hind III double-digested pMV261 to
construct pMV261-pncB. Then digested the vector pMV261-pncB by Xba I and
Hind III (with the Phsp60 promoter included) and inserted into the vector pMV306,
with the vector pMV306-pncB generated also. The pMV306-pncB vector was
imported into MNR M3 by electroporation. The transformants were screened by LB
medium agar plate containing kan. The selected mutants were designated as MNR
M3-pMV306-pncB, for further characterization.
Regulation of NAD (H) Pool by Overexpression of Nicotinic Acid … 359
Substrate phytosterol (PS; 98.4% purity) was obtained from COFCO Tech
Bioengineering Co. Ltd. (Tianjin). The standard of AD and ADD were purchased
from Sigma Aldrich Co. (USA). All chemical solvents and salts used were of
analytical grade or higher. The cultivation and bioconversion of microorganisms, as
well as the preparation and analysis of transformation products, were performed
following the procedures described by Shen et al. [1]. The PS and nicotinic acid
(NA) concentration added in the fermentation system were 3 g/L and 10 mg/L,
respectively.
In the PS free medium, the growth of cell measured by optical density (OD), but it’s
difficult to measure the cell growth in the culture broth with the PS by this method.
In this study, cell growth measurement in medium with PS was done as described
by Paul RM [11].
To determine enzyme activities, cells were harvested by centrifugation at
10,000g for 10 min at 4 °C, and washed with the buffer used in the subsequent
enzyme assays. The suspended cells were disrupted by sonification on ice. Cell
debris was removed by centrifugation at 10,000g for 15 min at 4 °C. The crude
cell extracts were used for the determination of enzyme activity. NAPRTase activity
was measured by following the formation of ADP. The reaction mixture contained
4.5 mM ATP, 1.5 mM PRPP, 45 mM potassium phosphate, 45 mM Tris–HCl,
15 mM MgCl2, 0.15 mM nicotinate, 4 mM PEP, 0.2 mM NADH, 13 U LDH, and
13 U pyruvate kinase (PYK) at pH 7.5. The reaction was started by the addition of
nicotinate. The concomitant consumption of NADH (e340 nm = 6.22 mM−1 cm−1)
was monitored spectrophotometrically. A unit of NAPRTase activity was defined as
the amount of enzyme that catalyzed the oxidation of 1 lmol NADH to NAD+ per
minute. Protein concentrations were determined using the Bradford method. The
intracellular concentrations of NADH and NAD+ were assayed using a cycling
method [12].
The complete sequence of the pncB gene from MNR M3 was obtained by PCR. The
pncB gene sequence from M. neoaurum strain VKM Ac-1815D was used as a basis
360 L. Su et al.
The specific activity of NAPRTase was measured when cells entered end stage of
exponential phase. As shown in Fig. 2, the NAPRTase activity in MNR M3
pMV306-pncB (0.024 U/mg) was 2-fold higher than in the parent strain
(0.008 U/mg). The results demonstrated that NAPRTase was successfully over-
expressed in MNR M3 pMV306-pncB.
To investigate the effect of NAPRTase overexpression on cell growth, the
recombinant strain and the parent strain were cultured at the same conditions. As
shown in Fig. 3, the recombinant strain grew to a higher OD600 as compared to the
parent strain, indicating that the cell growth of MNR M3 was promoted due to the
overexpression of NAPRTase. At the first 48 h, the recombinant strain entered the
exponential phase while the control strain entered it later. The growth rates for both
strains were then increased. At the end time of exponential phase of the control
strain was still later compared to the recombinant strain and this trend lasted to the
end.
Regulation of NAD (H) Pool by Overexpression of Nicotinic Acid … 361
Fig. 4 Time-course of concentrations of intracellular NADH (a), NAD+ (b), and NAD+/NADH
ratio (c) by MNR M3 and MNR M3-pMV306-pncB. MNR M3 (triangle), MNR M3-pMV306-pncB
(circle)
strain, 13.8% higher than that in the control strain after 72 h. The difference of the
NAD+/NADH ratio between the parent and the recombinant strain was also observed
(Fig. 4c), in the whole stages of fermentation, the higher NAD+/NADH ratio was got
in recombinant strain. The highest ratio in MNR M3-pMV306-pncB was 22.2%
higher than that in MNR M3. This indicated that the redox status in MNR M3 was
disturbed. The cofactor changes showed in MNR M3 was similar to that in engi-
neered E. coli [6], in which the NAD (H) pool size and the NAD+/NADH ratio were
greatly increased by the overexpression of NAPRTase.
The AD (D) production of the parent and the recombinant strains were monitored
(Fig. 5a). It could be observed that the AD (D) production was strongly influenced
by the overexpressed NAPRTase. After 72 h of fermentation, a final AD
(D) production of 94.9% was achieved, 9.6% higher than that without overex-
pression of NAPRTase which was 86.5%. What’s more, the producing rate [mg/
(L h)] of AD (D) in MNR M3-pMV306-pncB was also higher in the whole stages in
PS conversion process than the parent strain. It was analysed that the process from
b-sitosterol to AD uses NAD+ as main cofactor with NADH are generated [4]. The
results showed in this study, after overexpression of NAPRTase in MNR M3, more
NAD+ generated, which was helpful for the NAD+-dependent PS degradation
pathway. Therefore, the AD (D) yield was improved.
From the studies of Liang [6, 8], Ji [13] and Sun [14], manipulating the levels of
intracellular cofactors had strongly effects on the redirection of glucose metabolism
and the cell growth, with a high efficiency of producing the NAD+-dependent
microbial metabolite achieved. In the present study, the glucose consumption and
cell growth were analysed as well.
As shown in Fig. 5b, c, in the fermentation process with PS, the overexpression of
NAPRTase could accelerate the glucose consumption and cell growth to a certain
extent, which was similar to the growth in PS free system (Fig. 3). It was known that
the glucose degraded through glycolysis and TCA pathway, which were NAD+-
Regulation of NAD (H) Pool by Overexpression of Nicotinic Acid … 363
Fig. 5 Time-course of AD (D) molar yield (a), glucose (b), DCW (c) by MNR M3 and MNR
M3-pMV306-pncB. MNR M3 (triangle), MNR M3-pMV306-pncB (circle)
4 Conclusions
Acknowledgments This work was supported by the National Natural Science Foundation of
China (21276196, 21406167 and 21306138), Key Project of Chinese Ministry of Education
(213004A), and Tianjin Programs for Science and Technology Development (15ZCZDSY00510).
References
1 Introduction
This research was supported by National Natural Science Foundation of China (21676143),
Qing Lan Project of Jiangsu Province, program for Innovative Research Team in University of
Jiangsu Province and the Hi-Tech Research and Development Program of China (863 Program,
2011AA02A209).
F F F
OH O
O OH
Lipase
O O
Organic solvent
N N N
R= Alloc, Boc, Me and Poc
R R R
(±)-trans-paroxol (−)−trans-paroxol
not been revealed. Molecular dynamics (MD) simulations has been an important
assistant tool in latest decade for revealing the interactions of enzyme with substrate
and analyzing the molecular mechanism of enhancing the property of enzyme [9,
10]. Such as, Chen et al. [11] analysed the structural conformation of Pseudomonas
alcaligenes lipase (PAL) using MD simulations, which indicated that stronger steric
exclusion and structural rigidity facilitated diastereopreference. As well, Park et al.
[12] found that the increasing of overall flexibility and the forming of hydrogen
bonds were beneficial to understand the effect of tert-butanol on CALB catalyzed
transesterification resolution by MD simulations.
In this study, we used molecular docking and MD simulations to analyze the
influence of different replacing groups on the piperidine ring (Met, Alloc, Boc and
Poc) of (±)-trans-paroxol for enzymatic resolution (Table 1). Generally, stabilized
complex is always rigid with lower Root Mean Square Deviation (RMSD) and
radius of gyration (Rg), and the stabilized state has more chance to stabilize the
intramolecular interactions, including hydrogen bonds, electrostatic interactions and
hydrophobic interactions [13, 14]. Herein, four substrates with different substituents
were successful docked to the active site of CALB for MD simulations and anal-
ysis. We hope this research would be useful for understanding the molecular
mechanism of enzymatic resolution of (±)-trans-paroxol and guiding to design the
more appropriate substrate with higher E value.
The initial conformation of CALB solved 1.55 Å resolution was taken from X-ray
diffraction (PDB entry code: 1TCA) [15]. CALB is composed of 317 amino acid
residues, the ligands and waters in three-dimensional model were removed prior to
the docking. Besides, the substrates were prepared with Autodock4.2 [16]. The
coordinate of atom OG1 from residue Thr40 was set to the center of grid box.
Study on the Different Replacing Groups … 367
Table 1 The structure of four different substrates for molecular docking and MD simulations and
the E value of enzymatic resolution
Substrate R-group R-structure E value
F Alloc 16
O
O
OH
Boc O 45
N O
R Met CH3 6.20
Poc O 46
Spacing 0.375 Å, number of GA runs with 100. The binding energy was calculated
with lamarckian GA. The figures of protein structure were carried out by
PyMOL0.98 program [17].
All MD simulations were performed using GROMACS 4.5.4 package [18, 19] at
Hp Z800 workstation, employing the GROMOS96 53a6 united atom protein force
field [20]. Nonbonded interactions were calculated using a twin-range method [21]
with short and long range cutoffs of 8 and 14 Å, respectively. The Particle Mesh
Ewald (PME) method [22] was used to evaluate the long electrostatic interactions.
Bond lengths of the solute were constrained with LINCS [23] and the ones of water
with SETTLE [24]. The simple point change water model [25] was used in sim-
ulations. Considering a dielectric of 54 for simple point change water [26]. The
snapshots of each complex system were saved every 1 ps for data analysis. Each
initial system was subjected to energy minimization (1000 steepest descents and
1000 conjugate gradient) and 500 ps equilibration with position restrained. The
protein, non-protein were coupled to an external heat bath [27] with temperature
coupling constants of 0.1 ps. Then the MD simulations were carried out for 50 ns
with a timestep of 2 fs at constant temperature (300 K) and pressure (1 atm).
The MD trajectories were analyzed and calculated by GROMACS 4.5.4 program
including the backbone-RMSD, Root Mean Square Fluctuation (RMS-Fluctuation)
and the radius of gyration.
368 C. Zhang et al.
3.1 MD Simulations
The stabilized structure of protein is essential for catalysis. Generally, the stability
of enzyme is determined by RMSD and radius of gyration for simulations [9]. For
this, the MD simulations of the four complexes were addressed in 50 ns MD
simulations at 300 K. The simulations were started from the optimized structure
which obtained from cluster analysis using molecular docking. The
backbone-RMSD value was given in Fig. 1a and the results showed that Alloc-cal,
Boc-cal and Poc-cal were more stable than Met-cal. At the last 25 ns of simulations,
the structure of Alloc-cal, Boc-cal and Poc-cal reached balance and the RMSD
values stabilized around 0.25 nm. On the contrary, the RMSD value of Met-cal
complex always kept upward trend and in balance about 0.4 nm. Unlike the
RMSD’s values changes of complex. We found that the Rg values changed slightly
as shown in Fig. 1b. The Rg of Met-cal complex was 1.96 nm, and others were
1.90 nm. The compactness of Met-cal complex was worse than others obviously
according to the result of simulations. Therefore, the result indicated that the sta-
bility and compactness of Alloc-cal, Boc-cal and Poc-cal complexes were better
than Met-cal complex.
Meanwhile, through the analysis of RMS-Fluctuation (Fig. 2), we could find the
fluctuation of residues for local area are very large. Combining the catalytic triad
Ser105, Asp187 and His224 with the RMS-Fluctuation, the fluctuation of Met-cal is
smaller than others. The reduction of flexibility made ligand not be easy to couple
with the residues of active pocket, form strong interactions and steric exclusion.
Therefore, the binding force and stabilized property of Met-cal complex were worse
than other complexes, and reduced the efficiency of enzymatic resolution. And that
also indicated the results of H-bond interaction at the following part.
Fig. 1 The RMSD of backbone for different complex in 300 K (a), the radius of gyration of
different complex in the balance of 15 ns simulations in 300 K of MD simulations (b)
Study on the Different Replacing Groups … 369
Fig. 3 The hydrogen bonds of different substrates for residues in the active pocket (the imaginary
lines of yellow are hydrogen bonds)
Fig. 4 The distribution of four substrates in the active pocket which were docked using
Autodock4.2 package and the residues
hydrogen bonds except Met. In contrast, the ligand in Met-cal complex only formed
hydrogen bonds with the atom OG of Ser105 and the atom N of Thr40 respectively
(Fig. 4). This was because that the conformational inversion resulted in the phe-
nomenon and made the atom O of Thr40 be far away from the atom O of Met-cal.
Besides, we found that all the occupancy of hydrogen bonds were 100%, which
means that the hydrogen bonds were quite stable and had a strong binding force.
Although there is no rule for the distance of hydrogen bonds to expound the
diversity of mechanism for enzymatic resolution (Table 2), the reduction of
hydrogen bonds in number for Met-cal indicated that hydrogen bonds were an
important element for the influence of enzymatic resolution’s performance. Besides,
hydrophobic interactions are also important for recognition effect and the interac-
tions of substrate with enzyme. According to the analysis, we found that the
complex had a large difference in interactions residues. Because of the conforma-
tional inversion and the small of steric exclusion for the Met ligand, it only had
hydrophobic interactions with the residues Thr138, Val154, Gln157, IIe189,
Leu278, Ala281 and IIe289 (Fig. 3). Based on the energy’s analysis of hydrophobic
interactions and hydrogen bonds for different complexes, the energy of four
replacing groups(Alloc, Boc, Met and Poc) of trans-paroxol were −8.46, −7.62,
−6.49 and −9.22 kcal/mol, Which were consistent with the number of residues of
hydrophobic interactions. Through analyzing the residues, we considered that the
residues of Thr40, Ser105, Thr138, IIe189, Leu278, Ala281 and Ile285 were
372 C. Zhang et al.
Table 2 The distance, donor H-X and acceptor of hydrogen bonds for four different complexes
Complex Donor H-X Acceptor Distance Complex Donor H-X Acceptor Distance
(Å) (Å)
Alloc-cal Ser105.OG Alloc.O1 2.99 Boc-cal Ser105.OG Boc.O1 3.27
Thr40.N Alloc.O1 2.94 Thr40.N Boc.O1 3.05
Thr40.O Alloc.O1 3.10 Thr40.O Boc.O1 3.01
Poc-cal Ser105.OG Poc.O1 2.97 Met-cal
Thr40.N Poc.O1 2.89 Thr40.N Met.O 2.64
Thr40.O Poc.O1 3.16 Ser105.OG Met.O 2.98
essential for enzymatic resolution. Based on the analysis of above, the hydrogen
bonds, hydrophobic interactions and the diversity for the stability of complex were
major factors that resulted in the diversity of different complexes for enzymatic
resolution.
4 Conclusions
References
1. De GG, Brieva R, Sánchez VM, Bayod M, Gotor V (2001) Enzymatic resolution of trans-4-
(4′-fluorophenyl)-3-hydroxymethylpiperidines, key intermediates in the synthesis of (-)-
paroxetine. J Org Chem 6626:8947–8953
2. Su B, Bao Z, Xing H, Yang Y, Ren Q (2009) Enantioseparation of paroxetine intermediate on
an amylose-derived chiral stationary phase by supercritical fluid chromatography.
J Chromatogr A 121626:5140–5146
3. Christensen JA, Squires RF (1977) 4-Phenylpiperidine compounds. U.S. Patents 4007196, 8
Feb 1977
4. Amat M, Bosch J, Hidalgo J, Cantó M, Pérez M, Llor N et al (2000) Synthesis of enantiopure
trans-3, 4-disubstituted piperidines. An enantiodivergent synthesis of (+)-and (-)-paroxetine.
J Org Chem 6510:3074–3084
5. Gledhill L, Kell C (1998) Aminometyl oxooxazolidinyl benzene derivatives W.O. Patent
1999011642, 11 Mar 1998
Study on the Different Replacing Groups … 373
28. Escorcia AM, Daza MC, Doerr M (2014) Computational study of the enantioselectivity of the
O-acetylation of (R, S)-propranolol catalyzed by Candida antarctica lipase B. J Mol Catal B
Enzym 108:21–31
29. Matsumura H, Yamamoto T, Leow TC, Mori T, Salleh AB, Basri M et al (2008) Novel
cation-p interaction revealed by crystal structure of thermoalkalophilic lipase. Proteins Struct
Funct Bioinf 702:592–598
30. Yao J, Xu Q, Guo H (2013) QM/MM and free-energy simulations of deacylation reaction
catalysed by sedolisin, a serine-carboxyl peptidase. Mol Simulat 393:206–213
31. Hamberg A, Magnusson AO, Hu FJ, Hult K (2013) Selective Monoacylation of diols by
substrate assisted catalysis in T40A Candida antarctica Lipase B. Chem Cat Chem 53:743–747
32. Klibanov AM (2001) Improving enzymes by using them in organic solvents. Nature
4096817:241–246
33. Zaks A, Klibanov AM (1988) The effect of water on enzyme action in organic media. J Biol
Chem 26317:8017–8021
34. Valivety RH, Halling PJ, Macrae AR (1992) Reaction rate with suspended lipase catalyst
shows similar dependence on water activity in different organic solvents. Biochim Biophys
Acta Protein Struct Mol Enzymol 11183:218–222
35. Affleck R, Haynes CA, Clark DS (1992) Solvent dielectric effects on protein dynamics. Proc
Nat Acad Sci 8911:5167–5170
36. Park HJ, Joo JC, Park K, Yoo YJ (2012) Stabilization of Candida antarctica lipase B in
hydrophilic organic solvent by rational design of hydrogen bond. Biotechnol Bioproc Eng
174:722–728
37. Carter P, Wells JA (1990) Functional interaction among catalytic residues in subtilisin BPN′.
Proteins: Struct. Funct Bioinf 74:335–342
Relationship Between Coenzyme Q10
Synthesis and Cytochrome Accumulation
in Rhodobacter sphaeroides 2.4.1
Penghao Li, Dan Gao, Junqian Gao, Hao Liu and Zhengliang Qi
1 Introduction
ispB in Escherichia coli accompany with overexpressing a dps gene derived from
A. tumefaciens, resulting in a CoQ10 generating strain ultimately [8]. Moreover,
mutagenesis has also been an efficient way to acquire CoQ10 high-yield strains.
Researchers executed chemical mutagenesis to the A.tumefaciens AJ-24 strain using
NTG with biotin K3 as the selection marker. Finally, they obtain a mutant strain
producing 20% higher CoQ10 yield than the original strain [9].
CoQ10 synthesis in R. sphaeroides is influenced by many aspects, such as the
accumulation of cytochrome which competes in the common precursor (E, E)-
farnesyl-PP with the formation of CoQ10. The synthesis of cytochrome is regulated
by many global transcription regulators. The amount of cytochrome can be decided
by the level of photosynthetic (PS) apparatus including bacteriochlorophyll (Bchl),
carotenoids (Crt), membrane proteins of the reaction center (RC) and two
light-harvesting (LH) complexes as well as assembly factors [10, 11]. The
PrrA/PrrB and AppA/PpsR two-component systems are two significant regulators
which are directly related to cytochrome accumulation in R. sphaeroides. For the
PrrA/PrrB two-component system, PrrB delivers the phosphate group (Pi) to the
PrrA firstly before a self-phosphorylation, and then the PrrA-Pi complex facilitates
the transcription of PS genes [12, 13]. The AppA/PpsR two-component system can
MEP pathway
Glycosis Ubiquinone pathway
CoQ10
D-Glyceraldehyde 3-phosphate
ubiH、ubiE、ubiF、ubiG
Pyruvate 2-Polyprenyl-6-methoxyphenol
Dxs、dxsA
ubiG
1-Deoxy-D-xylulose 5-phosphate 2-Polyprenyl-6-hydroxyphenol
dxr、ispD、ispE、ispF、gcpE、LytB ubiD
Dimethylallyl-PP 3-Polyprenyl-4-hydroxybenzoate
crtE、ispA ubiA
(E,E)-Farnesyl-PP Decaprenyl-PP
Dxs
crtE Hydroxybenzoate
Geranyl geranyl-PP AroA、AroB、AroC、AroD
AroE、AroF、AroL、UbiC
bchP
inhibit the transcription of crt, bch and puc genes directly with PpsR combining to
their promoter regions and restraining puf indirectly by interaction with other
regulatory proteins. Afterwards, the AppA can specifically bind with PpsR and
liberate it from the operon, thus activating the transcription procession ultimately
[14]. Other regulators such as FnrL, TrxA, Spb and IHF also make a effect on the
synthesis of cytochrome [15].
Former studies mostly concentrated on the reconstruction of the metabolic
pathway of CoQ10 synthesis in R.sphaeroides. In the present study, with attempting
to address the relationship between cytochrome accumulation and synthesis of
CoQ10, we deleted the two key genes in the PrrA/PrrB and AppA/PpsR
two-component systems, respectively, to alter the accumulated amount of intra-
cellular pigments. Subsequently, shaking-flask fermentation was followed to
evaluate the cell growth and CoQ10 synthesis [16, 17].
All the strains and plasmids used in this study were summarized in Table 1. E.coli
JM109 was used for plasmids construction and preparation. E.coli S17-1 was a kind
gift of Prof. Dr. Hongwei Yu being used for di-parental conjugation. R.sphaeroides
strains 2.4.1 (WT), △prrA and △ppsR were used for CoQ10 fermentation. Plasmid
pLH146 was used for gene deleting in R. sphaeroides 2.4.1.
E.coli S17-1 and R. Sphaeroides, as donor and receptor strain respectively, were
harvested and washed twice with fresh LB medium after cultivating to the early log
phase. Then, mixing the suspension of E.coli S17-1 and R. Sphaeroides at a 1:10
ratio, which was subsequently added to a filter disc on the medium A agar plate and
cultivated at 32 °C for 24 h. Ultimately, washing off the lawn on the plate with
400 lL sterile water and spreading it on the medium A agar plate supplemented
with 25 lg/mL kanamycin and 150 lg/mL K2TeO3. The plate was cultivated at
32 °C until transformants presenting.
shaking incubator. The cell density was measured at OD600 each 12 h and the
CoQ10 production was detected each 24 h during the entire course of fermentation.
3
Absorbance
WT
2 prrA
ppsR
0
400 500 600 700 800 900
Wavelength
(a) (b)
35
50 WT
30 prrA
ppsR
CoQ10 yield (mg/L)
25 40
OD600
20 30
15
WT
20
prrA
10
ppsR
10
5
0 0
0 12 24 36 48 60 72 84 96 24 48 72 96
Time (h) Time (h)
(c) 7
WT
6 prrA
CoQ10 content (mg/g)
ppsR
5
0
24 48 72 96
Time (h)
Fig. 4 CoQ10 fermentation with WT, △prrA and △ppsR under aerobic dark cultivation
Relationship Between Coenzyme Q10 Synthesis … 383
4 Conclusion
prrA and ppsR are directly related to the synthesis of carotenoid and bacteri-
ochlorophyll in R. sphaeroides 2.4.1. ppsR mutation apparently activates carotenoid
synthesis under aerobic cultivation, while prrA defection obviously inhibits syn-
thesis of carotenoid and bacteriochlorophyll under the same condition. Comparing
to WT, both growth and CoQ10 yield are repressed during aerobic CoQ10 fer-
mentation by △prrA and △ppsR, but CoQ10 content reveal different phenomena
that CoQ10 content for △prrA is increased and for ppsR is reduced. Therefore,
the synthesis of cytochrome such as carotenoid and bacteriochlorophyll competes
with the CoQ10 synthesis and weakening the related cytochrome synthesis path-
ways may be beneficial to CoQ10 accumulation.
384 P. Li et al.
References
1. Ndikubwimana JDD, Lee BH (2014) Enhanced production techniques, properties and uses of
coenzyme Q10. Biotech Lett 36(10):1917–1926
2. Negishi E, Liou SY, Xu C et al (2002) A novel, highly selective, and general methodology for
the synthesis of 1,5-diene-containing oligoisoprenoids of all possible geometrical combina-
tions exemplified by an iterative and convergent synthesis of coenzyme Q(10). Org Lett
4(2):261–264
3. Lipshutz BH, Lower A, Berl V et al (2005) An improved synthesis of the “miracle nutrient”
coenzyme Q10. Org Lett 7(19):4095–4097
4. Gin P, Hsu AY, Rothman SC et al (2003) The Saccharomyces cerevisiae CoQ6 gene encodes
a mitochondrial flavin-dependent monooxygenase required for coenzyme Q biosynthesis.
J Biol Chem 278(28):25308–25316
5. Nguyen TPT, Theresa PT, Clarke, et al (2013) S. cerevisiae coq5 null mutants require
over-expression of Coq8 kinase for rescue by E. coli CoQ5 homolog ubiE. FASEB J
27(12):585–616
6. Lu W, Shi Y, He S et al (2013) Enhanced production of CoQ10 by constitutive overexpression
of 3-demethyl ubiquinone-9 3-methyltransferase under tac promoter in Rhodobacter
sphaeroides. Biochem Eng J 72:42–47
7. Lu W, Ye L, Xu H et al (2013) Enhanced production of coenzyme Q10 by self-regulating the
engineered MEP pathway in Rhodobacter sphaeroides. Biotechnol Bioeng 111(4):761–769
8. Choi JH, Ryu YW, Park YC et al (2009) Synergistic effects of chromosomal ispB deletion and
dxs overexpression on coenzyme Q10 production in recombinant Escherichia coli expressing
Agrobacterium tumefaciens dps gene. J Biotechnol 144(1):64–69
9. Yoshida H, Kotani Y, Ochiai K et al (1998) Production of ubiquinone-10 using bacteria.
J Gen Appl Microbiol 44(1):19–26
10. Matthews PD, Wurtzel ET (2000) Metabolic engineering of carotenoid accumulation in
Escherichia coli by modulation of the isoprenoid precursor pool with expression of
deoxyxylulose phosphate synthase. Appl Microbiol Biotechnol 53(4):396–400
11. Happ HN, Braatsch S, Broschek V et al (2005) Light-dependent regulation of photosynthesis
genes in Rhodobacter sphaeroides 2.4.1 is coordinately controlled by photosynthetic electron
transport via the PrrBA two-component system and the photoreceptor AppA. Mol Microbiol
58(3):903–914
12. Kim YJ, Ko IJ, Lee JM et al (2007) Dominant role of the cbb3 oxidase in regulation of
photosynthesis gene expression through the PrrBA system in Rhodobacter sphaeroides 2.4.1.
J Bacteriol 189(15):5617–5625
13. Abada E, Balzer A, Jäger A et al (2002) Bacteriochlorophyll-dependent expression of genes
for pigment-binding proteins in Rhodobacter capsulatus involves the RegB/RegA
two-component system. Mol Genet Genomics Mgg 267(2):202–209
14. Jäger A, Braatsch S, Haberzettl K et al (2007) The AppA and PpsR proteins from
Rhodobacter sphaeroides can establish a redox-dependent signal chain but fail to transmit
blue-light signals in other bacteria. J Bacteriol 189(6):2274–2282
15. Li K, Pasternak C, Klug G (2004) Expression of the trxA gene for thioredoxin 1 in
Rhodobacter sphaeroides during oxidative stress. Arch Microbiol 180(6):484–489
16. Tucker JD, Siebert CA, Escalante M et al (2010) Membrane invagination in Rhodobacter
sphaeroides is initiated at curved regions of the cytoplasmic membrane, then forms both
budded and fully detached spherical vesicles. Mol Microbiol 76(4):833–847
17. Niederman RA (2006) Structure, function and formation of bacterial intracytoplasmic
membranes. Springer, Berlin, pp 193–227
Optimization of the One-Step
and Two-Step Transformation Methods
of Mannitol by Lactobacillus buchneri
1 Introduction
no studies for mannitol production with the two-step transformation strategy were
reported. In the theory, the strategy could reduce the complexity of product sepa-
ration and increase the repeat times of cell use, which will help to reduce the
producing cost of mannitol.
2.1 Materials
Peptone, beef extract and yeast extract were products of Aobox Biotechnology.
Glucose and Fructose were purchased from Beijing solarbio. Ammonium citrate,
Anhydrous sodium acetate, K2HPO4, MgSO47H2O, MnSO44H2O and twain-80
were purchased by Tianjin north day medical chemical reagent factory, Corn steep
liquor was supplied by Cargill. Mannitol standard product was purchased by Sigma.
The activated L. buchneri CGMCC 7300 cells were added by 2% cell quantity to
different MRS-improved fermentation medium with different total concentration of
fructose (F) and glucose (G) (60, 90, 120, 150, 180 g/L) and different ratios of them
(F:G = 1:2, 1:1, 3:2, 2:1) at 30 °C for 72 h.
The cells were added by 2% (v/v) quantity to MRS-improved medium to study the
effects of different temperature (25, 30, 32, 35, 37, 40, 45 °C) and different initial
pH (3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0) on the growth condition of L.
buchneri CGMCC 7300, and then conform the best growth condition.
The cells were cultured at the best growth condition, and then collected by
centrifugation at 6000 r/min for 10 min and washed twice with sterile water. Then
suspended with the mixture of fructose and glucose at different concentrations
(90, 120, 150 g/L) and 0.5% yeast powder for biotransformation at different pH
(3.0, 4.0, 5.0, 4.0, 5.0) and different temperature (25, 28, 30, 32, 35, 37, 40 °C) for
48 h. The concentration of mannitol and residual sugar were detected by high
performance liquid chromatography (HPLC).
Optimization of the One-Step and Two-Step Transformation … 387
Under the condition of the ratio of fructose and glucose set to be 3:2, change the
concentration of total sugar in the medium (60, 90, 120, 150, 180 g/L) and investigate
their effects on the mannitol transformation. As can be seen in Fig. 2, high substrate
concentration up to 180 g/L limited the transformation, while as the concentration of
substrate increased from 60 to 150 g/L, the mannitol concentration also increased.
When total sugar concentration was 150 g/L, the highest yield of mannitol 55.01 g/L
was achieved, but the residual amount of fructose and glucose also increased to be
25.49 and 58.01 g/L respectively. Overall consideration, the substrate concentration
of 90 g/L was the best, in which mannitol production reached 48.82 g/L, while
fructose residual decreased to be 4.15 g/L, and conversion rate reached 50.43% and
the proportion of mannitol in the total sugar reached 72.18%.
The two-step transformation method includes the first step of cell growth and the
second step of cell catalysis. The essence of cell catalysis is the enzyme catalysis in
biological system. Compared with the extraction of enzyme, whole-cell catalysis can
use cellular cofactor and other enzymes for reducing cost and improving the efficiency
of biological catalysis. As catalyst, the concentration of the cells determines the
transformation speed of mannitol. Therefore, it is critical for transformation to opti-
mize the growth conditions to maximize the cell concentration. In addition, it is also
important to optimize the cell catalysis conditions for transformation.
Optimization of the One-Step and Two-Step Transformation … 389
Except for the composition of medium, temperature and pH also affected the cell
growth of L. buchneri CGMCC 7300. The effects of temperature on growth at 25,
30, 32, 35, 37, 40, and 45 °C were investigated. As can be seen in Fig. 3, cell
concentration achieved maximum at 37 °C for OD600 0.4. The effects of different
pH from 3.5 to 8.0 on the growth were also compared. Shown in Fig. 4, pH from
5.5 to 6.5 were suitable for the growth of L. buchneri CGMCC 7300, and the
maximum cell concentration was reached at pH 6.5. The growth was obviously
restrained at the pH lower than 4.0 or higher than 7.5.
The medium was removed by centrifuge followed by the catalysis step. The con-
ditions in this step needs to satisfy the cell catalysis, but not the cell growth. So, the
conditions optimized in the one-step transformation method or the first cell growth
step may not suit the second cell catalysis step. The optimal substrate concentration,
pH and temperature for cell catalysis were optimized in this study.
Taking both the yield and the conversion rate in account, the substrate con-
centration 120 g/L was considered the best, as was shown in Fig. 5. At 120 g/L, the
mannitol concentration reached 57.81 g/L, and the residual fructose was only
8.93 g/L.
For the whole-cell catalysis of mannitol, the mannitol dehydrogenase plays a key
role in the transformation [15]. Therefore, a suitable pH was required for the
mannitol dehydrogenase to maximize the mannitol output. As shown in Fig. 6, the
best pH for whole-cell catalysis by L. buchneri CGMCC 7300 was 5.0. Also, when
pH 7.0 or 3.0, the enzyme activity of the mannitol dehydrogenase reduced
greatly.
In the conditions of the ratio of fructose and glucose 3:2, total sugar concen-
tration 120 g/L and pH 5.0, the effects of the temperature on the transformation
were shown in Fig. 7. The mannitol production reached the highest 63.71 g/L at
32 °C, and meanwhile fructose was completely consumed. It indicated that the
optimal temperature for transformation was different from that for cell growth.
Optimization of the One-Step and Two-Step Transformation … 391
4 Conclusions
In this study, both the one-step method and two-step method were used for the
transformation of mannitol by L. buchneri CGMCC 7300 with the mixture of
fructose and glucose as substrate, and their conditions were optimized respectively.
The best conditions for one-step method were as follows: the ratio of fructose and
glucose 3:2, substrate concentration 90 g/L. After fermentation at these conditions
for 60 h, mannitol concentration reached 48.82 g/L and the conversion reached
50.43%. The best conditions of the two-step transformation method were as fol-
lows: in the first step, the initial pH was 6.5 and the temperature 37 °C; in the next
cell catalysis step, substrate concentration 120 g/L, catalysis at 32 °C and pH 5.0
for 36 h. At these conditions, mannitol concentration reached 63.71 g/L with the
residual fructose only 6.67 g/L and the conversion rate up to 50.24%. The yield of
mannitol increased 30.5% more than that of the one-step transformation method,
showing that the two-step transformation method had a great advantage in mannitol
production. The results of this study will be significant for further industrial-scale
production of mannitol.
Acknowledgements This study was supported by the National Natural Science Foundation
(21306140).
References
1. Saha BC, Racine FM (2011) Biotechnological production of mannitol and its applications.
J Appl Microbiol Biotechnol 89(4):879–891
2. Soetaert W, Buchholz K, Vandamme E (1995) Production of D-mannitol and D-lactic acid by
fermentation by Leuconostoc mesenteroides. J Agro Food Ind Hi-Tech 6(1):41–44
3. Saha BC (2003) Production of mannitol by fermentation. In: Saha BC (ed) Fermentation
biotechnology. American Chemical Society, Washington, DC, pp 67–85
392 H. Wang et al.
1 Introduction
The A. simplex CPCC 140451 was obtained from China Pharmaceutical Culture
Collection (CPCC). The wide type A. globiformis ATCC 8010 was obtained from
American Type Culture Collection (ATCC). Escherichia coli strains DH5a was
used for construction, copy, and storage plasmid DNA, which was purchased from
Transgene Biotech (Beijing, China).
The plasmid pART2 and pART2-gfp [11] were respectively used to transform
A. simplex CPCC 140451, E. coli and A. globiformis ATCC 8010, which were
kindly provided by Cristinel Sandu (University of Rockefeller, USA). The plasmid
pART2 has a size in 4634 bp, which includes the following features: pCG100 and
ColE1 origins of replication; Kanr, kanamycin resistance gene; P, promoter/operator
of the hdnO gene (hdnOp); MCS; His8, eight-histidine tag coding sequence. The
plasmid pART2-gfp was constructed by ligating the green fluorescent gene (gfp) in
a size of 717-bp into the pART2 vector.
A. simplex and A. globisformis were routinely grown in LB broth at 32 °C.
E. coli was grown in LB broth at 37 °C. When appropriate, kanamycin was added
to medium at the final concentration 50 lg/ml for recombinant strains.
2.2 Material
(Beijing, China). Protein Marker II was purchased from Biomed (Beijing, China).
Taq DNA polymerase, dNTPs was purchased from Sangon (Shanghai, China).
The plasmid pART2-gfp was transformed into A. simplex CPCC 140451 using the
above optimized electroporation protocol. The strains only containing the plasmid
pART2 was used as the control strain.
The cell growth curve of A. simplex was shown in Fig. 1. The strain was in the lag
phase when cultured for 8 h with the OD600 below 1.0. A. simplex was in the
logarithmic phase when it continued to cultivate until 18 h. It was previously
reported that cells collected in the exponential growth phase produced better
electroporation efficiency. In this study, cells at different phase were harvested and
used to prepare the competent cells. As shown in Fig. 2, the resultant transfor-
mation efficiency varied slightly between an OD600 of 0.2–0.6, but a rapid increase
in transformation efficiency was observed as OD600 value was further increased.
The top transformation efficiency (4.83 103 transformants/lg DNA) was reached
at OD600 of 1.0. With the continue increasing of OD600, the transformation effi-
ciency exhibited slight decrease tendency. Therefore, the best cell growth stage was
selected at the OD600 of 1.0.
A. simplex, as a kind of Gram-positive bacteria with high GC content, its intact cell
wall is always considered to be a strong barrier to the foreign DNA [2]. The cell
Optimization of Electroporation Conditions for Arthrobacter … 397
6
Fig. 1 Growth curve of A.
simplex CPCC 140451. Data 5
are means ± SD (n = 3) 4
(P < 0.05)
OD600
3
0
0 5 10 15 20 25 30 35
Time(h)
means ± SD (n = 3) 3000
(P < 0.05)
2000
1000
0
0.2 0.4 0.6 0.8 1.0 1.2 1.4
OD600
wall-weakening treatment is one of the most effective methods for the enhancement
on the electroporation efficiency [15]. The effects of four wall-weakening agents,
including glycine, threonine, lysozyme, and penicillin on the transformation effi-
ciency of A. simplex were investigated and results were shown in Fig. 3.
When the OD600 of the culture reached 1.0, different kinds of wall-weakening
agent were added to prepare the competent cells respectively, including 0–2.0%
(w/v) threonine, 0–2.0% (w/v) glycine, 0–10 lg/ml lysozyme, or 10–110 lg/ml
penicillin. An electrical transformation system, including 500 ng of plasmid DNA
and 60 ll of competent cells was then constructed. As shown in Fig. 3, The
transformation efficiency was about 20 transformants/(lg DNA) without any
treatment. The transformation efficiency was greatly increased after treatment by
different wall-weakening agents. For threonine, the highest transformation effi-
ciency (207 transformants/(lg DNA)) was obtained at the concentration of 1.5%;
For glycine, the highest transformation efficiency (314 transformants/(lg DNA))
was obtained at the concentration of 1.0%; For lysozyme, the highest transforma-
tion efficiency (352 transformants/(lg DNA)) was obtained at the concentration of
6 lg/ml; For penicillin, the highest transformation efficiency (5236 transformants/
(lg DNA)) was obtained at the concentration of 70 lg/ml. Therefore, the best cell
wall-weakening treatment condition was 70 lg/ml penicillin treated for 1 h.
398 J. Luo et al.
200 300
250
150
200
100 150
100
50
50
0 0
0.0 0.5 1.0 1.5 2.0 0.0 0.5 1.0 1.5 2.0
Threonine (% (w/v)) Glycine (% (w/v))
400 6000
350
5000
300
4000
250
200 3000
150
2000
100
1000
50
0 0
0 2 4 6 8 10 10 30 50 70 90 110
Lysozyme(ug/mL) Penicillin (µg/mL)
The DNA concentration is one of the key factors for electroporation efficiency.
Different qualities of DNA (1–2000 ng) were transformed into A. simplex CPCC
140451, respectively. Two particular trends were indicated in Fig. 4. When the
quantity of DNA was no more than 500 ng, the number of transformants increased
along with the augment of DNA quantity but no obvious increase in the transformants
number was observed as DNA quantity was further increased. However the highest
transformation efficiency (2531 transformants/(lg DNA)) occurred at 200 ng, further
increase in DNA concentration resulted in significant decrease in transformation
efficiency. Similar results were reported by previous researcher [1, 10]. In conclusion,
200 ng of DNA was selected for our follow-up experiments.
Optimization of Electroporation Conditions for Arthrobacter … 399
Number of transformants
means ± SD (n = 3)
(P < 0.05) 20000
1200
15000
800
10000
400
5000
0 0
0 200 500 1000 1500 2000
DNA(ng)
Electroporation efficiency (transformants/µg DNA)
30000
25000
20000
15000
10000
5000
0
10 12 14 16 18 20 22 24
voltage (kV/cm)
60 ll of competent cells and 200 ng DNA were added into 0.1 cm cuvettes to
electroporation. The effects of different voltages on electroporation efficiency were
examined. As shown in Fig. 5, the transformation efficiency increased with the raise
of voltage ranging from 10 to 22 kV/cm, and the highest value reached 3.76 104
transformants/lg DNA at 22 kV/cm.
400 J. Luo et al.
4 Conclusions
In this study, we firstly describe the electroporation protocol for A. simplex CPCC
140451 with results of 3.76 104 transformants/lg DNA. To obtain high trans-
formation efficiency, the parameters of two aspects were optimized. The first aspect
is to optimize pre-treatment conditions of competent cells, including the cell growth
phase and wall-weakening treatment conditions. Our results indicate that cells
collected in the early stage of exponential phase give rise to better electroporation
efficiencies than those collected in the middle or late period of log phase. The cell
wall modification by using different kinds cell wall-weakening agents (glycine,
threonine, lysozyme and penicillin) indeed promote electroporation efficiency to
some extent and the best result is obtained at the penicillin treatment, which
inhibitor the synthesis of peptidoglycan and has previously been shown to stimulate
electro-competence in various bacteria [4, 12, 17], The second aspect is to optimize
the factors of transformation process. Our results prove that both the quantity of
DNA and high-voltage pulses are important parameters for electroporation effi-
ciency. The optimized electroporation protocol can be well applied to other dif-
ferent strains (such as A.globisformis ATCC 8010), which provide feasible means
for genetic manipulations in A. simplex CPCC 140451.
Acknowledgements This work was supported by the National Natural Science Foundation of
China (No. 21646017 and 21306138) and the Lab Innovation Foundation of Tianjin University of
Science and Technology (No. 1504A205X).
References
1. Dorella, FA, Estevam EM, Cardoso PG, Savassi BM, Oliveira SC, Azevedo V (2006) An
improved protocol for electrotransformation of Corynebacterium pseudotuberculosis. Vet
Microbiol 114(3–4):298–303
2. Dunny GM, Lee LN, LeBlanc DJ (1991) Improved electroporation and cloning vector system
for Gram-positive bacteria. Appl Environ Microbiol 57(4):1194–1201
3. Fernandes P, Cruz A, Angelova B, Pinheiro HM, Cabral JMS (2003) Microbial conversion of
steroid compounds: recent developments. Enzyme Microb Technol 32(6):688–705
4. Kurusu Y, Kainuma M, Inui M, Satoh Y, Yukawa H (1990) Electroporation–transformation
system for coryneform bacteria by auxotrophic complementation. Agric Biol Chem 54
(2):443–447
5. Le Marrec C, Michotey V, Blanco C, Trautwetter A (1994) UAAU2, a temperate
bacteriophage specific for “Arthrobacter aureus”, whose integrative functions work in other
corynebacteria. Microbiol 140(11):3071–3077
6. Luo JM, Ning J, Wang YX, Ning J, Wang YX, Cheng YX, Zheng Y, Shen YB, Wang M
(2013) The effect of ethanol on cell properties and steroid 1-en-dehydrogenation biotrans-
formation of Arthrobacter simplex. Biotechnol Appl Biochem 61(5):555–564
7. Marina VD, Olga VE (2012) Microbial steroid transformations: current state and prospects.
Appl Microbiol Biotechnol 94(6):1423–1447
8. McDonald IR, Riley PW, Sharp RJ, McCarthy AJ (1995) Factors affecting the electroporation
of Bacillus subtilis. J Appl Microbiol 79(2):213–218
402 J. Luo et al.
1 Introduction
c-Aminobutyric acid (GABA) exists widely among animals, plants and microor-
ganisms as a natural non-protein amino acid [1–3]. Also, GABA acts as major
inhibitory neurotransmitter in the mammalian central system. Due to its involve-
ment in many important physiological functions, GABA has broad potential for
application as a bioactive additive in the food and pharmaceutical industries [4–7].
GABA can be produced by chemical and biological syntheses [8–10]. However,
GABA produced by chemical methods cannot be used in food industry due to its
unsafety. On the contrary, many kinds of microorganisms, such as lactic acid
bacteria (LAB) and yeasts, are generally recognized as safe (GRAS). Moreover,
some GABA-producing LABs have been reported in recent years, including
Lactobacillus brevis, Lactococcus lactis and Lactobacillus buchneri [11–13].
Besides, LABs exhibit a great promising for using as a starter in fermented food,
such as yoghurt, bread and cheese [14, 15].
Culture conditions, such as medium, exhibit a great effect on GABA production
in various strains. Response surface methodology (RSM) is one of the best
experimental strategies to seek optimal conditions for multivariable system and
have been successfully employed for optimizing the medium composition [16–18].
To improve the GABA production of Enterococcus raffinosus TCCC11660, RSM
protocol was used for optimizing conditions for fermentation medium composition
in the present work.
Enterococcus raffinosus strain TCCC11660 (CGMCC No. 5584) used in this work
was isolated from Chinese traditional pickled vegetables in our previous work, and the
initial medium and cultural condition were the same as previously described [19].
Pyridoxal 5′-phosphate (PLP) and GABA standard were bought from
Sigma-Aldrich (St Louis, MO, USA). Monosodium glutamate (MSG, purity
99%) was bought from Neimenggu Fufeng Biotechnologies Co., Ltd. (Hohhot,
Inner Mongolia, China). All other chemicals were of analytical or biochemical
grades.
GABA concentrations in the fermentation broth were assayed using high perfor-
mance liquid chromatography (HPLC) method as previously described [6, 20].
The Box-Behnken design of the response surface methodology (RSM) was pro-
posed in order to analyze the yield of GABA by E. raffinosus TCCC11660, as a
function of the chosen factors on the response surfaces of the investigated region.
Medium Optimization for c-Aminobutyric Acid Production … 405
The screened factors in the Plackett-Burman design were used for the Box-Behnken
design, and each factor was examined at three different coded levels (Table 2). The
Design-Expert (Version 8.0.6) software was used for RSM design and regression
analysis. The P-value < 0.05 was considered to be significant.
Nine components were analyzed for their effects on GABA production using the
Plackett-Burman design. The results were presented in Table 3 and the analysis of
variance (ANOVA) for GABA production was performed in Table 4. Based on the
ANOVA results, citric acid, PLP, Na2MoO4 and glycine showed significant effects
(P-value < 0.05) on GABA production while the rest of the other ingredients had
no statistically significant effects (P-value > 0.05) on it. Besides, the analysis of
coefficients indicated that citric acid, glycine and PLP had positive effects on
GABA production while Na2MoO4 exerted negative effect. The most significant
variable was citric acid, which had the highest coefficient, followed by glycine and
PLP. Then the significant variables were used for further analysis.
406 C.-Y. Chang et al.
PLP added in the medium from 0.05 to 0.5 mmol/L and the other components in
the medium were fixed as follows (g/L): sucrose 30, yeast extract 30, L-MSG 40,
MgSO47H2O 0.04, K2HPO4 2.0, Al2(SO4)3 0.03, citric acid 10, glycine 1.0, and
Tween-80 2 mL/L. As indicated in Fig. 3, GABA production increased signifi-
cantly when different concentrations of PLP were added. The results revealed that
PLP was essential to GABA production, but the GABA titer leveled off when the
concentration of PLP was equal or more than 0.2 mmol/L.
In order to approach the GABA yield, significantly positive (P-value < 0.05)
variables (citric acid, glycine and PLP) were further studied. The suitable con-
centration ranges of these variables were also preliminarily determined at three
levels each according to the Box-Behnken design (Table 2). As shown in Table 5,
the real values of the coded variables by Box-Behnken design together with the
results of the GABA yield. The results were analyzed by linear multiple regression
using the Design-Expert and the model equation for GABA yield was obtained.
The regression equation was obtained as following:
where A, B and C are the symbols of concentration of citric acid, glycine and PLP,
respectively.
The results of the response surface model were analyzed using ANOVA to validate
the regression coefficient (Table 6). The F-test showed the significance of the model
(P-value = 0.0019). Besides, the lack of fit test measures the failure of the model to
Medium Optimization for c-Aminobutyric Acid Production … 409
represent data in the experimental domain at points that are not included in the
regression. The P-value of lack of fit was 0.0756, implying that the lack of fit test is not
significant. A regression model is considered as having a high correlation when the R2
value of the model is higher than 0.9 [21], and the R2 value of the present model is
0.99. Thus, it is reliable to use the regression model for further analysis.
The 3D response surface plots serve as graphical representations of the regres-
sion model equation for GABA production. The graphical representation provides a
method to demonstrate the interaction effects of two parameters when the third one
is kept constant at a center point. Figure 4 demonstrated the relationship between
410 C.-Y. Chang et al.
Fig. 4 Three-dimensional surface plots showing the effect of the concentrations of citric acid,
glycine and PLP on GABA production
the response and design levels of each variable and the type of interactions between
test variables to deduce the optimum conditions on GABA production. Therefore,
the optimal medium composition was found as the follows (g/L): citric acid 8.9,
glycine 0.82 and PLP 0.21 mmol/L. To verify the proposed medium for GABA
production, fermentation experiments were implemented with the optimized
nutrients levels. The maximum value of GABA production was 77.5 g/L and
103.9% higher than the initial medium. The results suggested that the tested strain
has a great potential for industry applications.
Medium Optimization for c-Aminobutyric Acid Production … 411
4 Conclusion
Acknowledgements This work was financially supported by the National Basic Research
Program (973 Program) of China (2013CB734004), the National Natural Science Foundation of
China (31370075, 31471725 & 61603273), and the Youth Innovation Fund of Tianjin University
of Science & Technology of China (2014CXLG28).
References
1. Cho YR, Chang JY, Chang HC (2007) Production of gamma-aminobutyric acid (GABA) by
Lactobacillus buchneri isolated from kimchi and its neuroprotective effect on neuronal cells.
J Microbiol Biotechnol 17:104–109
2. Sandmeier E, Hale TI, Christen P (1994) Multiple evolutionary origin of pyridoxal-5′-
phosphate-dependent amino acid decarboxylases. Eur J Biochem 221:997–1002
3. Trobacher CP, Zarei A, Liu J et al (2013) Calmodulin-dependent and calmodulin-independent
glutamate decarboxylases in apple fruit. BMC Plant Biol 13:144
4. Ding JZ, Yang TW, Feng H et al (2016) Enhancing contents of gamma-aminobutyric Acid
(GABA) and other micronutrients in dehulled rice during germination under normoxic and
hypoxic conditions. J Agric Food Chem 64:1094–1102
5. Park KB, Oh SH (2007) Cloning, sequencing and expression of a novel glutamate
decarboxylase gene from a newly isolated lactic acid bacterium, Lactobacillus brevis OPK-3.
Bioresour Technol 98:312–319
6. Gao Q, Duan Q, Wang DP, Zhang YZ et al (2013) Separation and purification of
c-aminobutyric acid from fermentation broth by flocculation and chromatographic method-
ologies. J Agric Food Chem 61:1914–1919
7. Shi XF, Chang CY, Ma SX et al (2016) Efficient bioconversion of L-glutamate to
c-aminobutyric acid by Lactobacillus brevis resting cells. J Ind Microbiol Biotechnol. doi:10.
1007/s10295-016-1777-z
8. Plokhov AY, Gusyatiner MM, Yampolskaya TA et al (2000) Preparation of c-aminobutyric
acid using E. coli cells with high activity of glutamate decarboxylase. Appl Biochem
Biotechnol 88:257–265
9. Komatsuzaki N, Shima J, Kawamoto S et al (2005) Production of c-aminobutyric acid
(GABA) by Lactobacillus paracasei isolated from traditional fermented foods. Food
Microbiol 22(6):497–504
10. Choi SI, Lee JW, Park SM et al (2006) Improvement of gamma-aminobutyric acid (GABA)
production using cell entrapment of Lactobacillus brevis GABA 057. J Microbiol Biotechnol
16:562–568
412 C.-Y. Chang et al.
Yan Liu, Tianyi Shang, Zhong Chen, Yaozhou Zhang, Wei Sun,
Junjie Yang and Yan Pan
1 Introduction
N C
MeOH O O
H H
N N N
rt, 24 h N N
NH2 N
O N O
N
O
N
OH
N
N
O MOMO
140 °C O
H OMOM
Et N
N o-Cl 2C 6H 4 -N2
O N
N N [4+2] O Et
BnO cycloaddition N N
N OBn
MeO 2C CO 2Me
MOMO MOMO
O
O
[3+2]
N cycloaddition N
O Et O Et
N OBn N OBn
CO 2 Me CO 2 Me
57%, de = 82%
NH2
O
N
CHO N
2a O
1a + MeOH H
C N tBu N
HOOC t Bu N
4a r.t., 12 h
O OBn
OBn O N
3a N
5a inisolated
120 ℃, 2 h
o-Cl 2C 6 H4 N N -N2
O
O
O O
[4+2] N N
cycloaddition OBn NH OBn
NH tBu
t Bu O O
7a
6a
Table 1 Reaction conditions varying the solvents, temperatures and reaction timesa
O 1. [4+2] cycloaddition
H
N O O
tBu N 2. -N2 N
O OBn NH OBn
O N tBu
O
N
5a 7a
Enty Sovelution [5a] (M) Temp. (°C) Time (h)b Yield (%)c
1 o-C6H4Cl2 1.0 120 2 47
2 p-C6H4Cl2 1.0 120 2 21
3 m-C6H4Cl2 1.0 120 2 16
4 Toluene 1.0 Reflux 2 0
5 o-xylene 1.0 120 2 0
6 DMSO 1.0 120 2 0
7 o-C6H4Cl2 1.0 100 2 30
8 o-C6H4Cl2 1.0 140 2 36
9 o-C6H4Cl2 1.0 120 1 29
10 o-C6H4Cl2 1.0 120 4 45
a
Reaction conditions: 5a (1.0 mmol) heated in 2 mL solvent
b
The reaction was monitored by TLC
c
Isolated yield
long reaction time did not led to increased yield. Generally, the optimized condition
of the Diels-Alder additional reaction to generate 7a used 1.0 equiv of 5a, in
o-C6H4Cl2 at 120 °C for 2 h (Table 1, entry 1).
With the conditions optimized, we further endeavoured to explore the substrate
scope and generosity of this Ugi/Intramolecular inverse electron demand
Diels-Alder sequence using commercially available substrates to build up a
diversified and substituded 2-pyrrolidinones library. Table 2 summarizes the results
of additional examples employing different substrate. As expected, the optional use
of benzylamine 1b (Table 1, entry 2), a double bond input 3c (Table 1, entry 3) and
isocyanide with little steric hindrance 4d (Table 1, entry 4) resulted in the similar
scaffold as the one in entry 1, Table 2 via air oxidation of the corresponding
Diels-Alder intermediate. 1,3,4-oxadiazol-2-amine (2a) were required for complete
conversion to the final products (Table 1, entry 1–4).
In conclusion, we have developed an Ugi/intramolecular inverse electron
demand Diels-Alder reaction sequence, which provided access to a concise and
diversity-oriented strategy for the synthesis of substituded 2-pyrrolidinones in a
two-step procedure. The procedure is general and efficient and the substrates are
easily available. Considering the importance of 2-pyrrolidinone derivatives, this
method may find wide application in the synthesis of more complex polycyclic
heterocycles.
A Concise and Diversity-Oriented Strategy … 417
NH2 COOH
O C
CHO O
2 Bn
N tBu
N O 7b, 42
N OBn N
OBn
tBu NH
O
a
Reaction conditions: amine (1.0 mmol), acid (1.0 mmol), aldehyde (1.0 mmol) and isocyanide
(1.0 mmol) in MeOH (2 mL) at r.t. for 12 h; then in o-C6H4Cl2 (5 mL) at 120 °C for 2 h
b
Isolated yield
3 Experimental
Compound 7a (197 mg, 47%) was obtained as white solid. 1H NMR (400 MHz,
d6-DMSO): d 8.18 (s, 1H), 7.27–7.33 (m, 10H), 6.53 (s, 1H), 5.82 (s, 1H), 4.93 (s,
2H), 4.53 (s, 2H), 2.85 (s, 2H), 1.15 (s, 9H). 13C NMR (100 MHz, d6-DMSO):
418 Y. Liu et al.
d 27.4, 29.2, 60.0, 64.6, 71.7, 83.1, 99.8, 127.1, 127.6, 128.9, 129.6, 136.1, 151.3,
168.6, 169.7. LRMS (ESI) m/z: 421.2 [M + H]+.
Compound 7b (183 mg, 42%) was obtained as white solid. 1H NMR
(400 MHz, d6-DMSO): d 8.18 (s, 1H), 7.32–7.33 (m, 5H), 7.14–7.19 (m, 5H), 6.53
(s, 1H), 5.82 (s, 1H), 4.93 (s, 2H), 4.92 (t, 2H), 4.53 (s, 2H), 3.33 (d, 2H), 2.85 (s,
2H), 1.15 (s, 9H). 13C NMR (100 MHz, d6-DMSO): 29.2, 35.6, 57.2, 60.0, 71.7,
127.1, 127.6, 127.7, 128.6, 128.9, 136.1, 136.6, 171.1. LRMS (ESI) m/z: 435.2
[M + H]+.
Compound 7c (148 mg, 43%) was obtained as white solid. 1H NMR
(400 MHz, d6-DMSO): d 8.18 (s, 1H), 7.27–7.31 (m, 5H), 6.53 (s, 1H), 5.82 (s,
1H), 4.53 (s, 2H), 3.51 (s, 3H), 2.85 (s, 2H), 1.37 (s, 9H). 13C NMR (100 MHz,
d6-DMSO): d 27.4, 29.2, 56.1, 60.0, 71.4, 83.1, 99.8, 127.6, 128.9, 129.2, 129.6,
138.8, 151.3, 168.6, 169.7. LRMS (ESI) m/z: 345.1 [M + H]+.
Compound 7d (164 mg, 39%) was obtained as white solid. 1H NMR
(400 MHz, d6-DMSO): d 8.01 (s, 1H), 7.27–7.33 (m, 10H), 6.53 (s, 1H), 5.82
(s, 1H), 4.93 (s, 2H), 4.53 (s, 2H), 3.18 (t, 2H), 2.85 (s, 2H), 1.49 (m, 2H), 1.29
(m, 2H), 0.89 (t, 3H). 13C NMR (100 MHz, d6-DMSO): d 13.8, 19.8, 32.2, 38.9,
64.0, 71.7, 83.1, 99.8, 127.1, 127.6, 128.9, 129.2, 129.6, 136.1, 136.8, 151.3,
169.2, 169.7. LRMS (ESI) m/z: 421.2 [M + H]+.
References
10. Ramachandran G, Karthikeyan NS, Giridharan P et al (2012) Efficient iodine catalyzed three
components domino reaction for the synthesis of 1-((phenylthio)(phenyl) methyl)
pyrrolidin-2-one derivatives possessing anticancer activities. Org Bio Chem 10(28):
5343–5346
11. Boger DL (1986) Diels-Alder reactions of heterocyclic aza dienes. Scope and applications.
Chem Rev 86(5):781–793
12. Akritopoulou-Zanze I, Wang Y, Zhao H et al (2009) Synthesis of substituted fused pyridines,
pyrazines and pyrimidines by sequential Ugi/inverse electron demand Diels-Alder transfor-
mations. Tetrahedron Lett 50(42):5773–5776
13. Pellissier H (2012) Stereocontrolled domino reactions. Chem Rev 113(1):442–524
Optimization of Medium Components
for the Production of Flavonoids
and Soluble Protein with Phellinus
igniarius in Liquid Culture
1 Introduction
The submerged fermentation of edible fungi not only shows the higher growth
speed of mycelium and higher utilization rate of the nutrition, the mycelia obtained
have a variety of nutrients and bioactive substances, but also the submerged fer-
ments contain a wealth of primary metabolic products, such as proteins, polysac-
charides and secondary metabolism products [1–4], such as flavonoids, antibiotics,
etc. In our previous studies also confirmed that edible fungi of Phellinus igniarius
and Grifola frondosa produced a lot of secondary metabolites such as polysac-
charides, flavonoids and soluble protein in liquid fermentation broth [5, 6]. These
substances can enhance the ability of human and animal to resist, increase nutrition
and improve the taste. The study will provide important new resources for the
development of new feed and functional drinks rich in mycelium body, proteins and
flavonoids [7].
Phellinus igniarius was a kind of edible fungus with an important medicinal
value, and its submerged ferments contained a variety of bioactive substances, such
as soluble protein, vitamin C and flavonoids etc. [8]. Corn silk had the effects of
diuresis, detumescence and lowering blood sugar, cholesterol and blood pressure in
traditional Chinese medicine, and be treated as health care tea because of its rich
nutrients [9, 10]. However, only a little corn silk was used in Chinese medicine in
our country, most of it is discarded as an agricultural waste after harvest. If it is
Y. Wang
College of Basic Science,
Tianjin Agriculture University, Tianjin 300384, China
e-mail: [email protected]
Z. Yuan X. Tan Z. Ran H. Jin (&)
College of Agronomy and Resource Environment,
Tianjin Agriculture University, Tianjin 300384, China
e-mail: [email protected]
2.1 Materials
Corn silk, collected by ourselves, the corn silk was screened by the same maturity
degree, dried at 60 °C, crushed and reserved over 60 mesh sieve. Phellinus
igniarius strain was obtained from the biotechnology laboratory of Tianjin
Agricultural University. It was maintained on potato agar and incubated at 28 °C
for 7 days. Formula of liquid seed medium: 3% glucose, 0.3% peptone, 0.05%
MgSO4, 0.1% KH2PO4, pH unadjusted. Formula of basal liquid submerged fer-
mentation medium (100 mL): 6 g wheat bran, 0.2 g KH2PO4, 0.4 g yeast extract,
0.1 g MgSO4, pH unadjusted [12–14].
The seed culture was cultivated for 5 days in 100 mL of liquid seed medium that
was inoculated with 3–4 strain blocks of the activated Phellinus igniarius with the
size of 0.5 cm2 at 25 °C and 150 rpm in a shaking incubator. 10 mL of the seed
culture was transferred into 100 mL of fresh liquid submerged fermentation med-
ium in a 250 mL flask. They were then cultivated for another 5 days at 25 °C and
150 rpm in a shaking incubator. After 5 days’ cultivation, the culture broth was
used as the culture strains of further fermentation.
The fermentation broth was centrifuged at 3000 rpm for 10 min, the supernatant
was used to determine the contents of flavonoid and soluble protein by the method
from Liu [8] the absorbance of flavonoids was determined at 285 nm wavelength.
Optimization of Medium Components … 423
10 mL of the seed culture was transferred into 100 mL of fresh liquid submerged
fermentation medium in a 250 mL flask. They were then cultivated for 7 days at
25 °C and 150 rpm in a shaking incubator. Fermentation broth was sampled for
once every 24 h and the contents of flavonoid and soluble protein from the broth
were determined. The strain growth curves were drawn to find out when the con-
tents of flavonoid and soluble protein were the highest with the cultivation.
2.2.4 The Effect of Different Ratios of Corn Silk and Wheat Bran
Different ratio of corn silk and wheat bran was added into the basal liquid sub-
merged fermentation medium. The ratios of corn silk and wheat bran were
respectively: corn silk to wheat bran (0–6%), (3–6%), (6–6%), (9–6%), (12–6%),
(15–6%) and (18–6%). 10 mL of the seed culture was transferred into 100 mL of
fresh such liquid submerged fermentation medium in a 250 mL flask. They were
then cultivated at 25 °C and 150 rpm in a shaking incubator and ended at the day
which had been found to be the optimal cultivation. Contents of flavonoids and
soluble protein from the broth were determined to find the optimal ratio at which
contents of flavonoids and soluble protein were the highest.
On the basis of optimal ratio, three different inoculation amounts (1.5, 3, 4.5%)
were studied to find the optimal one.
In order to obtain the optimal formula of culture medium whose ferment broth
showed the highest levels of flavonoids and soluble protein, based on the above
424 Y. Wang et al.
Table 1 The orthogonal test design of four factors and four levels
Levels Factors
Ratio of corn silk to bran KH2PO4 (%) Yeast extract (%) MgSO4 (%)
1 6% + 3% 0.10 0.2 0.05
2 5% + 6% 0.15 0.3 0.10
3 4% + 9% 0.20 0.4 0.15
4 3% + 12% 0.25 0.5 0.20
single factor experiment, ratio of corn silk to bran, yeast extract, KH2PO4, and
MgSO4 were selected as factors to design the orthogonal test of four factors and
four levels, the factors and levels were shown in Table 1. The optimal culture
medium formula was obtained through comprehensive equilibrium analysis.
The change curve of the content of flavonoids with culture time was shown in Fig. 1.
During the process of submerged fermentation, there was a linear relationship
between the content of metabolite flavonoids and the culture time, and content of
flavonoids was increased with the time increasing, until the 4th day it reached the
maximum and thereafter was decreased with the increase of time. Flavonoids are
secondary metabolites, which were mainly produced in the stable phase. At early
stage of infection, mycelium was just added into the new medium, and grew slowly
for adapting to the new culture medium, so, the content of metabolites was lower.
With the increase of days of culture, Phellinus igniarius was growing to the expo-
nential phase, content of metabolites was accumulated, then to a period of decline,
the death of the fungus, reduced metabolites and accumulation would appear and
continue to decline. Predictably, mycelium in the growth process, continued to use
the nutrients for its breeding and production of products until the nutrients could not
maintain biological activity and metabolism, so, the incubation time was the 4th day
after incubation when flavonoid content was reached the highest.
Optimization of Medium Components … 425
0.6
Content of flavonoid
0.5
(mg/mL) 0.4
0.3
0.2
0.1
0
1 2 3 4 5 6
T ime (d)
Fig. 1 The change curve of the content of flavonoids during the process of Phellinus igniarius
submerged fermentation
Content of soluble protein
0.25
0.2
(mg/mL)
0.15
0.1
0.05
0
1 2 3 4 5 6
T ime (d)
Fig. 2 The change curve of content of soluble protein during the process of Phellinus igniarius
submerged fermentation
The change curve of soluble protein content was shown in Fig. 2. The cir-
cumstance as for change of soluble protein content with culture time was similar to
that of the flavonoids. at the 4th day of incubation, content of soluble protein
reached maximum value.
As a whole, at the 4th day of incubation, contents of metabolites of flavonoids
and soluble protein were determined to reach the highest level. In the following test,
the stop incubation time was set at the 4th of incubation.
The effect curves of corn silk and wheat bran with different ratio on the contents of
flavonoids and soluble protein in the fermentation liquid were shown in Figs. 3 and
4. Ratios 1–7 were established on the basic 6% wheat bran and added different
426 Y. Wang et al.
Fig. 3 Effect of different concentration ratio of corn silk and wheat bran on content change of
flavonoids
Content of soluble
protein(mg/mL)
0.5
0.4
0.3
0.2
0.1
0
Mixture ratio Mixture ratio Mixture ratio Mixture ratio Mixture ratio Mixture ratio Mixture ratio
1 2 3 4 5 6 7
Different concentration ratio of corn silk and wheat bran
Fig. 4 Effect of different concentration ratio of corn silk and wheat bran on content change of
soluble protein
concentration of corn silk (0, 3, 6, 9, 12, 15 and 18%), which was shown in Fig. 3.
In the process of submerged fermentation of Phellinus igniarius, content of fla-
vonoids varied greatly with different conc. of corn silk, the ratio 4 (9% corn silk,
6% wheat bran) showed the highest level of flavonoid content.
That meant that corn silk might play an active supplement role on the synthesis of
flavonoids in the process of submerged fermentation of Phellinus igniarius. Over a
certain concentration, metabolite synthesis showed a downward trend. According to
Han ping’ report [17], the main chemical constituents in corn silk were volatile fatty
oils, volatile oils, saponins, polysaccharides, vitamins, various organic acids, and so
on, thus, corn silk in culture medium was mainly used as carbon source, and wheat
bran also as carbon source, whose main component was cellulose and hemicellulose.
From the point of nutritional components, the nutrition of corn silk was more com-
prehensive than that of wheat bran, to some extent, it was a good supplement to the
wheat bran, but the nutritional carbon source factor of corn silk was not enough,
reasonable collocation of both would be more beneficial to the fermentation of
Phellinus igniarius. How to use the waste of corn silk instead of wheat bran, reduce the
cost of fermentation was the purpose of our study. Therefore, the optimal ratio of corn
silk and wheat bran for flavonoids was ratio 4, namely 9% corn silk, 6% wheat bran.
Optimization of Medium Components … 427
It was shown in Fig. 4, based on the fixed concentration of wheat bran, different
ratios of corn silk and wheat bran had slight effect on the content of soluble protein in
fermentation liquid. To comprehensive consider as for the contents of flavonoids and
soluble protein, the optimal ratio was ratio 4, it was 9% corn silk, 6% wheat bran.
0.9
inoculum amount on the
0.8
content of flavonoids in the
fermentation liquid 0.7
0.6
0.5
0.4
0.3
0.2
1.5 3 4.5
Inoculum amount (%)
428 Y. Wang et al.
0.5
(mg/mL)
0.3
0.2
0.1
0
1.5 3 4.5
Inoculum amount (%)
Fig. 6 The effect of different inoculum amount on the content of soluble protein in the
fermentation liquid
In order to obtain the optimal formula of culture medium whose ferment broth
showed the higher levels of both flavonoid and soluble protein, based on the above
single factor experiment, ratio of corn silk to bran, yeast extract, KH2PO4, and
MgSO4 were selected as factors to design the orthogonal test of four factors and
four levels according to Table 1. Results were shown in Table 2. From Table 2, the
best culture medium formula based on the content of flavonoids was A4B2C3D1.
According to the analysis of range, size order of each factor affecting the content of
flavonoids in fermentation liquid was: ratio of corn silk to wheat
bran > KH2PO4 > yeast extract > MgSO4. The best medium formula based on the
content of soluble protein was A4B1C4D1, the size order was ratio of corn silk to
wheat bran > yeast extract > MgSO4 > KH2PO4. The two schemes were not the
same, so, the comprehensive balance method [18] was used to carry out the analysis
of multi-indexes to obtain the final optimal formula of medium with both higher
levels of flavonoids and soluble protein.
From Table 2, factor A (the concentration ratio of corn silk to wheat bran)
showed significant effects on contents of flavonoid and soluble protein with bigger
ranges, indicating that factor A was the biggest effective factor. In terms of the
content of flavonoids, A4 level was the best, as for the content of soluble protein, A4
level was also the best. Overall, A4 level was selected. In terms of the content of
flavonoids, B2 level (KH2PO4) was the best. In terms of soluble protein content, B1
level was the best, but B2 level was not bad. Aiming to both of indexes, B2 level
was selected. Factor C (yeast extract) showed smaller range to the content of
flavonoids, but bigger range of soluble protein content. That meant yeast extract
was the major influence factor on the soluble protein content. In terms of the
content of flavonoids, C3 level was the best, C4 level is not too bad; for soluble
protein content, C4 level was the best. In summary, the level of the best yeast
Optimization of Medium Components … 429
extract was C4. The impact of Factors D (MgSO4) on both of indicators: Factor D
showed smaller ranges to the contents of both flavonoids and soluble protein. That
meant MgSO4 was the minor effect factor on the soluble protein content. In terms of
the content of flavonoids and soluble protein, D1 level was the best, so, D1 level was
selected.
In conclusion, after the overall balance, the optimal scheme of medium was
gotten to be A4B2C4D1, namely corn silk 12%, wheat bran 3%, KH2PO4 0.15%,
yeast extract 0.5%, MgSO4 0.05%. Three sets of parallel experiments were con-
firmed by using the optimal medium formula. The content of flavonoids in fer-
mentation broth was 1.551 mg/mL, and the soluble protein content was
0.691 mg/mL.
430 Y. Wang et al.
4 Conclusion
Through orthogonal test and comprehensive balance analysis method, the optimal
medium composition was determined: 3% wheat bran, 12% corn silk, 0.5% yeast
extract, 0.15% KH2PO4, 0.05% MgSO4. The best inoculation amount was 3%.
With the optimal formula. The confirmation experiment was that the content of
flavonoids in fermentation broth was 1.551 mg/mL, and the soluble protein content
was 0.691 mg/mL.
References
1. Wang W, Zhu J (1998) Research progress and prospect of edible fungus liquid deep
fermentation technology. Edible Fungi China 17(2):11–13
2. Guo S, Wang H (2013) Submerged fermentation technology of edible fungus and its
application. J Shanxi Agric Sci 41(8):885–888
3. Qin J, Chen M, Chen H et al (2004) Prospect and current studies on edible and pharmaceutical
fungi polysaccharides. Edible Fungi China 23(2):6–9
4. Chen X, Liu Q, Chen B (2008) Preliminary study of antimicrobial activities of Russula vinosa
lindbl mycelium and its submerged culture fermentation broth. Food Sci 29(7):260–262
5. Jin H, Yang X, Ren C et al (2015) The comparison of the contents of bioactive substances in
edible fungus by submerged ferments. Food Res Dev 36(3):93–96
6. Yang X, Liu M, Wu X et al (2015) Study on optimizing and improving polysaccharide
production of Grifola frondosa in submerged ferments. Food Res Deve 36(24):51–55
7. Su Y, Lu P, Guo Q et al (2016) Progress in edible fungus by submerged fermentation. J Food
Saf Qual 7(2):645–650
8. Liu W (2012) Study on the metabolic regulation of flavones produced by a medicinal fungus
Phellinus igniarius. China University of Petroleum, Beijing, pp 1–23
9. She M (2014) Overview of clinical application research of Maize. China Health Care Nutr
(4):2383–2384
10. Chen Y, Ma Q (2014) Study on blood sugar and blood pressure, blood lipid, liver function of
corn silk. Tradit Chin Med Res 27(3):78–80
11. Cao S, Zheng H, Chen L et al (2014) Optimized conditions of botway solid
FERMENTATION for transforming inonotus obliquus with stigma maydis. Inform Tradit
Chin Med 31(4):61–64
12. Xu Q (2015) Optimization of liquid culture medium for fermenting mycelial flavone in
Phellinus igniarius. Food Mach 31(1):190–193
13. Lima LFO, Habu S, Gern JC et al (2008) Production and characterization of the
exopolysaccharides produced by Agaricus brasiliensis in submerged fermentation. Appl
Biochem Biotechnol 151(2):283–294
14. Kwon JS, Lee JS, Lee KE et al (2009) Optimization of culture conditions and medium
components for the production of mycelial biomass and exo-polysaccharides with Cordyceps
militarisin liquid culture. Biotechnol Bioprocess Eng 14(6):756–762
Optimization of Medium Components … 431
15. Deng L, Pan X, Sheng J et al (2012) Optimization of experimental conditions for the
determination of water soluble protein in apple Pulp using coomassie brilliant blue method.
Food Sci 33(24):185–189
16. Liu Y, Yang Y, Jia W et al (2006) Study on the determination method of total flavonoids from
Phellinus igniarius. Acta Edulis Fungi 13(2):45–48
17. Han P, Li H, Hou C (2009) The chemical component of maize silk and its application research
progress. Mod Agric Sci Technol (18):19–21
18. Zhang J, Ma Y (2016) Optimization of processing technology of nine steaming nine drying of
Rehmannia glutinosa by multiple indexes comprehensive balance method-orthogonal test.
China Pharm 27(7):962–965
Application of Sun Light Conversion
Film on the Outdoor Culture
of Nostoc flagelliforme
Shigang Shen, Peipei Han, Shunyu Yao, Rongjun Guo and Shiru Jia
1 Introduction
The growth increment of the N. flagelliforme cells was measured with dry mass
method. The EPS and CPS production was performed via the modified phenol–
sulphuric acid method using glucose as standard [12]. Crude protein content was
determined by Automatic Kjeldahl Apparatus (JK9830) in accordance with the
method of the determination of protein in foods (GB 5009.5-2010).
Effects of seven different types of SCF on the biomass production were investi-
gated, and the results were shown in Fig. 1. Compared to the control group (under
436 S. Shen et al.
the use of common polyethylene film), the biomass was greatly increased under the
use of SCF 34#, 39#, 40# and 41#, but there were no obvious difference under the
use of SCF 36# and 47#. After 14 days of culture, under the use of SCF 41#, the
highest biomass was achieved with the value of 1.36 g/L, which was increased by
20.35% compared with control group. The results showed that SCF 40# and 41#
can significantly promote the biomass accumulation (P < 0.05), which indicted that
SCF 40# and 41# were more suitable for cell growth.
As we can see from Fig. 2, under the use of different types of SCF, the significant
difference was observed in the EPS production. After 14 days of culture, EPS
production was higher in the order of 41#, 36#, 39#, 40#, 43#, 34#, 47# and
control, which reached 46.53, 36.64, 36.61, 35.35, 34.03, 30.71, 30.32 and
28.52 mg/L, respectively. Under cultivation of SCA 41#, the EPS production was
1.63 times to that of control group. The results showed that SCF 41# significantly
stimulated the EPS production, which may be related to the properties of adding red
color masterbatch (P < 0.01). Red color masterbatch is originally used for agri-
cultural production, and it has the function of promoting fruit ripening.
From Figs. 1 and 2, it was found that both the biomass and EPS production
reached the highest under cultivation of SCF 41#, which increased by 20.35 and
63.15% compared with control group, respectively. Results of the experiment
indicated SCF could convert useless wavelengths to be useful for N. flagelliforme
growth, thereby increasing the productivity of biomass and EPS, which could bring
up remarkable economy benefits. Taken biomass and EPS into consideration, SCF
41# was more suitable for culture of N. flagelliforme.
Application of Sun Light Conversion Film … 437
Fig. 3 Effects of SCF on the photosynthetic pigment content of N. flagelliforme. Control (the cells
grown under common polyethylene film)
438 S. Shen et al.
4 Conclusions
In this study, different types of SCF were applied to culture the N. flagelliforme in
order to improve the production of biomass and EPS. The results demonstrated
clearly that SCF could significantly increase the biomass and EPS production.
Particularly, under the use of SCF 41#, both the biomass and EPS production
reached the highest, which were increased by 20.35 and 63.15% compared with
control group, respectively. Based on this study, application of SCF on the
microalgal culture was feasible and these results will shed light on novel culture
strategies for microalgal outdoor cultivation.
Acknowledgements This work was supported by the National Natural Science Foundation of
China (Grant No. 31671842 and 31201405) and Changjiang Scholars and Innovative Research
Team in University (Grant No. IRT1166), which are all acknowledged.
References
1. Jia SR, Yao J, Tan ZL et al (2008) The preparation method for N. flagelliforme cells and N.
flagelliforme extract with anti-oxidant activity. Chinese granted patent ZL200810152297.8
2. Kanekiyo K, Lee JB, Hayashi K et al (2005) Isolation of an antiviral polysaccharide nostoflan
from a terrestrial cyanobacterium Nostoc flagelliforme. J Nat Prod 68:1037–1041
3. Jia SR, Yu HF, Lin YX et al (2007) Characterization of Exocellular Polysaccharide of Nostoc
flagelliforme in Liquid Suspension Culture. Biotechnol Bioproc E 12(3):271–275
4. Han PP, Sun Y, Wu XY et al (2014) Emulsifying, flocculating, and physicochemical
properties of exopolysaccharide produced by cyanobacterium Nostoc flagelliforme. Appl
Biochem Biotechnol 172(1):36–49
5. Gao KS (1998) Chinese studies on edible blue-green alga, Nostoc flagelliforme: a review.
J Appl Phycol 10:37–49
6. Yu HF, Jia SR, Dai YJ (2010) Accumulation of Exopolysaccharides in Liquid Suspension
Culture of Nostoc flagelliforme Cells. App Biochem Biotechnol 160:552–560
7. Mishra SK, Shrivastav A, Maurya RR et al (2012) Effect of light quality on the
C-phycoerythrin production in marine cyanobacteria Pseudanabaena sp. isolated from
Gujarat coast, India. Protein Express Purif 81:5–10
8. Otero A, Vincenzini M (2003) Extracellular polysaccharide synthesis by Nostoc strains as
affected by N source and light intensity. J Biotechnol 102:143–152
9. Yang Z, Geng LL, Wang W et al (2012) Combined effects of temperature, light intensity, and
nitrogen concentration on the growth and polysaccharide content of Microcystis aeruginosa in
batch culture. Biochem Syst Ecol 41:130–135
10. Han PP, Sun Y, Jia SR et al (2014) Effects of light wavelengths on extracellular and capsular
polysaccharide production by Nostoc flagelliforme. Carbohyd Polym 105:145–151
11. Liu XJ, Jiang Y, Chen F (2005) Fatty acid profile of the edible filamentous cyanobacterium
Nostoc flagelliforme at different temperatures and developmental stages in liquid suspension
culture. Process Biochem 40:371–377
12. Dubois M, Gilles KA, Hamilton JK et al (1956) Colorimetric method for determination of
sugars and related substances. Anal Chem 28:350–356
13. Wellburn AR (1994) The spectral determination of chlorophylls a and b, as well as total
carotenoids, using various solvents with spectrophotometers of different resolution. Plant
Physiol 144(3):307–313
14. Yi ZW, Huang H, Kuang TY et al (2005) Three-dimensional architecture of phycobilisomes
from Nostoc flagelliforme revealed by single particle electron microscopy. FEBS Lett
5793:569–3573
Determination of Ginkgolic Acids
in Ginkgo Seeds Using HPLC-MS
in the Presence of Lipids
1 Introduction
Yanying Hu, Guojuan Sun—These two authors contributed to the work equally and are treated
as co-first authors.
fast, cheap and easy to operate, but only suitable for qualitative analysis because of
its large errors and limited precision. GC and GC-MS need a derivatization process
for the determination of ginkgolic acids, which is relatively cumbersome [7], fur-
ther, it is not easy to judge the results because the ginkgo acid derivatives, not
ginkgolic acids themselves are directly detected for this process. Duo to the high
resolution and no need of derivation process, HPLC was reported recently to be
used for the quantitative analysis of ginkgolic acids in ginkgo biloba leaves and
their extracts. HPLC-MS has the advantages of high efficiency, fast speed and high
sensitivity, which is suitable for the determination of components with trace con-
tent, difficulty for separation, or variability. It also gives rich information of the
samples such as retention time, online UV spectra, molecular weight and charac-
teristics of structural fragments of the components synchronously. When these
methods were used for the determination of ginkgolic acid contents in ginkgo seeds
[8], an extraction process using a Soxhlet extractor, which is complicated and
time-consuming, was usually conducted. Compared with the extract of ginkgo
leaves, the extracts of ginkgo seeds or ginkgo sarcotesta contain higher content of
lipid substances [9]. On the other hand, strong polar solvents such as water,
methanol or acetic acid were usually used as the mobile phase in HPLC analysis
[4–6]. Because the containing lipids are immiscible in these mobile phases and are
similar in properties to ginkgolic acids, which may give negative influence on the
determination of ginkgolic acids, the pretreatment of silica gel column chro-
matography was usually conducted in order to get rid of them [10]. It is a
time-consuming process, which may decrease the accuracy of the qualitative
determination of ginkgolic acids with HPLC method due to the inevitable sample
loss.
In order to simplify the pretreatment processes and improve the accuracy of
ginkgolic acids’ analysis, isopropanol, which has a better solubility to ginkgo acids,
was used in this study as extraction solvent and a component of mobile phase and
HPLC-MS, which has the high sensitivity and selectivity, was employed to
determine the content of ginkgolic acids in ginkgo seeds.
The fresh ginkgo seeds were purchased from Taixing (Jiangsu Province, China).
Standard samples (>99.0%) of ginkgo acids C15:1, and ginkgolic acid mixture
(C13:0, C15:0, C15:1, C17:1 and C17:2) were purchased from Shanghai Tongtian
Biotechnology Incorporated Company (China), batch number were 12101935,
12102306 and 12102406 respectively.
Determination of Ginkgolic Acids in Ginkgo Seeds … 443
Before extraction, the hulled ginkgo seeds were dried to constant weight, grinded to
powder, and then screened with a 200 mesh sieve. 2.0 g of the powder was
weighted accurately into a 50 mL conical flask with plug and placed on a ther-
mostatic shaker (Jintan Science Analysis Instrument Co. Ltd, THZ-82, China).
25 mL isopropanol was added to extract the ginkgolic acids and the shaker was
shaking for a period (the shaking speed is 124 r min−1 at 28 °C). Then the liquid
was filtered with 0.22 lm microporous membrane (Tianjin Keyilong Experiment
Equipment Co., Ltd., China) and condensed with a rotary evaporator (Shanghai
Yarong Biochemistry Instrument Factory, RE-3000, China), finally the volume of
the extraction was adjusted to 2.5 mL to obtain the sample solution for the deter-
mination of ginkgolic acids.
1.0 mg of the standard, ginkgolic acid C15:1, was weighted accurately into a 10 mL
volumetric flask and isopropanol was added to adjust the volume of ginkgolic acid
solution to 10 mL as the stock solution. Before the determination, 1.0 mL of the
stock solution was then diluted for four times and filtered with 0.22 lm microp-
orous membrane.
Eight levels of concentration within the range 0.0008–0.1 mg mL−1 were prepared
and injected into the HPLC-MS system respectively, and the peak areas were
obtained.
The limit of detection (LOD) was determined by the ratio of signal to noise, the
ratio was detected using the lowest concentration of the standard curve through
Agilent ChemStation. And the levels in which the response was 3 higher than the
ratio of signal to noise was taken as LOD. The limit of quantitation (LOQ) for
ginkgolic acids C15:1 was identified from the LOD as follows:
Each sample was injected into the chromatography system for six parallel times
and chromatograms were recorded. The injection volume was 5.0 lL. The peak
area values were recorded and the content of the ginkgolic acid was calculated, the
average value and RSD (Relative Standard Deviation) were all calculated.
The recovery of the determination method was examined by adding standard
solutions at three different concentrations: 9.4, 12.5, and 15.6 µg mL−1, respec-
tively to the container of 2.00 g ginkgo seed powder, followed by subsequent
extraction using the same process employed for the samples, which consisted of
filtration and direct analysis of the extraction solution by HPLC-MS.
Ginkgo seeds contain large amounts of lipids. When the strong polar solvents such
as methanol or ethanol were used for the extraction of ginkgolic acids, these lipids
may form a separate phase from the solvent, which is not conducive to constant
volume process before the determination. However, when the nonpolar solvents
were employed as extraction solvent, ginkgo seeds must be fully dried before the
extraction, otherwise, these solvents were difficult to penetrate into the wet ginkgo
seeds, resulting in the low extraction ratio. In addition, the nonpolar solvents such
as cyclohexane and petroleum ether, cannot be completely miscible with the
common HPLC mobile phase with strong polarity (for example, the acetonitrile).
Through our experiments, it was found that isopropanol not only has good
Determination of Ginkgolic Acids in Ginkgo Seeds … 445
miscibility with lipids and ginkgolic acids, but it also miscible with methanol and
acetonitrile, which are often used as a mobile phase in HPLC. Isopropanol itself can
also usually used as a HPLC mobile phase component. Thus, in our study iso-
propanol was selected as the extraction solvent and the main component of the
HPLC mobile phase, which facilitates the extraction and HPLC determination of
ginkgolic acids. In order to improve the separation ability of the HPLC technique,
acetonitrile was used to adjust the polarity of the mobile phase and a small amount
of acetic acid was introduced to reduce the trailing behavior. Thus, in our experi-
ments, isopropanol/acetic acid/acetonitrile (42:1:57, v/v) was used as the mobile
phase.
2.0 g of the dried ginkgo seed powder was taken for the extraction into a 50 mL
conical flask with plug and placed on the thermostatic shaker with the shaking
speed of 124 r min−1 at 28 °C. 25 mL of isopropanol was used as the extraction
solvent for the extraction of ginkgolic acids from ginkgo seeds. In order to ensure
the ginkgolic acids in ginkgo seeds can be adequately extracted, the extraction time
was optimized with single factor experiment. The results are shown in Fig. 1. It can
be seen that the content of ginkgolic acids C15:1 in the extract solvent nearly
doesn’t change after the extraction time is longer than 120 min. Thus, all the
extraction for subsequent experiment was kept for 120 min.
Fig. 2 HPLC and HPLC-MS analysis of the extract of ginkgo seeds. a HPLC determination of
ginkgolic acids in the isopropanol extract injected directly. b HPLC-MS analysis (SIM mode m/z
345) of ginkgolic acid C15:1 in the isopropanol extract of ginkgo seeds
The following parameters were evaluated for the method validating herein: lin-
earity, limits of detection and quantitation, precision, and recovery. To this end, a
standard of C15:1 and ginkgolic acid mixture (C15:1, C17:1, C17:2, C15:0) were
employed. The results are presented below.
3.4.1 Linearity/Range
While X is the sample weight (µg) and Y is the peak area. It correlates well in
the range of 0.008–1 µg of ginkgolic acid [11].
The ratio that was detected using the lowest concentration of the standard curve
through Agilent ChemStation was 65.7, and the LOD and LOQ are
0.354 10−3 lg and 1.179 10−3 lg respectively.
448 Y. Hu et al.
Precision values are expressed as the coefficient of variation (CV), according to the
formula:
where SD is the standard deviation and DAC is the determined average concen-
tration. As for repeatability, the sample solution was determined for six times.
Correlation between the results was determined within a short period and the data
measured by the same analyst by means of the same instrumentation. The average
concentration was 170.95 mg kg−1 and CV was 3.3%.
In this study, UV detector was set at 312 nm. The results are listed in Table 2. The
results show that there are four kinds of ginkgo acids in sample and the ginkgolic acid
C15:1 has the most of 170.95 ± 0.033 mg kg−1. The ginkgolic acid of C15:0 may have
Table 1 The recovery of HPLC-MS method was calculated for ginkgo seed powder spiking with
different amounts of ginkgolic acid C15:1
Sample (mg) Standard (mg) Spiked sample (mg) Recovery (%)
A1 2.08 10−5 3.34 10−5 5.57 10−5 104.50
A2 2.10 10−5 3.34 10−5 5.60 10−5 104.80
A3 2.16 10−5 3.34 10−5 5.79 10−5 108.68
B1 2.11 10−5 2.62 10−5 4.83 10−5 103.82
B2 2.20 10−5 2.64 10−5 4.93 10−5 103.41
B3 2.14 10−5 2.77 10−5 4.81 10−5 96.39
C1 2.07 10−5 2.24 10−5 4.34 10−5 101.34
C2 2.15 10−5 2.32 10−5 4.25 10−5 90.52
C3 2.09 10−5 2.23 10−5 4.48 10−5 107.17
Determination of Ginkgolic Acids in Ginkgo Seeds … 449
Fig. 3 The HPLC-MS (SIM mode, m/z 347) analysis of ginkgolic acid C15:0
isomers because there are two adjacent peaks with the same m/z appeared (Fig. 3). The
peak time of sample and the ginkgolic acid mixture standard are the same.
4 Conclusions
In this study, a determination method using HPLC-MS for four kinds of ginkgolic
acids in ginkgo seeds C15:0, C15:1, C17:1, C17:2 was established with isopropanol
as the extraction solvent and a component of the mobile phase. The concentrations
of ginkgolic acids in the extract can be determined using HPLC-MS by the direct
injection of the extract solution without any lipid removal process. The coefficient
of variation and the recovery of the determination method are 3.3% and 102.29%
respectively. It has good linearity within the range of 0.0008–0.1 mg mL−1. This
paper provides a simple and convenient method for the determination of ginkgolic
acids in ginkgo seeds with the presence of a large amount of lipids.
References
1. Koch E, Jaggy H, Chatterjee SS (2000) Evidence for immunotoxic effects of crude Ginkgo
biloba L. leaf extracts using the popliteal lymph node assay in the mouse. Int J
Immunopharmacol 22(3):229–236
2. Baron-Ruppert G, Luepke NP (2001) Evidence for toxic effects of alkylphenols from Ginkgo
biloba in the hen’s egg test (HET). Phytomed Int J Phytotherapy Phytopharmacol 8(2):133–
138. doi:10.1078/0944-7113-00022
450 Y. Hu et al.
1 Introduction
Vinegar is a traditional oriental grain condiment with a sour taste and distinct
fragrance. Now, it has been used as a condiment sauce worldwide [3]. The global
vinegar demand is increasing significantly in the last few years [13]. Its main
industrial production technology was semi-continuous fermentation with acetic acid
bacteria (AAB), in which the acidity usually does not exceed 60 g/L. High acidity
vinegar(acidity 90 g/L acetic acid) can save storage and transport cost [6]. So,
production of high acidity vinegar is valuable [12].
However, there is some hardness in production of high concentration vinegar
with AAB fermentation. The inferior quality white vinegar was mainly produced by
blending the glacial acetic acid. This means that it is not healthy and poor taste. The
traditional high quality vinegar was produced from ordinary fermentation vinegar
by repeatedly freezing, however its productivity is very low [4]. Here, we try to
produce the vinegar from edible alcohol by biocatalysis with acetic acid bacteria
(AAB). This is a safe and feasible route.
AAB has powerful ability to oxidise ethanol. In the two-step reaction [14], the
AAB acts as a cell factory, in which the ethanol is oxidized to acetic acid catalyzed
2.1 Microorganisms
The original medium composition for AAB culture were glucose (10 g/L), yeast
extract (10 g/L), KH2PO4 (0.5 g/L), MgSO4 (0.5 g/L) and NaH2PO4 (0.5 g/L), and
ethanol (20 mL/L).
Carbon source optimization: The concentration of glucose was as follows (w/v)
0.2, 0.3, 0.4, 0.5, 0.6%. Others compositions are the same as the original medium.
Nitrogen source optimization: The concentration of yeast extract was as follows
(w/v) 2.3, 2.4, 2.5, 2.6, 2.7%. Others compositions are the same as the original
medium.
Ethanol concentrations optimization: In starting-up stage, the concentration of
ethanol was as follows (v/v) 0.0, 1.0, 2.0, 3.0, 4.0%. The concentration of glucose
and yeast extract were the optimized amount. Others compositions are the same as
the original medium. In production acid stage, the concentration of ethanol was as
3.0, 4.0, 5.0, 6.0, 7.0% (v/v).
In the process, the AAB culture broth, which was at exponential growth phase,
was inoculated into the fermenter with 10% of inoculum size. The fermenter was
opened in 30 °C and 220 r/min agitation rate. The first 24 h culture is the
starting-up stage for AAB biomass growth. The next stage is production stage,
which is mainly production of vinegar.
High Concentration Vinegar Production by Acetic Acid Bacteria … 453
The acidity of acetic acid was quantitatively determined by titration with 0.1 M
NaOH solution using phenolphthalein as indicator [9].
The total biomass was determined by turbidity method based on the optical
density measurements at 600 nm using a UV/visible spectrophotometer [14].
Samples were diluted to the appropriate concentration to keep the OD600nm value
between 0.2 and 0.8. The relationship between dry cell weight and OD600nm was
constructed by standard line [8].
To model the growth curve, the biomass data was analyzed with Logistic model
(1), Gaussian Eq. (2) and Lorentz Eq. (3).
cm ð c0 cm Þ
c¼ þ cm ð1Þ
c0 elm t c0 þ cm
4 ln 2ðccm Þ2
A e w2
c ¼ c0 þ pffiffiffiffiffiffiffiffi ð2Þ
w 4 lnp 2
2A w
c ¼ c0 þ ð3Þ
p 4ðc cm Þ2 þ w2
C0: the biomass at the start in theory, Cm: the maximal biomass in theory, w:
half-peak width, lm: the specific growth rate in theory [2, 5, 7].
Glucose was used as the carbon source. To optimize the glucose concentration,
various glucose concentration was applied and the corresponding growth curve was
determined (Fig. 1).
To find the relationship between Cm and glucose concentration, we fitting the
curves with least square method. The result were given in Table 1.
The data were further fitted with Gaussian equation and Lognormal equation.
The results were given in Fig. 2. It shows that Logistpk equation, Gaussian
equation and Lognormal equation all have a good imitative effect in the relation-
ship between Cm and glucose concentration. The fitting degree (R2) are respectively
0.9860, 0.9871 and 0.9870. Based on the R2, Gaussian equation is the most suit-
able. When C have the highest, the corresponding parameter values were
C0 = 0.7620,Cm = 0.5066,A = 0.0108,w = 0.1144. According it, the optimum
value for glucose concentration in the medium is about 0.51% (w/v).
454 X.-Y. Yin et al.
(a) (b)
0.2%
0.2%
1.0 0.3% 1.0 0.3%
0.4% 0.4%
0.5% 0.5%
0.6% 0.6%
0.8 0.8
0.6 0.6
0.4 0.4
0.2 0.2
0.0 0.0
0 20 40 60 80 100 0 20 40 60 80 100
Time /h Time /h
Fig. 1 Growth curves in different concentration of glucose a experiment data, b fitting curves of
biomass with Logistic equation
0.80
0.78
0.76
0.2 0.3 0.4 0.5 0.6
Glucose concentration g/100mL
Yeast extract was applied as the nitrogen source. Various yeast extract amount was
applied and the corresponding growth curve was determined (Fig. 3).
High Concentration Vinegar Production by Acetic Acid Bacteria … 455
Ethanol is the feedstock to the vinegar product. Its concentration is the key factor to
the production process. If the ethanol concentration is not enough, the process can’t
reach a high productivity. Simultaneously, the vinegar acidity will be very low. On
the other extreme, the excessively high ethanol concentration will inhibit the AAB
activity even cause the AAB death. The effect of ethanol concentration to the AAB
(a) (b)
2.3% 2.3%
2.4%
1.2 2.4%
1.2 2.5% 2.5%
2.6%
2.6%
2.7%
1.0 1.0 2.7%
Dry cell weight g/L
Dry cell weight g/L
0.8 0.8
0.6 0.6
0.4 0.4
0.2 0.2
0.0 0.0
0 20 40 60 80 100 0 20 40 60 80 100
Time /h Time /h
Fig. 3 Growth curves in various amount of yeast extract a experiment data; b fitting curves of
biomass with Logistic equation
Cm g/L
0.94
0.92
0.90
3.5
2.8
2.1
1.4
0.7
0.0
0 20 40 60 80 100 120
Time /h
growth and the vinegar acidity were investigated. The corresponding results was
shown in Figs. 5 and 6.
Figure 5 shows that with 1.0% (v/v) ethanol concentration dry cell weight could
reach 4.16 g/L at 72 h. While in other conditions, the biomass are obviously lower.
So in starting-up stage, 1.0% (v/v) ethanol concentration was favorable to im-
prove the biomass.
Figure 6 shows that the total acid was increased with ethanol concentration
increasing from 3 to 5% in 72 h. The high acidity 45.71 g/L was obtained with 5%
ethanol and the yield could reach up to 88.76% in 72 h. Although the acid in 6 and
7% can also reached around 45 g/L in 96 h, but that means the productivity is
lower.
High Concentration Vinegar Production by Acetic Acid Bacteria … 457
40
20
10
0
0 24 48 72 96 120
Time /h
4 Conclusions
The carbon source and nitrogen source were optimized through fitting model
equations for the alcohol vinegar production. At the same time, the ethanol con-
centrations in starting-up stage and production of acid stage were also optimized.
With the optimized condition, the biomass can increased 4.34 fold, and the yield of
ethanol can reaches up to 88.76% in 5% ethanol concentration. This can provide
basic information for alcohol vinegar production.
Acknowledgements The present work was financed by the National Natural Science Foundation
of China (Grant no. 21376184), the Scientific Research Foundation for the Returned Overseas
Chinese Scholars (State Education Ministry), Foundation from Educational Commission of Hubei
Province of China (Grant no. D20121108) and the Innovative Team of Bioaugmentation and
Advanced Treatment on Metallurgical Industry Wastewater.
References
6. Mamlouk D, Gullo M (2013) Acetic acid bacteria: physiology and carbon sources oxidation.
Indian J Microbiol 53(4):377–384
7. Mas A, Torija M, Troncoso A et al (2014) Acetic acid bacteria and the production and quality
of wine vinegar. Sci World J 2:1–6
8. Mitsukura K, Uno T, Yoshida T (2007) Microbial asymmetric oxidation of 2-butyl-1,
3-propanediol. Appl Microbiol Biotechnol 76(1):61–65
9. Matsushita K, Kobayashi Y, Mizuguchi M et al (2008) A tightly bound quinone functions in
the ubiquinone reaction sites of quinoprotein alcohol dehydrogenase of an acetic acid
bacterium Gluconobacter suboxydans. Biosci Biotechnol Biochem 72(10):2723–2731
10. Natsaran S, Kazunobu M, Osao A et al (2015) Acetic acid bacteria: A group of bacteria with
versatile biotechnological applications. Biotechnol Adv 33:1260–1271
11. Qi Z, Yang H, Yu X (2013) A protocol for optimization vinegar fermentation according to the
ratio of oxygen consumption versus acid yield. J Food Eng 116:304–309
12. Sofia L, Efimia H, Maria P et al (2015) Beyond traditional balsamic vinegar: compositional
and sensorial characteristics of industrial balsamic vinegars and regulatory requirements.
J Food Compos Anal 43:175–184
13. Torija M, Mateo E, Vegas C (2009) Effect of wood type and thickness on acetification
kinetics in traditional vinegar production. Int J Wine Res 1(1):155–160
14. Toshiharu Y (2010) Alcohol dehydrogenase of acetic acid bacteria: structure, mode of action,
and applications in biotechnology. Appl Microbiol Biotechnol 86:1257–1265
15. Yang HL, Qi ZL, Xia XL et al (2011) An optimum medium designed and verified for alcohol
vinegar fermentation. Afr J Biotechnol 10(42):8421–8427
Optimization of Process for Optical
Resolution of DL-Pantolactone Using
Immobilized D-Lactonohydrolase
1 Introduction
2.1 Materials
Fusarium solani var. AS3.4489 was preserved in our lab. The weakly alkaline ion
exchange resin D-380 donated by Nankai University (Tianjin, China) was previ-
ously washed with distilled water and then activated with 1 mol/L hydrochloric
acid solution, with 1 mol/L sodium hydroxide solution and then washed again with
distilled water and 0.2 mol/L Tris-HCl buffer (pH 7.5). Standard of DL-panto-
lactone, D-lactonohydrolase and D-pantoic acid was purchased from Sigma
Company. The other reagents used were made in China and analytical grade.
Fusarium solani var. AS3.4489 was cultured in 500 mL flask containing 100 mL
medium (1% corn steep liquor, 2% glycerin, 1% Peptone and 1% Yeast extract, pH
6.7) at 30 °C for 64 h with 180 r/min. The mycelium was harvested by filtration.
100 g mycelium was washed two times using Tris-HCl buffer (0.2 mol/L, pH 7.5)
and was broken with high-pressure homogenizer, and then the supernatant was
collected by centrifugation. The rude D-lactonohydrolase solution was obtained by
ultra-filtration of the supernatant with ultrafiltration membrane of MWCO ≦ 2000
and MWCO ≧ 100000.
The reaction mixture of 2 mL in 0.2 mol/L Tris-HCl buffer (pH 7.5) comprising
20 mg (as weight of resin) immobilized enzyme and 500 mg DL-pantolactone was
incubated at 40 °C for 1 h with gentle shaking. After reaction, the D-pantoic acid
was quantified by HPLC. One unit of D-lactonohydrolade activity was defined as
the amount of enzyme to form 1.0 µmol pantoic acid under the above described
condition.
462 M. Xuan et al.
DL-pantolactone decreased with the temperature increase. It was also observed that
the change of immobilized D-lactonohydrolase activity with tempreture was con-
sistent with the change of hydrolysis rate of DL-pantolactone, and the change
between them was proportional, showing that tempreture influenced the hydrolysis
rate of DL-pantolactone by affecting the activity of the immobilized D-lactonohy-
drolase. Therefore, 40 °C was selected as the optimal temperature for hydrolysis
reaction of DL-pantolactone.
Because the pH of reaction system affected both the hydrolysis rate of DL-panto-
lactone and optical purity of product, we investigated the effect of pH on hydrolysis
of DL-pantolactone with the immobilized D-lactonohydrolase. The result was shown
in Fig. 3. At pH values between 5.0 and 7.5, the hydrolysis rate of DL- pantolactone
increased in proportion to the pH of the reaction system, and the maximum
DL-pantolactone hydrolysis activity was observed at pH 7.5. However, when pH
was higher than 7.0, optical purity of product began to decrease, the same as the the
report by Kataoka et al., which was not expected. According to the report by
Kataoka et al., it was the chemical hydrolysis of L-isomer that resulted in the
decrease of optical purity of product. So, the suitable pH for hydrolysis reaction was
at pH 7.0.
4 Conclusions
Acknowledgements This work was supported by the National Natural Science Foundation of
China (No. 21176190). We thank NanKai University for providing the resin D-380 kindly.
Optimization of Process for Optical Resolution … 467
References
1. Yu MR, Tan TW (2005) Optical resolution of racemic pantolactone by Fusarium sp. BU-011
with high lactonohydrolase activity. Process Biochem 40(8):2609–2614
2. Kataoka M, Shimizu K, Sakamoto K et al (1995) Optical resolution of racemic pantolactone
with a novel fungal enzyme, lactonohydrolase. Appl Microbiol Biotechnol 43:974–977
3. Sakamoto K, Yanada KH (1994) Process for the preparation of D-pantolactone. US 5275949
4. Kataoka M, Shimizu K, Sakamoto K (1995) Lactonohydrolase-catalyzed optical resolution of
pantoyl lactone: selection of a potent enzyme producer and optimization of culture and
reaction conditions for practical resolution. J Appl Microbiol Biotechnol 44:333–338
5. Tang YX, Sun ZH, Hua L (2002) Production of D-pantolactone hydrolase by Fusarium
moniliforme SW902. J Acta Microbiol Sin 42(1):81–87
6. Tang YX, Sun ZH, Hua L (2001) Optical resolution of racemic DL-pantolactone by a fungal
enzyme, D-lactonohydrolase. J Chin Ind Microbiol 31(3):1–5
7. Tang YX, Sun ZH, Hua L (2002) Kinetic resolution of DL-pantolactone by immobilized
Fusarium moniliforme SW-902. Process Biochem 38:545–549
8. Hua L, Sun ZH, Zheng P (2004) Biocatalytic resolution of dl -pantolactone by glutaraldehyde
cross-linked cells of Fusarium moniliforme CGMCC 0536. Enzym Microb Technol 35
(2):161–166
9. Hua L, Sun ZH, Leng Y (2005) Continuous biocatalytic resolution of DL-pantolactone by
cross-linked cells in a membrane bioreactor. Process Biochem 40:1137–1142
10. Li M, Zhang JZ, Song XY et al (2011) Effect of pH and temperature on activity of
immobilized lactonase. In: The 5th international conference on bioinformatics and biomedical
engineering (iCBBE 2011), Wuhan, China, 13–15 May 2011
11. Bucke C (1987) Cell immobilization in calcium alginate. Meth Enzymol 135:175–189
Enzymatic Synthesis of L-Cysteine
by Escherichia coli Whole-Cell Biocatalyst
Mingli Ma, Tao Liu, Heyun Wu, Fangqing Yan, Ning Chen
and Xixian Xie
1 Introduction
Escherichia coli BL21 and plasmid pET-his (Shenzhen Gene Power) were used as
host strain and expression vector. The plasmids pKD46, pKD3 and pCP20 used in
the k Red recombination [17, 18] system are stored in this laboratory. All other
chemicals were commercially available reagents of analytical grade.
Enzymatic Synthesis of L-Cysteine … 471
Recombinant strains were cultured and induced with IPTG for 12 h at 28 °C.
Expression of recombinant proteins was evaluated by 12% SDS-PAGE. The cul-
tivated cells were harvested by centrifugation at 6000 rpm and 4 °C for 5 min, and
washed two times with phosphate buffered saline (PBS). Then 1 g cells (wet cells)
were resuspended in 10 mL PBS buffer. The whole-cell solution was treated at
−80 °C for 12 h, and then thawed at 4 °C.
The reaction was performed in 100 ml PBS containing 30 g/L cells (wet cells) and
3.0% (w/v) DL-ATC in a 250 ml flask with shaking at 200 rpm. To determine the
whole-cell activity, the specific cell activity for L-cysteine synthesis was defined as
the amount (lmol) of L-cysteine conversion for 1 min at 37 °C per unit cell mass
(mg−1 wet cells) in the reaction mixture. For temperature optimization, the reaction
temperature was varied from 35 to 41 °C. For pH optimization, pH of the reaction
mixture was varied from 6.0 to 8.0. All measures were performed in triplicate and
error bars denote standard deviation of the mean.
Fig. 1, the recombinant L-ATC hydrolase and L-NCC amidohydrolase were cor-
rectly expressed as soluble proteins after IPTG induction. Assay of whole-cell
biocatalyst reaction was performed using DL-ATC as substrate. 13.1 mM of
L-cysteine was accumulated with BL21/pETatcBC as the whole-cell biocatalyst,
whereas only a small amount of L-cysteine (0.99 mM) was detected when using
BL21/pET as the whole-cell biocatalyst (Fig. 2). These results showed that
recombinant L-ATC hydrolase and L-NCC amidohydrolase could convert DL-ATC
to L-cysteine efficiently.
Although the cells doesn’t grow during the process of biocatalysis, L-cysteine
desulfhydrase (CD) existing in cells catalyzes the degradation of L-cysteine to
pyruvate, ammonia and sulfide [19, 20]. In E. coli, five proteins, encoded by metC,
malY, cysK, cysM and tnaA respectively, have the ability of degrading L-cysteine, of
which the tryptophanase/L-cysteine desulfhydrase encoded by tnaA was reported to
play a major role in L-cysteine degradation [21]. In order to reduce L-cysteine
degradation in the catalytic process, we knocked out the gene tnaA of E. coli BL21.
The cultivation results demonstrated that the deficiency in tnaA had no effect on cell
growth (data not shown). Compared with that of BL21/pETatcBC, the concentra-
tion of L-cysteine (18.8 mM) was increased by 54.4% by using BL21DtnaA/
pETatcBC as the whole-cell biocatalyst (Fig. 2). Since the activity of L-cysteine
desulfhydrase of BL21DtnaA had been significantly reduced, we didn’t attempt to
delete other four genes encoding L-cysteine desulfhydrase and the strain
BL21DtnaA/pETatcBC was thus used for subsequent optimization efforts to boost
L-cysteine production. Recombinant strain, BL21DtnaA/pETatcBC, was cultivated
25
22
17
474 M. Ma et al.
Fig. 2 Accumulation of
L-cysteine by different strains
Strains
Both pH and temperature could affect the efficiency of the whole-cell biocatalyst,
including reaction rate and cellular maintenance. In whole-cell biocatalyst system
for L-cysteine production, pH not only has an impact on enzymatic activities of
L-ATC hydrolase and L-NCC amidohydrolase, but also the extent of L-cysteine
Enzymatic Synthesis of L-Cysteine … 475
The time course production of L-cysteine from DL-ATC under the optimized con-
ditions determined in the previous sections was carried out by E.coliBL21DtnaA/
pETatcBC. After optimization, the production of L-cysteine reached the maximum
concentration (70.2 mM) at 8 h (Fig. 6), which was a 5.36-fold increase in the
yield. Chemosynthetic DL-ATC is an equimolar mixture of D-ATC and L-ATC, and
D-ATC cannot be catalyzed by L-ATC hydrolase. The molar conversion rate from
L-ATC to L-cysteine was 68.2%. AtcA encoded by atcA was reported to be an
L-ATC racemase that can catalyze D-ATC to L-ATC [26, 27]. Thus, L-ATC race-
mase could be introduced in the whole-cell biocatalyst to enhance the production of
L-cysteine and the substrate conversion rate in the further study.
Enzymatic Synthesis of L-Cysteine … 477
4 Conclusions
In this study, the bioconversion process from DL-ATC to L-cysteine was developed
by E. coli whole-cell biocatalyst, and the catalytic conditions were explored and
optimized. Heterologous expression of the L-ATC hydrolase and L-NCC amido-
hydrolase in E. coli enabled us to construct an efficient whole-cell biocatalyst, and
reduction of the activity of L-cysteine desulfhydrase in E. coli further increased the
accumulation of L-cysteine. Effects of various reaction conditions, including pH,
temperature and glycerol concentration on catalytic activities and L-cysteine pro-
duction were examined, and the optimal conditions were determined. Under the
optimized conditions, the production of L-cysteine reached up to 70.2 mM after 8 h
whole-cell catalysis. This study provides a new economical and environment-
friendly route for large-scale production of L-cysteine.
Acknowledgements This work was supported by Tianjin Science and Technology Support
Program (NO. 16YFZCSY00770).
References
1. Kuśmierek K, Bald E (2008) Reduced and total glutathione and cysteine profiles of citrus fruit
juices using liquid chromatography. Food Chem 106(1):340–344
2. Ismail NI, Hashim YZ, Jamal P et al (2014) Production of cysteine: approaches, challenges
and potential Solution. Inter J Biotechfor Wellness Ind 3:95–101
3. Duan J, Zhang Q, Zhao H et al (2012) Cloning, expression, characterization and application
of atcA, atcB and atcC from Pseudomonas sp. for the production of L-cysteine. Biotech Lett
34(6):1101–1106
4. Leuchtenberger W, Huthmacher K, Drauz K (2005) Biotechnological production of amino
acids and derivatives: current status and prospects. Appl Microbiol Biot 69(1):1–8
5. Chen N, Huang J, Feng ZB et al (2009) Optimization of fermentation conditions for the
biosynthesis of L-threonine by Escherichia coli. Appl Biochem Biotechnol 158(3):595–604
6. Park JH, Jang YS, Lee JW et al (2011) Escherichia coli W as a new platform strain for the
enhanced production of L-valine by systems metabolic engineering. Biotechnol Bioeng
108(5):1140–1147
7. Grant GA, Hu Z, Xu XL (2001) Specific interactions at the regulatory domain-substrate
binding domain interface influence the cooperativity of inhibition and effector binding in
Escherichia coli D-3-phosphoglycerate dehydrogenase. J Biol Chem 276(2):1078–1083
8. Nakatani T, Ohtsu I, Nonaka G et al (2012) Enhancement of thioredoxin/
glutaredoxin-mediated L-cysteine synthesis from S-sulfocysteine increases L-cysteine pro-
duction in Escherichia coli. Microb Cell Fact 11(1):62
9. Park S, Imlay JA (2003) High levels of intracellular cysteine promote oxidative DNA damage
by driving the fenton reaction. J Bacteriol 185(6):1942–1950
10. Sørensen MA, Pedersen S (1991) Cysteine, even in low concentrations, induces transient
amino acid starvation in Escherichia coli. J Bacteriol 173(16):5244–5246
11. Sand K, Eguchi C, Yasuda N et al (1979) Metabolic pathway of L-cysteine formation from
2
DL-2-amino-D -thiazoline-4-carboxylic acid by Pseudomonas. J Gen Appl Microbiol 43(11):
2373–2374
478 M. Ma et al.
12. Yu Y, Liu Z, Liu C et al (2006) Cloning, expression, and identification of genes involved in
the conversion of DL-2-Amino-D2-thiazoline-4-carboxylic acid to L-cysteine via S-Carbamyl-
L-cysteine pathway in Pseudomonas sp. TS1138. Biosci Biotechnol Biochem 70(9):2262–
2267
13. Tamura Y, Ohmachi T, Asada Y (2001) Induction of 2-amino-D2-thiazoline-4-carboxylic acid
hydrolase and N-carbamoyl-L-cysteine amidohydrolase by S-compounds in Pseudomonas
putida AJ3865. J Gen Appl Microbiol 47(4):193–200
14. Tamura Y, Nishino M, Ohmachi T et al (1998) N-carbamoyl-L-cysteine as an intermediate in
the bioconversion from DL-2-Amino-D2-thiazoline-4-carboxylic acid to L-cysteine by
Pseudomonas sp. ON-4a. Biosci Biotechnol Biochem 62(11):2226–2229
15. Huai L, Chen N, Yang W et al (2009) Metabolic control analysis of L-cysteine producing
strain TS1138 of Pseudomonas sp. Biochemistry (Mosc) 74(3):288–292
16. Youn SH, Park HW. Shin CS (2012) Enhanced dissolution of the substrate DL-2-amino-D2-
thiazoline-4-carboxylic acid and enzymatic production of L-cysteine at high concentrations.
Eng Life Sci. 12:514–517
17. Gu X, Li C, Cai Y, Dong H et al (2013) Construction of lactococcus lactis thyA-null using the
Red recombination system. Ann Microbiol 63(3):951–956
18. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia
coli K-12 using PCR products. Proc Natl Acad Sci U S A 97(12):6640–6645
19. Awano N, Wada M, Kohdoh T et al (2003) Effect of cysteine desulfhydrase gene disruption
on L-cysteine overproduction in Escherichia coli. Appl Microbiol Biotechnol 62(2):239–243
20. Dwivedi CM, Ragin RC, Uren JR (1982) Cloning, purification, and characterization of
beta-cystathionase from Escherichia coli. Biochemistry 21(13):3064–3069
21. Awano N, Wada M, Mori H et al (2005) Identification and functional analysis of Escherichia
coli cysteine desulfhydrases. Appl Environ Microbiol 71(7):4149–4152
22. Read JF, Bewick S, Graves CR et al (2000) The kinetics and mechanism of the oxidation of
s-methyl-L-cysteine, L-cystine and L-cysteine by potassium ferrate. Inorg Chim Acta 303(2):
244–255
23. Sano K, Mitsugi K (1978) Enzymatic production of L-cysteine from DL-2-amino-D2-
thiazoline-4-carboxylic acid by Pseudomonas thiazolinophilum: optimal conditions for the
enzyme formation and enzymatic reaction. Agric Biol Chem 42(12):2315–2321
24. Youn SH, Park HW, Choe D et al (2014) Preparation of eutectic substrate mixtures for
enzymatic conversion of ATC to L-cysteine at high concentration levels. Bioprocess Biosyst
Eng 37(6):1193–1200
25. Kumar A, Pawar SS (2012) High viscosity of ionic liquids causes rate retardation of
Diels-Alder reactions. Sci China Chem 55(8):1633–1637
26. Wang P, He JY, Yin JF (2015) Enhanced biocatalytic production of L-cysteine by
Pseudomonas sp. B-3 with in situ product removal using ion-exchange resin. Bioprocess
Biosyst Eng 38(3):421–428
27. Wada M, Takagi H (2006) Metabolic pathways and biotechnological production of
L-cysteine. Appl Microbiol Biotechnol 73(1):48–54
Analysis on Acid, Bile, and Heat Tolerance
of Probiotics Strains in Maca-Probiotics
Granule
1 Introduction
Probiotics have been defined as “a live microbial food supplement which affects the
host beneficially by improving the intestinal microbial balance” [1, 2]. As sum-
marized in the World Health Organization (WHO) and Joint Food and Agriculture
Organization (FAO), probiotics were defined as live microorganisms, providing a
health benefit to the host, when consumed in a sufficient quantity as a part of food
[3]. As “living micro-organisms”, probiotics exert health affects beyond inherent
basic nutrition after ingesting in certain numbers [4]. To provide health benefit, the
suggested concentration of probiotics strains is 106 CFU/g [5]. A growing number
of evidences have been shown that probiotics were associated with numerous health
benefits, such as reduction of lactose intolerance [6], inhibition of pathogenic
organisms [7, 8], decrease of blood glucose levels [9], anti-inflammation [10],
increasing immune response [11], inhibition of cancer [12, 13], etc. To provide
health benefits, probiotics must overcome chemical barriers, especially acidity and
bile salt, in the gastrointestinal tract. In addition, probiotics in the commercial
products should also have enough heat tolerance ability to ensure the survival
during the long-time storage.
Lepidium meyenii walp, known as maca, grows over 4000 m altitude in the
central Peruvian Andes. Proved by scientific research, maca has antioxidant
properties in vitro and in vivo [14, 15], and can improve sperm production [16],
Y.-X. Jiang Q.-Q. Dong T.-C. Zhang Y.-J. Song Z.-Y. Li X.-G. Luo (&)
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education
and Tianjin City, College of Biotechnology, Tianjin University of Science
and Technology, Tianjin 300457, China
e-mail: [email protected]
J.-P. Qu
Aladdin Biotechnology Limited Company, Suzhou, China
sexual performance parameters [17, 18], memory ability [19] and fatigue resistance
[20]. Maca products have become one of the best-selling health food in the world.
In order to combine the functions of maca and probiotics, a compound granule
consisted of maca and five probiotics, Bifidobacterium, Lactobacillus plantarum,
Lactobacillus rhamnosus, Lactobacillus acidophilus and Bifidobacterium longum,
was prepared in our previous study. However, whether the probiotics in the com-
posite particles could survive in the long-term storage or after oral administration
has not been researched. To address this problem, we analyzed the acid resistance,
bile salt tolerance and heat tolerance of five probiotics strains in the compound
granule, and provided the theoretical guidance for the storage and reasonable
application of this healthy product.
2.1 Materials
The total lactobacillus in the maca-probiotics compound granule were firstly acti-
vated in MRS broth 5 mL (1%) and then the medium were adjusted to pH 4.0, 3.5,
3.0, 2.5 and 2.0 with 5 N HCl and incubated at 32 °C for 4 h. The initial bacterial
concentration was 2.2 106 CFU. Strains were calculated by pour plate counts
using 10-fold serial dilutions with MRS, and incubated at 32 °C for 48 h. Acid
tolerance was determined by comparing the final plate counts after 4 h with the
initial plate counts at 0 h [22]. The experiment and analysis were carried out in
triplicate.
The lactobacillus was grown in MRS broth 5 mL (1%) which was adjusted to pH
3.0. The viable number of strains were calculated by pour plate counts using
100-fold serial dilutions with MRS (pH 3.0) per hour for 1, 2, 3, 4 h and incubated
Analysis on Acid, Bile, and Heat Tolerance of Probiotics … 481
The total lactobacillus in the maca-probiotics compound granule was firstly acti-
vated in MRS broth 5 mL (1%) and then the cultures were treated by pig bile salt of
0.05, 0.1, 0.2, 0.3% (w/v) and cultivated at 32 °C for 2 h. Probiotics were enu-
merated by pour plate counts using 20-fold serial dilutions with MRS (bile salt of
0.05, 0.1, 0.2, 0.3%) incubated at 32 °C for 48 h.
The lactobacillus was grown in MRS broth 5 mL (1%) which containing bile salt of
0.3%. Samples were taken at 0.5, 1, 1.5, 2 h and the viable number of strains were
calculated by pour plate counts using 100-fold serial dilutions with MRS (bile salt
of 0.3%) and incubated at 32 °C for 48 h. Bile salts tolerance was determined by
comparing the final plate counts after different hours (0.5, 1, 1.5, 2 h) with the
initial plate counts at 0 h.
Total lactobacillus was cultured at 37, 42, 47, 52 °C for 10 min. Strains were
enumerated by pour plate counts using 20-fold serial dilutions with MRS (pH 7.4)
incubated at 32 °C for 48 h.
3 Results
Stomach has the highest acidity (pH 1–4) in the gastrointestinal tract [23]. In order
to exhibit the beneficial functions, the probiotics must be able to survive under such
rigorous conditions.
482 Y.-X. Jiang et al.
Bile salt in the intestinal tract is an important factor to kill probiotics and other
microorganisms. The physiological concentration of human bile is different in
1.4
maca-probiotics granule in
1.2
different time at pH 3.0
1
0.8
0.6
0.4
0.2
0
1 2 3 4
Culture time (h)
Analysis on Acid, Bile, and Heat Tolerance of Probiotics … 483
40
20
0
0.05 0.1 0.2 0.3
Bile salt (%)
maca-probiotics granule at 15
different time in 0.3% bile salt
10
0
0.5 1 1.5 2
Culture time (h)
different regions of the human body and usually below 0.3%. Therefore, resistance
to bile acid of such concentration is an important characteristic that enables pro-
biotics to survive in the small intestine.
The result described in Fig. 3 demonstrated that the probiotics strains in the
maca-probiotics granule could be viable in 0.05, 0.1, 0.2, 0.3% bile salts for 2 h,
but the survivors would be less than 20% when the concentration of bile salts was
over 0.1%.
As shown in the Fig. 4, it is apparently that the probiotics strains in the
maca-probiotics granule could survive at 0.3% bile salt during 3 h. They decreased
sharply in the first 0.5 h, but then recovered lately, indicating that these probiotics
strains had ability to adapt to the damage of bile salts.
below 47 °C, whereas the number of probiotics decreased with the increase of
temperature. The decline in the number of viable bacteria will be significantly
accelerated when the temperature exceed 47 °C. These results implied that this
product should be taken with water below 47 °C.
4 Conclusion
To combine the efficacy of probiotics and Maca together, the compound granule
was prepared with maca and five types of probiotics such as Bifidobacterium,
Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus acidophilus and
Bifidobacterium longum. The present study further confirmed that the probiotics
strains in the maca-probiotics compound granule still have acceptable ability of acid
resistance, bile salt tolerance and heat tolerance. Therefore, this healthy product
could exhibite expected functions after oral administration. In addition, in order to
obtain the best application effect, the product should be storage at low temperature
and be taken after meals with water below 47 °C.
Acknowledgements This work was supported by the 863 (Hi-tech research and development
program of China) program under contract NO. 2012AA022108, Tianjin Research Program of
Application Foundation and Advanced Technology (14JCZDJC33200) and the Laboratory Open
Foundation of Tianjin University of Science and Technology (1504A303).
References
1. Chou LS, Weimer B (1999) Isolation and characterization of acid- and bile-tolerant isolates
from strains of Lactobacillus acidopHilus. J Dairy Sci 82:23–31
2. Fuller R (1989) A review: probiotics in man and animals. J Appl Bacteriol 66:365–378
3. Servin AL, Coconnier MH (2003) Adhesion of probiotic strains to the intestinal mucosa and
interaction with pathogens. Best Pract Res Clin Gastroenterol 17:741–754
Analysis on Acid, Bile, and Heat Tolerance of Probiotics … 485
Hongbo Wei, Tuo Shi, Lihong Du, Qixin Chen, Yuechao Ma,
Quanwei Zhang, Qian Ma and Ning Chen
1 Introduction
The leucine-producing strain used throughout this study was C. glutamicum CP,
which was stored at the Culture Collection of Tianjin University of Science and
Technology. The slope medium contained: yeast extract 5 g/L, tryptone 10 g/L,
beef extract 10 g/L, NaCl 2.5 g/L, MgSO4 0.5 g/L, KH2PO4 1 g/L, agar 20 g/L.
The seed medium contained: glucose 40 g/L, corn steep liquor 20 mL/L, KH2PO4
2 g/L, MgSO47H2O 2 g/L, MnSO4 2.5 mg/L, FeSO4 5 mg/L, vitamin B1 0.2 mg/
L, vitamin H 0.5 mg/L. The fermentation medium contained: glucose 50 g/L, corn
steep liquor 20 mL/L, soybean protein hydrolysate 20 mL/L, MgSO4 2 g/L,
MnSO4 30 mg/L, K2HPO4 3 g/L, FeSO4 30 mg/L, vitamin H 0.3 mg/L, vitamin B1
0.3 mg/L. The pH of each medium was adjusted to 7.0–7.2 with 4 mol/L NaOH.
C. glutamicum CP was first cultured on the slope medium, and then cultured in
100 mL seed medium in a 1000 mL baffled flask at 32 °C and 200 rpm for 14 h.
An inoculum of 300 mL seed culture was transferred to a 5 L fermentor (New
Brunswick controller, BioFlo®/CellGen®115, Germany) containing 2.7 L fermen-
tation medium, and was cultivated at 32 °C for 32 h. The dissolved oxygen (DO)
level was controlled by adjusting the aeration rates, tank pressure and stirring speed.
The DO was maintained at 20% during the growing stage, and 10% during the acid
producing stage. The pH was adjusted to 7.0 with 25% (v/v) ammonia during the
overall cultivation process.
During the fermentation process, samples were collected every half hour from the
beginning of the fermentation. 189 samples obtained from three batches were
Near-Infrared Spectroscopy for the Monitoring of Leucine … 489
centrifugated at 13,000 rpm for 2 min. Collect the supernatants to determine the
concentrations of leucine using high performance liquid chromatography analysis
system.
The near infrared spectra of the fermentation samples were obtained by a NIR
analyzer Tensor 37 spectrophotometer (Bruker Optics, Ettlingen, Germany) with a
2 mm cuvette, which was filled with 1 mL fermentation broth. The scanning was
from 833 to 2500 nm at 25 °C. Air was used as the reference, and one measurement
was the accumulation of 32 scans. The near infrared spectra obtained were first
pretreated by the first derivative, second derivative, standard normal variate, or
fourier transform etc., and then further processed to establish a near infrared cali-
bration model by the Partial Least Squares (PLS) regression method.
The NIR spectra of 189 samples from 3 batches of fermentation were scanned by
Tensor 37, and the raw NIR spectra were shown in Fig. 1. NIR peaks appeared at
5500–6200, 7000–9000 and 9500–11,000 cm−1. From the figure, it could be seen
that the NIR peaks at 5500–6200 cm−1 were unstable, and the absorbency at
9500–11,000 cm−1 was quite low, while, the NIR peaks at 7000– 9000 cm−1 were
significant and stable. Thus, we chose this NIR spectra range for further modelling.
The 189 samples were divided into two groups, the calibration set and the vali-
dation set (Table 1). The concentration range of leucine in the calibration set was
0.38–31.83 g/L, and that for the validation set was 0.47–30.79 g/L. The concen-
tration range of leucine in the validation set was in the range of the calibration set,
and the standard deviations of the two sets were close, thus, these two sets were
suitable for further NIRS modelling.
Different spectral pretreatment methods were tested for the PLS calibration
modelling of leucine concentration using the software OPUS 7.0 (Bruker Optics).
The results of these pretreatments were shown in Table 2. The root-mean square
error of calibration and validation (RMSECV) value was used for the performance
evaluation of the PLS model. As the R2 with all these pretreatment methods were
pretty low (<0.8), the three pretreatment methods with lower RMSECV, namely
model 1, 2, and 4, were selected for further optimization.
The three pretreatment methods: no spectral data preprocessing, straight line
substraction and min-max normalization were further optimized using OPUS 7.0.
Table 2 Optimal model of leucine concentration under different spectral pretreatment methods
Model Pretreatment methods Range/cm−1 RMSECV RPD R2
number (g/L)
1 No spectral data preprocessing 7000–10,000 6.79 1.53 0.7559
2 Straight line subtraction 7000–10,000 6.94 1.49 0.7435
3 Vector normalization(SNV) 7000–10,000 7.94 1.3 0.6378
4 Min-Max normalization 7000–10,000 6.85 1.5 0.7479
5 First derivative 7000–10,000 7.55 1.36 0.6985
6 Second derivative 7000–10,000 8.51 1.21 0.5677
7 First derivative + Straight line subtraction 7000–10,000 7.05 1.46 0.7402
8 First derivative + SNV 7000–10,000 8.47 1.22 0.5724
9 First derivative + MSC 7000–10,000 8.43 1.22 0.577
Near-Infrared Spectroscopy for the Monitoring of Leucine … 491
The optimal models were shown in Table 3. The straight line substraction method
had the lowest RMSECV (1.34 g/L) and the highest R2 (0.9905), and was thus
chosen as the optimal pretreatment method. After pretreatment, the parameters of
the calibration model for the correction of leucine concentration were illustrated in
Table 4. The NIR peak range was 9403.4 * 7489.1 cm−1, root-mean square error
of prediction (RMSEP) was 2.31, with a 0.9782 R2. The NIR spectra before and
after pretreatment were compared in Fig. 2, which suggested that the pretreatment
could reduce quite a number of backgrounds and noises. The relationships between
the experimental values and the predictive values of leucine concentration in cal-
ibration set and validation set during the fermentation of C. glutamicum were
shown in Fig. 3. This figure indicated that there was a good linear relationship
between the experimental value and the predictive value, in other words, the model
had good predictive capacity.
good predictive ability, and could be used for the leucine concentration determi-
nation during fermentation.
4 Conclusion
In this study, near-infrared spectroscopy was used to monitor the leucine concen-
tration in the fermentation of C. glutamicum CP. A PLS model for the prediction of
leucine concentration was established, and the results showed that the method could
predict and monitor the leucine concentration during the fermentation process
accurately. The on-line monitoring of substrate and product concentrations could be
conveniently conducted by NIRS, based on which prompt control strategies could
be implemented. In summary, NIRS is quite a helpful tool for the monitoring and
controlling of in-process parameters in industry.
Near-Infrared Spectroscopy for the Monitoring of Leucine … 493
Acknowledgements The authors are very grateful for the financial support from the Foundation
(No.2016IM104) of Key Laboratory of Industrial Fermentation Microbiology of Ministry of
Education and Tianjin Key Lab of Industrial Microbiology (Tianjin University of Science &
Technology), and the Foundation for Young Teachers of Tianjin University of Science and
Technology (Grant No.2016LG11).
494 H. Wei et al.
References
Ning Xue, Zhixiang Li, Junjie Zhan, Jie Ma, Qingyang Xu,
Chenglin Zhang and Ning Chen
1 Introduction
YILW-C. The design principles described in this study would be useful to construct
strains for producing other similar biological products.
Strains, plasmids and primers used in this work were listed in Tables 1 and 2.
C. glutamicum cells was inoculated from seed culture (glucose 30 g/L, yeast
extract 5 g/L, (NH4)2SO4 3 g/L, KH2PO43H2O 1.5 g/L, MgSO47H2O 0.6 g/L,
FeSO47H2O 0.01 g/L, MnSO4H2O 0.01 g/L, corn steep liquor 30 mL/L, soybean
hydrolysate 30 mL/L.) and cultured to exponential growth period (for quantitative
RT-PCR and intracellular metabolites detection) or to 48 h (for isoleucine fer-
mentation) in 27 mL fermentation medium (glucose 80 g/L, (NH4)2SO4 4 g/L,
FeSO47H2O 0.015 g/L, MgSO47H2O 0.5 g/L, MnSO4H2O 0.015 g/L,
KH2PO43H2O 1.5 g/L, K2HPO43H2O 3 g/L, biotin 100 lg/L, vitamin B1 5 mg/L,
soybean hydrolysate 20 ml/L, and corn syrup 15 mL/L) in 500-mL shake flasks
with 10% (v/v) inoculum size at 35 °C with 200 rpm [9].
Total RNA was isolated from C. glutamicum cells and transcription level of
selected genes was measured by quantitative RT-PCR according to the manufac-
turer instructions of One Step SYBR® PrimeScript™ RT-PCR Kit(Takara, Japan).
498
Table 2 Primers
Primersa Sequence (5′-3′) Description
IlvA-1 TCTAGACTGCAGTACCGCAAAAGGAAT (Xba I) Amplifying upstream fragment of ilvA promoter
IlvA -2 TTTCCTTCGGATCTAAACGATCTCAATACTGTGGTTGTGGCACTACA
IlvA -3 ACCACGAAGTCCAGGAGGACATACAATGAGTGAAACATACGTGTCTGAGAA Amplifying downstream fragment of ilvA promoter
IlvA -4 GGATCCGGCTCGATCAGCGTTGC (BamH I)
IlvA -5 AGATCGTTTAGATCCGAAGGAAA Amplifying promoter of tuf gene
IlvA -6 TGTATGTCCTCCTGGACTTCGTGGT
IlvB-1 AAGCTTCCGGCGAACGCGAGCTG (Hind III) Amplifying upstream fragment of ilvBNC promoter
IlvB-2 TTTCCTTCGGATCTAAACGATCTTCTGTTGCAAAGTTGGCTACTTG
IlvB-3 ACCACGAAGTCCAGGAGGACATACAGTAAAGGAGCCAGAAAGTCGTGAATGTG Amplifying downstream fragment of ilvN promoter
IlvB-4 GGATCCTTAGATCTTGGCCGGAGCCATG (BamH I)
Brn-1 AAGCTTTTTCATAGCAAAACGTGATGAGATC (Hind III) Amplifying upstream fragment of brnEF promoter
Brn-2 CACGAATTATGCAGTGATTTACGAACTACAATCATCACACAATTGCCG
Brn-3 TTTCACACAGGAAACAGAATTAATTCGTGTGTGCAAAAAACGCAAGAGATTC Amplifying downstream fragment of brnEF
Brn-4 GGATCCCCGCCGAATACCCAGTAGG (BamH I) promoter
Brn-5 TCGTAAATCACTGCATAATTCGTG Amplifying tac promoter
Brn-6 ACACGAATTAATTCTGTTTCCTGTGTGAAA
RT-7F TCAGGGACGCATCTATGTTCCTGTGCAGAC RT-PCR for ilvA
RT-7R GCTTCGTCGAAGTTATTGCCAGTGACCACC
RT-8F CCCCATTAAGATCGCACTAATCAACAACGGAAA RT-PCR for ilvB
RT-8R CCTCAGAAAGGGTAACAAAGTCGGGCATGTACT
16S-F GTGGTTTGTCGCGTCGTCTGT Internal reference for RT-qPCR
16S-R TGCCTTCGCCATTGGTGTTC
a
Recognition sites are underlined and restriction enzymes are shown in parentheses
N. Xue et al.
Modification of Corynebacterium glutamicum YILW … 499
Data were analyzed using the 2−DDCT method(16S rDNA was used as internal
control) [10].
Fragment, in which the promoter of tuf gene [11] was flanked by regions upstream
and downstream the native promoter of ilvA was generated in two rounds of overlap
PCR using primers indicated in Table 2 (Fig. 2). Fragment containing regions
upstream and downstream of the native promoter of ilvBNC or brnEF operon as well
as tuf or tac promoter [12] was obtained by the same way. And then the fragments
were inserted into pK18mobsacB after digesting with respective enzyme, using
E. coli DH5aMCR as host. The plasmids were designated pK18mobsacBPtuf-A,
pK18mobsacBPtuf-BN and pK18mobsacBPtac, respectively (Fig. 2).
The plasmid pK18mobsacBPtuf-A was electroporated into C. glutamicum YILW
where Ptuf replaced the native promoter of ilvA was constructed by two-step double
homologous as reported (Fig. 2) [13, 14]. Strain YILW-B where tuf promoter
replaced the native promoter in YILW-A was constructed with the same method
using pK18mobsacBPtuf-BN. Finally, pK18mobsacBPtac was introduced into
YILW-B in the same way, resulting YILW-C.
Fig. 2 Construction of
YILW-A
500 N. Xue et al.
Cell growth was detected by measuring OD600 and was converted to the corre-
sponding cell dry weight (DCW (g/L) = 0.24 OD600 − 0.01). Glucose concen-
tration was determined by an SBA biosensor analyzer (Institute of Biology of
Shandong Province Academy of Sciences, Shandong, China). Amino acids and
intracellular metabolite were analyzed by high-performance liquid chromatography
(HPLC).
4 Conclusion
Acknowledgements This work was supported by National High Technology Research and
Development Program 2013AA102106), by the National Natural Science Foundation of China
(31300069); Tianjin Municipal Science and Technology Commission (grant No. 15JCTPJC62800);
Tianjin Undergraduate Training Program for Innovation and Entrepreneurship (201510057063).
Innovation training program for college students in Tianjin (201710057039).
References
1 Introduction
D. Yuan Y. Dong
Jinjin Pharmaceutical Co., Ltd, Tianjin, China
Y. Shen Q. Zhao M. Wang (&)
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education,
College of Biotechnology, Tianjin University of Science and Technology,
Tianjin 300457, People’s Republic of China
e-mail: [email protected]
principle of split the subject and object by using organic solvent competitive replace
for the recovery of hydrocortisone from the fermentation liquor to avoid the
above-mentioned drawbacks [6].
2.1 Reagents
The fermentation liquor of hydrocortisone was obtained from Tianjin Key Lab of
Industrial Microbiology, Tianjin University of Science and Technology. The major
composition of the fermentation liquor is shown in Table 1. HP-b-CD (Mw: 1522,
average degree of substitution: 6.5) were obtained from Wacker Biochem.
Corp. (Munich, Germany). All chemical solvents and salts used were of analytical
grade or higher.
The contact between aqueous and organic phases was carried out in closed tubes
with a maximum capacity of 50 mL, at 25 °C. The experimental procedure
involved measuring and adding to the tubes the proper volume of each phase
according to the selected volume ratios A/O = 1:1. The tubes were shaken in an
orbital stirrer at 170 r min−1 for 5 min. At the end of the contact time, the phases
were separated by centrifugation at 5000 r min−1 for 10 min. Final volumes were
measured and the aqueous phase or the organic phase was sampled for analysis. All
experiments were conducted on a replicate basis.
For analysis of the influence of the manipulate condition on the extraction
equilibrium, the extraction of hydrocortisone in a butyl acetate/water system.
A batch stagewise test was used to simulate the continuous countercurrent process.
Before the test, a simulation calculation of the separation process was conducted to
determine the optimum flow ratio and equilibrium stage number based on the data
obtained in the distribution equilibrium test for the hydrocortisone in fermentation
liquor/water system. The optimum results were then evaluated by the batch
stagewise test. Each test tube simulated a shakeout unit in the stagewise phase
equilibrium.
The hydrocortisone contents of the aqueous phase and the organic phase in each
phase were determined using HPLC with an ODS Hypersil-C18 reversed phase
column using the following conditions: mobile phase water/methanol (20:80 v/v),
flow rate 0.8 mL min−1, a UV detector set at 254 nm. The HP-b-CD was deter-
mined using HPLC analysis was performed using refractive index detection and a
Mark-NH2 column (250 4.6 mm) with mobile phase water/acetonitrile (40:60
v/v) as the mobile phase.
The temperature and pH are two important parameters for extraction process.
The results showed that the distribution ratio of hydrocortisone increased with
increasing temperature and pH, but the separation factor and the extraction effi-
ciency were almost unchanged (data not shown). The multi-level of the extraction
process implied that volumetric ratios of organic phase and water phase are the
same important as temperature’s effect on the phase equilibrium. And the flow ratio
of extraction process is according to the technics requirement and selected operation
condition. Obviously, the greater flow rate and the amount of organic phase, the less
theoretical stages of extraction theory series was performed under the other oper-
ation condition.
The addition of some ammonium sulfate into the aqueous phase significantly
increased the distribution ratio, seen in Table 2. In general, the salting–out effect
resulted from the reduced water activity due to the salt addition. In addition, the
strong electrolyte reduced the extractant solubility in the aqueous phase, which
decreased solvent losses. But the salt is difficult to recover and reuse, thus com-
mercial application of the salting-out effect would be limited.
Table 2 The effect of ammonium sulfate on the distribution and extraction in a butyl
acetate/water system with 12 mM HP-b-CD. (pH = 7, T = 25 °C)
Ammonium sulfate Distribution ratio of Separation Extraction ratio of
content in water (wt%) hydrocortisone factor hydrocortisone
0 2.620 ± 0.018 2.361 ± 0.024 0.721 ± 0.010
5 2.693 ± 0.026 2.383 ± 0.019 0.732 ± 0.006
8 2.738 ± 0.035 2.335 ± 0.022 0.733 ± 0.008
10 3.172 ± 0.040 2.430 ± 0.031 0.760 ± 0.011
Liquid-Liquid Extraction of Hydrocortisone … 509
Effect of mixing time on the hydrocortisone concentration in the organic phase and
the aqueous phase were presented in Table 3. It was shown that when the mixing
time was more than 3 min, the hydrocortisone concentration in the organic and
aqueous phase does not change with the mixing time, and the extraction process
reached an equilibrium. Distribution of hydrocortisone in butyl acetate/fermentation
liquor systems at 25 °C was showed in Fig. 3. The apparent distribution equilib-
rium can be described by Eq. (1).
The Janecke diagram mode shows that the extraction of hydrocortisone from the
fermentation liquor was a continuous multistage countercurrent extraction process
with 6 stages. A over 18-row transfer process was needed for a flow ratio of 1 to
extraction efficiency over 98%.
Table 3 Variation of the hydrocortisone concentration in the organic phase and the aqueous
phase with the mixing time (25 °C)
Mix time 1 3 5 7 9
(min)
Concentration 0.725 ± 0.006 0.738 ± 0.012 0.736 ± 0.020 0.740 ± 0.009 0.739 ± 0.018
in the organic
phase (g/L)
Concentration 0.182 ± 0.004 0.176 ± 0.002 0.174 ± 0.005 0.176 ± 0.005 0.175 ± 0.002
in the aqueous
phase (g/L)
Fig. 3 Distribution of
hydrocortisone in butyl
acetate/fermentation liquor
systems at 25 °C
510 D. Yuan et al.
The concentration profiles in the extraction process are plotted in Fig. 4. After
the 24-row transfer for 6 stages and O/A 1, with an initial concentration of
1.179 g/L, the determined concentration profiles were in good agreement with the
data predicted by Eq. (1). Xien Hu et al. had studied the extraction of steroid
by-products in the fermentation liquor. The recovery of hydrocortisone and
epi-hydrocortisone through the extraction process was 95% with a flow ratio of 1.1
and 6 stages [8]. By contrast, the extraction efficiency of hydrocortisone through the
continuous multistage countercurrent extraction process was 98.80% with a flow
ratio of 1 and 6 stages in our research (Table 4).
4 Conclusions
distribution was also affected by the ammonium sulfide content, the greater flow
rate and the amount of organic phase, the less theoretical stages of extraction theory
series was performed under the other operation condition. When the hydrocortisone
was extracted from the fermentation liquor with the butylacetate, the distribution
ratio reduced with the increasing of high concentration of the hydrocortisone. The
recovery of hydrocortisone and epi-hydrocortisone through the extraction process
was 98.8% with a flow ratio of 1 and 6 stages.
Acknowledgements The current work was supported by the National Natural Science
Foundation of China (21276196, 21406167) and Tianjin Programs for Science and Technology
Development (15ZCZDSY00510).
References
1. Arun RA, Kumar ACK, Sravanthi VVNSS (2008) Cyclodextrins as drug carrier molecule: a
review. Sci Pharm 76:567–598
2. Ma B, Shen Y, Fan Z et al (2011) Characterization of the inclusion complex of
16,17a-epoxyprogesterone with randomly methylated b-cyclodextrin in aqueous solution and
in the solidstate. J Incl Phenom Macrocycl Chem 69:273–280
3. Donova MV, Nikolayeva VM, Dovbnya DV et al (2007) Methyl-b-cyclodextrin alters growth,
activity and cell envelope features of sterol-transforming mycobacteria. Microbiology
153:1981–1992
4. Hapiot F, Ponchel A, Tilloy S et al (2011) Cyclodextrins and their applications in
aqueous-phase metal-catalyzed reactions. ChemInform 14:149–166
5. Zhou J, Duan W, Zhou X et al (2010) Extraction of hydrocortisone from the fermentation
liquor with annular centrifugal contactors. Sep Sci Technol 41(3):573–581
6. Loftsson T, Hreinsdóttir D (2007) The complexation efficiency. J Incl Phenom Macrocycl
Chem 57(1):545–552
7. Mazzola PG, Lopes AM, Hasmann FA et al (2008) Liquid-liquid extraction of biomolecules:
an overview and update of the main techniques. J Chem Technol Biotechnol 83:143–157
8. Hu X, Tang Z, Zhu Y (2001) Separation of hydrocortisone and its steroisomer from
fermentation liquor by chloroform extraction process. Sep Sci Technol 36(7):1421–1435
9. Shen Y, Ma B, Zheng Y et al (2010) The mechanism of b-cyclodextrin on the
11b-hydroxylation biotransformation of steroid. In: Proceedings of the 2010 3rd international
conference on biomedical engineering and informatics (BMEI 2010), vol 5, pp 1964–1967
Conversion of Food Waste and Feldspar
into Biofertilizer Using a Stress-Tolerant
Keldspar-Solubilizing Bacillus Subtilis
Xue-113168
Abbreviations
CMF Compound Microbial Fertilizer
PGPR Plant growth-promoting rhizosphere
SSF Solid-state fermentation
SMF Submerged fermentation
SMS spent mushroom substrate
KSM Potassium dissolving microorganism
LiCl Lithium chloride
KCl Kalium chloratum
1 Introduction
With the exhaustion of non-renewable resources like coal and peat, the advancing
of technology also prompt the development of new sustainable sources of humic
products (e.g. organic wastes) [1]. Biofertilizer without chemical fertilizer has a
slow effect on crops, Compound Microbial Fertilizer (CMF) with stress-tolerant
microorganisms combine the advantages of both biofertilizer and chemical
fertilizer.
Microbial fertilizers promote biological fertility of soil, maintain and slow the
release of chemical fertilizer, reduce the amount of nitrate nitrogen, heavy metals,
and pesticides in crops, and reduce the occurrence of crop diseases [2].
Biofertilizers could mitigate crisis, e.g., the energy crisis, scarcity of resources, and
environmental pollution [3]. Plant growth-promoting rhizosphere (PGPR) raises the
resistance to pathogen by producing antibiotics and System resistance, etc.
The CMF can palliate Jujube and Selenium-enriched Jujube from rust and
anthracnose. Solid state fermentation using waste is a popular way of biofertilizer
manufacturing. Low water activity in solid state fermentation (SSF) medium
facilitates spore forming on the solid substrate. Unlike in submerged fermentation
(SMF) processes, humidity is an important parameter of SSF. Microbial releases of
potassium from K-bearing minerals have two steps, fermentation and bioleach [4].
The solubilization of potassium-bearing rock powder by Aspergillus niger in sub-
merged fermentation lasted for 35-day period [5]. This study achieves it in one
process for 7 days, saving production cycle and enhancing robustness. The
imbalance of soil nutrients in China is the consequence of available potassium
deficiency in the soil and shortages of potassium fertilizer, although K-bearing
minerals in soil and mine, such as K-feldspar is rich, the amount of potassium
dissolved by bacteria in soil is limited.
Keldspar can be dissolved by silicate bacteria such as B. mucilaginosus, B.
edaphicus, B. circulans, B. subtilis which are part of the PGPR [6, 7]. Humus and
Humic acids, which exist in spent mushroom substrates and biofertilizer, can
complex with the potassium released from K-feldspar to improve its dissolving
efficiency. Conversion of food waste and feldspar into biofertilizer using a
stress-tolerant keldspar-solubilizing Bacillus subtilis Xue-113168 make the best use
of agricultural and mineral resources, enhance crop yields and play an important
role in the sustainable development.
In an SSF process, the solid substrate not only supplies anchorage for the cells, but
also nutrients and air channel. A number of cheaply available raw substrates have
been screened for the SSF. Shrimp shell, spent mushroom substrate (SMS) and corn
bran of 0.1 mm, are all support material for ventilation in SSF. Chitin in shrimp
shell and SMS can induce chitinase. K-feldspar containing 10.0% total potassium
and insoluble potassium, was purchased from Lingshou County, Hebei, P.R. China.
The shrimp shell was from Whiteleg. SMS of Pleurotus ostreatus, constitute of
4.45% organic matter, 1.58% total N, C/N ratio 28/1, water absorption rate
78–80%, humic acid content 20–30%, obtained from a local market. Corn bran
constitute of 11.8% protein, 32% glucose, 1% cellulose, purchased from the North
China Pharmaceutic Corporation, Hebei, P.R. China.
Conversion of Food Waste and Feldspar into Biofertilizer … 515
KSM are isolated from medium containing feldspar as the only potassium source
(Hutchens et al. 2003). Medium’s ingredients are as follows (g/L): starch, 5.0; yeast
extract, 1.0; MgSO4 7H2O, 0.5; CaCO3, 0.1; FeCl36H2O, 5 mg, feldspar 10, pH
7.5. After 1-day incubation at 30 °C, the transparent colonies, which resemble half
round glass bead, were picked and purified by growth of K-feldspar medium.
Stress-tolerance induction was carried out by semi-continuous culture in 50-ml
shaking flasks at 30 °C on a reciprocal shaker (150 rpm). The cells were transferred
to the induction solution which contains KCl, monosodium glutamate 4.27 mg%.
Concentration of k is increasing at a rate of about 2.5% per circulation, from 2.5 to
15%.
This isolates were originally named Bacillus circulans, later identified as
Bacillus subtilis by culturing characteristics and morphological observation,
physiological and biochemical characteristics and identification of genetic charac-
terization by Institute of Microbiology, Chinese Academy of Sciences in December
2016. The potassium dissolving rate was determined as = (St–Sc)/It*100%, where
“St” and “Sc” are the water-soluble potassium in the treatment and matrix,
respectively, and “It” = the total potassium in the treatment.
For UV’s convenience and efficacy, breeding a high potassium dissolving rate B.
subtilis strain had been performed using UV mutagenesis, screen in a fermentation
broth using the potassium tetraphenylborate spectrophotometric method. After a
series of mutation steps (Fig. 1), B. subtilis Xue-113168 has been obtained, which
have chitinase and dissolving potassium function, preserved as patent strain in the
Chinese General Microbiological Culture Collection Center (CGMCC) with the
accession number 5155 [8].
The biofertilizer was made from SMS, shrimp shell, corn bran and feldspars using a
simultaneously dissolving K-feldspar and SSF. Besides solid material, flour and
feldspar were used as substrates at 10 and 2% (w/v), respectively, medium are
sterilized in 121 °C, 0.1 MPa, for 30 min. An initial moisture content is 60–65%,
and culture temperature is 30 °C. The SSF was stirred every 48 h for 7 days.
The pH was nature during the fermentation of the SSF with B. subtilis Xue-113168.
After 168 h of fermentation, the spore number and dissolving K rate are tested.
516 S. Xue et al.
Bacillus subtilis Xue-113168 was isolated from a corn rhizosphere and breed by
UV, UV+LiCl, natural selection, breed genealogy is showed in Fig. 1. Sieved by
feldspar as the only source of potassium and colloid chitin for carbon. We use
monosodium glutamate as osmotic protection, culture the stress-tolerance bacteria
with a stepwise increase of KCl concentration, which are different from sorbitol [9],
NaCl, glycerol and glucose as osmotic protection [10]. The biofertilizer are man-
ufactured by B. subtilis Xue-113168 for dissolve potassium mineral substance in
soil. Potassium dissolving microorganisms (KSM) is able to solubilize ‘unavail-
able’ forms of K-bearing minerals, such as micas, illite and keldspar, by excreting
organic acids that either directly dissolves rock K or chelate silicon ions to bring the
K into solution [11].
B. subtilis Xue-113168 has a high potassium dissolving rate (41%), also pro-
duces chitinase. Due to superiority alive in 8% K2O of Bacillus subtilis
Xue-113168, CMF had the combining advantage of both chemical fertilizer and
biological fertilizer.
B. subtilis Xue-113168 colon morphology changes into opaque, B. subtilis
Xue-10311 still transparent and B. subtilis Xue-103116 stay thickness and viscous
(Fig. 2). The changes of colon morphology indicate the potential increase of
stress-tolerant capacity.
Morphology of B. subtilis Xue-113168 is Gram-positive, rod shape showed in
Fig. 3.
Fig. 3 Morphology of B.
subtilis Xue-113168(*1600)
by Gram Stain
The component of formulation is a key factor of the SSF and influences the overall
cost significantly.
The formulation of SSF could be similar to that of a submerged fermentation
(SMF) [12]. But sucrose was replaced with wheat flour for the SSF in this study and
the spore formation rate of SSF is higher than SMF because these two processes
have state and component of substance. The combination of corn bran, shrimp shell,
and spent mushroom substrate was the best medium for the SSF. The K-dissolving
rate (43.00%) and spore formation rate (83.18%) achieved were the best among all
the groups, and the live bacteria amount of 9.16 lg (CFU) was second only to the
spent mushroom substrate group (10.08 lg(CFU)).
The fermentation formulation for obtain a higher concentration of spores and
potassium dissolving capacity for B. subtilis Xue-113168 was initially determined
through a single factor experiment, then further through an orthogonal experiment.
The range of (NH4)2SO4 concentrations was the most important variable, sug-
gesting that in the B. subtilis Xue-113168 culture, the effects of the three factors of
the potassium dissolving ratio were (NH4)2SO4 content > MgSO4 content > wheat
flour content by range analysis. The above three factors have evident effects on
potassium dissolving ratio (P < 0.05) and the optimal conditions were: wheat flour
content, 0.75%; (NH4)2SO4 content, 0.1%; and MgSO4 content, 0.2%.
As for the spore concentration, it can be concluded that the ranges of (NH4)2SO4
and wheat flour concentrations were larger compared to the MgSO4 concentration.
Thus, the effects of the three factors of the spore concentration were (NH4)2SO4
content > wheat flour content > MgSO4 content, MgSO4 is not significant factor
for spore concentration (p > 0.05). Optimal conditions were: wheat flour content,
0.75; (NH4)2SO4 content, 0.1%; and MgSO4 content, 0.2%. The effect of ingredient
composition and concentration in medium for spore formation is the same with
Conversion of Food Waste and Feldspar into Biofertilizer … 519
potassium dissolving condition. The K-dissolving rates are different between the
SMS and Corn bran + Shrimp shell + SMS in the SSF. The humic acids in the
SMS can also dissolve the K-feldspar, which is complementary to the effect of B.
subtilis Xue-113168.
Organic matter is 250 g kg−1 for the B. subtilis Xue-113168 high decompose
performance to food waste. Organic matter reach 532 g kg−1 by adding humic acid.
We observed some changes in pH in the reactor with different medium during the
experiment. The pH decreased from 7.0 to 5.0 during the first day, recovered to
5.0–6.0 in a few days and then increased and maintained around 7.6 to the end of
the experiment.
The Spore formation was affected by varietal spectrum of humidity and tem-
perature. Controlling the moisture content of the SSF process was performed as
follows: Initially the moisture content was adjusted to approximately 60–65%, at
the end of the fermentation, the moisture content was 40–50%. The moisture
content was controlled by environmental moisture and also by controlling the
temperature in three phrases. During the prophase, the temperature was 33–35 °C,
whereas, at the metaphase, the temperature dropped to 30–33 °C. Finally, it
increased to 33–35 °C during the anaphase.
The fermentation time was also an important parameter. By the time that the rate
of spores is 80%, the processes had typically ended. An appropriate temperature
and humidity ensured the formation of the spores. When the fermentation last for
4 days, the potassium dissolving rate was 24.09%. After the fermentation time was
extended to 7 days, the potassium dissolving rate increased to 41.53%.
The process of potassium dissolving from feldspar is a synthesized multifaceted
result. There is no single gene that encodes for a potassium dissolving ability in
bacteria, which is similar to the process of dissolving phosphate. It is well known
that there are many differences between SSF and SMF in physiology, such as Aw
(water activity) and metabolite. The pH range for B. subtilis Xue-113168 is between
5 and 9, and the temperature range is 28–37 °C. Moreover, the indispensable
moisture required for SSF was low. All the characteristics described above make B.
subtilis Xue-113168 suitable for SSF. Sheng demonstrated that the potassium
dissolving rate of Bacillus edaphicus is low, which also has been proven to have a
low potential for commercial use [13]. Tan reported that 9–28% of the potassium
that they measured was released by humic acids [14]. It has been hinted that the
potassium dissolving rate (41.53%) of B. subtilis Xue-113168 may include dis-
solved potassium from K-feldspar through the action of humic acids. Consistent
and sustained product of SSF can be achieved in different growing media as long as
the following variables are being controlled: consistency of the parent organic
material, moisture content, carbon to nitrogen ratio, and process parameters.
520 S. Xue et al.
During SSF with feldspar, spore concentrations can reach 2 109 cfu/g and
soluble potassium content is 1%, B. subtilis Xue-113168 ferments and dissolves K
simultaneously. B. subtilis Xue-113168 displayed the highest K-solubilizing
activity, as high as 41.53% after 7d in culture with K-feldspar powder. This
cycle is shorter than Lian and Ciceri [4, 15], who performed SSF and SMF for 15
and 35 d respectively. Bioleaching combined with SSF is more advantageous, more
economical and more timesaving. Stephanie. K gets mutant bacteria for a high
efficient bioleaching also [16].
The quality index plays a vital role in measuring the efficiency of a fertilizer. The
indexes are consistent with the Compound Microbial Fertilizer Standard (NY/T
798-2015, China): N + P2O5 + K2O 80–250 g kg−1, number of viable cells
is 0.2 (one hundred million/g) [17]. Compound Microbial Fertilizer (CMF), for-
mulated by humic acid and K2HPO4 with biofertilizer, have a quick and
long-lasting effect. The stress-tolerance towards K2HPO4 of B. subtilis Xue-113168
is a key factor, the humic acid’s chelating functions also lessens the damage to
bacteria done by K2HPO4. Product Quality index of the CMF were examined by
Quality supervision, inspection and Testing Center for microbial products of
Ministry of Agriculture in WuHan in December 2016. Provisional registration
certificate of CMF is No. 3878 by Ministry of Agriculture of the People’s Republic
of China in March 15, 2017. Product Quality index of the CMF is different from the
that of pilot sample showed in Table 1, such as content of P2O5, inferring phos-
phorus as massive element in cell is less harmful to microorganism. Function of
PGPR dependent on the clone in zone of root [18]. Organic matter in CMF offer
nutrient, shelter to adverse situation for PGPR in field.
4 Conclusions
This CMF is formulated by humic acid, K2HPO4, and biofertilizer which is SSF by
chemical fertilizer-tolerant feldspar-solubilizing B. subtilis Xue-113168.
Provisional registration certificate of CMF is No. 3878 by Ministry of Agriculture
of the People’s Republic of China in March 15, 2017.
Bacillus subtilis Xue-113168 converts K-feldspar, corn bran, shrimp shell, and
spent mushroom substrate to a biofertilizer that have a 41% potassium dissolving
rate. The CMF used in this study can enhance the efficiency of fertilizers and utilize
recycled waste resource. It also promotes a sustainable agriculture industry, com-
plex formulations and process of the SFF are suitable for factory, especially farmer
uses in the fields.
Acknowledgements This work was supported by the Ministry of Science, People’s Republic of
China under Grant [number 2008GA620020]; Hebei Province natural fund under Grant [number
C2015207019]. Hebei University of Economics and Business fund under Grant [number
2016kyz01]. Hebei Provincial department of education under grant [number ZD2017229].
Thanks to professor Yu Li, Wenhang Wang, Guorong He, Yingjie Pan for review the paper.
References
11. Sheng X (2005) Growth promotion and increased potassium uptake of cotton and rape by a
potassium releasing strain of Bacillus edaphicus. Soil Biol Biochem 37:1918–1922
12. Tan KH (1978) Effects of humic and fulvic acids on release of fixed potassium. Geoderma 21
(1):67–74
13. Barrios-González J (2012) Solid-state fermentation: physiology of solid medium, its
molecular basis and applications. Process Biochem 47:175–185
14. Vaneeckhaute C, Janda J, Vanrolleghem PA, Tack FMG, Meers E (2016) Phosphorus use
efficiency of bio-based fertilizers: bioavailability and fractionation. Pedosphere 26(3):
310–325
15. Ciceri D, Allanore A (2015) Microfluidic leaching of soil minerals: release of k+ from k
feldspar. PLoS One 10(10):1–10
16. Kraft S, Obst U, Schwartz T (2011) Immunological detection of uv induced cyclobutane
pyrimidine dimers and (6–4) photoproducts in dna from reference bacteria and natural aquatic
populations. J Microbiol Methods 84(3):435–441
17. Ministry of Agriculture of China (2015) Compound microbial fertilizer standard NY/T
798-2015. Standard Press
18. Dutta S, Podile AR (2010) Plant growth promoting rhizobacteria (PGPR): the bugs to debug
the root zone. Crit Rev Microbiol 36(3):232–244
Part III
Biological Separation and Biological
Purification
Biological Degradation of Aflatoxin B1
by Emericellopsis sp. 1912
and Sarocladium sp. 10A
Hui Wang, Zhongyuan Li, Haiyan Qiu, Shuang Li and Tongcun Zhang
1 Introduction
In this study, the moldy soils from Tianjin of China were used to screen the AFB1
degradation microorganisms. AFB1 was purchased from Sigma (St. Louis, MO)
and it was dissolved with methanolto a stock solution of 100 lg ml−1, and then the
storage solution was diluted with double distilled water to the working concen-
tration of 1 ppm. Nutrient borth (NB) medium was used for strains cultivation and
it contained the following ingredients (per liter): 3.0 g yeast extract, 5.0 g peptone,
6.0 g glucose, 10 g NaCl. Coumarin medium (CM) was used for screening the
AFB1 degradation strains, and it contained the following ingredients (per liter):
1.0 g coumarin (Aladdin, Shanghai, China), 2.0 g (NH4)2SO4, 0.2 g MgSO4.7H2O,
1.5 g Na2HPO4.12H2O, 0.001 g FeSO4.7H2O, 0.01 g CaCl2.2H2O and 1.5 g
KH2PO4.
Coumarin medium (CM) was used to isolate the AFB1 degradation strains from the
moldy peanut and moldy corn according to Guan et al. [11] with modification.
About 2 g of each sample was grinded and dissolved in 10 ml 0.9% (w/v) NaCl,
then these samples were transferred into 50 ml NB medium and incubated at 30 °C
(n = 220 rpm) for 4 h. Then the cells was collected by centrifuged at 5000 rpm for
10 min and transferred the cells into 50 ml coumarin medium cultured at 30 °C for
7 days. Then, the strains which could grow in CM were transferred into the fresh
CM for the further screening. This process was repeated three times. In order to
obtain the purified strains, the liquid culture (0.3 ml) was spread on CM plates and
incubated at 30 °C until visible colonies appeared. In order to avoid the effect of
agar to the screening results, each single colony was transferred into 50 ml fresh
CM and cultivated at 30 °C for further screening.
Biological Degradation of Aflatoxin … 527
The isolated strains were incubated in 100 ml NB medium at 30 °C and 220 rpm
for 48 h, and the cells of microbes were removed by centrifugation at 12,000 rpm
for 10 min, then 4.5 ml culture supernatant was taken out and incubated with
0.5 ml AFB1 (1000 ppb) solution on a rotary shaker (n = 220 rpm) at 30 °C in
dark for 48 h. AFB1 was extracted from reaction mixtures by immunoaffinity
chromatography (Huaan Maghech B-Tech Co, China), then evaporated by dryer at
60 °C and derived by incubating with N-hexane (200 ll) and trifluoroacetic acid
(50 ul) for 5 min at 40 °C. The derivatized was dissolved in 1.95 ml of 10% (v/v)
acetonitrile by mixing vigorously for 30 s and standing for 10 min, and then filtered
with filter membrane (Millex-GV, Durapore, 0.22 lm), analyzed using
high-performance liquid chromatography.
High-performance liquid chromatography was performed using a C18 column
(250 mm 4.6 mm, 5 um, Agilent) equipped with a fluorescence detector (exci-
tation wavelength: 350 nm; detection wavelength: 450 nm). The injection volume
of each sample was 20 µl and the mobile phase was water: methanol: acetonitrile
(70:17:17, v/v) at a flow rate of 0.6 ml/min. The reaction with NB medium instead
of microbial supernatant was used as the control. According to Guan et al. [11], the
percentage of AFB1 degradation was calculated using the following formula: (1-
AFB1 peak area in treatment/AFB1 peak area in control) 100%.
The isolate strains 1912 and 10A were cultivated in NB medium at 30 °C for 48 h,
the cells were collected by centrifugation at 12,000 rpm for 10 min, and the
genomic DNA was extracted by CTAB-SDS method [12]. The genes encoding the
ribosomal rRNAs in the eukaryotic genome include 28S rDNA, 5S rDNA, 18S
rDNA, and 5.8S rDNA. The internal transcribed spacer Its1 and Its4 were used for
strains classification and identification because of their specificity of interspecific
and intraspecific conservative [13, 14]. In our study, the ITS rDNA sequences of
strain 1912 and 10A were amplified by PCR using primers Its1 and Its4 (5′-
TCCGTAGGTGAACCTGCGC-3′; 5′-TCCTCCGCTTATTGATATGC-3′), and
the genomic DNA of strain1912 and strain 10A was used as templates for ampli-
fication, respectively. Then, the PCR products were analyzed by agarose gel
electrophoresis and ligated into the vector pMD-19T for sequencing by Genewiz
(Beijing, China).
528 H. Wang et al.
The ITS rDNA sequences of strains 1912 and 10A were analyzed by BLAST search
in the GenBank database (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and the high the
homology nucleic acid sequences of each strain were downloaded as the reference
sequences. A phylogenetic tree was constructed using Molecular Evolutionary
Genetics Analysis, version 7, (MEGA 7), software (www.megasoftware.net) with
the neighborjoining method. The tree was evaluated by bootstrap analysis based on
1000 resamplings by MEGA 7.
The single colonies picked from the soild coumarin medium (CM) were cultured at
30 °C for 7 days, strains 1912 and 10A could grow on liquid culture medium
(CM) as shown in Fig. 1, and these two strains were used as the candidates for the
further study. The mycelial morphology was shown in Fig. 1.
The ITS rDNA sequences of strains 1912 and 10A were successfully obtain by
PCR, and the PCR products were detected by electrophoresis (Fig. 3). Based on the
Biological Degradation of Aflatoxin … 529
Fig. 1 Morphological characteristics of strains 1912 and 10A. a strain 1912 grew in liquid CM.
b strain 10A grew in liquid CM. c strain 1912 grew on the solid NB plate. d strain 10A grew on
the solid NB plate
blast analysis, the ITS rDNA sequence of strain 1912 had the highest identity (99%)
with that of Emericellopsis alkalina strain A112 (GenBank accession
No. KC987149.1), which suggests strain1912 belongs to the Emericellopsis
sp. Strain 10A had the highest identity (99%) with that of Sarocladium kiliense
UOA/HCPF 12768A (GenBank accession No. KC254087.1), which suggests strain
10A belongs to the Sarocladium sp. Based on the ITS sequence analysis, strain
strain 1912 and 10A were identified as Emericellopsis sp.1912 and Sarocladium
sp. 10A, respectively (Fig. 4a and b). To our best of knowledge, strain 1912 is the
first reported AFB1 degradation fungus belonging to genus Emericellopsis, and
strain 10A is the first reported AFB1 degradation fungus belonging to genus
Sarocladium.
3.4 Conclusion
In this research, we had screened the strains 1912 and 10A. Based on BLAST
analysis, strain 1912 belongs to the Emericellopsi sp. and strain 10A belongs to the
Sarocladium sp. The AFB1 degradation ratios were 60.49 and 45.51% in
Emericellopsi sp. 1912 and Sarocladium sp. 10A, respectively. Moreover,
Emericellopsi sp. 1912 was the first to be found in Emericellopsi sp. that has the
ability to degrade AFB1 and Sarocladium sp. 10A was the first strain that has the
ability to degrade AFB1 of Sarocladium sp.
Biological Degradation of Aflatoxin … 531
Fig. 4 Phylogenetic analysis of the isolation strains 1912 (a) and 10A (b) by MEGA 7 software
532 H. Wang et al.
References
Ping Li, Zhan Shu, Lan Zhang, Tao Li and Lin Tian
1 Introduction
In recent years, public concerns regarding safety of food have brought scientists to
focus on the application of many spices and herbs extracts to preserve the quality of
food [1, 2]. Application of plant-origin essential oils as food preservatives has
received more and more attention since many works have demonstrated their
antimicrobial and antioxidant activities [3–5]. Vatavali et al. [6] reported that the
combination of chitosan and oregano essential oil was very effective on extending
the shelf life of red porgy stored in ice. Kapoor et al. [7] demonstrated that black
pepper essential oil had better preservative effect for orange juice. Cristina et al. [8]
revealed that cinnamon bark oil and citrus extracts, even at low concentrations,
exhibited high anti-yeast effects and could increase shelf life of ready-to-eat table
grape compared to the control. In addition, cinnamon oil combined sand-based
storage at 12 °C could prolong storage time for baby ginger [9].
Star anise (Illicium verum) is an aromatic evergreen tree and it is widely culti-
vated in China, especially in Guangxi and Guangdong provinces. Its fruit is a
traditional medicine as well as a spice widely used in foods and beverages [10].
Many kinds of active compounds have been identified in Illicium verum such as
essential oils, oleoresin, and shikimic acid [11]. Among these active compounds,
star anise oleoresin, the major flavoring ingredient in star anise, is of particular
importance. Star anise oleoresin contains volatile essential oil, less volatile com-
ponents, pigments, fatty acids and resins. The taste and aroma of star anise oleoresin
is more balanced and complete than the essential oil in terms of food seasoning and
it has been allowed using as an additive in food processing industry in many
countries [12]. Traditional methods for obtaining extracts from Illicium verum fruits
are hydro-distillation, steam distillation and solvent extraction, which have some
disadvantages. For hydro-distillation and steam distillation, some thermal-sensitive
constituents may decompose during the prolonged extraction time [13]. Solvent
extraction, such as heat reflux and soxhlet extraction takes a long time and high
energy cost. These shortcomings have led to consideration of the use of innovative
and environment-friendly techniques in active compounds extraction, such as
ultrasound-assisted extraction [14], supercritical fluid extraction [15, 16] and
microwave extraction [17]. Recently, ultrasonic-assisted method has been suc-
cessfully applied in the extraction of many active extracts and this method can offer
many important advantages over traditional alternatives, viz. shorter extraction
time, simple sampling, better yields, low energy cost, cleaner features and provide a
more valuable extracts [11, 18]. Many reports were published for the identification
and application of essential oil of Illicium verum and its antimicrobial activity [3, 5,
10]. However, rarely studies have been conducted on the extraction of star anise
oleoresin, especially ultrasonic-assisted extraction, and its antimicrobial activity.
The aim of this study was to optimize the conditions for ultrasound-assisted
extraction of star anise oleoresin from Illicium verum fruits using orthogonal
experiment design, as well as investigate its antimicrobial activity in order to
provide a reference for the extraction and application of star anise oleoresin.
Illicium verum fruits were purchased from a vanguard supermarket (Nankai District
of Tianjin, China). The fruits were dried at 50 °C for 24 h and pulverized by a
grinder and then passed through different mesh sieves. The bacterial stains used in
this study were Escherichia coli and Bacillus subtilis, which were provided by
College of Agronomy & Resources and Environment, Tianjin Agricultural
University. After activated, the stains were inoculated into liquid standard nutrient
broth medium, and cultured at 37 °C with regularity shaking at 180 rpm for 18 h.
Series dilution were carried out to obtain the final concentration of colonies was
106 CFU/mL by using sterile distilled water. All the other chemicals used in this
study were analytical reagent grade.
The influences of many parameters on the yield of the oleoresin were investigated
by single factor experiment. On the basis of the results of single factor experiment,
optimization experiments were carried out according to the L16 (45) orthogonal
experiment design (Table 1).
For GC-MS analysis, the samples were injected into a HP-5MS capillary column
(30 m 0.25 mm i.d with 0.25 µm film thickness, Agilent United States,
Initial concentration of the oleoresin was 1.00 mg/mL and it was diluted twofold
with N, N-dimethylformamide (DMF) as a solvent to obtain a series of different
concentrations of samples.
Antimicrobial activity was determined by disc diffusion method described by
Wang et al. [19]. DMF was used as a negative control. Three replicates were
performed for each concentration. After incubation, diameters of the inhibition zone
were measured and inhibition (%) was calculated according to the following
formula:
M1 M2
Inhibition(%Þ ¼ 100 ð2Þ
M1
Effects of different extraction solvents on the yield of star anise oleoresin were
shown in Fig. 1. It could be seen that ethyl acetate was the best extraction solvent
with the highest extraction yield (19.93%), while the other conditions were kept the
same and the obtained oleoresin was a dark green oily liquid with significant
aromatic odor.
Study on Ultrasonic-Assisted Extraction of Star Anise Oleoresin … 537
Fig. 1 Effect of different solvents on the yield; 1 petroleum ether (b.p. 30–60 °C); 2 petroleum
ether (b.p. 60–90 °C); 3 acetone; 4 anhydrous ethanol; 5 cyclohexane; 6 ethyl acetate; extraction
conditions: 40–60 mesh powder; ratio of material to solvent was 6:60 (g/mL); ultrasonic power
was 330 W; ultrasonic time was 30 min; room temperature
Powder granularity is one of the most important factors that can affect the oleoresin
yield. It could be seen from Fig. 2, as the powder granularity increasing, the yield
increased rapidly, and the maximum yield (23.31%) could be obtained at 60–80
mesh, and then declined. One possible explanation was that fine materials was
benefit for the extraction due to the increased surface area, yet too small powders
might cause adhesion between materials, then impeded the dissolution of the ole-
oresin, and our result was in agreement with that of the previous observation [20].
Ratio of material to solvent is another crucial factor that can affect the yield of
oleoresin. As shown in Fig. 3, the result indicated that the increase of ratio elevated
oleoresin yield during 6:30–6:60 (g/mL), and the yield reached maximum (21.61%)
at 6:60 (g/mL), and then declined. The reason might be that with the increasing of
ratio, ingredients could be fully dissolved in solvent, however, excessive solvent
might absorb a large amount of ultrasonic energy, which resulting in the decrease of
absorption of ultrasound intensity for raw materials in extracted system and yield
reduction.
Besides, ultrasonic power is also a primary factor that can significantly influence the
oleoresin yield. Figure 5 showed that with the increasing of ultrasonic power, the
yield increased and reached maximum (19.96%) at 264 W, and then turned to
Study on Ultrasonic-Assisted Extraction of Star Anise Oleoresin … 539
decline, which indicated that any excess power was useless. One reason was that
with the power increasing, temperature in the extraction system enhanced, which
resulting in some losses of volatile components in oleoresin and yield reduction.
The results of antimicrobial activities of unpurified and purified star anise oleoresin
were shown in Fig. 7. It could be seen that all the obtained oleoresins, either
purified or not, exhibited good inhibitory effects on the two tested stains and
antimicrobial activities positively correlated with the concentrations. The antimi-
crobial activity of the oleoresin could be attributed to its high content of trans-
anethole documented by Huang et al. [21]. It could be seen that the inhibitory effect
of unpurified oleoresin was higher than purified oleoresin at all the tested con-
centrations, which could be well interpreted by the GC-MS results that the content
Study on Ultrasonic-Assisted Extraction of Star Anise Oleoresin … 541
Table 2 Results of orthogonal experiment design for ultrasonic-assisted extraction of star anise
oleoresin
Number Factors Yield (%)
A B C D
1 1 1 1 1 18.24
2 1 2 2 2 21.59
3 1 3 3 3 21.56
4 1 4 4 4 14.98
5 2 1 2 3 19.93
6 2 2 1 4 18.27
7 2 3 4 1 19.95
8 2 4 3 2 23.28
9 3 1 3 4 21.66
10 3 2 4 3 19.91
11 3 3 1 2 14.95
12 3 4 2 1 19.99
13 4 1 4 2 19.96
14 4 2 3 1 21.58
15 4 3 2 4 19.91
16 4 4 1 3 18.28
k1 19.09 19.95 17.44 19.93
k2 20.36 20.34 20.35 19.94
k3 19.13 19.09 22.02 19.92
k4 19.93 19.13 18.70 18.70
R 1.27 1.25 4.58 1.24
k1, k2, k3, k4 are the mean values of the sum of deviation under the four same level, respectively;
R is the range value
Fig. 7 Antimicrobial activities of star anise oleoresin and purified star anise oleoresin against
Escherichia coli (a) and Bacillus subtilis (b)
542 P. Li et al.
4 Conclusions
References
1. Antunes MDC, Cavaco AM (2010) The use of essential oils for postharvest decay control.
A review. Flavour Frag J 25:351–366
2. Gracia CM, Bermudez CAG, Valcarcel AMC et al (2015) Use of herbs and spices for food
preservation: advantages and limitations. Curr Opin Food Sci 6:38–43
Study on Ultrasonic-Assisted Extraction of Star Anise Oleoresin … 543
23. Arfa AB, Belloy LP, Chalier P et al (2007) Antimicrobial paper based on a soy protein isolate
or modified starch coating including carvacrol and cinnamaldehyde. J Agric Food Chem
55:2155–2162
24. Nanasombat S, Wimuttigosol P (2011) Antimicrobial and antioxidant activity of spice
essential oils. Food Sci Biotechnol 20:45–53
25. Becerril R, Gomez LR, Goni P et al (2007) Combination of analytical and microbiological
techniques to study the antimicrobial activity of a new active food E. coli and S. aureus. Anal
Bioanal Chem 388:1003–1011
Preparation of Dialdehyde Cellulose
and Its Antibacterial Activity
Huanhuan Ge, Liming Zhang, Meng Xu, Jie Cao and Caicai Kang
1 Introduction
2.1 Materials
The preparation of DAC can be found in our previous report [12]. An experimental
procedure was performed as follows: 10.0 g of MCC was added to 500 mL of
distilled water and the solution was adjusted to pH 2.0 by sulfuric acid (20%). Then,
13.2 g of sodium periodate was added. The mixture was stirred at 30 °C in the dark
for 9 and 19 h. The remaining periodate was decomposed by adding excess ethy-
lene glycol, the slurry was filtered and the product was washed with distilled water.
Then anhydrous ethanol was used to remove water, and then the product was dried
at 50 °C for 12 h and grinded into powder using mortar.
Preparation of Dialdehyde Cellulose … 547
where M NaOH = 0.1 mol/L, m is the dry weight (g) of DAC, and 162 is the
molecular weight of DAC. The experiments were performed in triplicate.
The FT-IR analysis was performed using a Bruker Vector 22 FTIR spectrometer
(Rheinstetten, Germany). The samples were prepared by blending about 1.0 mg
MCC and DAC samples with 150 mg KBr and pressing the mixture into very thin
tablets before measurement. All the spectra of measured samples were averaged
from 32 scans ranging from 400 to 4000 cm−1 with a resolution of 4 cm−1.
The thermal behavior of MCC and DAC were determined by TGA measurement on
a TGA-Q50 thermal analyzer (Kyoto, Japan). Thermal analysis was performed
between room temperature and 600 °C at a heating rate of 10 °C/min under
nitrogen atmosphere. About 8–15 mg of sample was used in single runs.
The antibacterial activity of MCC and DAC was evaluated against S. aureus, E. coli,
B. subtilis and S. typhimurium by the double dilution method (DDM), and the
548 H. Ge et al.
The Nutrient Agar plates were prepared for cell incubation at 37 °C for 24 h. The
nutrient medium was inoculated with four types of bacteria (S. aureus, E. coli, B.
subtilis, S. typhimurium) at 37 °C overnight with constant agitation under the
aerobic condition. The four kinds of bacterial suspensions were diluted with a
sterile 0.9% (w/v) saline solution. The turbidity of the bacterial suspension was
adjusted to 1–2 108 CFU/mL based on the 0.5 McFarland standard. A total of
100 lL proofread cell culture was added to 2.9 mL lysogeny broth (LB) medium to
prepare bacterial suspension spare and the concentration of the bacterial suspension
was 5.0 106 CFU/mL.
A double dilution method was used to determine the MIC of the DAC aqueous
suspension. Stock solutions of DAC aqueous suspension were prepared in an
oil-bath at 100 °C for 1 h [15]. These suspensions were diluted to 12.00% and
joined 5 mL LB culture medium into the first tube and blending. The concentration
of DAC in the test tubes were, in order, 6.00, 3.00, 1.50, 0.75, 0.38 and 0.19% by
using the method of DDM. At the same time, the tube did not add the DAC aqueous
suspension was performed as the blank control. Finally, the bacterial suspension
(0.1 mL, 5.0 106 CFU/mL) was added to each tube. All the test tubes were
inoculated for 20 h with an agitation rate of 220 rpm at 37 °C. After 20 h, remove
the tubes from the shaker and kept stationary for 5 min. Each of the tubes super-
natant was measured absorbance at 600 nm using UV-2401 spectrophotometer
(SHIMADZU, Japan). The MIC was defined as the lowest concentration of the
DAC aqueous suspension at which the microorganism does not demonstrate visible
growth [16]. Each assay was repeated three times.
According to the different stirring time, we have got two kinds of aldehyde content
of DACs. The DAC with 60 and 93% aldehyde contents were obtained from 9 and
Preparation of Dialdehyde Cellulose … 549
19 h, respectively. The literature has reported that the oxidation degree 90% of
DAS suspensions exhibited antibacterial activities [11]. In order to explore whether
the low oxidation degree of DAC has the antibacterial activities, we chose the
oxidation degree of 60% of the DAC for the experiment.
FTIR spectra analysis was performed to detect chemical changes of MCC and DAC
(Fig. 1).
The band at 1637 cm−1 is the absorbed moisture of the sample, the characteristic
absorption band of carbonyl groups is at 1730 cm−1 [17] for DAC (Fig. 1b and c).
1430 cm−1 is ascribed to the C–H stretching and bending modes of the methylene
[18]. A slightly red shift of the hemiacetal vibration peak at 888 cm−1 implies the
skeletal changed on the main chain. Furthermore, an increase in the intensity at
888 cm−1 (Fig. 1b and c) supported the conclusion that the aldehyde or hemiacetal
groups were introduced into DAC by sodium periodate oxidation [5]. The resultant
aldehyde or hemiacetal groups may be further modified to carboxylic acids or
imines [19], thus serving as intermediates for cellulose-based functional products,
such as drug carriers, adsorbents for heavy metals [20].
The TGA curves (Fig. 2) show a characteristic change by MCC and oxidation of
cellulose. The decomposition of MCC in nitrogen started at about 280 °C and rapid
550 H. Ge et al.
Fig. 2 Thermogravimetric
curves (TGA) of MCC and
DAC. a MCC; b The DAC
with 60% of aldehyde; c The
DAC with 93% of aldehyde
The antibacterial activity of DAC with different contents and MCC against
Gram-positive bacteria S. aureus and B. subtilis and Gram-negative bacteria E. coli
and S. typhimurium were tested by the double dilution method. These bacterial
species (S. aureus, E. coli and S. typhimurium) were selected because they are
commonly known to cause human infections [21].
The MIC values of MCC were showed in Table 1 MCC did not show any
antibacterial activity. The measured ultraviolet values have no obvious changes in
different concentrations of DAC aqueous suspension. This proved that the raw
material without aldehyde group showed no antibacterial effect. However, DAC
aqueous suspension with 60 and 93% aldehyde contents showed clear antibacterial
activity (Tables 2 and 3) and the ultraviolet values (OD600) of these samples
decreased coupled with the concentration of DAC aqueous suspension when
compared with MCC.
Table 2 is the MIC results of DAC aqueous suspension with 60% aldehyde
contents against four kinds of bacteria. The DAC aqueous suspension with 60%
aldehyde contents exhibited a broad antibacterial spectrum against all of the test
strains with MIC values between 1.50 and 3.00%. The MIC results of DAC
aqueous suspension with 60% aldehyde contents against S. aureus, E. coli, B.
subtilis and S. typhimurium were 1.50, 3.00, 3.00 and 3.00%, respectively. Table 3
Preparation of Dialdehyde Cellulose … 551
Table 2 The MIC results of DAC with 60% aldehyde contents against four kinds of bacteria
Sample concentration (%) OD600
S. aureus E. coli B. subtilis S. typhimurium
0.00 1.924 1.868 1.941 1.975
0.19 1.514 1.639 1.772 1.780
0.38 0.812 1.175 1.208 1.637
0.75 0.794 1.038 1.062 1.528
1.50 0.045 0.577 0.709 0.869
3.00 0.042 0.038 0.039 0.045
6.00 0.040 0.038 0.037 0.043
MIC 1.50 3.00 3.00 3.00
Data of OD600 were shown in average value (n = 3)
Table 3 The MIC results of DAC with 93% aldehyde contents against four kinds of bacteria
Sample concentration (%) OD600
S. aureus E. coli B. subtilis S. typhimurium
0.00 1.848 1.875 1.925 1.929
0.19 1.376 1.499 1.655 1.713
0.38 0.625 1.012 1.143 1.575
0.75 0.577 0.931 1.022 1.369
1.50 0.050 0.053 0.054 0.848
3.00 0.049 0.045 0.050 0.049
6.00 0.042 0.043 0.043 0.047
MIC 1.50 1.50 1.50 3.00
Data of OD600 were shown in average value (n = 3)
552 H. Ge et al.
is the MIC results of DAC aqueous suspension with 93% aldehyde contents against
four kinds of bacteria. The MIC results of DAC aqueous suspension with 93%
aldehyde contents against S. aureus, E. coli, B. subtilis and S. typhimurium were
1.50, 1.50, 1.50 and 3.00%, respectively. The bacteriostatic effect of the DAC with
93% aldehyde contents aqueous suspension is superior to the DAC with 60%
aldehyde contents aqueous suspension. It is seen that the bacteriostatic effect of S.
aureus is the best one and the bacteriostatic effect of DAC aqueous suspension was
increased with the increase of the degree of oxidation. These results indicate that
DAC with 60 and 93% aldehyde contents showed antibacterial activity against both
Gram-positive and Gram-negative bacteria because of the loading of the dialdehyde
groups.
4 Conclusion
DAC with 60 and 93% aldehyde contents, prepared by the selective periodate
oxidation of MCC with the introduction of the dialdehyde functions. The charac-
terization of MCC and DAC by FTIR and TGA showed that the products were
introduced two aldehyde groups and its thermal stability decreased. The results of
this study indicate that the DAC shows high antibacterial properties. The higher
DAC aldehyde content is, the better its bacteriostatic effect is. When DAC aldehyde
content exceeded 60%, the MIC against S. aureus, E. coli, B. subtilis and S.
typhimurium were 1.50, 3.00, 3.00 and 3.00%, respectively. When DAC aldehyde
content exceeded 93%, the MIC of S. aureus, E. coli, B. subtilis and S. typhimurium
reached 1.50, 1.50, 1.50 and 3.00%, respectively. Therefore, the findings in this
study proved the potential applications of DAC as a new antibacterial agent.
References
1. Turbak AF, Snyder FW, Sandberg KR (1983) Microfibrillated cellulose, a new cellulose
product: properties, uses and commercial potential. J Appl Polym Sci 37:815–827
2. Klemm D, Schumann D, Kramer F et al (2006) Nanocelluloses as innovative polymers in
research and application. Adv Polym Sci 205:49–96
3. Dinand E, Chanzy H, Vignon MR (1999) Suspensions of cellulose microfibrils from sugar
beet pulp. Food Hydrocolloids 13:275–283
4. Yang J, Han C, Duan J, Xu F, Sun R (2013) Mechanical and viscoelastic properties of
cellulose nanocrystals reinforced poly (ethylene glycol) nanocomposite hydrogels. ACS Appl
Mater Inter 5:3199–3207
5. Sun B, Hou QX, Liu ZH, Ni YH (2015) Sodium periodate oxidation of cellulose nanocrystal
and its application as a paper wet strength additive. Cellulose 22:1135–1146
6. Browning BL (1976) Methods of wood chemistry, Vol. 2. Interscience, London, New York,
pp 476, 477, 499
Preparation of Dialdehyde Cellulose … 553
7. Kim UJ, Kuga S (2000) Reactive interaction of aromatic amines with dialdehyde cellulose
gel. Cellulose 287–297
8. Ramirez H, Cao R, Fragoso A, Torres-Labandeira J, Dominguez A, Schacht E et al (2006)
Improved anti-inflammatory properties for naproxen with cyclodextringrafted polysaccha-
rides. Macromol Biosci 555–561
9. RoyChowdhury PV, Kumar J (2006) Biomed. Mater Res A 76, 300
10. Zhang X, Shen G, Sun S, Shen Y, Zhang C (2014) Direct immobilization of antibodies on
dialdehyde cellulose film for convenient construction of an electrochemical immunosensor.
Sensor Actuat B-Chem 200:304–309
11. Song L, Sang YJ, Cai LM, Shi YC et al (2010) The effect of cooking on the antibacterial
activity of the dialdehyde starch suspensions. Starch-Starke 62(9):458–466
12. Kim UJ, Kuga S (2001) Thermal decomposition of dialdehyde cellulose and its
nitrogen-containing derivative. Thermochim Acta 369:79–85
13. Sirvio J, Hyvakko U, Liimatainen H, Niinimaki J, Hormi O (2011) Periodate oxidation of
cellulose at elevated temperatures using metal salts as cellulose activators. Carbohyd Polym
83:1293–1297
14. Standards NCFCL (2006) Performance standards for antimicrobial disk susceptibility tests:
approved standards, 11th ed. National Committee for Clinical Laboratory Standards, USA
15. Kim UJ, Wada M, Kuga S (2004) Solubilization of dialdehyde cellulose by hot water.
Carbohyd Polym 56(1):7–10
16. Yang CH, Chang HW, Lin HY, Chuang LY (2013) Evaluation of antioxidant and
antimicrobial activities from 28 Chinese herbal medicines. J Pharmacogn Phytochem 2(1):
2278–4136
17. Gong R, Zhang J, Zhu J, Wang J, Lai Q, Jiang B (2013) Loofah sponge activated by periodate
oxidation as a carrier for covalent immobilization of lipase. Korean J Chem Eng 30(8):1620–
1625
18. Sheng Y, Wang QH, Xu XC, Jiang WY, Gan SC, Zou HF (2011) Oxidation of cornstarch
using oxygen as oxidant without catalyst. LWT—Food Sci Technol 44:139–144
19. Kim UJ, Kuga S, Wada M, Okano T, Kondo T (2000) Periodate oxidation of crystalline
cellulose. Biomacromol 1(3):488–492
20. Kim UJ, Kuga S (2001) Ion-exchange chromatography by dicarboxyl cellulose gel.
J Chromatogr 919:29–37
21. Hanim SAM, Malek NANN, Ibrahim Z (2016) Amine-functionalized, silver-exchanged
zeolite NaY: preparation, characterization and antibacterial activity. Appl Surf Sci 360:
121–130
Optimization of Microwave-Assisted
Extraction of Total Flavonoids
from China-Hemp Leaves and Evaluation
of Its Antioxidant Activities
Jie Cao, Limin Hao, Liming Zhang, Meng Xu, Huanhuan Ge,
Caicai Kang, Jianyong Yu and Zongzhen Wang
1 Introduction
Flavonoids from powders of hemp leaves were extracted using a domestic micro-
wave oven system. The apparatus was equipped with a digital control system for
irradiation time, microwave powder (the latter was linearly adjustable from 100 to
1000 W), magnetic stirrer speed and temperature.
Tow gram of hemp leaves powder was stirred into aqueous ethanol by stirring in
preparation for extraction using the MAE system. Parameters of the MAE extrac-
tion were ethanol proportion (40–80%), liquid-to-solid ratio (20–40 mL/g),
extraction time (5–40 min) and extraction temperature (40–80 °C). Table 1 pro-
vides the experimental conditions respectively, where the influence of each
parameter was in single-factor experiments. Each trial was carried out in triplicate.
After MAE treatment, the extraction solution was separated from insoluble residue
Optimization of Microwave-Assisted Extraction … 557
Table 1 Experimental design with the observed responses of total flavonoids (TF) yield from
China-hemp leaves using MAE
Run X1 ethanolm X2 X3 X4 extraction Y yield
concentration (% liquid-to-solid extraction temperature (° of TF
v/v) ratio (mL/g) time (min) C) (%)
1 60.00 35.00 10.00 70.00 2.66
2 60.00 35.00 20.00 60.00 2.77
3 60.00 30.00 20.00 50.00 2.43
4 60.00 35.00 20.00 60.00 2.81
5 80.00 35.00 10.00 60.00 2.33
6 60.00 40.00 20.00 70.00 2.85
7 80.00 35.00 30.00 60.00 2.95
8 80.00 35.00 20.00 50.00 2.28
9 60.00 35.00 20.00 60.00 2.64
10 40.00 35.00 30.00 60.00 1.88
11 60.00 35.00 30.00 70.00 2.88
12 80.00 40.00 20.00 60.00 2.50
13 60.00 30.00 10.00 60.00 2.42
14 40.00 40.00 20.00 60.00 2.10
15 60.00 30.00 20.00 70.00 2.88
16 40.00 35.00 20.00 70.00 2.52
17 60.00 35.00 10.00 50.00 2.11
18 60.00 40.00 10.00 60.00 2.33
19 60.00 35.00 20.00 60.00 2.76
20 40.00 35.00 20.00 50.00 1.63
21 40.00 30.00 20.00 60.00 2.33
22 60.00 30.00 30.00 60.00 2.68
23 60.00 40.00 30.00 60.00 2.56
24 40.00 35.00 10.00 60.00 2.05
25 80.00 35.00 20.00 70.00 3.01
26 80.00 30.00 20.00 60.00 2.65
27 60.00 40.00 20.00 50.00 2.22
28 60.00 35.00 20.00 60.00 2.66
29 60.00 35.00 30.00 50.00 2.34
by centrifugation (8000 rpm for 10 min), and then the supernatant was collected in
a volumetric flask for determination of FT content.
The flavonoid content of the extracts was estimated by the Al(NO3)3 method [10].
Briefly, 1 mL of 10-fold diluted supernatant was mixed with 0.3 mL of 5% NaNO2.
558 J. Cao et al.
The solutions were mixed thoroughly and incubated at room temperature for 6 min.
And then 0.3 mL of 10% Al(NO3)3 solution was added and mixed. 6 min later,
4 mL of 4% NaOH solution was added and used 60% ethanol diluted to 10 mL.
With 15 min standing, the absorbance of the solution was measured at 510 nm with
UV-2401 spectrophotometer against the same mixture, without the sample as a
blank. (The calibration curve: y = 9.4975 x + 0.0366, R2 = 0.9996).
where Xi was a coded value of the variable; xi was the actual value of the variable;
x0 was the actual value of the independent variable at the center point; Dx and was
the step change of the variable.
Using a Box-Behnken design (BBD) [11], response surface methodology was
conducted to determine the MAE optimized extraction process variables for max-
imum recovery of TF yield. Tables 1 and 2 represent the non-coded values of the
experimental variables and 29 experimental points. On the basis of the experimental
date, a second-order polynominal model corresponding to the BBD was fitted to
correlate the relationship between the independent variables and the response to
predict the optimized condition. The nonlinear computer-generated quadratic model
was given as:
X
4 X
4 4 X
X 4
Y ¼ b0 þ bi Xi þ bii X2i þ bij Xi Xj ð2Þ
i¼0 j¼0 i¼0 j¼0
where Y was the response function; b0 was a constant; bi bii and bij were the linear,
quadratic and interactive coefficients, respectively; Xi was the coded levels of
independent variables. The terms XiXj and X2i represented the interaction and
quadratic terms, respectively.
Radical scavenging activity of the China-hemp leaves extract was evaluated using
DPPH radicals based on the method by Xu and Chang [12]. DPPH radical scav-
enging activity was calculated by the following equation: scavenging effect
(%) = [1 − (A1 − A2)/A0] 100, where A0 is the absorbance of the control, A1 is
the absorbance of the sample, and A2 is the background absorbance of the sample.
The determination of reducing power was carried out according to the method of
Yen and Chen [13]. The reducing power was calculated as following: Reducing
power = A1 − A2, where A1 is the absorbance of the sample, A2 the absorbance of
the reagent blank without potassium ferricyanide.
In this study, the effect of ethanol concentration on the extraction yield of TF from
hemp leaves was investigated and prepared different concentrations of ethanol (40,
50, 60, 70, 80%), when other experimental parameters were set as follows: the ratio
560 J. Cao et al.
The choice of liquid-to-solid ratio to raw material was another important step [15].
In this study, effect of different ratio of liquid to material (20:1, 25:1, 30:1, 35:1 and
40:1) on the extraction yield was investigated. The results were displayed in
Fig. 1b. It was observed that the recovery of TF yield was maximized at a
liquid-to-solid ratio of 35:1 (mL/g). A ratio of 30–40 (mL/g) was further used in the
optimization of process parameters during MAE.
Extraction temperature was, respectively, set at 40, 50, 60, 70, 80 °C to examine the
influence of different temperature on the yield of TF. Figure 1d indicated that the
yield of TF rose gradually with the increase of temperature, reached the peak at 60 °
C, and finally dropped from 50 to 70 °C.
The experiment design and corresponding response date for TF content from
China-hemp leaves are presented in the Table 1.
All 29 of the designed experiments were conducted for optimizing the four
individual parameters in the current BBD. By applying multiple regression analysis
on the experimental date, the response variables and the best variables were related
by the following second-order polynomial equation:
where Y, X1, X2, X3 and X4 were the coded valued of yield of TF, ethanol con-
centration, liquid solvent to solid ratio, extraction time and extraction temperature,
respectively.
The analysis of variance (ANOVE) for the experimental results of TF yield from
China-hemp leaves were given in Table 3. It shows that the model is significant at
F-value of 23.69. There is only a 0.01% chance that a “Model F-Value” this large
could occur due to noises. The determination coefficient (R2) was 0.9595, which
implied that the sample variations of 95.95% for the MAE efficiency of TF were
attributed to the independent variables, and only 4.05% of the total variations could
not be explained by the model. However, a large value of R2 does not always
indicate that the regression model is a sound one. Here, the Adj.R2 value was 0.919,
which meant most variation (>91.9%) of TF yield could be predicted by the models,
while only 8% variation could not be explained by the model.
562 J. Cao et al.
Table 3 Estimated regression coefficients for the quadratic polynomial model and the analysis of
variance (ANOVE) for the experimental results of total flavonoids yield from China-hemp leaves
Source Sum of Degree of Mean F-Value P-Value
squares freedom square (Prob>F)
Model 3.02 14 0.22 23.69 <0.0001
X1 0.86 1 0.86 94.41 <0.0001
X2 0.057 1 0.057 6.31 0.0249
X3 0.16 1 0.16 17.7 0.0009
X4 1.2 1 1.2 131.61 <0.0001
X1 X2 1.60E-03 1 1.60E-03 0.18 0.6813
X1 X3 0.16 1 0.16 17.16 0.001
X1 X4 6.40E-03 1 6.40E-03 0.7 0.4156
X2 X3 2.25E-04 1 2.25E-04 0.025 0.8773
X2 X4 8.10E-03 1 8.10E-03 0.89 0.3613
X3 X4 2.50E-05 1 2.50E-05 2.75E-03 0.9589
X21 0.5 1 0.5 54.53 <0.0001
X22 0.025 1 0.025 2.7 0.1228
X23 0.16 1 0.16 17.47 0.0009
X24 0.04 1 0.04 4.45 0.0534
Residual 0.13 14 9.10E-03
Lack of fit 0.11 10 0.011 1.93 0.2757
Pure error 0.022 4 5.470E-003
Cor total 3.14 28
R2 0.9595
Adj.R2 0.919
Pred.R2 0.7959
Adequate 17.08
precision
The 3D response surface and 2D contour profiles for flavonoids extraction from
China-hemp leaves were presented in Figs. 2a–f and 3a–f. It has reported that the
3D response surface plots and 2D contour plots are able to reflect the effects of
multiple independent variables and sensitiveness of response value toward the
change of variables [17]. For example, if the response surface was more steeper, its
influence on response value is extremely significant. The elliptical shape of contour
plots was more significant than that of circular ones.
Figures 2a and 3a showed the combined effect of ethanol concentration (v/v) and
the ratio of solvent volume to solid on the extraction yield of TF. The yield of TF
increased with the increasing of ethanol concentration from 40 to 70%, then
decrease when ethanol concentration continues to increase. The reason for this is
that the appropriate concentration of ethanol could provide the most suitable
Optimization of Microwave-Assisted Extraction … 563
Fig. 2 Response surface plots showing the effect of X1 (ethanol concentration, %), X2
(solvent-to-solid ratio, mL/g), X3 (extraction time, min), X4 (extraction temperature, °C) to the
total flavonoids on the response yield
polarity for flavonoid glucosides. The result was in consistent with the previous
finding [18]. When the ratio of sovent to solid increased in the range from 34:1 to
40:1 mL/g, the yield of TF decreased. Therefore, the optimum ratio was 34:1 mL/L
for the extraction of TF, this value was in consistance with the preliminary
experimental result and could be determined for the accurate parameter.
Figures 2b and 3b showed the effects of ethanol concentration (v/v) and
extraction time on the flavonoid extraction yield under the fixed other conditions.
The extraction yield of TF increased with the increase of extraction time from 10 to
25 min, the yield was decreased when the extraction time was more than 25 min.
The yield of TF was increased with the increase of ethanol concentration from 40 to
72%, further enhancing ethanol concentration led to the decrease of TF yield.
Figures 2c and 3c presented the effects of ethanol concentration and extraction
temperature on the TF yield under the fixed other conditions. It could be seen that at
lower ethanol concentration (below 50%), the TF yield changed little as extraction
temperature improved. However, at higher ethanol concentration (50–60%), the TF
yield increased significantly with the increase of extraction temperature.
Figures 2d and 3d depicted the effects of the ratio of solvent to solid and
extraction time on the TF yield of TF under the fixed other conditions. It indicated
that variation of extraction time has a marked effect on the TF yield. However, at
low level of extraction time (from 10 to 15 min), the ratio of solvent to solid had
little influence on the TF yield.
564 J. Cao et al.
Fig. 3 Contour plots showing the effect of X1 (ethanol concentration, %), X2 (solvent-to-solid
ratio, mL/g), X3 (extraction time, min), X4 (extraction temperature, °C) to the total flavonoids on
the response yield
Figures 2e and 3e showed effect of the ratio of solvent to solid and extraction
temperature on the yield of TF under the fixed other conditions. It revealed that the
ratio of solvent to solid had little influence on the TF yield. However, the TF yield
was linearly increased with the extraction temperature increment.
Figures 2f and 3f showed the effects of extraction temperature and extraction
time on the yield of TF under the fixed other conditions. It can be seen that
extraction time and extraction temperature exhibited a significant effect on TF yield.
The maximum yield of TF was achieved when the process operated at extraction
temperature of 70 °C for 20 min of extraction time.
In this study, the optimal microware extraction condition for obtain maximal yield
of TF predicted by the quadratic model was as follows: ethanol concentration of
69.15%, solvent-to-solid ratio of 31.69 mL/g, extraction time of 25.14 min and
extraction temperature of 69.96 °C. The predicted extraction yield of TF was
3.06%, which was consistent with the experimental yield of 3.04 ± 0.62%.
Optimization of Microwave-Assisted Extraction … 565
Fig. 4 Antioxidant activity assay: a scavenging effects on DPPH; b reducing power; c ABTS
radical cation inhibition activity. a Vc; b BHT; c HL-95E; d HL-60E; e HL-30E. Each value is the
mean ± SD of triplicate measurements
The hemp leaves powder (10 g) was respectively extracted by different concen-
tration aqueous ethanol (95, 60, 30%) at 60 °C for 2 h. After filtration, the
supernatants were concentrated and vacuum dried to obtain HL-95E (95% ethanol
extraction), HL-60E (60% ethanol extraction), HL-30E (30% ethanol extraction),
respectively.
The DPPH radical-scavenging activity of HL-95E, HL-60E, HL-30E were
investigated at different concentrations (0.2–1.0 mg/mL) and the results were pre-
sented in Fig. 4a. In the results, Vc showed obvious scavenging activity and BHT,
HL-95E, HL-60E, HL-30E showed scavenging activity on DPPH radical in a
concentration-dependent manner. HL-95E, HL-60E and HL-30E showed a linear
increase in scavenging activity with increase sample concentration, and exhibited
under Vc and BHT. It was found that the ability to scavenge DPPH radical were in
order of HL-95E > HL-60E > HL-30E.
The reducing capacity of HL-95E, HL-60E and HL-30E always showed lower than
Vc and BHT and indicated relatively low of its potential antioxidant activity. In
Fig. 4b, the absorbance at 700 nm increased with the concentration of HL-95E,
HL-60E and HL-30E. At 1.0 mg/mL, the reducing power of HL-95E, HL-60E and
HL-30E was only 0.504, 1.079 and 1.146 respectively.
566 J. Cao et al.
ABTS inhibition activity of HL-95E, HL-60E, HL-30E were carried out and
showed in Fig. 4c. These samples exhibited an interesting ABTS radical cation
inhibition activity and were found active close to each other. It was found that
the ability to inhibit ABTS radical cation were in order of HL-60E >
HL-30E > HL-95E.
4 Conclusion
In this work, the microwave-assisted extraction (MAE) method was used to extract
TF from China-hemp leaves. Based on single factor experiment and RSM analysis,
the optimum technology parameters of MAE for extracting TF were obtained. The
optimized results are as follows: ethanol concentration of 69.15%, solvent-to-solid
ratio of 31.69 mL/g, extraction time of 25.14 min and extraction temperature of
69.96 °C. Under these conditions, a maximum TF yield was 3.04 ± 0.62%.
The RSM could successfully model and optimize extraction process of TF from
China-hemp leaves.
Additionally, the antioxidant activity of TF obtained from different concentration
ethanol was evaluated in vitro by scavenging capacity of DPPH, ABTS, and
reducing power. It is revealed that the ethanol concentration has significant effects
on the antioxidant activity of TF. This result should be useful to further develop and
apply China-hemp leaves resource.
Acknowledgements This research was financially supported by the Research Project of People’s
Liberation Army (No. AX110C002 and BX115C007).
References
1 Introduction
With the development of aquaculture, more and more intensive farming methods
have instead of traditional fish farming mode. However, the high stocking density
can result in deterioration of water quality and rapid growth of aquatic animal
pathogenic bacteria, thereby causing disease outbreaks. To avoid economic loss
caused by diseases, antibiotics are being used as prophylactic and therapeutic agent.
The use of antibiotics can lead to the development of drug-resistant bacteria and
residues of drugs in fish and in environment, which are potentially risky to human
[1, 2]. Consequently, it is urgent to look for safer agent, instead of antibiotic, to
fight the fish pathogens.
The antibacterial peptides (APMs) was first found in Hyalophora cecropia, and then
named cecropin in 1981 by Steiner and Boman [3], thereafter, a variety of AMPs were
reported in various organisms including bacteria, fungi, plants and animals and have
been found to defend against invading bacteria, viruses and fungi [4]. AMPs, relatively
low molecular mass, either inducible or constitutive [5], have also been found to display
stable physical and chemical properties, broad-spectrum antimicrobial activity and do
not induce de novo bacterial resistance, which make AMPs a novel class of antimi-
crobials, particularly, an eco-friendly green antibacterial agents [6].
In teleost fish, innate immune system is very important and believed to be the
first line of fish in opposing pathogenic organisms [7]. In innate immune system,
endogenous AMPs are regarded as the earliest and fundamental immune molecules
and exist widely in tissues and organs under physiologic and pathologic conditions
[8]. African catfish, Clarias gariepinus, belonging to Siluriformes, Clariidae,
Clarias, is rapid growth and high resistant to disease [9] and had become one of the
most important fish in aquaculture in China since it was introduced to China in
1981 [10]. Owing to the fish muscle with high protein and low lipid content as well
as absence of intramuscular bones [9], marketable size of the fish were supplied to
processing industries. Fishery processing industries generate large amount of
wastes such as viscera, skin, gill, blood and so on. To avoid wasting these fish
wastes, various disposal methods have been applied in producing high added value
products [11]. Interestingly, bio-active antibacterial compounds were obtained from
C. gariepinus wastes with 70% saturation ammonium sulphate salting-out [12] and
acidic extracts [13].
Ammonium sulphate [(NH4)2SO4] fractionation, is generally utilized as the
initial step in the isolation of proteins/peptides from various tissues, which provides
a rapid and inexpensive method for concentrating large starting volumes. Stepwise
precipitation with (NH4)2SO4 is an effective way to fractionate proteins into similar
molecular weight populations, and the higher the (NH4)2SO4 saturation is, the lower
molecular weight proteins/peptides will be obtained [14, 15].
Therefore, this study was carried out to investigate the effects of reducing steps
of fractionated precipitation with (NH4)2SO4 on the yields and antibacterial activ-
ities of proteins/peptides isolated from C. gariepinus wastes at 80 and 100% sat-
urated ammonium sulphate solutions.
Healthy fish were obtained from Deren aquaculture center, Tianjin, China. The fish
were reared at 180 kg/m3 in static aerated concrete pond at temperature of 25 ± 1 °
C. Fish body weight was 287.45 ± 69.46 g, body length was 32.06 ± 3.72 cm at
the sampling time.
The C. gariepinus wastes, namely, gill, suprabranchial organ and viscera
including hepatopancreas, spleen, kidney, head kidney and alimentary tract were
collected and washed gently in cold sterilized 0.85% NaCl and intestinal contents
were flushed out gently with same solution. After that, these tissues were pooled
and stored at −20 °C for subsequent proteins/peptides extraction. The fish were
anesthetized with MS-222 (tricaine methanesulphonate, sigma) before dissecting.
Comparison of Different Protocols of Gradient Ammonium Sulfate … 571
A total of 100 g C. gariepinus wastes were homogenized in 500 ml PBS buffer (pH
6.0, 0.02 mol/L), heated to 80 °C and stirred for 30 min, then centrifuged at
8000 rpm for 20 min at 4 °C. The supernatant was dispensed in 3 equal volumes
into 500 mL beakers, and termed as S1, S2 and S3. Solid (NH4)2SO4 was slowly
added to the S1, S2 and S3. The saturation level of (NH4)2SO4 were adjusted
stepwise to 20, 40, 60, 80 and 100% for S1; to 40, 60, 80 and 100% for S2 as well
as to 60, 80 and 100% for S3, respectively. Each saturation solution was allowed to
stand for 6 h at 4 °C except that 40% saturation of S2 was stood for 12 h and 60%
saturation of S3 was stood for 18 h. The precipitated crude proteins/peptides were
collected by centrifugation at 10,000 rpm for 15 min at 4 °C, corresponding pre-
cipitated fractions were named as S1P-20, S1P-40, S1P-60, S1P-80 and S1P-100
obtained from S1; S2P-40, S2P-60, S2P-80 and S2P-100 obtained from S2; S3P-60,
S3P-80 and S3P-100 obtained from S3; respectively. The precipitates were sepa-
rately dissolved in sterile deionized water and dialyzed in 1000 molecular weight
cut-off dialysis bag against sterile deionized water for 24 h at 4 °C with changes of
sterile deionized water per 2–3 h in order to remove (NH4)2SO4. All of dialyzed
crude proteins/peptides fractions were lyophilized, weighed and kept at −20 °C.
The data of the weight of dialyzed crude proteins/peptides fractions were
expressed as means ± SD and subjected to one-way analysis of variance. After
variance analysis, means were compared using Duncan test, with the differences
considered to be statistically significant at p < 0.05. All statistical analyses were
performed using the software SPSS version 11.5 for Windows.
3 Results
4 Discussion
Fish possess both an innate and adaptive immune system, however, the innate
immune system is an extremely important compared to adaptive immune system in
fish [17]. Antimicrobial peptides, either inducible or constitutive [5], are key
parameters and at the forefront of the innate immune system, which act against
bacterial infection, killing bacteria by disrupting the cell membrane [18]. C.
gariepinus possess high disease resistance at high stocking density [9], and in
Fig. 4 Coomassie brilliant blue R-250 stained SDS-PAGE of crude proteins/peptides fractionated
with (NH4)2SO4 from C. gariepinus wastes. Lane M broad range protein markers. Lane 1–5 in a:
S1P-20–S1P-100; Lane 1–4 in b: S2P-40–S1P-100; Lane 1–3 in c: S3P-60–S3P-100. Numbers on
the left side of the gels correspond to the molecular weight of the markers
From the figures of the SDS-PAGE, there were not significantly different pat-
terns among the samples of S1P-80, S2P-80 and S3P-80 as well as among S1P-100,
S2P-100 and S3P-100. The protein profiles of these samples showed a broad range
of proteins/peptides with molecular weights ranging from over 66 kDa to less than
6.5 kDa. It means that the molecular weights of crude proteins/peptides obtained
with gradient (NH4)2SO4 salting-out from C. gariepinus wastes were wide range.
Abundant proteins/peptides with molecular weights of 26, 9.5 and 5.5 kD were
observed in S3P-80 and S3P-100. The antibacterial proteins of 27 and 31 kD from
the skin mucus of Cyprinus carpio [22], antibacterial proteins of 15.5 and 30 kD
from the skin of Ictalurus punctatus [23], and various bio-active peptides with
antimicrobial activities in fish were reported [24]. Therefore, the work on the 26,
9.5 and 5.5 kD proteins observed in this paper is being further studied in our
laboratory for understanding their other characteristics. On the other hand, the crude
proteins/peptides extracts with antibacterial activities from C. gariepinus wastes
will be used as feed additive in order to test whether the extracts can enhance the
fish resistance to pathogens infection.
In conclusion, in order to obtain relatively low-molecular weights antibacterial
proteins/peptides from C. gariepinus wastes by using gradient ammonium sulphate
precipitation technique, according to the results of yield, antimicrobial activity and
protein profile on the SDS-PAGE, and simultaneously taking into account the
convenience of operation, we propose that the fish wastes could be precipitated
initially at 60% saturation. The data of the present and our previous studies [12, 13,
25] highlight the evidence that antimicrobial proteins/peptides in C. gariepinus
consist of a range of molecular weight of proteins, and the wastes of the fish have a
potential to be used as a valuable source for extracting antibacterial
proteins/peptides.
Acknowledgements This work was supported by natural science foundation of Tianjin, China
(No. 15JCZDJC33500), and partly supported by the innovative talent cultivation plan for young
and middle-aged in Tianjin higher educational institutions (Fisheries resources utilization and
ecological remediation).
References
1. Smith P, Hiney MP, Samuelesen OB (1994) Bacterial resistance to antimicrobial agent used in
fish farming: a critical evaluation of method and meaning. Annu Rev Fish Dis 4:273–313
2. Alderman DJ, Hasting TS (1998) Antibiotic use in aquaculture: development of antibiotic
resistance—potential for consumer health risks. Int J Food Sci Tech 33(2):139–155
3. Steiner H, Hultmark D, Engström Å et al (1981) Sequence and specificity of two antibacterial
proteins involved in insect immunity. Nature 292(5820):246–248
4. Radek K, Gallo R (2007) Antimicrobial peptides: natural effectors of the innate immune
system. Semin Immunopathol 29:27–43
5. Andreu D, Rivas L (1998) Animal antimicrobial peptides: an overview. Biopolymers 47
(6):415–433
Comparison of Different Protocols of Gradient Ammonium Sulfate … 577
6. Amy TYY, Shaan LG, Robert EWH (2011) Multifunctional cationic host defence peptides
and their clinical applications. Cell Mol Life Sci 68:2161–2176
7. Whyte SK (2007) The innate immune response of finfish: a review of current knowledge. Fish
Shellfish Immun 23:1127–1151
8. Lauth X, Shike H, Burns JC et al (2002) Discovery and characterization of two isoforms of
moronecidin, a novel antimicrobial peptide from hybrid striped bass. J Biol Chem 277
(7):5030–5039
9. Prokešová M, Drozd B, Kouřil J (2015) Effect of water temperature on early life history of
African sharp-tooth catfish, Clarias gariepinus (Burchell, 1822). J Appl Ichthyol 31(Suppl.
2):18–29
10. Li HY, Deng XH, Ye W et al (1984) Introduction of good freshwater fish—Clarias
gariepinus (in Chinese). Freshwater Fisheries 1:7–12
11. Rebah FB, Miled N (2013) Fish processing wastes for microbial enzyme production: a
review. Biotech 3:255–265
12. Wang X, Dai W, Xing K et al (2012) Antibacterial activities of antibacterial proteins/peptides
isolated from organs and mucus of Clarias gariepinus reared at high stocking density. Adv
Mater Res 455–456:455–460
13. Wang Y, Xu Y, Mei J et al (2015) Optimization of extraction conditions for crude
antibacterial proteins/peptides from Clarias gariepinus by-products. LNEE 333:547–555
14. Barsukov AK, Barmin AV, Kuznetsov AI et al (2009) The isolation of immunoglobulin G
and albumin protein standards and the study of their oligomerization and antigenity during
storage in saturated ammonium sulfate solution. Appl Biochem Micro 45(3):343–348
15. Kent Ute M (1995) Purification of antibodies using ammonium sulfate fractionation or gel
filtration. Methods Mol Biol 34:13–21
16. Xia Q, Zeng R (2004) Protein chemistry and proteomics (in Chinese). Science Press, Beijing
17. Magnadottir B (2010) Immunological control of fish diseases. Mar Biotechnol 12:361–379
18. Maier VH, Dorn KV, Gudmundsdottir BK et al (2008) Characterisation of cathelicidin gene
family members in divergent fish species. Mol Immunol 45(14):3723–3730
19. Zheng J, Meng Q, Wang J (2008) Study on extraction of antimicrobial peptid and its
antibacterial activity (in Chinese). Food Res Dev 29(10):51–53
20. Liu Y, Huang Q, Yang Z et al (2007) Screening of antibacterial peptides from cactuses and
characterization of antimicrobial peptide MH-AMP-1 purified from Mammillaria haw (in
Chinese). J Sichuan Agric Univ 25(9):271–276
21. Jiang H, Zhang G (2011) Purification and antimicrobial activity of a natural antimicrobial
peptide from bamboo leaves (in Chinese). Food Ind 5:12–14
22. Lemaître C, Orange N, Saglio P et al (1996) Characterization and ion channel activities of
novel antibacterial proteins from the skin mucosa of carp (Cyprinus carpio). Eur J Biochem
240(1):143–149
23. Robinette D, Wada S, Arroll T (1998) Antimicrobial activity in the skin of the channel catfish
Ictalurus punctatus: characterization of broad-spectrum histone-like antimicrobial proteins.
Cell Mol Life Sci 54:467–475
24. Altınelataman C, Torkova A, Tsentalovich M (2015) Fish derived bio-active peptides and
their metabolic effects. Ege J Fish Aqua Sci 32(4):217–223
25. Wang X, Dai W, Chen Ch et al (2012) Analysis of antibacterial activities of antibacterial
proteins/peptides isolated from serum of clarias gariepinus reared at high stocking density.
LNEE 137:303–309
Screening of Microbial with the Ability
of Epothilones Biotransformation
1 Introduction
Sorangium cellulosum is a microbial strain kept at our laboratory and is used for the
fermentation and production of epothilone A and B. The wild type Burkholderia
sp. and wild type Bacillus megaterium are isolated and purified in our laboratory.
The PDA medium (200 g potatoes chopped into slices and boiled for 30 min,
filtered, added with 20 g glucose and 15 g agar, diluted to a constant volume of 1 L
using deionized water, mixed, adjusted pH to 7.2 with 1 mol/L NaOH, and ster-
ilized at 115 °C for 30 min) and LB medium (10 g tryptone, 5 g yeast extract, 5 g
NaCl and 15 g agar. Adjusted pH to 7.2 with 1 mol/L NaOH and diluted to a
constant volume of 1 L with deionized water. Sterilized at 121 °C for 20 min) are
chosen as the solid culture medium for microbial isolation and purification. The
fermentation culture medium for Sorangium cellulosum is CNST culture medium
(0.5 g KNO3, 0.65 g Na2HPO4, 1.0 g MgSO4 7H2O, 1 ml FeCl3, 1 ml solution of
trace elements, 15 g agar. Diluted to a constant volume of 1 L with deionized water.
Adjusted pH to 7.2 with 1 mol/L NaOH. Sterilized at 121 °C for 20 min).
Adequate amounts of soil in different environments are obtained and suspended into
sterile water. The supernatant is made into serial dilutions and is spread on PDA
and LB culture plates. After incubating for 2 days at 33 °C, single colonies are
picked and cultured. The purified microorganisms are preserved.
Screening of Microbial with the Ability … 581
The Sorangium cellulosum is inoculated on the solid CNST culture medium and
incubated for 4 days. A layer of sterilized resin is laid on top and the incubation is
continued for another 6 days. The resin is collected and dried at 30° C before
desorbed by methanol to dissolve epothilone A and B. The methanol solution is
subsequently dried with a rotary evaporator, and the obtained epothilone A and B
are dissolved in anhydrous ethanol. The solution is stored at 4 °C for future use.
Three experimental groups were setted for screening (Fig. 1). The purified
microorganisms from 2.2 are inoculated in 25 mL liquid medium, while at the same
time a 0.5 mL of ethanol solution containing epothilone is added into the medium
(No. 3). Two experimental control groups are set up for comparison: one is 25 mL
medium added with 0.5 mL ethanol solution of epothilones but with no microor-
ganism inoculation (No. 1), and the other one is 25 mL medium added with 0.5 mL
of anhydrous ethanol and inoculated with the purified microorganism. The three
sets of groups are incubated simultaneously at 32 °C for 5 days on a 180 r/min
shaker. The collected zymotic fluid is mixed with methanol by 1:1 and the
supernatant is obtained by centrifugation in order remove the precipitating sugars
and proteins in the culture medium. Subsequently, the supernatant is analyzed by
HPLC. After comparing the three groups, the sample with new peak near the
epothilone A and B in the No. 3 group was selected and the genome DNA of
Fig. 2 The chromatogram map of HPLC (1 medium + epothilones 3.1: midium + Burkholderia c
sp. + epothilones. 2.1: midium + Burkholderia sp. 3.2: midum + B. megatherium + epothilones.
2.2: midium + B. megatherium. 3.3: midium + P. polymyxa + epothilones. 2.3:
midium + P. polymyxa. 3.4: midium + A. minutus + epothilones. 2.4: midium + A. minutus.
3.5: midium + K. variicola + epothilones. 2.5: midium + K. variicola.)
corresponding microorganismswas isolated. Using 27F and 1492R primers, the 16s
rDNA fragment was amplified and compared with Blast in NCBI.
The HPLC measurement was done with a Japanese SHIMADZU LC-20A HPLC
machine. Column: Agilent column, RP-C18 filler, particle size of 5 lm,
4.1 250 mm; mobile phase: methanol: water = 6:4; flow rate: 1.0 mL/min;
detection wavelength: 249 nm; column temperature: 35 °C; injection volume:
20 lL.
The LC-MS measurement was done using Agilent 6530 QTOF machine. LC
Methods: Agilent column, ProeshelllC18 filler, particle size of 2.7 lm,
3.0 100 mm; mobile phase: 0.1% formic acid solution in water/methanol gra-
dient elution, flow rate: 0.3 mL/min; detection wavelength: 249 nm; column tem-
perature: 35 °C, injection volume: 20 lL. MS conditions: Source: AJS ESI, Gas
temp: 325 °C, Drying Gas: 6 L/min, Sheath gas: 350 °C, Sheath gas flow:
11 L/min, Nebulizer: 35 psig, Vcap: 3500 V, Nozzle voltage: 500 V.
We got 5 microbes for the biotransformation of epothilone A and B, and they are:
Burkholderia sp., B. megatherium, P. polymyxa, K. variicola, and A. minutus.
As shown by the HPLC chromatogram map (Fig. 2), new peaks near epothilone
A and B can be seen in all culture media for these five types of microbes (3.1–3.5)
and the amount of epothilone A and B decreased significantly in experiment
group. However, in the two control groups, there are no peaks at the same time
points (1, 2.1–2.5), peaks are related to the same substance.
The new product and the epothilone B subsequently underwent MS/MS scan-
ning, and the Mass chromatogram show that the structures of the two have a high
degree of similarity (Fig. 3). The structure analysis by MSC (Molecular Structure
Correlator of Agilent) resulted in a molecular formula of C27H43NO7S for the new
substance. The chemical structure formula is shown in Figs. 4 and 5 and it can be
seen that the epoxy ring at positions C12–C13 opens and becomes two hydroxyl
groups on the basis of epothilone B. It is suspected that the new substance is
transformed from epothilone B, and its structural formula is speculated in Fig. 6.
Screening of Microbial with the Ability … 583
584 M. Zhang et al.
Fig. 4 Comparison of structure between new product and epothilone B, A is the MS/MS
spectrometry of the new product. B is the MS/MS spectrometry of epothilone B
Sefkow et al. [10] has obtained a new analogue of epothilone by modifying the
12C–13C epoxy group of epothilone A with complex chemical methods.
Karl-Heinz A et al. [11] have analyzed the anticancer activity of this new epothilone
and the results showed that the activity is greatly reduced. But based on this
structure, Altmann et al. [12] has synthesized an epothilone analogue with a better
anticancer activity by chemical ketone reduction at the 12C–13C position. Altmann
et al. [13] has pointed out that the opening of 12C–13C ring makes the confor-
mation of epothilone analogues more flexible, thus making it possible to synthesize
more epothilone analogs.
It is a new way to develop new medicines with similar functions as epothilones by
transforming structure of epothilones with microorganisms. We will analyze the
antitumor activity of the new medicines with similar functions as epothilones, and try
to convert other drugs with the epoxy group Burkholderia sp. and B. megatherium so
Screening of Microbial with the Ability … 585
Acknowledgements The work was financially supported by Shandong Provincial Key Research
and Development Program (No. 2015ZDZX05001, 2015ZDXX0502B01, 2015ZDXX0403B01,
2016GGB01409), National Natural Science Foundation (No. 31501396), Shandong Provincial
Natural Science Foundation (No. ZR2012CQ027).
586 M. Zhang et al.
References
1. Yan JQ, Dai HM (2012) Review of the R&D and technology innovation of epothilones as
new drugs. Chin J New Drugs 21:2241–2249
2. Kolman A (2005) Acitivity of epothilones. Curr Opin Ivestig Drugs 6:616–622
3. Klar U, Platzek J (2011) Asymmetric total synthesis of the epothilone sagopilone-from
research to development. Acc 23:1291–1299
4. Hegazy MF, Mohamed TA, Eishamy AI et al (2015) Microbial biotransformation as a tool for
drug development based on natural products from mevalonic acid pathway: a review. J A R
6:17–33
5. Holland HL (1998) Microbial transformations. Curr Opin Chem Biol 2:77–88
6. Tang L, Qiu RG, Katz L (2003) Generation of novel epothilone analogs with cytotoxic
activity by biotransformation. J Antibot 56:16–23
7. Sohng JK, Kim BG, Ramesh PP et al (2016) Enzymatic synthesis of lactosylated and
sialylated derivatives of epothilone A. Glycoconj J 33:137–146
8. Sohng JK, Parajuli P, Pandey RP (2014) Enzymatic synthesis of epothilone A glycosides.
AMB Exp 4:31–44
9. Altmann KH, Pfeiffer B, Nicolaou KC (2007) The chemistry and biology of epothilones—the
wheel keepsturning. Chem Med Chem 2:396–423
10. Sefkow M, Kiffe M, Hfle G (1998) Derivatization of the C12–C13 functional groups of
epothilones A, B and C. Bioorg Med Chem Lett 8:3031–3036
11. Karl-Heinz A, Guido B, Giorgio C et al (2000) Epothilones and theiranalogs-potential new
weapons in the fight against cancer. Chimia Int J Chem 54:612–621
12. Altmann KH (2009) Semisynthetic derivatives of epothilones. Fortschr Chem Org Naturst
90:135–156
13. Altmann KH, Gaugaz FZ, Schiess R et al (2011) Diversity through semisynthesis: the
chemistry and biological activity of semisynthetic epothilone derivatives. Mol Divers 15:
383–399
Isolation, Screening and Evaluation
of Potential Biocontrol Endophytes
Against Ralstonia solanacearum on Ginger
1 Introduction
Ginger (Zingiber officinale Rosc.), a perennial herb, its extract has the activity of
antibacterial, antioxidant, antiviral, anticancer, etc. Bacterial wilt caused by R.
solanacearum is one of the major limiting factor in the cultivation of ginger. The
peak of occurrence and prevalence about ginger wilt is from June to August, which
has the characteristics of infecting easily and rapidly by R. solanacearum [1].
However, weight and bulk of the ginger tuber increase rapidly in the period, thus,
the occurrence of diseases is easy to reduce the production of ginger. The common
management strategies to control the ginger wilt include the adoption of resistant
varieties, crop rotation and the use of synthetic chemical fungicides [2, 3].
However, considering the limitations of these methods, it seems appropriate to
search for an alternative control strategy. Biocontrol approach using antagonistic
microorganisms against the pathogen is now increasingly considered as an ideal
treatment to manage plant diseases [4].
Plant endophyte can be defined as those microbe that colonize the internal tissue
of the plant showing no external sign of infection or negative effect on their host [5,
6]. Plant endophyte are widely found in the root, stem, leaf, fruit and other organs,
which have the characteristics of wide distribution, multiple species and abundant
secondary metabolites. At present, scientists have proved that cotton, rice, potatoes,
tomatoes, peppers and other plants [7] are host to one or more endophytes, and,
Ning Zhou and Lin Zhao have contribute equally to this paper.
some of these endophytes play a significant role to control plant diseases. A lot of
studies have shown that niche exclusion, substrate competition, inducing plant
resistance and production of secondary metabolites including antibiotics and
siderophores make positive contribution in the control of pathogens by the antag-
onistic organism [2].
In this study, endophytes were isolated and screened from ginger (Shandong
Laiwu, China). Our objectives were to assess the ability of different endophytes to
control R. solanacearum in ginger, and provided a scientific basis for the prevention
and treatment of ginger disease.
The healthy tuber of ginger were collected from Ginger-growing Region in Laiwu,
Shandong Province, China. The collected samples were placed in plastic bags and
stored in a freezer at 4 °C.
R. solanacearum was gifted from the Institute of Vegetables and flowers Chinese
Academy of Agricultural Sciences.
2.3 Medium
hole, with the sterile water in another hole as the control. These plates were cultured
in incubator at 28 °C for two days, and then, we observe and measure the size of
inhibition zone.
The morphological traits of strains BJ-1 and BJ-31 were observed under the
microscope after dyeing. Twelve physiological and biochemical tests of strains
BJ-1, BJ-31 for bacterial identification were implemented with the following
experimental index: xylose, fructose, mannitol, glucose, V.P., citrate, gelatin
hydrolysis, H2S, nitric acid reduction, tyrosine hydrolysis, starch hydrolysis and
catalase test [9].
The genomic DNA of endophytes: BJ-1 and BJ-31 were isolated using Ezup
Column Bacteria Genomic DNA Purification Kit (Sangon Biotech, Shanghai,
China) respectively. An approximately 1.5 kb sequence of the bacterial 16SrDNA
gene was amplified using the primers 27f (5′-AGAGTTTGATCCTGGCTCAG-3′)
and 1492r (5′-GGTTACCTTGTTACGACTT-3′). The PCR amplification was
performed in a 50 µL reaction mixture containing 25 µL 2 Easy pfu PCR
SuperMix, 1 µL forward primer(10 µM), 1ul reverse primer(10 µM), 1 µL of
template DNA, 22 µL of sterile double-distilled water. The PCR cycling protocol
consisted of an initial denaturation at 94 °C for 4 min, followed by 30 cycles at
94 °C for 30 s, 55 °C for 30 s, 72 °C for 3.5 min, followed by a final step at 72 °C
for 10 min. The PCR products were purified using SanPrep Column DNA Gel
Extraction Kit (Sangon Biotech, Shanghai, China). These purified products were
sequenced by Sangon Biotech (Shanghai, China). The 16S rDNA gene sequence of
strains BJ-1 and BJ-31 were aligned with the reference sequences available in the
Nucleotide Database of the National Center for Biotechnology Information (NCBI).
Phylogenetic analysis was performed using the Neighbor-Joining (NJ) method with
the MEGA software.
3 Results
The effect of surface sterilization and the number of isolated endophytes are the
basis of the separation experiment of plant endophytes. Results shown, when ginger
tubers were disinfect with different concentration of sodium hypochlorite and dif-
ferent processing time, that 3% sodium hypochlorite for 2 min is the best disin-
fection condition for the isolation of ginger endophyte, and the number of isolated
endophytes is maximum (Table 1). In addition, it also proved that the concentration
of sodium hypochlorite and disinfection time have significant effect to the sepa-
ration of plant endophyte.
In the study, a total of 39 endophytic bacterial isolates including ten strains of
Bacillus (Table 2) and 2 endophytic actinomycetes were obtained, and fungal was
not found, which is consistent with the result from Chu min [10]. In general, the
method of tissue block is adopted for the isolation of endophytic fungi. Therefore,
no fungi were found in this study, which may be associated with the separation
method of endophytes.
Table 1 Surface sterilization rate of different sterilization (a) conditions and number of
endophytes (b)
Concentration of sodium hypochlorite Index Processing time
2 min 5 min 10 min 15 min
1% NaClO a 30.2% 75.6% 100% 100%
b 0 0 0 20
3% NaClO a 100% 100% 100% 100%
b 32 28 20 15
5% NaClO a 100% 100% 100% 100%
b 23 18 11 7
10% NaClO a 100% 100% 100% 100%
b 8 5 0 0
Fig. 1 Antagonistic effect of strains BJ-1, BJ-31 against R. solanacearum. a BJ-1, b Sterile water,
c BJ-31, d Sterile water
All the isolates were screened against R. solanacearum causing ginger wilt. We
found that the strains BJ-1 and BJ-31 performed the highest and stable inhibition
activity by analyzing the size of the diameter of the inhibition zone (Table 3). The
antagonistic effect of BJ-1 and BJ-31 against R. solanacearum were shown in Fig. 1.
From the Table 3, most of isolated endophytic Bacillus have obvious antagonistic
activity against R. solanacearum, hence, the result revealed endophytic Bacillus
used as potential biocontrol factor play an important role to control ginger wilt. We
speculated that niche exclusion, substrate competition and the production of
antibacterial substance may be positive factors in the inhibition to R. solanacearum.
Strain BJ-1 has characteristics of larger, flat, moist, G +, short rod, spore-production
on NA medium; strain BJ-31 is small, round, ridgy, dry, G+, short rod,
spore-production on the NA medium (Fig. 2).
Isolation, Screening and Evaluation of Potential Biocontrol … 593
BJ-1 BJ-31
The results of physiological and biochemical tests (Table 4) revealed that strains
BJ-1 and BJ-31 were similar with Bacillus cereus and Bacillus subtilis respectively.
1500 bp PCR products from the 16S rDNA gene were amplified respectively from
the genomic DNA of strains BJ-1 and BJ-31. Sequence analysis showed that strains
BJ-1 and BJ-31 respectively shared 99% identity with B. cereus and B. subtilis in
the NCBI. NJ trees using 16S rDNA sequences were constructed, and the results
clearly showed that strains BJ-1, BJ-31 clustered with the genus Bacillus (Fig. 3).
594 N. Zhou et al.
Fig. 3 Phylogenetic trees of strain BJ-1 (a) and BJ-31 (b) based on 16S rDNA gene sequences.
The phylogenetic trees were constructed by the neighbor-joining (NJ) method using the MEGA
5.1 software
4 Discussion
Acknowledgements The work was financially supported by Shandong Provincial Key Research
and Development Program (No. 2015ZDZX05001, 2015ZDXX0502B01, 2015ZDXX0403B01,
2016GGB01409), National Natural Science Foundation (No. 31501396), Shandong Provincial
Natural Science Foundation (No. ZR2012CQ027).
596 N. Zhou et al.
References
1. Zhang CL, Zhao YQ, Xiao-Qing YU et al (2008) Screening and identification of antagonistic
actinomyces strains against Ralstonia solanacearum. Acta Phytopathol Sin 38(4):414–419
2. Thomas P, Upreti R (2015) Testing of bacterial endophytes from non-host sources as potential
antagonistic agents against tomato wilt pathogen Ralstonia solanacearum. Adv Microbiol 04
(10):656–666
3. Ohike T, Makuni K, Okanami M et al (2013) Screening of endophytic bacteria against fungal
plant pathogens. J Environ Sci 25(25S1):S122–S126
4. Wang SL, Shih IL, Wang CH et al (2002) Production of antifungal compounds from chitin by
bacillus subtilis. Enzym Microb Technol 31(3):321–328
5. Ryan RP, Germaine K, Franks A et al (2008) Bacterial endophytes: recent developments and
applications. FEMS Microbiol Lett 278(1):1–9
6. Petrini O (1991) Fungal endophytes of tree leaves. Microbial ecology of leaves. Springer,
New York
7. Zhu YJ, Chen L, Lan JL et al (2009) Isolation, identification and the biocontrol potential of
endophyte in theasienensis (camellia sinensis). J Fujian Agric For Univ
8. Kusari P, Kusari S, Spiteller M et al (2014) Biocontrol potential of endophytes harbored in
radula marginata (liverwort) from the new zealand ecosystem. Antonie Van Leeuwenhoek
106(4):771–788
9. Zhou D (1986) Microbiology experimental manual. Shanghai Science and Technology Press
10. Chu M, Zhang ZD, Wang W et al (2011) The diversity of endophytes in ginger and screening
of the antagonism. Xinjiang Agric Sci
11. Hyakumachi M, Takahashi H, Matsubara Y et al (2014) Recent studies on biological control
of plant diseases in japan. J Gen Plant Pathol 80(4):287–302
12. Wang Z, Wang Y, Zheng L et al (2014) Isolation and characterization of an antifungal protein
from bacillus licheniformis, hs10. Biochem Biophys Res Commun 454(1):48–52
Isolation and Molecular Identification
of Lactobacillus brevis from Spoilage Craft
Beer in China
Zhu Liping
Craft beer is a consumed fermented alcoholic beverage produced with water, malted
cereal grains (generally barley and wheat), hops, and yeast. Due to the inclusion of
specialty malt and hop ingredients, a microbrew varies in aroma and flavor from
commercially brewed beer. Craft beer is more fresh, nutritious and complex flavor
than typical light lager beer because of the absence of sterilization and filtration of
Saccharomyces cerevisiae after brewing. Therefore, craft beer is more favorable
and popular than industry beer world widely in recent years. Thousands of craft
beer firms have sprung up in the past several years in China and other countries.
According to the data from Brewers Association, there are 3418 craft brewers in
America in 2014, sales of craft beer was about 2,664,000 tons with up 19.6 billon
dollars in yearly sales, accounting for 11% of total beer production.
Beer is considered an unfavorable substrate of growth for many microorganisms
due to the presence of ethanol, hop, high content of carbon dioxide, low pH (3.8–
4.7), extremely reduced content of oxygen and the presence of only traces of
nutritive substances [1]. However, there are still a limited number of bacteria and
wild yeasts which can grow in beer and result in the production of turbidity and off
flavor. Beer spoilage bacteria reported include the genera Lactobacillus,
Pediococcus, Pectinatus and Megasphaera [1, 2].
Moreover, craft beer seems to be easily spoiled because of without being pas-
teurized or sterile-filtered after fermentation in order to hold special flavor and
nutrient. More important, a considerable amount of small-scale craft beer breweries
are usually lack of good management and quality control system in China. Even if
craft beer happens to spoil and result in turning a little acid, microbrewery perhaps
cannot be found. We encountered several spoilage craft beer in microbrewery in
Z. Liping (&)
School of Bioengineering, Qilu University of Technology, No. 3501, University Road,
Changqing District, Jinan 250353, Shandong, People’s Republic of China
e-mail: [email protected]
The spoilage beer sample was streaked or spread onto MRS agar plates (Difco), all
the plates were incubated under anaerobic conditions (AnaeroPack Rectangular Jar,
Mitsubishi Gas Chemicals, Japan) at 35 °C for 48–72 h. The inoculated MRS agar
was examined every day for the presence of colony formation [3, 4]. Then picked a
typical colony using sterilized toothpicks to inoculate MRS broth (pH 5.5) and
cultured anaerobically at 35 °C for 24 h. Measured pH value of the bacterial media
using a pH meter (SevenCompact™ S210, Mettler, Switzerland).
Applied a smear of bacteria onto a slide, aired dry, heat fixed by passing it
through a flame a few times, stained the bacterial sample with Gram’s Stain Kit, and
then examined under microscope at both 400 and 1000 oil immersion.
Isolation and Molecular Identification of Lactobacillus brevis … 599
The isolate colony was inoculated in MRS broth media and grew at 35 °C for 24 h
on a roller. Took 1 ml of pure bacterial culture into a 1.5 mL microfuge tube,
centrifuged at 10,000g for 2 min at 4 °C, resuspend the sediment in 1 ml of TE
buffer by pipetting gently, pelleted the cells by centrifuging as before. Resuspend
the pellet in 175 µL TE buffer (pH 8) and then mixed and centrifuged. The
supernatant was removed, and then 175 lL of TE buffer and 10 lL of RNase A
(Sigma-Aldrich) were added to resuspend the cell pellet, incubated at room tem-
perature for 10 min. The cells were lysed by the addition of 20 lL of 10% sodium
dodecyl sulphate and 5 lL of a proteinase K solution (20 mg/mL) (Sigma-Aldrich),
followed by a 2 h incubation at 56 °C. Subsequently, 20 lL of 5 M NaCl and
500 lL of TE (pH 8) were added to the samples. The lysate was extracted once with
500 lL of equilibrated phenol, which was mixed for 10 min and then centrifuged.
The supernatant was removed, and the aqueous phase was extracted once more with
500 lL of chloroform:isoamyl alcohol (24:1) and centrifuged. The supernatant was
transferred to a sterile tube and 500 lL of isopropanol was added. The mixture was
centrifuged and the pellet was washed with 10 lL of 70% cold ethanol and cen-
trifuged as before. The pellet was air dried and resuspended in 100 lL of
DNase-free water. Bacterial genomic DNA thus prepared was stored at −20 °C
until used.
Bacterial genomic DNA of the isolate was subjected to PCR analysis. The 16s
rDNA polymerase chain reaction (PCR) amplifications of was performed with
universal primers, 27F (5′-AGAGTTTGATCATGGCTCAG-3′) and 1492R
(5′-TACGGTTACCTTGTTACGACTT-3′) [5, 6]. PCR was performed in a ther-
mocycler (Mastercycler, Eppendorf, Germany).
The PCR amplifications were performed as follows: 2 lL of the PCR template
was used in a 25 lL PCR mixture containing 1 PCR buffer with 2 mM MgCl2,
0.3 mM of dNTPs mixture, 0.2 lM of each primer, and 2.5 units of Taq DNA
polymerase (Invitrogen). PCR amplification was conducted with the following
temperature profile: an initial denaturation of 5 min at 94 °C, 31 cycles of 30 s at
94 °C, 60 s at 55 °C, and 90 s at 72 °C, followed by 5 min at 72 °C. PCR product
was resolved by electrophoresis in a 1% (w/v) agarose gel and visualised by EB
staining [7, 8].
600 Z. Liping
PCR amplified product was purified using a PureLink Quick Gel Extraction Kit
(Invitrogen) according to the manufacturer’s instructions. The product was directly
sequenced on an ABI-PRISM 310 Genetic Analyzer (Applied Biosystems, USA)
according to the manufacturer’s protocol. Ambiguous and incorrectly called bases
were manually corrected using Chromas Lite software (version 2.01) and Seaview
software (version 4.3.3).
The 16s rDNA gene sequence of the isolate was compared with the published
sequences from GenBank DNA database (www.ncbi.nih.gov) for homology using
BLAST algorithm. Sequences from the top BLAST hits were downloaded for
further phylogenetic comparison. Multiple-aligned with 16s rDNA gene sequences
of different strains for similarity using Clustal W 1.81 software program coupled
with MEGA 5 software. A neighbor-joining method was employed to construct the
phylogenic tree using MEGA 5. The stability or accuracy of the inferred topology
was assessed via a bootstrap analysis of 1000 replicates. The identities of the
sequences were determined based on the highest percentage (a minimum of 98%) of
the total nucleotide match with sequences from GenBank.
The isolated strain grew slowly on MRS agar plate, and it forms visible colonies
two days later. Colonies are white, round, convex, regular and 0.5–1 mm in
diameter after 2–3 days growing on MRS agar plate (Fig. 1).
A typical bacterial colony was inoculated in MRS broth media and grew at
35 °C for 24 h, white sediment was found at the bottom of bacterial media culture.
The isolate showed certain acidifying capacity. After growing 24 h, the pH value
of the inoculated bacterial culture decreased from 6.4 to 3.8.
A loop of pure culture of the isolate was taken and plated on a slide, and then
airdried, flame fixed, Gram stained, and microscopic observated. Figure 2 showed
the isolate is Gram positive and short-rod shaped.
Fig. 3 Electrophoresis
detection for 16s rDNA PCR
2 1 bp
product of the spoilage
bacterium (Lane 1, molecular
2000
marker; Lane 2, 16s rDNA 1000
gene from the spoilage
750
bacterium)
500
250
100
phylogenetic tree was constructed using Mega 5. A phylogenetic tree showing the
relationship of the isolate with other Lactobacillus brevis species was shown in
Fig. 4. Heredity evolution analysis showed the isolate belongs to different branch of
Lactobacillus brevis, indicating potentially distinctive characteristics and function
of the Lactobacillus brevis isolate to be further investigated in the future.
Craft beer contaminated by lactobacillus usually happened in microbrewing
plants and was difficult to be realized by some microbreweries. We isolated, cul-
tivated, Gram-staining microscopic examined an isolate bacterium from the spoi-
lage craft beer, determined the pH value change of the isolate grown in MRS broth
media, and further molecularly identified the isolate through 16s rDNA sequencing.
Through the above research, the craft beer spoilage bacterium was isolated and
identified as Lactobacillus brevis.
References
1. Sakamoto K, Konings WN (2003) Beer spoilage bacteria and hop resistance. Int J Food
Microbiol 89(2–3):105–124
2. Haakensen M, Ziola B (2008) Identification of novel hora-harbouring bacteria capable of
spoiling beer. Can J Microbiol 54(4):321–325
3. Suzuki K, Asano S, Iijima K, Kuriyama H, Kitagawa Y (2008) Development of detection
medium for hard-to-culture beer-spoilage lactic acid bacteria. J Appl Microbiol 104(5):
1458–1470
4. Bartowsky EJ, Xia D, Gibson RL, Fleet GH, Henschke PA (2003) Spoilage of bottled red wine
by acetic acid bacteria. Lett Appl Microbiol 36(5):307–314
5. Wilson KH, Blitchington RB, Greene RC (1990) Amplification of bacterial 16s ribosomal dna
with polymerase chain reaction. J Clin Microbiol 28(9):1942–1946
6. Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA, Olsen GJ (2008) Critical evaluation
of two primers commonly used for amplification of bacterial 16s rRNA genes. Appl Environ
Microbiol 74(8):2461–2470
7. Farimani RH, Najafi MBH, Bazzaz BSF, Edalatian MR, Bahrami AR, Flórez AB et al (2015)
Identification, typing and functional characterization of dominant lactic acid bacteria strains
from iranian traditional yoghurt. Eur Food Res Technol 242(4):517–526
8. Drancourt M, Bollet C, Carlioz A, Martelin R, Gayral JP, Raoult D (2000) 16S ribosomal DNA
sequence analysis of a large collection of environmental and clinical unidentifiable bacterial
isolates. J Clin Microbiol 38(10):3623–3630
9. Kim YW, Jeong YJ, Kim AY, Son HH, Lee JA et al (2014) Lactobacillus brevis strains from
fermented Aloe vera survive gastroduodenal environment and suppress common food borne
enteropathogens. PLoS ONE 9(3):e90866
Production of 5′-Inosinic Acid
by Whole-Cell Biocatalyst
Expressing a Mutated Acid
Phosphatase/Phosphotransferase
Hui Yuan, Zi-fan Jia, Ju-hua He, Xiao-guang Fan and Ning Chen
1 Introduction
The amounts of 5′-IMP produced were closely related to the Km value of AP/PTase
for inosine [9, 10]. To enhance the molar yield of inosine to 5′-IMP, error-prone
polymerase and site-directed mutation have been used for the improvement of
phosphotransferase activity of AP/PTase [11–13]. With mutated AP/PTase, an
improved phosphotrasferase reaction of inosine to 5′-IMP was obtained.
Although mutated AP/PTase has the potential for enzymatic synthesis of 5′-IMP,
the high cost of enzyme still limit its large-scale industrial application. Recently,
whole-cell biocatalyst has been applied into the production of many compounds in
food and beverage industry [14, 15]. Compared with the purified enzymes, whole
cell biocatalyst could simplify the process and be more stable to the external
environment. Therefore, in the present study, the catalytic properties of whole-cell
biocatalyst with mutated AP/PTase was studied and optimized.
The intact cells were harvested by centrifugation at 7000 g for 10 min and
washed twice with 50 mM phosphate buffer solution (pH = 7.0). The cell pellet
was then resuspended in the same buffer solution containing with 20% glycerol,
frozen in liquid nitrogen and stored at −80 °C.
The reaction was conducted in 250 mL Erlenmeyer flask containing 5 g/L (dry cell
weight) whole-cell biocatalyst and 100 mM sodium acetate buffer solution (pH 5.2)
and carried out in a shaking water bath (200 rpm, 35 °C) for 7 h. Different concen-
trations of inosine and disodium pyrophosphate were used as the substrates with a total
reaction system volume of 100 mL.
AP/PTase activity was assayed in a standard reaction mixture comprising 0.2 mmol
inosine, 0.2 mmol disodium pyrophosphate, 0.1 mmol acetate buffer (pH 5.0) and
10 mg (dry cell weight/DCW) whole-cell biocatalyst in a total volume of 2 mL.
The reaction mixture was incubated at 35 °C and stopped after 20 min by adding
200 µl HCl (2 M). One unit of AP/PTase activity was defined as the amount of
enzyme that generated 1 µmol of 5′-IMP per minute under the assay condition.
Specific activity was defined as units per mg of protein. Protein concentration was
determined using the method of Bradford with crystalline bovine serum albumin as
a standard [18].
Quantitative determination of inosine and 5′-IMP was carried out by HPLC
(Series 1200, Agilent Technologies, Santa Clara, CA, USA) with a diode array
detection wavelength of 245 nm. The temperature of C18 column (4.6 150 mM,
3.5 µm; Agilent, USA) was maintained at 30 °C. The mobile phase was 10 mM
608 H. Yuan et al.
potassium phosphate buffer (pH 2.8) and methanol (9:1, v/v), and the flow rate was
1.0 mL/min. Synthesized 5′-IMP was calculated as IMP 2Na 7.5H2O (molecular
weight, 527).
All experiments were carried out in triplicate and results represent mean
standard ± error.
Based on the reported nucleotide sequence, the AP/PTase gene with mutated sites
from M. morganii was synthesized after optimization of codons. The mutated
AP/PTase gene, named as phoCM, was inserted into an expression vector pQE30 to
construct the recombinant plasmid pQE30-phoCM. The recombinant plasmid
pQE30-phoCM was transformed into the competent cells of E. coli XL1-Blue. The
positive transformant was selected by colony PCR and double enzymatic digestion.
The agarose gel electrophoresis analysis was shown in Fig. 1.
Fig. 2 The effect of induction initiation time on mutated AP/PTase expression. a The time course
curve of unit enzyme activity with different induction initiation time; b The time course curve of
biomass with different induction initiation time; c The time course curve of total enzyme activity
with different induction initiation time
protein degradation and cell lysis [24]. However, when the mutated AP/PTase was
incubated at a temperature of 28 °C, the total activity only remained 65%, indi-
cating that the intracellular metabolism and enzyme secretion were weak at lower
temperature [25].
Fig. 3 The effect of induction temperature on mutated AP/PTase expression. a The time course
curve of unit enzyme activity with different induction temperature; b The time course curve of
biomass with different induction temperature; c The time course curve of total enzyme activity
with different induction temperature
densities and undesirable culture conditions, which might cause the proteolysis by
degradation of the cell membrane [26]. In the process of heterologous protein
overexpression, total activity was the key factor for enzymatic reaction. Higher total
activity resulted in lower protein dosage and more production formation. From an
industrial point of view, 9 h was the best induction duration for mutated AP/PTase
expression.
Using the whole-cell biocatalyst, the production of 5′-IMP from different concen-
trations of inosine and disodium pyrophosphate was examined. The reaction tem-
perature and pH of this enzyme were set as 30 °C and 5.2 according to the previous
study [7]. As shown in Fig. 5, 5′-IMP production decreased at lower substrate
concentration because the superfluous whole-cell biocatalyst limited the mixing
efficiency and oxygen transfer rate. Meanwhile, when the amount of substrate was
612 H. Yuan et al.
greater than the required limit, the activities of the enzymes were inhibited, which in
turn decreased the molar yield of 5′-IMP. The maximal molar yield and concen-
tration of 5′-IMP were 99.65% and 46.89 g/L with 120 mM inosine and 200 mM
disodium pyrophosphate. Yasuhiro Mihara et al. have developed several processes
to produce 5′-IMP. Using mutated AP/PTase from M. morganii, 101 g/L of 5′-IMP
production from inosine was achieved with a molar yield of 88% [13]. While using
mutated AP/PTase from E. blattae, 156 g/L of 5′-IMP production from inosine was
achieved with a molar yield of 79% [12]. The molar yield obtained in the present
Production of 5′-Inosinic Acid by Whole-Cell … 613
study was close to theoretical value, which was benefit for the separation and
purification of the products. These results suggested that the whole-cell biocatalyst
process described here might be an alternative choice for simple and efficient 5′-
IMP production.
4 Conclusions
This paper presented a study of optimizing the induction conditions associated with
whole-cell biocatalysis for 5′-IMP production. A successful extracellular expression
of AP/PTase from M. morganii with mutations of G92D and I171T was reported.
Results of single factor analysis indicated that the influence of induction initiation
time and temperature on mutated AP/PTase expression was significant. 120 mM
inosine and 200 mM disodium pyrophosphate could be converted to 5′-IMP during
7 h whole-cell biocatalysis with a molar yield of 99.65%. The approximate theo-
retical molar yield obtained in this study confirmed that the carbon efficiency value
could be enhanced based on the optimization of mutated AP/PTase expression.
Further study will be focused on the combination of inosine fermentation and
immobilized whole-cell biocatalysis for 5′-IMP production.
Acknowledgements The authors are very grateful for financial support from Foundation for Key
Laboratory of Industrial Fermentation Microbiology of Ministry of Education and Tianjin Key Lab
of Industrial Microbiology (Grant No. 2016IM101).
References
1. Carver JD, Walker WA (1995) The role of nucleotides in human nutrition. J Nutr Biochem 6
(2):58–72
2. Ghirri A, Bignetti E (2012) Occurrence and role of umami molecules in foods. Int J Food Sci
Nutr 63(7):871–881
3. Asano Y (2002) Overview of screening for new microbial catalysts and their uses in organic
synthesis—selection and optimization of biocatalysts. J Biotechnol 94(1):65–72
4. Asano Y, Mihara Y, Yamada H (1999) A novel selective nucleoside phosphorylating enzyme
from Morganella morganii. J Biosci Bioeng 87(6):732–738
5. Mori H, Iida A, Fujio T et al (1997) A novel process of inosine 5′-monophosphate production
using overexpressed guanosine/inosine kinase. Appl Microbiol Biot 48(6):693–698
6. Asano Y, Mihara Y, Yamada H (1999) A new enzymatic method of selective phosphorylation
of nucleosides1. J Mol Cata B: Enzy 6(6):271–277(7)
7. Mihara Y, Utagawa T, Yamada H et al (2001) Acid phosphatase/phosphotransferases from
enteric bacteria. J Biosci Bioeng 92(1):50–54
8. Usuda Y, Shimaoka M, Kawasaki H et al (2002) Expression of the guanosine-inosine kinase
gene from Exiguobacterium. World J Microb Biot 27(3):709–712
9. Ishikawa K, Mihara Y, Shimba N et al (2002) Enhancement of nucleoside phosphorylation
activity in an acid phosphatase. Protein Eng Des Sel 15(7):539–543
10. Pugmire MJ, Ealick SE (2002) Structural analyses reveal two distinct families of nucleoside
phosphorylases. Biochem J 361(1):1–25
614 H. Yuan et al.
11. Liu ZQ, Zhang L, Sun LH et al (2012) Enzymatic production of 5′-inosinic acid by a newly
synthesised acid phosphatase/phosphotransferase. Food Chem 134(2):948–956
12. Mihara Y, Ishikawa K, Suzuki E et al (2004) Improving the pyrophosphate-inosine
phosphotransferase activity of Escherichia blattae acid phosphatase by sequential
site-directed mutagenesis. Biosci Biotech Bioch 68(5):1046–1050
13. Mihara Y, Utagawa T, Yamada H et al (2000) Phosphorylation of nucleosides by the mutated
acid phosphatase from Morganella morganii. Appl Environ Microb 66(7):2811–2816
14. Carvalho CCCRD (2011) Enzymatic and whole cell catalysis: finding new strategies for old
processes. Biotechnol Adv 29(1):75–83
15. Ishige T, Honda K, Shimizu S (2005) Whole organism biocatalysis. Curr Opin Chem Biol 9
(2):174–180
16. Seidman CE, Kevin S, Jen S et al (2001) Introduction of plasmid DNA into cells. Current
protocols in molecular biology Chapter 1:A.4D.1-A.4D.2
17. Green MR, Green MR (2012) Molecular cloning: a laboratory manual, 4th edn.
Three-Volume Set, Cold Spring Harbor Laboratory Press
18. Bradford MM (1976) Anal Biochem 72:248–254
19. Hannig G, Makrides SC (1998) Strategies for optimizing heterologous protein expression in
Escherichia coli. Trends Biotechnol 16(2):54–60
20. Sivashanmugam A, Murray V, Cui C et al (2009) Practical protocols for production of very
high yields of recombinant proteins using Escherichia coli. Protein Sci 18(5):936–948
21. Shokri A, Sandén A, Larsson G (2002) Growth rate-dependent changes in Escherichia coli,
membrane structure and protein leakage. Appl Microb Biotechnol 58(3):386–392
22. Hossain GS, Li J, Shin HD et al (2014) Bioconversion of l-glutamic acid to a-ketoglutaric
acid by an immobilized whole-cell biocatalyst expressing l-amino acid deaminase from
Proteus mirabilis. J Biotechnol 169(Complete):112–120
23. Fu Z, Ng K, Lam TW (2005) Cell death caused by hyper-expression of a secretory
exoglucanase in Escherichia coli. Protein Expres Purif 42(1):67–77
24. Baneyx F (1999) Recombinant protein expression in Escherichia coli. Curr Opin Biotechnol
10(5):411–421
25. Wang Y, Wang Z, Xu Q et al (2009) Lowering induction temperature for enhanced
production of polygalacturonate lyase in recombinant Pichia pastoris. Process Biochem 44
(9):949–954
26. Mattanovich D, Gasser B, Hohenblum H, Sauer M (2004) Stress in recombinant protein
yeasts. J Biotechnol 113(1–3):121–135
Bio-production of L-rhamnonate
by Pseudomonas taetrolens
Shuhong Mao, Jianlin Wu, Lixia Zhang, Shuqi Gui and Fuping Lu
1 Introduction
Carbohydrate is one kind of important source of raw materials [1]. More and more
attention was paid to the catalysis of the carbohydrate such as monosaccharides,
disaccharides to their corresponding aldonic acids. These products have wide
applications in the industry of food, cosmetics and medicine. For instance, gluconic
acid is an oxidation product of glucose, in addition to its use as a food additive to
regulate the acidity, its capability for chelating metals make them useful as the
mineral supplement [2]. Calcium gluconate is on the World Health Organization’s
List of Essential Medicines. Lactobionic acid, which can be obtained by lactose
oxidation, is a new important humectant and antioxidant due to its polyhydroxy
acid structure [3]. Lactobionic acid can bind with water up to 14% to form a
transparent matrix, and such a gel matrix is very useful for the skin as well as
protection in wound healing [4].
The production of aldonic acid by microbial fermentation has become a reliable,
cost-competitive, feasible way to overcome certain drawbacks associated with
chemical synthesis or enzymatic catalysis [5]. In fact, microbial production of
aldonic acid has been explored since 1950s. Pseudomonas taetrolens species such
as P. mucidolens, P. myxogenes or P. fluorescens were found to be the main
efficient aldonic acid producer [6, 7].
L-rhamnose is widely spread in plant biomass, and several microorganisms such
as Cry. ptococcus laurentii, Cry. neoformans and Pichiascolyti are able to utilize
L-rhamnose as the carbon source to produce L-rhamnose acid after a long time
fermentation with low yield but the by-product 1,2-propylene glycol was also
obtained in this process [8], but little has been reported with P. taetrolens species.
This study investigated the pattern of L-rhamnose dissimilation by P. taetrolens,
the isolation and identification of the product L-rhamnose acid as well as the effect
of the temperature, cell dentistry and dissolved oxygen on the L-rhamnose acid
production in a resting cell system was also studied.
The transformation of L-rhamnose (1 g/L) by resting cells with the final cell con-
centration OD600 at about 20 was carried out under the shaker condition (180 rpm)
at different temperature (28, 30, 32, 34, 37 and 40 °C).
Bio-production of L-rhamnonate by Pseudomonas taetrolens 617
The effect of different cell concentration at OD600 (10, 20, 30, 40 and 50) on
L-rhamnonic acid was studied at 180 rpm and 37 °C.
After biotransformation, the medium was centrifugated at 8000 rpm, the super-
natant was obtained and evaporated at 100 °C, the concentrated L-rhamnonate was
then precipitated with equal volume of 95% ethanol, the precipitate was filtered and
dried at 60° C for about 24 h, and the crude L-rhamnonate was then washed twice
by water and filtered and dried at the same condition. The final product was dis-
solved in D2O and analyzed by 1H NMR.
Fig.1 The HPLC spectrum of L-rhamnonic acid produced by P. taetrolens. The peak 4 is
corresponded to L-rhamnonic acid
OH OH OH OH
P. t aetr olens
OHC HOOC
OH OH OH OH
(a) (b)
33 60
30
50
productivity(%)
27
productivity(%)
40
24
21 30
18 20
15
10
12
28 30 32 34 36 38 40 10 20 30 40 50
temperature( ) OD600
(c) (d)
70
100
60
80
productivity(%)
productivity(%)
50
60
40
40
30 20
20 0
140 160 180 200 220 0 12 24 36 48
shaker speed(r/min) time(h)
Fig. 5 Effect of temperature, cell concentration and shaker speed on L-rhamnonic acid production
using P. taetrolens resting cells. a Effect of temperature, OD600 = 20, 180 rpm, 17 h; b Effects of
cell concentrations, 37 °C, 180 rpm, 17 h; c Effect of shaker speed, OD600 = 40, 37 °C, 17 h.
d Time profiles of biotransformation of the L-rhamnonic acid by P. taetrolens resting cells. All
experiments were performed in triplicate. Error bars represent standard deviations
4 Conclusions
References
Chuanxue Fu, Shuai Yang, Jun Mou, Jia Song, Min Wang
and Yu Zheng
1 Introduction
Lactic acid bacteria (LAB) are well recognized worldwide, which are applied to
food, health care, feed, agriculture etc. [1, 2]. Many strains of LAB are isolated and
applied in production of fermented foods, such as cheese [3], sausage [4] and pickle
[5]. Specially, LAB are important bacteria for Chinese traditional vinegar (CTV).
LAB, including Lactobacillus helveticus, Lactobacillus acetotolerans,
Lactobacillus fructivorans and Lactobacillus pontis, are dominant bacteria during
fermentation process of Shanxi aged vinegar, a famous CTV, and produce abundant
organic acids which give the vinegar unique taste and flavor [6]. To improve the
property of CTV, fermentation reinforced with LAB that are isolated from itself is
considered a potential strategy [7].
To make the use of LAB conveniently, the direct vat set (DVS) of LAB has been
developed in spray-dried, or freeze-dried forms [8]. Within these forms,
freeze-dried or lyophilized bacteria has been proven to be the most convenient and
successful method for preserving bacteria, and have been used for several decades
[9–11]. However, the freeze-drying process may be lethal to a large fraction of
microorganisms, and the cytoplasmic membrane is considered the main site of
dehydration damages [12]. Many studies focused on approaches to minimize the
damage by adding protective agents. Different substances, including sugars (su-
crose, lactose maltose trehalose), sugar alcohols (inositol, sorbitol), amino acids
(sodium glutamate), have been tested for their protective effect during drying and
storage [13, 14]. Sugars are reported to exhibit enhanced desiccation tolerance by
forming hydrogen bonds to proteins during drying, which help to maintain the
tertiary protein structure in the absence of water [15]. On the other hand, designing
an appropriate fermentation medium is of crucial importance because medium
composition can significantly affect the product yield of cells. MRS culture medium
is commonly used for LAB culture, some other nutrient or enhancement factor such
as tomato juice, CaCO3 are added to improve the yield of cells [16–18].
In our previous work, L. helveticus AAF1-5 that appeared a potential application
in reinforcing vinegar fermentation was isolated from pei of Shanxi aged vinegar.
Thus, the objective of this work was to optimize the preparation of the DVS L.
helveticus AAF1-5 and to evaluate the stability of this DVS.
2.1 Microorganisms
Malt wort, tomato juice and corn steep liquor were chosen as growth factor. OD600
and the number of viable cells were chosen as the index to find out the suitable
growth factor, and then the concentration (5, 10, 15, 20, 25, 30%) of malt wort was
further optimized.
The fermentation was ended after 24 h cultivation. The fermentation broth was
treated by centrifugation at 5000g for 5 min and the supernatant was discarded to
harvest L. helveticus AAF1-5 cells. To protect the cell from low temperature and
desiccation, lactose, sucrose, glucose, fructose and skim milk were chosen as
protective agents. Each protective agent was added to the living cells (Bacterial
mud: Protective agents (w/v), 1/17), and then cells were pre-frozen at 4 °C for 12 h
and −20 °C for 24 h. Lyophilized was performed at −80 °C, 0.37 Pa for 24 h using
a vacuum freeze dryer. DVS of L. helveticus AAF1-5 was spread on solid MRS
Preparation and Stability Evaluation of Direct Vat Set … 625
media. The number of viable cells was calculated to select an appropriate protective
agent. And then the concentration (5, 8, 11, 14%) was further optimized.
Prepared DVS of L. helveticus AAF1-5 was stored at 25 and 4 °C, respectively,
to determine the survival rates of the strain.
(a) (b)
7 8
6 7
6
5
5
4
OD600
OD600
4
3
3
2
2
1
1
0 0
A B C D 5% 10% 15% 20% 25% 30% control
A: Malt extract C: Corn steep liquor
B: Tomato juice D: Control The concentrate of malt extract / %
Fig. 1 The effect on the growth of L. helveticus AAF 1-5. Data are means ± SD (n = 3)
(P < 0.05)
626 C. Fu et al.
As show in Fig. 1b, 20% malt wort was the optimized concentration for L. hel-
veticus AAF1-5 cultural. (P < 0.05), and the number of viable cells was
(2.35 ± 6.00) 109 CFU/mL.
The kind of protective agent, which is a key factor that can significantly affect
bacteria survival, serve as an anchor which play the role of protecting the structure
of cells. Other researchers reported that the cell survival rate is approximate to
99.8% when adding the protective agent [19]. Thus, adding the protective agent is
critical to the preparation of DVS L. helveticus AAF1-5. It was reported that
Micrococcus sp played a reinforcement role in cheese production and could shorten
the maturity of cheese [20].
Similarly, LAB appeared a potential application in reinforcing vinegar fermen-
tation. To facilitate prepare and usage the DVS of L. helveticus AAF1-5 was
prepared. The effeteness of skim milk and 4 sugars (lactose, sucrose, glucose and
fructose) as protective agent was compared. As listed in Table 1, the highest viable
cell was obtained when lactose was used as protective agent, and 8% was the
optimal concentration for DVS preparation (Fig. 2). Lactose is commonly used in
DVS preparation. Also, it is beneficial to the recovery of DVS when it was used for
vinegar fermentation.
Temperature plays an important role during bacteria powder storage. It was reports
that the cell membrane of freeze-dried powder of Lactobacillus bulgaricus often
happen to oxidation during storage. To avoid this oxidation, freeze-dried powder of
L. bulgaricus should be stored in low temperature [21]. Studies have also
shown that, when it was preserved at 4 °C, the preservation period of freeze-dried
product is much longer compared with room temperature preservation [22].
Table 1 The effect of protective agents on the property of DVS L. helveticus AAF1-5
Protective agent Viable cells of DVS (1010 CFU/g) Yield ratio (%)
Lactose 5.66 ± 0.07 87.5 ± 0.42
Sucrose 4.24 ± 0.02 26.5 ± 0.25
Glucose 4.97 ± 0.03 39.8 ± 1.47
Fructose 2.24 ± 0.01 13.4 ± 0.38
Skim milk 5.22 ± 0.05 83.7 ± 0.12
Data are means ± SD (n = 3) (P < 0.05)
Preparation and Stability Evaluation of Direct Vat Set … 627
10.4
10.2
10.0
9.8
5% 8% 11% 13%
Concentrations of lactose / %
90
80
70
60
50
40
30
0 1 3 5 6
Time / months
It must be recognized that the efficacy of DVS depends largely on the count of
viable bacteria [23]. The allowable level of loss of viable bacteria in DVS should be
generally less than 10%. As shown in Fig. 3, the viable cells was 84.3% and 82.5%
of initial when it was stored at 4 and 25 °C, respectively, for 1 month. Then, the
inactivation of L. helveticus AAF1-5 increased. After 6 months store at 4 and
25 °C, respectively, the viable cells was 69.0 and 58.7% of initial. Thus, the DVS
should be used prior to 1 month.
4 Conclusions
The optimum medium for L. helveticus AAF1-5 cultural is consisted of glucose 2.0%,
peptone 1.0%, beef extract 1.0%, yeast extract 0.5%, NaAc 0.5%, K2HPO4 0.2%,
MgSO4 0.058%, malt wort 20%, the cell number is (2.35 ± 6.00) 109 CFU/mL
628 C. Fu et al.
after 24 h cultivation at 37 °C. The DVS was prepared with the method of
freeze-drying with 8% lactose as protective agent. Ant the DVS containing L. hel-
veticus AAF1-5 of (5.66 ± 0.07) 1010 CFU/g was obtained. The viable cells were
84.3 and 82.5% of initial after 1 month at 4 and 25 °C, which is satisfied for its
usage.
Acknowledgements This work was supported by the Ministry of Science and Technology of the
P.R. China (2016YFD0400505), Tianjin Municipal Science and Technology Commission
(16YFZCNC00650).
References
18. Gao H, Liu M, Liu J et al (2009) Medium optimization for the production of avermectin B1a
by Streptomyces avermitilis, 14-12A using response surface methodology. Biores Technol
100(17):4012–4016
19. Li Hua, Luo Yaner (2002) Research progress of vacuum freeze-drying microorganisms.
Microbiology 29(3):78–82
20. Morales P, Gaya P, Nuñez M (2005) Effect of the addition of Micrococcus sp. INIA 528 milk
cultures and curds on cheese proteolysis and lipolysis. Milchwissenschaft-milk Sci Int 60
(4):410–414
21. Castro HP, Teixeira PM, Kirby R (1996) Changes in the cell membrane of lactobacillus
bulgaricus during storage following freeze-drying. Biotechnol Lett 18(1):99–104
22. Matejtschuk P (2004) Freeze-drying of biological standards, freeze-drying of pharmaceutical
and biological products. Marcel Dekker Inc, New York, pp 215–224
23. Champagne CP, Mondou F, Raymond Y et al (1996) Effect of polymers and storage
temperature on the stability of freeze-dried lactic acid bacteria. Food Res Int 29(29):555–562
Overexpression of the Endo-inulinase
Gene from Two Different Sources
and Characteristics Analysis
1 Introduction
L.-K. Wei Q.-L. Xin Z.-M. Feng X.-Y. Xing W. Feng Y. Li (&)
Key Laboratory of Industrial Microbiology, Ministry of Education,
College of Biotechnology, Tianjin University of Science and Technology,
Tianjin 300457, China
e-mail: [email protected]
L.-K. Wei
e-mail: [email protected]
The strain of A. niger TCCC41064, Escherichia coli JM109, Pichia GS115, the
expression vector pPIC9K was preserved in the laboratory. The EZ-10 Spin
Column Plasmid Mini-Prep kit, agarose gel DNA purification kit, restriction
enzymes, PCR enzyme “LA Taq”, DNA marker, Solution I DNA ligase, and
cloning vector pMD19-T simple vector were purchased from TakaRa (Otsu,
Japan). Synthesis of DNA primers and DNA sequencing were performed by
AuGCT (Beijing, China). LB, YPD, MD, G418, BMGY, and BMMY cultures were
prepared according to the Ref. [15]. Unless stated otherwise, all the chemicals were
analytical grade and purchased from Sangon Biotech (Shanghai) Co. Ltd (Shanghai,
China).
Genomic DNA of A. niger TCCC41064 and Penicillium sp. TN-88 were extracted
as described in Ref. [16]. The gene encoding endo-inulinases were inuA, GenBank
Accession No. CAA07345, and inuC, GenBank Accession No. AB041337.2.
The DNA sequence of inuA was analyzed and designed using the analyzer Primer
5, including the addition of two restriction sites EcoR I and Not I, to the forward and
reverse end, respectively. The PCR primers of inuA and inuC gene were synthe-
sized by AuGCT (Beijing, China) (Table 1).
The full-length genes were amplified using the primers inuA-F, inuA-R, inuC-F,
inuC-R and LA Taq DNA polymerase. The recombinant pMD19-T simple
vector/inuA was obtained and transformed into E. Coli JM109 by the heat-shock
method [17]. The recombinant pMD19-T simple vector/inuA and pPIC9 K were
digested with EcoR I and Not I, gel-purified, and ligated into pPIC9K. Next, the
recombination vector pPIC9K/inuA was extracted from E. Coli JM109 and then
transformed into P. pastoris G418 using the electrical pulse method. The recom-
binant plasmid of gene inuC was performed as described above.
200.0 µL of the crude endo-inulinase was mixed with 800 µL of 4.0% (w/v) inulin
in 0.05 mol/L HAC-NaAC buffer (pH 4.6). The mixture was incubated at 50 °C for
15 min. After that, the mixture was immediately inactivated in the boiling water for
10 min. The reducing sugar released from inulin was measured using DNS method
[19]. The same mixture with 200 µL of the fermentation supernatant heated at
100 °C for 10 min was used as the negative control. One unit of endo-inulinase
activity was defined as the amount of enzyme causing release of reducing sugars
equivalent to 1.0 µmol from inulin in 1 min under the assay conditions.
Take appropriately diluted enzyme 200 µL, was added 800 µL 4% inulin (with
0.05 mol/L of HAC-NaAC buffer preparation), measure inulinase vitality at dif-
ferent temperatures (40, 45, 50, 55, 60, 65, 70, 75 °C) conditions. The enzyme was
saved at 50, 55, 60, 65 °C at per hour and then rapidly cooled, measuring residual
enzyme activity.
634 L.-K. Wei et al.
The optimum pH was measured by 0.05 mol/L of HAC-NaAC buffer (pH 3.5–11)
compounded in 4% of inulin, inulin determination of endo-enzyme activity under
different pH conditions.
The enzyme was placed in buffers with different pH, at room temperature for
60 min, after acetate buffer diluted 0.l mol/L pH 4.6, the remaining enzyme activity
was measured at 50 °C
2 lL sample of the reaction product was carried out on the TLC plate for qualitative
analysis, The developing solvents were n-butanol–isopropanol–water–acetic acid
(volume ratio of 7:5:4:2). After each developing layer was dried with a hair dryer,
exhibited the floor for twice. And next, added liquid on the TLC plate(water,
235 mL, ammonium molybdate 12 g, cerium ammonium molybdate 0.5 g, con-
centrated sulfuric acid 15 mL), dried at 95 °C for 10 min, observation result lastly.
A. niger TCCC 41064 strain DNA was used as a template for gene amplification,
PCR amplification by using primers P1, P2 according to the Method Sect. 2.2.2.
A single band DNA of the target gene fragment at the same size in the vicinity of
1.5 kb was detected on 8% agarose gel electrophoresis. The PCR product T-inuA
Overexpression of the Endo-inulinase Gene … 635
and T-inuC were sequenced by Beijing BGI Ltd. The PCR product sequence
similarity was 99.67% compared with those published on NCBI.
The amplified endo-inulinase gene fragment was inserted into the expression
vector pPIC9K, constitute recombinant plasmid pPIC9K-inuA, using EcoR I and
Not I for double enzyme digestion. Small gene fragments about 1500 bp is inuA, a
large fragment about 9000 bp is the pPIC9K carrier. It is indicated that the gene has
been inserted into pPIC9K carrier. Similarly as above, gene inuC double digestion
with EcoR I and Not I, was inserted into the expression vector PMD19T-simple and
pPIC9K successively.
After the transformants of electroporation was certified, and then detected the
activity of the recombinants fermentation supernatants. The activity of culture
supernatant of inuA and inuC were 13.5 U/mL and 69.3 U/mL.
SDS-PAGE showed that the supernatant from the transformant carrying the inuA
and inuC gene exhibited one band compared with the control group with a
molecular mass of about 66.2 kDa. This is caused by glycosylation process, in
which the folded protein was secreted into the extracellular. The recombinant
enzyme was purified as described in Ref. [20]. After purification, this unique band
was the His-tagged protein of the recombinant endo-inulinase (Fig. 1a, b). InuC
specific activity reached 792.09 U/mg after purified, which was higher than inuA
(350.00 U/mg).
The temperature data showed that under assay conditions used, the temperature for
optimal activity of the inuA and inuC endo-inulinase gene were determined at 60,
50 °C (Fig. 2a, b), which were in accordance with the optimum inulinases tem-
peratures of 45–60 °C from other molds [21]. In addition, the enzyme of gene inuA
retained 83.2% of its activity after 9 h at 55 °C, and the enzyme of gene inuC
retained 75.4% activity after 9 h at 40 °C (Fig. 2c, d), which displayed good
thermostability among the inulinase family [22, 23]. Since temperatures of inuA
over 60 °C, temperatures of inuC temperatures over 50 °C ensure proper solubility
636 L.-K. Wei et al.
As shown in Fig. 3, the effects of pH on the activity and stability of the recombinant
endo-inulinase were also determined. The enzyme inuA and inuC exhibited the
highest activity at pH 5.0, 4.0. The enzyme inuA was stable over a pH range of 4.5–
5.5, retaining >80% of its initial activity. Meanwhile, the enzyme inuC was stable
over a pH range of 3.0–6.0, retaining >85% of its initial activity (Fig. 3a, b). These
results showed that the recombinant endo-inulinase inuC was potentially to be
effectively in the preparation of product. The pH stability of recombinant enzymes
were similar, the two enzyme were stable over a pH range of 3.0–6.0, retaining
>85% of its initial activity (Fig. 3c, d).
The combination and mode of action for inulin and endo-inulinase were different,
the distribution of polymerization degree of the products were different, the
Overexpression of the Endo-inulinase Gene … 637
Fig. 2 The optimum temperature and thermostability of the recombinant enzymes a the optimum
temperature of inuA b the optimum temperature of inuC c the thermostability of inuA d the
thermostability of inuC
Fig. 3 The optimum pH and pH stability of recombinant enzymes a the optimum pH of inuA
b the optimum pH of inuC c the pH stability of inuA d the pH stability of inuC
The TLC analysis result of inuA was shown in Fig. 6. The long-chain inulin was
gradually hydrolyzed to short-chain. After 8 h, inulin was completely hydrolyzed to
short-chain oligosaccharides.
Hydrolytic product by inuC was initial detected, shows in Fig. 7. Long-chain
inulin was gradually hydrolyzed to low molecular weight saccharide [25]. After
continuous reaction of 20 h, inulin is mostly converted to trisaccharide as the main
ingredient and other oligosaccharide mixtures. The long-chain inulin random was
hydrolyzed to relatively short molecules (lanes 4, 5) (DP > 5), and then turned them
to the lower degree of polymerization oligosaccharides. It also shows that
endo-inulinase cleavage the internal glycosidic bond was random.
Overexpression of the Endo-inulinase Gene … 639
Fig. 4 The hydrolyzd products in different periods using inulin as the substrate by HPLC analyze
a hydrolysis 30 min; b hydrolysis 120 min; c hydrolysis 240 min; d Hydrolysis 480 min peak 2–
8: F2 (fructose), F3, F4, F5, F6, F7, F8
Fig. 5 The hydrolyzd products of inuC in different periods with HPLC analyze red line original
inulin substrate, green line hydrolysis 480 min; blue line hydrolysis 240 min
640 L.-K. Wei et al.
Fig. 7 TLC analysis of the hydrolysate of inulin by inuC Lane 1 from top to bottom are glucose,
sucrose; Lane 2 from top to bottom are glucose, kestose (GF2), fungitetraose (GF3),
F-fructofuranosylnystose (GF4); Lane 3: inulin substrate + inactivated fermentation supernatant;
Lane 4–7 the time of hydrolysate of inulin 240, 480, 720 min
4 Conclusions
In this study, we cloned two endo-inulinase genes (inuA, inuC) from A. niger
TCCC41064 and Penicillium TN-88, and over-expressed in P. pastoris GS115. The
molecular weight of the purified inuA and inuC were both about 66.2 kDa. The
optimal pH and temperature of the purified inuA were 5 and 60 °C, respectively.
The enzyme of inuA retained 83.2% of its activity after 9 h at 55 °C, and exhibited
higher thermal stability. After 8 h, inulin substantially could be hydrolyzed to the
short-chain oligosaccharides, (inulin-disaccharide 32.5%, inulin-trisaccharide
36.7%, and inulin-tetrasaccharide 30.7%). After 11 h, FOS conversion yield was
63.5%. For the gene inuC, the optimal pH and temperature of the purified were
Overexpression of the Endo-inulinase Gene … 641
4 and 50°C. The enzyme of inuC retained 75.4% of its activity after 9 h at 40 °C.
Major products of inulin hydrolyzed by inuC were trisaccharide (74.8%), inulin
tetrasaccharide (21.6%), but also produce a small quantity of inulin-disaccharides
and monosaccharides.
Comparing with these two genes, inuC showed the higher enzyme activity.
Secondly, the temperature of hydrolysis at 40 °C is lower, which can save more
energy by compared with inuA. The hydrolyze inulin by inuC can generate more
fructo-oligosaccharides, which are better for health, more easily absorbed and can
be used by probiotics [20]. The endo-inulinase inuC derived from Penicillium has
more advantages, providing important guidance for the use of inulin-oligofructose
industrial production. Further research will focus on the optimum process condi-
tions of inuC for preparing fructo-oligosaccharides.
References
13. Wang JH, Teng D, Yao Y, Yang YL, Zhang F (2004) Expression of Aspergillus niger 9891
endoinulinase in Pichia pastoris. High Tech Lett 10:52–56
14. He M, Dan W, Jing W, Chen Jian (2014) Enhanced expression of endoinulinase from
Aspergillus niger by codon optimization in Pichia pastoris and its application in
inulooligosaccharide production. J Ind Microbiol Biotechnol 41:105–114
15. Hu S, Luo S, Zhang J, Zhangsun D (2007) Pichia pastoris expression system and strategies
for high-level expression. Biotechnology 17(6):79−83
16. Cho Y, Yun JW (2002) Purification and characterization of an endoinulinase from
Xanthomonas oryzae No. 5. Process Biochem 37(11):1325–1331
17. Shi XL, Feng MQ, Shi J (2007) High-level expression and purification of recombinant human
catalase in Pichia pastoris. Protein Expr Purif 54(2):193–203
18. Kango N, Jain SC (2011) Production and properties of microbial inulinases: recent advances.
Food Biotechnol 25:165–212
19. Chen HQ, Chen XM, Li Y, Wang J, Jin ZY, Xu XM, Zhao JW, Chen TX, Xie ZJ (2009)
Purification and characterisation of exo-and endo-inulinase from Aspergillus ficuum
JNSP5-06. Food Chem 115:1206–1212
20. Chi Z, Zhang T, Liu G, Yue L (2009) Inulinase-expressing microorganisms and applications
of inulinases. Appl Microbiol Biotechnol 82:211–220
21. Nguyen QD, Rezessy-Szabó JM, Czukor B, Hoschke Á (2011) Continuous production of
oligofructose syrup from Jerusalem artichoke juice by immobilized endo-inulinase. Process
Biochem 46:298–303
22. Cho YJ, Yun JW (2002) Purification and characterization of an endoinulinase from
Xanthomonas oryzae No. 5. Process Biochem 37:1325–1331
23. Zhang T, Gong F, Chi Z et al (2009) Cloning and characterization of the inulinase gene from
yeast Pichia guillermondii and its expression in Pichia pastoris. Antione van Leeuwenhoek
95(1):13–22
24. Ohta K, Akimoto H, Moriyama S (2004) Fungal inulinase: enzymology, molecular biology
and biotechno logy. J Appl Glycosci 51:247–254
25. Kolida S, Tuohy K, Gibson GR (2002) Prebiotic effects of inulin and oligofructose. Br J Nutr
87(S2):S193–S197
Production of Ethyl Acetate Catalyzed
by Activated Carbon-Based Solid Acid
Catalyst
1 Introduction
Aroma components in Chinese baijiu are nearly 1000. But the main aroma com-
ponents are esters, including ethyl acetate, ethyl lactate, ethyl hexanoate and ethyl
butyrate esters, which cover more than 90% of the total ester content. Esters are
produced by dehydration of acid and alcohol, and the esterification reaction is a
typical acid catalytic reaction. Concentrated sulfuric acid or other liquid acid was
used as catalyst during esterification reaction in traditional industrial production.
However, there are many shortcomings, such as a lot of by-products and acid waste
water, difficulties in the separation of reaction products, serious environment pol-
lution and the equipment corroded [1]. Compared with the traditional liquid acid, the
solid acid catalyst has the advantages of high activity, easy separation, no corrosion
to the equipment, less pollution to the environment and easy recovery and reuse.
Therefore, solid acid catalyst has been widely used as a substitute for liquid acid.
In recent years, carbon-based solid acid catalysts with high activity and good
stability, which are produced by carbohydrate compound or woody biomass con-
taining carbon, have attracted wide attention from domestic and overseas scholars
[2–4]. Carbon-based solid acid is a new type of solid acid material. The solid acid
catalyst is prepared by using the biomass carbon as the carrier and loading acid
substance. Wood materials with high cellulose content are abundant renewable
resource. The advantage of low cost and environmental protection makes them
J. Li
Tianjin University of Science and Technology, Tianjin, China
Y. Li H. Zhao (&)
Key Laboratory of Industrial Fermentation Microbiology,
Ministry of Education, Tianjin Key Laboratory of Industrial Microbiology,
College of Biotechnology, Tianjin University of Science and Technology,
Tianjin 300457, China
e-mail: [email protected]
great importance to the development and utilization in the current age of resource
scarcity and pollution [5]. The carbon-based solid acid catalyst prepared by high
carbon content of cellulose can be widely used in the process of esterification,
hydrolysis and alkylation [3, 6–8].
Ren [9] used expanded starch as the carrier, and combined it with methyl benzene
sulfonic acid to produce a new carbon-based solid acid catalyst, which was applied
in the esterification of oleic acid and ethanol. The results showed that the catalytic
activity of the new type of carbon based solid acid catalyst was very strong, and the
esterification rate of oleic acid ethyl ester was 83.78%. The high stability of the solid
acid catalyst could be reused more than 6 times. Kastner [10] used peanut shell,
sawdust and concentrated sulfuric acid to prepare a carbon-based solid acid catalyst.
It showed high activity in the esterification of both palm acid and stearic acid, and the
conversion of palm acid could be close to 100%. Wu [11], through the process of
carbonization and sulfonation, used bamboo charcoal as raw materials to prepare
solid acid catalyst and catalytic esterification reaction of spend jatropha seed oil with
methanol. The results showed that the esterification efficiency was improved sig-
nificantly, and the esterification rate of the seed oil could reach 90.02%.
In this study,activated carbon-based solid acid catalyst was prepared from baijiu
vinasse. The effects of solid acid catalyst amount, acid alcohol ratio, esterification
time and esterification temperature on the esterification reaction were investigated.
The optimum conditions of the reaction were obtained, and the stability of the solid
acid catalyst was also investigated to further evaluate the catalyst.
2 Experimental
The activity of catalysis for the prepared solid acid was conducted using the
esterification rate of ethyl acetate, which was produced through the reaction of
ethanoic acid and ethanol. Ethanoic acid and ethanol with certain mass ratios were
first mixed in a 100 mL flask with a reflux condenser. And the catalyst with
different dosages was added into the reaction system. Then, the mixture was heated
in a water bath on certain temperature for different time. The esterification rate was
measured after the reaction.
The esterification rate can be calculated by the formula:
amount of substance of acid
Esterification rate ð%Þ ¼ 1
amount of substance of initial ethanoic acid
100%
3.1 Characterization
It can be seen from the infrared spectrum that the 3300–3600 cm−1 has a wide
spectrum band, and the low frequency absorption peak is due to the stretching
vibration of O–H. The absorption peak near 1592 cm−1 is caused by the C=C
stretching vibration. The absorption peak near 2850 cm−1 is caused by C–H
stretching vibration. Characteristic peak of carbon based solid acid catalyst existed
in 500–1500 cm−1; C–S (573 cm−1), S–O (752 cm−1), –SO3H (1031 cm−1),
O=S=O (1185 cm−1), the S functional groups in these stretching vibrational peaks
show that the solid acid catalyst is prepared by using activated carbon as the carrier
and sulfonate with the concentrated sulfuric acid. At the same time, the catalytic
performance of the activated carbon-based solid acid is also showed (Fig. 1).
646 J. Li et al.
10
C-S
8
Transmitance(%)
6 S-O
O=S=O
4
-SO3H
2 C=C
C-H
-OH
0
500 1000 1500 2000 2500 3000 3500 4000
Wavenumber (cm-1)
Four factors, that were catalyst dosage, ethanoic acid/ethanol mass ratio, reaction
time and reaction temperature, were chosen in order to evaluate catalytic activity of
activated carbon-based solid acid catalyst prepared at optimum conditions.
The effect of the catalyst dosage on esterification rate was observed in our work.
The results are showed in Fig. 2.
It can be seen that esterification rate was obviously influenced before the dosage
of catalyst was 3%. When the addition amount of solid acid catalyst was 3%, the
esterification rate reached the maximum value of 85.4%. After that, it was not
improved significantly. Since in a certain range of catalyst concentration, the amount
of catalyst was increased, the more active groups were provided, the catalytic per-
formance was enhanced, and the esterification rate was increased. However, when
the added amount of the catalyst reaches a certain value, the amount of the active
group can no longer change the thermodynamic effect in esterification reaction.
Therefore, the catalyst dosage of 3% was used in the following experiments.
Production of Ethyl Acetate Catalyzed by Activated Carbon … 647
90
80
60
50
40
30
20
10
0 1 2 3 4 5
catalyst dosage (%)
Fig. 2 Effect of catalyst dosage on esterification rate at the conditions of ethanoic acid/ethanol
mass ratio of 1:4, reaction time of 4 h and reaction temperature of 80 °C
The effect of the molar ratio of ethanoic acid to ethanol on esterification rate was
observed in our work. The results are showed in Fig. 3.
As shown in Fig. 3, with the increase of ethanol content, the conversion of acetic
acid increased, and the esterification rate increased. In the esterification process,
theoretical molar ratio of acetic acid and ethanol amount is 1:1. But the esterification
reaction is reversible. Increasing the concentration of a reactant or separating the birth
of a product can promote the reaction to the positive direction and increase the
efficiency of the reaction. Ethanol volatilizes easily, increase its content can improve
the rate of esterification. When the ratio of acid to alcohol was 1:5, the esterification
rate reached 85.9%. However, it cannot increase owing to the limitation of equilibrium
condition of reaction if molar ratio of ethanoic acid to ethanol was further increased. In
the following experiments, the mass ratio of 3:1 for ethanol to ethanoic acid was used.
It can be seen from Fig. 4 that the esterification rate is low when the esterification
time short, because the esterification reaction is not complete. With the extending of
reaction time, the esterification rate increases. When the esterification time was 4 h,
the esterification rate was 86%. The esterification reaction is reversible, the reaction
system can reach the dynamic equilibrium when the time exceeds 4 h, and the
esterification rate is no longer increased. Therefore, the esterification time of 4 h
was chosen as the best reaction time.
648 J. Li et al.
90
80
70
esterification rate (%)
60
50
40
30
20
10
1:2 1:3 1:4 1:5 1:6 1:7
acid and alcohol ratio (%)
Fig. 3 The effects of acid and alcohol ratio on the esterification rate of ethyl acetate at the
conditions of catalyst dosage was 3%, the esterification time was 4 h, the esterification temperature
was 80 °C
90
80
esterification rate (%)
70
60
50
40
30
20
10
1 2 3 4 5 6
esterification time (h)
Fig. 4 The effects of esterification time on the esterification rate of ethyl acetate at the conditions of
catalyst dosage of 3%, ethanoic acid/ethanol molar ratio of 1:5 and esterification temperature of 80 °C
From Fig. 5, we can see with the increase of the reaction temperature, the esteri-
fication rate rises rapidly. And the esterification temperature reaches 80 °C, the
esterification rate reaches a maximum value of 86.1%. The reaction of ethyl acetate
Production of Ethyl Acetate Catalyzed by Activated Carbon … 649
90
80
esterification rate(%)
70
60
50
40
30
20
10
0
50 60 70 80 90 100
esterification temperature (%)
Fig. 5 The effects of esterification temperature on the esterification rate of ethyl acetate at the
conditions of catalyst dosage of 3%, ethanoic acid/ethanol molar ratio of 1:5 and esterification time
of 4 h
The stability of solid acid depends on the acidic groups inside the carbon. Fourier
transform infrared spectroscopy was used to characterize the internal structure of
the carbon based solid acid recovered after each reaction. The results were showed
in Fig. 6.
Figure 6 shows that with the increase of the number of applications, the peak of
the intrinsic characteristics group of carbon-based solid acid gradually weakened,
the most significant for –SO3H (1000–1180 cm−1), O=S=O (1185–1380 cm−1).
When use times reaches 5 times, C–S, –SO3H peak basically disappeared, when it
reaches sixth times, the O=S=O peak basically disappeared. C–S, –SO3H, O=S=O
groups are provided by sulfuric acid, but also are the characteristic peaks of
carbon-based solid acid with catalytic activity. With the extension of the use of
carbon-based solid acid, the active carbon groups attached to solid acids with
650 J. Li et al.
5
Transmittance (%)
2
C-S
O=S=O
S-0 C-H 1
-SO3H -OH
C=C
500 1000 1500 2000 2500 3000 3500 4000
Wavenumber (cm-1)
4 Conclusions
The esterification reaction of ethyl acetate catalyzed by solid acid catalyst suggested
that the esterification rate of ethyl acetate with 85.4% was obtained under the best
conditions of the single factor tests, which were catalyst dosage of 3%, ethanoic
acid/ethanol molar ratio of 1:5, reaction time of 4 h, reaction temperature of 80 °C.
At the same time, the stability of the activated carbon solid acid catalyst was
analyzed by the esterification rate and the infrared spectrum. Finally, it was con-
cluded that the activated carbon-based solid acid catalyst prepared by this experi-
ment can be reused for 6 times.
References
1. Danlin Z, Min S, Yali M (2012) Recent developments in biomass carbon-based solid acid
catalyst. Pet Proc Petrochem 43(11):63–68
2. Issariyakul T, Dalai AK (2010) Biodiesel production from green seed canola oil. Energy Fuels
24(9):4652–4658
Production of Ethyl Acetate Catalyzed by Activated Carbon … 651
1 Introduction
Y. Li
Tianjin University of Science and Technology, Tianjin, China
J. Li H. Zhao (&)
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education,
Tianjin Key Laboratory of Industrial Microbiology, College of Biotechnology,
Tianjin University of Science and Technology, Tianjin 300457, China
e-mail: [email protected]
use of acid and alkali, reduction of industrial pollution on the environment, Which
will become a common alternative in the future.
In this paper, the hydrolytic conditions of corncob and hydrolyzate detoxification
were studied, as well as the components of medium to obtain chitosan. The aim of
this study was to investigate the potential of mycelia to produce chitosan from
hemicellulose.
After the corncob (hemicellulose 32%) was crushed, respectively using sulfuric acid
with the concentration of 0.5, 0.8, 1.0, 1.5 and 2.0% as the solid-liquid ratio of 1:10,
hydrolyzing at 100 and 120 °C for 2 h.
The spores were obtained by using PDA medium, then inoculated into the seed
medium, thereafter cultured in fermentation medium at 6% inoculum, placed in a
shaker at 200 r/min for 48 h at 30 °C.
The mycelium was collected by suction using a Buchner funnel and washed with
distilled water until clarified, then dried in an oven at 50 °C.
Weigh the sample 1 g, with concentrated hydrochloric acid hydrolysis at 100 °C for
6 h, after adjusting pH to neutral with sodium hydroxide, dilute the measured
absorbance, glucosamine hydrochloride from the standard curve of the sample in
the quality of glucosamine hydrochloride. According to the formula obtained chi-
tosan content
m1 103
Chitosan yield ¼ 0:8309100% ð1Þ
m2 102
Note: m1: The quality of glucosamine hydrochloride was determined from the
working curve (mg); m: The mass of the sample (g); 0.8309: Glucosamine
hydrochloride is converted to glucosamine by a factor.
The corncob was hydrolyzed by solid-liquid ratio 1:10 under different conditions
for 2 h, and the xylose content was determined. The hydrolysis condition of each
sample is shown in Table 1. The total yield of xylose is shown in Table 2.
Table 2 shows that the yield of xylose increases obviously with the increase of
acid concentration and temperature. When the concentration of sulfuric acid was
2.0% at 120 °C, the yield of xylose was the highest, reaching 87.79%.
656 Y. Li et al.
Table 3 The effects of hydrolysis conditions on mycelium growth and chitosan yield after initial
detoxification
Hydrolysis Mycelium concentration (g/L) Chitosan yield (g/L)
1 11.6 1.5
2 17.42 2.26
3 17.27 2.24
4 17,24 2.24
5 17.12 2.22
1° 18.79 2.44
2° 17.55 2.28
3° 16.27 2.16
4° No growth –
5° No growth –
well, the concentration reached 16.27 g/L and the yield of chitosan was 2.16 g/L.
While the hydrolysis condition with 2.0% sulfuric acid, the concentration of the
inhibitor in the hydrolyzate was too high to make mycelium to grow.
The hydrolyzate with 0.5 and 1.0% sulfuric acid undergo deep detoxification
experiments. After be detoxified by Ca(OH)2, then Ca(OH)2, activated carbon and
NKA-2 macroporous adsorption resin used for further detoxification. The mycelia
concentration and the chitosan yield were measured with the hydrolyzate as carbon
source. The results are shown in Table 4.
From Table 4, it was found that Ca(OH)2 had no significant effect on the
mycelial growth after two treatments, whereas activated carbon and NKA-2
macroporous resin detoxification hydrolyzate is more conducive to the growth of
mycelium. It may be that the latter causes the concentration of sugar in the
hydrolyzate to rise and the amount of the inhibitor to be reduced. The amount of
chitosan produced by activated carbon detoxification solution and NKA-2 macro-
porous resin was 2.74 and 2.78 g/L, respectively. As the cost of activated carbon is
low and easy to recover, therefore, the ideal detoxification method for is Ca(OH)2
detoxification with the deep detoxification by activated carbon.
Table 4 The effects of secondary detoxification on mycelium growth and chitosan yield
Sulfuric acid Detoxification Mycelium concentration Chitosan yield
concentration (%) (g/L) (g/L)
0.50 Ca(OH)2 18.8 2.46
Activated 19.21 2.55
carbon
NKA-2 19.29 2.56
1.00 Ca(OH)2 16.3 2.17
Activated 20.6 2.74
carbon
NKA-2 22.1 2.78
658 Y. Li et al.
Nitrogen sources were mainly composed of cell material and nitrogen metabolites.
With 2% peptone, beef extract, yeast extract, corn steep liquor, 0.58% sodium
nitrate and 0.73% ammonium nitrate as nitrogen source in the basal medium,
respectively (Inorganic nitrogen source was converted to the same nitrogen content
as peptone). The effects of different nitrogen sources on mycelial growth and chi-
tosan yield were investigated using 3% xylose as carbon source.
As shown in Table 5, the yield of chitosan was 0.67 g/L with corn steep liquor
as nitrogen source, which probably attribute to the rich soluble protein, inorganic
salt, biotin, and necessary nutrients in corn steep liquor [15], effectively promote
cell biomass synthesis. The yield of chitosan by yeast powder was 0.78 g/L, but it’s
price was expensive, therefore, using corn steep liquor as the medium nitrogen is
better.
After the detoxification of the hydrolyzate, 0.2% MgSO47H2O and 0.2% KH2PO4
were added. The results are shown in Fig. 1.
As shown in Fig. 1, the mycelial concentration increased with increasing corn
syrup, and the yield of chitosan increased from 1.58 to 2.74 g/L. However, when the
addition of corn steep liquor was over 7%, the yield of chitosan decreased with the
decrease of mycelium concentration due to the inhibition of substrate. Therefore,
the addition of corn steep liquor in the medium was determined to be 7%.
30 5
15
2
10
1
5
0 0
2 3 4 5 6 7 8 9 10
Corn syrup content (%)
Fig. 1 The effects of corn syrup contents on mycelium concentration and chitosan production
The initial pH of the fermentation medium was adjusted to different levels. The
fermentation temperature was controlled at 30 °C, shaking speed was 200 r/min,
inoculation amount was 6%. After 60 h, the mycelial concentration, chitosan yield
and degree of deacetylation were measured (see Fig. 2).
As shown in Fig. 2, when the medium pH was controlled at 4–5, the mycelium
concentration and the yield of chitosan were the highest. When the initial pH of the
culture medium was controlled from 6 to 7, the mycelium concentration and chi-
tosan production decreased, but the difference was not significant, which indicated
that the optimum pH of the Actinomucor elegans was 4–5. The degree of
deacetylation of chitosan increased with the initial pH of the culture medium. When
the pH was 7, the degree of deacetylation was the highest, and the degree of
deacetylation began to decrease after the pH was over 7, which mostly because the
deacetylase activity is highest under neutral conditions. Taking into account, the
optimal pH of the culture medium was 7.
660 Y. Li et al.
30 5 94
Degree of deacetylation
Chitosan yield 92
25
4
Mycelium concentration (g/L)
Mycelium concentration
Degree of deacetylation
90
0 0 80
2 3 4 5 6 7 8 9 10
pH
Fig. 2 The effects of initial pH on mycelium growth, chitosan production and deacetyiation
The fermentation temperature was controlled at 30 °C, pH 7, control air flow rate
1.667 vvm, stirring speed 100 r/min. The pH, xylose concentration, glucose con-
centration, cell biomass and chitosan content in the fermentation broth were mea-
sured every 4 h.
As shown in Fig. 3, the pH did not change much throughout the fermentation.
The xylose and glucose in the fermentation broth were first utilized by the myce-
lium, and the glucose was almost completely utilized at 20 h. When the fermen-
tation started, the mycelium grew slowly, entered the logarithmic phase at 24 h,
stabilized at 52 h, reached a maximum of 2.87 g/L, and the time of culture was 6 h
earlier than in the shaker, mainly depend on ventilation and stirring improve the
dissolved oxygen in the fermentation, cell growth faster, so that the fermentation
cycle shortened. Prolonged fermentation time, chitosan production began to
decline, which may depend on increased cell harmful metabolites and dissolved
oxygen, mycelium cell wall autolysis.
The Preparation of Chitosan from Corncob Hydrolyzate … 661
35 9 5
Xylose Chitosan yield
Mycelial concentration pH 8
Concentration of carbohydrate (g/L) 30
4
7
Mycelial concentration (g/L)
25
pH
15 4
2
3
10
2
1
5
1
0 0 0
0 4 8 12 16 20 24 28 32 36 40 44 48 52 56 60 64 68 72
Time (h)
4 Conclusion
In this paper, the hydrolysis conditions of corncob and the optimization of the
process for the production of chitosan by fermentation of Actinomucor elegans
were studied. The results are as follows:
(1) The best hydrolysis condition of corncob was hydrolyzed by 0.5% H2SO4 at the
ratio of 1:10 and 120 °C for 2 h, the best detoxification method was Ca(OH)2
and activated carbon.
(2) The optimal medium components of Actinomucor elegans were determined as
following: the detoxification corncob hydrolysate, 7% corn syrup, 2%
MgSO47H2O and 2% KH2PO4, initial pH 6.5, inoculation amount 6% under
60 h, the yield of chitosan increased to 2.87 g/L.
(3) The feasibility of fermentative preparation of Chitosan by corncob hydrolysate
was proved by fermentation experiment. However, the toxic components in the
hydrolysate have a great impact on the growth of M. elegans. The detoxification
process needs a high cost, and the domestication bacteria is needed to enhance
the tolerance of toxic components from the hydrolyzate.
662 Y. Li et al.
References
1. Du FG, Shi JP, Zhang L et al (2007) Research progress of fuel ethanol production in cellulose
production. Chin J Hemorheol 29(1):72–85
2. Dong XM, Revol J, Gray DG (1998) Effect of microcrystallite preparation conditions on the
formation of colloid crystals of cellulose. Cellulose 5(1):19–32
3. Slamenova Darina (2002) Reduction of carcinogenesis by bio-based lignin derivatives.
Biomass Bioenergy 23(8):153–159
4. Lloyd TA, Wyman CE (2005) Combined sugar yields for dilute sulfuric acid pretreatment of
corn stover followed by enzymatic hydrolysis of the remaining solids. Biores Technol 96
(18):1967–1977
5. Fan YC, Xu QQ, Zhuang YJ (2004) Extraction of chitin and ChITOSAN FROM Aspergillus
niger. Biotechnology 10(2):2–3
6. Liu HW, Wang AM, Feng GN (2009) Study on the technology of producing saccharomyces
cerevisiae protein by corn corn hydrolyzate. Food Sci Technol 34(6):48–51
7. Zamani A, Edebo L, Sjostrom B et al (2007) Extraction and precipitation of chitosan from cell
wall of zygomycetes fungi by dilute sulfuric acid. Biomacromol 8(12):3786–3790
8. Herrera A, Luis SJ, Cabriales JJ et al (2004) Effect of the hydrochloric acid concentrationon
the hydrolysis of sorghum straw at atmospheric pressure. J Food Eng 63(1):103–109
9. Jiang TD (2009) Chitosan (2nd edn). Chemical Industry Press; Beijing, p 4
10. Aranaz I, Mengibar M, Harris R, et al (2009) Functional characterization of chitin and
chitosan. Curr Chem Biol 3(2):203–230
11. Chatterjee S, Adhya M, Guha AK et al (2005) Chitosan from Mucor rouxii: production and
physico-chemical characterization. Process Biochem 40(1):395–400
12. Dhillon GS, Brar SK, Kaur S et al (2013) Green synthesis approach: extraction of chitosan
from fungus mycelia. Crit Rev Biotechnol 33(4):379–403
13. Cheung RC, Ng TB, Wong JH et al (2014) Chitosan: an update on potential biomedical and
pharmaceutical applications. Mar Drugs 13(8):5156–5186
14. Chen X, Lai XH, Yuan YY et al (2000) Preparation of chitosan from filamentous. Fine Chem
17(3):132–134
15. Li WY, Zhao XM (2006) Study on L-lactic acid fermentation of corn steep liquor as organic
nitrogen source. Chem Ind Times 20(9):61–63
High-Efficiency Separation
and Purification of Taq DNA Polymerase
1 Introduction
The thermostable Taq DNA polymerase was firstly isolated by Ms. Qian Jiayun
from the YT-1 strain of the aquatic thermophilic bacteria (Thermus aquatics) [1–3].
Its high specificity, yield and sensitivity make it widely used in PCR [4, 5] and
other related techniques for many years. Taq polymerase has a half-life of 9 min at
97.5 °C and its optimum temperature is 75–80 °C. It can replicate a DNA fragment
of 1000 bp within 10 s at 72 °C. Its higher enzyme activity is temperature
dependent. At low temperature, the enzyme activity of replicating DNA was sig-
nificantly lower comparing to that at higher temperature. However, its activity on
DNA synthesis is also quickly reduced when temperature is higher than 90 °C.
At present, the main task in optimizing Taq DNA polymerase is to improve its
yield by genetic engineering as well as simplifying the purification and shortening
the production process [6, 7]. Large-scale production of efficient and cost-effective
Taq DNA polymerase relys on new engineering method, and therefore the PCR
technology still has much room to improve [8].
Engelke et al. constructed recombinant plasmid pTTQ18 and expressed the
recombinant Taq DNA polymerase in Escherichia coli. It was purified by denaturing
heat- hybrid protein and PEI. Then used BioRex 70 Ion Exchange Chromatography to
obtain recombinant Taq DNA polymerase. However, the yield, purity and enzyme
activity of this method are not very high. Qinchuan et al. used ammonium sulfate
precipitation and freezing and thawing to extract Taq DNA polymerase. It showed that
ammonium sulfate precipitation is relatively simple and low in cost. The activity of
2.1 Materials
Taq DNA polymerase Recombinant Escherichia coli strain preserved in our labo-
ratory. Chemicals and culture medium: Luria-Bertani (LB, 1% Tryptone, 0.5%
Yeast extract, 1% NaCl), 50 TAE Buffer (Tris, acetate, EDTA, pH 8.5), DNA
extracts (100 mmol/L Tris-Cl pH 8.0, 50 mmol/L EDTA pH 8.0, 500 mmol/L
NaCl, 1% SDS, 10 mmol/L bHere) [10]. Buffer A (500 ml): 0.6057 g Tris (pH
7.9), 0.2033 g MgCl2, 0.1982 g (NH4) 2SO4, 0.99 g Glucose, 1.86 g KCl.
The enzyme activity of one unit of Taq polymerase was defined by the amount of
enzyme required to incorporate 10 nmol deoxynucleotides into acid-insoluble
matter at 74 °C for 30 min using activated salmon sperm DNA as template/primer
[11].
High-Efficiency Separation and Purification of Taq DNA Polymerase 665
The E. coli strain of this experiment contains an exogenously expressed Taq DNA
polymerase gene. To purity Taq DNA polymerase, the strains were streaked on LB
plates (Amp 100 lg/mL), cultured for 16–20 h at 37 °C. Single colony is picked
and inoculated into 6 ml LB medium containing ampicillin (100 lg/mL), and
cultured overnight at 37 °C.
When the bacteria reached their semi-growth phase(OD660 = 0.4), induction of
Taq DNA polymerase was performed using different concentrations of IPTG and
samples were shook for 12 h at 37 °C.
Total DNA was extracted by using the Kit (Solarbio) according to the manufac-
turer’s instructions. Using extracted cell genome as PCR template through culturing
cell. Three kinds of primers were designed and verified by PCR [17]. The length of
the target fragment was 2200, 750 and 600 bp respectively. It can verify the amplify
efficiency of PCR.
3 Results
Drawing three section line [18] with a small amount of Taq DNA polymerase
solution. The treated plate was then incubated overnight at 37 °C and the growing
rounded single colony was picked as the candidate Taq DNA polymerase strain.
Fig. 1 Induction of
Taq DNA polymerase
The crude Taq DNA polymerase was obtained by repeated freezing and thawing
cycle as previously described [20] with constantly switching high and low tem-
perature. The protein was purified by affinity chromatography. The purified
Taq DNA polymerase that was obtained after the elution and detected the purifi-
cation effect of protein by SDS polyacrylamide gel electrophoresis [21].
As shown in Fig. 2, compared with the purchased Taq DNA polymerase
(control), the crude enzyme solution contains a small amount of hybrid protein, but
the purity of Taq DNA polymerase has been greatly improved after affinity chro-
matography. The purity of Taq DNA polymerase is up to about 90% by the gray
level analysis through Quantity One.
The obtained crude Taq DNA polymerase and purified enzyme were checked to see
whether there are residual amount of nucleic acid by using agarose gel elec-
trophoresis. As shown in Fig. 3, there was no ribonucleic acid bands in the obtained
Taq DNA polymerase extracts, thus it could be used for PCR experiment.
200 lL Coomassie Brilliant Blue G-250 Formulation Solution and 5 lL Taq DNA
Polymerase Purified Enzyme were added to each well of a cleaning 96-well plate,
reading the OD at 595 nm. The protein concentration of Taq DNA polymerase was
calculated according to the standard curve [22]. As shown in Fig. 4, after purifi-
cation, protein concentration of Taq DNA polymerase had increased.
It can be found that the purified enzyme of Taq DNA polymerase was heated to
15 min. PCR target band did not differ from the standard enzyme, which can meet
the high temperature conditions during PCR. Thus it could prove that the extracted
Taq DNA polymerase has good heat resistance.
Using PCR to analyze the efficiency of the obtained Taq DNA polymerase. The
length of the target fragment was 2200, 750 and 600 bp respectively. The results
indicated that our purified Taq DNA polymerase not only showed the high effi-
ciency on PCR as that of the standard enzyme, but even more powerful in
amplifying short length DNA template as it revealed higher specificity. Our purified
670 H. Zhou et al.
Taq DNA polymerase was not do the transformed, so fidelity will not have any
increase or decrease. Fidelity was not significantly different from the purchased
standard (Fig. 6).
4 Discussion
This study characterized and optimized the procedure of produce Taq DNA poly-
merase using a strain developed in our lab. Here we optimized the induction time of
IPTG for Taq DNA polymerase, and the protein content after induction was sig-
nificantly increased. Taq DNA polymerase was isolated by the method of prelim-
inary protein extraction combined with freeze-thawing and thermal denaturation,
followed by further purified using heparin affinity chromatography. The production
of Taq DNA polymerase was in high yield that reached *3.43 mg/mL. Taq DNA
polymerase was not do the transformed, so enzymatic activity will not have any
increase or decrease. The yield of purified enzyme was 5.15 mg and the final yield
was 2.6 mg/mL. The study also verified the quality and efficiency of the extracted
Taq DNA polymerase, and our results showed that Taq DNA polymerase could
amplify the DNA fragment of different length with even higher specificity than that
of the standard commercial enzyme.
Acknowledgements This work was financially supported by the Laboratory Open Foundation of
Tianjin University of Science and Technology (1304A303).
References
1. Zhan Q, Zhan W, Liu Z, Zhu K (2013) Preparation and purification of Taq DNA polymerase.
Hunan Agric Sci 13(10–11):15
2. Ding Y, Liu S, Qi Q (2011) Agricultural biotechnology. Agric Sci Technol 12(3):375–378
3. Yu Y, Li C, Chen S (2012) Rapid purification of Taq DNA polymerase by anion exchange
column. Fujian Agric J 27(7):734–738
4. Ding Y, Liu S, Li Q (2011) Preparation of Taq DNA polymerase by thermal purification.
Anhui Agric Sci 39(17):10153–10155
5. Ishmael Faoud T, Stellato C (2008) Principles and applications of polymerase chain reaction.
Basic Sci Pract Phys 101(4):437–443
6. Wang JC, LI RG (2004) Expression and purification of recombinant Taq DNA polymerase in
Escherichia coli. J QiangDao Univ (E&T)
7. Arezi B, Xing W, Sorge JA, Hogrefe HH (2003) Amplification efficiency of thermostable
DNA polymerases. Anal Biochem 321(2):226–35
8. Moazen F, Rastegari A, Hoseini SM, Panjehpour M, Miroliaei M, Sadeghi HM (2012)
Optimization of Taq DNA polymerase enzyme expression in Escherichia coli. Adv Biomed
Res, vol 82
9. Sadeghi HM, Rabbani M, Moazen F (2006) Amplification and cloning of Taq DNA
polymerase gene from Thermus aquaticus strain YT-1. Res Pharm Sci 1:49–52
10. Bu Z, Biehl R, Monkenbusch M (2005) Coupled protein domainmotionin Taq polymerase
revealed by neutron spin-echo spectroscopy. Natl Acad Sci USA 102(490):17646–17651
11. Lawyer FC1, Stoffel S, Saiki RK, Myambo K, Drummond R, Gelfand DH (1989) Isolation,
characterization, and expression in Escherichia coli of the DNA polymerase gene from
Thermus aquaticus.The Journal of Biological Chmistry 264(11):6427–37
12. Arabski M, Konieczna I, Wąsik S, Relich I, Zając K (2015) The use of lysozyme modified
with fluorescein for the detection of Gram-positive bacteria. Microbiol Res 170:242–247
13. Urh M, Simpson D, Zhao K (1990) Affinity chromatography: general methods. Methods
Enzymol 463:417–438
14. Zhang C, Long AM, Swalm B, Charest K, Wang Y, Hu J, Schulz C, Goetzinger W, Hall BE
(2016) Development of an automated mid-scale parallel protein purification system for
antibody purification and affinity chromatography. Protein Expr Purif 128:29–35
15. Krieg RC, Dong Y, Schwamborn K, Knuechel R (2015) Protein quantification and its
tolerance for different interfering reagents using the BCA-method with regard to 2D
SDS PAGE. J Biochem Biophys Method 65(1):13–9
16. Wiechelman K, Braun RD, Fitzpatrick JD (1988) Investigation of the bicinchoninic acid
protein assay: identification of the groups responsible for color formation. Anal Biochem, vol
175(1) (McCarthy)
17. McCarthy MW, Walsh TJ (2016) PCR methodology and applications for the detection of
human fungal pathogens. Expert Rev Mole Diagn 16(9):1025–36
18. Si Z, Zhu J, Wang W, Huang L, Wei P, Cai J, Xu Z (2016) Novel and efficient screening of
PQQ high-yielding strains and subsequent cultivation optimization. Appl Microbiol
Biotechnol
672 H. Zhou et al.
19. Marbach A, Bettenbrock K (2012) Lac operon induction in Escherichia coli: Systematic
comparison of IPTG and TMG induction and influence of the transacetylase LacA.
J Biotechnol 157(1):82–88
20. Pluthero FG (1995) Rapid purification of high- activity Taq DNA polymerase Nucl Acids Res
21:4850–4851
21. Ying Y, Zhao L, Kong L, Kong X, Hua Y, Chen Y (2015) Solubilization of proteins in
extracted oil bodies by SDS: a simple and efficient protein sample preparation method for
Tricine-SDS-PAGE. Food Chem 181:179–185
22. Brunelle JL, Green R (2014) Coomassie blue staining. Methods Enzymol 541:161–167
Determination of Activity and Extraction
of Thrombin from the Porcine Blood
Tianjun Li, Heng Li, Hong Pan, Tao Li and Jun Shi
1 Introduction
reported on porcine thrombin. Porcine production in China ranked first in the world,
a total of about 1 billion kilograms of porcine was got every year. At present, most
of the blood in the form of sewage is discharged out, not only a waste of valuable
biological resources and cause serious environmental pollution. Therefore, the
extraction of thrombin from porcine blood can make full use of blood resources, has
great market value.
Thrombin is extracted by the methods of isoelectric precipitation and ammonium
sulfate fractionation precipitation from fresh porcine blood. The solution of crude
thrombin which was activated by the 0.05 mol/L Ca2+ solution were obtained and
purified through chromatographic column of cellulose DEAE-52. The measurement
of activity of the obtained thrombin was carried.
2.1 Materials
The fresh porcine blood is obtained from Yanchen porcine farm in Wuqing distinct
Tianjin. Before sampling, the 3.8% sodium citrate solution as anticoagulation was
shook and centrifuged under 4000 r/min for 20 min. The adtevak (the supernatant)
is packed in small tubes and saved under −20 °C.
Fibrinogen standard products (1000 l, dissolved in 1 mL NS, and then packed
into 100 tubes, each tube is 10 l) were supplied by the microbiology laboratory of
Tianjin University.
3.8% sodium citrate solution, 2% acetate acid, 30% ammonium sulfate,
Tris-HCl buffer solution(0.05 mol/L, pH = 7.2), 0.05 mol/L CaCl2 solution, NS,
0.1 mol/L NaCl solution
Isoelectric precipitation Two tubes of adtevak were taken out and unfrozen under
−4 °C, and then centrifuged under 4000 r/min for 10 min. The lower precipitation,
fibrinogen and other miscellaneous protein, was removed, and the supernatant was
collected. The supernatant was diluted 10 times with distilled water. The pH was
adjusted to 5.0 with 2% acetate acid. Then the solution was placed overnight under
−4 °C. The supernatant was removed by siphon method. The precipitation was
centrifuged under 4000 r/min for 10 min.
Ammonium sulfate fractionation precipitation The saturated solution 30%
ammonium sulfate was added to the precipitation. The precipitation was dissolved
Determination of Activity and Extraction of Thrombin … 675
completely. This solution was placed overnight. The above-mentioned solution was
centrifuged under 4000 r/min for 10 min in the next day. Ammonium sulfate was
added to the supernatant until the solution reach to its degree of saturation of 65%.
This solution was centrifuged under 4000 r/min for 20 min after being placed for
10 h. The supernatant was removed and the precipitation (prothrombin) was
collected.
Dialysis The above-mentioned precipitation was dissolved with 0.05 mol/L
Tris-HCl solution with pH = 7.2. The dialysis bag was boiled for 10 min and
checked its leaks. The solution was transferred into dialysis bag. After this dialysis
bag was full of 60% and the air was removed, the solution was dialyzed for 4 h
under −4 °C. During the process, the solvents was changed once time. Then the
solution was dialyzed against buffer solution overnight. This solution was cen-
trifuged under 3000 r/min for 20 min. The supernatant was the prothrombin of
porcine blood.
0.4 mL 0.25 mol/L CaCl2 was added to the 19.6 mL solution of prothrombin. The
final concentration of Ca2+ was 0.05 mol/L. The prothrombin was activated during
1.5 h. The activated prothrombin was the crude thrombin.
The thrombin was purified by ion-exchange chromatography [4]. First, the sus-
pension including 30 g cellulose DE-52 was boiled for 10 min to swell it. This
suspension was added into column and balanced with the 0.05 mol/L, pH = 7.2
Tris-HCl solution. The sample of thrombin was eluded by 0.1 mol/L, 0.1 mol/L
NaCl, respectively after the sample was dissolved with 0.05 mol/L, pH = 7.2
Tris-HCl solution. The constant pump flow rate is set as 20 m L/h, 4 mL/tube. The
collected solution was the thrombin solution which was dialyzed against water to
remove the ion of Na+ and Cl− and frozen drying. The product was thrombin.
The activity for thrombin was determined according to the method provided by the
Pharmacopoeia of the People’s Republic of China [5]. The standard curve was
drawn with different concentrations of thrombin standard vs the reaction time of
different fibrinogen standard solution. The activity of purified thrombin could be
obtained by the standard curve after determining the reaction time between
thrombin and fibrinogen.
Determination of protein content was done using UV absorption method, with
bovine serum albumin as the standard with 752 spectrophotometer.
676 T. Li et al.
After the prothrombin extracted from blood was activated, the thrombin was
purified with ion-exchange chromatography. The column was balanced with the
0.05 mol/L, pH = 7.2 Tris-HCl solution overnight before the 2 mL crude thrombin
solution was pour into the column. The sample was eluted with 0.05 mol/L,
pH = 7.2 Tris-HCl solution and 0.1 mol/L NaCl, respectively. The flow rate was
20 mL/h. The sample was collected onto automatic collector with 4 mL/tube. The
number of the tubes was 1–10. The elution solution was changed into 0.2 mol/L
NaCl after the sample collection was completed. The flow rate and the number of
the tubes were unchanged. The number of these tubes was 11–20. The adsorption of
these samples was measured with UV–Vis spectrophotometer at 280 nm. The
reference solutions were 0.1 mol/L NaCl for the 1–10 tube and 0.2 mol/L NaCl for
11–20 tube, respectively. The protein content solution of each sample was shown in
Fig. 1. At the same time, 50 lL solution, added the same volume solution of
fibrinogen (0.25 g/mL), was taken out from each tube in a small centrifuge tube.
There was precipitation in tube to account for the existence of thrombin activity. So
the thrombin activity was measured qualitatively.
As shown in Fig. 1, a small amount protein was eluted by 0.1 mol/L NaCl while
a large amount protein was eluted by 0.2 mol/L NaCl. The results showed that there
was thrombin activity in the 12–17 tube, not in other tubes. So the protein eluted by
0.2 mol/L NaCl was the thrombin protein. The solution in 12–17 tubes was merged
to obtain 24 mL solution. The 4 mL solution was taken out for subsequent mea-
surement and the surplus 20 mL solution was dialyzed against water to remove the
Na+ and Cl− overnight. The dialysis solution was frozen-drying overnight.
There were different methods in every step during the separation and purification
of the thrombin. So the purity and yield of thrombin obtained by different combi-
nation methods were different. Thrombin extraction is mainly divided into four
steps: obtained plasma, extraction of prothrombin, prothrombin activation and
thrombin purification. The different dilution ration of the blood plasma had a certain
effect on the extraction of thrombin when the method of the isoelectric point pre-
cipitation was used. The obtained blood plasma was frozen for 12 h under −20 °C to
remove the fibrinogen and other proteins of the blood plasma. The prothrombin,
which was extracted with the combined method of the isoelectric point precipitation
and ammonium sulfate precipitation, was diluted 10 times, activated by 0.05 mol/L
Ca2+ and purified by DEAE-52 cellulose ion exchange chromatography. After the
combination of the above methods, the extracted thrombin showed that the protein
content was similar to that of the thrombin standard, and the product was fully
purified. 5 mg thrombin was extracted from the 100 mL blood plasma. The activity
of thrombin was low. So the different method combination is used to achieve the best
results in the future experiments.
The purified water was added to the 25 mg bovine serum albumin to 25 mL. The
concentration of the bovine serum albumin solution was 1 mg/L. A variety of
reagents was added and mixed into the test tubes numbered 1–8 according to the
Table 1. The value of adsorption (OD280) was measured at 280 nm with the
solution in 1 tube as reference.
Figure 2 show that the standard curve of adsorption with protein concentration
was drawn. As shown in Fig. 2, the equation of protein concentration was
y = 0.1805x. The adsorption of thrombin measured with 752 UV–Vis spectrometer
was 0.139. The calculated protein concentration was 0.77 mg/mL.
5.0 U thrombin standard solutions (5 lL) was added 0.9% NaCl to the final volume
of 1 mL, which was the thrombin standard solution. 0.1 mL thrombin standard
solution was added 0.9 mL fibrinogen standard solution with different concentra-
tions which heated at 37 °C for 5 min. The reaction time was controlled about
1 min by adjusting the concentration of fibrinogen standard solution. The reaction
time was about 80 s when the fibrinogen standard solution was 0.25 mg/mL. So
0.25 mg/mL of fibrinogen standard solution was chosen during the process of
drawing the standard curve.
The thrombin standard solution was dissolved with 0.9% NaCl to obtain a serial
of solution with 5.0, 6.4, 8.0, 10.0 and 12.0 U. 0.1 mL above-mentioned solutions
and 0.9 mL fibrinogen standard solution with concentration of 0.25 mg/mL was
quickly mixed in five tubes respectively at 37 °C for 5 min. At the same time, the
time started. These tubes was shaken well and placed in a water bath at 37 °C. The
initial setting time of fibrinogen was recorded. The measurements were repeated
three times to obtain the average value.
The reaction time of the thrombin standard solution reacted with fibrinogen
standard was shown in Table 2.
In the double logarithmic, changes in the setting times with the average value of
actual activity units was shown in Fig. 3.
As shown in Fig. 3, the equation of activity of thrombin was
y = −0.115x + 14.406. The initial setting time of thrombin was measured with the
same method. The times were 75, 73, 76 s respectively. The average value was
74.7 s. The calculated activity of thrombin was 5.8 U/mL and the specific activity
was 29.9 U/mg.
According to the literatures [4], the activity of thrombin was affected by the
temperature. The lower the temperature was, the higher the activity of thrombin
Determination of Activity and Extraction of Thrombin … 679
was. The activity of thrombin decreased remarkably when the temperature was
higher than 25 °C. The activity of the thrombin decreased to 15% with the increase
of the temperature. So, the extraction should be carried out at low temperature in the
process of extracting thrombin. The experiment was carried out at room tempera-
ture, which may cause effects on the activity of thrombin with extent.
The concentration of CaCl2 and the activated time have effect on the activity of
thrombin. The higher the concentration of CaCl2 was, the higher the activity of
thrombin was. The activity of the thrombin kept a constant when the concentration
of CaCl2 was increased to a certain value. So the effect of the different temperature
and concentration on the activity of thrombin should be considered in the future
research.
4 Conclusions
There is rich porcine blood in China. The extraction of thrombin from porcine
blood may make fully use of the porcine blood resource. The thrombin has great
application value in clinical due to its good hemostatic effect. In our experiment, the
680 T. Li et al.
porcine blood was used as raw material to extract the thrombin. Thrombin is
extracted by the methods of isoelectric precipitation and ammonium sulfate frac-
tionation precipitation from fresh porcine blood. The solution of crude thrombin
which was activated by the 0.05 mol/L Ca2+ solution were obtained and purified
through chromatographic column of cellulose DEAE-52. The active component, as
pure solution of thrombin, was frozen-drying to obtain the white and pure thrombin.
The specific activity was 29.9 U/mg by measuring the activity and purity of the
extracted thrombin.
References
1. Wenjing Zhou, Jiali Lv (2005) The improvement of method for the extraction and purification
of thrombin from the porcine blood. Res Dev Food 26(2):93–95
2. Changfa Xu, Yulan Wang, Defu Liu et al (1994) Dertermination, separation and purification of
thrombin. J Beijing Union Univ 8(1):45–48
3. Yi Lai, Yang Liu, Fangzhao Lin (2009) Overview of thrombin research. Thrombosis
Hemostasis 15(3):142–144
4. Wanqiong Ren (2008) The effect of the conditions for the separation and extraction of
thrombin. J Med Sci 29(23):53–54
5. Chinese Pharmacopoeia Commission (2005) The third Pharmacopoeia of the People’s
Republic of China. Chemcal Industry Press, Beijing, pp 193–194
An Efficient Method for Isolation
and Separation of Pigments
from Streptomyces alboflavus TD-1
Xiaoyue Gu, Yali Zhang, Laifeng Lu, Zhenjing Li and Changlu Wang
1 Introduction
Colorants derived from natural sources, such as plant and microorganisms, are
believed to be a good alternative to artificial pigments because they are non-toxic,
non-carcinogenic and biodegradable [1, 14]. The isolation and application of
microbial pigments have been investigated by various researchers [13]. Urgent
problems that need to be solved are improving extraction and separation process of
pigment produced by microorganisms expanding the scope of natural pigment
application and reducing the production cost of natural pigment [7, 15]. For
microbial pigments, their solubility, coloring, and stability are important indices of
their applicability in industry [18]. Microbial pigments are also attractive for its
wide range of biological activities, including activities as antimalarial, antifungal,
immunosuppressant, and antibiotic agents, which make them an excellent target for
dual or multifunctional application [8].
Despite a long history of studies on Streptomyces species, they still have many
biochemical mysteries to be elucidated [5]. Our previous studies indicated that
Streptomyces alboflacus TD-1 could significantly inhibit various fungi, such as
Fusarium moniliforme, Fusarium oxysporum, Fusarium solani, Aspergillus flavus,
Aspergillus niger, Aspergillus oryzae, Aspergillus ochraceus, Aspergillus nidulans,
Penicillium verrucosum and Penicillum citrinum [17, 19]. Interestingly, S. albo-
flacus TD-1 was found to produce amounts of pigments which are supposed to have
anti-bacterial property. Necessities both in extraction and isolation from microbial
pigments have increased as new research areas of their characteristic and antibac-
terial activities have been developed [16]. However, there still be many problems
The strain S. alboflavus TD-1 was isolated from the soil around the grain storage
silo of the Feed Mill of Baodi District in Tianjin City and preserved in the China
General Microbiological Culture Collection Center (CGMCC No. 4666). The spore
suspension was inoculated in Gause’s synthetic medium on a gyratory shaker at
30 rpm s−1 for 7 days at 30 °C. The Gause’s synthetic medium consisted of 20.0 g
of soluble starch, 1.0 g of KNO3, 0.5 g of K2HPO4, 0.5 g of NaCl, 0.5 g of
MgSO4 7H2O, and 0.01 g of FeSO4 7H2O in 1 L of tap water (pH 7.2). The
fermentation broth was filtered, and the mycelium of S. alboflavus TD-1 was used
for pigment extraction.
In the present study, two-phase solvent systems with four different solvents were
selected for the pigment separation. Each solvent system was full equilibrium at
room temperature after thorough vigorous shaking. Approximately 0.1 mg of S.
alboflavus TD-1 pigment powder was added in 4 mL upper phase of the two-phase
solvent system. Taken 1 mL solution as the value of K1, the 3 mL remaining upper
phases and lower phase were mixed, then taken 1 mL lower phase of mixture
solution as the value of K2 [2]. Equal volumes of the upper and lower phases were
evaporated to dryness, respectively. The sample was dissolved with 100% methanol
to equal volumes and analysed by HPLC to obtain the partition coefficient (K) of S.
alboflavus TD-1 pigment [12].
Intensively mix four organic reagents of a specific volume, then stand for 30 min, to
reach stratification between the liquid phase and the stationary phase. Select upper
phase as the stationary phase and the lower one as the liquid phase, perform
ultrasonic degaussing for 30 min, to avoiding air bubbles, respectively [3]. Turn
down the pump at 10 mL min−1 in the stationary phase. Turn off the pump when it
flows out of the column outlet [20]. Change the pump head and put it into the liquid
phase. Then, adjust the speed of countercurrent chromatography of the host, select
mode of reverse connection and forward mode, and slowly modulates the revolving
speed to 14.1 rpm s−1. After the host speed is stable, pump it into the lower phase at
a speed of 2 mL min−1. Make sure that the stationary phase and the liquid phase are
balanced, and then recording the volume of the upper and lower phase, and con-
tinue to pump into the lower phase [11]. Injecting the pigments into the sample with
a syringe, closing the injection program, switching the button to load mode. Finally,
collect the outflow of liquid and stop the host’s rotation. Adjust the rotational speed
slowly to 15 rpm s−1 under forward positive connection mode, collect the outflow
of liquid, and record the time.
684 X. Gu et al.
3 Results
The S. alboflavus TD-1 mycelium sample was mixed with different solvents at a
ratio of 1:10 (v:v), 1:50 (v:v), 1:100 (v:v), respectively. Its absorption value was
then measured under absorbance of 530 and 360 mm.
As it is shown in Fig. 2a, absorbency of S. alboflavus TD-1 methanol extracts at
360 nm is higher than ethanol and hexane extracts. The methanol fully extract the
secondary metabolites at the solid-liquid ratio of 1:10 (v:v); ethanol extracts the
secondary metabolites fullest at the solid-liquid ratio of 1:50 (v:v); but the
Methanol
Ethanol
2 Hexane
Absorbance
0
200 400 600 800 1000
-1
Ultraviolet wavelengths (nm)
-2
(a)
6
Ethanol
5
Methanol
Hexane
c c
Absorbance [OD 360]
4
b
c
3 b
b
2
a a a
0
1:0 1:10 1:50 1:100
Solid-liquid ratio [g/mL]
(b)
3
Ethanol
Methanol
Hexane
Absorbance [OD 530]
c
b
c a
1 b
b
a a
a
0
1:0 1:10 1:50 1:100
S. alboflavus TD-1 mycelium sample was added into solvents with a ratio of 1:50
(v:v), then assisting of ultrasound for 10, 30, and 60 min. As it is shown in Fig. 3a,
the absorbency of secondary metabolites is highest in methanol at 360 nm, fol-
lowed by ethanol and lower in hexane. It takes 10 min to fully extract secondary
metabolites by methanol and 30 min by ethanol and hexane at the wavelength of
360 nm. As it is shown in Fig. 3b, the absorbency of secondary metabolites is
highest when extracting by hexane, followed by methanol, lowest by ethanol;
(a)
Cont-Ethanol Ultr-Methanol
6 Ultr-Ethanol Cont-Hexane
Cont-Methanol Ultr-Hexane
Absorbance [OD360]
e d c
4 d c c bc bc
b b
c
b
a a a
a a a
0
10 0 30 60
Time [min]
(b)
Cont-Ethanol Ultr-Methanol
Ultr-Ethanol Cont-Hexane
Cont-Methanol Ultr-Hexane
4
Absorbance [OD530]
f e
f
d d
2
e e c c
d c
c b
b b
a a a
0
10 0 30 60
Time [min]
hexane fully extract the secondary metabolites for 30 min and the absorbency of
secondary metabolites are lower without ultrasonic than under the condition of
ultrasonic.
In Fig. 4, the absorbance rate of 30-fold diluted extraction was measured four times
after each time of extraction, respectively.
(a)
5
4 b
Ethanol
b Methanol
Absorbance [OD 360]
Hexane
3
2
c
a
1
b c
b a
a a
0
1 2 3 4
Extraction Times
(b)
4
Ethanol
c
Methanol
Absorbance [OD 530]
3 Hexane
b
1 c
a
b b
a
0 a a a
1 2 3 4
Extraction Times
The absorbance of extract in methanol and ethanol is higher than hexane and
decrease significantly during the fourth extraction with the wavelength of 360 nm.
The absorption value of hexane at 360 nm was low. The high absorption value was
at 530 nm, and the secondary metabolites were fully extracted the third time, and
the secondary metabolites of methanol and hexane in the third extraction were
completely adequate.
4 Discussion
balance value K in high-speed reflux. The liquid phase, with the Solvent system
ratio is 6:4:7:3, can separate the yellow pigments (Fig. 5I) by using the corotation
and positive connection mode and orange red, rose red, and orange pigments
(Fig. 5II–IV) by using the forward-rotating and reverse connection mode.
In conclusion, four kinds of pigments were separated from the S. alboflavus
TD-1 extracts by HSCCC, the four kinds of pigment with moderate polarity could
be more suitable used in dyeing industry. What’s more, S. alboflavus TD-1 pigment
showing excellent antibacterial properties which give it higher values in colorants
industrial. However, the metabolic processes of pigment production in S. alboflavus
TD-1 still needs further research.
References
14. Shirsath SR, Sonawane SH, Gogate PR (2012) Intensification of extraction of natural products
using ultrasonic irradiations—a review of current status. Chem Eng Process 53:10–23
15. Venil CK, Zakaria ZA, Ahmad WA (2013) Bacterial pigments and their applications. Process
Biochem 48(7):1065–1079
16. Verma B, Kumar P, Dhanasekaran D et al (2015) Gas chromatography-mass spectrometry
analysis and antibacterial activity of bluish-green pigment from pseudomonas sp. JJTBVK
(KF836502). Braz Arch Biol Tech 458(4):628–635
17. Wang C, Wang Z, Qiao X et al (2013) Antifungal activity of volatile organic compounds from
Streptomyces alboflavus TD-1. FEMS Microbiol Lett 341(1):45–51
18. Wang Y, Lu Z, Lv F et al (2009) Study on microencapsulation of curcumin pigments by spray
drying. Eur Food Res Technal 229(3):391–396
19. Wang Z, Wang C, Li F et al (2013) Fumigant activity of volatiles from Streptomyces
alboflavus TD-1 against fusarium moniliforme sheldon. J Microbio 51(4):477–483
20. Yang Y, Aisa HA, Ito Y (2009) Mathematical model of computer-programmed intermittent
dual countercurrent chromatography applied to hydrostatic and hydrodynamic equilibrium
systems. J Chromatogr A 1216(35):6310–6318
Part IV
Progress of Biotechnology
Establishment of the Method for Screening
Small Molecule Inhibitors Blocking
the Interaction Between PD-1 and Its
Ligand PD-L1
1 Introduction
In the last decades, cancer biology studies have attempted to stimulate the antitumor
immune response to fight cancer. However, those attempts were not very successful
because the cancer cells could evade the immune system by modulating the “immune
checkpoints”. Until recent years, the antibodies targeted the “immune checkpoints”
were developed [1], the immunotherapies had a fast development in clinical treat-
ment for some types of solid tumors [2], especially in melanoma [1, 3–5].
Programmed cell death-1 (PD-1) protein is a type I transmembrane receptor that
was originally isolated from T-cell hybridoma [6]. It belongs to Ig super-family that
contains a Ig-like-V domain in its extracellular region and has been found to be
expressed on macrophages, mature B cells and T cells following activation [7–9].
PD-1 has been shown to negatively regulate T-cell receptor signaling, which lead to
reduced T-cell cytolysis, proliferation and cytokine production [10, 11]. Its ligand
PD-L1 also known as B7-H1 is highly over-expressed in many solid tumors. In
addition, PD-L1 was also found to be expressed on various human tumor cell lines
containing colon, breast and lung cell lines [12]. IFN-c up-regulates the expression
of PD-L1 on human tumor cells [13]. These observations have led to the founding
that tumors escape immune system via PD-1/PD-L1 interaction by negative the host
immune responses.
The PD-1/PD-L1 immune checkpoint is a key target in the immune treatment of
cancer, and mostly inhibitors on PD-1/PD-L1 checkpoint are monoclonal antibodies
targeting PD-1 or PD-L1. These antibody-based drugs have inherent drawbacks,
such as poor tumor penetrance due to their large size and activated cytotoxic
immune responses through NK cells and macrophages [14, 15], which limit their
The DNA fragments encoding the extracellular domain of human PD-1 and PD-L1
protein were amplified by PCR using the primers listed in Table 1, which cloned
from the cDNA plasmids pMD-PD-1 and pMD-PD-L1 (Sino Biological). The PCR
product of amplified PD-1 gene was digested by using BamHI and EcoRI and
inserted into the pET32a (GE Healthcare) vector. The PCR product of amplified
PD-L1 gene was purified and digested with EcoRI and XhoI and inserted into the
pGEX-4T-2 (GE Healthcare) vector.
overnight at 16 °C. The His-tagged protein was purified using Ni-Sepharose beads
after lysis of the bacteria in Na-P lysis buffer (50 mM Phosphate Buffer pH 8.0,
150 mM NaCl, 5 mM b-mercaptoethanol) plus protease inhibitors. After sonica-
tion, the extracts were clarified by centrifugation. The recovered supernatants were
allowed to bind to Ni-Sepharose beads (GE Healthcare) for 3 h at 4 °C. After
washed three times with Na-P lysis buffer containing 50 mM imidazole, the beads
was eluted with elution buffer (50 mM Phosphate Buffer pH 8.0, 150 mM NaCl,
5 mM b-mercaptoethanol and 250 mM imidazole).
For the GST pull-down assays, 5 lg GST-fusion proteins were incubated with the
Glutathione-Sepharose beads for 2 h in rotation at 4 °C, then washed three times
with cold GST pull-down buffer (20 mM Tris-Cl pH 7.4, 150 mM NaCl, 1%
Triton-100, 2 mM DTT). 0.5 lg protein of His-Trx-PD-1 was resuspended in the
GST pull-down buffer and clarified by centrifugation at 14,000 rpm for 10 min, the
supernatant was added to the GST-beads and incubated for 2 h in rotation at 4 °C,
then washed three times with cold GST pull-down buffer and washed once with
1 PBS. Finally, the beads were resuspended and boiled in 40 ll 2 SDS
loading buffer for 5 min, the supernatants were collected and separated by 10%
SDS-PAGE and analyzed by Western blot using anti-His-tag antibody.
3 Result
Fig. 1 The schematic structure of human PD-1 (a) and its ligand PD-L1 (b). Amino acid positions
of individual domains are denoted with corresponding numbers. TMD transmembrane domain
Establishment of the Method for Screening Small … 699
Fig. 2 Expression and purification of the GST-PD-L1 (a, c) and His-Trx-PD-1 (b, c) fusion
protein induced by 0.2 mM IPTG. 1, 6, 11 protein makers; 2, 7 culture before IPTG induction; 3, 8
the total cell lysate; 4, 9 the soluble cell lysate after centrifugation; 5, 10 the cell pellet after
centrifugation; 12, 13 the purified GST-PD-L1 protein; 14, 15 the purified His-Trx-PD-1 protein
GST pull-down experiment was performed to verify whether PD-1 interacts with
PD-L1. As shown in Fig. 3a, GST-PD-L1, but not GST, pulled down purified
His-Trx-PD-1, which indicates that GST-PD-L1 interacts with His-Trx-PD-1
directly. To largely screen the small molecule inhibitors blocking PD-1/PD-L1
interaction, the competitive ELISA assay was used to measure the PD-1/PD-L1
interaction. As shown in Fig. 3b, the interaction of GST-PD-L1 with His-Trx-PD-1
had a high absorbance value than the GST control, the ratio of the binding of
GST-PD-L1 with His-Trx-PD-1 to the GST control was optimized with the
GST-PD-L1, His-Trx-PD-1 and GST proteins were at 200 ng/well separately
(Fig. 3c). These results showed that competitive ELISA assay could be used
measure PD-1/PD-L1 interaction for inhibitor screening.
Fig. 3 Measuring the PD-1/PD-L1 interaction. a Direct interaction between PD-1 and PD-L1
determined by the GST pull-down assay; b measure the interaction between PD-1 and PD-L1
determined using the ELISA assay, GST protein was used as a negative control. c The optimized
combination of different concentration of adding GST-PD-L1, His-Trx-PD-1 or GST proteins.
Y-axis: the ration of absorbance value for GST-PD-L1 with His-Trx-PD-1 to GST control
had an obviously inhibitory effect, the chemicals S2468 (Fenbendazole) and S2084
(Duloxetine HCl) had the most inhibitory effect with the inhibition rate 0.49 and
0.52 respectively (Fig. 4a). The chemical structure of Fenbendazole and Duloxetine
HCl were shown in Fig. 5. During the screening, the chemicals S2485
(Mitoxantrone Hydrochloride) and S1957 (Sulfamethizole) had a positive effect
with the inhibition rate 1.8 and 1.6 respectively (Fig. 4a). The chemical structure of
Mitoxantrone hydrochloride and Sulfamethizole were shown in Fig. 5.
Establishment of the Method for Screening Small … 701
Fig. 4 Screening of the small molecule chemicals inhibiting the PD-1/PD-L1 interaction using
competitive ELISA assay. Inhibition rate, the ratio between the treatments added small molecule
and the treatment without. Value < 1, inhibitory effect. Value > 1, positive effect
4 Discussion
It has been reported that blocking immune checkpoint has a positive role on the
anti-tumor treatment. Most monoclonal antibodies, targeting immune checkpoint
are widely used on clinical trials now, such as pembrolizumab [16], nivolumab [4],
MDX-1105 [17], MDX-1106 [2]. Although antibody-based inhibitors for blocking
immune checkpoints, such as PD-1, PD-L1, CTLA-4, have been significantly
developed recent years, almost all antibodies have immunogenicity and have dif-
ferent therapeutic effect to different patients. These deficiency limit their application
on clinical trial.
Blocking the interaction of PD-1 protein with its ligand PD-L1 was proved to be
an effective way for suppressing the development of tumors. Thus, screening the
small molecule inhibitors blocking the interaction of PD-1 with PD-L1 became an
efficient strategy. Here, we screened 320 small molecule chemicals from L1300
702 L. Jing et al.
Selleck FDA Approved Drug Library by using the competitive ELISA assay.
Fenbendazole and Duloxetine HCl have a highly inhibitory effect and the inhibition
rates are about 0.49 and 0.52 with the concentration at 5 lM. The homogeneous
time-resolved fluorescence (HTRF) [18] might be applied to further evaluate the
inhibitive activity of Fenbendazole and Duloxetine HCl, and additional studies are
required to further elucidate the therapeutic value and clinical applications of these
inhibitors targeting PD-1/PD-L1. It was proved that Fenbendazole has a potential
anti-cancer activity while Duloxetine HCl was just as a anti-depressant combining
with chemotherapy [19–21]. This may be important for immunotherapy. In recent
years, the short single stranded DNA as known as aptamer, have a strong plasticity
that can be formed the unique three dimensional structures and be easier modified to
change their pharmacokinetics [22, 23]. Several immune modulatory aptamers have
been developed to block immune checkpoint such as the DNA aptamer blocking the
murine PD-1/PD-L1 interaction [24, 25]. Based our established screening model for
PD-1/PD-L1 interaction inhibitors, this method also can be used to screen more
efficient DNA aptamers inhibiting the PD-1/PD-L1 interaction.
In conclusion, we established a method for screening small molecule inhibitors
blocking the interaction between PD-1 and its ligand PD-L1 using the competitive
ELISA assay, which can be used for the development of inhibitors blocking
PD-1/PD-L1 interaction.
Acknowledgements This research is supported by the program for Tianjin University of Science
and Technology student laboratory Innovation Fund (1504A302X).
References
1. Hodi FS, O’Day SJ, Mcdermott DF et al (2010) Improved survival with ipilimumab in
patients with metastatic melanoma. N Engl J Med 363(8):711–723
2. Brahmer JR, Drake CG, Wollner I et al (2010) Phase I study of single-agent anti-programmed
death-1 (MDX-1106) in refractory solid tumors: safety, clinical activity, pharmacodynamics,
and immunologic correlates. J Clin Oncol 28(19):3167–3175
3. Hamid O, Robert C, Daud A et al (2013) Safety and tumor responses with lambrolizumab
(anti-PD-1) in melanoma. N Engl J Med 369(2):134–144
4. Tsai KK, Daud AI (2014) Nivolumab plus ipilimumab in the treatment of advanced
melanoma. J Hematol Oncol 8(1):1–4
5. Wolchok JD, Kluger H, Callahan MK et al (2013) Nivolumab plus ipilimumab in advanced
melanoma. N Engl J Med 369(2):122–133
6. Ishida Y, Agata Y, Shibahara K et al (1992) Induced expression of PD-1, a novel member of
the immunoglobulin gene superfamily, upon programmed cell death. EMBO J 11(11):
3887–3895
7. Nishimura H, Honjo T (2001) PD-1: an inhibitory immunoreceptor involved in peripheral
tolerance. Trends Immunol 22(5):265–268
8. Carreno BM, Collins M (2002) The B7 family of ligands and its receptors: new pathways for
costimulation and inhibition of immune responses. Annu Rev Immunol 20(20):29–53
9. Agata Y, Kawasaki A, Nishimura H et al (1996) Expression of the PD-1 antigen on the
surface of stimulated mouse T and B lymphocytes. Int Immunol 8(5):765–772
Establishment of the Method for Screening Small … 703
10. Rodig N, Ryan T, Pang H et al (2003) Endothelial expression of PD-L1 and PD-L2
down-regulates CD8+ T cell activation and cytolysis. Eur J Immunol 33(11):3117–3126
11. Freeman GJ, Long AJ, lwai Y et al (2000) Engagement of the PD-1 immunoinhibitory
receptor by a novel B7 family member leads to negative regulation of lymphocyte activation.
J Exp Med 192(7):1027–1034
12. Dong H, Strome SE, Salomao DR et al (2002) Tumor-associated B7-H1 promotes T-cell
apoptosis: a potential mechanism of immune evasion. Nat Med 8(8):793–800
13. Wintterle S, Schreiner B, Mitsdoerffer M et al (2003) Expression of the B7-related molecule
B7-H1 by glioma cells: a potential mechanism of immune paralysis. Can Res 63(21):
7462–7467
14. Lee CM, Tannock IF (2010) The distribution of the therapeutic monoclonal antibodies
cetuximab and trastuzumab within solid tumors. BioMed Central Cancer 10(1):1–11
15. Scott AM, Wolchok JD, Old LJ (2012) Antibody therapy of cancer. Nat Rev Cancer
12(4):278–287
16. Khoja L, Butler MO, Kang SP et al (2015) Pembrolizumab. J Immunother Cancer 3:36
17. Taneja SS (2012) Re: safety and activity of anti-PD-L1 antibody in patients with advanced
cancer. J Urol 188(6):2148–2149
18. Liu A, Dong L, Wei XL et al (2016) Development of amino and dimethylcarbamate
substituted resorcinol as programmed cell death-1 (PD-1) inhibitor. Eur J Pharm Sci Official J
Eur Fed Pharm Sci 88:50–58
19. Duan Q, Liu Y, Rockwell S (2013) Fenbendazole as a potential anticancer drug. Anticancer
Res 33(2):355–362
20. Aycock-Williams AN, Pham LK, Liang M et al (2011) Effects of fenbendazole and vitamin E
succinate on the growth and survival of prostate cancer cells. J Cancer Res Exp Oncol
3(9):115–121
21. Hershman DL, Lacchetti C, Dworkin RH et al (2014) Prevention and management of
chemotherapy-induced peripheral neuropathy in survivors of adult cancers: American Society
of Clinical Oncology clinical practice guideline. J Oncol Pract 10(6):421–424
22. Ku TH, Zhang T, Luo H et al (2015) Nucleic acid aptamers: an emerging tool for
biotechnology and biomedical sensing. Sensors 15(7):16281–16313
23. Sun H, Zhu X, Rosato RR et al (2014) Oligonucleotide aptamers: new tools for targeted
cancer therapy. Mol Therpy Nucleic Acids 3(8):e182–e182
24. Prodeus A, Abdulwahid A, Fischer NW et al (2015) Targeting the PD-1/PD-L1 immune
evasion axis with DNA aptamers as a novel therapeutic strategy for the treatment of
disseminated cancers. Mol Therapy Nucleic Acids 4(4):1–10
25. Hervasstubbs S, Soldevilla MM, Villanueva H et al (2015) Identification of TIM3 2′-fluoro
oligonucleotide aptamer by HT-SELEX for cancer immunotherapy. Oncotarget 7(4):
4522–4530
Construction of the PD-L1
Promoter-Luciferase Reporter Expressing
Vector for Small Molecule Inhibitors
Screening
Bo Jiang, Zhichen Shi, Ali Wang, Yuyin Li, Qiurong Zhang, Lei Jing
and Aipo Diao
1 Introduction
T cell mediated immune response plays an important role in modulating the growth,
proliferation and recurrence of tumor cells. Activation of T cell requires binding of
the T cell receptor (TCR) with a cognate peptide presented on the MHC of an APC
and a co-stimulatory signal, mainly generated between members of the B7 ligand
family on the APC and the CD28 receptor family on the T cell. On the contrast, the
inhibitory signaling between these two families acts to down-grade T cell activa-
tion, resulting in T cell exhaustion, deletion or tolerance [1]. Antigen-specific T cell
responses are regulated by the balance between co-stimulatory and co-inhibitory
signals [2, 3], and modulation of such co-signal pathways is beneficial when
immune intervention is necessary [4].
PD-1 (programmed cell death-1) and its ligand PD-L1 (programmed cell
death-ligand 1) belonged to the immunoglobulin super-family of CD28/B7, are
co-stimulatory molecules which have a negative regulation effect. The hypothesis
that PD-1/PDL-1 interaction mediated immune evasion from tumor specific T cells
was founding due to the widely expression of PD-L1 in human various cancer
tissues or cell lines [5]. Thus, blocking of such negative immune regulatory signals
on tumor cells has given rise to hope that their manipulation may lead to enhanced
tumor-specific CD8+ T-cell immunity in vivo [6]. To extend survival further, novel
type’s targets for PD-L1 have been developed and achieved good clinical efficacy
[7]. In recent years, immunotherapy involving drugs such as humanized mono-
clonal antibodies against PD-1 and its ligand PD-L1, have been applied to the
clinical treatment of cancers, with improved treatment effects observed for mela-
noma, lung cancer, and other cancers. Pembrolizumab and nivolumab are the first
of this anti-PD-1 pathway family of checkpoint inhibitors to gain accelerated
approval from the US Food and Drug Administration (FDA) for the treatment of
ipilimumab-refractory melanoma [8].
Previous studies have demonstrated that PD-L1 was expressed in various human
tumor cell lines [9, 10]. Therefore, discovery of safe and effective anti-PD-L1 drugs
was required. In this study, we established a method to measure the transcriptional
activity of PD-L1 promoter using luciferase reporter gene assay system to screen
small molecule inhibitors down-regulating the expression of PD-L1.
Human genomic DNA was isolated from MCF-7 cells. The 5′-untranslated region
(from nt −818 bp to +134 bp) of PD-L1 was amplified by PCR using the primers
(forward primer: 5′-GGGGTACCTAGAAGTTCAGCGCGGGATAATAC-3′ and
reverse primer: 5′-CCGCTCGAGCTGCAGGCGGACAGAAGCGCGGCTG-3′).
The PCR product of amplified PD-L1 promoter region was digested by KpnI and
XhoI and inserted into pGL4 vector.
2.4 RT-PCR
Total RNA was extracted from MGC-803 cells treated with drugs for 48 h by using
Trizol Reagent (thermo scientific) according to the manufacturer’s protocol. One
microgram of total RNA was reverse transcribed by oligo(dT)18 primers using the
Reverse Transcription System (thermo scientific). The single-stranded cDNA was
amplified by PCR using PD-L1 specific primers (forward primer:
5′-GGAATTCATGGACCTATATGTGGTAGAGTATGG-3′, reverse primer:
5′-CCGCTCGAGTCAATTTGGAGGATGTGCCAGAGGTA-3′) and b-actin
primers (forward primer: 5′-TGACGAGGCCCAGAGCAAGA-3′, reverse primer:
5′-ATGGGCACAGTGTGGGTGAC-3′). The PCR products were analyzed by
electrophoresis on a 0.8% agarose gel.
MGC-803 cells treated with drugs were washed twice with PBS before lysed with
RIPA lysis buffer. Equal amounts of protein were loaded into each well and sep-
arated by 10% SDS-PAGE gel, followed by transferring onto PVDF membranes.
The membranes were blocked in PBST buffer containing 5% nonfat dry milk for
1 h at room temperature. The blots were then incubated overnight at 4 °C with
primary antibodies. Secondary antibodies were incubated for 1 h at room temper-
ature. Finally, the Odyssey infrared laser imaging system (LI-COR Biosciences)
was used to image the experimental results.
All the presented data and results were confirmed in at least three independent
experiments. Data were expressed as mean ± SD.
708 B. Jiang et al.
3 Result
The PCR product of the 5′-flanking non-coding region of PD-L1 promoter was
amplified and separated by agarose gel electrophoresis, the result showed that the
size of the amplified DNA fragment is consistent with the expectation which was
952 bp (Fig. 1a). The recombinant plasmid was digested with KpnI and XhoI and
the products were detected using agarose gel electrophoresis, the recombinant
plasmid was digested into two fragments of 952 and 5599 bp which represented the
inserted DNA fragment and pGL4 vector respectively (Fig. 1b). The recombinant
plasmid was further verified by DNA sequencing. These data showed that PD-L1
promoter luciferase reporter expressing vector pGL4-PD-L1 was constructed
successfully.
Fig. 2 Detecting the activity of PD-L1 promoter in HeLa cells. pGL4-PD-L1 plasmid was
transfected into HeLa cells and cultured for 24 h, the empty pGL4 was as a negative control.
Relative luciferase activity was measured (N = 3, ***P < 0.001)
Fig. 3 Screen the small molecule inhibitors down-regulating activity of PD-L1 promoter. a Over
200 compounds were used to screen the inhibitors of PD-L1 promoter. b The chemical structure of
Fludarabine Phosphate
710 B. Jiang et al.
Fig. 4 Detecting the specificity of Fludarabine Phosphate induced inhibiting of PD-L1 promoter
activity. a HeLa cells transfected with pGL4-PD-L1and pCMV-b-galactosidase plasmids were
treated for 24 h with different concentrations of Fludarabine Phosphate (0.2, 1 lM), 0.1% (v/v)
DMSO was used as a negative control. b pGL4-PD-L1, pGL4-SM22 or pGL4-Beclin1 plasmids
were co-transfected with pCMV-b-galactosidase plasmid and then1 µM Fludarabine Phosphate
were treated for 24 h. Relative luciferase activity was measured (N = 3, **p < 0.01,
***P < 0.001, N.S. indicates not significant)
Construction of the PD-L1 Promoter-Luciferase Reporter … 711
4 Discussion
Immune inhibitory checkpoints, such as PD-1 and PD-L1, allow the tumor to evade
immune monitoring, which has become a new hallmark of cancer cells. Activation
of PD-1 signaling pathway by PD-L1 has been shown to inhibit T cells activity.
Balancing with co-stimulatory signals is crucial to maintain peripheral tolerance
and prevent excessive damage to tissues during clearing infection. Two monoclonal
antibodies against PD-1 have been approved for the treatment of unresectable and
metastatic melanoma (nivolumab and pembrolizumab). As for the anti-PD-L1
mAbs, they have already shown some promising results on advanced incurable
cancer treatment [13], which suggests that PD-L1 plays a crucial role in tumori-
genesis and a novel drug screening target for cancer therapies.
PD-1/PD-L1 monoclonal antibodies have a significant efficacy in clinical trials.
However, it also appears to the adverse reactions associated with T cell excessive
activation and clinically observable autoimmune damage. In this study, we suc-
cessfully constructed PD-L1 promoter luciferase reporter expressing plasmids and
found that Fludarabine Phosphate down-regulated the transcriptional activity of
PD-L1 promoter. We have verified that Fludarabine Phosphate inhibited the
expression of PD-L1 in MGC-803 cells, which suggests Fludarabine Phosphate is a
potential drug to activate the anti-tumor immune response of T cells.
Acknowledgements This research is supported by the program for College students’ innovative
entrepreneurial training plan (201510057058).
References
1. Barach YS, Lee JS, Zang X (2011) T cell coinhibition in prostate cancer: new immune
evasion pathways and emerging therapeutics. Trends Mol Med 17:47–55
2. Greenwald RJ, Freeman GJ, Sharpe AH (2005) The B7 family revisited. Annu Rev Immunol
23:515–548
712 B. Jiang et al.
3. Zou W, Chen L (2008) Inhibitory B7-family molecules in the tumour microenvironment. Nat
Rev Immunol 8:467–477
4. Ritprajak P, Azuma M (2015) Intrinsic and extrinsic control of expression of the
immuno-regulatory molecule PD-L1 in epithelial cells and squamous cell carcinoma. Oral
Oncol 51:221–228
5. Yamamoto R, Nishikori M, Tashima M et al (2009) B7-H1 expression is regulated by
MEK/ERK signaling pathway in anaplastic large cell lymphoma and Hodgkin lymphoma.
Cancer Sci 100:2093–2100
6. Blank C, Gajewski TF, Mackensen A (2005) Interaction of PD-L1 on tumor cells with PD-1
on tumor-specific T cells as a mechanism of immune evasion: implications for tumor
immunotherapy. Cancer Immunol Immunother 54:307–314
7. Shien K, Papadimitrakopoulou VA, II Wistuba (2016) Predictive biomarkers of response to
PD-1/PD-L1 immune checkpoint inhibitors in non-small cell lung cancer. Lung Cancer
99:79–87
8. Mahoney KM, Freeman GJ, McDermott DF (2015) The next immune-checkpoint inhibitors:
PD-1/PD-L1 blockade in melanoma. Clin Ther 37:764–782
9. Padda SK, Riess JW, Schwartz EJ et al (2015) Diffuse high intensity PD-L1 staining in
thymic epithelial tumors. J Thorac Oncol 10(3):500–508
10. Katsuya Y, Fujita Y, Horinouchi H et al (2015) Immunohistochemical status of PD-L1 in
thymoma and thymic carcinoma. Lung Cancer 88(2):154–159
11. Holets LM, Carletti MZ, Kshirsagar SK et al (2009) Differentiation-induced
post-transcriptional control of B7-H1 in human trophoblast cells. Placenta 30:48–55
12. Qin K, Rosenfield RL (2005) Characterization of the basal promoter element of the human
type 5 17beta-hydroxysteroid dehydrogenase gene. Biochim Biophys Acta 1728:115–125
13. Silva R, Gullo I, Carneiro F (2016) The PD-1: PD-L1 immune inhibitory checkpoint in
Helicobacter pylori infection and gastric cancer: a comprehensive review and future
perspectives. Porto Biomed J 1:4–11
Construction and Functional Analysis
of BNP Promoter Luciferase Reporter
Plasmid
Jian Zhang, Nan Wang, Yanzhong Liu, Man Li, Huiqin Gong,
Hongpeng He and Tongcun Zhang
1 Introduction
The BNP promoter containing CArG boxes and NRSE was amplified from genomic
DNA of MCF-7 cells by PCR and cloned into a pGL3 luciferase reporter vector.
The primers used in PCR reactions are as followed: forward primer-ACTA
CGCGTGAGACGGGGTTTCACCGT, reverse primer-TTATCTCGAGTGAACC
GGGGCTGCCCAG. Amplification conditions for PCR are as follows:
pre-degeneration for 5 min at 95 °C, denaturation for 45 s at 95 °C, annealing for
45 s at 55 °C and extension for 1 min 30 s at 72 °C. PCR reaction was carried out
for 35 cycles.
The PCR products and pGL3-Basic vector were digested with restriction enzyme
HindIII and XhoI at 37 °C for 1 h and then the gene fragment was linked to
pGL3-Basic vector using T4 DNA ligase at 16 °C for 12 h. The recombinant
plasmids were transformed into E. coli DH5a. The correct construction of BNP
promoter reporter plasmids was confirmed by restriction enzyme digestion and
DNA sequencing.
COS-7 cells were derived from the American Type Culture Collection (ATCC).
COS-7 cells were cultured in Dulbecco’s Modified Eagle Medium Nutrient Mixture
F-12(Ham)(1:1)(DMEM/F-12)(GIBCO) supplemented with 10% fetal bovine
serum (FBS) at 37 °C in a 5% CO2 incubator.
For transfection experiments, COS-7 cells were plated in DMEM/F-12 medium
without antibiotics. Transfection was carried out using transfection reagent
Turbofect following the manual of the manufacturer (Thermo), when cells were
cultured to 70–80% confluence. The myocardin expression construct contained a
cDNA of mouse myocardin encoding amino acids 129–935. The NRSF ORF was
amplified from pHR′-NRSF-CITE-GFP, which was a gift from Jay Nadeau
(Addgene plasmid # 21310) and then cloned to pcDNA3.1 vector.
Luciferase activity assay was performed using the Luciferase Assay System
(Promega) according to the instructions. Briefly, after transfection 24 h, the trans-
fected cells were lysed in Cell Culture Lysis Reagent. 20 µL of cell lysate and
100 µL of luciferase assay reagent were added into a 96-well plate and then luci-
ferase activity was measured by on a SynergyTM 4 (Bioteck). All experiments were
Construction and Functional Analysis of BNP Promoter … 715
performed at least three times with different preparations of plasmids and primary
cells, producing qualitatively similar results.
All experiments were performed at least three times. Data are analyzed with
unpaired t-test. Values of P < 0.01 was represented by **. Data are presented as
means ± SD.
3 Results
The schematic structure of human BNP promoter containing CArG boxes and
NRSE was shown in Fig. 1. The BNP promoter sequence from −1046 to +189 was
cloned from the genomic DNA of the MCF-7 cell line.
To estimate the PCR amplification of BNP promoter, agarose gel electrophoresis
was performed. As shown in Fig. 2a, one band emerged at the site of 1235 bp,
which represent PCR product of BNP promoter.
As shown in Fig. 2b, the PCR products and pGL3-basic vector were digested
with restriction enzyme HindIII and XhoI. Purified vector fragments and PCR
fragments were used in a DNA ligation reaction to generate recombinant plasmids.
Next, the recombinant plasmid was analyzed with 1% agarose gel elec-
trophoresis. The size of recombinant plasmid (lane 2) was larger than pGL3-basic
vector (lane 1) (Fig. 3). Next, the recombinant plasmid was digested with HindIII
and XhoI at 37 °C for 1 h and 1% agarose gel electrophoretic was used to analyze
the DNA products. As shown in Fig. 3, analysis of these digests revealed two major
bands: a 1235 bp band could represent BNP gene promoter; a 4818 bp band could
represent a pGL3-Basic vector. Finally, BNP promoter was successfully con-
structed, confirmed by plasmid sequencing.
Fig. 1 A schematic structure of BNP promoter luciferase reporter plasmid. “+1” represents the
transcription start site
716 J. Zhang et al.
4 Discussion
Heart failure is a common heart disease and one of the most common causes leading
to death. Some transcription factors contribute to the development and progression
of heart failure by promoting cardiac hypertrophy. It has been reported that myo-
cardin induces cardiac hypertrophy by activating the transcription of hypertrophic
marker genes including ANF and BNP, etc. Generally, the re-expression of a fetal
cardiac gene program, including BNP, leads to the development of cardiac
hypertrophy. In this study, we found that myocardin activated BNP promoter
activity and BNP was the target gene of myocardin.
NRSF inhibits the expression of a variety of genes as a transcriptional activity
inhibitor. Previous studies showed the role of NRSF/REST in the regulation of
cardiac gene expression and function [10]. But about transcription factors which
can target myocardin and regulate its transcription and expression are poorly
understood. Whether NRSF can inhibit myocardin-stimulated hypertrophic marker
gene express is not clarity. Our results preliminarily demonstrated that NRSF
inhibited the transcription activity of BNP activated by myocardin. However, fur-
ther study is needed to illuminate the role of NRSF in cardiac hypertrophy.
Acknowledgements This work was financially supported by the National Natural Science
Foundation of China (31171303, 31301073 and 31470816).
References
1. Pipes GCT, Creemers EE, Olson EN (2006) The myocardin family of transcriptional
coactivators: versatile regulators of cell growth, migration, and myogenesis. Genes Dev
20:1545–1556
718 J. Zhang et al.
2. Man L, Study on the regulation of Myocardin modulated cardiomyocyte Hypertrophy via the
calcium-dependent signaling pathway
3. Xing W, Zhang T-C, Cao D et al (2006) Myocardin induces cardiomyocyte hypertrophy. Circ
Res 98:1089–1097
4. Kraner SD, Chong JA, Tsay HJ et al (1992) Silencing the type II sodium channel gene: a
model for neural-specific gene regulation. Neuron 9:37–44
5. Mori N, Schoenherr C, Vandenbergh DJ et al (1992) A common silencer element in the
SCG10 and type II Na+ channel genes binds a factor present in nonneuronal cells but not in
neuronal cells. Neuron 9:45–54
6. Chong JA, Tapia-Ramirez J, Kim S et al (1995) REST: a mammalian silencer protein that
restricts sodium channel gene expression to neurons. Cell 80:949–957
7. Schoenherr CJ, Anderson DJ (1995) The neuron-restrictive silencer factor (NRSF): a
coordinate repressor of multiple neuron-specific genes. Science 267:1360–1363
8. Ogawa E, Saito Y, Kuwahara K et al (2002) Fibronectin signaling stimulates BNP gene
transcription by inhibiting neuron-restrictive silencer element-dependent repression.
Cardiovasc Res 53:451–459
9. Kuwahara K, Saito Y, Takano M et al (2003) NRSF regulates the fetal cardiac gene program
and maintains normal cardiac structure and function. EMBO J 22:6310–6321
10. Kuwahara K (2013) Role of NRSF/REST in the regulation of cardiac gene expression and
function. Circ J 77:2682–2686
HPV18 E6 and E7 Influence
the Expression of Cancer Related
LncRNAs in HeLa Cells
Xiang Liu, Yongwei Lai, Hailin Yao, Mengmeng Zhang, Hao Zhou,
Tongcun Zhang and Hongpeng He
1 Introduction
Cervical cancer which is identified as the second most common type of cancer in
women worldwide, is responsible for more than 275,100 mortalities each year and
associated with high-risk human papillomavirus, including HPV18 [1].
HPV18 DNA contains two vital oncogenes, E6 and E7, which have crucial roles in
malignant transformation in cervical cancer. The E6 promotes p53 degradation
through E6AP interaction [2], and interfere with other pro-apoptotic proteins [3], E7
interacts with the PDZ domain of cellular proteins, such as retinoblastoma protein
(pRb) to cause cellular transformation, leading to neoplastic progression [4].
Previous studies have revealed that LncRNAs (long non-coding RNAs), which
are non-coding transcripts that are more than 200nt in length, are important regu-
lators in various biological processes such as proliferation, differentiation and
metastasis, and took vitally an function on the oncogenesis and progression of
cervical cancer [5]. It was revealed that there was a close correlation between
HPV16 E7 and LncRNA HOTAIR expression in cervical cancer, whereas the
detailed mechanism was not identified [6]. So far, the mechanism by which
LncRNAs are regulated in cervical cancer is mainly obscure. As an important
causative factor of cervical cancer [7], demonstrating how high-risk HPVs regulated
the expression of cancer-related LncRNAs would help to understand the mecha-
nism of cervical cancer development.
HeLa or HaCaT cells cultured in 6-well plates at about 80% confluency were
transfected with 2.5 lg of plasmids, namely PCMV-tag2B, PCMV-tag2B-E6,
HPV18 E6 and E7 Influence the Expression of Cancer … 721
Total RNA was extracted with Trizol reagent (Invitrogen). Reverse transcription
was performed with M-MLV reverse transcriptase (Promega). Complementary
DNA was quantified by Semi-quantitative PCR using EasyTaq DNA Polymerase
kit (TransGen Biotech). PCR primers were designed with NCBI online software
Primer-BLAST and synthesized by Invitrogen. Sequences of the primers were: 18s
rRNA-forward: 5′-CACGGGAAACCTCACCCGGC-3′; 18s rRNA-reverse: 5′-
CGGGTGGCTGAACGCCACTT-3′; HPV18 E6-forward: 5′-CCAGAAACCG
TTGAATCCAG-3′; HPV18 E6-reverse: 5′-G TTGGAGTCGTTCCTGTCGT-3′;
HPV18 E7-forward: 5′-TGAAATTCCGGTTGACCTTC-3′; HPV 18E7-reverse: 5′-
TCGGGCTGGTAAATGTTGAT-3′; TMPOP2-forward: 5′-CTGGAATAACTG
GGA CTGA-3′; TMPOP2-reverse: 5′-CTCGCTGAAATTACTGCTC-3′;
GAS5-forward: 5′-TAATGACCAC AACAAGCAA-3′; GAS5-reverse: 5′-
CCATCAGGCAGTCTACAA-3′; MEG3-forward: 5′-CTGCCCA TCTACAC
CTCACG-3′; MEG3-reverse: 5′-AGCTGGCTGGTCAGTTCC-3′; NPTN.IT1-
forward: 5′-C CTGTGGTGCTGTATCCT-3′; NPTN.IT1-reverse: 5′-CACCAGC
CACTCACTCTAC-3′; TUSC8-Forward: 5′-GGAGGTGAACTGCTTCTTAT-3′;
TUSC8-reverse: 5′-CAGGTCCCTTTCTTTGAGAA-3′; U-CA1-forward: 5′-
TAGTGGCTGAAGACTGATGC-3′; UCA1-reverse: 5′-GAGGCTGTAGAGT
TTGA-3′; CRNDE-forward: 5′-GCTGAAATTCATCCCAAGGC-3′; CRNDE-
reverse: 5′-CCTCCTTCCAAT AGCCAGTA-3′; H19-forward: 5′-TCGGTGC
CTCAGCGTTCG-3′; H19-reverse: 5′-CTGGCGTCTT GGCCTTCG-3′;
MALAT1-forward: 5′-GTGATGCGAGTTGTTCTCCG-3′; MALAT1-reverse: 5′-
CTG GCTGCCTCAATGCCTAC-3′; Lnc-01468-forward: 5′-TGAGTCTCAA
CTCTGCTGCTTT-3′; Lnc-014-68-reverse: 5′-CACTGCGATTAGATCTTC
ACGA-3′. cDNA was quantified by real-time qPCR, with BiosyStems
StepOne™ Real-Time PCR and Fast SYBR Green MasterMix (Applied
Biosystems).
The data are representative of three independent experiments, and the GraphPad
Prism 6 was used for analysis. The data are presented as the mean ± standard
deviation and were compared using Student’s t-test or one-way ANOVA test, as
appropriate. Statistical significance was defined as P < 0.05.
722 X. Liu et al.
To figure out potential LncRNAs correlated with cervical cancer development, the
difference in LncRNA expression between HeLa cervical cancer cell line and
HaCaT nonmalignant epithelial cell line was investigated. Total RNA was extracted
from freshly cultured cells and the expression levels of LncRNAs were determined
with RT-qPCR. As shown in Fig. 1a, LncRNAs MALAT1, TMPOP2 and GAS5
were more highly expressed in HeLa cells than that in HaCaT cells. Additionally,
the expression of LncRNA TUSC8 was only detected in HeLa cells but not in
HaCaT cells (data not shown). The above results suggested that expression of these
four LncRNAs could be positively correlated with cervical cancer development. By
contrast, the expression of Lnc-01468, H19, UCA1 and Lnc-00657 in HeLa were
lower than that in HaCaT (Fig. 1b), indicating that these four LncRNAs might be
repressers of carcinogenesis. The expression of MEG3, NPTN.IT1 and CRNDE
were undetectable in HeLa (data not shown).
To narrow down the list of interesting LncRNAs for further investigation, the
expression of above mentioned LncRNAs were investigated in human embryonic
epithelial cell line HEK293T, in human breast cancer cell lines MCF7 and T47D,
and in human blood vessel endothelial cell line HUVEC. The results of RT-qPCR
showed that, comparing with the expression in HaCaT cell line, the RNA level of
TMPOP2 was nearly 90-fold higher in HEK293T cells, about 25- to 30-fold higher
Fig. 1 The expression levels of LncRNAs in HeLa and HaCaT cell lines. a The expression of
MALAT1, TMPOP2 and GAS5 in HeLa were higher than that in HaCaT. b The expression of
Lnc-01468, H19, UCA1 and Lnc-00657 in HeLa were lower than that in HaCaT
HPV18 E6 and E7 Influence the Expression of Cancer … 723
Fig. 2 Expression of lncRNAs varied from cell line to cell line. a The expression of TMPOP2,
MALAT1 and GAS5 in 293T, MCF7, HUVEC and T47D were basically higher than that in
HaCaT. b The expression of, H19 and MEG3 in 293T, MCF7, HUVEC and T47D had different
varieties comparing with that in HaCaT
in HUVEC and T47D cells, and about 5-fold higher in MCF7 cells, suggesting that
TMPOP2 expression was up-regulated in embryonic and cancer epithelial cell lines
(Fig. 2a). Also, in non-malignant blood vessel endothelial cell HUVEC, TMPOP2
was moderately up-regulated (Fig. 2a). Unlike the relative high expression in HeLa
cells (Fig. 1a), GAS5 expression was slightly higher in HEK293T cells but was
lower in MCF7, HUVEC and T47D cells (Fig. 2a), suggesting that the high
expression of GAS5 in HeLa cells might be cervical cancer specific.
In parallel, the lncRNAs that were relatively low expressed in HeLa were also
determined. And as shown in Fig. 2b, the expression of H19 was obviously lower
in 293T and HUVEC cells, on the contrary, it was surprisingly high in MCF7 cells.
LncRNA MEG3 was highly expressed in 293T and MCF7 cells but not much
varied in HUVEC and T47D cells. The rest of the LncRNAs examined in this study
were expressed at too low level to be detected herein.
Taken together, these results suggested that the expression of LlncRNAs was
different from cell line to cell line and, among the 11 LncRNAs tested in this study,
TMPOP2, MALAT1 and GAS5 were most possible to be correlated with cervical
cancer due to their highly expression in HeLa cells.
Fig. 3 Over-expression of HPV18 E6 E7 altered the expression levels of lncRNAs in HeLa cells.
a The mRNA levels of E6 and E7 in HeLa transfected with PCMV-tag2B, PCMV-tag2B-E6,
PCMV-HA-E7 or PCMV-tag2B-E6-E7 plasmids were tested with RT-qPCR. b, c Western blot
assay detected E6 expression in HeLa treated with PCMV-tag2B, PCMV-tag2B-E6 or
PCMV-tag2B-E6-E7 plasmids, and E7 expression in HeLa cells treated with PCMV-tag2B,
PCMV-HA-E7 or PCMV-tag2B-E6-E7 plasmids. d The RNA levels of H19, TMPOP2, MALAT1,
Lnc-01468, UCA1, GAS5, Lnc-00657 and MEG3 in HeLa were determined 48-h post transfection
with PCMV-tag2B, PCMV-tag2B-E6, PCMV-HA-E7 or PCMV-tag2B-E6-E7 plasmids
transfection, total RNA was extracted and analyzed with RT-qPCR. Protein
expression was analyzed with Western-blot. Figure 3a shows the overexpression of
E6 and E7 at mRNA level. Figure 3b, c show the overexpression of E6 and E7 at
protein level. As shown in Fig. 3d, TMPOP2 and GAS5 RNA levels were increased
in E7- and E6-E7-overexpressed cells, indicating that E7 enhanced the expression
of TMPOP2 and GAS5. MALAT1 and lnc-01468 RNA levels were boosted by E6
overexpression or E6-E7 co-overexpression, suggesting a positive role of E6 in the
regulation of MALAT1 and Lnc-01468 expression (Fig. 3d). Expression of
LncRNA MEG3 was repressed by E6 and E7 over-expression, indicating that
HPV18 E6 and E7 played a negative role in MEG3 expression (Fig. 3d). RNA
levels of lncRNA H19 and UCA1 were not significantly affected by E6 or E7
overexpression (Fig. 3d).
HPV18 E6 and E7 Influence the Expression of Cancer … 725
Due to the basal expression of HPV18 E6 and E7 in HeLa cells, the relation
between HPV18 E6 E7 oncogenes and LncRNAs needed further confirmation. We
transfected PCMV-tag2B, PCMV-tag2B-E6, PCMV-HA-E7 and
PCMV-tag2B-E6-E7 plasmids into the HPV-negative nonmalignant HaCaT cells,
and then measured the expression of the LncRNAs. The successful expression of
HPV18 E6 and E7 in HaCaT cells was demonstrated with RT-qPCR as shown in
Fig. 4a. The results for TMPOP2, MALAT1, UCA1, Lnc-01468, GAS5 and MEG3
in HaCaT were basically consistent with that in HeLa (Fig. 4b), while the RNA
level of the H19 in HaCaT was significantly negative correlated with HPV18 E6,
and the RNA level of the Lnc-00657 in HaCaT had significantly positive correla-
tion with HPV18 E7 and E6-E7 (Fig. 4b).
Fig. 4 Expression of HPV18 E6 E7 in HaCaT cells affected the expression of LncRNAs. a The
mRNA levels of E6 and E7 in HaCaT transfected with PCMV-tag2B, PCMV-tag2B-E6,
PCMV-HA-E7 or PCMV-tag2B-E6-E7 plasmids were tested with RT-qPCR. b The RNA levels of
H19, TMPOP2, MALAT1, Lnc-01468, UCA1, GAS5, Lnc-00657 and MEG3 in HaCaT were
determined 48-h post transfection with PCMV-tag2B, PCMV-tag2B-E6, PCMV-HA-E7 or
PCMV-tag2B-E6-E7 plasmids
726 X. Liu et al.
4 Discussion
To investigate the relation between HPV18 E6/E7 and the LncRNAs in cervical
cancer, the RNA levels of 11 LncRNAs in HeLa, HaCaT, HEK293T, MCF7,
HUVEC and T47D were tested by RT-qPCR with 18S rRNA served as endogenous
control. We found that the lncRNA expression profile was cell type dependent.
Basically, TMPOP2 and MALAT1 were highly expressed in embryonic or cancer
cell lines comparing with nonmalignant HaCaT cells. Intriguingly, GAS5 was
highly expressed in HeLa but not in other cancer cell lines tested herein, suggesting
that GAS5 might be specifically upregulated in HeLa cells. Introduction of
ectopically expressed HPV18 into HeLa cells further boosts the expression of
TMPOP2, MALAT1 and GAS5. Similar effects were observed in HaCaT cells.
Taken together, our results suggested that HPV18 E6 E7 oncoproteins stimulated
the expression of cervical cancer-related LncRNA TMPOP2, MALAT1 and GAS5.
The mechanism by which HPV18 E6 and E7 regulate the expression of these
lncRNA was worth of further study.
The expression of lncRNA H19, UCA1, Lnc-01468 and Lnc-00657 were rela-
tively lower in HeLa cells than that in HaCaT cells, indicating that they might be
negatively correlated with cervical cancer, whereas HPV18 E6 E7 did not suppress
their expression in both HeLa and HaCaT cells. There might be other factors
involved in the regulation of these lncRNAs.
HPV infection was highly correlated with cervical caner and LncRNAs irregu-
lation was a novel “hot spot” of cancer study. Our results primarily established a
link between HPV18 E6 E7 and the expression of cancer related LncRNAs, which
would contribute to a better understanding to the mechanism of HPV induced
cervical cancer development.
Acknowledgements This work was supported by National Natural Science Foundation of China
(31301073) and Applied Basic Science and Frontier Technology Program of Tianjin
(13JCYBJC38000).
References
1. Jiang Y, Li Y, Fang S et al (2014) The role of MALAT1 correlates with HPV in cervical
cancer. Oncol Lett 7:2135–2141
2. Zur Hausen H (2002) Papillomaviruses and cancer: from basic studies to clinical application.
Nat Rev Cancer 2:342–350
3. Thomas M, Banks L (1999) Human papillomavirus (HPV) E6 interactions with Bak are
conserved amongst E6 proteins from high and low risk HPV types. J Gen Virol 80(Pt
6):1513–1517
4. Ramakrishnan S, Partricia S, Mathan G (2015) Overview of high-risk HPV’s 16 and 18
infected cervical cancer: pathogenesis to prevention. Biomed Pharmacother 70:103–110
5. He JH, Han ZP, Li YG (2014) Association between long non-coding RNA and human rare
diseases (Review). Biomed Rep 2:19–23
6. Sharma S, Mandal P, Sadhukhan T et al (2015) Bridging links between long noncoding
RNA HOTAIR and HPV oncoprotein E7 in cervical cancer pathogenesis. Sci Rep 5:11724
HPV18 E6 and E7 Influence the Expression of Cancer … 727
7. Nohata N, Abba MC, Gutkind JS (2016) Unraveling the oral cancer lncRNAome:
identification of novel lncRNAs associated with malignant progression and HPV infection.
Oral Oncol 59:58–66
8. Yan X, Hu Z, Feng Y et al (2015) Comprehensive genomic characterization of long
non-coding RNAs across human cancers. Cancer Cell 28:529–540
9. Peng L, Yuan X, Jiang B et al (2015) LncRNAs: key players and novel insights into cervical
cancer. Tumour Biol
10. Sun R, Qin C, Jiang B et al (2016) Down-regulation of MALAT1 inhibits cervical cancer cell
invasion and metastasis by inhibition of epithelial-mesenchymal transition. Mol BioSyst
12:952–962
11. Sun NX, Ye C, Zhao Q et al (2014) Long noncoding RNA-EBIC promotes tumor cell
invasion by binding to EZH2 and repressing E-cadherin in cervical cancer. PLoS ONE 9:
e100340
12. Liao LM, Sun XY, Liu AW et al (2014) Low expression of long noncoding XLOC_010588
indicates a poor prognosis and promotes proliferation through upregulation of c-Myc in
cervical cancer. Gynecol Oncol 133:616–623
13. Feigenberg T, Gofrit ON, Pizov G et al (2013) Expression of the h19 oncofetal gene in
premalignant lesions of cervical cancer: a potential targeting approach for development of
nonsurgical treatment of high-risk lesions. ISRN Obstet Gynecol 2013:137509
14. Hong HH, Hou LK, Pan X et al (2016) Long non-coding RNA UCA1 is a predictive
biomarker of cancer. Oncotarget
15. Ellis BC, Molloy PL, Graham LD (2012) CRNDE: a long non-coding RNA involved in
CanceR, Neurobiology, and DEvelopment. Front Genet 3:270
16. Qian X, Xu C, Zhao P et al (2016) Long non-coding RNA GAS5 inhibited hepatitis C virus
replication by binding viral NS3 protein. Virology 492:155–165
17. Zhang J, Yao T, Wang Y et al (2016) Long noncoding RNA MEG3 is downregulated in
cervical cancer and affects cell proliferation and apoptosis by regulating miR-21. Cancer Biol
Ther 17:104–113
Construction of Tip60-Encoding Plasmid
and the Effect of Tip60 on the Expression
of HPV18 Genes in HeLa Cells
Yongwei Lai, Xuena Liu, Yijie Wang, Yunpeng Yue, Xiang Liu,
Hao Zhou, Nan Wang, Xue-Gang Luo, Wenjian Ma,
Tong-Cun Zhang and Hongpeng He
1 Introduction
Tip60 is a cellular protein belonging to the MYST family of histone acetyl trans-
ferases (HATs) and it is universally expressed in various types of cells. Tip60 was
originally isolated as an HIV Tat-interactive protein with molecular weight of
60 kDa thus was named Tip60 [1]. Tip60 functions as a transcriptional co-factor in
the regulation of HIV gene expression. Later on, the histone acetyl transferase
(HAT) activity of Tip60 was identified [2]. In addition to histone, Tip60 was also
found to be a lysine acetyl transferase therefore it is also known as KAT5. ER, a
well-known transcription activator, is a typical target of Tip60 for acetylation [3].
Previous studies suggest that Tip60 plays important roles in many biological
processes, such as cellular signalling, DNA damage repair, cell cycle regulation and
apoptosis [4]. In response to DNA double strand breaks, Tip60 is recruited to DNA
lesions where it participates both in the initial as well as the final stages of DNA
repair [5]. Tip60 is part of a multiprotein complex, NuA4, which is recruited by
many transcription factors to their target promoters, where it is thought to partici-
pate in histone acetylation and transcriptional regulation [6]. The role of Tip60 in
target gene transcription could be active or repressive depending on the context of
chromatin [7, 8].
Human papillomavirus (HPV) is a causative factor of cervical cancer which
threatens the health of females worldwide. In cervical cancer cells, HPV DNA was
broken into DNA fragments and integrated into cellular genome thereby being
regulated by cellular transcriptional factors. It was reported that Tip60 is involved
The encoding sequence of Tip60 was amplified with RT-PCR method using total
RNA extracted from HeLa cells as template. Pfu DNA polymerase (Thermo
Scientific, Waltham, USA) was used in PCR reaction. Restriction enzyme sites
EcoRI and XhoI were introduced into forward or reverse PCR primers, respectively.
Primer sequences for Tip60 cloning were: Tip60-Fd (EcoRI): AGATGAATTC
GCGGAGGTGGTGAGTCCGGTG, Tip60-Rv (XhoI): GGTCTCTCGAGTC
ACCACTTCCCCCTCTTGCTC. pCMV-Tag2B was used as expressing vector and
Tip60-encoding sequence was inserted into the vector with the help of T4-DNA
ligase (Promega, Madison, USA). The correct Tip60 constructs were primarily
identified by double RE-digestion and finally confirmed by plasmid sequencing.
HeLa cells were cultured in DMEM (Gibico, Waltham, USA) supplemented with
10% FBS (Kangyuan, Tianjin, China) at 37 °C in a humidified incubator with 5%
CO2. Tip60-expressing plasmid was constructed in this study and EP400-expressing
plasmid is a gift from Prof. Robert Roeder (USA) [8]. Empty vector pCMV-Tag2B
served as negative control. Plasmids were transfected into HeLa cells with
TurboFect (Thermo Scientific, Waltham, USA) following the manufacturer’s
instruction.
Total RNA was extracted from Hela cells with Trizol (Invitrogen, Waltham, USA).
cDNA was synthesized by reverse transcription with M-MLV reverse transcriptase
(Promega, Madison, USA). cDNA was quantified by either regular PCR using
Construction of Tip60-Encoding Plasmid and the Effect … 731
2.4 Western-Blotting
HeLa cell lysates were separated with SDS-PAGE using a 15% gel and then
transferred to nitrocellulose membrane (Millipore, Darmstadt, Germany). Primary
antibodies included HPV18 E6, HPV18 E7, b-actin and GAPDH (Santa Cruz,
Santa Cruz, USA). Secondary antibodies were IRDye-conjugated donkey
anti-mouse or anti-rabbit IgG LI-COR Biosciences, Lincoln USA) and membranes
were visualized with Odyssey Infrared Imaging System (LI-COR Biosciences,
Lincoln USA).
To test whether the recombinant Tip60 plasmid would be expressed in human cells,
pCMV-Tag2b-Tip60 was transfected into HeLa cells. Fourty-eight hours post
transfection, cells were harvested for mRNA and proteins analysis. mRNA level
was determined with RT-realtime qPCR and the results showed that Tip60 mRNA
level was dramatically boosted with Tip60-plasmid transfection (Fig. 2a). Results
of Western-blotting showed that the protein level of Tip60 increased in
pCMV-Tag2b-Tip60 transfected cells, demonstrating the successful overexpression
of Tip60 in HeLa cells (Fig. 2b).
732 Y. Lai et al.
(a) (b)
Vector
Tip60 insert
Lane: 1 2 Lane: 1 2 3
(a) (b)
48 h post-transfection
Relative Tip60 mRNA level
Tip60
£- actin
Lane: 1 2
Fig. 2 Over-expression of Tip60 in HeLa cells. a The mRNA level of Tip60 was increased by
about 150 folds in pCMV-Tag2b-Tip60 transfected cells. The mRNA levels were measured with
realtime qPCR. 18S rRNA was used as endogenous control. b The protein level of Tip60 was
increased in Tip60 overexpressing cells. Lane 1 HeLa cells transfected with empty vector. Lane 2
HeLa cells transfected with pCMV-Tag2b-Tip60 plasmids. b-actin served as loading control
Tip60 was previously found to repress HPV E6 and E7 gene transcription in a HPV
E2-dependent manner [9]. To examine the effect of Tip60 over-expression on
HPV18 E6 and E7 gene regulation in the E2-defective HeLa cells, mRNA levels of
HPV18 E6 and E7 were measured with RT-realtime qPCR. The results showed that
both E6 and E7 mRNA levels were reduced by roughly 60% (Fig. 3), indicating
Construction of Tip60-Encoding Plasmid and the Effect … 733
48 h post-transfection
that Tip60 is able to repress HPV18 E6 and E7 gene transcription without the
mediation of HPV E2.
Fig. 4 EP400 and Tip60 co-overexpression repressed the transcription HPV18 E6 and E7 more
significantly than single-overexpression of either one
Fig. 5 EP400 and Tip60 worked synergistically in the repression of HPV18 E6 and E7 in HeLa
cells. Density of bands was analyzed with Image J software. GAPDH served as a loading control.
The density of E6 or E7 bands was normalized with that of GAPDH bands and then calibrated by
control. Protein expression levels in control were set as 1 and the numbers under the bands indicate
the expression levels of various proteins
for the first time. EP400 is a chromatin-remodeling factor with ATPase activity
which could facilitate a more condensed chromatin structure to reduce the acces-
sibility of HPV18 promoter to the transcription machinery. Tip60 and EP400 were
previously demonstrated to form a protein complex [8], which might contribute to
their synergistic effect in HPV18 gene repression. The detailed mechanism will be
further studied in the future.
Construction of Tip60-Encoding Plasmid and the Effect … 735
References
Zhaoyuan Jing, Yang He, Qian Li, Bo Zhang and Hongjiang Yang
1 Introduction
sequencing analysis [5]. Since 16S rRNA gene sequence is highly homologous
among most Aeromonas species, the Aeromonas isolates in this study were also
analyzed with the multilocus sequence typing (MLST) method for further dis-
crimination of the Aeromonas isolates [6].
Freshwater fishes were obtained from five local markets and two fish farms in
Tianjin, China from March through May 2012. The fishes belonged to 11 different
species, including Hypophthalmichthys molitrix (4), Ctenopharyngodon idella (4),
Carassius auratus (4), Hypophthalmichthys nobilis (4), Megalobrama ambly-
cephala (2) and Ephippus orbis (2). Penaeus vannamei shrimp seeds (2) and
Saltwater fish Epinephelus awoara (12) were respectively obtained from Hangu,
Tianjin, and Xiamen, Fujian, China, during March 2012. Seawater samples (4) were
obtained from in Tianjin, China from March through May 2012.
The gastrointestinal tract was removed from fish and the content was collected
and stored at 4 °C. The content sample was serially diluted in phosphate buffered
saline and spread on three types of agar plates, including SS (Salmonella Shigella
agar), TCBS (thiosulfate citrate bile salts sucrose agar) [7, 8], MAC (MacConkey
agar) [9], CIN-1 (Cepulodin Irgasan Novobiocin Agar). L-agar plates containing
ampicillin (20 lg/ml), erythromycin (20 lg/ml), and kanamycin (20 lg/ml) were
also used for screening the possible bacterial pathogens in the gut samples.
The genomic DNA was extracted from the isolated strains. The DNA was used as
template for PCR amplification of the 16S rRNA gene with primers described
previously [10]. The PCR product was subjected to sequencing directly. The
obtained sequences were analyzed by the BLAST program on the NCBI website.
MEGA 5 was used to construct the phylogenetic trees [11].
namely, gyrB, groL, gltA, metG, ppsA, and recA, was synthesized for MLST of the
Aeromonas isolates [12]. The sequences of distinct alleles were deposited in the
Aeromonas MLST database (http://pubmlst.org/aeromonas). Allele number and
sequence type (ST) number were determined by described previously [12].
3 Results
120 bacteria strains were isolated from 37 different samples with various media.
Morphology of bacterial colonies grown on the TCBS plate were mostly yellow and
green, smooth, and moist; on the SS plate were mostly yellow, pink, colorless with
black center; on the MAC plate mostly were pink and red, flat; on the CIN-1 plate
mostly were pink, big, and smooth.
120 isolated strains were identified with the comparative sequence analysis of the
16S rRNA gene. The 16S rRNA sequences were deposited in GenBank with
accession no KC210757-KC210826, KC210827- KC210872 and
KC252599-KC252602. All the isolates were tentatively classified into 15 genera of
seven families, including Aeromonas spp. (53), Vibrio spp. (19), Proteus spp. (5),
Citrobacter spp. (9), Hafnia spp. (8), Providencia spp. (6), Pseudomonas spp.
(3), Kluyvera spp. (2), Enterobacter spp. (2), Bacillus spp. (2), Pantoea sp. (1),
Leclercia sp. (1), and Acinetobacter sp. (1). Aeromonas strains were not isolated
from all the samples except from Epinephelus awoara from samples of Xiamen,
Fujian, China. The Vibrio isolates include V. parahaemolyticus (2), V. alginolyticus
(5), V. azureus (2), V. anguillarum (9), and V. fluvialis (1), found in the samples
from Tianjin and Xiamen, Fujian, China (Table 1).
Based on the 16S rRNA gene sequences, the phylogenetic tree of all isolated strains
was constructed. As shown in Fig. 1, Aeromonas isolates, Enterobacteriaceae
isolates, Vibrio isolates, and Shewanella isolates were in grouped in one cluster,
respectively; 9 C. freundii isolates were also grouped into two clades, one com-
prising of 4 members and the other comprising of 5 members. The phylogenetic
740 Z. Jing et al.
analysis result indicated that the isolated strains within the same genus or species
might belong to different lineages (Fig. 1).
Since 16S rRNA gene sequence is highly homologous among most Aeromonas
species, the Aeromonas isolates in this study were identified only at genus level [6].
The fragments of the six housekeeping genes were successfully amplified and
sequenced in all 53 Aeromonas strains. The sequence alignment results showed only
21 out of the 318 alleles was known alleles in the database, including gyrB22 (LSB2),
gyrB22 (MY-1), gyrB97 (MJ-4), gyrB22 (MY), groL42 (MJ-1), groL96 (CH13),
groL96 (SH11), gltA56 (MY-1), gltA56 (MJ-4), gltA51 (ML-1), gltA56 (MY),
gltA56 (SJ1), gltA51 (SL-1), gltA99 (TB2), metG64 (TY-4), ppsA67 (LSJ1),
ppsA40 (MJ-1), ppsA40 (SL1), ppsA40 (TL1), ppsA40 (TY-2) and recA42 (MJ-1).
The remaining 297 sequences represented the novel alleles. Correspondingly, only 8
STs were known sequence types and 45 STs were novel. The results suggested the
highly genetic diversity of the Aeromonas isolates in our work.
Investigation of Aquatic Pathogens and Diversity Analysis … 741
By analyzing the database of all 398 Aeromonas STs, Aeromonas strains geographic
isolation was found. As shown in Fig. 2a, the Asia, Europe, North America and
South America were respectively discovered 195, 181, 8 and 1 unique STs, only one
ST is the North American and Asian shared, the ST is famous ST 251 [13].
As shown in Fig. 2b, a total of 171 unique ST were found in the Chinese region,
Beijing, Tianjin, Jilin, Guangdong and Zhejiang as the main source of the data, and
was found to also have geographic isolation; no duplicate ST occurs among strains
isolated in different regions.
Relationships among the STs deposited in the Aeromonas MLST database were
analyzed by using the eBURST algorithm [9]. The eBURST analysis revealed that 42
irrelevant clonal complexes (CCs) and 81 singletons were identified. Figure 3 is a
schematic diagram of eBURST analysis, the identified 45 STs distributed in the 8 of
42 clonal complexes, and the low correlation between strains, indicating a high degree
of biological diversity of Aeromonas strains. Additionally, in this study only one
allele number difference was identified between ST127 (MY-1) and ST 140 (MY).
Fig. 2 Distributions of Aermonas STs across China (a) and the world (b)
Investigation of Aquatic Pathogens and Diversity Analysis … 743
4 Discussion
Aquatic pathogenic bacteria can cause fish diseases, leading to the death of aquatic
animals, bringing economic losses to farmers. Deng et al. [14] collected samples
from a variety of aquatic animals from 64 aquaculture farms in Guangdong, China,
and isolated 112 Aeromonas strains with multidrug-resistant phenotype and Class I
integrons. Adesoji et al. [15] isolated 108 tetracycline resistant strains from water
distribution systems in southwestern Nigeria, including Aermonas spp., Alcaligenes
spp., Bacillus spp., Klebsiella spp., Leucobacter spp., Morganella spp., and Proteus
spp..
MLST was performed to further discriminate the 53 Aeromonas isolates. Totally
297 new alleles and 45 novel STs were identified in our study. The data indicated
the strains of the Aeromonas genus from different sources were highly genetically
diversified [16, 17]. By eBURST algorithm analysis 398 Aeromonas STs were
found belonging to 42 CCs, further suggesting the diversity of all Aeromonas
isolates across the world. That may be due to the small number of Aeromonas
isolates in the MLST database, and more deposited strains will better unveil the
distribution patterns of Aeromonas strains.
This study has identified a number of novel alleles and STs of the Aeromonas
spp. The relevant information has been deposited in the Aermonas MLST database.
The data obtained in our study will provide more support for the study of the
Aeromonas epidemiology.
Acknowledgements This work was partly supported by The National Natural Science
Foundation of China (Grant 31370205 and 30970114).
744 Z. Jing et al.
References
1. Greenlees KJ, Machado J, Bell T et al (1998) Food borne microbial pathogens of cultured
aquatic species. Vet Clin North Am Food Anim Pract 14(1):101–120
2. Janda JM, Abbott SL (2010) The genus Aeromonas: taxonomy, pathogenicity, and infection.
Clin Microbiol Rev 23(1):35–73
3. Parker JL, Shaw JG (2011) Aeromonas spp. clinical microbiology and disease. J Infect 62
(2):109–118
4. Greenlees KJ, Machado J, Bell T et al (1998) Food borne microbial pathogens of cultured
aquatic species. Vet Clin North Am Food Anim Pract 14(1):101–112
5. Woese CR (1987) Bacterial evolution. Microbiol Res 51(2):221–271
6. Martinez AJ, Benlloch S, Collins MD (1992) Phylogenetic interrelationships of members of
the genera Aeromonas and Plesiomonas as determined by 16S ribosomal DNA sequencing:
lack of congruence with results of DNA-DNA hybridizations. Int J Syst Bacteriol 42(3):412–
421
7. Uchiyama H (2000) Distribution of vibrio species isolated from aquatic environments with
TCBS agar. Environ Health Prev Med 4(4):199–204
8. Feil EJ, Li BC, Aanensen DM et al (2004) eBURST: inferring patterns of evolutionary
descent among clusters of related bacterial genotypes from multilocus sequence typing data.
J Bacteriol 186:1518–1530
9. Mishra S, Nair GB, Bhadra RK et al (1987) Comparison of selective media for primary
isolation of Aeromonas species from human and animal feces. J Clin Microbiol 25(11):2040–
2043
10. Weisburg W, Barns S, Pelletier D et al (1991) 16S ribosomal DNA amplification for
phylogenetic study. J Bacteriol 173(2):697–703
11. Tamura K, Peterson D, Peterson N et al (2011) MEGA5: molecular evolutionary genetics
analysis using maximum likelihood, evolutionary distance, and maximum parsimony
methods. Mol Biol Evol 28(10):2731–2739
12. Elena MM, Luca F, Filomena M (2011) Determination of microbial diversity of Aeromonas
strains on the basis of multilocus sequence typing, phenotype, and presence of putative
virulence genes. App Environ Microbiol 77(14):4986–5000
13. Pang M, Jiang J, Xie X et al (2015) Novel insights into the pathogenicity of epidemic
Aeromonas hydrophila ST251 clones from comparative genomics. Sci Rep 5:9833
14. Deng Y, Wu Y, Jiang L et al (2016) Multi-Drug resistance mediated by class 1 integronsin
Aeromonas isolated from farmed freshwater animals. Front Microbiol 7:935
15. Adesoji AT, Ogunjobi AA, Olatoye IO et al (2015) Prevalence of tetracycline resistance genes
among multi-drug resistant bacteria from selected water distribution systems in southwestern
Nigeria. Ann Clin Microbiol Antimicrob 14:35
16. Neo E, La T, Phillips ND et al (2013) The pathogenic intestinal spirochaete Brachyspira
pilosicoli forms a diverse recombinant species demonstrating some local clustering of related
strains and potential for zoonotic spread. Gut Pathog 5(1):24
17. Cui SY, Sun QH, Li JX et al (1997) Study on the phenotypic characters and pathogenic
factors of 260 Aeromonas spp. strain. Microbiol China 24(4):227–230
Expression of Transcription Factor EB
(TFEB) Promotes Cancer Cell
Proliferation, Migration and Invasion
Wei Li, Yang Liu, Min Hao, Meng Yang, Shuang Zhao, Zhenxing Liu
and Aipo Diao
1 Introduction
increased and HIF-1 reporter activity was inhibited due to the overexpression of
TFEB [11]. In addition, increasing TFEB expression in RAW 264.7 cells resulted in
the generation of osteoclast-like cells that were more efficient in resorbing a min-
eralized ECM [12].
It has been shown that overexpression of TFEB leads to the generation of new
lysosomes and increased the number of autophagosomes in variety of cell types [5,
7, 13]. Stable and transient overexpression of TFEB in HeLa cells significantly
increased the number of autophagosomes [7]. However, whether the expression of
TFEB inflect the proliferation, migration and invasion of cancer cells hasn’t been
investigated. In this study, we investigated whether expression of TFEB was
involved in tumor cells proliferation, migration and invasion, in an attempt to gain
further insights on the role of TFEB in tumorigenesis.
2.1 Reagents
Fetal bovine serum (FBS) was purchased from Tianhang Biological Technology
(Zhejiang, China). Rabbit anti-TFEB antibody was obtained from Santa Cruz
Biotech (USA). Mouse anti-b-actin and anti-Flag antibodies, goat anti-mouse 680
and anti-rabbit 680 secondary antibodies were purchased from Sungene Biotech
(Tianjin, China). MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bro-
mide) was purchased from Solarbio Biotech (Beijing, China). All other biological
or chemical reagents were from Thermo Scientific or Sigma Aldrich unless
otherwise stated.
The HeLa cells were cultured in Dulbecco’s modified Eagel’s medium (DMEM)
supplemented with 10% FBS, 100 unit/mL penicillin and 100 lg/mL streptomycin
in humidified incubator at 37 °C and 5% CO2.
The TFEB gene was amplified by PCR and the product was purified and digested
with EcoRI and BamHI restriction enzyme, and then inserted into pcDNA3.1+
vector with flag tag on its upstream and HA tag on its downstream. The recom-
binant plasmid and empty vector (EV) were transiently transfected into HeLa cells.
In brief, transient transfection were performed when cells grown to about 70–80%
confluence using 2 lg plasmid DNA, 4 lL TurboFect transfection reagent
(Thermo, USA) and 200 lL Opti-MEM per 35 mm dish according to the manu-
facturer’s instructions.
Expression of Transcription Factor EB (TFEB) Promotes Cancer … 747
The methyl thiazolyl tetrazolium (MTT) assay was used to assess cell proliferation
[14]. HeLa cells were seeded in 96-well plates at a density of 8000 cells per well,
then incubated at 37 °C for 24, 48, and 72 (h), respectively. After incubation, 20 lL
of MTT (5 mg/mL) was added and the cells were cultured for additional 4 h to
format the formazan salt crystals. The reaction was terminated by removal of the
supernatant and addition of 200 lL of DMSO. The 96-well plate was shaken for
10 min at room temperature gently. A Microplate Reader (Thermo, USA) was used
to measure the optical density (OD) of each well at 490 nm. The results were
plotted as means ± SD of three independent experiments.
748 W. Li et al.
The wound healing assay was performed to evaluated the migration ability of tumor
cells [15]. HeLa cells were cultured in 35 mm dishes and grown to approximate
100% confluence. A clear area was scraped in the monolayer with a 200 lL pipette
tip. After washing three times with DPBS, cells were incubated at 37 °C in DMEM
medium containing 3% FBS. The wounded gap sizes were evaluated at 0, 24, 48
and 72 (h) with an inverted microscope and photographed. The healing rate was
quantified with the gap sizes compared to the control (0 h). Three different areas in
each assay were chosen to measure.
For the invasion assay [16], matrigel solution (BD Biosciences) was prepared in
serum-free cell culture medium at a dilution of 1:8, and used to coat the 24-well
transwell chambers overnight at 37 °C before cell seeding. The cells were cultured
in the chambers with serum-free media at 1 105 cells per well. After 48 h, the
insert were removed by wiping with a cotton swab. Cells that migrated to the
bottom surface of the insert were fixed with 4% paraformaldehyde, stained with
0.1% crystal violet, and counted in five random fields.
Experiments were independently repeated three times. Student’s t-test and One-way
analysis of variance (ANOVA) were used to investigate the difference between the
transfected/infected cells and control cells. SPSS18.0 statistical software package
was used for all statistical analysis. P < 0.05 was considered to indicate statistical
significance.
3 Results
The TFEB gene with flag- and HA-tag was inserted into a pcDNA3.1+ plasmid. The
empty vector (EV) and TFEB gene were transiently transfected into HeLa cells,
named as pcDNA3.1+-EV and pcDNA3.1+-flag-TFEB-HA, respectively. TFEB
expression in HeLa cells was analyzed by Western blot. As shown in Fig. 1, Western
blot analysis confirmed that only endogenous TFEB protein was detected in control
Expression of Transcription Factor EB (TFEB) Promotes Cancer … 749
Fig. 1 Expression of TFEB in the transiently transfected HeLa cells. The protein level of TFEB in
control or transfected HeLa cells (pcDNA3.1+-EV and pcDNA3.1+-flag-TFEB-HA) was detected
by Western blot. The untransfected HeLa cells were used as control. b-actin was used as the
loading control
cells and cells transfected with pcDNA3.1+-EV plasmid, while TFEB fusion protein
was detected in the cells transfected with pcDNA3.1+-flag-TFEB-HA, which indi-
cated that exogenous TFEB protein was expressed in HeLa cells.
To assess whether TFEB promotes or inhibits the growth of HeLa cells, the MTT
assay was performed. The empty plasmid was transient transfected serving as
control, and pcDNA3.1+-flag-TFEB-HA was transfected into HeLa cells under the
same experimental circumstances. As shown in Fig. 2a, cell growth rate between
pcDNA3.1+-flag-TFEB-HA and pcDNA3.1+-EV cells had significant difference
(P < 0.05) at 72 h post-transfection. Moreover, TFEB was depleted in HeLa cells
infected lentiviruses expressing TFEB-shRNA (named shTFEB), HeLa cells
expressing TFEB-shRNA showed efficient silencing of TFEB expression, as
determined by Western blot (Fig. 2b). MTT assay showed that knockdown of
TFEB expression significantly decreased HeLa cell viability compared to the
Fig. 2 The effect of TFEB expression on the proliferation of HeLa cells. a MTT assay were
performed and the growth rates in transiently transfected HeLa cells expressing TFEB were
analyzed compared to control cells (*P < 0.05, **P < 0.01). The untransfected HeLa cells were
used as control. b TFEB expression was inhibited in HeLa cells infected lentiviruses expressing
TFEB-shRNA. c The proliferation of HeLa cells depleted TFEB was assayed by MTT compared
to control cells (**P < 0.01)
750 W. Li et al.
control (Fig. 2c). These results demonstrate that expression of TFEB promotes
HeLa cells proliferation.
To investigate the effect of TFEB on cell migration, wound healing assay was
performed in our study. The transfected HeLa cells were incubated for 24 h and
then scraped with a 200 lL pipette tip. The cells were incubated continuously in
DMEM medium with 3% FBS under the same condition and the wound size were
measured at 0, 24, 48 and 72 (h). The results showed that the gaps were gradually
reduced from 24 to 72 h. The pcDNA3.1+-flag-TFEB-HA transfected HeLa cells
had a much faster wound-healing rate compared with the control pcDNA3.1+-EV
transfected Hela cells (P < 0.05), which suggests that TFEB expression increases
the migration ability of HeLa cells (Fig. 3a, b).
Fig. 3 The effect of TFEB expression on HeLa cell migration was determined using wound
healing assay. a Observations were carried out at 0, 24, 48 and 72 (h) after the start of culture.
Scale bar 100 lm. b The gap size was measured and plotted as the percentage of the original time
point (0 h), (*P < 0.05)
Expression of Transcription Factor EB (TFEB) Promotes Cancer … 751
Fig. 4 Expression of TFEB promoted MGC-803 cells invasion. a MGC-803 cells overexpressing
TFEB were used to determine the effect of TFEB on cell invasion by a transwell invasion assay.
b The invasive cells of MGC-803 cells overexpressing TFEB were calculated and then normalized
with that of pc-DNA3.1+-EV transfected cells (*P < 0.05)
To further assess the role of TFEB on the invasion of cancer cells, transwell
invasion assay was performed. The pcDNA3.1+-flag-TFEB-HA plasmid was
transiently transfected into MGC-803 cells, the empty vector were used as control.
The results indicated that TFEB expression promoted MGC-803 cells invasion
through matrigel by about 1.8 times compared to the control (Fig. 4a, b).
4 Discussion
Giatromanolaki et al. [20] showed that more than 80% of wounded gap was not
refilled after TFEB silencing, which suggested that TFEB had influences on the cells
migration. The present study suggested the overexpression of TFEB could accelerate
the healing rate of HeLa cells, which indicated that TFEB might increase the
migration ability of HeLa cells. Our results further indicate that TFEB expression is
connected with cancer cells migration. In addition, we detected the effects of TFEB
expression on cancer cell invasion using transwell assay. Because the HeLa cells
have a weak ability of cell invasion, we overexpressed TFEB gene in MGC-803 cells
and investigated the effect of TFEB on the invasion of cancer cells. Our findings
indicated that expression of TFEB promoted the invasion of MGC-803 cells.
Collectively, this study provides a novel evidence that TFEB expression pro-
motes the cancer cell proliferation, migration and invasion. Therefore, our findings
implicate TFEB is a potential therapeutic target for cancer treatment.
References
14. Zhang T, Chen X, Qu L, Wu J, Cui R, Zhao Y (2005) Chrysin and its phosphate ester inhibit
cell proliferation and induce apoptosis in Hela cells. Bioorg Med Chem 12(23):6097–6105
15. Zhang H-Y, Sun H (2010) Up-regulation of Foxp3 inhibits cell proliferation, migration and
invasion in epithelial ovarian cancer. Cancer Lett 287(1):91–97
16. Lv T, Yuan D, Miao X, Lv Y, Zhan P, Shen X et al (2012) Over-expression of LSD1
promotes proliferation, migration and invasion in non-small cell lung cancer. PLoS ONE 7(4):
e35065
17. Mizushima N, Komatsu M (2011) Autophagy: renovation of cells and tissues. Cell
147(4):728–741
18. Chen Y, Liu H, Guan Y, Wang Q, Zhou F, Jie L et al (2015) The altered autophagy mediated
by TFEB in animal and cell models of amyotrophic lateral sclerosis. Am J Transl Res
7(9):1574–1587
19. Pena-Llopis S, Vega-Rubin-de-Celis S, Schwartz JC, Wolff NC, Tran TAT, Zou L et al
(2011) Regulation of TFEB and V-ATPases by mTORC1. EMBO J 30(16):3242–3258
20. Giatromanolaki A, Kalamida D, Sivridis E, Karagounis IV, Gatter KC, Harris AL et al (2015)
Increased expression of transcription factor EB (TFEB) is associated with autophagy,
migratory phenotype and poor prognosis in non-small cell lung cancer. Lung Cancer
90(1):98–105 (Amsterdam, Netherlands)
Research Progress of Squalene Synthase
on Function and Application
1 Introduction
Triterpene and sterols play an important role in organisms such as the fungi,
animals and plants, and they have potential application value in pharmaceuticals
industry [1], therefore synthesis of triterpene and sterols draw more and more
researchers’ attention [2]. Squalene (SQ) is a direct descendent of SQS, and SQS
has a wide range of application value in our daily life [3, 4].
SQ is a key intermediate product in the synthesis of cholesterol, which is the
composition of various organs and tissues, including cell membranes and liver fat
[5–7]. In addition, SQ could be used as oil phase raw materials for cosmetics [8],
which has function of potent free radical scavenger and antioxidant capability
[9, 10]. SQ is effective in cancer treatment since it has the strong ability supplying
D. Sun Q. Guo Z. Zhu S. Li J.-W. Wang Y.-F. Zhang H.-M. Qin (&) F. Lu
College of Biotechnology, Tianjin University of Science and Technology,
Tianjin, China
e-mail: [email protected]
H.-M. Qin F. Lu (&)
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education,
Tianjin, China
e-mail: [email protected]
H.-M. Qin F. Lu
Tianjin Key Laboratory of Industrial Microbiology, Tianjin, China
H.-M. Qin F. Lu
National Engineering Laboratory for Industrial Enzymes, Tianjin 300457,
People’s Republic of China
L. Guan
Food Processing Institute, Heilongjiang Academy of Agricultural Science,
368# Xuefu Road, Nangang District, Harbin 150086, China
oxygen in organisms [6, 11]. So, SQ has curative effect to many kinds of cancers,
especially for the ovarian cancers and the lung cancers [12, 13]; One hand, SQ
could promote the blood circulation and prevent high or low blood pressure caused
by poor circulation, on the other hand, SQ lowers the risk of myocardial infarction
and coronary heart disease [14]; Besides, SQ was also used for anti-infection cure
as it possesses stronger antibacterial action on most parts of the bacterium [15].
The SQS has a transmembrane domain at its C-terminal with a quadruple spiral to
anchor at cell membrane [16]. And it has a large N-terminal catalytic domain facing
the cytosol. This orientation would enable SQS to accept water soluble farnesyl
pyrophosphate (FPP) and NADPH from the cytosol, and release lipophilic squalene
to the membrane of the endoplasmic reticulum, thus reflecting the enzyme’s unique
position in the cholesterol biosynthetic pathway [17]. Mammalian SQS include 416
amino acids with a molecular mass of 47 kDa. The crystal structure of the human
SQS has been identified that the overall structure has a single domain, which is
composed of an a-helical bundle fold. In hSQS, one side of the central cavity is
buttressed by two mobile segments, the AB flap and the JK loop and helix aK,
which are assumed to regulate the binding of substrates (prenyl donor and acceptor)
and NADPH (Fig. 1) [18]. hSQS catalyzes the first step of cholesterol biosynthesis,
in which two farnesyl pyrophosphate (FPP) molecules are condensed in a
‘head-to-head’ or ‘1′–1’ coupling to form SQ. The catalytic process involves two
half-reactions: firstly, two FPP molecules are condensed to form presqualene
diphosphate (PSPP), an intermediate with a cyclopropane C1′–C2–C3 ring struc-
ture; secondly, PSPP undergoes a NADPH-dependent rearrangement and reduction
to generate the end product SQ. The active site is lined to both sides by conserved
aspartate and arginine residues. Those two residues are important for the two
half-reactions, which are testified by mutagenesis experiments [19].
SQS catalyzes the first reaction of the branch of the isoprenoid metabolic pathway
committed specifically to sterol biosynthesis [17]. And sterols serve as hormone
precursors and secondary messengers play crucial role in developmental signalling
[20]. SQS also would compete with several other enzymes to produce precursor of
various terpenoid using FPP. The FPP conversion to the cholesterol will be
inhibited when the SQS activity reduced, and that leads to increasing the generation
Research Progress of Squalene Synthase on Function … 757
Fig. 1 The tertiary structure of the human squalene synthase, and overall structure of the hSQS–
FSPP–Mg2+ complex [18]. The two molecules of FsSPP, S1 FSPP (green) and S2 FSPP (yellow),
bound to the active site are shown as ball-and-stick models. The two golden boxes highlight the
flexible regions in ligand binding. The coloured ribbon model is based on B factors, with red
representing a high B factor and deep blue representing a lower B factor (the B factor stands for
conformational states of protein crystals)
SQS is a key enzyme in isoprenoid synthesis and it catalyzes two molecules of FPP
into 30-carbon linear SQ [23]. The isoprenoid metabolic pathway is essential in the
biosynthesis of plant sterols and triterpenoid saponins. A large amount of triter-
penoid saponin and phytosterol were produced when SQS was overexpressed in
Panax ginseng, and it indicated that SQS played an important role in the synthesis
of phytosterol [24, 25]. In addition, the overexpression of SQS in the bupleurum
(Bupleurum falcatum) would cause the increase of phytosterol and saikosaponin,
meanwhile the squalene epoxidase and cycloartenol synthase mRNA expression
also increased [26].
The synthetic pathway of steroidal and saponin [27] is as follow: (1) the
mevalonic acid is converted into isoprene pyrophosphate (IPP) with the participa-
tion of dimethylallyl diphosphate (DMAPP). IPP is normally catalyzed by long
geranyl pyrophosphate synthase to generate geranyl diphosphate (GPP); (2) GPP is
catalyzed by famesyl diphosphate synthetase (FPPS), which react with IPP to
produce famesyl diphosphate (FPP); (3) SQS is a bifunctional enzyme that
758 D. Sun et al.
SQS catalyzes two molecules of FPP to form pre-squalene diphosphate, and then it
is converted to SQ in a two-stage reaction [30, 31]. Initially, two molecules of FPP
are condensed to form presqualene diphosphate (PSPP), Secondly; PSPP is rear-
ranged and reduced by NADPH to form SQ. Research of yeast SQS enzyme
activity in vitro showed PSPP would be transformed to SQ directly with binding to
the active site when NADPH is present in the reaction buffer [23].
Farnesyl diphosphate (FPP) is formed in the process of generating SQ which is
C15 allylic compound [22]. Its reaction is shown in Fig. 2 [22]. It is two FP that are
connected together, forming a carbon bond in the position of the C-terminal leading
to the reaction of biosynthetic terpenoid. The divalent cations are required to take
part in reaction regularly so as to facilitate the FPP phosphate group [32].
Fig. 2 The proposed reaction mechanisms for the two half-reactions catalyzed by SQS. The two
molecules of FPP appear to bind sequentially with different affinities to two distinct regions of the
enzyme, prior to the binding of NADPH, and prior to dissociation of the first diphosphate leaving
group. The binding site for the donor FPP is more selective for FPP than is the acceptor FPP
binding site. The PSPP binding site either overlaps with, or is the same as, the FPP binding sites
[22]
Research Progress of Squalene Synthase on Function … 759
In the first half reaction, two FPP molecules are combined to SQS by the CIS
acting. One FPP molecule is got by pyrophosphate group cleavage when FPP
molecules bind to different regions of the enzyme with different binding affinity
[33]. By the catalytic reaction of SQS, a head-to-head condensation reaction (10-2,
3-linked) between two molecules of FPP forms a cyclopropylcarbinyl intermediate,
presqualene diphosphate (PSPP) [34].
In the second step of SQS-catalyzed reaction, PSPP moves to the second reaction
sites in SQS, which is located in the central channel, and would be exactly avoid
water when reaction happen [35]. Then the cyclopropyl is opened, PSPP is rear-
ranged, and the NADPH is reduced to a linear end product SQ, while the
pyrophosphate, H+, and NADP+ is generated, then SQ is released into the endo-
plasmic reticulumomentum [23].
Genes encoding SQS have been identified from a variety of eukaryotic sources, the
fungi, animals and plants included. We conducted a database search for proteins
from fungi, animals, and plants, to biochemically characterized SQS and found hits
in two DXXED motifs as the substrate-binding sites and residues involved in
NADPH recognition [36].
Multiple sequence alignment of SQS proteins indicated (Fig. 3, I–IV) that there
existed four highly conserved regions among these organisms (animals, plants and
fungi). Regions I, II, and III are related to the first half-reaction, the condensation of
two molecules of FPP to produce PSPP. The binding of the diphosphate units in
FPP via bridging Mg2+ is likely involved in regions I and III [35, 37]. While the
region IV is considered to be required for the rearrangement of PSPP to SQ. The
amino acid sequence of animals and fungi shares highest similarity in regions I and
II and drops considerably in regions III and IV, which is a little high compared with
that from plants [38].
Meanwhile the AB-flap (SRSF) was also found, which were thought to regulate
the binding of NADPH, respectively. The distinctive domains distributed between
the conserved domains were also shown by the amino acid sequence alignment [36].
The first committed steps of steroid/hopanoid pathways involve SQS that are
constitute two of the major sub-groups of isoprenoids, and it is the biosynthesis of
squalene from two farnesyl diphosphates (FPPs), thus, some synthetic biology
760 D. Sun et al.
Fig. 3 Amino acid sequence alignments for representative SQS proteins from Polygala tenuifolia,
Panax ginseng, Euphorbia lathyris, Mus musculus, Rattus norvegicus, Saccharomyces cerevisiae,
Candida tenuis [36]. The ClustalW algorithm was used to generate the alignment (www.ebi.ac.uk/
Tools/clustalw/index.html). Dashes indicate gaps that were introduced to maximize the alignment.
The four conserved regions (I–IV) are indicated below the sequences
products can use this pathway to realize overexpression. Since these reactions in
pathway are all placed at the branching position, the precursors enter pathway are
determined by its enzyme activities. Once some special pathway formed, SQ could
be exclusively used.
Here, some experiments showed that SQS could synthesize detectable amounts
of dehydrosqualene in the absence of NADPH [23, 31]. Therefore, SQS could
generate the carotenoid dehydrosqualene, and this could be a theoretically possible
route for carotenoid biosynthesis [39]. It is showed the carotenoid pigments could
be synthesized mainly via the desaturation of SQ rather than the direct synthesis of
dehydrosqualene which had a low production. This also revealed the possible
existence of a “SQ route” for C30 carotenoids, using SQS in carotenoid biosyn-
thetic pathways [39].
In addition, SQS could control sterol biosynthesis that has been well established
using SQS mutants in animals [40] and yeast [41]. The upstream part of the
withanolide biosynthesis pathway is about isoprenoid biosynthesis and that diver-
ges into sterol and triterpene biosynthesis. In consequence, to enhance withanolide
production which is held in high repute in traditional Indian medicine can make
overexpression of SQ in Withania somnifera [42].
Gene overexpression strategies are commonly employed for the upregulation of
metabolic pathways in engineered hosts [43]. It suggests that the enhanced
coproduction of SQ, ergosterol, oleic acid and biomass in yeast due to the over-
expression of genes in the squalene biosynthetic (SB) pathway by newly charac-
terized constitutive promoter. Hence, the regulation of complementary SB pathways
to achieve a large-scale SQ production can be a useful strategy for engineering of
the terpenoid pathway in Saccharomyces cerevisiae co-overproduces SQ [44].
According to overexpression genes of the SB pathway, production of SQ could
Research Progress of Squalene Synthase on Function … 761
SQ was extensively studied in medical and pharmaceutical research for its chemical
effectiveness to inhibit chemically induced colon, lung, and skin cancers; possess
bactericidal and antifungal properties; significantly increases cellular immune and
reduce total cholesterol of plasma levels [46].
SQS has been investigated as a key enzyme, because it plays an important role in
the biosynthesis of SQ, which could be as an intermediate for the production of
sterols, hopanoids or other triterpenoids. SQS catalyzes the first committed step of
the sterol branch of the cholesterol biosynthesis pathway, which could regulate
target of cholesterol level. Studies have shown that the increase of SQS expression
constitutes an important approach to improve the level of cholesterol in mice [22].
Therefore, researchers are interest in SQS function of inhibiting high cholesterol
and coronary heart disease (CHD) [32]. But others believe that the variation of the
enzyme may be associated with hypercholesterolemia genetic disorders [47].
The hybrid human-yeast SQS was expressed by genetic engineering, which can
be as a tool for anti-cholesterol drug assessment [48]. HMG-CoA reductase inhi-
bitors are safe and effective in reducing cardiovascular disease risk, and also can be
tolerated well for the majority of patients [49], but some of SQS failed to pass
clinical phase I/II trials because of their hepatoxicity [50]. However, SQS is still
regarded as a potential for therapeutic molecules that could decrease cholesterol
level without affecting other isoprenoids [48]. In summary, SQS inhibitors have
shown great promise and potential as cholesterol-lowering agents in human health,
and both as alternatives to statins.
The fungal SQS was the first active enzyme to be purified from yeast [16], and then
Rat liver active SQS is also purified from mammals, which has a transmembrane
structure binding in the endoplasmic reticulum [51, 52]. And using similar research
method of mouse liver, human liver SQS gene was cloned [53]. And then SQS
genes were researched widely. SQS genes have been cloned from a variety of
organisms including animals (such as, human, mouse, Trypomosoma cruzi, etc.)
[54, 55], plants (Euphorbia tirucalli, Taxus chinensis, Arabidopsis thaliana, etc.)
[30, 56, 57], fungi (Ganoderma lucidum, yeast, etc.) [58, 59] and
Thermosynechococcus elongates [60].
762 D. Sun et al.
Through the study of SQS in these organisms, the results revealed that all the
SQS had a transmembrane region in the enzyme C terminal anchored the cell
membrane by a short helix, and its N terminal is located in the cytoplasm. This
structure of SQS prevents the researchers from purifying the soluble wild SQS.
Compared to the eukaryotic SQS, investigations of prokaryotic SQS are very
limited and only one example from was reported. Previous studies have shown that
the full length of SQS gene was cloned and expressed in Thermosynechococcus
elongatus. The bacterial SQS protein structure analysis showed that was not similar
to the eukaryotic SQS protein for it lacked the C-terminal transmembrane heli [60].
The studies found that the SQS catalytic activity was not affected in vitro when
the amino acids of the C-terminal transmembr were knocked out. Some scholars
confirmed that the purification of the Trypanosoma cruzi SQS still had catalytic
activity when the N-terminal and C-terminal amino acids were knockout [61, 62].
Human squalene synthetase crystal has been crystallized, composed mostly of spiral
Q. Later, on the basis of the human SQS structure, the new identification of SQS
was performed by researchers [57, 62].
References
1. Silva AAS, Morais SM, Falcão MJC et al (2014) Activity of cycloartane-type triterpenes and
sterols isolated from Musa paradisiaca fruit peel against Leishmania infantum chagasi.
Phytomedicine 21(11):1419–1423
2. Lukić M, Lukić I, Krapac M et al (2013) Sterols and triterpene diols in olive oil as indicators
of variety and degree of ripening. Food Chem 136(1):251–258
3. Batista I, Nunes ML (1992) Characterisation of shark liver oils. Fish Res 14(4):329–334
4. Hye JC, Taylor W, Timothy P et al (2013) Vibrational spectra and DFT calculations of
squalene. J Mol Struct 1032:203–206
5. Harivardhan LR, Squalene CP (2009) A natural triterpene for use in disease management and
therapy. J Adv Drug Delivery Rev 61(15):1412–1426
6. Kin S, Karadeniz F (2012) Biological importance and application of squalene and squalane.
Adv Food Nutr Res 65:223–233
7. Pragst F, Auwärter V, Kiessling B et al (2004) Wipe-test and patch-test for alcohol misuse
based on the concentration ratio of fatty acid ethyl esters and squalene C FAEE/C SQ in skin
surface lipids. Forensic Sci Int 143(2):77–86
Research Progress of Squalene Synthase on Function … 763
31. Blagg BS, Jarstfer MB, Rogers DH, Poulter CD (2002) Recombinant squalene synthase.
A mechanism for the rearrangement of presqualene diphosphate to squalene. J Am Chem Soc
124(30):8846–8853
32. Davidson MH (2007) Squalene synthase inhibition: a novel target for the management of
dyslipidemia. Curt Atheroscler Rep 9(2):78–80
33. Mookhtiar KA, Kalinowski SS, Zhang D et al (1994) Yeast squalene synthase. A mechanism
for addition of substrates and activation by NADPH. J Biol Chem 269(21):1201–1207
34. Lin FY, Liu CL, Liu YL et al (2010) Mechanism of action and inhibition of dehydrosqualene
synthase. Proc Natl Acad Sci U S A 107(11):21337–21342
35. Pandit J, Danley DE, Schulte GK et al (2000) Crystal structure of human squalene synthase.
A key enzyme in cholesterol biosynthesis. J Biol Chem 275(8):30610–30617
36. Huang D, Yao Y, Zhang H et al (2015) Directed optimization of a newly identified squalene
synthase from Mortierella alpine based on sequence truncation and site directed mutagenesis.
J Ind Microbiol Biotechnol 42:1341–1352
37. Pandit J, Danley DE, Schulte GK et al (2000) Crystal structure of human squalene synthase.
A key enzyme in cholesterol biosynthesis. J Biol Chem 275:30610–30617
38. Lee Sungwon, Dale Poulter C (2008) Cloning, solubilization, and characterization of squalene
synthase from Thermosynechococcus elongatus BP-1. J Bacteriol 190(11):3808–3816
39. Furubayashi M, Li L, Katabami A et al (2014) Construction of carotenoid biosynthetic
pathways using squalene synthase. FEBS Lett 588:436–442
40. Tozawa R, Ishibashi S, Osuga J et al (1999) Embryonic lethality and defective neural tube
closure in mice lacking squalene synthase. J Biol Chem 274:30843–30848
41. Karst F, Lacroute F (1977) Ergosterol biosynthesis in Saccharomyces cerevisiae mutants
deficient in early steps of pathway. Mol Gen Genet 154:269–277
42. Grover A, Samuel G, Bisaria VS et al (2013) Enhanced withanolide production by
overexpression of squalene synthase in Withania somnifera. J Biosci Bioeng 115(6):680–685
43. Paddon CJ, Westfall PJ, Pitera DJ, Benjamin K et al (2013) High-level semi-synthetic
production of the potent antimalarial artemisinin. Nature 496:528–532
44. Rasool A, Zhang G, Li Z et al (2016) Engineering of the terpenoid pathway in Saccharomyces
cerevisiae co-overproduces squalene and the non-terpenoid compound oleic acid. Chem Eng
Sci 152:457–456
45. Rasool A, Ahmed MS, Li C (2016) Overproduction of squalene synergistically downregulates
ethanol production in Saccharomyces cerevisiae. Chem Eng Sci 152:370–380
46. Kim SK, Karadeniz F (2012) Biological importance and applications of squalene and
squalane. Adv Food Nutr 65:223–233
47. Do R, Kiss RS, Gaudet D et al (2009) Squalene synthase: a critical enzyme in the cholesterol
biosynthesis pathway. Clin Genet 75(5):19–29
48. Gora1 WM, Wysocka-Kapcinska M et al (2016) Genetic engineering and molecular
characterization of yeast strain expressing hybrid human-yeast squalene synthase as a tool for
anti-cholesterol drug assessment. J Appl Microbiol 120:877–888
49. Armitage J (2007) The safety of statins in clinical practice. Lancet 370:1781–1790
50. Liao JK (2011) Squalene synthase inhibitor lapaquistat acetate: could anything be better than
statins. Circulation 123:1925–1928
51. Shechter I, Klinger E, Rucker ML et al (1992) Solubilization, purification, and character-
ization of a truncated form of rat hepatic squalene synthetase. J Biol Chem 267(21):
8628–8635
52. Stamellos KD, Shackelford JE, Shechter I et al (1993) Subcellular localization of squalene
synthase in rat hepatic cells. Biochemical and immunochemical evidence. J Biol Chem 268
(11):12825–12836
53. Jiang G, McKenzie TL, Conrad DG et al (1993) Transcriptional regulation by lovastatin and
25-hydroxycholesterol in HepG2 cells and molecular cloning and expression of the cDNA for
the human hepatic squalene synthase. J Biol Chem 268(13):12818–12824
Research Progress of Squalene Synthase on Function … 765
54. Summers C, Kant F, Charles AD (1993) Cloning, expression and characterisation of the
cDNA encoding human hepatic squalene synthase, and its relationship to phytoene synthase.
Gene 136(9):185–192
55. Soltis DA, McMahon G, Caplan SL et al (1995) Expression, purification, and characterization
of the human squalene synthase: use of yeast and baculoviral systems. Arch Biochem Biophys
316(26):713–723
56. Uchida H, Yamashita H, Kajikawa M et al (2009) Cloning and characterization of a squalene
synthase gene from a petroleum plant. Euphorbia tirucalli L. Planta 229(19):1243–1252
57. Huang Z, Jiang K, Pi Y et al (2009) Molecular cloning and characterization of the yew gene
encoding squalene synthase from Taxus cuspidate. J Biochem Mol Biol 40(2): 625–635
58. Zhao MW, Liang WQ, Zhang DB et al (2007) Cloning and characterization of squalene
synthase (SQS) gene from Ganoderma lucidum. J Microbiol Biotechnol 17(2):1106–1112
59. Lograsso PV, Soltis DA, Boettcher BR (1993) Overexpression, purification, and kinetic
characterization of a carboxyl-terminal-truncated yeast squalene synthetase. Arch Biochem
Biophys 307(12):193–199
60. Lee S, Pouiter CD (2008) Cloning, solubilization, and characterization of squalene synthase
from Thermosynechococcus elongatus BP-1. J Bacteriol 190(15):3808–3816
61. Sealey-Cardona M, Cammerer S, Jones S et al (2007) Kinetic characterization of squalene
synthase from Trypanosoma cruzi: selective Inhibition by quinuclidine derivatives.
Antimicrob Agents Chemother 51(3):2123–2129
62. Shang N, Li Q, Ko T-P et al (2014) Squalene synthase as a target for Chagas disease
therapeutics. PLoS Pathogen 10(5):1178–1191
Review in Metabolic Modulation of Higher
Alcohols in Top-Fermenting Yeast
1 Introduction
Wheat beer is a Bavarian and Austrian specialty beer, which is produced by wheat
malt, non-germinated malt occasionally, as the major raw material, usually requires
the amount of wheat malt accounts for at least 50% of the total raw material
internationally [1]. All the traditional wheat beer that is produced by top fermen-
tation has pure white exquisite froth, mellow and smooth taste, slight bitterness,
high calorie and nutritious [2–4].
In 80 s last century, China’s Beer Enterprises has imported wheat beer, but the
awareness of this beer in the consumers is not high for many years. With the current
consumer demand becoming increasingly diversified, differentiation, personalized,
and in recent years, the shortage of global barley resources leading to rise in price,
all beer enterprises actively adjust the product structure, by the way of developing
high-quality, diversified and personalized products. Wheat malt is favored by the
brewer, with its excellent brewing characteristics [5, 6]. Among them, Weiss and
Bitter are the two most famous top-fermented beer styles. The Weiss style is
characterized by a very fruity aroma (usually banana) and a strong phenolic (usually
clove) content; on the other hand, the Bitter beer has a malt aroma and
low-moderate fruity and hop aroma [3].
One of the main characteristic of fermentation and beer flavor maturation is the
adjustment of the concentration of all volatile compounds. Among them, fusel or
higher alcohols are the major abundant organoleptic compounds in wheat beer,
contributing along with the related acetate esters to the overall flavor of beer.
However, due to higher concentration of higher alcohols, drinking wheat beer will
cause thirst, headache and other symptoms, and is harmful to the health of the
drinkers, which seriously affects the development of wheat beer.
Through the whole brewing process, fermenting cultures of the yeast produce many
low-molecular-weight flavor compounds, along with ethanol and carbon dioxide.
These higher alcohols, esters, aldehydes, phenols, organic acids, organic sulfides
and other carbonyl substances have a strong impact on product quality [7, 8].
Higher alcohols have the function of giving the beer taste harmonious and
full-bodied, but if the concentration of higher alcohols over the taste threshold, not
only affect the quality of beer flavor, but also bring the body of the drinkers obvious
side effects [9]. The optimum concentration of higher alcohols in 12.0°P beer,
brewed by bottom fermentation, is 70–100 mg/L, as for beer with lighter taste and
lower wort concentration, the concentration of higher alcohols should be even
lower. Top fermented beer with wheat wort as the main raw material, because of its
plumper aroma, is allowed a little higher concentration of higher alcohols [10].
However, the concentration of higher alcohols in wheat beer is as high as 300 mg/L
or even higher, while generally below 100 mg/L in barley beer and about 50 mg/L
in high-quality beer. Too much higher alcohols in wheat beer will cause obvious
side effects after drinking, and it is one of the primary reasons for inhibiting the
development of wheat beer. The major higher alcohols are listed in Table 1 with
their characteristic flavor, taste threshold and fluctuation range of normal content in
lager.
In the higher alcohol groups, it is reported that amyl alcohol is the most quan-
titatively significant aromatic compound. Active amyl and isoamyl alcohols are
sometimes considered as one and represented simply as amyl alcohol. Active amyl
Table 1 List of beer flavors associated with the major higher alcohols [2, 7]
Higher Flavor in beer Organoleptic Range of normal
alcohols threshold (mg/L) content (mg/L)
n-propanol Bitterness 25 5–15
Isobutyl Alcohol 75 5–15
alcohol
Isoamyl Alcohol, banana, 75 30–35
alcohol sweetish, aromatic
Active amyl Alcohol, banana, edicinal, 50 15–50
alcohol solvent
b-Phenyl Roses, sweetish, perfumed 75 15–50
ethanol
Total – – 70–100
Review in Metabolic Modulation of Higher Alcohols … 769
alcohol is generally one-fifth to one-quarter of the total amyl alcohol, but it affects
drinkability because beer flavor is considered heavier as amyl alcohol concentration
increases. Isobutyl alcohol has an undesirable effect on beer quality when its
concentration exceeds 20% of the total concentration of three alcohols: n-propanol,
isobutyl, and amyl [7].
The importance of aromatic yeast metabolites in the beer brewing has been a
driving force for the screening of mutant strains in order to find those capable of
producing compounds with desirable aromas. Higher alcohols are major determi-
nants of the flavor of yeast fermented alcohols.
In recent years, there are many research reports about the modification of higher
alcohols metabolism gene in S. cerevisiae [22–26]. Branched chain amino acids
(BCAAs) are regarded as the key substrates in the formation of higher alcohols. The
first step in the catabolic BCAA degradation is a transaminase step, catalyzed by a
branched-chain amino acid transaminase (BCAAT). Saccharomyces cerevisiae
possesses a mitochondrial and a cytosolic BCAAT, Bat1p and Bat2p, respectively
[24]. Eden et al. [27] found out that the deletion of the BAT2 gene encoding amino
transferase had a great influence on the production of isobutyl alcohol and isoamyl
alcohol.
It has been studied how yeast can convert branched chain amino acids to higher
alcohols. Carbon skeletons are derived from the catabolism of BCAAs through the
Ehrlich pathway as branched-chain oxoacids. And also, in S. cerevisiae, production
of 2-ketoisovalerate (2-KIV), one of the branched chain oxoacids, from pyruvate
occurs in the mitochondrial matrix by the consecutive actions of ILV2 (ALS), ILV5
(KARI), and ILV3 (DHAD). 2-KIV is further degraded to isobutanol via several
2-keto acid decarboxylases and alcohol dehydrogenases in yeast. Conversion of
2-KIV to 2-ketoisocaproate (2-KIC) is catalyzed by three enzymatic steps involving
Leu4p (2-isopropylmalate synthase), Leu1p (isopropylmalate isomerase), and Leu2p
(3-isopropylmalate dehydrogenase), and 2-KIC can be either converted to leucine by
Bat2 or degraded to 3-methyl-1-butanol via Ehrlich pathway [28]. Chen et al. [29]
came to the conclusion that overexpression of genes ILV2, ILV3, ILV5, and BAT2 in
valine metabolism led to an increase in isobutanol production in S. cerevisiae while
additional overexpression of ILV6 in the ILV2, ILV3, ILV5 overexpression strain had
a negative effect. Park et al. [28] obtained a mutant strain overexpressing LEU2 and
LEU4D578Y showed a 34-fold increase in 3-methyl-1-butanol synthesis compared
with the original strain.
In our laboratory, Zhang et al. [30] constructed two engineered strains S5-2 and
S5-4, which feature partial BAT2 allelic genes replaced by the constructed ATF1
overexpression cassette. The experiment results showed that the engineered strains
S5-2 and S5-4, respectively, produced about 65 and 51% of higher alcohols
Review in Metabolic Modulation of Higher Alcohols … 771
produced by the parental strain. Wang Dan studied the effect of BAT2 gene deletion
on the production of higher alcohols in the top-fermenting yeast S-17, the research
results indicated that the higher alcohols content of the BAT2 gene deletion mutant
was reduced by 34.08%, compared with the starting strain, the largest decline in
higher alcohols was isobutanol, which decreased by 48.26%, and more importantly,
the fermentation performance of the mutant was basically unchanged.
5 Outlook
Higher alcohols represent the most important aroma-active substances in wheat beer
produced by top-fermenting yeast due to their essential aroma impressions. Great
advance has been made in elucidating their biochemical pathways and their regu-
latory mechanisms. However, there are still many problems about the genetic
modification of top-fermenting yeast strains. First of all, in the process of brewing
wheat beer by using top-fermenting yeast, the effect of different fermentation fac-
tors on the accumulation of the higher alcohols is not clear enough. Secondly, the
metabolic regulation mechanism of the higher alcohols in top-fermenting yeast is
not yet unequivocal [31], which will cause us unable to achieve the desired results
when we carry out genetic modification of industrial yeast strains in according with
the standard brewing yeast gene map. In our laboratory, Hao Xin et al. [32] pro-
posed to reduce the production of higher alcohols in industrial brewing yeast by
knocking out a pyruvate decarboxylase-like gene YDL080C, however, the experi-
mental results showed that there is no significant change in the production of higher
alcohols. Thirdly, how to achieve the genetic regulation of higher alcohols content
without affecting the production of other flavor compounds, especially their har-
mony, is still uncertain. Finally, the vast majority of the mutant strains are obtained
by introducing exogenous genes, especially resistance genes, which will bring
security risks to the mutants [33]. Because of these reasons, at present most of the
research on the metabolism of Saccharomyces cerevisiae flavor substances remains
in the experimental stage, and there are rare commercial production reports.
Acknowledgements This work was supported by the National Natural Science Foundation of
China (31471724).
References
23. Friden P, Schimmel P (1998) LEU3 of Saccharomyces cerevisiae activates multiple genes for
branched-chain amino acid biosynthesis by binding to a common decanucleotide core
sequence. Mol Cell Biol 8:2690–2697
24. Schoondermark-Stolk SA, Tabernero M, Chapman J et al (2005) Bat2p is essential in
Saccharomyces cerevisiae for fusel alcohol production on the non-fermentable carbon source
ethanol. FEMS Yeast Res 5:757–766
25. Abe F, Horikoshi K (2005) Enhanced production of isoamyl alcohol and isoamyl acetate by
ubiquitination-deficient Saccharomyces cerevisiae mutants. Cell Mol Biol Lett 10:383–388
26. Lilly M, Bauer FF, Styger G et al (2006) The effect of increased branched-chain amino acid
transaminase activity in yeast on the production of higher alcohols and on the flavour profiles
of wine and distillates. FEMS Yeast Res 6:726–743
27. Eden A, Van Nedervelde L, Drukker M et al (2001) Involvement of branched-chain amino
acid aminotransferases in the production of fusel alcohols during fermentation in yeast. Appl
Microbiol Biotechnol 55:296–300
28. Park SH, Kim S, Hahn JS (2014) Metabolic engineering of Saccharomyces cerevisiae for the
production of isobutanol and 3-methyl-1-butanol. Appl Microbiol Biotechnol 98:9139–9147
29. Chen X, Nielsen KF, Borodina I et al (2011) Increased isobutanol production in
Saccharomyces cerevisiae by overexpression of genes in valine metabolism. Biotechnol
Biofuels 4:21
30. Zhang CY, Liu YL, Qi YN et al (2013) Increased esters and decreased higher alcohols
production by engineered brewer’s yeast strains. Eur Food Res Technol 236:1009–1014
31. Procopio S, Qian F, Becker T (2011) Function and regulation of yeast genes involved in
higher alcohol and ester metabolism during beverage fermentation. Eur Food Res Technol
233:721–729
32. Hao X, Xiao DG, Zhang CY (2010) Effect of YDL080C gene deletion on higher alcohols
production in Saccharomyces cerevisiae haploids. Acta Microbiologica Sinica 50:1030–1035
33. Zhang YY, Xiao DG, Zhang CY et al (2012) Construction and crossing trial of BAT2 deletion
mutants lacking antibiotic resistant gene in Saccharomyces cerevisiae. Food Ferment Ind
38:36–40
Research Progress of Aldehyde Ketone
Reductase for Asymmetric Catalysis
of Chiral Compounds
1 Introduction
AKRs exist in nearly all phyla (Table 1), they are mainly monomeric soluble
proteins (34–37 kDa) [1]. These enzymes reduce carbonyl substrates such as sugar
aldehydes, keto-steroids, keto-prostaglandins, retinals, quinones, and lipid peroxi-
dation by-products. AKR family members owns the form of an (a/b)8 TIM barrel
fold consisting of a cylindrical core of eight parallel b-strands, forming the b-barrel,
surrounded by eight a-helices running antiparallel to the strands [2] (Fig. 1). The
carboxy ends of the b-strands are connected to amino ends of the a-helices by loops
of varying lengths forming the active site. These loops are most flexible and
variable in length, so that they enable the enzymes to accommodate substrates of
varying shapes and sizes, and to control many molecular events such as catalytic
action [3]. Sequence alignment in AKR family enzymes showed a conserved
quadruplet, which is the key characteristic to the enzymes responsible for the
substrate catalytic amino acids. The quadruplet is composed of aspartic acid, tyr-
osine, lysine and histidine. AKRs catalyze an ordered bi-bi kinetic mechanism, in
which NAD(P)H cofactor binds first and leaves last. Following cofactor binding,
the steroid is bound and transformed through a “push–pull” mechanism. Therefore,
AKRs catalytic enantioselective reduction reaction to show high levels of the
chemical selectivity, antipodal selectivity and regioselectivity.
Research Progress of Aldehyde Ketone Reductase … 777
Now AKRs from a variety of microorganisms have been used in the synthesis of
chiral compounds. Here, we reviewed the research progress about improving AKRs
as industrial catalysts.
Usually, the wild-type AKR has poor catalytic efficiency. Therefore, it needs to be
further modified to improve the catalytic properties of these enzymes. Studies have
shown that AKRs have some important amino acids directly or indirectly affecting
the process of enzyme catalysis [4]. Therefore, it is necessary to solve the crystal
structure, and elucidate the activity center of the enzymes and the catalytic mech-
anism of AKR. It is also important to find the key amino acids related to the enzyme
catalytic reaction to direct transformation enzyme protein or to create a new enzyme
protein.
Widboom et al. [5] used the method of homologous modeling reported the first
structure of an oxygenase class in complex with a bound substrate mimic. The
results resolve the unique and complex chemistry of DpgC, a key enzyme in
biosynthetic pathway of antibiotics. Furthermore, mechanistic parallels exist
between DpgC and cofactor-dependent flavoenzymes, providing information
regarding the general mechanism of enzymatic oxygen activation. Now, it has
become the research focus. To simulate the structure of the enzyme targeting for the
retional design, Gregory Zeikus et al. [6] developed a catalyst, which was able to
produce 1-phenyl-2-propanol from phenylacetone using TeSADH as target enzyme.
778 S. Li et al.
They designed a catalytic site by point mutation W110A, which makes TeSADH
active on phenylacetone, producing 1-phenyl-2-propanol. They also showed that
W110A in TeSADH is active on benzylacetone, and it is specific for (S)-
4-phenyl-2-butanol and (S)-1-phenyl-2-propanol. Stephanie Majkowicz et al. [7]
changed the enzyme stereoselectivity and significantly improved the optical purity
of the product through enzymes from yeast by site-directed mutation. Recently,
some researches on aldehyde ketone reductases from the genus Candida by
site-directed mutation have made a lot of progress. The wild type
NADPH-dependent carbony1 reductase from Candida magnoliae could not utilize
NADH as a coenzyme. Surprisingly, Souichi et al. [8] designed mutants, which are
activities toward NADH-dependency and disability to utilize NADPH as a coen-
zyme. A short-chain carbonyl reductase (SCR) from Candida parapsilosis catalyzes
an anti-prelog reduction of 2-hydroxyacetophenone to (S)-1-phenyl-1,2-ethanediol
(PED), and exhibits coenzyme specificity for NADPH over NADH. Rongzhen
Zhang et al. [9] designed the mutants with different combinations of Ser67Asp,
His68Asp, and Pro69Asp substitutions inside or adjacent to the coenzyme binding
pocket by site-directed mutagenesis. The S67D/H68D mutant produced (R)-PED
with high optical purity and yield in the NADH-linked reaction. Huimin Qin et al.
[10] found the enzyme, Thr25, Lys26 and Ser260 play a key role in combination
with coenzyme through analyzing the crystal structure of the CPR-C1 derived from
Candida, which providing the key information for further reforming the enzyme.
[14] identified eight new type of aldehyde ketone reductase using genome infor-
mation from C. parapsilosis to catalytize N,N-dimethyl-3-ketone-3-(2-thiophene)-
1-propanamine (DKTP) for generation of (S)-N,N-dimethyl-3-hydroxy-3-
(2-thiophene)-1-propanamine (DHTP). Genome mining can effectively develop
new biocatalysts for pharmaceutical and fine chemical industry.
Aldehyde ketone reductases are redox enzyme that dependent on cofactors. It needs
a certain amount of coenzyme NADPH as electron transfer for catalytic asymmetric
reduction reaction process [15]. Therefore, it is necessary to add extra coenzyme in
the catalytic reaction to maintain the reaction. However, the coenzyme NADPH is
cost, and not suitable for the industrial utilization of chiral compounds. Therefore, it
is important to build an efficient and economic system of co-enzyme regeneration
cycle. In recent years, a series of methods, such as electrochemical, chemical,
photochemical methods and enzymatic regeneration system, and enzymatic
regeneration, have been developed in order to solve the problem of co-enzyme
regeneration. Enzymatic regeneration has two methods: double enzymes of alde-
hyde ketone reductase and regeneration enzyme catalyzedcoupling reaction to build
aldehyde ketone reductase and regeneration enzyme into the same expression
vector (Fig. 2). Kataoka et al. [16] have applied ethanol, in place of glucose for
coenzyme factor, to the catalytic reduction reaction of asymmetric carbonyl com-
pounds, but the utilization rate of ethanol is extremely low. Furthermore, high
concentration of ethanol is toxic to which cells. The researchers found that
excessive glucose as the electron donor resulted in a high rate of alcoholic fer-
mentation, oxygen consumption and biomass formation, and therefore causing low
efficiency of glucose utilization. Controlling the supply of the electron donor of
glucose at the highest rates applied prevented alcoholic fermentation but still
resulted in biomass formation and a high oxygen requirement. Low supply rates of
ethanol resulted in biomass decrease while low supply rates of glucose provided the
most efficient strategy for electron donor provision and yielded a high products.
Therefore low supply rates of ethanol prevented by-product formation and biomass
increase, and resulted in a low oxygen requirement [17]. In 1989, Makino et al. [18]
used glucose dehydrogenase as coenzyme factor regeneration enzyme, because both
NADH and NADPH can be generated by glucose oxidation of glucose dehydro-
genase. All kinds of aldehyde ketone reductase can show the independent cofactor
specificity. The sources of glucose dehydrogenase are extensive and the product of
lactone can be quickly converted to other acids, which can be jointly with the
aldehyde ketone reductase coenzyme regeneration cycle system for large-scale
chiral synthesis. Yasohara et al. [19] constructed a recombinant bacterium with two
genes of aldehyde ketone reductase and glucose dehydrogenase. These two
enzymes coordinated expression of chiral product with 85% of production rate. Ni
Yan et al. coexpressed the aldehyde ketone reductase gene from Bacillus subtilis
and glucose dehydrogenase gene into the same plasmid for preparation of (R)-
CHBE. The final yield was 91.7% [20].
3 Conclusion
References
1. Penning TM (2015) The aldo-keto reductases (AKRs): overview. Chem Biol Interact
234:236–246
2. Ren D, Villeneuve NF, Jiang T et al (2011) Brusatol enhances the efficacy of chemotherapy
by inhibiting the Nrf2-mediated defense mechanism. Proc Natl Acad Sci U S A 108(4):
1433–1438
3. Couture JF, Legrand P, Cantin L et al (2004) Loop relaxation, a mechanism that explains the
reduced specificity of rabbit 20a-hydroxysteroid dehydrogenase, a member of the aldo-keto
reductase superfamily. J Mol Biol 339:89–102
4. Sanli G, Blaber M (2001) Structural assembly of the active site in an aldo-keto reductase by
NADPH cofactor. J Mol Biol 309(5):1209–1218
5. Widboom PF, Fielding EN, Liu Y et al (2007) Structural basis for cofactor-independent
dioxygenation in vancomycin biosynthesis. Nature 447(7142):342–345
Research Progress of Aldehyde Ketone Reductase … 781
Xiu Rong Zhang, Feng Zhen Liu, Kun Zhang and Yong Shan Wan
1 Introduction
Peanut, one of the most important oilseed crops, is grown in more than 100
countries in the world [1, 2]. Cultivated peanut (Arachis hypogaea L.) is a highly
selfing allotetraploid species (2n = 4x = 40, AABB), covering subspecies fastigiata
and hypogaea. The ssp. hypogaea can be divided into two botanical types var.
hypogaea and var. hirsuta, while ssp. fastigiata including four botanical types var.
fastigiata, var. vulgaris, var. peruviana and var. aequatoriana [1, 3]. Furthermore,
many breeding programs in china have developed a lot of varieties or lines with
high yield and quality and strong resistance to environmental stress through cross
breeding between subspecies or different types, known as the “irregular type” in the
world [4]. Compared with other countries, peanut germplasm resources belonging
to irregular type are more abundant in China [4].
Improvement of yield, quality and resistance in peanut is mostly rely on
germplasm resources with distinct characters by breeding ways. However, varieties
or lines, developed from breeding parents with narrow genetic basis, may be
remarkably similar to each other in many aspects [5]. Thus, it is very difficult to
make breakthrough in peanut breeding due to their closely related genetic
relationship. Morphological characters were always used in artificial selection for
millennia, as well as in selection of breeding parents. Most characters of economic
importance, such as yield and quality, are quantitative traits, influenced by
numerous genes that often have individually small effects throughout the genome
[6]. These traits are also susceptible to environment, making breeding and selection
more difficult. Molecular markers evaluate genetic variation on DNA level, pro-
viding reliable evidence for germplasm enhancement [1, 3, 7]. A peanut integrated
consensus map was constructed by Shirasawa [8] in 2013, covering 2651 cM with
3693 marker loci which was anchored to 20 linkage groups corresponding to peanut
genomes. The integrated map supplies valuable data resources to increase the
genetic and genomic understanding and facilitate molecular breeding in peanut [8].
There are two most commonly used tools for dissecting complex quantitative
traits in crops, linkage analysis and association mapping [9]. Linkage analysis has
been always performed with experimental populations which are derived from a
bi-parental cross, and individuals shared inheritance of polymorphisms within
families of known ancestry [10]. Association mapping has been typically conducted
using a collection of individuals often with unobserved ancestry, which is called
association mapping population or natural population [9, 10]. When compared with
linkage analysis, association mapping has many advantages including higher
mapping resolutions, shorter research time and greater number of alleles investi-
gated at the same time [10].
Abundant phenotypic variation and genetic diversity among individuals are
necessary for association mapping. However, the confounding effects of population
structure can lead to spurious results if not controlled during association analysis.
We collected hundreds of peanut germplasm resources including preserved germ-
plasm by our lab and cultivars (lines) supported by other breeding program in
China. Most of the collections were from different areas in China, and the rest were
originally from other countries. A number of phenotypic traits related to agronomy
and quality of all varieties had been identified for many years. Based on phenotypic
data, a collection of 367 peanut germplasm was developed, which represented the
phenotypic variation of all materials. In the present study, genetic variation of the
population was evaluated using a total of 101 SSR and transposable element
(TE) markers from peanut integrated map [8]. The results from genetic diversity and
population structure analysis will provide important information to understand the
peanut genetic variation worldwide and broaden the genetic base of peanut vari-
eties. In addition, it could be used for constructing association mapping population
and doing further marker-trait association analysis.
A total of 367 peanut germplasm resources were used as materials, and the number
of resources for botanical type irregular type, var. hypogaea, var. hirsuta, var.
vulgaris, var. fastigiata and var. aequatoriana is 109, 89, 34, 106, 26 and 3,
respectively (Supplemental file, Table S1).
Population Structure and Genetic Diversity Analysis … 785
Young leaves of all peanut lines were sampled and put in liquid nitrogen imme-
diately for DNA extraction. Total genomic DNA was extracted using the hexadecyl
trimentyl ammonium bromide (CTAB) method as described in previous study [2].
The DNA quality and concentration of each samples were respectively estimated by
1% agarose gel and NanoDrop2000 spectrophotometer (Thermo, USA). Finally, the
DNA concentration was normalized to about 50 ng µl−1 for polymerase chain
reaction (PCR).
A set of 101 molecular markers from peanut integrated map [8] were selected in
our research, distributed on to the 20 linkage groups (Supplemental file, Table S2).
PCR amplification was performed in a total volume of 20 µl comprising of 2 µl
genomic DNA as template, 10 Taq PCR buffer, 0.25 µM of each forward and
reverse primer, 0.2 mM dNTPs and 1.0 U EasyTaq polymerase. Touchdown PCR
was carried out in ABI 2720 Cycler (ABI, USA) using the following protocol:
pre-denaturation at 94 °C for 5 min, followed by denaturation at 94 °C for 45 s,
annealing (from 60 to 50 °C, −0.5 °C for each cycle) for 45 s, and elongation at
72 °C for 45 s, and then 35 cycles of 94 °C for 45 s, 55 °C for 45 s, 72 °C for 45 s
and post-elongation at 72 °C for 7 min.
The PCR products were size separated in non-denaturing polyacryl-amide gel
electrophoresis (PAGE) using 8% (w/v) polyacryl-amide gel at 150 V for 2.5 h in
1 TBE buffer using DYCZ-24B gel rigs (Beijing, China). Based on the expected
product size, the size of the most intensely amplified bands around the expected
product size for each marker was determined using identified concentrations of
standard molecular markers after the bands were visualized by silver staining.
Chain Monte Carlo (MCMC) replications during analysis. The program Structure
Harvester [13] was used to determine the optimal K. Out of the 5 runs for K, the run
with the highest log likelihood value, known as Ln P(D), was selected to assign the
membership coefficients (Q) to each sample. When Q is 0.50 or higher, samples
were clustered to one subpopulation, otherwise they were clustered to mixed
group. Program NTSYSpc v2.20 [14] was used to perform principal component
analysis (PCA) to identify amounts of variance, eigenvectors, and cumulatively
explained variances per component using the Dice coefficient of similarity.
3 Results
In total, the 101 markers produced 503 polymorphic bands. The number of alleles
per locus, ranging from 2 to 15 with an average of 4.98, varied widely among the
markers (Supplemental file, Table S2). The major allele frequency (MAF) varied
from 0.213 to 0.975 with an average of 0.618. The mean value of gene diversity
(GD) was 0.495, ranging from 0.048 to 0.857. The polymorphism information
content (PIC) for all the markers ranged from 0.047 to 0.845 with an average of
0.432 (Supplemental file, Table S2).
Among all the peanut lines, the genetic distance ranged from 0.033 to 0.846 with an
average of 0.470. The largest genetic distance 0.846 was between Qinghua505 from
China and Ganyinxuan1003 from India. Shanhua15 and 98H101 showed the least
genetic distance, as they were both selected from one breeding institute in
Shandong, China. Overall 42% peanut lines had a genetic distance greater than 0.5.
These results indicated that peanut germplasm resources were abundant in genetic
variation.
The UPGMA (unweighted pair group method with arithmetic average) den-
drogram was constructed from DNA marker data based on Nei’1983 genetic dis-
tance. Clustering analysis showed 367 peanut lines were obviously grouped into 2
branches (Fig. 1a), denoted as G1 and G2. G1 contained 119 peanut lines and
grouped into G1a, G1b, G1c and G1d, while G2 contained 248 peanut lines and
grouped into G2a, G2b, G2c and G2d (Fig. 1a). Interestingly, G1b contained 24
peanut lines, of which 3 were var. aequatoriana and 19 were var. fastigiata. G1c
and G1d mainly contained var. vulgaris, and represented peanut varieties from
northern and southern China, respectively. G2a contained 24 var. hirsuta and 47
var. hypogaea. G2b mainly contained var. hypogaea. G2d, the largest group,
Population Structure and Genetic Diversity Analysis … 787
Fig. 1 The UPGMA clustering and population structure. a UPGMA dendrogram based on
Nei’1983 genetic distance, b the changes of likelihood value Ln P(D) against K value, c the
changes of Delta K against K value and d the distribution of sub-populations from population
structure analysis at K = 2 and K = 4
contained 119 peanut lines, 83 of which were irregular type. Therefore, G1 mainly
contained peanut lines from var. fastigiata, var. vulgaris and var. aequatoriana,
while G2 mainly contained peanut lines from var. hypogaea, var. hirsuta and
irregular type. G1 and G2 was in accordance with ssp. fastigiata and ssp. hypogaea,
respectively. The detailed information of each peanut line, classified into each
group (G), was presented in supplemental file Fig. S1.
788 X.R. Zhang et al.
When K was set from 1 to 20, the log likelihood score did not plateau at a single K
value, instead, it continued to increase at relatively constant increments (Fig. 1b). In
this case, Delta K score based on calculation from Structure Harvester [13] was
used to find the optimal K. Figure 1c showed that a sharp peak of Delta K appeared
at K = 2, followed by that at K = 4.
Population structure analysis showed 367 peanut lines were divided into 2
subpopulations at K = 2, designated as P1 and P2 respectively (Fig. 1d). Among
the two groups, P1 contained 124 peanut lines, and P2 contained 243 peanut lines
(the membership coefficients Q to each sample at K = 2 was presented in supple-
mental file Fig. S2). There are 77 var. vulgaris, 27 var. fastigiata and 3 var.
aequatoriana in P1 group, while 100 irregular type, 84 var. hypogaea and 29 var.
hirsuta in P2 group. P1 and P2 was in accordance with ssp. fastigiata and
ssp. hypogaea as the same as G1 and G2. Furthermore, at K = 4, these peanut lines
were classified into 4 groups, named as P1a, P1b, P2a and P2b. P1a contained 83
peanut lines, 69 of which were var. vulgaris mainly from China. P1b contained 34
peanut lines, 27 of which were var. fastigiata, including the 3 var. aequatoriana.
P2a contained 95 peanut lines, 60 of which were var. hypogaea, including other 25
var. hirsuta. P2b contained 131 peanut lines, including mainly irregular type from
China. The detailed membership coefficients Q to each sample at K = 4 was pre-
sented in supplemental file Fig. S3.
Among all the materials, there were six botanical varieties that were classified based
on morphological characters. The distribution frequency of each botanical type
within each group and the frequency of each group within each botanical type were
showed in Fig. 2a, b, respectively. From Fig. 2a, ssp. fastigiata, including var.
fastigiata, var. vulgaris and var. aequatoriana, accounted for 86.44% of G1 group,
while 86.46% as to P1 group. The irregular type accounted for 41.22 and 37.36% of
G2 and P2 group, and ssp. hypogaea (var. hypogaea and var. hirsuta) accounted for
45.71 and 53.85%, respectively. The distribution frequency of each group within
each botanical type showed that 91.30% of the var. hypogaea and 82.35% of the
var. hirsuta were grouped into G2, while 81.43% of the var. hypogaea and 75.59%
of the var. hirsuta were grouped into P2. Most of the var. vulgaris and var. fasti-
giata were grouped into G1 (72.82, 82.76%) and P1 (56.33, 79.31%). The 3 var.
aequatoriana were grouped into G1 and P1. In spite of discrepancies, the popu-
lation structure and genetic clustering is obviously associated with the botanical
types.
Population Structure and Genetic Diversity Analysis … 789
Fig. 2 The distribution frequency of each botanical type within each group (a) and the frequency
of each group within each botanical type (b). Note the botanical types were abbreviated as ir for
irregular type, hy for var. hypogaea, hi for var. hirsuta, fa for var. fastigiata, vu for var. vulgaris
and ae for var. aequatoriana
Fig. 3 Factorial analysis of the peanut lines based on markers. a Clustering related to botanical
type, b clustering related to geographical origin. Note the botanical types were abbreviated as ir for
irregular type, hy for var. hypogaea, hi for var. hirsuta, fa for var. fastigiata, vu for var. vulgaris
and ae for var. aequatoriana. The botanical type and origin of each peanut materials were listed in
Table S1
(Supplemental file, Table S1). Factorial analysis showed that the majority of peanut
lines from South America were clustered on the quadrant “i”, and peanut lines from
North America, Africa and Europe were mostly clustered on the quadrant “ii”
(Fig. 3b). The peanut lines from Asian countries such as China and India were
widely distributed. Took Chinese peanut lines as an example, these varieties from
northern China including Shandong, Henan and Hebei were mainly distributed on
quadrant “iii”, while these varieties from southern China including Guangdong,
Guangxi and Fujian were mainly clustered on quadrant “iv” (Fig. 3b). Therefore,
these results showed that the clustering was closely related to geographical origin.
Population Structure and Genetic Diversity Analysis … 791
The cultivated peanut is divided into two subspecies, ssp. fastigiata and ssp. hy-
pogaea, including different botanical types. There were six botanical types using in
the present study. For one thing, the ssp. fastigiata (var. fastigiata, var. vulgaris and
var. aequatoriana) accounted for more than 80% cumulatively of both G1 and P1
group, and factorial analysis confirmed the results as most of the ssp. fastigiata
were clustered on quadrant “I” and “IV”. Besides, over 80% of the var. hypogaea
and var. hirsuta were grouped into G2 and P2 group, which was in accordance with
factorial analysis that those peanut lines were clustered on quadrant “II”. Those
results were consistent with previous studies [1, 15].
There are obvious phenotypic and genetic differences among peanut lines from
different areas due to geographical location, climate, natural and artificial selection
[6]. Those germplasm from other countries were mostly clustered on quadrant “i”
and “ii”, while germplasm from China were mainly clustered on quadrant “iii” and
“iv”. Those results were also consistent with previous studies [1]. Among the tested
materials, more than 70% of peanut lines were from China, including local vari-
eties, market types and other breeding lines (Supplemental file, Table S1). Those
varieties from northern and southern China were clustered into different groups
based on UPGMA and factorial analysis, indicating that peanut varieties from
different regions showed obvious ecological adaptability on genetic level [16, 17].
Compared with other crops, molecular marker techniques in peanut is devel-
oping slowly. There is a long way to go on molecular breeding, while conventional
cross-breeding is still the main method at present. Breeding parents with obvious
genetic background difference within a certain range are more likely to generate an
elite variety in the cross-breeding program. Therefore, understanding of genetic
relationship is critically important for crop improvement [18]. In the present study,
analysis showed that 42% of peanut lines had a genetic distance greater than 0.5,
indicating that variation were abundant on genetic level. Genetic distance between
Chinese and some foreign peanut lines or between subspecies were larger than
others. Thus, it is essential to choose breeding parents with larger genetic distance
from different countries, subspecies or types to conduct cross-breeding programs in
peanut.
The power of association mapping relies on a large population of individuals
with abundant phenotypic and genetic variation. From our study, the 101 molecular
markers produced 503 alleles, and the mean values of GD and PIC were 0.495 and
0.432, which were much higher than a previous study by Ren et al. [16] but similar
to a recent study by Wang [1]. The results suggested that the 367 peanut lines were
rich in genetic variation with a higher level of allelic diversity. However, there were
still some varieties found to be extremely similar in both phenotypic and genetic
characters. In order to perform marker-trait association analysis, the natural popu-
lation maybe need to be further optimized. Furthermore, clustering results from
UPGMA, population structure and PCA showed the peanut lines grouped into
792 X.R. Zhang et al.
Acknowledgements We would like to thank Oil Crops Research Institute of the Chinese
Academy of Agricultural Sciences, Hebei Agricultural University, Hebei Academy of Agriculture
and Forestry Sciences, Henan Academy of Agricultural Sciences and Shandong Peanut Research
Institute for providing valuable peanut germplasm resources. This research was supported by the
earmarked fund for China Agriculture Research System (CARS-14), the Peanut Seed Industry
Project in Shandong province of China, and the earmarked fund for Agriculture Research System
in Shandong province of China (SDAIT-04-03).
References
Jun Yu, Lin Zhao, Song Li, Xin Sun and Xin-li Liu
1 Introduction
Jun Yu, Lin Zhao and Song Li are contributed equally to this paper.
Bacillus lincheniformis was kept at our laboratory and used for the fermentation of
c-PGA. Fresh waste beer yeast (moisture content 50%) was provided by
China-Germany Brewing Technical Center of Qilu University of Technology. The
fermentation medium for B. lincheniformis is PP medium (10.0 g glucose, 10.0 g
yeast powder, 5.0 g peptone, 10.0 g sodium glutamate, 1.0 g K2HPO4, 0.5 g
MgSO47H2O, diluted to a constant volume of 1 L with deionized water, adjusted
pH to 7.2 with 1 mol/L NaOH, sterilized at 115 °C for 20 min).
2.2 Fermentation
Related enzymes, dextranase (10,000 l/g), cellulose (40,000 l/g) and complex
protease were bought from Ji’nan De-Ke Bio-Tech Co., Ltd., alkaline protease
(400,000 l/g) and papain (800,000 l/g) were bought from Nan’ning Doing-Higher
Bio-Tech Co., Ltd. Other reagents were analytical pure. Raw materials used in the
fermentator were industrial grade or above.
The waste beer yeast was sieved and washed with water to remove the impurities
and residual alcohol, and then the yeast paste was washed with 0.5% sodium
hydrogen carbonate solution for 30 min to remove the bitterness. The treated yeast
paste was prepared to yeast cream at a concentration of 10%, and a pH value of 7.0.
First, the accelerant dosage experiment was performed. Yeast autolysis is an
enzymatic reaction process, and a plasmolysis process. It is reported that sodium
chloride, ethanol, ethyl acetate, toluene and other substances can be useful in
promoting the autolysis of yeast, among them, sodium chloride is the most safe and
Research on c-Polyglutamic Acid Fermentation … 797
economic promoter [6]. Sodium chloride dosage was optimized to determine the
optimum dosage. The autolysis conditions were listed as follows: 55 °C, 24 h.
Then, the external enzyme dosage experiment was performed. By external
enzyme addition, it was available to shorten the time of yeast autolysis and improve
the rate of yeast autolysis. We studied independent or compound application of
dextranase, cellulose, papain, alkaline protease and complex protease, as well as the
effect of such application approaches on the yield of yeast extract solids content. The
dosage was 2‰, the enzymolysis conditions were listed as follows: 55 °C, 24 h.
After the optimal enzyme preparation was determined, the enzymolysis tem-
perature and dosage of enzyme preparation were optimized. The experiment was
conducted at 45, 50, 55, 60, and 65 °C respectively. The experimental dosage was
set to 1, 2, 3, 4 and 5‰.
The impact of yeast extract dosage on c-PGA production was studied with the
extract prepared in Sect. 2.4. The experiment contained five groups at a dosage of
0, 2.5, 5, 7.5 and 10% respectively.
Experiments above were repeated three times. After autolysis and enzymatic
hydrolysis, the hydrolysate was centrifuged at 10,000 rpm for 10 min. Then the
supernatant was removed, the solution was heated and dried at 110 °C until constant
weight [7]. After fermentation, 100 mL of fermentation broth was taken, three times
the volume of fermentation broth (300 mL) of absolute ethyl alcohol was added, and
stirred evenly. The liquid was centrifuged at 3000 rpm for 5 min. After the super-
natant was removed, the white precipitate was PGA crude extract [8]. The precipitate
was dried at 65 °C until constant weight, and the yield of PGA was calculated finally.
Sodium chloride could affect the autolysis. The yields of soluble solids increased by
18.49, 20.64, 28.79, 29.21 and 13.36% with different sodium chloride addition (as
shown in Fig. 1). Meanwhile, the soluble solids yield of 4% and 5% conditions
798 J. Yu et al.
40
20
10
%)
(
0
0 1 2 3 4 5
Sodium chloride dosage (%)
Fig. 1 Impact of sodium chloride dosage on the yield of the soluble solids of yeast extract
50
Soluble solids yield (%)
40
30
20
0 1 2 3 4 5 6
Enzymes
Fig. 2 Enzymes addition effect on yeast autolysis. 0 3.0% NaCl, 1 3.0% NaCl + dextranase, 2
3.0% NaCl + cellulose, 3 3.0% NaCl + dextranase +papain, 4 3.0% NaCl + dextranase + alkaline
protease, 5 3.0% NaCl + dextranase + complex protease and 6 dextranase + papain + alkaline
protease + complex protease
were lower than 3% condition, which meant that the high concentration could
inhibit the activity of enzymes in vivo [9]. Therefore, 3% sodium chloride was
chosen for autolysis in follow-up experiments (Fig. 2).
Yeast cell wall was mainly composed of dextran and cellulose [10]. When the
dextranase and cellulase were added, the soluble solid yields increased by 9.22 and
Research on c-Polyglutamic Acid Fermentation … 799
3.63% than control. Furthermore, the complex protease showed significant effect,
but the compound application of three proteases did not significantly improve the
yield of solids, which may be due to the interaction of enzymatic reactions.
According to the above results, the yield of soluble solid of yeast extract could be
effectively improved by adding dextranase and complex protease.
Fig. 3 Temperature 50
optimization of complex
protease
Soluble solids yield (%)
40
30
20
45 50 55 60 65
Temperature ( )
40
30
1 2 3 4 5
Addition amount (‰)
800 J. Yu et al.
10
0
0.0 2.5 5.0 7.5 10.0
YE addition amount (%)
It can be seen from Fig. 5 that the yeast extract could significantly improve the
yield of c-PGA, and the second highest yield of 18.69 g/L was obtained at the
dosage of 7.5%. Continuing to increase extract dosage contributed a minor
improvement of 6.31%, indicating that the yeast extract had become almost satu-
rated due to culture conditions, strain productivity and other factors. In this paper,
7.5% was chosen for the optimum dosage of yeast extract for cost considerations.
4 Conclusions
In this paper, the feasibility of c-PGA fermentation with yeast extract from waste
beer yeast was investigated and composite method for preparation of yeast extract
from waste beer yeast was constructed. The optimized condition was: 24-hours
autolysis at 55 °C with 2% NaCl, 2‰ dextranase and 3‰ complex protease
addition, the highest extracting yield reached 48.64% (w/w). Then the yeast extract
was employed into c-PGA fermentation process, and the c-PGA yield increased
greatly by 290% from 4.8 to 18.69 g/L, with adding 7.5% waste beer yeast extract.
These results showed a significant valuable for industrial applications of c-PGA.
Acknowledgements The work was financially supported by Shandong Provincial Key Research
and Development Program (No. 2015ZDZX05001, 2015ZDXX0502B01, 2015ZDXX0403B01,
2016GGX107003), National Natural Science Foundation (No. 31501396), Shandong Provincial
Natural Science Foundation (No. ZR2012CQ027).
Research on c-Polyglutamic Acid Fermentation … 801
References
Wenyuan Sun, Yanli Fan, Jing Li, Gaoshaer Kayierhali, Xuejiao Liu,
Yun Hao, Yirong Hou, Yajian Song and Tongcun Zhang
1 Introduction
Lactic acid bacteria (LAB), which are a group of bacteria found as gastrointestinal
symbionts in humans and animals, are recognized as probiotics. These bacteria are
also found in fermented foods as the prime fermenting microorganism [1]. The
concept of the LAB as a group of organisms developed at the beginning of the
1900s, preceded by pioneering scientific and technical developments during the
latter part of the 19th century [2]. LAB are commonly thought to be having
health-promoting effects on human [3]. Currently, this group comprises the fol-
lowing genera: Carnobacterium, Enterococcus, Lactobacillus, Lactococcus,
Leuconostoc, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus,
Vagococcus and Weissella [4]. They can be found in different habitats such as soil,
water, animal and human gastrointestinal tract, as well as in food and fermented
products [5].
Probiotics are live microorganisms which confer a health benefit on the host
when administered in adequate amounts. Most probiotics are from LAB and other
genera such as Bacillus [6]. The health benefits they displaying includes: maintain
the microbial balance of intestinal microflora, improve product flavor, promote the
maturity of fermented products, improve nutrient utilization, promote nutrient
absorption, control of endotoxin, lower cholesterol and et al. [7]. Probiotics can be
consumed directly as part of a dietary supplement or as a component of a
health-promoting food [8]. They are usually available as culture concentrates in
dried or deep-freeze form to be added to a food for industrial or home uses [9].
In recent years, the health effects of probiotics attracted more and more atten-
tions of domestic and foreign scholars. Numerous researches about LAB diversity
of dairy products in Inner Mongolia Autonomous Region, Xinjiang Uygur
Autonomous Region and other places have been investigated. Xinyuan County in
Yili Kazakh Autonomous Prefecture, Xinjiang Uygur Autonomous Region, China
is one of the main regions inhabited by Kazakh people. So far, LAB in the tradi-
tional dairy products of this region has not been studied. In this study, we collected
dairy samples from this region and studied its biodiversity by isolating and iden-
tifying the bacteria in the samples.
All samples used in this study were collected from Kazak herdsman families of
Xinyuan County, Yili Kazakh Autonomous Prefecture, Xinjiang Uygur
Autonomous Region, China. These samples are all dairy products including ghee,
dry yogurt, butter, yogurt milk cheese and red knots made by traditional methods.
All the samples were immediately transported to the laboratory by vacuum pack-
aging after collection and preserved at 4 degree to ensure the freshness of the
samples.
0.1 g sample was taken and diluted gradually by normal saline. The dilutions were
plated onto Man Rogosa and Sharp (MRS) agar (Beijing AoBoXing Bio-Tech Co.
Ltd, China). Isolates were picked based on colony morphology and purified by
successive streak plate method. The strains were cultivated in MRS liquid medium
and collected in mid-logarithmic phase. 20% glycerol was used to preserve the
culture and the mixture was stored at −80 °C for further analysis.
The genomic DNA of the LAB was extracted using DNA Extraction Kit (Axygen,
Hangzhou, China) following the manufacture’s protocol. The quality of the product
was determined by electrophoresis in 1.5% agarose gel with 1 TAE (40 mM
Tris-acetate, 1 mM EDTA, pH 8.0) at 130 V. The 16SrDNA gene was amplified by
Isolation and 16SrDNA Identification … 805
the universal prime pairs 27F and 1492R and using genome as template [10]. The
quality of PCR product was determined by gel electrophoresis.
We collected 6 samples from Kazak herdsman families. Ghee from two different
families was labeled as A1 and A2 respectively. Dry yogurt, butter, yogurt milk
cheese and red knots were labeled as B1, C1, D1, E1 respectively. After separation
and purification, 22 strains were isolated according to the colonial morphology.
16SrDNA genes of all the strains isolated were successfully amplified and
sequenced. The alignment of the sequences with Genbank database was conducted
using the BLAST algorithm. 22 strains were identified and belong to 5 genera
including Lactobacillus, Enterococcus, Leuconostoc, Acetobacter, and Bacillus.
Strains in Lactobacillus are clarified into 2 species, Lactobacillus casei and
Lactobacillus plantarum. Strains in Enterococcus also belong to 2 species,
806 W. Sun et al.
0.10
Enterococcus faecalis and Enterococcus faecium. Each other genera contains only
one species, and they were Acetobacter orientalis, Bacillus licheniformis, and
Leuconostoc mesenteroides. Phylogenetic relationship of the 22 strains was con-
structed by Neighbor-joining analysis as shown in Fig. 1. All the strains are LAB
except Bacillus licheniformis and Acetobacter orientalis. No pathogenic bacterium
was detected in the samples.
All the samples in this study were found to contain two or more strains (Table 1).
The isolation strains from two ghee sample A1 and A2 showed dramatic difference.
It indicated that the environment of different family influence the microorganism
composition even though the process method was identical. There are 6 different
strains found in dry yogurt sample identified as E. faecalis, as is likely to be related
to the special process method and flavor of dry yogurt. L. plantarum and
Isolation and 16SrDNA Identification … 807
A. orientalis are the most widespread strains, which could be found in three dif-
ferent kinds of dairy products. L. plantarum was isolated in ghee, butter, and yogurt
milk cheese, while A. orientalis was isolated from butter, yogurt milk cheese and
red knots. The results above demonstrated that the traditional dairy products
exhibited good biodiversity and the microorganism composition was dramatically
influence by environment and process method.
6 LAB were selected to test the bile salt and acid tolerance, including L. plantarum
A1-3-15 and C1-2-5, E. faecalis B1-1-1, and B1-1-5, and B. licheniformis A1-1-1
and B1-1-7. Cell viability of the strains was determined by MTT method after
treating by 0.3% bile salt as well as under pH 3.0. L. plantarum A1-3-15 and
C1-2-5 were found to have better bile salt tolerance than other strains (Fig. 2a).
L. plantarum A1-3-15 also showed good acid tolerance (Fig. 2b). It was suggested
that this strain is likely to have good viability in human digestive tract, and is a
candidate probiotic to be further studied.
808 W. Sun et al.
Fig. 2 Viability of 6 LAB after treated by 0.3% bile salt (a) and pH 3.0 (b)
4 Conclusion
References
9. Tripathi MK, Giri SK (2014) Probiotic functional foods: Survival of probiotics during
processing and storage. J Funct Foods 9:225–241
10. Tongjie L, Yun L et al (2016) Prevalence and diversity of lactic acid bacteria in Chinese
traditional sourdough revealed by culture dependent and pyrosequencing approaches.
J LWT-Food Sci Technol 68:91–97
11. Katrolia P, Jia H et al (2012) Characterization of a protease-resistant a-galactosidase from the
thermophilic fungus Rhizomucor miehei and its application in removal of raffinose family
oligosaccharides. J Bioresour Technol 110:578–586
12. Muñoz-Atienzaa E, Araújo C et al (2015) Different impact of heat-inactivated and viable
lactic acid bacteria of aquatic origin on turbot (Scophthalmus maximus L.) head-kidney
leucocytes. J Fish Shellfish Immun 44:214–223
Research on Extracting Technology
of Chlorogenic Acid from Honeysuckle
Honeysuckle, the flower of Lonicera japonica Thunb with sweet flavor and cold
nature, is commonly used as traditional Chinese medicine and tea beverage [1]. It
has effects of antifebrile and detoxifcation, anti-bacteria and dephlogisticate,
detumescence, liver protection and cholagogue and so on. Honeysuckle is widely
distributed in China and as a kind of both food and medicinal plants, it has a long
medicinal history and it is one of the 60 kinds of Chinese herbal medicines and the
first batch issued by national ministry of health [2]. Its chemical composition
contains chlorogenic acid, isochlorogenic acid, flavonoid compounds, linalool and
so on.
Chlorogetic acid is recognized as the “gold plant” [3, 4] because of its main
active ingredient in honeysuckle. Chlorogetic acid is styrene acrylic class of sec-
ondary metabolites produced in shikimic acid pathway of aerobic respiration pro-
cess. Its molecular structure contains three instable parts, including ester bond,
unsaturated double bond and polyphenol. The pharmacological functions of
chlorogetic acid have been studied extensively. Potentially beneficial properties to
human such as antimicrobial, anti-inflammatory, antioxidant and anticancer have
been received more and more attention [5]. Li et al. [6] reported that chlorogetic
acid could reduce blood pressure acutely, which would benefit cardiovascular
health. Because of these functions, chlorogetic acid has been recorded officially in
the National Pharmacopoeia of China, and which is widely applied to food, med-
icine, cosmetics and other industries [3, 7].
A series of methods have been reported for the extraction bioactive chlorogetic
acid from plant materials, such as water extraction [8], ethanol refluxing method
[9]. As two traditional methods for the extraction of chlorogenic acid, they take
long time and the extraction rate of chlorogenic acid is lower. According to the
The 7.5 mg Chlorogenic acid standard was dissolved in the capacity of 25 mL and
then 1, 1.5, 2, 2.5, 3 mL were accurately quantified to placed in capacity of 10 mL.
Chlorogenic acid standard was determinated by using UV-visible spectropho-
tometer at the wavelength of 328 nm. Standard curve of chlorogenic acid was drew
using absorbance (Y) as the vertical coordinate and the mass concentration (X,
lg/mL) as the horizontal coordinate, the curve equation was Y = 00651X + 0.0045,
R2 = 0.9998.
Research on Extracting Technology … 813
(1) Study on the dosage of enzyme Honeysuckle was 2 g, solid-liquid ratio was
1:50 (g/mL), the dosage of enzyme were 0, 0.5, 1, 1.5, 2% respectively
(proportion of raw materials), Enzymatic hydrolysis temperature was 45 °C,
Enzymatic hydrolysis time was 90 min, Enzymatic hydrolysis pH was 4, the
extraction rates were 2.01, 3.59, 3.51, 3.43, 3.4% respectively. It showed that
with the increase of the dosage of enzyme, the extraction rate of the chloro-
genic acid increased gradually in Fig. 1, when the dosage of enzyme increased
to 0.5%, the extraction yield of the chlorogenic acid decreased slightly.
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.0 0.5 1.0 1.5 2.0
Dosage of enzyme (%)
814 Y. Sun et al.
3.8
3.6
3.4
3.2
3.0
30 35 40 45 50 55
Enzyme temperature ( )
Research on Extracting Technology … 815
3.5
3.0
2.5
2.0
1.5
1.0
0.0 0.5 1.0 1.5 2.0
Dossage of enzyme (%)
3.6
3.4
3.2
3.0
2 3 4 5 6
enzymatic hydrolysis pH
different affinity between enzyme and substrate, which lead to different cat-
alytic rate. With the increasing of pH, the extraction rate of chlorogenic acid
was increasing, and when it was 4, the extraction yield of chlorogenic acid
reached the maximum and the extraction rate was decreased.
The round-bottom flask containing 2 g dried material and certain solvent were
placed in oil bath, and the dispersion tool was put in the solvent at the same time.
When the extraction was ended, the extraction solvent was filtered through a
filtration net into the collection pot and concentrated liquid was added to 15 mL,
816 Y. Sun et al.
and then according to the method of 2.2, the extraction rate of chlorogenic acid was
calculated.
On the basis of single factor investigation, Enzyme dosage (A), enzymatic
hydrolysis temperature (B), enzymatic hydrolysis time (C), and pH (D) were used
as the factors of investigation, the extraction rate of chlorogenic acid was used as an
index of investigation and orthogonal experiment table (L9(34)) was designed to
carry out the experiment. The factor levels were shown in Table 1, orthogonal
experimental results were shown in Table 2, the results of analysis of variance were
shown in Table 3.
Significant test: variance analysis showed that factor B was highly significant,
factors A and D were significant, factors C was not significant, influence order of
each factor on the experimental indexes was BDAC. The Optimal conditions were
A1B3C3D3.
Verification tests: according to the orthogonal experiment, the optimal process
conditions were repeated for 3 times. When the solid-liquid ratio was 1:50 (g/mL),
the enzyme hydrolysis temperature was 50 °C, the enzymatic hydrolysis pH was 5,
the dosage of enzyme was 0.5%, the time of enzymatic hydrolysis was 120 min, the
extraction rate of chlorogenic acid reached 4.75%.
6.0
5.8
5.6
40 60 80 100 120
Ultrasonic time (min)
818 Y. Sun et al.
6.0
5.9
200 240 280 320 360 400
Ultrasonic power (W)
5.8
5.6
5.4
40 50 60 70 80 90 100
Ethanol concentration (%)
6.2
6.0
5.8
5.6
1:20 1:30 1:40 1:50 1:60
Solid- liquid ratio (g/ml)
The round-bottom flask containing 2 g dried material and certain solvent were
placed in oil bath, and the dispersion tool was put in the solvent at the same time.
When extraction process ended, the extraction solvent was filtered through a fil-
tration net into the collection pot and concentrated liquid was added to 15 mL, and
then according to the method of 2.2, the extraction rate of chlorogenic acid was
calculated.
On the basis of single factor investigation, ultrasonic time (A), ultrasonic power
(B), ethanol concentration (C), and solid-liquid ratio (D) were used as the factors of
investigation, extraction yield of chlorogenic acid was used as an index of inves-
tigation and orthogonal experiment table (L9(34)) was designed to carry out the
experiment. The factor levels were shown in Table 4, orthogonal experimental
820 Y. Sun et al.
results were shown in Table 5, the results of analysis of variance were shown in
Table 6.
Significant test: variance analysis showed that factor B was highly significant,
factors A, C, D were not significant, the order of influence of each factor on the
experimental indexes was BACD. The Optimal conditions are A3B2C3D1.
Verification tests: according to the orthogonal experiment, the optimal process
conditions were repeated for 3 times. When ultrasonic temperature was 40 °C,
ultrasonic power was 280 W, ultrasonic time was 80 min, ethanol concentration
was 70%, ultrasonic solid- liquid ratio was 1:30 (g/mL), and under this condition,
the extraction rate of chlorogenic acid reached 6.26%.
Research on Extracting Technology … 821
3 Conclusions
References
1. Xiang Z, Ning Z (2008) Scavenging and antioxidant properties of compound derived from
chlorogenic acid in South-China honeysuckle. LWT-Food Sci Technol 41(7):1189–1203
2. Li M, Wang YX, Meng J (2014) Determination of eight components in Lonicerae Japonicae
Flos by HPLC. China Tradit Herb Drugs 45(7):1006–1010
3. Marques V, Farah A (2009) Chlorogenic acids and related compounds in medicinal plants and
infusions. Food Chem 113(4):1370–1376
4. Du YB, Qian AY (2006) Bioactivity, resources, extraction and purification of chlorogenic
acid. Mod Food Sci Technol 22(2):250–252
5. Seo ON, Kim GS, Park S et al (2012) Determination of polyphenol components of Lonicera
japonica Thunb. using liquid chromatography–tandem mass spectrometry: contribution to the
overall antioxidant activity. Food Chem 134(1):572–577
6. Li J, Jin S, Zu YG et al (2014) Rapid preparative extraction and determination of major
organic acids in honeysuckle (Lonicera japonica Thunb.) tea. J Food Compos Anal 33
(2):139–145
7. Saleh IA, Vinatoru M, Mason TJ et al (2016) A possible general mechanism for
ultrasound-assisted extraction (UAE) suggested from the results of UAE of chlorogenic acid
from Cynara scolymus L. (artichoke) leaves. Ultrason Sonochem 31:330–336
8. Zheng XQ, Jiang JF, Liu X et al (2006) Extraction of chlorogenic acid from sunflower seeds
by water solution and alcohol sedimentation. Food Sci 27(1):159–161
9. Wu L, Zhang ZS (2005) Extraction and examination of chlorogenic acid from Flos Lonicerae.
Food Sci 26(6):130–134
10. Xu WJ, Zhai JW, Cui Q et al (2016) Ultra-turrax based ultrasound-assisted extraction of five
organic acids from honeysuckle (Lonicera japonica Thunb.) and optimization of extraction
process. Sep Purif Technol 166:73–82
11. Li AM, Yao YZ, Guo Y et al (2013) Optimization of ultrasonic-assisted extraction process of
chlorogenic acid from Sambucus chinensis Lindl. Leaves. Sci Technol Food Ind 31(6):15–19
12. Chen YS, Li ZG, Dong JG (2008) Study on extraction process of sunflower meal by enzyme
treatment. Food Sci 29(2):202–204
13. Cao Y, Li CJ, Xia ZN (2008) Optimization of ultrasound extraction technology of chlorogenic
acid in Flos Lonicerae. Lishizhen Med Mat Med Res 19(12):2857–2858
14. Fu SL, Zhong JP, Li HX et al (2007) Study on extracting process of chlorogenic acid from
Flos Lonicerae. J Guangdong Ocean Univ 27(4):70–73
Construction and Functional Analysis
of Luciferase Reporter Plasmid
Containing Vimentin Gene Promoter
Cheng-Xi Yu, Yuan Xiang, Xing-Hua Liao, Xiao-Yu Zhang, Hui Li,
Jia-Peng Li and Tong-Cun Zhang
1 Introduction
Breast cancer is the most common malignancy of women [1]. The major cause of
death from breast cancer is due to metastases that are resistant to conventional
therapies [2]. Tumor metastasis is a multi-step, multi-stage, multi-channel complex
process involving multiple gene variations. The Epithelial to mesenchymal
transition (EMT) process, in which epithelial cells are converted into mesenchymal
cell, is frequently activated during cell invasion and migration, and facilitates
metastasis in multiple carcinoma types [3]. Vimentin is an important marker gene for
mesenchymal cell. It was discovered that abnormal expression or abnormal activa-
tion of certain related proteins during the occurrence and metastasis of cancer [4].
It is reported that the persistent activation of signal transducer and activator of
transcription 3 (STAT3) in prostate cancer [5]. And STAT3-expressing cells had
decreased E-Cardherin levels, and enhanced migratory capacities compared to
control-expressing cells [6]. STAT3 convey signal from numerous cytokines and
growth factors to the nucleus. The expression and activity have been shown to be
perturbed in a variety of malignancies including breast cancer [7].
The myocardin protein family, myocardin-related transcription factor MRTF-A
is co-activators of serum response factor (SRF). MRTF-A bind to SRF and strongly
activate transcription from promoter by binding to serum response element (SRES),
also known as CArG box, in their promoter [8]. It is reported that the Rho-A
pathway appears to activate MRTF-A by altering MRTF-A binding to actin and
causing MRTF-A translocation from cytoplasm to the nucleus [9]. Previously
C.-X. Yu Y. Xiang X.-H. Liao (&) X.-Y. Zhang H. Li J.-P. Li T.-C. Zhang (&)
Institute of Biology and Medicine, Wuhan University of Science and Technology,
Wuhan 430081, China
e-mail: [email protected]
T.-C. Zhang
e-mail: [email protected]
reported MRTF-A play dual roles in EMT, direct regulation of slug transcription
and reorganization of actin cytoskeleton [10].
In this study, it is our objective whether MRTF-A and STAT3 have interaction in
the regulation of EMT during breast cancer [11]. The Vimentin promoter was
amplificated from human genome by PCR and inserted into pGL-3 basic vector
(luciferase vector). Furthermore, luciferase assays were performed in MDA-MB-231
cells.
Human breast cancer cell line MDA-MB-231 was obtained from Boster
Immunoleader. MDA-MB-231 cells were cultured in Dulbecco’s modified Eagle’s
medium (GIEMO) containing 10% fetal bovine serum (FBS) and incubated in a 5%
CO2 incubator at 37 °C.
The human genome was extracted from MDA-MB-231 cells. The Vimentin pro-
moter fragment (−326 to +83) was PCR amplified by the following primer:
F: 5′-CGGGGTACCCATTTGTGTTACATAATTG-3′
R: 5′-GGCGAGCTCTTTTAATAACTCGCTAAAGC-3′
PCR conditions are as follows: 95 °C pre-denaturation 5 min, 95 °C denatura-
tion 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 2 min. The PCR
reaction was carried out for 30 cycles, and the amplification product was subjected
to 1% agarose gel stained with ethidium bromide under UV lamp. PCR products
and pGL3-Basic vector were digested with restriction endonucleases KpnI and XhoI
at 37 °C for 1 h. The PCR product was mixed with the pGL3-Basic vector plasmid
with 2 ll of T4 ligase buffer and 1 ll of T4 DNA ligase, and water was added to
20 ll. Incubated at 16 °C for 2 h and then transformed into E. coli cells.
Monoclonal colonies were isolated and cultured in 3 ml of LB medium containing
ampicillin and incubated overnight at 37 °C. Plasmids were extracted using the
plasmid kit (Axygene) according to the manufacturer’s instructions and sequenced.
2.3 Transfection
3 Results
4 Discussion
Previous studies found that Vimentin was closely related to breast tumor migration
[12]. Vimentin is known as an important marker gene for epithelial-mesenchymal
transition (EMT). EMT is a key process that occurs during embryonic development
and fibrosis and tumor development [13]. Myocardin related transcription factor A
(MRTF-A), belongs to the MRTF family member, also known as MKL1, has been
Construction and Functional Analysis … 827
References
1. Colditz GA, Bohlke K (2014) Priorities for the primary prevention of breast cancer. CA
Cancer J Clin 64:186–194
2. Zhang XH-F, Giuliano M, Trivedi MV, Schiff R, Osborne K (2013) Metastasis dormancy in
estrogen receptor-positive breast cancer. Clin Cancer Res: Off J Am Assoc Cancer Res 19
(23). doi:10.1158/1078-0432
3. Chaffer CL, Brennan JP, Slavin JL, Blick T, Thompson EW, Williams ED (2006)
Mesenchymal-to-epithelial transition facilitates bladder cancer metastasis: role of fibroblast
growth factor receptor-2. Cancer Res 66(23):11271–11278
4. Vuoriluoto K, Haugen H, Kiviluoto S, Mpindi JP, Nevo J, Gjerdrum C, Tiron C, Lorens JB,
Ivaska J (2011) Vimentin regulates EMT induction by Slug and oncogenic H-Ras and
migration by governing Axl expression in breast cancer. Oncogene 30(12):1436–1448
5. Lee HT, Xue J, Chou PC, Zhou A, Yang P, Conrad CA, Huang S (2015) Stat3 orchestrates
interaction between endothelial and tumor cells and inhibition of Stat3 suppresses brain
metastasis of breast cancer cells. Oncotarget 6(12):10016–10029
6. Ko HS, Choi SK, Kang HK, Kim HS, Jeon JH, Park IY, Shin JC (2013) Oncostatin M
stimulates cell migration and proliferation by down-regulating E-cadherin in HTR8/SV neo
cell line through STAT3 activation. Reprod Biol Endocrinol RB&E, 11, 93
7. Klampfer L (2008) The role of signal transducers and activators of transcription in colon
cancer. Front Biosci 1(13):2888–2899
8. Li S, Chang S, Qi X, Richardson JA, Olson EN (2006) Requirement of a myocardin-related
transcription factor for development of mammary myoepithelial cells. Mol Cell Biol 26
(15):5797–5808
9. Ni J, Dong Z, Han W, Kondrikov D, Su Y (2013) The Role of RhoA and cytoskeleton in
myofibroblast transformation in hyperoxic lung fibrosis. Free Radical Biol Med 0:26–39
10. O’Connor JW, Gomez EW (2013) Cell adhesion and shape regulate TGF-Beta1-induced
epithelial-myofibroblast transition via MRTF-A signaling. PLoS One 8(12):e83188
11. Liao XH, Wang N, Liu LY, Zheng L, Xing WJ, Zhao DW, Sun XG, Hu P, Dong J, Zhang TC
(2014) MRTF-A and STAT3 synergistically promote breast cancer cell migration. Cell Signal
26(11):2370–2380
12. Lehtinen L, Ketola K, Mäkelä R, Mpindi J-P, Viitala M, Kallioniemi O, Iljin K (2013)
High-throughput RNAi screening for novel modulators of vimentin expression identifies
MTHFD2 as a regulator of breast cancer cell migration and invasion. Oncotarget 4(1):48–63
13. Wang Y, Zhou BP (2011) Epithelial-mesenchymal transition in breast cancer progression and
metastasis. Chin J Cancer 30(9):603–611
14. Morita T, Mayanagi T, Sobue K (2007) Dual roles of myocardin-related transcription factors
in epithelial–mesenchymal transition via slug induction and actin remodeling. J Cell Biol 179
(5):1027–1042
15. Lamouille S, Xu J, Derynck R (2014) Molecular mechanisms of epithelial–mesenchymal
transition. Nat Rev Mol Cell Biol 15(3):178–196
STAT5A and MKL-1 Activate the Activity
of Luciferase Reporter Plasmid
Containing FOXP3 Gene Promoter
Jia-Peng Li, Hui Li, Xiao-Yu Zhang, Cheng-Xi Yu, Yuan Xiang,
Ze Yin, Xing-Hua Liao and Tong-Cun Zhang
1 Introduction
J.-P. Li (&) H. Li X.-Y. Zhang C.-X. Yu Y. Xiang Z. Yin X.-H. Liao (&)
T.-C. Zhang (&)
Institute of Biology and Medicine, Wuhan University of Science and Technology,
No. 2 Huangjiahu, Wuhan 430065, China
e-mail: [email protected]
X.-H. Liao
e-mail: [email protected]
T.-C. Zhang
e-mail: [email protected]
Human renal epithelial cell line 293T was obtained from American Type Culture
Collection. 293T cells were cultured in Dulbecco’s modified Eagle’s medium
(DMEM) (GIBCO) supplemented with 10% fetal bovine serum (FBS) at 37 °C in
an atmosphere of 5% CO2 incubator.
The human genome was extracted from 293T cells. The cDNA was obtained by
reverse transcription used RNA extracted from Jurkat cell line. FOXP3 promoter
fragment from −1847 to +10 bp is amplified by PCR using the primers (F: 5′-
CCTAGCTAGCCACACCCAAGCCATTTTTGG-3′; R: 5′-GCATCTCGAGCTC
GAGTAGTCCAGCAGCTGATAA-3′), PCR condition is as follows:
pre-degeneration for 5 min at 95 °C, denaturation for 1 min at 95 °C, annealing for
30 s at 55 °C, and extension for 2 min at 72 °C. PCR reaction was carried out for
32 cycles and PCR product was visualized in 1% agarose gels stained with ethidium
bromide under UV transillumination.
STAT5A and MKL-1 Activate the Activity of Luciferase … 831
2.3 Transfection
293T cells at logarithmic phase were seeded in 24-well plates at the density of
1 105 cells/well in an atmosphere of 5% CO2 at 37 °C. The 60–70% confluent
293T cells were cotransfected with 1 µg of total plasmid containing 0.2 lg foxp3
promoter luciferase reporter plasmid and MKL-1 or/and STAT5A expression
plasmids or control plasmids (pcDNA3.1) using TurboFect reagent (Fermentas)
according to the instructions of the manufacturer. Mainly, the overexpression vector
plasmid pcDNA3.1 was added to make sure that every group had a same quality of
total plasmid, 1 lg total plasmids were added into 2 µL Turbo reagents, and, and
then added to the medium without serum. incubated for 20 min. After transfection
for 6 h, the medium without serum were replaced with the medium containing 10%
fetal calf serum. Transfected with comparable quality of pcDNA3.1 vector plasmids
can be used as a negative control. And a green fluorescent protein (GFP) plasmid
was used to test the efficiency of transfection.
Firefly luciferase activity was determined using the Luciferase Assay system
(Promega) after cells were lysed with passive lysis buffer according to the
instructions of the manufacturer. The content of total protein was measured with a
BCA protein assay kit (Beyotime).The firefly luciferase activities were measured by
Microplate Reader (Molecular Devices). Relative luciferase activity was calculated
by normalizing the firefly luciferase activity (FOXP3-pGL3-Promoter) to the
internal control content of total protein. All experiments were performed at least
three times with different preparations of plasmids and primary cells, producing
qualitatively similar results. Columns represent the means of three independent
experiments expressed relative to the luciferase activities obtained for untreated
cells. The error bars represent the standard errors of the mean. The data was
detected using t-test.
832 J.-P. Li et al.
3 Result
Based on the results of fragment competition test and homology, the FOXP3
promoter contained some key sites which located at base pairs 1827–1837 (5′-
CCATTTTTGG-3′), 1476–1482 (5′-TCTTTC-3′) (Fig. 1)
Fig. 1 The FOXP3 promoter contained key sites. The foxp3 promoter contained a MKL-1 and a
STAT5A bInding sequence
STAT5A and MKL-1 Activate the Activity of Luciferase … 833
Fig. 2 Agarose gel electrophoretic analysis of FOXP3 promoter luciferase reporter plasmids.
a Agarose gel electrophoretic analysis of PCR product. M 500 bp DNA marker; 1 Foxp3 gene
promoter. b Agarose gel electrophoretic analysis of recombinant plasmids. M 1 kb DNA marker; 1
pGL3-Promoter vehicle plasmid; 2 Foxp3 recombinant plasmid. c Agarose gel electrophoretic
analysis of recombinant plasmids by digestion. M 500 bp DNA marker; 1 foxp3 recombinant
plasmid; 2 pGL3-Promoter vehicle plasmid
Luciferase Reporter Assay was performed to test the role of ML-1 in regulating
FOXP3 transcription. Contrasting with control group transected with equiponderant
pcDNA3.1 vehicle plasmid, MKL-1 showed a significant effect to enhance the
transcription activity of FOXP3 promoter in a dose-dependent manner (Fig. 3).
Luciferase Reporter Assay was performed to test the role of STAT5A in regulating
FOXP3 transcription. Contrasting with control group transected with equiponderant
pcDNA3.1 vehicle plasmid. STAT5A showed a feebly effect to enhance the tran-
scription activity of FOXP3 promoter in a dose-dependent manner (Fig. 4).
Luciferase Reporter Assay was performed to test the role of MKL-1 and STAT5A
in regulating FOXP3 transcription. Contrasting with control group transected with
equiponderant pcDNA3.1 vehicle plasmid, MKL-1 showed a significant effect to
enhance the transcription activity of FOXP3 promoter STAT5A showed a feebly
effect to enhance the transcription activity of FOXP3 promoter, and the transcrip-
tion activity of FOXP3 promoter can be enhanced when MKL-1 and STAT5A were
cotransfected (Figs. 5 and 6).
Fig. 4 MKL-1 enhanced the transcriptional activity of FOXP3 promoter. A gradient concentra-
tion quality of MKL-1 overexpression plasmid were cotransfected with foxp3 promoter luciferase
plasmid, and the overexpression vector plasmid pcDNA3.1 was added to make sure that every had
a same quality of total plasmid. The relative luciferase activity increased with the increase of
the amount of MKL-1 overexpression plasmid. All groups have significant difference when
compared with control (p < 0.001)
STAT5A and MKL-1 Activate the Activity of Luciferase … 835
Fig. 5 STAT5A enhanced the transcriptional activity of FOXP3 promoter. A gradient concen-
tration quality of STAT5A overexpression plasmid were cotransfected with foxp3 promoter
luciferase plasmid, and the overexpression vector plasmid pcDNA3.1 was added to make sure that
every had a same quality of total plasmid. The relative luciferase activity increased with the in-
crease of the amount of STAT5A overexpression plasmid. The relative luciferase activity of
transfected 0.6 and 0.8 lg STAT5A overexpression plasmid has a significant difference when
compared with control (p < 0.001)
Fig. 6 MKL-1 and STAT5A enhanced the transcriptional activity of foxp3 promoter. A same
quality of 0.4 lg MKL-1 or STAT5A overexpression plasmid were cotransfected with foxp3
promoter luciferase plasmid, the relative luciferase activity increased when transfected MKL-1
overexpression plasmid (p < 0.001) or cotransfected MKL-1 and STAT5A overexpression
plasmids (p < 0.001). And the fold of cotransfected MKL-1 and STAT5A overexpression
plasmids is higher than transfected MKL-1 overexpression plasmid alone
836 J.-P. Li et al.
4 Discussion
References
1. Cines DB, Blanchette VS (2002) Immune thrombocytopenic purpura. N Engl J Med 346:995–
1008
2. McMillan R (2000) The pathogenesis of chronic immune (idiopathic) thrombocytopenic
purpura. Semin Hematol 37:5–9
3. Hed J (1998) Role of complement in immune or idiopathic thrombocytopenic purpura. Acta
Paediatr Suppl 424:37–40
4. Olsson B, Andersson PO, Jernås M et al (2003) T-cell-mediated cytotoxicity toward platelets
in chronic idiopathic thrombocytopenic purpura. Nat Med 9:1123–1124
STAT5A and MKL-1 Activate the Activity of Luciferase … 837
Qian Zhang, Huan Liu, Chaoran Yao, Tingshen Li, Xuehui Li,
Li Zhang, Zhen Liu, Peng Yu and Yuou Teng
1 Introduction
similar to those found in some complement-binding proteins [1]. The selectin has
variety of ligand, such as E-selectin ligand-1 (ESL-1), p-selectin glycoprotein
ligand-1 (PSGL-1), glycosylation-dependent cell adhesion molecule-1
(GlyCAM-1). However, the sialyl Lewis X (sLex) and sialyl Lewis A (sLeA) are
the minimum unit of the ligand recognized by the selectin. The lectin with con-
servative sugar-binding domain, ligand-binding domain of E-selectin, can combine
with sLex specificity [8]. It’s worth noting that both of leukocytes and tumor cells
can express sLex. While tumor cells themselves have ability to induce endothelial
cells to express E-selectin [5].
As reported, modulation of Ca2+ by engagement of E-selectin receptor starts
signal transduction pathways that affect cell spreading, tyrosine phosphorylation
signaling, and cancer cell motility [9]. Therefore, we use Calcein-AM to stain
THP-1 cells.
The model of THP-I adhesion to HUVEC we constructed is indispensable
ingredient in building up a system that consents us to evaluate the ability of targeted
compound to inhibit the progress.
2 Experimental
2.1 Material
Calcein-AM was purchased from Molecular probes. Flow cytometry was purchased
from the company of BD, USA. Microplate reader was purchased from
SYNERGY, BioTek, USA
2.2 Method
THP-1 cells (purchased from the Shanghai Institutes of Biological Sciences, China)
were grown in suspension culture in RPMI 1640 medium supplemented with 10%
fetal calf serum, 100 U/mL glutamine and 100 mg/mL penicillin (all from
Biological Industries, Kibbutz Beit-Haemek, Israel) at 37 °C under an atmosphere
consisting of 95% air and 5% CO2. Human umbilical vein endothelial cells
(HUVEC, purchased from the Shanghai Institutes of Biological Sciences, China)
were grown in F-12 medium supplemented with 10% fetal calf serum, 100 U/mL
glutamine and 100 mg/mL penicillin/streptomycin (all from Biological Industries,
Kibbutz Beit-Haemek, Israel) at 37 °C under an atmosphere consisting of 95% air
and 5% CO2. The cells we used are in the logarithmic growth phase in the
experiments.
Study the Role of E-selectin and Its … 841
HUVEC cells (1 105 cells/mL) were seeded into 12-well plates for 24 h at 37 °
C. The cells were then activated with 20 ng/mL TNF-a, 1 lg/mL LPS,
1 ng/mL IL-b for 0, 2, 4, 6, and 8 h, respectively. The cells were harvested by
centrifugation at 1000 g for 5 min. 3% paraformaldehyde was used to sustain the
cell at room temperature for 30 min, and then the cells were rinsed by cold PBS and
fixed with 5% BSA for 30 min at room temperature. Then the cells were washed by
cold PBS and fixed with anti-E-selectin (1:50) at 4 °C overnight. Control cells were
washed only by PBS. HUVEC were rinsed by cold PBS and added
goat-anti-E-selectin contained 5% BSA (1:50) at 4 °C for 30 min in the dark. The
cells were washed by cold PBS again and analyzed by flow cytometry.
Poly-L-lysine (100 lg/mL) was coated onto 96-well plates (Costar 9600) at 12 h at
37 °C. HUVEC cells were seeded at a density of 1 105 cells/mL,
2 105 cells/mL, and 3 105 cells/mL, respectively at 36 h at 37 °C onto the
coated 96-well plates. The cells were then activated with 20 ng/mL TNF-a,
1 lg/mL LPS, 1 ng/mL IL-b in medium for 0, 2, 4, 6, and 8 h, respectively.
Control cells were left untreated. Meanwhile, THP-1 cells were collected by cen-
trifugation at 1000 g for 5 min, washed with 5 mL of PBS, and stained with
calcein-AM (10 lM) for 45 min at 37 °C. After removing the treatments, HUVECs
were incubated with 1 106 cells/mL of stained THP-1 cells for 30 min at 37 °C.
Then HUVECs were washed three times with PBS to remove unbound THP-1 cells.
Then the plates were kept at −80 °C overnight, thawed at 37 °C, and the fluores-
cence of cell lysates was read with a microplate reader (ex, 485 nm; em, 535 nm)
[10].
All data were expressed as mean ± S.D. Results were analyzed by one-way
analysis of variance (ANOVA), and significant differences were determined by post
hoc Tukey test using SPSS 21.0 software.
842 Q. Zhang et al.
** p<0.01 Vs control
###p<0.05 Vs 10 ng/mL
2000 ###
**
1500
flourance value
1000
500
0
control 10 ng/mL 20 ng/mL
TNF-
The fluorescence value of TNF-a, LPS, IL-b are 5213.39, 420.83, and 180.00 at
4 h. In addition, the data got to 9538.00, 2233.00, and 4444.00 at 6 h. Compared
with three inflammatory factors, we observed that TNF-a with 20 ng/mL reached
the highest fluorescence value when the HUVEC was incubated with it in 6 h.
E-selectin peaked at 6 h when stimulated by three inflammatory cytokines (Fig. 3),
which consistent with others study [11]. However, we perceive the fluorescence
value of LPS keep on increasing while the value of other inflammatory factors is
decreased, especially IL-b.
The density of HUVEC was also evaluated in the experiment. During the experi-
ment, we designed three kind of density of HUVEC: 1 105, 2 105,
3 105 cells/mL. All of them were stimulated with TNF-a in 6 h. As shown in
844 Q. Zhang et al.
###p<0.01 Vs 0 h
10000 ###
TNF-α 20 ng/mL
8000 IL-β 1 ng/mL
flourance value
4000
###
2000
### ### ###
0
0h 4h 6h 8h
time/h
Fig. 4, both of the groups of 20 ng/mL were higher than the 10 ng/mL ones. Thus,
the value of 3 105 cells/mL group is lower than negative. It is probably related to
the density of HUVEC, which is so high resulted the unenough THP-1 adhesion to
it.
3.4 Discussion
Recent finding demonstrated that selectins mediate the adhesion by interacting with
specific carbohydrate ligands on the cell surface [12]. Tumor cell adhesion to
endothelial cells is an important part of tumor metastasis. Adhesion is not only the
basis of directional metastasis of tumor cells, but also is the mainly method to help
tumor immune evasion. E-selectin is not constitutively expressed by endothelial
cells but expressed by inflammatory molecules stimulating such as tumor necrosis
factor (TNF-a), interleukin-1 (IL-1) and bacterial lipopolysaccharide (LPS) [1–3,
6]. sLeX contained oligosaccharides, is a group of carbohydrate antigens with sugar
esters and glycoprotein in the surface of tumor cells. sLex antigens, the ligand of
E-selectin, is expressed on the surface of cells mostly [13, 14]. Therefore, it had a
specificity of the interaction between leukocytes or tumor cells and human
umbilical vein endothelial cells. This study found that the number of THP-1 cells
adhesion to HUVEC significantly increased after HUVEC cells cultivated with
TNF-a for 6 h. Some recent researches had shown that expression of E-selectin
reached to the maximal after cytokine stimulation for 4–6 h and then decreases
rapidly [11]. Meanwhile, the fluorescence value is the highest with stimulation of
20 ng/mL TNF-a. In the course of clinical treatment of cancer, the lack of tumor
Study the Role of E-selectin and Its … 845
2500 ###**
### negative
*** **
2000 ###
#
flourance value
###
10 ng/mL
1500 20 ng/mL
1000
500
0
1×105 2×105 3×105
density (cells/mL)
Fig. 4 The fluorescence value at different densities of HUVEC induced by TNF-a (20 ng/mL).
The densities of HUVEC are 1 105, 2 105, 3 105 cells/mL respectively. All of them were
stimulated with TNF-a for 6 h. The fluorescence value presented the ability of adhesion between
HUVEC and THP-1. The data was presented as mean of three independent experiments
4 Conclusion
References
Xiaohua Chen, Qixiu Pang, Mengnan Li, Baojiang Sun, Ruibo Zhang,
Shiru Jia and Peipei Han
1 Introduction
The strain used to produce EPS was Burkholderia sp. TKS1 isolated from fluid mud
from one muddy port in China. The culture conditions followed our early report [5],
and medium composition was as follows: 21.0 g/L sucrose, 1.1 g/L NH4Cl, 0.2 g/L
MgSO4, 1.0 g/L KH2PO4, Na2HPO4•12H2O 2.0 g/L, CaCO3 1.5 g/L.
After incubation for 3 days, the medium was centrifuged at 4000 r/min for 15 min
after diluting with 4 volumes of distilled water. A total of 3 volumes of pre-chilled
ethanol is added to the supernatant to collect the precipitate of crude EPS. The
crude EPS was dissolved in distilled water, dialyzed by 2000 Da dialysis bag at 4 °
C for 48 h, and then preserved at 4 °C after being freeze-dried to obtain purified
EPS, which was used in the subsequent experiment for testing the effects of EPS on
sedimentation of fluid mud.
Carbohydrate content in the EPS was measured by phenol-sulfuric acid method
using glucose as standard [8]. Protein content was measured according to the method
of Coomassie brilliant blue [9]. Nucleic acid content was measured by spec-
trophotometer method (BioSpectrometer basic, Eppendorf, Germany). Lipid content
was determined by vanillin assay and cholesterol was used as the standard [10].
The Application of Microbial Technology in Harbor … 849
Carbohydrate in the EPS was purified by ion exchange resin DEAE-650M [11].
The column was eluted with deionized water first, and then with a linear gradient of
0–0.5 mol/L NaCl solution at a flow rate of 1.0 mL/min. The fractions were col-
lected and the carbohydrates were monitored via phenol-sulfuric acid method.
Carbohydrate-positive fractions were merged and lyophilized.
The purity of carbohydrate was measured by the High Performance Liquid
Chromatography (HPLC, Dionex, USA) equipped with RI-101 refractive index
detector (RID) and TSK G4000PWXL sugar column (7.8 mm 30.0 cm). The
column oven was set at 30 °C and 20 lL of sample was injected. The mobile phase
is 0.9% NaCl solution with a flow rate of 0.5 mL/min.
Monosaccharide composition was analyzed using 1-Phenyl-3-methyl-
5-pyrazolone-High Performance Liquid Chromatography (PMP-HPLC, Dionex,
USA). The separation was carried out using C18 column (250 mm 4.6 mm i.d.,
5 lm, ZORBAX SB-C18, Aglient, USA). The wavelength of 250 nm was selected
for HPLC analysis and 10 lL of injection volume was injected. During measure-
ments the column oven was set to 30 °C and the mobile phase consist of 17%
acetonitrile and 0.05 mmol/L phosphate buffer solution (KH2PO4-NaOH, pH 6.9)
with a flow rate of 1 mL/min.
The mud used in the study was collected from the fluid mud layer of one muddy
port in China. The sedimentation of fluid mud after addition of EPS with different
concentrations was evaluated by settled sediment volume, which was determined by
measuring the volume of settled sediment in the 100 mL graduated cylinder. The
initial mud sample was diluted to a density of 1,050 g/L, and adequate amount of
EPS was added to make the final concentration at 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 and
0.8 g/L, respectively. After thoroughly mixed for 12 h, the mixture was transferred
to the glass cylinder and then allowed to settle to measure the settled sediment
volume. Rotational viscosimeter (NDJ-79, Changji, China) was used for measuring
viscosity. The surface charge density of fluid mud was measured according to the
method of colloid titration [12]. Mixed liquor suspended solids (MLSS) was
determined in conformity with the standard methods [13]. The sediment particle
size distribution of fluid mud was measured by Laser Scattering Particle Size
Distribution Analysis (LSPSDA, LS13 320, Beckman, USA).
850 X. Chen et al.
3 Results
nRIU 2
10000
8000
6000
4000
2000
0 1
0 5 10 15 20 25 min
unambiguously by comparing the retention time and mass data with those of
standard monosaccharides and the result was presented in Fig. 3. The result showed
that polysaccharide was heteropolysaccharide composed mainly of mannose, glu-
curonic acid, glucose, galactose and fucose at the molar ratio of
0.06:0.19:1.00:0.09:0.48, and also included a little galacturonic acid, the main
component of which was glucose.
Intrinsic viscosity is a parameter reflecting the hydrodynamic volume occupied
by polymers, which is defined as the reduced viscosity when concentration of
polymer solution closes to zero [14]. It was determined in dilute solution and
852 X. Chen et al.
mainly depends on the molecular size and chain stiffness of the polymer, as well as
solvent quality [15]. The intrinsic viscosity of polysaccharide was determined in
0.1 M NaCl using isoionic dilution. The value of intrinsic viscosity ([η]) was
reported as the mean of both intercepts by plotting Huggins and Kraemer against
concentration and extrapolating each linear trend line to zero concentration [16].
Sometimes, the intercept of the combined Huggins and Kraemer extrapolations
might not meet at C = 0, which is the situation in this case, thus [η] was presented
as the average of the Huggins and Kraemer intercepts. The intrinsic viscosity of
polysaccharide of Burkholderia sp. TKS1 at 25 °C is 802.1 mL/g, as presented in
Fig. 4. Xanthan gum is a polysaccharide secreted by the bacterium Xanthomonas
campestris, used as a food additive, rheology modifier, and food thickening agent
due to its high intrinsic viscosity [17] of 541 mL/g, which is significantly lower
than the polysaccharide of Burkholderia sp. TKS1.
Furthermore, settled sediment volume at the same settling time increased along with
the increase of EPS concentration. When the concentration of EPS was higher than
0.8 g/L, the fluid mud system showed no obvious sediment settling during the
observation period. Compared to the control group (0 g/L), addition of EPS has
delayed the sedimentation of fluid mud significantly.
The main factors influencing the settling velocity of sediments include salinity,
sediment concentration, organic matter etc., mainly by flocculation. The strong
flocculation would make the particles condense into larger particles more easily,
which was conducive to settlement. Therefore, studies on these factors affecting the
flocculation could help us explore the mechanism of EPS delaying the settling
velocity of sediments.
The changes of viscosity, particle size distribution and surface charge density of
fluid mud samples with different EPS concentrations were measured. The results of
viscosity and surface charge density were presented in Fig. 6a, b. The results
showed that the viscosity increased from 1.5 to 3.2 mPaS with the increase of EPS
concentration. There were reports that the polysaccharide in EPS could form col-
loidal system to change the viscosity of the system [18]. The surface charge density
of EPS was |0.38 meq/g EPS|, which could confirm that EPS was positively
charged. The surface charge density of fluid mud without EPS was |−0.7 meq/g
MLSS|, and the value decreased after adding EPS, and would remain stable until the
surface charge density fell to |−0.3 meq/g MLSS|. It showed that the interaction
between EPS molecules and sediment particles resulting in the absorption of EPS
onto the particle surfaces therefore forming a stable electric double layer structure.
As shown in Fig. 6c, the median sediment particle size of fluid mud without EPS
854 X. Chen et al.
Fig. 6 The changes of viscosity (a), surface charge density (b) and sediment particle size (c) of
fluid mud after adding EPS with different concentrations
was 6 lm, and after adding EPS the proportion of sediment particles with size
larger than 6 lm significantly increased with the increase of EPS concentration, and
it was speculated as the result of adsorption of EPS to the particle surface.
4 Discussion
Researches about the effects of EPS on sedimentation mainly focused on the process
of wastewater treatment with activated sludge, while studies on its effects on the
sedimentation process of fluid mud are very few at present. The sedimentation of
fluid mud with EPS of different concentrations was measured and the results indi-
cated that EPS could delay the sedimentation of fluid mud very effectively and the
effect was dependent on the EPS concentration in the range of 0.1–0.8 g/L tested in
The Application of Microbial Technology in Harbor … 855
the study. The phenomenon that the amount and properties of EPS played a pre-
dominant role on settling properties was also found in activated sludge. The settling
velocity of sludge would be deceased with more EPS content [19]. For flocs in the
sludge, a high or excessive polysaccharide content was viewed as being detrimental
to settling and dewatering properties owing to higher water content associated with
polysaccharide rich EPS [20]. These studies indicated that polysaccharide in EPS
might play a role in delaying the sedimentation and the composition of EPS had
significant influences on the settling properties besides EPS contents. The results
agreed well with previous reports, and the composition of EPS consisting of 47.2%
polysaccharides and only 5.9% proteins revealed that polysaccharides were the key
component delaying the sedimentation of fluid mud. It was found that the loosely
bound EPS (LB-EPS) had a negative effect on bioflocculation and sludge-water
separation. Although EPS was essential to sludge floc formation, excessive EPS in
the form of LB-EPS could weaken cell attachment and the floc structure, resulting in
poor bioflocculation, greater cell erosion and retarded sludge-water separation [21].
Additionally, it has been reported that the surface properties, hydrophobicity, and
surface charge of EPS affected bioflocculation in the sludge and then influenced its
settling properties [12]. Therefore, based on the results of the effects of EPS on fluid
mud properties such as sediment particle density, viscosity and surface charge, the
possible mechanism for EPS delaying the sedimentation of fluid mud was proposed
as shown in Fig. 7. With the presence of EPS, the sediment density decreased due to
the join of EPS, according to Stokes law, the decrease of sediment particle density
caused the reduced particle settling velocity, the positively charged EPS could
interact with sediments in fluid mud, which was negatively charged, to form a stable
electric double layer structure, and steric repulsive energy was generated as a result
of the interaction between the organic substances adsorbed onto the particle surfaces
[22]. Due to the repulsion between particles, the flocculation between fine sediment
particles by closing to each other and collision to form larger particles was inhibited,
therefore dispersing the sediments in the mutually single-particle state. Moreover,
Fig. 7 The proposed mechanism for EPS delaying the sedimentation of fluid mud. a Represents
under natural conditions (without EPS addition) and b represents under the presence of EPS
856 X. Chen et al.
owing to the EPS with higher molecular weight and rich in polysaccharides (47%),
in the presence of EPS, the water conditions of fluid mud system changed and the
viscosity notably increased. According to Stokes law, the increase of viscosity
caused the reduced particle settling velocity. Therefore, under the combined effects
of viscosity and surface charges, the settling velocity of sediments was decreased
and sedimentation of fluid mud was significantly delayed. The results showed that
EPS could effectively delay the sedimentation of fluid mud. The application of EPS
are successfully applied the biotechnology to the harbor engineering and save a lot of
money for the port.
5 Conclusions
In this study, one EPS-producing strain Burkholderia sp. TKS1 isolated from fluid
mud of a muddy port in China was utilized to investigate the impact of EPS on the
sedimentation of fluid mud and explore the underlying mechanism. The analysis of
chemical constituents of EPS showed the main component was a heteropolysac-
charide and had high intrinsic viscosity. The effects of EPS with different con-
centrations on the sedimentation of fluid mud were investigated and the results
showed that EPS could effectively delay the sedimentation of fluid mud. The
addition of EPS significantly changed the viscosity, sediment particle size distri-
bution and surface charge density of fluid mud. Based on the results, the possible
mechanism for EPS delaying the sedimentation of fluid mud was finally proposed.
The results would have important scientific significance to elucidate the mechanism
of interaction between EPS and the fluid mud and to promote the use of the
microbial technology in harbor engineering.
Acknowledgements The authors are very grateful for the financial support from Tianjin Research
Institute for Water Transport Engineering M.O.T. Research Innovation Funds of China
(TKS160201) and Changjiang Scholars and Innovative Research Team in University (IRT1166),
Ministry of Education, China.
References
5. Sun BJ (2015) Preliminary study of microbial extracellular polymeric substances delaying the
sedimentation of fluid mud and its mechanism. M.E. Dissertation, Tianjin University of
Science & Technology, Tianjin 300457, China
6. Greiser N, Wurpts R (2008) Microbiological impact on formation and rheological properties
of fluid mud. In: Zanke U (ed) Chinese-German joint symposium on hydraulic and ocean
engineering. Eigen-Verlag, Darmstadt, pp 369–371
7. Kirby R (2011) Minimising harbour siltation—findings of PIANC working group 43. Ocean
Dyn 61(2):233–244
8. Dubois M, Gilles KA, Hamilton JK et al (2002) Colorimetric method for determination of
sugars and related substances. Anal Chem 28(3):350–356
9. Bradford MM (2015) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal Biochem
72(s 1–2):248–254
10. Frings CS, Dunn RT (1970) A colorimetric method for determination of total serum lipids
based on the sulfo-phospho-vanillin reaction. Am J Clin Pathol 53(1):89–91
11. Al-Sheraji SH, Ismail A, Manap MY et al (2012) Purification, characterization and
antioxidant activity of polysaccharides extracted from the fibrous pulp of Mangifera pajang
fruits. Lebensmittel-Wissenschaft und-Technologie 48(2):291–296
12. Liao BQ, Allen DG, Droppo IG et al (2001) Surface properties of sludge and their role in
bioflocculation and settleability. Water Res 35(2):339–350
13. Eaton AD, Franson MA (2005) Standard methods for the examination of water and
wastewater, 21th edn. American Public Health Association, American Water Works
Association and Water Environment Federation, Washington, USA
14. Eich A, Wolf BA (2011) Intrinsic viscosities of polyelectrolytes: determination and modeling
of the effects of extra salt. ChemPhysChem 12(15):2786–2790
15. Moresi M, Lo PS, Mancini M (2001) Rheology of scleroglucan dispersions. J Food Eng 50
(4):235–245
16. Qian KY, Cui SW, Wu Y et al (2012) Flaxseed gum from flaxseed hulls: extraction,
fractionation, and characterization. Food Hydrocolloids 28(2):275–283
17. Nie LH, Zhou RJ, Ning ZX (2003) Focus on Xanthan Gum. China Food Addit 3:82–85
18. Yin JY, Nie SP, Li J et al (2012) Mechanism of interactions between calcium and viscous
polysaccharide from the seeds of Plantago asiatica L. J Agric Food Chem 60(32):7981–7987
19. Wang LF, Wang LL, Li WW et al (2014) Surfactant-mediated settleability and dewaterability
of activated sludge. Chem Eng Sci 116:228–234
20. Basuvaraj M, Fein J, Liss SN (2015) Protein and polysaccharide content of tightly and loosely
bound extracellular polymeric substances and the development of a granular activated sludge
floc. Water Res 82:104–117
21. Li XY, Yang SF (2007) Influence of loosely bound extracellular polymeric substances
(EPS) on the flocculation, sedimentation and dewaterability of activated sludge. Water Res
41(5):1022–1030
22. Sato T, Ruch R (1980) Stabilization of colloidal dispersions by polymer adsorption.
Surfactant Science Series Volume 9. Marcel Dekker Ltd, New York
Polyvalent Effect Enhances Anti-influenza
Virus Activity
1 Introduction
attaching ZA on the polymers can dramatically enhance antiviral activity not only
against drug-sensitive but also drug-resistant strains [10, 11].
Our previous work [12] has shown that when attaching the DFSAs on octavalent
scaffolds, the increased binding affinities of this conjugate to NA was achieved with
IC50 values is maximal 145-fold to the monomer. With these promising results,
polyvalent DFSAs were synthesized and their antiviral activity against H7N9 virus
like particle (VLP) was evaluated in this paper. This report represents an initial
attempt for the development of polyvalent DFSAs conjugates as strong
anti-influenza inhibitors.
2 Experimental
2.1 Material
All solvents were dried prior to use. Thin-layer chromatography (TLC) was pur-
chased from EMD Co. Ltd. (German). All compounds were stained with 5% H2SO4
in ethanol followed by heating. Detection with UV light was employed when
possible. Flash column chromatography was performed on silica gel 200–300
mesh. NMR spectra were recorded on Bruker AVANCE III (400 MHz) instru-
ments. Chemical shifts (d) were reported in parts per million downfield from TMS,
the internal standard; J values were given in Hertz. Fluorescence intensity was
measured using a Synergy™ H1/H1MF microplate reader (BioTek Instruments,
Inc. USA) with excitation and emission wavelengths of 360 and 440 nm,
respectively.
2.2 Method
out for 2 h at 37 °C. The fluorescent signal was monitored using the kinetics
function of Synergy™ H1/H1MF microplate reader with excitation and emission
wavelengths of 360 and 440 nm, respectively. The IC50 was calculated as the
concentration of inhibitor resulting in a 50% reduction in fluorescent units
(FU) compared to the control.
See Scheme 1.
O O
O NO2 O
NHCH2CH2N3
O O
O O
NHCH2CH2N3 AcO OAc
O COOMe O COOMe
O a O COOMe b c
O
O
AcHN AcHN
BocHN AcHN
BocHN BocHN
1 2 3
O O O
NHCH2CH2N3 NHCH2CH2N3 NHCH2CH2N3
AcO OAc OAc AcO OAc
AcO COOMe
O OH d COOMe e O
O
O F f
O COOMe O F AcHN F
AcHN F AcHN F
BocHN HN
BocHN
5 BocN 6
4
NHBoc
N3
O
NH O O
OH
HO O COOH
g
O F O O
AcHN F O O
HN HN HO NH
HO n
n
H2 N NH
N 9
7 8 N N
O
NH
OH
HO O COOH
O F
AcHN F
HN
H2N NH
Scheme 1 Reagents and conditions: (a) 2-azidoethanamine, Py, DMAP, 90%; (b) (i) 80% HAc;
(ii) Ac2O/Py, 80% over two steps; (c) CH3NO2, H2O, Selectfluor®, rt, 50%; (d) CH2Cl2, DAST,
−40 °C, 79%; (e) (i) TFA/CH2Cl2 1:1; (ii) MeSC(=NBoc)NHBoc, HgCl2, Et3N, CH2Cl2, rt, 12 h,
83% over two steps, (f) (i) CH3OH, CH3ONa, rt, 2 h (ii) NaOH (aq) rt, 3 h, (iii) TFA/CH2Cl2 1:1,
rt, 2 h, 45% over three steps; (g) CuSO45H2O, VcNa, THF/H2O, rt, 12 h, 76%
862 H. Liu et al.
3 Results
Methyl [5-acetamido-2,6-anhydro-7-O-(2-azidoethylcarbamoyloxy)-8,9-O-
isopropylidene-4-N-tert-butyloxycarbonyl-3,4,5-trideoxy-D-glycero-D-galacto]
non-2-enonate (2). To a solution of 2-azidoethanamine (932.17 mg, 10.83 mmol)
in Py (10 mL), DMAP (660 mg, 5.41 mmol) was added. The solution was stirred at
rt for 30 min then 1 [12] (3.30 g, 5.41 mmol) was added and continue stirring for
3 h. The progress of the reaction was monitored by TLC. Upon completion, the
reaction mixture was washed by HCl (1 M, 25 mL), extracted by DCM
(3 20 mL), the organic phases were combined and dried over Na2SO4. Solvent
was removed under vacuum and the product was purified by column chromatog-
raphy using PE:EtOAc (1:1) to give compound 2 (2.6 g, 86.3%).
1
H NMR (400 MHz, CDCl3) d 6.37 (d, J = 9.6 Hz, 1H, NHAc), 5.91 (d,
J = 2.1 Hz, 1H,), 5.43 (t, J = 5.6 Hz, 1H), 5.29 (d, J = 4.1 Hz, 1H), 5.10 (d,
J = 9.0 Hz, 1H), 4.51 (t, J = 9.0 Hz, 1H), 4.34 (dt, J = 16.7, 8.3 Hz, 2H), 4.20–
4.07 (m, 2H), 4.04–3.93 (m, 1H), 3.77 (s, 3H, CH3O), 3.44 (dd, J = 12.4, 6.2 Hz,
2H), 3.36–3.25 (m, 2H), 1.93 (s, 3H), 1.40 (s, 9H), 1.37 (s, 3H), 1.35 (s, 3H).
Methyl [5-acetamido-8,9-di-O-acetyl-2,6-anhydro-7-O-(2-azidoethylcarba-
moyloxy)-4-N-tert-butyloxycarbonyl-3,4,5-trideoxy-D-glycero-D-galacto] non-
2-enonate (3). Compound 2 (2.6 g, 4.67 mmol) was dissolved in 20 mL 80%
acetic acid, then stirred at rt for 4 days. Then the reaction mixture was washed by
saturated NaHCO3, extracted by DCM (3 30 mL), the organic phases were
combined and dried over Na2SO4. Solvent was removed under vacuum and the
residue was dissolved in 10 mL Py. Acetic anhydride (3 mL) was added and the
reaction was stirred overnight. The reaction mixtrue was washed by HCl (1 M,
50 mL), extracted by DCM (3 20 mL), the organic phases were combined and
dried over Na2SO4. DCM was removed in vacuo and the product was purified by
column chromatography using PE:EtOAc (1:1) to give compound 3 (2.1 g,
86.29%).
1
H NMR (400 MHz, CDCl3) d 6.14 (d, J = 8.8 Hz, 1H, NHAc), 5.91 (d,
J = 1.9 Hz, 1H), 5.45–5.25 (m, 3H), 4.99 (d, J = 9.0 Hz, 1H), 4.65 (d,
J = 11.7 Hz, 1H), 4.51 (t, J = 9.0 Hz, 1H), 4.28 (d, J = 10.2 Hz, 1H), 4.15 (ddd,
J = 27.3, 14.9, 6.9 Hz, 2H), 3.78 (s, 3H), 3.57–3.18 (m, 4H), 2.06 (d, J = 7.6 Hz,
6H), 1.94 (s, 4H), 1.42 (s, 9H).
Methyl 5-acetamido-8,9-di-O-acetyl-7-O-(2-azidoethylcarbamoyloxy)-
4-N-tert-butyloxycarbonyl-3,4,5-trideoxy-3-fluoro-D-erythro-b-L-gluco-non-2-
ulopyranosonate (4) compound 3 (3 g, 5 mmol), nitromethane (20 mL), water
(4 mL) and Selectfluor® (5.3 g, 15 mmol, 3 eq.) was stirred for 4 days at room
temperature. The reaction was quenched with saturated NaHCO3 (100 mL),
extracted with EtOAc (4 200 mL). The organic phase was washed with saturated
NaHCO3 (300 mL) and brine (300 mL), dried over Na2SO4. After evaporation, the
Polyvalent Effect Enhances Anti-influenza Virus Activity 863
0.1 M sodium hydroxide solution (1 mL, 1 mmol). After 3 h, the reaction mixture
was neutralized by H+ resin adjust to pH 7.0, the solvent was evaporated and the
residue was stirred in 50% trifluoroacetic acid (10 mL) solution in DCM at room
temperature for 2 h and evaporated to dryness. The resulting syrup was dissolved in
distilled water, after removing the copper complex by CupriSorb® if needed, and
purified by Sephadex® LH-20 then lyophilisation to afford the compound 7 (33 mg,
45%).
1
H NMR (400 MHz, D2O) d 4.76 (d, J = 10.1 Hz, 2H), 4.63 (t, J = 11.8 Hz,
1H), 4.42–4.26 (m, 1H), 4.11 (dd, J = 22.3, 11.6 Hz, 1H), 3.94–3.72 (m, 1H), 3.55
(d, J = 12.0 Hz, 1H), 3.44–3.14 (m, 5H), 1.89 (s, 3H).
Polymer 9. 7 (20 mg, 0.00028 mmol) was dissolved in the buffer (pH = 7.2),
the polyvalent alkynyl backbone 8 (50 mg, 0.014 mmol), CuSO45H2O (2 mg,
1 eq.) and sodium ascorbate (4 mg, 1 eq.) were added. The mixture was stirred at
room temperature overnight 16 h. The solvent was evaporated to dryness, the
copper complex was absorbed by CupriSorb® if needed and the crude products
were purified by Sephendex LH-20. Then lyophilisation to afford the compound 8
(40 mg, 76%).
1
H NMR (400 MHz, D2O) d 8.38, 7.93, (2 s, 2H), 4.55–2.26 (m, 12H), 2.14–
0.68 (m, 5H). 19F NMR (376 MHz, D2O) d −111.82 (s), −122.28 (s), −198.70 (s).
See Table 1.
4 Conclusions
Acknowledgements This work was financially supported by the Natural Science Foundation of
China (21402140, 21502139) and the International Science & Technology Cooperation Program
of China (2013DFA31160). The authors are thankful to the Research Centre of Modern Analytical
Technology, Tianjin University of Science and Technology for NMR measurements.
References
1. National Health and Family Planning Commission of the People’s Republic of China, Reports
of nationally notifiable infectious diseases. Available online: http://www.moh.gov.cn/jkj/
s3578/201612/8a84c914186441d9a444e81751f58863.shtml
2. Itzstein MV et al (1993) Rational design of potent sialidase-based inhibitors of influenza virus
replication. Nature 363(363):418–423
3. Wagner R, Matrosovich M, Klenk HD (2002) Functional balance between haemagglutinin
and neuraminidase in influenza virus infections. Rev Med Virol 12(3):159–166
4. Hay AJ, Hayden FG (2013) Oseltamivir resistance during treatment of H7N9 infection.
Lancet 381(9885):2230–2232
5. Kim JH et al (2013) Mechanism-based covalent neuraminidase inhibitors with
broad-spectrum influenza antiviral activity. Science 340(6128):71–75
6. Das K et al (2010) Structures of influenza A proteins and insights into antiviral drug targets.
Nat Struct Mol Biol 17(5):530–538
7. Lundquist JJ, Toone EJ (2002) The cluster glycoside effect. Chem Rev 102(2):555–578
8. Cecioni S, Imberty A, Vidal S (2015) Glycomimetics versus multivalent glycoconjugates for
the design of high affinity lectin ligands. Chem Rev 115(1):525–561
9. Cheng CK et al (2014) From neuraminidase inhibitors to conjugates: a step towards better
anti-influenza drugs? Future Med Chem 6(7):757–774
10. Weight AK et al (2011) Attaching zanamivir to a polymer markedly enhances its activity
against drug-resistant strains of influenza a virus. J Pharm Sci 100(3):831–835
11. Haldar J et al (2010) Bifunctional polymeric inhibitors of human influenza A viruses. Pharm
Res 27(2):259–263
12. Yang ZL, Zeng XF, Liu HP, Yu Q, Meng X, Yan ZL, Fan ZC, Xiao HX, Iyer SS, Yang Y,
Yu P (2016) Tetrahedron Lett 57(24):2579–2582