MZOL-002

LABORATORY COURSE-II
Indira Gandhi National
Open University
School of Sciences

List of Experiments
1. Genomic DNA Isolation 7
2. Transfer of Bacterial DNA to Filters Following Colony Lysis 11
3. Polymerase Chain Reaction 15
4. Protein Isolation and Estimation by Lowry Method 19
5. Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis 24
(SDS-PAGE) of Proteins
6. Assay of Extracellular α-Amylase Through Bacterial Cell 30
Immobilization
7. Thin Layer Chromatography 36
8. Estimation of Tryptophan 40
9. Isolation and Analysis of Metagenomic DNA 42
10. In Silico Designing of Oligonucleotide Primers for Polymerase 46
Chain Reaction
11. Identification of Open Reading Frames and In Silico Translation 55
Using a Nucleotide Sequence
12. Identification of Restriction Enzyme Sites in Sequences and 59
Performing In Silico Restriction Fragment Length Polymorphism
(RFLP) Analysis
13. Construction of Phylogenetic Trees Using Different Algorithms 74
14. Visualisation of Protein Structure Using Rasmol: Basic Analysis 82
15. Study of Geotaxis, Phototaxis, Chemotaxis and Hydrotaxis in 95
Earthworm
16. Study of the Response of Woodlice to Hygrostimuli 103
17. Study of Phototaxis Behaviour of Insect Larvae and Effect of 107
Different Light Spectra on their Movement
18. Behaviour Observations in a Primitive Eusocial Wasp 110
19. Courtship and Mating Behaviour in Drosophila 113
20. Farming Chicken for Meat 118
21. Demonstration of Fish Breeding Pools and Hatcheries 123
22. Identification of Eggs, Spawn, Fry and Fingerlings of Cultivable 127
Fishes of India
23. Analysis of the Proximate Composition of Fish 134
24. Study of Feeding Habits of Fishes by Gut Content Analysis 142
25. Formulation and Preparation of Artificial Fish Food 149
26. Molecular Techniques in Fish Health Management 154
27. Aquarium Design and Maintenance 159
28. Collection and Identification of Aquatic Insects and Aquatic 163
Weeds
29. Suggested Readings 174
30. Self-Assessment Questions 176
COURSE NAME: LABORATORY COURSE-II COURSE CODE: MZOL-002

Course Design Committee

Prof. Sujatha Varma Prof. Bharati Chauhan Prof. Amrita Nigam (Retd.)
Former Director, School of Department of Zoology School of Sciences, IGNOU
Sciences, IGNOU, Maidan Garhi University of Rajasthan Maidan Garhi, New Delhi-110068
New Delhi-110068 Jaipur-302004
Prof. Neera Kapoor
Prof. Neeta Sehgal Prof. Devinder Kaur Kochar School of Sciences, IGNOU
Department of Zoology Department of Zoology, Punjab Maidan Garhi, New Delhi-110068
University of Delhi, Delhi-110007 Agricultural University
Ludhiana-141004 Dr. Siya Ram
Prof. Sarita Kumar School of Sciences, IGNOU
Department of Zoology Prof. Varsha Wankhade Maidan Garhi, New Delhi-110068
Acharya Narender Dev College Department of Zoology
University of Delhi, Delhi-110007 Savitribai Phule University Dr. Ravi Rajwanshi
Pune-411007 School of Sciences, IGNOU
Prof. S. Dinakaran Maidan Garhi, New Delhi-110068
Department of Zoology Prof. Sarita Sachdeva
Madurai Kamaraj University Department of Biotechnology
Tamil Nadu-625021 Manav Rachna International
University, Sector-43, Faridabad
Haryana-121004

Block Preparation Team

Dr. Sayak Ganguly Dr. Priyanka De School of Sciences
Department of Biotechnology Department of Biotechnology
Prof. Aryadeep Roy Choudhury
St. Xavier’s College St. Xavier’s College
School of Sciences, IGNOU
(Autonomous), Kolkata (Autonomous), Kolkata
Maidan Garhi, New Delhi-110068
Kolkata-700016 (West Bengal) Kolkata-700016 (West Bengal)
(Experiments 1 to 28)
(Experiments 9 to 14) (Experiments 15 to 28)

Programme Coordinators : Prof. Neera Kapoor and Dr. Siya Ram

Course Coordinator : Prof. Aryadeep Roy Choudhury

Course Editor : Prof. Aryadeep Roy Choudhury

Print Production

Acknowledgement:
• Prof. Aryadeep Roy Choudhury and Mr. Ajit Kumar, Suggestions for figures and cover design.
• Mr. Vikas Kumar, JAT for word processing and CRC preparation.
May, 2024
Indira Gandhi National Open University, 2024
ISBN : 978-93-6106-395-4
All rights reserved. No part of this work may be reproduced in any form, by mimeograph or any other
means, without permission in writing from Indira Gandhi National Open University.
Further information on Indira Gandhi National Open University courses may be obtained from the
University’s office at Maidan Garhi, New Delhi-110 068 or IGNOU website [Link].
Printed and published on behalf of Indira Gandhi National Open University, New Delhi by the Registrar,
MPDD, IGNOU.
Printed at: Raj Printers, A-9, Sector B-2, Tronica City, Loni (Gzb).
 LABORATORY COURSE-II: INTRODUCTION

Laboratory Course-II is the second laboratory course in [Link]. Zoology programme based on
the four theory courses that you have studied in Semester 2. You will have in total four
laboratory courses in [Link]. programme of Zoology where you will get an exposure of several
experiments based on different courses that you will be studying in your theory. These
experiments are intended to provide hands-on-training and develop your skills of
observation, analysis and interpretation that will also help you in your Dissertation as well as
in your future research programmes. Laboratory course-II is an intensive course which you
will need to complete over a period of two week. This 4-credit laboratory course requires 120
hours of input by the learners. You will have to work 8 hours each day with two laboratory
sessions of 4 hours each, where 3 hours will be allotted video viewing or demonstration by
the counselors and 1 hour for preparing your record note book and viva-voce undertaken by
the counselors. So, there will be a total of 28 sessions. A schedule for laboratory
experiments will be given to you by your counselor in the first session. Make sure that you do
not miss any of the laboratory sessions, since it will be difficult to repeat the same
experiment due to time constraint.

The course comprises one block, containing a total of 28 experiments, which would
encompass the concepts learnt in your four theory courses. Experiments 1 and 2 will make
you familiar with the isolation of genomic DNA from bacterial specimen and transfer of
bacterial DNA to nitrocellulose or nylon filters. Experiment 3 will enable you to learn to set up
a polymerase chain reaction (PCR) for amplifying any segment of DNA. In experiment 4 and
5, you will learn to isolate protein, quantify the protein level through Lowry method and study
the protein profile of any specimen through sodium dodecyl sulphate-polyacrylamide gel
electrophoresis. Experiment 6 will focus on extracellular α-amylase assay through bacterial
cell immobilization. Experiment 7 will enable you to separate amino acids from their mixture
through thin layer chromatography, while experiment 8 will focus on the quantification of a
vital amino acid namely tryptophan. Experiments 9 to 14 will encompass the basic
techniques from your genomics and proteomics theory course. You will learn to isolate and
analyze metagenomic DNA, in silico method for designing of oligonucleotide primer, identify
open reading frame through ORF Finder Programme, identify restriction enzyme sites and in
silico restriction fragment length polymorphism (RFLP) analysis, construct phylogenetic tree
using different algorithms and visualize protein structure through RASMOL. Experiments 15
to 20 will cover several experiments related to your theory course on Animal Behaviour and
Animal Welfare Ethics. In these set of experiments, you will study about the responses of
some organisms to different stimuli, behavioural responses or courtship and mating behavior.
Finally, Experiments 21 to 28 will cover certain topics that are part of your theory course on
Aquaculture. You will get exposure to the designing and maintenance of aquarium,
formulation of fish food, studying feeding habit of fishes, demonstration of breeding pools and
hatcheries, identification of eggs, spawns and fingerlings of cultivable fishes and molecular
techniques applied for fish health management. You may be taken to field trips for some of
these experiments.

You will be assessed for your performance in the laboratory course during the entire period.
Your counselor is supposed to give you proper instructions and necessary guidance to carry
out the experiments as well as assessing your performance simultaneously. Therefore, pay
proper attention to the instructions and maintain proper laboratory ethics. Upon completion of
the course, you will be required to face a term-end examination on the final day, based on
the experiments that you have performed during the entire tenure. 70% assessment will be
4 made on guided experiments and the rest 30% will be on the unguided experiments.
Study Guide
1. Before you enter your laboratory for performing experiments, you should go through
the experiment thoroughly as given in the manual. You should especially spend more
time on the procedure and the observation part.

2. You should underline the important steps given in the laboratory manual.

3. Please handle all the laboratory instruments very carefully, as most of them are quite
expensive and need adequate fund for repair, if damaged.

4. For experiments 1 to 9, it is advisable to wear apron and use gloves. Be cautious with
the use of reagents and chemicals, especially which are corrosive, toxic and
inflammable.

5. Do not forget to carry laboratory manual and a practical record book for recording your
observations. Please make extensive and detailed notes on the observation and results
of the experiments performed.

6. Interact with your counselors to the maximum during your stay at the study center.
Develop a habit of asking questions, however simple they might be, and bring out the
best of your counselors.

7. Try to learn as much as you can so as to make the laboratory course meaningful and
useful to you in the long run. Surely, the hands-on-training will help you to also
understand the theory courses better and make them more interesting.

Objectives
After undergoing the experiments of the laboratory course-II, you should be able to:

• isolate genomic DNA from bacterial sample and visualize DNA through agarose gel
electrophoresis,

• transfer and fix DNA molecule to nitrocellulose or nylon filter,

• set up a PCR and observe the amplified band through agarose gel electrophoresis,

• make a qualitative and quantitative estimation of protein,

• visualize the protein profile through sodium dodecyl sulphate-polyacrylamide gel

electrophoresis,

• detect and assay, respectively, the production and activity of the extracellular α-
amylase, produced by immobilized cells of Bacillus subtilis,

• separate and identify organic compounds from their mixtures through thin layer
chromatography,

• estimate tryptophan content through colorimetric estimation,

• obtain a representative sample of the genetic material present in the microbial

community through metagenome analysis,

• design oligonucleotide primers in silico for undergoing efficient PCR,

• determine all the potential open reading frames (ORFs) present in a given sequence
using ORF Finder, 5
 • generate graphical outputs, including restriction maps, highlighting the positions of
restriction sites and the resulting DNA fragments, using NEBcutter V3.0,

• gain an overview of construction of phylogenetic trees, using different algorithms, viz.,

CLUSTAL, Maximum Parsimony, Neighbour Joining and Maximum Likelihood, and
using FIGTREE to visualise and represent phylogenetic trees,

• visualize the protein structure using RASMOL,

• explain the mechanism of geotaxis, phototaxis, chemotaxis and hydrotaxis in

earthworm,

• analyze the response of woodlice to hygrostimuli,

• analyze the effect of different light spectra on the phototaxis behavior of insect larvae,

• comprehend the nature of the caste system in primitive wasp society,

• comprehend the nature of courtship and mating behaviour in the fruit fly, Drosophila
melanogaster,

• explain the basic strategies and objectives of chicken farming,

• describe the components and management strategies of the breeding pond and
hatching pond,

• identify the various developmental stages of cultivable fish (Rohu and Catla), namely,
eggs, spawn, fry and fingerlings,

• describe the standard protocols for the analysis of the proximate composition of fish,

• analyze the gut content of fishes,

• comprehend the composition of artificial fish food,

• explain the basic molecular strategies for maintaining fish health and breeding
management,

• identify the basic requirements of an aquarium and comprehend the aquarium design,
and

• describe the basic methods to collect, identify and study aquatic insects and weeds
from a local water body.

6
 EXPERIMENT 1
GENOMIC DNA ISOLATION

Structure
1.1 Introduction and Principle 1.3 Procedure
Objectives 1.4 Observations
1.2 Materials Required 1.5 Precautions

1.1 INTRODUCTION AND PRINCIPLE

Genomic DNA accounts for about two per cent dry weight of the cell. DNA is
CTAB has the useful
isolated and used for various analyses and applications. DNA can be
property of
extracted from bacteria as a high molecular weight polymer of precipitating nucleic
deoxyribonucleotides via enzyme or alkaline method. Isolation of genomic acids and acidic
DNA involves lysis of the cell via enzymatic method or mechanical breakdown polysaccharides from
of the cell membranes to release the genomic DNA into the solution. solutions of low ionic
strength. CTAB is
Extraction of genomic DNA sometimes becomes difficult because of the particularly useful for
presence of large amounts of phenolics and polysaccharides. The extraction is purification of DNA
based on the cetyl trimethylammonium bromide (CTAB) method. CTAB is from organisms that
produce large
a cationic detergent. In solutions of high ionic strength, CTAB forms
quantities of
complexes with proteins and most of the polysaccharides, but does not polysaccharides.
precipitate nucleic acids. The protocol has been modified to include CTAB and other
polyvinylpyrrolidone (PVP) and high salt solutions to get rid of phenolics and cationic detergents
polysaccharides from the isolated genomic DNA. After removing CTAB- can enhance the rate
polysaccharide-protein complexes by sequential extraction with phenol and of renaturation of
complementary DNA
chloroform, the genomic DNA in purified form can be recovered from the
strands.
supernatant by precipitation with chilled ethanol. This protocol can be used for
most of the Gram-negative bacteria to obtain high-quality genomic DNA. The
method needs to be modified for Gram-positive bacteria which would require
treatment with the enzyme (lysozyme) and proteinase K.

Objectives
Objectives
After doing this experiment, you should be able to:

 isolate the genomic DNA from a bacterial sample, and

 observe the isolated DNA through agarose gel electrophoresis.

MZOL-002 Laboratory Course-II

1.2 MATERIALS REQUIRED

CTAB (cetyl trimethylammonium bromide) 10% (w/v), pre-warm before use
CTAB is widely used Absolute ethanol (ice cold)
as a topical antiseptic
and is sold under the 70 % ethanol (ice cold)
trade names of
Savlon and Cetavlon. Agarose

Ethidium bromide

RNAse A (10 mg/mL), properly boiled to remove DNase I

Water (sterile)

Microfuge tubes

Microtips

Micropipette

Water bath

Agarose gel electrophoresis system

Falcon tubes (50 mL)

Tris – ethylene diamine tetra acetic acid (Tris-EDTA)

Dissolve 10 mM Tris-HCl, 1 mM EDTA. Adjust pH to 8.0 and autoclave

NaCl

Prepare 5 M NaCl. Autoclave

CTAB

Weigh 10 g CTAB and dissolve in 100 mL distilled water. Heat to dissolve.

Autoclave

Chloroform: isoamyl alcohol

Prepare a mixture of chloroform and isoamyl alcohol (24:1 ratio) equilibrated

with a layer of TE buffer (pH 8)

Phenol: chloroform: isoamyl alcohol

Prepare a mixture of phenol, chloroform, isoamyl alcohol ([Link] ratio)

equilibrated with a layer of TE buffer (pH 8)

Sodium acetate

Prepare 3 M sodium acetate pH 5.2 in water. Autoclave

1.3 PROCEDURE
1. Grow bacterial culture in 5 mL of nutrient broth. Pellet the cells by
centrifugation at ~5000 revolutions per minute (rpm) for 10 minutes.
8 Discard the supernatant.
Experiment 1 Genomic DNA Isolation
2. Add 400 µL of TE and 100 µL NaCl (5 M) to the pellet. Resuspend the
cells gently.

3. Add lysozyme to 1 mg/mL, and incubate for 1 hour at 37oC (for Gram
positive bacteria).

4. Add proteinase K to 0.5 mg/mL and incubate for 1-16 hours at 60oC (for
Gram positive bacteria).

5. Add 100 µL of CTAB and mix by swirling. Incubate at 65oC for 1 hour.
Mix occasionally by inverting the tube.

6. Add RNase A to remove RNA contamination (optional).

7. Add 500 µL of phenol: chloroform: isoamyl alcohol, mix thoroughly and

incubate on ice 30 minutes.

8. Centrifuge at 10,000 rpm 10 minutes.

9. Collect the supernatant by avoiding the interface material and lower

phase.

10. Add 500 µL of chloroform: isoamyl alcohol and mix gently.

11. Centrifuge for 10 minutes.

12. Collect the supernatant and add 1/10 volume Na-acetate pH 5.2 (50 µL)
and 2 volume ice-cold ethanol (1000 µL) to precipitate the DNA.
Incubate at -20oC for at least 1 hour.

13. Centrifuge at 4oC for 10 minutes. Discard the ethanol and retain the
pellet.

14. Add 500 µL of chilled 70% ethanol. Allow to stand for ~5 minutes at
room temperature. Centrifuge and drain again. If necessary, repeat this
step.

15. Drain off excess of ethanol and semi-dry the pellet.

16. Dissolve the pellet in 100 µL TE. Gentle heating may be required to
dissolve the pellet completely.

17. Store the DNA in cold (4oC) or at -20°C.

18. Check the quality of DNA by loading it in 0.8% (w/v) agarose gel.

1.4 OBSERVATIONS
The presence of a highly resolved and distinct high molecular weight band
indicates proper isolation and good quality DNA (Fig. 1.1), whereas presence
of a smeared band indicates DNA degradation. The molecular weight of DNA
can be detected by loading DNA ladder which serves as the molecular weight
marker. 9
MZOL-002 Laboratory Course-II

DNA band

Fig. 1.1: Isolated genomic DNA

1: Molecular weight marker; 2 and 3: Intact genomic DNA band

1.5 PRECAUTIONS
1. CTAB should be handled carefully. It is a strong detergent and can
damage eyes and irritate skin.

2. Chloroform should be handled carefully. It is toxic by inhalation and can

damage eyes.

3. Phenol should be handled carefully. It is toxic and corrosive to skin and

eyes.

4. All the buffers, water, glassware and plasticware should be properly

autoclaved to avoid DNase 1 contamination.

10
 EXPERIMENT 2
TRANSFER OF BACTERIAL DNA
TO FILTERS FOLLOWING
COLONY LYSIS

Structure
2.1 Introduction and Principle 2.3 Procedure
Objectives 2.4 Precautions
2.2 Materials Required

2.1 INTRODUCTION AND PRINCIPLE

Transfer of DNA from different sources to nitrocellulose or nylon filters is a
routine method in molecular biology work, especially when Southern blotting is
to be performed to check the presence of any gene in the genome or to check
the integration of any foreign gene following genetic transformation. It is
possible to liberate the DNA from bacterial colonies transformed with
recombinant plasmids and transfer the DNA to nitrocellulose or nylon filters.
Nylon filters that bind nucleic acids irreversibly are more durable than
nitrocellulose filters. Two types of nylon filters are available: neutral nylon and
charge-modified nylon, carrying amine groups, hence positively charged and
designated as (+) nylon. Both of them can bind single stranded and double
stranded nucleic acids. Treatment of filter with sodium dodecyl sulfate (SDS)
limits the diffusion of the plasmid DNA during subsequent denaturation and
neutralization steps, resulting in a sharper hybridization signal. Inundating the
filter with ethylene diamine tetra acetic acid (EDTA), present in saline sodium
phosphate EDTA (SSPE) solution, allows chelation of divalent cations such as
Mg2+, thereby inhibiting DNA degradation due to the action of any residual
nucleases. Baking allows fixing of the bacterial DNA to the nylon or
nitrocellulose filters and requires a time period of 1-2 hours.

Objectives
After doing this experiment, you should be able to:

 lyse the bacterial colonies for DNA transfer,

BZOL-002 Laboratory Course-II

 transfer the DNA molecule to nitrocellulose or nylon filter, and

 fix the DNA to the filter.

2.2 MATERIALS REQUIRED

Denaturing solution: 1.5 M NaCl, 0.5 M NaOH

Neutralizing solution: 0.5 M Tris Cl pH 7.4, 1.5 M NaCl

SDS (10% w/v)

2X SSPE

[For preparation of 20X SSPE, dissolve 175.3 g of NaCl, 27.6 g

NaH2PO4.7H2O and 7.4 g of EDTA in 800 mL of water. Adjust the pH to 7.4
with NaOH and then adjust the volume to 1 L with water. Sterilize by
autoclaving. Final concentration of ingredients is 3 M NaCl, 0.2 M
NaH2PO4.7H2O and 0.02 M EDTA]

Whatman 3MM paper

Glass or plastic trays for processing of filter

Microwave oven

Vacuum baking oven preset to 80 °C

Filter carrying colonies of Escherichia coli transformants

2.3 PROCEDURE
1. Cut four pieces of Whatman 3MM paper to an appropriate size and
shape so that they can fit well on to the bottom of four glass or plastic
trays. Soak each of the pieces of 3MM paper with one of the following
solutions:

i) 10% SDS

ii) Denaturing solution

iii) Neutralizing solution

iv) 2X SSPE

2. Decant off any excess liquid and roll a 10 mL pipette along the sheet to
remove air bubbles, trapped between the 3 MM paper and bottom of the
container. Make sure that the 3 MM paper is not excessively wet;
otherwise, bacterial colonies swell and diffuse at the time of lysis.

3. Use blunt-ended forceps to peel the nitrocellulose or nylon filter from the
bacterial agar plate. Place the filter with the colony side directed
upwards on the SDS-soaked 3MM paper for 3 minutes.

4. Transfer the SDS-soaked first filter to the second sheet of 3MM paper,
12 saturated with denaturing solution for 5 minutes. During filter transfer
Experiment 2 Transfer of Bacterial DNA to Filters Following Colony Lysis
from one tray to another, remove the excess liquid by transferring the
filter briefly to a dry paper towel. Avoid fluid accumulation on the side of
the filter carrying the bacterial colonies.

5. Transfer the filter to the third sheet of 3MM paper, saturated with
neutralizing solution and leave for 5 minutes. If necessary, repeat this
step.

6. Transfer the filter to the last sheet of 3MM paper, saturated with 2X
SSPE and leave for 5 minutes. Fill a tray with a certain volume of 2X
SSPE and float the filter from Step 5 on this solution for several minutes.

7. Agitate the container to sink the filter below the surface of the SSPE
solution.

8. Orient the filters with the colony side up on a sheet of dry 3MM paper
and allow them to dry at room temperature for at least 30 minutes.

9. Sandwich the filter between the two sheets of dry 3MM paper.

10. Fix the DNA to the filter by baking for 1-2 hours at 80°C in a vacuum
oven. Alternately, place the filter on a dry piece of blotting paper and
heat for 2-3 minutes in a microwave oven at full power (750-900 W).

The different steps of the transfer of bacterial colony to the filter are shown
diagrammatically in Figure 2.1.

Fig. 2.1: Steps of colony transfer to filter and binding of released DNA to filter 13
BZOL-002 Laboratory Course-II

2.4 PRECAUTIONS
1. Overbaking causes the filter to turn brittle.

2. Neutralize the nitrocellulose filter completely; otherwise, they would turn

brown or yellow during baking and chip easily.

3. Improper neutralization of the filter also increases background

nonspecific hybridization.

4. Microwave treatment may attenuate hybridization signals in subsequent

steps.

14
 EXPERIMENT 3
POLYMERASE CHAIN
REACTION

Structure
3.1 Introduction and Principle 3.3 Procedure
Objectives 3.4 Observations
3.2 Materials Required 3.5 Precautions

3.1 INTRODUCTION AND PRINCIPLE

Kary Mullis and coworkers first described in vitro amplification of single-copy
mammalian genes. They used the Klenow fragment of DNA polymerase I from
Escherichia coli for this purpose. The efficiency of polymerase chain reaction
(PCR) was enhanced by using a thermostable polymerase called Taq
polymerase.

The basic PCR consists of several components. A pair of synthetic

oligonucleotides, referred to as forward and reverse primers, each of which
are 20-30 nucleotides in length, with balanced content of GC residues and
less propensity of secondary structure formation, help in priming DNA
synthesis. Template DNA (plasmid or genomic DNA) contains the target
sequence to be amplified. The divalent cation Mg2+ is required for the
functioning of the thermostable DNA polymerases, which is achieved by
adding 1.5 mM MgCl2 to the reaction buffer. Equimolar amounts of the four
deoxynucleoside triphosphates (dNTPs), viz., dATP, dTTP, dCTP and
dGTP, usually 200-250 μM of each, are added in the reaction buffer. Use of
dNTPs at higher concentration (> 4 mM) hinders PCR by sequestering Mg2.
The working concentration of both MgCl2 and dNTPs might need to be
standardized for each combination of template and primer. The reaction is
carried out in presence of 10 mM Tris-Cl buffer adjusted to pH between 8.3
and 8.8. Finally, thermostable DNA polymerase, called Taq polymerase,
isolated from thermophilic archaebacteria called Thermus aquaticus, is used
at 0.5-2.5 units per 25-50-µL reaction.

PCR consists of (i) heat denaturation of the template DNA, (ii) annealing of
the oligonucleotide primers to the single-stranded target sequence(s), and (iii)
extension of the annealed primers by Taq polymerase. Denaturation is
carried out at 94-95oC for 45 seconds for routine amplification. Primer
MZOL-002 Laboratory Course-II
o
annealing to the template is normally executed at 3-5 C lower than the
calculated melting temperature (Tm) at which the dissociation of primers from
their template occurs. Extension of oligonucleotide primers is carried out 72-
78oC for 1 minute for every 1000 bp of product. The polymerization rate of Taq
polymerase is 2000 nucleotides/minute at this temperature range. Normally
25-30 cycles should be undergone for acceptable amplification. However, this
will again depend on the number of copies of template DNA at the beginning
of the reaction and the efficiency of primer extension and amplification.

Objectives
After doing this experiment, you should be able to:

 set up a PCR, and

 observe the specific amplified band in agarose gel.

3.2 MATERIALS REQUIRED

1. Thermal cycler

2. Microfuge tubes

3. Micropipette

4. Agarose gel electrophoresis system

Buffers and solutions

10× PCR amplification buffer

dNTP mix solution containing all the four dNTPs (pH 8.0)

Taq polymerase

Gene specific forward and reverse primers (each 20 µM)

Template DNA with the gene, dissolved in 10 mM Tris-Cl (pH 7.6)

Figure 3.1 represents a model for the thermal cycler used to run PCR.

16 Fig. 3.1: Thermal cycler

Experiment 3 Polymerase Chain Reaction

3.3 PROCEDURE
1. In a sterile 0.5-mL microfuge tube, mix the following:

1× PCR amplification buffer 5 µL (from 10 X stock)

MgCl2 1.5 mM

Solution of four dNTPs (pH 8.0) 200 µM

Forward primer 1 µM

Reverse primer 1 µM

Taq DNA polymerase (1-5 units/µL)

H2O

Template DNA 50 ng - 1 µg

Final volume 50 µL

PCR must always include positive and negative controls. Positive

controls determine the efficiency of the PCR, while negative controls
should be kept to detect contamination.

2. Switch on the thermal cycler and set the cycle number, time and
temperature for denaturation, annealing and polymerization as
represented in the Table 3.1.

Table 3.1: Setting up the PCR cycles in thermal cycler

Cycle Number Denaturation Annealing Polymerization

30 cycles 30 seconds at 94°C 30 seconds at 55°C 1 minute at 72°C

(this temperature is
to be set
depending on what
primer pairs you
are using, and
hence will vary)

Last cycle 1 minute at 94°C 30 seconds at 55°C 1 minute at 72°C

3. Load 10 µL of the reaction mixture in agarose gel and subject them to

electrophoresis. Load also the molecular weight marker to check
whether the amplified band is of proper size. Stain the gel with ethidium
bromide to check the PCR product.

3.4 OBSERVATIONS
You will observe the amplified DNA band of the expected size or appropriate
molecular weight, which you can also compare with the positive control. You
will not observe this band in the negative control (Fig. 3.2). You can check or
confirm the size of the PCR product by comparing with the DNA ladder
(molecular weight marker). 17
MZOL-002 Laboratory Course-II

PCR product

Fig. 3.2: PCR product observed through agarose gel electrophoresis

Lane 1: Molecular weight marker

Lanes 2 and 3: Negative control

Lane 4: Positive control

Lanes 5 and 6: PCR product from the samples

3.5 PRECAUTIONS
1. Autoclave the microfuge tubes and microtips as well as water before
setting up the reaction.

2. Properly store the PCR kit, including Taq polymerase at -20oC.

3. Place all the components on ice bath during preparation of the reaction
mixture.

4. Add the enzyme at the end during setting up the PCR.

5. Mix the reaction gently by pipetting.

6. Calculate the melting temperature of the two primers carefully in order to

set the annealing temperature.

7. Do not exceed 35 cycles.

18
 EXPERIMENT 4
PROTEIN ISOLATION AND
ESTIMATION BY LOWRY
METHOD

Structure
4.1 Introduction and Principle 4.3 Procedure
Objectives 4.4 Observations
4.2 Materials Required 4.5 Precautions

4.1 INTRODUCTION AND PRINCIPLE

Survival of the living organisms is based on their ability to adapt to the variable
conditions. The processes that ensure proper survival of the organism in
response to specific conditions as well as processes responsible for growth
and development are all carried out by different classes of functional proteins,
some of which are constitutive, while others may be tissue-specific or
inducible. Therefore, analysis of the entire protein profile from a specific tissue
is essential to understand the molecular response and cell signaling,
governing the survival of an organism.

Protein content in cell fractions can be estimated by Lowry method and by

estimating the total nitrogen content. Hydrolyzing the protein, followed by
amino acid estimation, can provide the exact quantification. The method by
Lowry et al is quite sensitive to provide a moderately constant value and
hence largely followed. The blue color generated as a result of the reduction of
the phosphomolybdic phosphotungstic components in the Folin-Ciocalteau
reagent by the amino acids tyrosine and tryptophan present in the protein,
along with the color developed by the biuret reaction of the protein with the
alkaline cupric tartarate are measured in the Lowry’s method. The assay is
applicable for buffer-soluble proteins, but not suitable for measuring the
content of hydrophobic and aggregated proteins. The assay is sensitive to the
variations in the content of tyrosine and tryptophan residues.

Objectives
After doing this experiment, you should be able to:
 determine the quality of the total protein isolated from your specimen,
and
MZOL-002 Laboratory Course-II
 make a quantitative estimation of the total protein in your specimen.

4.2 MATERIALS REQUIRED

Protein isolation

1. Isolation buffer: 50 mM Tris Cl pH 7.5, 5 mM MgCl2, 25 mM KCl, 250

mM sucrose, 1 mM phenyl methane sulfonyl fluoride (PMSF), 1 mM DTT

2. Phosphate buffer saline (PBS): This buffer solution (pH ~ 7.4) is a

water-based salt solution containing disodium hydrogen
phosphate, sodium chloride or potassium chloride and potassium
dihydrogen phosphate. It helps to maintain a constant pH.
The osmolarity and ion concentration of the solutions match those of the
human body (isotonic). Generally a 10X stock solution is prepared and
the working 1X buffer is prepared by adding 100 mL of 10X PBS to 900
mL of water.

1X PBS buffer contains 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4,

and 1.8 mM KH2PO4. Dissolve 8 g of NaCl, 0.2 g of KCl, 1.44 g of
Na2HPO4 and 0.24 g of KH2PO4. The contents are dissolved in 800 mL of
H2O. The pH is adjusted to 7.4 with HCl. The final volume is made to 1
L.

3. Lysis buffer: The disruption of the cells disturb the internal pH, altering
the structural integrity of proteins and other macromolecules; hence a
buffer solution with a pH equal to the normal intracellular pH is used. A
lysis solution contains 10 mM Tris-Cl buffer, 1 mM EDTA as the
chelating agent, and 0.5% (w/v) SDS as the detergent.

Protein estimation

Spectrophotometer

Cuvette

2% sodium carbonate in 0.1 N sodium hydroxide (reagent A)

0.5% copper sulphate (CuSO4.5H2O) in 1% potassium sodium tartarate

(reagent B)

Alkaline copper solution: Mix 50 mL of A and 1 mL of B prior to use (reagent

C)

Folin-Ciocalteau Reagent (reagent D) – Reflux gently for 10 hours, a mixture

consisting of 100 g sodium tungstate (Na2WoO4. 2H2O), 25 g sodium
molybdate (Na2MoO4.2H2O), 700 mL water, 50 mL of 85% phosphoric acid,
and 100 mL of concentrated hydrochloric acid in a 1.5 L flask. Add 150 g
lithium sulfate, 50 mL water and few drops of bromine water. Boil the mixture
for 15 minutes to remove excess bromine. Cool, dilute to 1 L and filter.

Protein stock - Weigh 50 mg of bovine serum albumin (BSA, fraction V),

dissolve in distilled water, and make up the volume to 50 mL. Dilute 10 mL of
the stock solution to 50 mL with distilled water so that 1 mL of this solution
20 contains 200 μg of BSA.
Experiment 4 Protein Isolation and Estimation by Lowry Method

4.3 PROCEDURE
Protein isolation

Extraction is usually carried out with the isolation buffer. Homogenize 500 mg
of the sample in 5-10 mL of the buffer. Centrifuge at 10,000 rpm for 15
minutes at 4oC to extract the buffer-soluble protein. Use the supernatant for
protein estimation.

Alternately, you can also use the following protocol for protein extraction.

I. EXTRACTION OF PROTEINS FROM CELLS IN SUSPENSION

i) Centrifuge the cell suspension at 2,000 x g for 10 minutes at 4 °C.

The cells are collected at the bottom of the tube. Discard the
supernatant.

ii) Add ice-cold phosphate buffer saline (PBS) to the pellet. Wash the
cells by centrifuging at 2,000 x g for 10 minutes at 4 °C.

iii) Add ice-cold lysis buffer to the cell pellet. Agitate the contents in
microcentrifuge tubes for 30 minutes at 4 °C.

iv) Centrifuge the tubes at 16,000 x g for 20 minutes at 4 °C. Collect

the supernatant in fresh tube and place on ice. Discard the pellet.

v) If the protein needs to be estimated in tissue samples, follow the

procedure given below.

II. EXTRACTION OF PROTEINS FROM TISSUES

i) Dissect the tissue in ice cold conditions. For 5 mg tissue, add 300
µL of ice-cold lysis buffer and homogenize. Add additional 300-600
µL of lysis buffer during homogenization.

ii) Transfer the contents in a centrifuge tube and centrifuge the tubes
at 16,000 x g for 20 minutes at 4°C.

iii) Collect the supernatant in fresh tube and place on ice. Discard the
pellet.

Protein estimation

1. Dissolve bovine serum albumin (BSA) powder in distilled water and

dilute to a concentration of 1 μg/μL. Make a series of dilutions of the
working standard into a series of test tubes. Dilute the samples such that
they fall within the BSA standard range (0-25 μg /100 μL).

2. Pipette out 0.1 mL and 0.2 mL of the sample extract in two other test
tubes. Take a small volume of lysate/ aliquot of the sample (serum or
blood plasma, tissue homogenate, etc.) in a microfuge tube. Dilute the
samples with buffer if required by adding adequate amount of ice-cold
lysis buffer.

3. Make up the volume to 1 mL in all the test tubes. Another tube

containing 1 mL of water serves as the blank. 21
MZOL-002 Laboratory Course-II
4. Add 5 mL of reagent C to each tube including the blank. Mix well and
allow the tubes to stand for 10 minutes.

5. Then add 0.5 mL of reagent D, mix well and incubate at room

temperature in the dark for 30 minutes. This will develop a blue color.

6. Record the readings at 660 nm.

4.4 OBSERVATIONS
Check the quality of the isolated proteins by visualization of protein bands
through sodium dodecyl sulfate polyacrylamide gel electrophoresis (Please
consult Experiment 5).

Prepare a standard curve by setting up a reaction mixture as shown in Table

4.1 and calculate the amount of protein in your sample against the standard
generated with BSA. Express the amount of protein in mg/g or μg/g sample.
Table 4.1: Setting up of reaction mixture for protein estimation

Reagents Samples

Blank Protein standard samples Tissue Tissue

sample 1 sample
2

Protein 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 1
sample (mL)

Water (mL) 1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0* 0*

Alkaline 5 5 5 5 5 5 5 5 5 5 5 5
copper
solution (mL)

Folin- 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5
Ciocalteau
Reagent (mL)

* If necessary, water has to be added to dilute the sample.

The method is based on a combination of two different reactions. The first

reaction involves the reduction of Cu2+ to Cu+ ions as a result of their
interaction with the peptide groups of the protein of the analyzed samples
(biuret reaction) under alkaline conditions. In this case, copper cations form a
complex compound (biuret chromophore) with amide bonds of peptide groups,
during which they are reduced. The biuret chromophore is further stabilized by
tartarate (tartaric acid). Addition of Folin-Ciocalteu reagent increases the
sensitivity of this method about 100 times. The second reaction involves the
reduction of the molybdenum-tungsten heteropoly acid, which is part of the
Folin-Ciocalteu reagent, with Cu+ ions, the amino acid residues of tyrosine,
22 tryptophan, histidine and cysteine to molybdenum-tungsten blue, which has
Experiment 4 Protein Isolation and Estimation by Lowry Method
a blue-violet color and intensely absorb light in the range of 500-750 nm.
The blue colour developed by the reduction of the phosphomolybdic-
phosphotungstic components in the Folin-Ciocalteau reagent, by the amino
acids tyrosine and tryptophan, present in the protein, is measured through
Lowry method.

4.5 PRECAUTIONS
1. During protein extraction, add protease inhibitors like PMSF and
dithiothreitol (DTT) to prevent degradation of proteins.

2. If the protein concentration of the sample is high, perform the dilution of

the sample before estimation of the protein content and measuring the
color intensity at 550 nm. Consider the dilution factor during calculation.

3. A set of standards is needed with each group of estimation preferably in

duplicate. Perform duplicate or triplicate of the unknown samples.

4. Store the Folin-Ciocalteau reagent in amber bottles in refrigerator. A

good quality reagent is straw yellow in color.

5. Folin-Ciocalteau reagent should have no greenish tint. Determine the

acid concentration of the reagent by titration with 1 N NaOH to a
phenolphthalein end-point.

6. If protein estimation is desired in a sample with high phenolic or pigment

content, the extract should be prepared with a reducing agent, preferably
cysteine and NaCI. Precipitate the protein with trichloroacetic acid
(TCA), separate the protein and dissolve in 2N NaOH and proceed.

7. Prepare the dilutions for standard curve generation very carefully.

23
 EXPERIMENT 5
SODIUM DODECYL SULFATE
SULFATE
POLYACRYLAMIDE GEL
ELECTROPHORESIS (SDS
(SDSPAGE)
OF PROTEINS

Structure
5.1 Introduction and Principle 5.3 Procedure
Objectives 5.4 Observations
5.2 Material Required 5.5 Precautions

5.1 INTRODUCTION AND PRINCIPLE

Polyacrylamide gels are composed of polymerized acrylamide chains cross-
linked by a bifunctional agent N, N’-methylene bisacrylamide. The
concentration of polyacrylamide and the extent of cross-linking determine the
range of separation. Addition of bisacrylamide initiates cross-linking of
polyacrylamide monomer chains and confers rigidity and tensile strength to the
gel. Generally, a molar ratio of bisacrylamide:acrylamide of 1:29 is used to cast
the gel. The absolute concentration of acrylamide and bisacrylamide determine
the pore size which in turn regulates the resolution of the gel. The basic
principle of electrophoresis in polyacrylamide gel is to dissociate the proteins
into their individual polypeptide subunits, minimizing the aggregation. Protein
dissociation is performed by using strongly anionic detergent, sodium dodecyl
sulfate (SDS) in combination with a reducing agent and heat. SDS binding
with denatured polypeptides (~1.4 g of SDS per gram of polypeptide) is
proportional to the molecular weight of the polypeptides, which turn negatively
charged. Hence, migration of SDS-polypeptide complexes occurs only on the
basis of the size of the polypeptide. The function of ammonium persulfate is
to provide free radicals for driving the polymerization of acrylamide and
bisacrylamide. TEMED (N, N, N ‘N’-tetramethylethylenediamine) accelerates
the polymerization of acrylamide and bisasrylamide by catalyzing the formation
of free radicals from ammonium persulfate.

SDS-polyacrylamide gel electrophoresis is carried out with a discontinuous

buffer system. The pH of buffer in the reservoirs is different from that used to
Experiment 5 Sodium Dodecyl Sulfate-Polyacrylamide Gel
Electrophoresis (SDS-PAGE) of Proteins
cast the gel. The SDS-polypeptide complexes in the sample, loaded in the gel
migrate through a stacking gel of high porosity. The complexes accumulate in
a very thin zone (or stack) on the surface of the resolving gel. The
discontinuous buffer systems allow concentrating all of the complexes in the
sample into a small volume, increasing the gel resolution. In the discontinuous
buffer system, the sample and the stacking gel contain Tris-Cl (pH 6.8), the
upper and lower buffer reservoirs contain Tris-glycine (pH 8.3), and the
resolving gel contains Tris-Cl (pH 8.8). The chloride ions in the sample and
stacking gel form the leading edge of the moving boundary, while the glycine
molecules constitute the trailing edge. A zone of lower conductivity and
steeper voltage gradient exists between the leading and trailing edges. This
zone thrusts the polypeptides from the sample on to the surface of the
resolving gel. Resolving gel has higher pH that favors the ionization of glycine.
The resulting glycine ions migrate through the stacked polypeptides and
migrate through the resolving gel, immediately behind the chloride ions. After
getting free from the moving boundary, the SDS-polypeptide complexes
migrate through the resolving gel in a zone of uniform voltage and pH and are
separated according to the molecular weight (Fig. 5.1). By using markers of
known molecular weight, it is possible to estimate the molecular weight of the
polypeptide chain(s).

Staining of the proteins is done with Coomassie Brilliant Blue, an

aminotriarylmethane dye that forms strong but not covalent complexes with
proteins, via van der Waals forces and electrostatic interactions with NH3+
groups. It binds nonspecifically to proteins but not to the gel, allowing
visualization of the proteins as discreet blue bands. The gel is immersed for
several hours in a concentrated methanol: acetic acid solution of the dye, and
excess dye is then allowed to diffuse from the gel during prolonged period of
destaining.

Objectives
After doing this experiment, you should be able to:

 cast a polyacrylamide gel and load the protein samples, and

 visualize the profile of protein isolated from any sample.

5.2 MATERIALS REQUIRED

Power supply, capable of supplying up to 500 V and 200 mA

Vertical electrophoresis apparatus with gel casting glass plates and spacers

Buffers and solutions:

1. Acrylamide solution (acrylamide: bisacrylamide 29:1)

2. SDS: Prepare a 10% (w/v) stock solution in deionized water and store at
room temperature

3. Ammonium persulfate: Prepare a small amount of a 10% (w/v) fresh

stock solution in distilled water and store at 4°C 25
MZOL-002 Laboratory Course-II
4. TEMED

5. Tris-glycine electrophoresis buffer: 25 mM Tris base, 250 mM glycine

(pH 8.3), 0.1% SDS

1× Tris-glycine electrophoresis buffer: 25 mM Tris, 250 mM glycine (pH

8.3), 0.1% (w/v) SDS [Prepare a 5× stock of electrophoresis buffer by
dissolving 15.1 g of Tris base and 94 g of glycine in 900 mL of distilled
water. Then add 50 mL of a 10% (w/v) stock solution of SDS and adjust
the volume to 1000 mL with water]

6. Protein molecular weight marker

7. Protein samples

8. 1×SDS gel-loading buffer: 50 mM Tris-Cl (pH 6.8), 2% (w/v) SDS, 0.1%

bromophenol blue, 10% (v/v) glycerol - Store 1× SDS gel-loading buffer
lacking dithiothreitol at room temperature. Add dithiothreitol from a 1 M
stock just before the buffer is used.

Table 5.1: Composition of a resolving gel

Components for 10% gel 10 mL 20 mL

H2O 4.0 7.9

30% acrylamide mix 3.3 6.7

1.5 M Tris Cl (pH 8.8) 2.5 5.0

10% SDS 0.1 0.2

10% ammonium persulfate 0.1 0.2

TEMED 0.008 0.008

Table 5.2: Composition of 5% stacking gel

Components 5 mL 10 mL

H2O 3.4 6.8

30% acrylamide mix 0.83 1.7

1.0 M Tris (pH 6.8) 0.63 1.25

10% SDS 0.05 0.1

10% ammonium persulfate 0.05 0.1

TEMED 0.005 0.01

9. Prepare the staining solution by dissolving 0.25 g of Coomassie Brilliant

Blue per 100 mL of methanol: acetic acid solution. Filter the solution
through a Whatman No. 1 filter to remove any particulate matter.

10. Methanol: acetic acid destaining solution: Combine 900 mL of

methanol: H2O (500 mL of methanol and 400 mL of H2O) and 100 mL of
26 glacial acetic acid.
Experiment 5 Sodium Dodecyl Sulfate-Polyacrylamide Gel
Electrophoresis (SDS-PAGE) of Proteins

Fig. 5.1: Illustration of apparatus for SDS-PAGE

5.3 PROCEDURE
Pouring of SDS-polyacrylamide gel and setting the gel system
1. Wipe the glass plates with acetone and assemble the vertical glass
plates.
2. Prepare appropriate volume of the resolving gel (Table 5.1) in a glass
beaker as given in the above table, mix the components and pour into
the gaps between the glass plates.

3. Allow to polymerize for at least 30 minutes. Wash the top of the gel
several times with distilled water to remove any unpolymerized
acrylamide. Drain off as much fluid as possible, and then remove any
remaining water with blotting paper.
4. Prepare appropriate volume of the stacking gel (Table 5.2) in a glass
beaker as given in the above table, mix the components and pour
directly on to the surface of the polymerized resolving gel.
5. Immediately insert a clean comb into the stacking gel solution, avoiding
the trapping of air bubbles. Add more stacking gel solution to fill the
spaces of the comb completely. Place the gel in a vertical position at
room temperature.

6. After completion of polymerization, remove the comb carefully, so that

the lanes are not distorted. Remove any unpolymerized acrylamide.

7. Mount the gel in the electrophoresis apparatus. Add Tris-glycine

electrophoresis buffer to the top and bottom reservoirs. Remove any
bubbles that become trapped at the bottom of the gel between the glass
plates using bent hypodermic needle attached to a syringe (Fig. 5.1).

Sample preparation and running of the gel

1. Prepare the protein samples in the appropriate volume of l X SDS gel-
loading buffer and heat them to 100°C for 3 minutes to denature the
proteins. Denature the molecular weight marker in a similar way.
2. Load up to 50 µL of each of the samples in the well. Load an equal
volume of 1× SDS gel-loading buffer into any unused well. 27
MZOL-002 Laboratory Course-II
3. Attach the electrophoresis apparatus to an electric power supply and run
the gel either at constant current or constant voltage. Increase the
voltage when the dye front has moved into the resolving gel. Run the gel
until the bromophenol blue reaches the bottom of the resolving gel. Then
turn off the power supply.
4. Remove the glass plates from the electrophoresis apparatus and
dismantle the glass plates.
5. Carefully collect the gel and proceed to the next step of staining.
Staining of the gel with Coomassie Brilliant Blue
1. Immerse the gel in at least 5 volumes of staining solution and place on a
slowly rotating platform for a minimum of 4 hours at room temperature.
2. Remove the stain and save it for future use.
3. Destain the gel by soaking it in the methanol: acetic acid solution on a
slowly rocking platform overnight, changing the destaining solution at
least three or four times. Destaining for 24 hours usually allows as little
as 0.1 µg of protein to be detected in a single band.
4. Take a photograph of the gel.

5.4 OBSERVATIONS
You can observe a series of protein bands, isolated from respective samples
and loaded in each lane of the SDS-polyacrylamide gel. The proteins are
separated on the basis of molecular weight. You can derive an idea regarding
the molecular weight of proteins by comparing them with the standard
molecular weight marker, containing proteins of known molecular weight (Fig.
5.2)

Fig. 5.2: Protein profile in SDS-PAGE

28 1: Molecular weight marker, 2 and 3: Protein profile from two different samples
Experiment 5 Sodium Dodecyl Sulfate-Polyacrylamide Gel
Electrophoresis (SDS-PAGE) of Proteins

5.5 PRECAUTIONS
1. Wear gloves while preparing acrylamide solution, since acrylamide is a
potent neurotoxin.

2. SDS is a neurotoxin and harmful when ingested and irritating for eyes
and skin. Do not inhale the material. Avoid contact with eyes and skin.

3. Add TEMED at the end, since polymerization starts immediately after

addition.

4. Be careful that no air bubbles are trapped within the gel or in the running
buffer.

5. Do rot pre-run the gel before loading the samples, since this procedure
will destroy the discontinuity of the buffer systems.

29
 EXPERIMENT 6
ASSAY OF EXTRACELLULAR α
AMYLASE THROUGH
BACTERIAL CELL
IMMOBILIZATION

Structure
6.1 Introduction and Principle 6.3 Procedure
Objectives 6.4 Observations
6.2 Materials Required 6.5 Precautions

6.1 INTRODUCTION AND PRINCIPLE

The process of making cells immobile on the surface of inert beads so that
they do not react with substrates, products or by-products is known as
immobilisation of cells. This technique prevents the diffusion of cells or
enzymes in a reaction mixture, and permits their recovery from the production
stream by simple solid-liquid separation methods. Immobilization of whole
microbial cells can be achieved in different ways: (i) cells may be directly
bound to water insoluble carrier, viz., cellulose dextran ion-exchange resins,
porous glass, brick, sand, etc. by adsorption, ionic bonds or covalent bonds;
(ii) cells can be cross linked to bi- or multi-functional reagents, viz.,
glutaraldehyde; (iii) polymer matrices, viz., polyacrylamide gel, κ-carrageenan
(a product isolated from seaweed), calcium alginate (alginic acid is extracted
from seaweed), polyglycol oligomers, etc. which may be used to entrap a cell.
Calcium alginate immobilisation is quite commonly used, as it can be
employed for even sensitive cells like plant cells. Immobilization of cells is
advantageous when (i) the enzymes of interest are intracellular and difficult
to be released into the medium; (ii) the extracted enzymes are unstable; (iii)
the cells do not have interfering enzymes, or such enzymes are easily
inactivated or removed; and (iv) the products released into the medium are of
low molecular weight. Cell immobilization has been used for the commercial
production of amino acid, organic acid and NADP+.

The bacteria Bacillus subtilis is an excellent producer of extracellular α-

amylase that catalyses the hydrolysis of starch to produce reducing sugars.
Experiment 6 Assay of Extracellular α-Amylase Through
Bacterial Cell Immobilization
This reaction is measured by the increase in the reducing sugar content using
3, 5 dinitrosalicylate (3, 5 DNS) as reagent, when an orange-colored alkaline
solution of 3, 5 DNS is reduced to an orange-red compound, 3-amino-5-
nitrosalicylate, with glucose being oxidised to gluconic acid. The optical density
of 3-amino-5-nitrosalicylate (the orange-red colored compound) produced is
measured at 540 nm.

Suchan assay, responsible for the production and activity of the extracellular
α-amylase enzyme, produced in each of the two cases by the experimental
(immobilised) and negative control (free) Bacillus subtilis cells, indicates that
fermentative production and activity is much greater in the former case, as
evident from both its intense orange-red colour and the higher OD value at 540
nm with respect to pale orange-red color and lower OD value at 540 nm in the
latter case.

In this experiment, Bacillus subtilis cells are immobilised on to calcium

alginate beads. Calcium alginate beads are not available commercially. They
need to be prepared chemically in the laboratory. Formation of calcium alginate
beads occurs via an exchange reaction. Reaction of sodium alginate with
CaCl2 yields calcium alginate and NaCl.

Objectives
After doing this experiment, you should be able to:

 immobilize Bacillus subtilis cells on calcium alginate beads, and

 detect and assay, respectively, the production and activity of the

extracellular α-amylase produced by immobilized cells of Bacillus
subtilis.

6.2 MATERIALS REQUIRED

A. Media: Luria Broth (LB; for inoculum preparation): Tryptone 2 g; Yeast
extract 1 g; NaCl 1 g; Distilled water 200 mL, pH adjusted to 7.0

B. Production media:

NaCl 0.01 g

(NH4)2SO4 0.02 g

MgSO4 0.005 g

CaCl2 0.0075 g

Tryptone 2g

Distilled water 100 mL

pH adjusted to 7.0

C. Reagents:
1. Freshly prepared 3.5% (w/v) sterile CaCl2 [to be prepared inside
laminar hood]: Prepare by dissolving 3.5 g of CaCl2 in 100 mL of
sterile distilled water. 31
MZOL-002 Laboratory Course-II
2. Freshly prepared 4% (w/v) sterile sodium alginate [to be prepared
inside laminar hood]: Prepare by taking 2 g of sodium alginate
powder in 100 mL sterile conical flask, spreading it out evenly, and
then add 50 mL of sterile water with constant shaking. The
preparation is then mixed well.

3. Freshly prepared starch substrate: Dissolve 3.75 g of soluble

starch in 30 mL of distilled water to make a smooth paste. Add 100
mL of distilled water to this paste, boil for 1 minute and then cool to
room temperature. Dilute with 200 mL of distilled water.

4. Freshly prepared 2N NaOH solution [stopping reagent]: Prepare by

dissolving 8 g of NaOH in 100 mL of distilled water.

5. Freshly prepared 3, 5-dinitrosalicylate (3, 5-DNS)

Solution A: Dissolve 30 g of sodium potassium tartarate in 50

mL distilled water.

Solution B: Dissolve 1 g of 3, 5-DNS in 20 mL of 2 N NaOH.

Mix the two solutions (70 mL), and add 30 mL of distilled water.

6. 0.9% (w/v) sterile NaCl solution

Dissolve 0.9 g of NaCl in 100 mL of distilled water and autoclave.

D. Glasswares: Clean and dry sterile culture tubes, conical flasks, sterile
glass pipettes and beakers

E. Others: sterile centrifuge (falcon) tubes, micropipettes, Sterile

micropipette tips, BOD incubator shaker, Centrifuge machiene, magnetic
stirrer, filter paper, water bath, spectrophotometer, glass cuvette,
autoclave, laminar hood, 70% alcohol, spirit lamp

6.3 PROCEDURE
Day 1: Inoculum preparation

Inoculate 5 mL (20%) of a pure Bacillus subtilis culture in 25 mL of sterile Luria

Broth (LB) [20% (v/v) ratio provides a thick culture for immobilization
purposes)], and incubate on a shaker at 37°C for 24 hours.

Day 2: Immobilization of Bacillus subtilis cells and fermentation

A. For experimental set (immobilized cells)

1. Add 5 mL of the overnight grown pure culture of Bacillus subtilis to

50 mL of sterile LB, and incubate on a shaker at 37°C till the OD
value comes between 0.5-0.6 at 600 nm. (0.5-0.6 OD reading
range signifies that the cells are in their log/exponential phase).

2. Centrifuge 55 mL of the LB culture (that reached 0.5-0.6 OD at 600

nm) at 5000 rpm for 10 minutes.

32 3. Discard the supernatant.

Experiment 6 Assay of Extracellular α-Amylase Through
Bacterial Cell Immobilization
4. Add 5 mL of sterile 0.9% NaCl solution (to maintain isotonicity).

5. Quickly mix 5 mL of total saline cell suspension with 5 mL of sterile

4% sodium alginate taken in a sterile culture tube.

6. Add 10 mL (5 mL sterile 4% sodium alginate + 5 mL of total saline

cell suspension) sodium alginate suspension of Bacillus subtilis
cells to 50 mL of sterile 3.5% CaCl2 solution, drop wise (it is added
drop wise because one drop results in the formation of one bead; if
excess is added, it will disrupt the bead formation) with the help of
sterile glass pipette, with constant stirring on a magnetic stirrer.
This will result in the formation of calcium alginate beads,
containing immobilized B. subtilis cells, due to the exchange
reaction between CaCl2 and sodium alginate.

7. Allow to stand for 40 minutes for sufficient hardening of the beads,

thus formed.

8. Decant excess, unreacted CaCl2 carefully.

9. Thoroughly wash the beads twice with sterile distilled water to

remove any traces of CaCl2; the wash is discarded.

10. Transfer the beads carefully to 50 mL of the sterile production

medium.

11. Incubate on the shaker at 37°C for 48 hours for optimal α-amylase
production.

B. For negative control set (free cells)

1. Add 5 mL of overnight-grown, pure B. subtilis (free cells) culture to

50 mL of sterile LB, and incubate on the shaker at 37°C, till the OD
value comes between 0.5-0.6 at 600 nm.

2. Add total volume of incubated LB (around 55 mL) to 50 mL of

sterile production medium

3. Incubate on the shaker at 37°C for 48 hours for optimal production

of extracellular α-amylase.

Day 3: Assay for the produced extracellular α-amylase activity

1. From the experimental set, filter the spent (fermented) production

medium and collect the filtrate in a 100 mL conical flask.

2. From the negative control set, centrifuge the spent (fermented)

production medium at 5000 rpm for 10 minutes. Collect the supernatant
carefully in a 100 mL of conical flask.

3. Incubate the spent media with 5 mL of freshly prepared starch substrate

at 37°C for 30 minutes (to break down the starch substrate into glucose
by hydrolysis).

4. Terminate the reaction after 30 minutes by adding 1 mL of 2 N NaOH

(the stopping reagent) in both the sets. Allow the reaction mixture to
stand for 10 minutes (time for the stopping reagent to react) at room
temperature. 33
MZOL-002 Laboratory Course-II
5. Collect 6 mL of the reaction mixture from the upper portion of both the
sets, and collect in two culture tubes marked ‘E’ (for experimental) and
‘NC’(for negative control).

6. Add 0.5 mL of 3, 5 DNS in both the tubes.

7. Prepare a blank (marked ‘B’) tube by taking 0.2 mL of starch substrate,

4.8 mL of distilled water, 1 mL of 2N NaOH and 0.5 mL of 3, 5 DNS.

8. Place all the three tubes in boiling water bath for 10 minutes (to allow
orange-red color development, following the conversion of 3, 5 DNS to
3-amino-5-nitrosalicylate).

9. Cool all the tubes, measure the OD value of the orange-red colored
compound (3-amino-5-nitrosalicylate) at 540 nm and record your
observation (Table 6.1).

6.4 OBSERVATIONS

Fig. 6.1: Cells of Bacillus subtilis immobilized on calcium alginate beads

Table 6.1: OD value at 540 nm

Test tube number Observed OD value at 540 nm

Blank (B)

Negative control (NC)

Experimental (E)

Conversion of OD value to product (glucose) formed in grams

In order to calculate the enzyme activity, the OD values obtained (in

experimental as well as negative control) need to be first converted into
product (glucose) formed in grams (Table 6.2).

This can be achieved according to the standard relation:

34 1 OD (at 540 nm) = 0.00154 g of glucose

Experiment 6 Assay of Extracellular α-Amylase Through
Bacterial Cell Immobilization
Table 6.2: Conversion of OD value to gram

Test tube number OD values at 540 nm Product (glucose) formed

(in g)

Blank (B)

Negative control (NC)

Experimental (E)

Calculation of enzyme activity of α-amylase

The incubation period of the enzyme-substrate reaction in this step was 30

minutes, which implies that the amount of glucose formed (in grams) occurred
in 30 minutes.

Calculate the enzyme activity of extracellular α-amylase as shown in the

following table (Table 6.3):

Table 6.3: Calculation of enzyme activity

Test tube number Product (glucose)formed Enzyme activity in g/min

(in g) (product formed in g/30
minutes)

Negative control (NC)

Experimental (E)

From the experimental observations, it is clear that:

1. Cells of a pure culture of Bacillus subtilis have been immobilized (Fig.

6.1).

2. Immobilized Bacillus subtilis cells (experimental) have higher α-amylase

activity (……………) than that (……………) of free Bacillus subtilis cells
(negative control).

3. Immobilized cells are better producers of extracellular α-amylase than

free cells.

6.5 PRECAUTIONS
1. Sodium alginate suspension of Bacillus subtilis cells should be added
drop wise to CaCl2 solution.

2. Grow the culture for sufficient time to attain the desirable OD value.

35
 EXPERIMENT 7
THIN LAYER
CHROMATOGRAPHY

Structure
7.1 Introduction and Principle 7.3 Procedure
Objectives 7.4 Observations
7.2 Materials Required 7.5 Precautions

7.1 INTRODUCTION AND PRINCIPLE

Thin layer chromatography (TLC) is an easy technique for the separation,
identification and characterization of unknown organic compounds like amino
acids, sugars, organic acids, lipids, etc. The basic principle is similar to column
chromatography (adsorption chromatography). The solute competes with the
solvent for the surface sites of the adsorbent. Depending on the distribution
coefficients, the compounds are distributed on the surface of the adsorbent,
containing a binding agent that helps in holding the adsorbent to the glass
plate. The chief advantage of this technique is that it is quite rapid. In case of
volatile solvents, the time required to affect separation is only about 30
minutes; while with nonvolatile solvents, it can be accomplished within 90
minutes.

The separation process is dependent on the relative affinity of compounds

towards both the phases. The compounds in the mobile phase move over the
surface of the stationary phase. The compounds with higher affinity to the
stationary phase move slowly, while the other compounds travel fast. After the
separation process is completed, the individual components in the mixture
appear as spots at respective sites on the plates.

Objectives
After doing this experiment, you should be able to:

 separate and identify organic compounds from their mixtures, and

 make qualitative as well as quantitative analyses of organic

compounds in a sample.
Experiment 7 Thin Layer Chromatography

7.2 MATERIALS REQUIRED

• Glass plate (20×20 cm or 20×10 cm)

• Glass tank with lid

• Spreader

• Solvent

• Adsorbent silica gel

• Sample (e.g., amino acids or sugars extracted with 80% ethanol)

• Standards

• Spraying agent (e.g., ninhydrin for amino acids)

7.3 PROCEDURE
A. Preparation of plates

Take clean, dry, grease-free glass plate and place it on the plastic base
plate over a plane surface.

1. Prepare a slurry of the adsorbent (e.g., silica) in water (sometimes

buffer) in the ratio 1:2 (w/v)

2. Stir the slurry thoroughly for 5 minutes and pour into the applicator,
positioned on the head glass plate. Coat the slurry over the glass
plates at a thickness of 0.25 mm for qualitative analysis by moving
the applicator at a uniform speed from one end to the other.

3. Leave the plates to dry at room temperature for 15-30 minutes.

4. Heat the plates in an oven for 2-3 hours for moisture removal and
activation of the adsorbent on the plate.

B. Sample application

1. Leave 2.5 cm from one end of the glass plate and at least an equal
distance from the edges.

2. To apply sample spots, thin marks are made at the bottom of the
plate with the help of a pencil.

3. Apply the sample and standard(s) on those marks, using either a

micropipette or syringe. Place the spots at equal distance from one
end of the plate.

4. Allow the spots to dry.

C. Developing chromatogram

1. Pour the developing solvent into the tank to a depth of 1.5 cm.
Keep the entire set up for at least an hour with the top of the tank
sealed with grease using a cover plate. Ensure that the
atmosphere within the tank is saturated with solvent vapor. 37
MZOL-002 Laboratory Course-II
2. Remove the cover plate and dip the spotted end of thin layer plate
(sample applied) vertically in the solvent contained within the tank
(Fig. 7.1).

3. Once the solvent reaches to the top of the plate, remove the plate
from the tank, air-dry it and proceed for the identification of the
separated compounds.

Fig. 7.1: Process of TLC

7.4 OBSERVATIONS
1. In case of amino acids, for example, spray the plate with ninhydrin
reagent when specific colored spots will appear for each amino acid
(Fig. 7.2), depending on their Rf value, which is equal to the distance
traveled by the compound divided by the distance traveled by the
solvent front (both measured from the origin).

Fig. 7.2: Amino acid profile in a TLC plate

1: asparagine; 2: histidine; 3: glutamine; 4: methionine; 5: alanine; 6:

phenylalanine; 7: tyrosine; 8: threonine; 9: leucine; 10: glycine; 11:
tryptophan; 12: proline; plate sprayed with SnCl2 2H2O and ninhydrin
reagents; butanol:glacial acetic acid:water ([Link], v/v) used as mobile
38 phase
Experiment 7 Thin Layer Chromatography

7.5 PRECAUTIONS
1. Plate should be absolutely dry before use.

2. Samples should be applied carefully as small spots.

3. Solvent tank with the plate dipped should be air tight.

39
 EXPERIMENT 8
ESTIMATION OF
TRYPTOPHAN

Structure
8.1 Introduction and Principle 8.3 Procedure

Objectives 8.4 Observations

8.2 Materials Required 8.5 Precautions

8.1 INTRODUCTION AND PRINCIPLE

Tryptophan is an essential amino acid needed for normal growth. It is involved
in the synthesis of nicotinamide (vitamin B6), melatonin, tryptamine,
kynurenine and quinolinic acids. Tryptophan participates in the therapy of
several disorders like cardiovascular diseases, autism, chronic kidney
diseases, depression and microbial infections. Therefore, proper intake of
tryptophan through diet is necessary for maintaining body growth and carry out
metabolic functions. Tryptophan is synthesized as a result of condensation of
serine with an indole group by the action of the enzyme tryptophan
synthase. However, tryptophan cannot be synthesized in humans and
animals due to the absence of tryptophan synthase. Hence, tryptophan has to
be supplemented through diet. The maximum limit of safe intake for diet-
added tryptophan is 4.5 g/day for young adults. Cereals especially maize are
usually poor in tryptophan content, while egg, milk proteins and seafood have
higher levels. Considering the nutritional and safety aspects of tryptophan, it is
necessary to properly estimate the tryptophan content in the sample food item.
The indole ring of tryptophan gives an orange-red colour with ferric chloride
under strongly acidic condition. The color intensity is measured at 545 nm.

Objectives
After doing this experiment, you should be able to:

 estimate tryptophan content through colorimetric estimation, and

 compare the level of tryptophan in different samples.

Experiment 8 Estimation of Tryptophan

8.2 MATERIALS REQUIRED

1. Papain solution: Dissolve 400 mg papain in 100 mL 0.1 N sodium
acetate buffer pH 7.0. Prepare the solution fresh.

2. Reagent A: Dissolve 135 mg FeCI3.6H2O in 0.25 mL water and dilute to

500 mL with glacial acetic acid containing 2% acetic anhydride.

3. Reagent B: 30 N H2SO4.

4. Reagent C: Mix equal volumes of reagent A and B one hour before use.

5. Standard tryptophan: Dissolve 5 mg tryptophan in 100 mL of water (50

μg/mL).

8.3 PROCEDURE
1. Weigh 100 mg of sample into a small test tube.

2. Add 5 mL of papain solution, shake well and close the tube.

3. Incubate at 65° C overnight.

4. Cool the digest to room temperature, centrifuge and collect the clear
supernatant.

5. To one mL of supernatant, add 4 mL of reagent C.

6. Mix in a vortex mixer and incubate at 65° C for 15 min.

7. Cool to room temperature and read the orange-red color at 545 nm.

8. Set a blank with 5 mL of papain alone and repeat the steps 3 to 7.

9. Pipette out 0, 0.2, 0.4, 0.6, 0.8 and 1 mL of standard tryptophan and
make up to 1 mL with water. Develop the color similarly, following the
steps from 5 to 7. Prepare a standard curve.

8.4 OBSERVATIONS
Calculate the tryptophan content from the graph by subtracting the
absorbance value of the blank from that of the sample.

Tryptophan content in the sample is calculated using the formula:

Tryptophan value from graph in μg × 0.096

=
Percentage N in the sample

8.5 PRECAUTIONS
1. Handle the spectrophotometer with care.

2. All the calculations should be done carefully.

41
 EXPERIMENT 9
ISOLATION AND ANALYSIS OF
METAGENOMIC DNA

Structure
9.1 Introduction and Principle 9.3 Procedure
Objectives 9.4 Observations
9.2 Materials Required 9.5 Precautions

9.1 INTRODUCTION AND PRINCIPLE

Isolation of metagenomic DNA involves the process of extracting and purifying
DNA from a complex mixture of genetic material derived from various
microorganisms present in an environmental sample such as soil, water or
human gut. Metagenomic DNA therefore contains genetic material from
multiple species, providing a snapshot of the entire microbiome present in the
sample.

Objectives
After doing this experiment, you should be able to:

 obtain a representative sample of the genetic material present in the

microbial community, which can then be used for further analysis and
research,

 explain the diversity of microorganisms including bacteria, viruses,

archaea, fungi, etc. present in a particular environment,

 discus the functional genes present in the microbial community, and

 assess the microbial interaction with each other and also with their
surroundings, and hence various ecological processes.

9.2 MATERIALS REQUIRED

1. Sequence Assembly Software: Software tools like SPAdes, IDBA-UD
and MEGAHIT are often used for assembling the short reads obtained
from metagenomic sequencing into longer contigs or scaffolds.
Experiment 9 Isolation and Analysis of Metagenomic DNA
2. Taxonomic Classification: Tools such as Kraken, MetaPhlAn and
MEGAN are used to assign taxonomic identities to the assembled
contigs or reads, based on sequence similarity to known reference
databases.

3. Functional Annotation: Databases like NCBI's Non-redundant (NR)

Protein database, UniProt and KEGG are commonly used for functional
annotation of metagenomic sequences. Tools like Prokka, MG-RAST
and HMMER are often employed for this purpose.

4. Comparative Analysis: Comparative metagenomic analysis involves

comparing multiple metagenomic datasets to identify similarities and
differences. QIIME2 is used for comparative analysis, including diversity
analysis, differential abundance testing and visualization.

5. Metagenome-Assembled Genome (MAG) Binning: Binning involves

grouping contigs or reads from metagenomic samples into discrete bins,
representing individual genomes. Tools like MetaBAT, MaxBin and
CONCOCT are used for MAG binning.

6. Metagenomic Databases: Several specialized databases store

metagenomic data and provide valuable resources for analysis.
Examples include Integrated Microbial Genomes and Microbiomes
(IMG/M) and the Human Microbiome Project (HMP) database.

7. Commercially available kits for metagenomic DNA isolation

9.3 PROCEDURE
1. Sample Collection: Collect the environmental or biological sample of
interest using appropriate sterile techniques (Fig. 9.1). For example, if
you are studying soil microbiota, collect a soil sample using a sterile
spatula or scoop.

2. Sample Processing: Homogenize the sample to ensure an even

distribution of the microorganisms. This can be done by vortexing,
grinding or sonicating the sample, depending on its nature.

3. Cell Lysis: Break open the microbial cells to release the DNA. Various
methods can be used, such as enzymatic lysis, mechanical disruption or
a combination of both. Enzymatic lysis involves the use of lysozyme,
proteinase K or other cell-lysing enzymes, while mechanical methods
may include bead beating or sonication.

4. Removal of Contaminants: Depending on the sample type, you may

need to remove the contaminants that can interfere with DNA isolation.
For example, in soil samples, humic acids can inhibit DNA extraction.
Treatment with specific reagents like polyvinylpolypyrrolidone (PVPP) or
using commercial DNA extraction kits can help remove the
contaminants.

5. DNA Extraction: Extract the metagenomic DNA using a suitable

extraction method. There are several commercial kits available that
provide specific protocols for metagenomic DNA extraction. These kits
generally involve a combination of chemical and mechanical lysis,
followed by DNA purification steps using spin columns or magnetic
beads. 43
MZOL-002 Laboratory Course-II
6. DNA Purification: Purify the extracted DNA to remove impurities such
as proteins, RNA and residual contaminants. This step typically involves
the use of phenol-chloroform extraction, ethanol precipitation or column-
based purification methods.

7. DNA Quantification and Quality Assessment: Measure the

concentration and assess the quality of the isolated metagenomic DNA
using spectrophotometry (e.g., UV absorbance at 260 nm) or fluorometry
(e.g., using fluorescent dyes like PicoGreen). This step helps determine
the yield and purity of the DNA.

8. Storage: Store the isolated metagenomic DNA under appropriate

conditions, such as at -20°C or -80°C, after adding stabilizing agents like
glycerol or dimethyl sulfoxide (DMSO) to maintain the stability for future
analyses.

9. Electrophorese the isolated DNA on 0.8% agarose gel and visualize

after ethidium bromide staining.

Note: Metagenomic DNA extraction methods can vary depending on the

sample type, the microbial community of interest and the downstream
applications. Optimizing the protocol for your specific needs may require
modifications or use of specialized kits.

Fig. 9.1: Different environmental and human samples employed for the isolation
of community DNA from culturable and non-culturable microbial
44 residents
Experiment 9 Isolation and Analysis of Metagenomic DNA

9.4 OBSERVATIONS
Genomic DNA isolated from different environmental and human samples is
shown in Figure 9.2. The structure of 16S rRNA gene and PCR amplification of
the same using specific primer are represented in Figure 9.3a and Figure 9.3b,
respectively.

Fig. 9.2: Agarose gel electrophoresis of microbial genomic DNA isolated from
environmental and human samples. (A) Lambda genomic DNA digested
with restriction endonuclease HindIII (lane 1); genomic DNA isolated
from sewage water (SW) (lane 2); genomic DNA from soil sample (lane
3); genomic DNA from stool (lane 4); genomic DNA from vaginal swab
(VS) (lane 5); genomic DNA from gastric tissue biopsy (GTB) sample
(lane 6). (B) Genomic DNA isolated through commercial kit or
automated liquid handling system from equal amount of samples.
Lambda genomic DNA digested with restriction endonuclease HindIII
(lane 1); genomic DNA from stool samples using commercial kit (lanes 2
and 3); genomic DNA from GTB samples using commercial kit (lanes 4
and 5); genomic DNA from stool samples using automated liquid
handling system (lanes 6 and 7); genomic DNA from VS samples using
automated liquid handling system (lanes 8 and 9)

Fig. 9.3: Structure of 16S rRNA gene (a) and PCR amplification of 16S rRNA gene
from community DNA, isolated from environmental and human origin
samples (b)

9.5 PRECAUTIONS
1. Be careful while handling the gel and other instruments.
2. Wear gloves during handling of ethidium bromide and avoid contact with
skin. 45
 EXPERIMENT 10
IN SILICO DESIGNING OF
OLIGONUCLEOTIDE PRIMERS
FOR POLYMERASE CHAIN
REACTION

Structure
10.1 Introduction and Principle 10.3 Procedure
Objectives 10.4 Observations
10.2 Materials Required 10.5 Precautions

10.1 INTRODUCTION AND PRINCIPLE

The polymerase chain reaction (PCR) has the remarkable capability to
selectively amplify a single DNA fragment from a complex mixture. This
incredible feat is made possible by the primer specificity. Primers, short
strands of single-stranded oligonucleotides, attach to the template DNA and
initiate DNA synthesis. To achieve exponential amplification of a DNA
fragment, two primers are necessary, each attaching to the opposite ends of
the target DNA. Crucially, the primers must possess a sequence that perfectly
complements the target DNA. Now, let us contemplate the given DNA
fragment (Please keep in mind that in the representation of DNA with both
strands, the top strand runs in the 5'-3' direction). The location of the two
primers is indicated by >>’s.
Experiment 10 In Silico Designing of Oligonucleotide Primers for
Polymerase Chain Reaction
Taq polymerase selectively replicates the required region; primers ought to
ideally bind to the target sequence specifically. When genomic DNA is used as
the template, it is likely that the other sequences exist that either fully or
partially complement the primers. Only a few areas besides the target
sequence should show minimal complementarity in a well-designed primer.
Since a primer that complements an isolated DNA sequence will not result in
the amplification of that specific region, this secondary binding does not
interfere with the PCR process. Only in specific areas does the exponential
amplification take place when the annealed primers are facing each other on
opposing strands. Moreover, there is a higher chance that the primers will
anneal to two complementary sections if a primer is made to be
complementary to a repeating sequence in the genome. Unintentional non-
targeted sequence amplification could occur under such circumstances.

Ensuring specificity in PCR relies on addressing two key concerns:

1. The primers must possess complementarity to the flanking sequences of

the target region.

2. The primers should avoid complementarity to numerous non-target

regions within the genome.

Melting temperature (Tm)

The temperature at which the annealing step of a PCR reaction occurs

depends on the melting temperature (Tm) of the primers. Tm represents the
temperature at which double-stranded DNA molecules undergo partial
denaturation, resulting in an equal distribution of single-stranded and double-
stranded molecules. When the temperature exceeds the Tm, DNA primarily
exists in a single-stranded state, while temperature below the Tm favor the
formation of stable double-stranded structures. Selecting an appropriate
annealing temperature is crucial for the successful binding and hybridization of
primers to the target DNA during PCR, ensuring that the desired DNA
fragment is amplified effectively.

To ensure successful primer binding to the target DNA, it is essential to set the
annealing temperature lower than the Tm of the primers. Typically, the
annealing temperature is set approximately 5ºC below the Tm. If the annealing
temperature is too high, the primers cannot bind effectively to the target DNA.
Conversely, if the annealing temperature is too low, the primers may bind to
non-target sequences that are not perfectly complementary. Therefore, it is
crucial for the two primers used in a PCR experiment to have similar Tm
values. Ideally, the Tm values should be within a 5ºC range of each other, with
closer values being more advantageous for reliable and specific primer binding
during the annealing step.

The specific sequence of a DNA molecule affects its Tm, although the
relationship between sequence and Tm is not straightforward. Generally, DNA
with a higher GC content tends to have a higher Tm. The Wallace formula
can provide a rough estimation of Tm.

Tm = 2 (A + T) + 4 (G + C) 47
MZOL-002 Laboratory Course-II
Alternative formula such as the “nearest neighbor” method exists for
estimating the Tm. Moreover, several websites offer Tm calculation tools,
employing these or other formula.

Two crucial considerations apply to Tm:

1. The two primers should possess similar Tm values to promote balanced

annealing.

2. The Tm should fall within the range of 55-72ºC, with around 60ºC being
an ideal target.

Primer length
When it comes to primer length, a Goldilocks-like balance must be struck – not
too short, nor too long. When primers are too short, their specificity is
compromised. For instance, let us take a 4-nucleotide primer like GATC. While
this primer could potentially bind to a region adjacent to the target sequence, it
would also have the ability to bind to numerous other sequences dispersed
throughout the chromosomes. This can result in the unwanted amplification of
non-targeted sequences.

On the other hand, if primers are excessively long, it impacts the efficiency of
annealing. The rate of primer-annealing increases in direct proportion to the
length of the primer. Consequently, very long primers fail to anneal efficiently,
leading to a reduced yield of the PCR product. For standard PCR, an optimal
oligonucleotide length is typically within the range of 18 to 24
nucleotides. This length is sufficient enough to provide specificity to a
potential target region while still being efficient enough to facilitate proper
annealing.

Product size
The selection of primers plays a critical role in determining the length of the
PCR product. When the two primers are designed to exhibit complementarity
to neighboring regions on the template DNA, it results in the amplification of a
shorter DNA fragment. Conversely, if the primers are targeted to regions that
are further apart, a larger DNA fragment will be amplified. With the use of
basic Taq polymerase, fragments up to 1000 to 2000 base pairs (bp) can be
easily amplified (Specialized polymerases can be employed to amplify larger
fragments). In a standard PCR, it is recommended that the primers are
complementary to regions on the target DNA that are within a range of
approximately 1000 bp from each other.

Hairpins
Complementary sequences within a single molecule can lead to base pairing
through intramolecular interactions. Let us take the example of the primer
GGC GGT ATG ATC CCG CTA GTT AC. This primer has the potential to form
a hairpin structure through internal base pairing (Fig. 10.1). When a primer
undergoes base pairing with its own complementary regions, it cannot
simultaneously base pair with the target DNA. Therefore, it is essential to
design primers in a way that minimizes intramolecular base pairing. The
analysis of intramolecular base pairing is typically carried out using computer
programmes. It is advisable to avoid primers that contain more than three
48 consecutive intramolecular base pairs.
Experiment 10 In Silico Designing of Oligonucleotide Primers for
Polymerase Chain Reaction

Fig. 10.1: Structure of a hairpin

Primer dimers

When self-complementary sequences are present, the highly concentrated

primers have the potential to undergo self-annealing. This self-annealing
prevents the primers from being available to bind to the target DNA. Self-
complementary sequences can be classified into two types: those that result in
hairpins and those that result in primer dimers.

Primers can participate in intermolecular base pairing, which involves the

formation of base pairs between two distinct primer molecules. Heterodimer
formation occurs when base pairing takes place between the forward and
reverse primers, resulting in the formation of a hybrid molecule, composed of
the two distinct primer sequences. In contrast, if base pairing occurs within a
single primer, it is termed as self-dimer formation.

Using the example of previously mentioned primer, several self-dimer

formations can be observed (as depicted in the two boxes below). Both
instances of primer dimer formation present certain issues. The first scenario
illustrates the formation of a highly stable structure characterized by the
presence of multiple base pairs. When the primers are involved in self-dimer
formation, they are unable to bind to the target DNA.

In contrast, the second example is less stable than the first, but it still poses a
problem. The base pairing occurs at the 3' end of the primer. In this scenario,
the second primer can serve as a template for DNA synthesis. As nucleotides
are added to the primers during the reaction, they prevent proper base pairing
with the target DNA. This is a common issue encountered in PCR and can
significantly impact their success.

49
MZOL-002 Laboratory Course-II

G/C content

As mentioned earlier regarding the Tm, it is crucial for the primers to have
approximately equal proportions of G/C and A/T bases, aiming for a balanced
composition. Additionally, it is important to avoid long stretches of G/C or A/T
within the primer sequence. A continuous sequence of A/T bases might
result in weak base pairing, while an extended G/C stretch could
increase the chances of incorrect annealing. It is also advisable to steer
clear of long stretches of a single nucleotide or extended sequences of purines
or pyrimidines, as they can introduce complications in primer design.

G/C clamp

Efficient DNA synthesis relies on the stability of base pairing between the 3'
end of a primer and the corresponding region in the target DNA. To enhance
the stability of this interaction, the primers are typically designed to end with
either a G or a C nucleotide. This choice is made because GC base pairs are
more stable, compared to AT base pairs. The presence of a G or C at the
terminal end of a primer is referred to as a G/C clamp.

1. The optimal length for primers is typically between 17 and 28 bases.

2. The base composition of primers should ideally range from 50% to 60%
G + C content.

3. To enhance priming efficiency and prevent "breathing" of ends, primers

should conclude with a G or C base, or CG or GC.

4. Target the Tm within the range of 55 to 80°C. This is preferred for primer
design.

5. It is crucial to avoid primer self-complementarity, which could lead to the

formation of secondary structures such as hairpins or primer dimers.

6. Particularly, it is important to ensure that the 3'-ends of primers do not

form complementary base pairs, as this would favor the synthesis of
primer dimers over other desired products.

7. Runs of three or more Cs or Gs at the 3'-end of primers should be

avoided, as they may promote mispriming at G or C-rich sequences due
to increased annealing stability.
50
Experiment 10 In Silico Designing of Oligonucleotide Primers for
Polymerase Chain Reaction

Objectives

After doing this experiment, you should be able to:

 design oligonucleotide primers for undergoing efficient PCR, and

 obtain an amplified gene product through PCR using gene-specific

primers.

10.2 MATERIALS REQUIRED

1. Primer3web version 4.1.0

2. Oligocalc

10.3 PROCEDURE
To facilitate primer design, we will utilize two internet applications. The first
application, called Primer3, is available within Biology Workbench. It offers a
comprehensive analysis of target regions and provides recommendations for
forward and reverse primer sequences. Primer3 can be tailored to specific
gene target regions, considering the factors such as product size, primer size,
Tm, GC content, GC clamps and dimer formation.

The second application that we will use is called oligocalc, which is provided
by IDT, one of the companies we rely on for primer orders. Oligocalc offers
various analysis tools for assessing hairpins, homodimers and heterodimers.
We will utilize this application as an additional step to verify the primers,
identified by Primer3.

Let us get started.

1. Begin by accessing the Biology Workbench platform and enter the

specific gene region you wish to amplify using PCR.

2. Launch the Primer3 program within the Workbench.

3. In the primer criteria section of the Primer3 page, make two

modifications to the default settings:

a) Adjust the desired product size range from 100-300 to 400-600.

b) Change the GC clamp length from zero (default) to one.

4. Initiate the analysis process by clicking "Submit."

5. The output from Primer3 will provide an "optimal" pair of primers, along
with their respective locations on the target sequence. Additionally, four
alternative primer pairs will be presented for consideration. 51
MZOL-002 Laboratory Course-II

To verify the primers using Oligocalc, follow these steps:

1. Open a new tab in your browser and navigate to the OligoCalc website.

2. Copy and paste the sequence of the first left primer into the designated
sequence box, located in the upper left-hand corner of the page.

3. Click on the "Hairpin" button, which will show an "mfold" box below the
sequence box. Initiate the analysis by clicking "Calculate" or "Submit" in
the mfold box.

4. An output box will appear, displaying predicted structures. Scroll down to

examine the structures and take note of the number of base pairs of the
hairpin structure, free energy and the location of the 3' end. A suitable
primer should have fewer than 5 base pairs in the hairpin structure, a
free energy lower than -5 Kcal mole-1 and an unstabilized 3' end without
base pairing.

5. Click on the "Self-Dimer" button to open a new window with the results.
A desirable primer should have a free energy value below -5 Kcal mole-1
and should not exhibit significant stability caused by base pairing at the
3' end.

6. Repeat the steps 4 and 5 for the complementary right primer.

7. Click on the "Heterodimer" button, paste the left primer sequence in the
"primary sequence" box, and place the right primer sequence in the
"secondary sequence" box. Click "Calculate."

8. A new window will appear with the results. An ideal primer pair should
have a free energy value below -5 Kcal mole-1 and the 3' ends of the
52 primers should not be stabilized due to base pairing.
Experiment 10 In Silico Designing of Oligonucleotide Primers for
Polymerase Chain Reaction
9. Evaluate all the primer pairs using the aforementioned steps and select
the primer pair that best meets the specified criteria. Note: Please
ensure that you follow the specific instructions and guidelines provided
by the oligocalc website for accurate primer analysis.

AddT7PromoterSequence

To perform additional analysis with the modified left primer and the original
right primer, follow these steps:

1. Concatenate the sequence "TAATACGACTCACTATAGGGAGA" to the

5' end of your selected left primer.

2. Repeat the hairpin, self-dimer and heterodimer analysis with the

modified left primer and the original right primer as the input. If any
issues arise due to the added sequence, you may need to consider
using one of your alternative primers.

Please note that it is crucial to reevaluate the modified primer sequences

to ensure that they meet the necessary criteria for hairpin formation,
self-dimerization and heterodimer formation, as outlined in the previous
instructions.

10.4 OBSERVATIONS
The entire process of primer designing involves thorough computer-based
sequence analysis and the purpose of this experiment is to provide a step-by-
step guidance through each stage of the analysis. It would in turn help you to
visualize the entire procedure of designing of random and gene specific
primers and performing in-silico PCR. You will be able to visualize the
appropriate sized PCR-amplified product only if you have designed the
forward and reverse primers correctly. 53
MZOL-002 Laboratory Course-II

10.5 PRECAUTIONS
The primer design stage is of utmost importance in your PCR experiment.
Inappropriate primer design could lead to minimal or no amplification of the
desired PCR product. Conversely, it may result in the amplification of
numerous undesired DNA fragments. Both the scenarios can significantly
hinder the subsequent cloning steps. Hence, it is crucial to approach primer
design with meticulous care.

54
 EXPERIMENT 11
IDENTIFICATION OF OPEN
READING FRAMES AND IN
SILICO TRANSLATION USING A
NUCLEOTIDE SEQUENCE

Structure
11.1 Introduction and Principle 11.3 Procedure
Objectives 11.4 Observations
11.2 Materials Required

11.1 INTRODUCTION AND PRINCIPLE

DNA, also known as deoxyribonucleic acid, serves as the hereditary material
within a living organism, encompassing all the genetic information necessary
for its development and maintenance. This information is encoded using
adenine (A), guanine (G), cytosine (C) and thymine (T) as genetic codes. The
unique double helix structure of DNA is formed by the complementary pairing
of adenine with thymine and guanine with cytosine. RNA, which differs from
DNA in having uracil (U) instead of thymine (T), is transcribed from DNA in the
nucleus, forming messenger RNA (mRNA). Through the process of
transcription, DNA is converted into messenger RNA (mRNA), wherein each
base pair forms a nucleotide by bonding with a sugar and phosphate
molecule. The mRNA then travels to the cytoplasm, where it is translated into
proteins by ribosomes. In the translation process, sets of three nucleotides,
known as codons, correspond to specific amino acids. The region spanning
from an initiation codon (ATG) to a stop codon (TAA, TAG or TGA) is termed
as an Open Reading Frame (ORF). The ORF defines the sequence that will
be utilized to produce proteins. By analyzing the ORF, it is possible to predict
the amino acids that may be generated during translation. The ORF Finder,
available on the NCBI website, can identify potential protein-coding regions or
ORFs within six different reading frames.

Objectives
After doing this experiment, you should be able to:
 gain an idea regarding Open Reading Frame (ORF) and its
importance,
MZOL-002 Laboratory Course-II
 explain how ORF Finder detects ORFs within a DNA sequence,
utilizing either standard or alternative genetic codes,

 determine all the potential ORFs present in a given sequence, and

 explore the process of conducting a BLAST search for a specific ORF.

11.2 MATERIALS REQUIRED

ORF Finder Program available at NCBI website.

11.3 PROCEDURE

56
Experiment 11 Identification of Open Reading Frames and In Silico
Translation Using a Nucleotide Sequence

57
MZOL-002 Laboratory Course-II

Through the analysis of the ORF, you can make informed predictions
regarding the amino acids that are synthesized during the translation process.
The precise identification of the ORF within a recently sequenced gene holds
significant importance. The detection of the ORF plays a vital role in designing
primers required for experimental techniques such as PCR and sequencing,
facilitating further investigations in molecular biology.

11.4 OBSERVATIONS
ORF Finder is a valuable tool that enables the identification of all the potential
ORFs within a given sequence, which represent regions that have the
potential to code for proteins. The tool visually presents the results using six
horizontal bars, each corresponding to one of the six possible reading frames.
These frames include +1, +2, and +3 for the forward strand, and -1, -2, and -3
for the reverse strand. By considering all the possible reading frames,
researchers can comprehensively analyze the genetic information and predict
the resulting amino acid sequences. The identified sequences can be saved
for further analysis and can also be compared against protein databases using
basic local alignment search tool (BLAST) to identify similar sequences or
proteins. The results obtained from this analysis provide valuable insights into
the possible protein sequences and the length of the identified ORFs,
facilitating a deeper understanding of genetic information and protein
synthesis processes.

58
 EXPERIMENT 12
IDENTIFICATION OF
RESTRICTION ENZYME SITES IN
SEQUENCES AND PERFORMING
IN SILICO RESTRICTION
FRAGMENT LENGTH
POLYMORPHISM (RFLP)
ANALYSIS

Structure
12.1 Introduction and Principle 12.3 Procedure
Objectives 12.4 Observations
12.2 Materials Required

12.1 INTRODUCTION AND PRINCIPLE

NEB Cutter V3.0, developed by New England Biolabs (NEB), is a user-
friendly software program, designed specifically for molecular biologists and
geneticists. Its primary function is to identify and analyze restriction sites within
DNA sequences. By understanding the presence and location of these sites,
researchers can select appropriate restriction enzymes for various molecular
biology experiments, such as DNA cloning, gene mapping and DNA fragment
analysis. The NEB Cutter V3.0 program offers several key features that make
it a preferred choice among scientists. Firstly, it supports a wide range of DNA
sequence formats, including plain text, FASTA, GenBank and EMBL. This
flexibility allows users to work with DNA sequences obtained from different
sources and formats seamlessly. Once a DNA sequence is provided, NEB
Cutter V3.0 performs a comprehensive analysis to identify all potential
restriction enzyme recognition sites within the sequence. It incorporates a vast
and up-to-date database of restriction enzymes, ensuring accurate and
reliable results. The software also provides detailed information about each
enzyme, including the recognition sequence, cut site, overhang and the
availability of the enzyme in the product catalog of NEB. NEB Cutter V3.0 also
offers advanced features to refine the analysis process. Users can customize
MZOL-002 Laboratory Course-II
the parameters, such as specifying the number of cuts per enzyme, defining
the minimum distance between cut sites and selecting specific subsets of
enzymes for analysis. These options allow researchers to tailor the results
according to their experimental requirements. NEB Cutter V3.0 provides an
intuitive and user-friendly interface, making it accessible even to those with
limited computational expertise. It includes a feature called "SimDigest," which
allows the simulation of DNA digestion experiments virtually.

Objectives
After doing this experiment, you should be able to:
 generate graphical outputs, including restriction maps, highlighting the
positions of restriction sites and the resulting DNA fragments,
 plan and design experiments in molecular biology,
 explain the operation of additional tools to enhance the overall utility,
and
 predict the expected fragment patterns based on user-defined
parameters, aiding in experimental planning and troubleshooting.

12.2 MATERIALS REQUIRED

NEBcutter V3.0 ([Link]

12.3 PROCEDURE
I. Determine the restriction enzymes that cut your DNA
NEBcutter serves as a cost-free utility employed for the analysis of restriction
enzymes. Various approaches can be employed when utilizing this tool. This
instructional video will guide you in determining the restriction enzymes,
capable of cleaving your DNA sequence a specific number of instances.

60
Experiment 12 Identification of Restriction Enzyme Sites in Sequences and Performing
In Silico Restriction Fragment Length Polymorphism (RFLP) Analysis

1. To begin, input your DNA sequence into NEBcutter. You have the option
to paste the sequence, upload it from a file or choose from the pre-
61
MZOL-002 Laboratory Course-II
loaded sequences accessible in the tabs. Additionally, you can select a
sequence from a previous project. You will be prompted to indicate
whether your DNA molecule is linear or circular. In case of a circular
sequence, please select the "circular" option. Click submit (Figs. A, B
and C).

62
Experiment 12 Identification of Restriction Enzyme Sites in Sequences and Performing
In Silico Restriction Fragment Length Polymorphism (RFLP) Analysis
E

2. On the default page labeled "Graphical View," you have the option to
choose between "1 cutters,""2 cutters,""3 cutters," or "List 0 cutters." If
you wish to view a comprehensive list of restriction enzymes with
recognition sites within the DNA molecule, select "Custom Digest." Once 63
MZOL-002 Laboratory Course-II
you have selected the desired enzymes, click on "Digest" to visualize
where these enzymes cleave the DNA molecule. The digestion
information can be displayed in different formats such as "graphical
view," "enzyme list," "fragment" list, or "gel." The gel view specifically
showcases digestion patterns for both unmethylated and/or methylated
DNA substrates (Figs. D, E, F and G).

3. By selecting the Enzyme List view and setting the "n-cutters" option to at
least 1 (minimum), you can obtain a comprehensive list of restriction
64 enzyme sites within the DNA sequence. Leaving the "max" field blank is
Experiment 12 Identification of Restriction Enzyme Sites in Sequences and Performing
In Silico Restriction Fragment Length Polymorphism (RFLP) Analysis
acceptable in this case. This feature will present you with all the
restriction enzymes that are capable of cleaving the DNA, along with
information such as the number of recognition sites, the specific
recognition sequence of each enzyme, and the enzyme activity in all four
NE Buffers (Figs. H and I).

Note: The options of 1, 2 and 3 cutters prove beneficial in cases involving the
linearization of plasmid DNA or when determining the appropriate enzyme for
Restriction Fragment Length Polymorphism (RFLP) analysis. 65
MZOL-002 Laboratory Course-II
Note: The option of 0 cutters is valuable for the purpose of introducing unique
restriction sites in DNA molecules through genetic engineering. Prior to
implementation, it is crucial to confirm that the selected site does not already
exist within the plasmid construct. Subsequently, the restriction site can be
introduced to flank the specific DNA region intended for removal.

II. Visualize a restriction digest on a virtual gel

Let us demonstrate how NEBcutter can assist in visualizing a restriction digest

on a virtual gel. We will use the example of PaqCI and the Lambda Phage
genome from NEB.

66
Experiment 12 Identification of Restriction Enzyme Sites in Sequences and Performing
In Silico Restriction Fragment Length Polymorphism (RFLP) Analysis
1. If you have a specific sequence you wish to analyze, you can easily
input it by pasting it into the designated DNA sequence box (Fig. J in
page 65). Alternatively, you have the option to choose from a collection
of frequently used plasmids and phage genomes. Another possibility is
selecting a sequence from a previous project, as depicted in Figures A,
B and C.

67
MZOL-002 Laboratory Course-II
E

2. Let us proceed with visualizing a virtual digest of the Lambda Phage

genome. To begin, click on the "Viral & Phage" option and select
"Lambda NEB" from the provided menu. Since Lambda DNA is linear,
ensure that the "circular" option remains unchecked. After making these
selections, click on the "Submit" button.

However, please note that the resulting image will only indicate enzymes that
cleave the DNA sequence once. In the case of PaqCI, which cleaves more
than once, we need to utilize the NEBcutter Custom Digest feature. To access
this feature, click on the "custom digest" option, as illustrated in Figures D, E,
68 F and G.
Experiment 12 Identification of Restriction Enzyme Sites in Sequences and Performing
In Silico Restriction Fragment Length Polymorphism (RFLP) Analysis
G

69
MZOL-002 Laboratory Course-II
I

3. To find a specific enzyme, you have the option to search by name or

scroll through the provided list. In this case, select PaqCI from the list
and click on the "digest" button. NEBcutter will then display a map of the
sequence highlighting the PaqCI sites. To visualize a gel representation
of this custom digest, click on the "Gel" option, as shown in Figures H, I,
70 J and K.
Experiment 12 Identification of Restriction Enzyme Sites in Sequences and Performing
In Silico Restriction Fragment Length Polymorphism (RFLP) Analysis
K

71
MZOL-002 Laboratory Course-II
M

4. To customize the virtual gel according to your electrophoresis conditions,

you can input the desired length of the gel. Additionally, if you are using
a different gel system, you have the flexibility to input your specific
electrophoresis parameters that correspond to your experimental set up.
You can also specify the type of electrophoresis gel you are using and its
percentage composition, as depicted in Figures L, M and N.

72
Experiment 12 Identification of Restriction Enzyme Sites in Sequences and Performing
In Silico Restriction Fragment Length Polymorphism (RFLP) Analysis
O

5. To include a DNA ladder marker on the virtual gel, select the NEB 1 Kbp
ladder from the drop-down menu. This will allow you to observe the
expected band pattern for a PaqCI digest of Lambda DNA (Fig. O).

By following these steps, you can effectively utilize NEBcutter to

visualize the anticipated band pattern for a PaqCI digest of Lambda DNA
on a virtual gel.

12.4 OBSERVATIONS
Overall, NEB Cutter V3.0 is an indispensable software tool for researchers in
the field of molecular biology. Its ability to quickly identify and visualize
restriction sites, provide comprehensive enzyme information and generate
visual outputs, making it an essential resource for planning and executing DNA
analysis experiments.

73
 EXPERIMENT 13
CONSTRUCTION OF
PHYLOGENETIC TREES USING
DIFFERENT ALGORITHMS

Structure
13.1 Introduction and Principle 13.3 Procedure
Objectives 13.4 Observations
13.2 Materials Required

13.1 INTRODUCTION AND PRINCIPLE

Phylogenetics is the field to explore the genetic relationships among
individuals, whether they belong to the same species or different ones. It helps
us to understand the evolutionary connections between them. A phylogenetic
tree can be rooted or unrooted, depending on whether we know the ancestral
origin or not. The root represents the point where evolution started for the
organisms under study. Branches in the tree illustrate the evolutionary
relationships, while the length of branches indicates the amount of time that
has passed. It is important to note that phylogenetic trees are estimations and
may not precisely represent the true tree of life.

Parsimony is a widely used algorithm in tree drawing. It follows the principle

that the simplest explanation is usually the correct one. Parsimony searches,
through various potential trees, to find the one requiring the fewest genetic
changes to explain the observed differences in sequences. Only informative
sites, which have different residues among sequences and are represented in
multiple alignments, are considered in a parsimony analysis. The number of
inferred evolutionary changes at each informative site is calculated for each
possible tree topology. The topology with the fewest inferred changes across
all informative sites is considered maximally parsimonious. Sometimes, there
can be multiple equally parsimonious tree topologies.

As the number of sequences increases, the number of potential tree

topologies also increases. It becomes impractical to evaluate all the scores for
each topology. The branch-and-bound algorithm is a shortcut method used in
such cases. It establishes an upper limit on the number of allowed
Experiment 13 Construction of Phylogenetic Trees Using Different Algorithms
evolutionary changes by quickly computing a tree using a fast or arbitrary
method. As it evaluates other trees, any exceeding this limit is discarded
before the calculation is completed.

Maximum likelihood methods evaluate every possible tree topology given a

starting set of sequences. These methods are probabilistic and assign
probabilities to each possible evolutionary change at informative sites. The
goal is to maximize the overall probability of the tree. Maximum likelihood
methods incorporate information about substitution rates for amino acids or
nucleotides, similar to the substitution matrices used in multiple sequence
alignment.

FigTree is a standalone program, specifically designed for visualizing

phylogenetic trees. It serves as a graphical viewer and can produce
publication-ready figures. FigTree offers customization options to enhance the
visual interactivity of the phylogenetic tree.

Objectives
After doing this experiment, you should be able to:

 create a high-resolution picture of the phylogenetic tree that you can

publish in your Research article via FigTree tool,

 make several changes to your phylogenetic tree that you have created
using any phylogenetic tree building tool (e.g., MEGA, BEAST, etc.), to
make it visually interactive, and

 gain an overview of the construction of phylogenetic trees, using

different algorithms - CLUSTAL, Maximum Parsimony, Neighbour
Joining and Maximum Likelihood, using FIGTREE to visualise and
represent phylogenetic trees.

13.2 MATERIALS REQUIRED

PHYLIP package

13.3 PROCEDURE

75
MZOL-002 Laboratory Course-II

76
Experiment 13 Construction of Phylogenetic Trees Using Different Algorithms

77
MZOL-002 Laboratory Course-II

78
Experiment 13 Construction of Phylogenetic Trees Using Different Algorithms

igTree Steps:
 Install Java on your PC before moving on, because FigTree is built upon
Java 9.

 Download FigTree on your PC:

 Click on the link below to download FigTree on your PC:

[Link]

 For Mac OS - click on the file with .dmg extension.

 For Windows - click on the file with .zip extension.

 For Linux- click on the file with .tgz extension.

 [It also provides the link to download the source code file of FigTree, if
you are a developer].

 If you are a Windows user, download the file with .zip extension.

 [It will download your file in a zip folder. To extract that particular file, you
must have WinRAR or WinZip preinstalled on your PC].

 After extracting the files, open the FigTree file with .exe extension, which
shows that it is an executable file and hence, it does not require
installation.

 [It will open up the whole window of the FigTree tool on your screen].

 Convert the phylogenetic tree you have created using any Phylogenetic
tree building tool (e.g., MEGA or BEAST) into Newick format.

 [You can input the whole phylogenetic tree into FigTree, but we would
recommend that you use Newick format].

 Note: To have a better understanding of Newick format and how to

convert a phylogenetic tree into Newick format using MEGA, watch our
videos on MEGA and iTOL.

 Go to ‘File’ and then click on ‘Open’ and then select the file having your
phylogenetic tree data in the Newick format, to input your data in the
FigTree tool.

 [It will display you the phylogenetic tree generated out of the Newick
format, to give you the graphical representation of your tree].

 Take the cursor of your mouse on any node of the tree, it will provide
you the information about the node, i.e., the length of the entire node,
and how far on the time scale that particular node came a far from the
root node. 79
MZOL-002 Laboratory Course-II
 By clicking on a particular node, you can make various types of
customizations to that particular node, e.g., coloring, rotating, rerooting,
etc.

 [All these options are available on the Menu bar of the FigTree tool].

Following are some parameters you should apply to your phylogenetic tree to
make it visually interactive:

Layout
To make a circular tree out of your data:

Click on the icon representing the circular tree.

To align all the nodes at the tip of each branch:

Click on ‘Align tip labels’.

To color the whole tree:

Click on ‘Appearance’ then select ‘Label’ and then color.

[It will color all the tree branches based on the color gradient you selected].

You can also change line width, line weight and color gradient by selecting the
appropriate parameters.

Rooting the Tree:

Click on ‘Trees’

Click on ‘Root Tree’ and then select suitable rooting for your tree.

To order the nodes:

Click on ‘Order nodes’ and then select the suitable ordering method
(ascending or descending).

To convert Phylogram and Cladogram:

Click on ‘Transform branches’ and then select the suitable parameter.

[FigTree displays a Phylogram by default, so you can convert it into a

cladogram.]

To edit tip labels:

Click on ‘Tip Label’ and select suitable parameters for ‘Display’, ‘Color by’,
‘Font Size’, etc.

To display how many time a node has evolved:

(An important factor that must be added in your tree to make it publication
ready)

Click on ‘Node Labels’ and then ‘Branch Times’

[It will add numbers to show how many times a node has been evolved]

To add scaling to your tree:

80 Click on ‘Scale Bar’ and then ‘Automatic Scale’

Experiment 13 Construction of Phylogenetic Trees Using Different Algorithms
To show how many scaling is being displayed on your tree:

Click on ‘Scale Axis’

To display with sort of editing you have done on to your tree:

Click on ‘Legends’ and choose suitable parameters.

Note: If you have quite large labels in your dataset, remove extra information
from the labels using a code editor.

To save your tree, go to ‘File’, then click on ‘Export SVG...’ or any other format.

[We would recommend saving your file in SVG or PDF format, it will not distort
your picture of the tree when you zoom in or zoom out]

Summary
In this experiment on FigTree tool, we learnt to create a publication quality
figure out of our phylogenetic tree data (Fig. 13.1). We come to know which
parameters should be applied on to our dataset to make it visually interactive,
more informative and annotated.

Fig. 13.1: Generation of phylogenetic tree by using FigTree

13.4 OBSERVATIONS
The above discussions will help us to generate phylogenetic trees by using
mentioned algorithms in near future. It should be possible to distinguish
between the two possibilities by looking at both the alignment and the
individual tree topologies.

81
 EXPERIMENT 14
VISUALISATION OF PROTEIN
STRUCTURE USING RASMOL:
RASMOL
BASIC ANALYSIS

Structure
14.1 Introduction and Principle 14.3 Procedure
Objectives 14.4 Observations
14.2 Materials Required

14.1 INTRODUCTION AND PRINCIPLE

RasMol is a highly popular molecular graphics programme utilized for
visualizing three-dimensional structures of proteins, nucleic acids and small
molecules. It offers user-friendly functionality, compatibility with various
platforms, minimal computational resource requirements, impressive power
and is available free of charge. The programme serves a wide range of
purposes, including analysis, display teaching and the generation of high-
quality images for publications. RasMol can be run on PC, MACs, SGIs and
other systems.

The programme reads molecular coordinates from different file formats such
as PDB files (x, y, z coordinates), Tripos Associates' Alchemy and Sybyl Mol2
formats, Molecular Design Limited's (MDL) Mol file format, Minnesota
Supercomputer Center's (MSC) XYZ (XMol) format, and CHARMm. RasMol
provides interactive display options for molecules in various representations
and colors. Users can visualize molecules as wireframe bonds, cylinder
'Dreiding' stick bonds, alpha-carbon trace, space-filling (CPK) spheres,
macromolecular ribbons (smooth shaded solid ribbons or parallel strands),
hydrogen bonding, and dot surface representations. Different parts of a
molecule can be individually represented and colored. The programme allows
rotation, translation, zooming and z-clipping (slabbing) of molecules using the
mouse, scroll bars or command line. The generated images can be saved in
multiple formats, including raster or vector PostScript, GIF, PPM, BMP, PICT,
Sun rasterfile, or as MolScript input scripts or Kinemage files. It is important to
note that RasMol does not support docking and model building functionalities.

Additionally, RasMol provides a set of mouse commands that enable users to

manipulate structures effortlessly (Table 14.1). By clicking and dragging
Experiment 14 Visualisation of Protein Structure Using Rasmol: Basic Analysis
across the main window, users can rotate, translate and zoom the displayed
molecules. The X and Y directions correspond to movements within the plane
of the screen, while the Z direction represents movements, perpendicular to
the screen.

Table 14.1: Mouse commands in RASMOL

Action Windows Macintosh

Rotate X, Y Left Unmodified

Translate X, Y Right Command

Rotate Z Shift-Right Shift-Command

Zoom Shift-Left Shift

Slab Plane Ctrl-Left Ctrl

Prior to commencing the tutorial, please utilize your web browser to download
and install the enhanced version of RasMol developed by UC, Berkeley. Once
the installation is complete, launch the RasMol programme. As a result, you
will be presented with three windows: a main window (which appears empty
and black), a command window and a molecules window. In the event that any
of these windows are not visible, access the "Windows" menu and select the
missing window to display it. To ensure optimal visibility, arrange the windows
in a manner that avoids any obstruction or overlapping. Next, visit the protein
databank ([Link] and proceed to download the
"[Link]" file. Although not obligatory, it is recommended to save the
"[Link]" file in the same directory or folder as the RasMol programme to
facilitate easy access during the experiment.

Objectives
After doing this experiment, you should be able to:

 visualize three-dimensional structures of proteins, nucleic acids and

small molecules,

 view and analyze the spatial arrangement and interactions within these
biomolecules,

 measure the distances of the angles involved in two of the hydrogen

bonds,

 study the interactions between DNA and protein,

 measure as well as construct a Phi/Psi Map, and

 observe hydrophilicity, hydrophobicity and amphiphilicity. 83

MZOL-002 Laboratory Course-II

14.2 MATERIALS REQUIRED

RasMol graphics programme

14.3 PROCEDURE
To load the "[Link]" file in RasMol, access the File menu and choose the
option to open the file. If you are unable to find the "[Link]" file in the
RasMol's "Open File" window, ensure that you are searching in the correct
directory. In case the file is not visible, it is possible that you accidentally
saved it in an incompatible format like HTML or a word processing document,
which RasMol cannot recognize. To address this issue, open the file in your
word processing programme and save it as "text only," or repeat the steps
mentioned earlier. If the problem persists, try dragging and dropping the
"[Link]" file directly onto the RasMol icon.

Once you successfully open the "[Link]" file in RasMol, you can
manipulate the DNA-protein complex by rotating, zooming and translating it.
However, it is essential to note that due to the complexity and the abundance
of atoms, performing these actions may not provide significant insights. The
intricate nature of the complex makes it challenging to visually distinguish
features such as alpha-helices or beta-sheets.

Regulating the rendering

One of the primary objectives in this context is to simplify the representation to

highlight specific characteristics and interactions. To begin, it is recommended
to remove excessive details and focus on visualizing the overall fold and
secondary structure of the protein.

To achieve this, access the Display menu and select the "cartoons" rendering
option. If cartoons are not available, choose "ribbons" instead. By doing so,
you should be able to observe the presence of beta-sheets, alpha-helices and
a short segment of DNA.

Next, navigate to the Colors menu and select the "structure" coloring option.
This color scheme aids in illustrating that the protein which in this case is TBP
consists of alpha-helices and beta-sheets.

By following these steps, one can simplify the representation of the protein
structure, focusing on the global fold, secondary structure elements and the
composition of TBP using appropriate rendering and coloring options.

Question #1a: How many different alpha-helices are there in TBP?

Question #1b: Are the helices right-handed or left-handed?

Question #1c: How many different beta-strands are there in TBP?

For this experiment, you type the text that is contained within the quotation
marks. Do not type the quotation marks. To enter text-based instructions, use
the command line. Activate the Rasmol Command Window by clicking on it.
The up arrow on your keyboard allows you to scroll up and repeat or edit your
84 previously-typed commands.
Experiment 14 Visualisation of Protein Structure Using Rasmol: Basic Analysis
Click on the Rasmol Command Window and type.

"restrict protein" this command cuts away all atoms except protein atoms

"select DNA" selects DNA

Pull down the display menu and set the display to ball and stick. Note that this
changes the rendering only of the selected atoms (in this case the DNA).

"color blue" changes the color of the selected atoms to blue. Try green, red,
cyan, etc.

"select hetero" selects non-DNA, non-protein atoms

Pull down the display menu and set the display to spacefill. Now you can see
the oxygen atoms from water molecules. In an x-ray diffraction experiment,
hydrogen atoms are generally not observable, so they are left out of the
coordinate file.

"color red" changes the water oxygen color to red

Let us take a look at the DNA in the absence of everything else.

"restrict DNA"

Pull down the display menu and set the display to spacefill.

"select c or g"

"color red"

"select a or t"

"color green"

Question 2a: How many AT base pairs are there in this DNA fragment?

Question 2b: How many CG base pairs are there in this DNA fragment?

Question 2c: Does the DNA seem to be linear or bent?

Question 2d: What are the terminal base pairs?

Let us take a closer look at a part of the DNA.

Pull down the display menu and set the display to sticks.

"restrict t2, g3, c114, a115" turns off everything but a dinucleotide step (i.e.
two base pairs plus the backbone)

"select all"

"color red"

"select c114"

"color cyan"

"center g3" sets the rotation center to residue g3 85

MZOL-002 Laboratory Course-II
Zoom in to get a closer view of this dinucleotide fragment. Rotate it around
and admire it. If you click on an atom, some information about that atom pops
up in the command window. Again notice that the hydrogen atoms are
missing.

Question #3a: What base is paired with cytosine 114? What base is stacked
on cytosine 114?

"color cpk" sets the color of the DNA to Corey-Pauling-Koltun; N is blue, O is

red, C is gray, etc)

Pull down the display menu and set the display to spacefill.

Question #3b: How many of each type of atom (nitrogen, oxygen, carbon, iron,
phosphorus, etc., omit hydrogen) are there in the dinucleotide?

Measuring distances

To measure distances between atoms in the dinucleotide, you can click on the
[Distance] button in the Molecules Window, which enables this function. By
selecting any two atoms, the distance between them will be displayed in the
Command Window. If you activate the [Keep labels on screen] option in the
Molecules Window, the atom names and their respective distances will remain
visible.

An alternative method is to type "set picking distance" in the command line to

enable the distance measurement feature.

For Question 4a, you are required to measure the length of all hydrogen bonds
in the two base pairs. Create a table with columns such as residue name 1,
atom name 1, residue name 2, atom name 2, and distance. This table will
allow you to record and analyze the hydrogen bond information.

To turn off the distance measurement function, simply click the [Distance]
button again.

Similarly, to measure angles, you can use the [Angle] button in the Molecules
Window, which activates this feature. By selecting any three atoms, the angle
between them will be shown in the Command Window.

Alternatively, you can enter "set picking angle" in the command line to enable
the angle measurement capability.

These methods enable you to measure distances and angles between atoms
in the dinucleotide, facilitating the analysis of the molecular interactions and
structural characteristics.

Question #5a: For carbon 4 of the guanosine, measure the bond distances
and bond angles relating all the atoms that are bound to it. What is the
hybridization of carbon 4?

Question #5b: For the carbon 4' (4 prime; primes are indicated by * in Rasmol;
the primed atoms are located in the sugar) of the guanosine, measure the
bond distances and bond angles relating all the atoms that are bound to it.
86 What is the hybridization of that carbon?
Experiment 14 Visualisation of Protein Structure Using Rasmol: Basic Analysis
Question #5C: Measure all the angles involved in two of the hydrogen bonds.
You should arrive at two angles for the external hydrogen bonds and four
angles for the internal hydrogen bonds.

Click on the [Angle] button a second time to toggle that function off.

Measuring torsion angles

A torsion angle, such as phi and psi, is determined by the relative positions of
four atoms. In the context of peptides and proteins, phi and psi angles play a
crucial role in characterizing the conformation of each amino acid residue. A
comprehensive explanation of phi and psi angles and their significance can be
found in Biochemistry, Voet and Voet, 2nd Edition.

To measure torsion angles, specifically the dihedral angles, you can utilize the
[Dihedral] button in the Molecules Window, which activates this function.
Alternatively, you can enter "set picking torsion" in the command line to enable
the torsion angle measurement feature.

By selecting any four atoms that are linearly bonded, the dihedral angle
relating to these atoms will be displayed in the Command Window. It is
important to note that when the four atoms lie in the same plane, the dihedral
angle is zero.

These methods allow you to measure torsion angles and specifically

determine dihedral angles between four atoms, aiding in the characterization
of molecular conformations and providing insights into the structural properties
of peptides and proteins.

Question #6a: Locate O4', C1', N1, and C2 of T2 (which is a pyrimidine; note
that in some structures the O4' is called the O1'). With the dihedral function
toggled on, click on these four atoms in the order given. Measure the torsion
angle. This torsion angle is called the glycosidic torsion.

Question #6b: Measure each glycosidic torsion angle of the dinucleotide.

There are four of them. For purines (A and G), the relevant atoms are O4', C1',
N9 and C4.

Click on the [Dihedral] button a second time to toggle that function off.

Measuring Phi and Psi, constructing a Phi/Psi map

Here we will make a phi/psi map of an alpha-helix and a beta-sheet. Check
here [phi and psi] for the meaning of the torsion angles phi and psi. To help
perform this task, look at an example of a Phi/Psi map (as shown in Voet and
Voet, 2nd edition).

Part 1: alpha-helix

First simplify the representation and make each type of atom in the backbone
a different color.

"select all"

Set display stick.

"restrict backbone and 314-330" turns off side chains and everything but one
helix. 87
MZOL-002 Laboratory Course-II
"center 320"

"color red"

"select *.n"

"color blue"

"select *.ca"

"color green"

"select *.c"

"color yellow"

To activate the dihedral angle measurement feature, you can simply click on
the Dihedral button in the Molecules Window.

To measure phi, for one of the residues, click on four atoms in order

C' (yellow), then Ca (green), then N (blue), then C' (yellow).

To measure psi, click on four atoms in order

N (blue), then C' (yellow), then Ca (green), then N (blue).

To deactivate the dihedral angle measurement feature, you can click on the
Dihedral button in the Molecules Window again.

Question #7a: Measure all the phi and psi angles for this fragment. You may
want to change the center for each pair, to walk down the peptide. Check the
sign by viewing directly down the appropriate bond (some versions of Rasmol
contain a bug that give an error in the sign). Make a table of residue name, phi
and psi.

Part 1: beta-sheet

"select all"

Set display stick.

"restrict backbone and (160-169 or 253-259)" turns off side chains and
everything but two beta-strands.

"center 164"

"color red"

"select *.n"

"color blue"

"select *.ca"

"color green"

"select *.c"

88 "color yellow"
Experiment 14 Visualisation of Protein Structure Using Rasmol: Basic Analysis
Question #7b: Measure all the phi and psi angles for these two fragments.
Again you may want to change the center and check the sign. Add these
values to your table from question 7a.

Question #7c: Graph phi versus psi. Set the limits of both axes from -180 to
+180 degrees.

Studying interactions between DNA and protein

Now let us study how this protein binds to the DNA.

"select all" selects all atoms

Set display to Cartoons

"color cyan"

"select DNA"

"color white"

Set display to Spacefill

Zoom back and rotate the complex, and you should see that some of the beta-
sheets interact with the DNA (are near it) and while the alpha-helices are
remote from the DNA. Let us use some of RasMol's powerful features to find in
detail out how the protein interacts with the DNA.

"select protein"

Set display to stick.

"select protein and backbone"

Set display to cartoons. This series of command allows you to visualize

secondary structure (helices and sheets) and the protein side chains, too.

"select within (10.0, DNA) and protein" selects all protein atoms that are within
10.0 Angstroms from the DNA.

"color yellow"

"select within (6.0, DNA)" selects all atoms that are within 6.0 Angstroms from
the DNA. You can use the up arrow on the keyboard to revisit previous
commands.

"color blue"

"select within (4.0, DNA)"

"color red"

This series of commands has colored your protein by layers from the DNA, like
an onion. The red atoms are essentially in van der Waals contact with the
DNA. The blue atoms are a little further away, and the yellow still further.

Click on some of the red atoms to find which residues they are. It may be
easier to see if you:

"select DNA" 89
MZOL-002 Laboratory Course-II
Set the display to stick.

Let us find out which atoms of the protein make short contacts with phosphate
oxygen atoms.

"select within (2.9, (*.o1p or *.o2p)) and protein" Six atoms are selected

"color violet"

Set the display to spacefill.

Question #8a: Compile the data for each of the six close contacts between
protein and DNA phosphate groups. Make a table with the columns - protein
residue, protein atom, DNA residue, DNA atom, distance.

Studying hydrophilicity, hydrophobicity and amphiphilicity

RasMol can show locations of polar and non-polar residues, and tell you if
alpha-helices are amphiphilic.

"select protein"

set display to stick

"select backbone"

set display cartoon

"select hydrophobic" selects all hydrophobic residues

"color red"

"select polar" selects all polar resides

"color cyan"

"select arg, lys, asp, glu" selects charged residues (not histidine, which is
sometimes charged).

"color blue"

Question #9a: Which region of the protein contains the most polar residues?

Question #9b: Which region of the protein contains predominantly non-polar

residues?

Question #9c: Find the starting and ending residues of one of the alpha-helces
of TBP. Determine the sequence. Construct a helical wheel of your alpha-
helix. Check here for information on helical wheels.

Question #9d: Is this alpha-helix amphiphilic? Why?

Identifying hydrogen bonds

The "hbonds" feature is used to calculate hydrogen bonds within the
programme. Since the programme lacks precise information about the
positions of hydrogen atoms, it relies on certain assumptions during the
calculation process.

To activate the calculation of hydrogen bonds, you can use the command
"hbonds on". This command enables the programme to detect and analyze
90 hydrogen bonds in the system.
Experiment 14 Visualisation of Protein Structure Using Rasmol: Basic Analysis

Conversely, if you want to deactivate the calculation of hydrogen bonds, you

can use the command "hbonds off". This command disables the detection
ability of hydrogen bonds for the programme.

In summary, the "hbonds" function performs hydrogen bond calculations, and

you can enable or disable this feature using the commands "hbonds on" and
"hbonds off" respectively.

This function seems to work within a protein but not between the protein and a
ligand.

Question #10a: Turn on the hydrogen bonds within your alpha-helix (from
above). Measure the length of each hydrogen bond. Make a table with atom 1,
atom 2 and length. What is the average hydrogen bond length? What is the
dispersion (given by the standard deviation).

Making illustrations

In this section, you will make an illustration showing two hydrogen bonding
interactions between the DNA and the protein.

"select all"

Set display to spacefill.

"color cpk"

"restrict (290 and protein) or (6,7,8 and DNA)"

"background white"

Zoom and rotate these fragments of the complex until the hydrogen bonding
interactions between the DNA and protein can be clearly observed. You can
recognize the hydrogen bonds by the penetration of van der Waals surfaces.

To store the current view as an image file, access the Export Menu and
choose the preferred file format, such as GIF or any other format of your
choice. Save the file to a location of your preference. Subsequently, import the
saved image file into a graphics-software like Photoshop. Utilize the labeling
features in the graphics programme to add labels to the residues or perform
any desired modifications. Write your name on the bottom right of the figure.
Print the figure, preferably on a color printer.

Rasmol Help

RasMol provides a built-in online help system that you can utilize for guidance.
To access specific information, you can use the following commands:

"help commands" provides a list of available commands.

"help colour" (or "help color") provides a list of colors that you can use.

"help expressions" and "help sets" provide partial lists of expressions for
selecting or restricting atoms. 91
MZOL-002 Laboratory Course-II

[Link] structure in RasMol programme

92 A
Experiment 14 Visualisation of Protein Structure Using Rasmol: Basic Analysis

[Link] structure in RasMol programme by changing the display; A.

Spacefill; B. Ribbons

14.4 OBSERVATIONS
Finally, we can observe several attributes of a protein structure by using
Rasmol. The following table would provide Rasmol Expressions (note there
are two types of wildcard; * & ?

Select expression Result

select all selects everything

select hydrophobic selects all hydrophobic residues

select polar selects all polar residues

select alpha selects all alpha-carbons

select helix selects all residues in alpha-helices

select sheet selects all residues in beta-sheets

select ligand selects ligands

select water selects water molecules

select DNA selects DNA atoms

93
MZOL-002 Laboratory Course-II

select at selects adenine and thymine

select cg selects cytosine and guanine

select 14 selects residue number 14

select 14, 21 selects residue numbers 14 and 21

select 14-21 selects residue numbers 14 through 21

select 14-21, 35 selects residue numbers 14

through 21 and 35

select atomno=1259 selects atom number 1259

select arg selects all arginine residues

select arg43 selects arginine 43

select [Link] selects Ca atom of arginine 43

select [Link] selects all Ca atoms of arginine

select *.cb selects all Cb atoms

select arg.c?? selects all carbon atoms of arginine

select arg43.* selects all atoms of arginine 43

select *.?e? selects epsilon atoms of all residues (the 2nd ? is

required because some residues have e1 and
e2)

select within (8.0, ser) selects all atoms within 8.0 Å of all serine
residues

select within (6.0, 14-21,35) selects all atoms within 6.0 Å of residue numbers
14 through 21 and 35

94
 EXPERIMENT 15
STUDY OF GEOTAXIS,
PHOTOTAXIS, CHEMOTAXIS
AND HYDROTAXIS IN
EARTHWORM

Structure
15.1 Introduction and Principle 15.4 Objective 3
15.2 Objective 1 Materials Required

Materials Required Procedure

Procedure Observations

Observations 15.5 Objective 4

15.3 Objective 2 Materials Required

Materials Required Procedure

Procedure Observations

Observations 15.6 Precautions

15.1 INTRODUCTION AND PRINCIPLE

Living organisms exhibit diverse behavioral adaptations with respect to their
varying environmental cues. Such environmental stimuli include bright light,
gravity, moisture and various chemical substances. Earthworms, belonging to
the Phylum Annelida and Class Oligochaeta, exhibit certain unique ethological
manifestations, in terms of sensitivity to certain stimuli. Such movement of a
living organism in response to a stimulus is known as kinesis or taxis. While
the term ‘taxis’ refers to the directional, specific movement, either towards or
away from a stimulus, the term ‘kinesis’ refers to the random, non-directional
movement in the presence of a stimulus. If the earthworm moves toward the
stimulus, then the movement is called positive taxis. If the earthworm avoids
or moves away from the stimulus, it is said to exhibit negative taxis. The
presence of stimuli such as light, gravity or chemicals can result in taxis.
Taxis-based behaviors may be further classified according to the nature of the
environmental stimuli producing the response. Phototaxis is the ethological
MZOL-002 Laboratory Course-II
response in the presence of bright light. Hydrotaxis refers to the movement of
the living organism in response to moisture. Chemotaxis refers to the
movement of the living organism in response to a specific chemical cue.
Geotaxis refers to the innate behavioral response or movement of the living
organism in response to gravity. This experiment is a part of animal behavior
study. Earthworms are usually collected from soil or maintained in the
laboratory for practical purposes. Almost similar-sized earthworms are
acclimatized in the laboratory conditions for at least three days before the
relevant experimentation.

I. Studying geotaxis in earthworm

15.2 OBJECTIVE 1
After doing the experiment, you should be able to:

 demonstrate the nature of the response to gravity or geotaxis-based

behavior in earthworm (Fig. 15.1).

Fig. 15.1: Studying geotaxis in earthworm

15.2.1 Materials Required

• Earthworms

• Work table

• Moist filter paper (or water paper towel)

• Rough cardboard paper (earthen-colored paper)

• Protractor (geometry box)

• Measuring scale

• Dissecting tray

• Pen

96 • Stop watch
Experiment 15 Study of Geotaxis, Phototaxis, Chemotaxis and
Hydrotaxis in Earthworm
15.2.2 Procedure
The earthworm has its own dorsal and ventral side, the ventral side being the
side facing the ground.

1. Take an earthworm and flip over at least three times, at different points
or places, in the dissecting tray, to find out if there is any change in its
movement.

2. Repeat the experiment with three different sets of earthworms, being

tilted at different points in the dissecting tray. It is recommended that the
experiment needs to be repeated with three different sets of earthworms
for confirmation.

3. In the second phase of the experiment, make an arrangement to create

a desired slope angle of the cardboard. The cardboard must be rough
and earthly colored.

4. Create different angular slopes (30°, 45°, 60°) with the cardboard, with
the help of the protractor (Fig. 15.2). Keep a zero-degree slant (no slope)
as a control.

5. Release the acclimatized earthworms slowly just in front of the slants of

different angles.

6. Place in front of the cardboard slant, a moist filter paper containing

earthworms. Maintain a gap of 5 cm from the margin, at the beginning of
the slope.

7. Count at specific time the number of earthworms crossing the 5 cm line

on the slant.

Fig. 15.2: Creation of different angular slopes with protractor 97

MZOL-002 Laboratory Course-II
8. Note the nature of the behavioral response in terms of the movements of
the earthworms. Depending upon the movement patterns, you will be
asked to conclude whether the response is positive or negative geotaxis.

15.2.3 Observation
Table 15.1: Movement-based observation (Ventral side being flipped
upside)

Earthworm 1 Earthworm 2 Earthworm 3

Spot (i) Turns upside down Turns upside down Turns upside down

Spot (ii) Turns upside down Turns upside down Turns upside down

Spot (iii) Turns upside down Turns upside down Turns upside down

Table 15.2: Angular slope-based movement

Angle of Number of Number of Percentage of

slope earthworms earthworms that earthworms showing
released in the crossed the 5 cm positive geotaxis
moist filter paper line on the slanted movement
just in front of the cardboard
cardboard

0° 10 6 60

30° 10 3 30

45° 10 2 20

60° 10 1 10

From the first set of experiments, it is clearly evident that the earthworms are
seen to return to their ventral side position facing the ground, whenever flipped
or tilted, signifying positive geotaxis behavior (Table 15.1).

From the angular slope-based movement, it is found that the percentage of

earthworms showing positive geotaxis movement decreased as the angular
slope of cardboard increased (Table 15.2).

Hence, the results clearly illustrate that earthworms exhibit positive geotaxis,
thereby moving toward gravity. Earthworms can sense the direction of gravity
and thus respond with the movement towards the soil, resulting in positive
geotaxis.

(II) Studying phototaxis in earthworm

15.3 OBJECTIVE 2
After doing the experiment, you should be able to:

 demonstrate the nature of the response to light or phototaxis-based

98 behavior in earthworms.
Experiment 15 Study of Geotaxis, Phototaxis, Chemotaxis and
Hydrotaxis in Earthworm
15.3.1 Materials Required
• Earthworms

• Work table

• Dissecting tray

• Stop watch

• Aluminum foil and flash light

15.3.2 Procedure
1. Collect an earthworm as before. Take a dissecting tray. In the first set of
the experiment, cover half portion of the tray with a piece of shining
aluminum foil.

2. In the second set of the experiment, shine a flash light on one side of the
tray, keeping the rest of the tray area darkened.

3. You will be asked to observe the behavior of the earthworm for a time
span of 1 minute. Every ten seconds, note the change of location of the
earthworm in response to light.

4. Repeat both the sets of the experiment with three different earthworms
for validation.

15.3.3 Observations
Table 15.3: Earthworm response to aluminium foil

Time elapsed Dark or non-shining Aluminium foil

(second) area of tray portion of tray

0 X √

10 X √

20 √ X

30 √ X

40 √ X

50 √ X

60 √ X

Table 15.4: Earthworm response to flashlight

Time elapsed Dark area Flash light

(second)

0 X √

10 √ X

20 √ X
99
MZOL-002 Laboratory Course-II

30 √ X

40 √ X

50 √ X

60 √ X

From the first set of the experiment, it is clearly evident that the earthworms
are seen to move away from the shining aluminium foil area on the dissecting
tray. The movement clearly signifies negative phototaxis behavior (Table
15.3).

From the second set of the experiment, it is found that, with time, the
earthworm moves towards the dark area, i.e., away from the flash light (Table
15.4).

Hence, the results clearly illustrate that earthworms exhibit negative

phototaxis, thereby moving away from bright light and towards darkness.

(III) Studying chemotaxis in earthworm

15.4 OBJECTIVE 3
After doing the experiment, you should be able to:

 demonstrate the nature of the response to chemicals or chemotaxis-

based behavior in earthworms.

15.4.1 Materials Required

• Earthworms

• Work table

• Dissecting tray

• Moist filter paper (or water paper towel)

• Ammonia

• Q-tip

15.4.2 Procedure
1. Take an earthworm in a dissecting tray.

2. At first, dip a Q-tip in ammonia and place near the anterior end or the
head region of the earthworm. Be careful not to touch the skin of the
earthworm or else it may render a burning sensation to the earthworm.

3. You will be asked to determine the response of the earthworm to

ammonia. Perform three different trials with different sets of earthworms
100 for consistency and accuracy.
Experiment 15 Study of Geotaxis, Phototaxis, Chemotaxis and
Hydrotaxis in Earthworm
15.4.3 Observations
Table 15.5: Earthworm response to Q-tip coated ammonia

Number of observations Anterior end response

Earthworm 1 √

Earthworm 2 √

Earthworm 3 √

From the experiment, it is clearly evident that the earthworms are seen to
move away from the Q-tip dipped in ammonia. In response to the ammonia-
coated Q tip, we find that the anterior end of the earthworm is sensitive to
ammonia. The results clearly demonstrate that the earthworms display
chemotaxis to ammonia. Earthworms are able to respond to the chemical
signals in the air, through the use of chemoreceptors. The buccal receptors at
the anterior end, in fact, are especially responsible for the chemotactic
behavior exhibited by the earthworms (Table 15.5).

(IV) Studying hydrotaxis in earthworm

15.5 OBJECTIVE 4
After doing the experiment, you should be able to:

 demonstrate the nature of the response to moisture or hydrotaxis-based

behavior in earthworms.

15.5.1 Materials Required

• Earthworms

• Work table

• Dissecting tray

• Stop watch

• Paper towel

• Dissecting tray

15.5.2 Procedure
1. Place a damp paper towel on one side of the dissecting tray. Place a dry
paper towel on the other side of the dissecting tray.

2. Place an earthworm in the tray in such a way that half part of the body of
the earthworm lies on the damp paper towel, while the other half of the
body is on the dry paper towel.

3. You will be asked to record the response of the earthworm. Note the
direction of its movement. At first, place the head on the damp side,
while in the second case, place the anterior end on the dry side. 101
MZOL-002 Laboratory Course-II
4. Perform at least six readings or trials, alternating the head region or
anterior end of the earthworm as described. Perform three different trials
with different sets of earthworms for consistency and accuracy.

15.5.3 Observations
Table 15.6: Earthworm response to moisture

Anterior end starts on dry side Response (movement)

Reading 1 Movement away from the dry side towards

the damp side

Reading 2 Movement away from the dry side towards

the damp side

Reading 3 Movement away from the dry side towards

the damp side

Anterior end starts on damp side Response (movement)

Reading 1 Movement restricted to the damp side

Reading 2 Movement restricted to the damp side

Reading 3 Movement restricted to the damp side

From the various readings of the experiment, it is clearly evident that the
earthworm is seen to move towards the damp or moist side of the dissecting
tray, i.e., away from the dry area on the dissecting tray. The response of the
earthworm clearly signifies positive hydrotaxis behavior (Table 15.6).

15.6 PRECAUTIONS
1. During all sets of the experiments mentioned, you must keep the
earthworm moist using a paper towel, since the earthworms perform
cutaneous respiration, i.e., obtain oxygen via skin.

2. Handle the earthworms gently and with care, or else there may be
different impacts or results, evident from their respective behaviours or
movements.

102
 EXPERIMENT 16
STUDY OF THE RESPONSE OF
WOODLICE TO HYGROSTIMULI

Structure
16.1 Introduction and Principle 16.3 Procedure
Objectives 16.4 Observations
16.2 Materials Required 16.5 Precautions

16.1 INTRODUCTION AND PRINCIPLE

Living organisms exhibit diverse behavioral adaptations with respect to their
varying environmental cues or stimuli. Hygrosensation or the ability to detect
humidity represents one of the significant sensory characteristics in various
animals. Many organisms may exhibit movement in response to the stimulus
of humidity or moisture; the corresponding stimuli are called hygrostimuli and
the specific sensory organs to detect humidity are called hygroreceptors.
Woodlice or pill bugs are terrestrial crustaceans often exploited as behavioral
models for investigating movement-related responses (taxis and kinesis).
Woodlice display kinesis-type responses while searching for ideal humidity
conditions as part of homeostasis.

A choice chamber is usually composed of connected compartments in a large

plastic Petri dish, each designed to simulate specific environmental settings
(moist/dry). A choice chamber experiment helps to analyze the behavior of
woodlice by observing their movements through the preferred compartments.
The preferred habitat settings of woodlice are reflected in their choice of
chamber partitions that more closely simulates their natural setting.

Objectives
After doing this experiment, you should be able to:

 explain the nature of the response of woodlice to hygrostimuli with the

help of woodlice choice chamber experiment, and

 investigate the responses of woodlice to moist/dry conditions in a

choice chamber.
MZOL-002 Laboratory Course-II

16.2 MATERIALS REQUIRED

1. Woodlice (collected from local habitat) (Fig. 16.1)

Fig. 16.1: Woodlice

2. Choice chamber with nylon mesh fabric (Fig. 16.2)

Fig. 16.2: Choice chamber

3. Filter paper or paper towels (as moisture reservoir): Moist filter paper in
one compartment can simulate moist or damp conditions.

4. Calcium chloride granules (as desiccant): Calcium chloride granules in

one compartment can simulate dry conditions since they act as
desiccants and absorb moisture from the air.

16.3 PROCEDURE
1. Set a choice chamber, about half an hour to 1 hour, before the actual set
of observations. The choice chamber should offer two types of ambience
(moist and dry). Set two choice chambers: (i) dry (calcium chloride
104 granules) and moist (moist filter paper) and (ii) control (Fig. 16.3).
Experiment 16 Study of the Response of Woodlice to Hygrostimuli

Fig. 16.3: Types of choice chambers

2. Secure the nylon fabric sheet on the base, so that the woodlice may
crawl over the nylon sheet and then move to the base. The lid is then
secured properly (Fig. 16.4).

Fig. 16.4: Securing of the nylon fabric sheet on the base

3. Introduce about 10 woodlice into the central lid hole of each choice
chamber. Place 10 woodlice in the damp or moist environment and 10
woodlice in the dehydrated or dry environment of the choice chamber, to
investigate the preferable conditions.

4. Leave the woodlice to move for 5 minutes. You will be asked to remove
the lid and count the number of woodlice in each part of the choice
chamber.
Note: You may also be asked to capture images of the woodlice in each
compartment, before and after the experiment.

16.4 OBSERVATIONS
For control set,
Table 16.1: Movement-based observation

Number of Distribution pattern of woodlice (Number of woodlice)

observations
First half of control area Second half of control area
Observation 1 6 4
Observation 2 5 5
Observation 3 6 4
105
MZOL-002 Laboratory Course-II
For experimental set,

Table 16.2: Movement-based observation

Number of Distribution pattern of woodlice (Number of

observations woodlice)

Area with moist filter Area with calcium

paper chloride granules

Observation 1 9 1

Observation 2 8 2

Observation 3 9 1

For the control set (Table 16.1), we find almost 1: 1 ratio of distribution in each
half of the chamber. We would expect that there would be an equal distribution
of 5 woodlice in each half of the control, but due to random chance
distribution, it may not be exactly equal in all cases.

From the experimental set distribution pattern of woodlice (Table 16.2), it is

clearly evident that woodlice usually show a preference for a moist or damp
environment. We find more woodlice in the moist half of the chamber after 5
minutes, in each set of observations.

When woodlice reach an unfavourable environment like dry ambience, they

tend to change the direction of movement and move faster. Such behavioral
response, called kinesis, increases their chances of finding a more favourable
ambience. Woodlice are known to undergo dehydration or lose moisture
content of their bodies in dry or desiccated conditions. Hence, while moving
from a humid to a dry area, woodlice are seen to move faster and change
direction more often to return to a damp or humid area. Such positive
hygrostimuli-based behavior increases the survival potential of woodlice.

16.5 PRECAUTIONS
1. You must wash your hands after handling calcium chloride, which may
act as a skin irritant.

2. Individuals with known skin allergies should be careful and wear hand
gloves.

3. It is also important to repeat each investigation at least three times for

validation.

106
 EXPERIMENT 17
STUDY OF PHOTOTAXIS
BEHAVIOU
BEHAVIOUR OF INSECT LARVAE
AND EFFECT OF DIFFERENT
LIGHT SPECTRA ON THEIR
MOVEMENT

Structure
17.1 Introduction and Principle 17.3 Procedure

Objectives 17.4 Observations

17.2 Materials Required 17.5 Precautions

17.1 INTRODUCTION AND PRINCIPLE

Living organisms exhibit diverse behavioral adaptations with respect to their
varying environmental cues or stimuli. The term ‘taxis’ refers to the directional
and specific movement, either towards or away from any stimulus. If an
organism moves toward the stimulus, the movement is called positive taxis
and if the organism avoids or moves away from the stimulus, it is said to
exhibit negative taxis. Phototaxis is the ethological response in the presence
of bright light. Insects possess the ability to see ultraviolet radiation. Many
insects, especially nocturnal ones, exhibit positive phototaxis to artificial light
sources that emit huge amounts of ultraviolet radiation. Such light traps play a
vital role in integrated pest management (IPM). Insects can sense different
light spectra, ranging from broad spectrum to narrow spectrum.
Photoreception refers to the ability to sense the visible light, consisting of a
certain wavelength of electromagnetic energy. Different insects may exhibit
their preference for shorter wavelengths such as ultraviolet (UV), violet and
blue light.

The insect selected for the experimentation is the fruit fly, Drosophila
melanogaster. Insect larvae of the first or second instar are collected for the
experimentation.
MZOL-002 Laboratory Course-II

Objectives
After doing this experiment, you should be able to:

 demonstrate the fundamental phototaxis behavior of insect larvae and

the effect of different light spectra on their movement, i.e., how insect
larvae react to different wavelengths of light.

17.2 MATERIALS REQUIRED

1. Insect larvae (collected from fruit flyculture bottle) of first (L1) or second
(L2) instar, belonging to the insect Drosophila melanogaster

2. Filter paper and brush

3. A glass tunnel open at both the sides

4. A black box with slit

17.3 PROCEDURE
1. Take about 10 larvae on a wet filter paper and with the help of brush,
place the larvae inside the glass tunnel, open at both the sides. Mark the
glass tunnel in the middle. At the other end of the tunnel, keep a light
source along with a black box, so that a slit is made to allow light to enter
the tunnel from the light source kept at that end. Note the number of
larvae moving toward light source thrice for validation (Fig. 17.1).

Fig. 17.1: Expermenal set up for studying phototaxis

2. In order to understand the effect of different light spectra on larval

movement, perform a visual stimulation experiment with different Light
Emitting Diodes (LEDs), emitting nearly monochromatic light. The
spectra of ultraviolet or UV, blue and green light are emitted by LEDs,
used for the experimental setup. The diverse sets of monochromatic and
white LEDs produce light with equal energy levels (69–72
microwatt/cm2). Note the nature of the movement of larvae at least
108 thrice.
Experiment 17 Study of Phototaxis Behaviour of Insect Larvae and Effect
of Different Light Spectra on their Movement

17.4 OBSERVATIONS
1. The number of Drosophila larvae moving toward light source is noted
thrice (Table 17.1).

Table 17.1: Fruit fly larvae response to light source

Number of Number of larvae moving Number of larvae moving

observations toward dark area toward area of light

1 9 1

2 10 0

3 9 1

2. Visual stimulation experiment

The larval movement in terms of light avoidance is noted. The larvae in each
experimental set-ups exhibit distinct phototaxis behavior, when exposed to
different wavelengths of light (Fig. 17.2). The larvae are noted to navigate
away from light in a light spectrum ranging from UV to green light.

Fig. 17.2: Different wavelengths of light used for treatment to the larvae

Fruit fly larval eyes can mediate avoidance of light stimuli with an extensive,
ecologically relevant range of wavelengths. The larvae of the fruit fly
Drosophila melanogaster exhibit negative phototaxis behavior and are known
to spend most of their life, feeding on the decomposing fruits. The larvae are
strongly deterred by light and prefer darker environment. The negative
phototaxis can be elicited by light with wavelengths ranging from ultraviolet
(UV) to green, in terms of varying light spectra.

17.5 PRECAUTIONS
1. Handle the fruit fly larvae with care.

2. Be careful not to disturb the spontaneous movement of the larvae

toward different light spectra.

109
 EXPERIMENT 18
BEHAVIOUR OBSERVATIONS IN
A PRIMITIVE EUSOCIAL WASP

Structure
18.1 Introduction and Principle 18.3 Procedure

Objectives 18.4 Observations

18.2 Materials Required 18.5 Precautions

18.1 INTRODUCTION AND PRINCIPLE

E. O. Wilson, the famous entomologist, developed the concept of eusociality
with respect to three important characteristics, namely, cooperative brood
care, reproductive division of labour or reproductive caste differentiation and
overlapping of generations. Eusociality is an ethological characteristic, well-
developed in various orders of insects. In terms of evolutionary strategies,
there are three grades of eusociality, namely, facultative, primitive and
advanced. In primitively eusocial insects, there is a considerable flexibility in
social roles so that the reversal of roles from reproductive queens to sterile
workers and sometimes, worker to queen via queen replacement is evident. In
certain primitively eusocial societies, there exists a reproductive hierarchy.
However, in the evolutionary history of primitive wasps, belonging to the order
Hymenoptera and the family Vespidae, all are independent founding wasps.
They exhibit a high level of interactions amidst the members of the nest,
including trophallaxis or mouth-to-mouth food transfer. The social organization
exhibits the division of labor between castes as well as temporal polyethism,
i.e., the division of labor among workers according to age. The primitively
eusocial wasp Ropalidia marginata is chosen for behavioural studies. Indian
paper wasps are tropical primitively eusocial paper wasps.

Objectives
After doing this experiment, you should be able to:

 comprehend the nature of the caste system in primitive wasp society,

and

 explain the behavioural nature in terms of social organization.

Experiment 18 Behaviour Observations in a Primitive Eusocial Wasp

18.2 MATERIALS REQUIRED

1. Wasp Ropalidia cyathiformis (R. marginata) nesting sites/colonies in the
garden

2. Camera for record

3. Beekeeping jacket with round veil for protection from wasps

4. A box for wasp colonization and study observation

18.3 PROCEDURE
1. You will be asked to survey selected buildings and other nesting sites in
the area of study, once, in about 2 weeks for the presence of the nests
of wasp Ropalidia marginata.

2. Alternatively, you may be asked to collect wasps and observe their

behavioural strategies in a box colonized by the wasps

18.4 OBSERVATIONS
Following behavioural observations are found.
1. Most wasp colonies have a single reproductive queen, morphologically
similar to the workers, but with better-developed ovaries. The single
docile queen can be identified by her egg-laying behavior.

2. Queens are the most dominant colony members and appear to inhibit
worker reproduction and also regulate non-reproductive activities of
workers using ‘dominance’ behaviours. The queen uses pheromones to
suppress worker reproduction.

3. When the queen dies, a potential queen (PQ) replaces the queen. There
may be the existence of a reproductive hierarchy with a reproductive at
least up to 5 PQs. Unlike other social insects, PQ cannot be identified if
the queen is present. The PQ is not the oldest, most dominant, largest or
mated female. However, it becomes hyper-aggressive after the death of
the queen and starts laying eggs in about a week unchallenged.

4. The queen exhibits significantly more aggression towards the PQ than to

the rest of the workers. Also, the PQ exhibits more aggression towards
workers than they show to each other.
5. Individuals may migrate from their birth or founded colony to take up
residence in another. This switching of colonies is most common during
the pre-emergence phase and when there are around 40-50 mature
members in the home nest. Migrant wasps are more likely to be
accepted while they are younger, which is generally less than 6 days old.
6. Trophallaxis is observed in terms of feeding behaviour. In the absence of
the queen, the workers continue to perform their activities such as
bringing food and feeding the larvae. The worker castes in the colony
show a positive correlation between the rates of bringing food and the
rates at which they feed the larvae. The wasps distribute themselves
non-randomly in their nests, a strategy that may help them exchange
food efficiently and avoid the spread of infections (Fig. 18.1). 111
MZOL-002 Laboratory Course-II
7. Some worker wasps primarily perform the extra-nidal tasks of foraging,
while others primarily perform the intra-nidal tasks of feeding larvae,
building the nest and other nest maintenance activities.

Fig. 18.1: Behavioural observation

The primitive wasp colony behaviour is an excellent ethological model to

study, characterised by dominance behaviours among the members,
establishing the social hierarchy and social stability.

18.5 PRECAUTIONS
The wasps may cause harm to the body. Use special collecting devices and
clothes with care to avoid any possibility of a sting.

112
 EXPERIMENT 19
COURTSHIP AND MATING
BEHAVIOUR IN DROSOPHILA

Structure
19.1 Introduction and Principle 19.3 Procedure
Objectives 19.4 Observations
19.2 Materials Required 19.5 Precautions

19.1 INTRODUCTION AND PRINCIPLE

The fruitfly Drosophila melanogaster, also known as ‘Cinderella of modern
genetics’ is an extensively-studied genetic model organism for the analysis of
different genetic and developmental processes. Studies have revealed that the
fruitfly genome is about 60% homologous to that of humans, with the majority
of human ailment genes having homologs in fruit flies. Due to the short
generation time (about 10 days at room temperature) and low maintenance
costs, the fruit fly has emerged as a powerful role model in genetics and
ethological studies. Research on single-gene mutants has paved our pathway
of comprehension of the neurobiological mechanisms encompassing the
biological clock, courtship and mating behaviours, and various aspects of
learning and memory.

Objectives
After doing this experiment, you should be able to:

 comprehend the nature of courtship and mating behaviour in the fruit

fly, Drosophila melanogaster, and

 demonstrate the male and female-specific courtship and mating

behaviour.

19.2 MATERIALS REQUIRED

1. Culture bottles and culture media

2. Drosophila male and female insects

MZOL-002 Laboratory Course-II

19.3 PROCEDURE
1. For obtaining good culture, allow to mate about 50 freshly eclosed males
and 50 virgin females for about 1-2 hours inside the culture bottles,
containing about 50 mL of nutritive medium or food. Label around five
culture bottles with about 10 mating partners in each bottle.

2. You will be asked to observe various ethological aspects of courtship

and mating in the fruit fly. You may also be asked to capture relevant
images of different phases of courtship and mating behaviour for
reference.

19.4 OBSERVATIONS
Various ethological aspects of courtship and mating in the fruitfly Drosophila
are observed.

1. Male-specific courtship and mating behaviour: Males exhibit a

complex stereotypical repertoire of behavioural manifestations and have
sensory systems that inform the decision-making processes for various
behaviours, including mate choice and egg laying.

a) Orienting: The male fruitfly follows the female. Once the male fruit
fly is in proximity to a female, the first observable courtship
behaviour is the orientation toward the target. When the male fruit
fly sees an attractive female, he follows her until he gets the signal
to approach. Such behaviour allows the male to potentially sense
the relevant airborne pheromones (Fig. 19.1).

Fig. 19.1: Orientation of male and female fruitfly

b) Tapping: Once the male fruit fly has located a female, he taps her
abdomen with his forelegs. This may provide a mechano-sensory
stimulus to the female, but may also allow the male to sample non-
volatile cuticular pheromones with chemosensory organs on his
114 forelegs (Fig. 19.2).
Experiment 19 Courtship and Mating Behaviour in Drosophila

Fig. 19.2: Tapping of the male fruitfly

c) Singing (wing vibration): When the female fly is responsive and

releases the corresponding pheromone, the male presents his
courtship song by vibrating his wings. Such mating behaviour is
associated with a species-specific courtship song that allows the
female to identify the appropriate male mating partner, in addition
to increasing her receptivity. The songs have the effects of
autoeroticism (becoming sexually stimulated through internal
stimuli), increasing the relevant courtship behavioural
manifestations (Fig. 19.3).

Fig. 19.3: Singing (wing vibration) associated with mating behavior

d) Licking: The mouthparts (proboscis) of the male partner come in

contact with the female genitalia. The male thereby licks the
female abdominal region, sampling a potentially different set of
non-volatile pheromones with his gustatory sensory systems (Fig.
19.4). 115
MZOL-002 Laboratory Course-II

Fig. 19.4: Licking

e) Copulation: The male partner bends his abdomen for copulation. In

fact, the male attempts to mount several times before successful
copulation. These steps could also involve mechanosensory
stimulation of both the partners, since genitalia are provided with
mechanosensory bristles (Fig. 19.5).

Fig. 19.5: Copulation in fruitfly

2. Rejection behaviour

a) In fact, male Drosophila learns short-term avoidance to non-

receptive individuals. If the female has already mated previously,
she produces certain antiaphrodisiac compound that directly
switches off the courtship behaviour. 7-tricosene is one such
compound that can be transferred to the virgin females that have
been courted, but not copulated. After 24 hours of mating, the
female has no longer 7-tricosene on their cuticle. However,
rejection can still occur since various substances from males in the
ejaculate are retained in the female reproductive tracts for longer
periods. One such compound is 11-cis-vaccenyl acetate (cVA).
This lipid is made predominantly in the male and when presented
116 with a virgin female, it results in courtship suppression (Fig. 19.6).
Experiment 19 Courtship and Mating Behaviour in Drosophila

Fig. 19.6: Rejection behaviour in fruitfly

b) Some virgin female fruitflies are also seen to be non-receptive to

the male courtship, exhibiting rejection behaviour or suppression of
courtship behaviour. The female tends to resist the male courtship
act by displaying specific rejection behaviour. The rejection
behaviour includes extruding her ovipositor, kicking or escaping. If
the female decides to accept the male, her rejection act
decelerates and then stops. She opens her vaginal plate for
copulation. After successful copulation, already mated females
become sexually non-receptive to further copulation for a brief
moment, to enhance their rate of egg-laying.

In Drosophila, it has been observed that the reproductive behaviour to attract

one individual to the other is primarily through the male, having a repertoire of
courtship behaviours from following the female, tapping her with his forelegs,
contacting her genitalia with his mouthparts, singing a species-specific
courtship song and bending his abdomen in order to mate. However, the
success of male courtship behaviour is a rate-determining step, determined by
the choice of the female partner, based solely on the courtship behaviours of
the male or a certain extent of genetically predisposed nature.

19.5 PRECAUTIONS
1. Handle the fruitflies with care.

2. Carry out the mating and courtship behavioural observations with

different mating partners for proper conclusive behaviour.

117
 EXPERIMENT 20
FARMING CHICKEN FOR MEAT

Structure
20.1 Introduction and Principle 20.3 Procedure
Objectives 20.4 Observations
20.2 Materials Required 20.5 Precautions

20.1 INTRODUCTION AND PRINCIPLE

Chicken farming for the purpose of meat is conducted as part of the global
marketing system. The chicken meat market is one of the leading sources of
protein for the global population. In terms of global perspectives, diseases
such as kwashiorkor and marasmus in children are associated with
inadequate dietary calorie and protein intake. In fact, pregnant and lactating
women and young children are particularly vulnerable. Chicken or poultry meat
is a vital source of animal protein, alleviating protein deficiency syndromes
worldwide, irrespective of age. Chicken meat is a healthy white meat, with
moderate fat content of cooked chicken, made up of desirable
monounsaturated fats and essential polyunsaturated fatty acids (PUFA),
especially the omega fatty acids and several dietary nutrients.

In terms of marketing, the chicken market has a huge consumption value and
productive chain, encompassing the nature of production, distribution and
marketing of chicken meat. The chicken market has immense potential for
income generation and job contribution. The poultry sector is one of the
fastest-growing livestock marketing sectors. The farming sector includes
individual links of the value chain, possible multi-market contacts, and the
nature and characteristics of various poultry meat products. Chicken farming
provides not only fresh meat, but also various processed forms of meat, such
as salami, kebab and sausage. All these meat products are available in frozen
conditions in various offline and online retail platforms. The farming aspects
are directly related to the market conduct and performance, such as price,
cost-effectiveness, quality and efficient retail functioning and practices.

Chicken farming involves innovations and improvements in the sections of

production systems (housing facilities), including the technical equipments,
production facilities, collection, distribution and marketing management
strategies. Poultry housing systems vary from small backyard flock only having
Experiment 20 Farming Chicken for Meat
simple night shelter (‘extensive’ farming), to modern houses with thousands of
birds in controlled environment houses (‘intensive’). In fact, there are four
broad production systems, namely, free-range extensive, backyard extensive,
semi-intensive and intensive farming.

Objectives
After doing this experiment, you should be able to:

 explain the basic strategies and objectives of chicken farming,

 describe the purposes of housing (protection, feeding and disease

control), and

 enumerate the different types of poultry management systems.

20.2 MATERIALS REQUIRED

1. Poultry farming system (extensive or intensive)

2. Camera for observation and record and notebooks

20.3 PROCEDURE
1. You will be taken to a nearby poultry farm (extensive or intensive poultry
farm) as part of the local field trip.

2. Please note the various observations, along with date and time, and
document your records.

20.4 OBSERVATIONS
(I) Free-range poultry farming

1. In this extensive production system, most family men rear about 8-

10 egg-laying fowls. Here, birds are not confined and can
scavenge for food over a wider area. Birds may roost outside,
usually in trees or nest in the bush. Different species of birds of
varying ages may flock together.

2. The farming method is simple and cost-effective. The birds eat up

leftover items and insects from the house and adjoining regions.

3. Being outdoors, exercise and outdoor lifestyle produce a tough, yet

tasteful chicken. Fowl excreta increases soil fertility.

4. However, this free-range system is impossible in case of space

constraints, like in urban areas. Little supervision can be done on
egg production, so that chicken may hide their eggs. Chicken
scavenge for seeds and insects and therefore, may damage the
cultivated crops nearby. Also, the birds are vulnerable to diseases,
predators and theft (Fig. 20.1). 119
MZOL-002 Laboratory Course-II

Fig. 20.1: Free-range poultry farm

(II) Semi-intensive poultry farming

1. In the semi-intensive production system, birds are allowed to move

within a confined area, usually protected with a wire net or fence,
having access to a nearby shelter.

2. In a typical run system, birds are confined in an enclosed area

outside during the day and housed at night. Poultry feed and water
are available in the house to avoid wastage by rain, wind or wild
animals.

3. This farming system is comparatively cheaper than the intensive

system. Feeding costs can be reduced if the free run is well
managed, such as with a good growth of grass.

4. However, the confined area may become dirty and unhealthy

rapidly. So, there is a mandatory requirement of regular cleaning,
else there will be gradual deterioration in bird health. The number
of eggs being laid is comparatively lesser than the intensive
system (Fig. 20.2).

120 Fig. 20.2: Semi-intensive poultry farm

Experiment 20 Farming Chicken for Meat
(III) Intensive poultry farming

Intensive poultry farming refers to modern poultry houses with birds in

controlled environment houses (Fig. 20.3).

(a) Deep litter system

1. The most common intensive poultry farming includes the deep

litter system.

2. In this system, the floor is covered with a deep litter (5-10 cm deep
layer or bedding material) of grain husks (maize or rice), straw,
wood shavings or a similarly absorbent, yet non-toxic material.

3. The litter absorbs moisture from the bird droppings.

4. However, special care is needed to avoid the accumulation of wet

litter, which may bring about the cases of aspergillosis and
coccidiosis.

Fig. 20.3: Intensive poultry farm

(b) Slatted floor system

1. The slatted floor system is made up of wire or wooden slatted

floors.

2. The space below the slats is utilized for collecting the bird
droppings.

3. However, this method is not recommended for the breeders and

may cause breast blisters in case of the broilers.

(c) Battery cage system

1. The battery cage system is utilized for laying chicken, kept in

cages throughout their productive life.

2. The birds are confined to small cages (about 1-5 layers/cage). The
cage density should not be too high. In hot climatic regions, this is
not <500 cm2 floor area. 121
MZOL-002 Laboratory Course-II
3. The battery cage system has several advantages, such as the
highest stocking rate, higher egg weight, lesser risk of disease,
lower feed intake (~3-4%), easier supervision and selection.

4. However, there is high initial investment cost per bird. The system
is not at all flexible, with strict thermoregulatory interventions

5. The battery farming systems may differ according to the

arrangement of rows and tiers. Accordingly, these may be: (i) flat
deck battery (8-10 birds/m2 floor area), (ii) stair-step battery (10-12
birds/m2) or (iii) tier battery (18-25 birds/m2) (Fig. 20.4).

Fig. 20.4: Types of battery farming systems

Chicken meat and eggs provide nutritionally beneficial food, containing protein
of high quality. Chicken farming sector is one of the fastest developing
marketing sectors, improving global nutritional status and generating huge
source of income. Different types of poultry production systems, as well as
small-scale and large-scale commercial farms aim at various improved
breeding programmes and holistic disease and health management.

20.5 PRECAUTIONS
1. Chicken must be housed according to the production purpose (egg-
laying or meat purpose).

2. The space availability must be taken into consideration for successful

poultry farming.

3. The types of chicken breeds need to be studied to select the nature of

the poultry farming systems.

4. Chicken can neither be transferred from cages to any other housing

system, nor from the fully slatted to partly slatted floors or all-litter floors.

122
 EXPERIMENT 21
DEMONSTRATION OF FISH
BREEDING POOLS AND
HATCHERIES

Structure
21.1 Introduction and Principle 21.3 Procedure
Objectives 21.4 Observations
21.2 Materials Required 21.5 Precautions

21.1 INTRODUCTION AND PRINCIPLE

In aquaculture, captive breeding and hatchery management play a significant
role in increasing freshwater fish production. For successful fish breeding
programmes, aquafarmers should have a complete idea of the different stages
of fish culture, such as, topographic situation, water quality, water source and
various other physical, chemical and biological factors. The management of
ponds has to be tackled from the point of view of breeding, hatching, nursing,
rearing and stocking ponds.

The first step in fish culture is the breeding of fishes; hence, for proper
breeding, special types of ponds called breeding ponds are prepared. These
ponds are usually prepared near the river or other natural water resources.
According to the mode, breeding may be natural (bundh breeding) or induced
breeding. On the other hand, the fertilized eggs are kept inside the hatching
pits for hatching. The hatching pool must be nearer to the breeding pool,
smaller in size and must contain a quantity of water that must dry within a
month or two. There are different types of hatcheries, namely, Chinese type
hatchery, glass jar hatcheries and modern control hatcheries.

Hapa breeding is the simplest and most effective method for the production of
fish seeds on a small-scale basis in rural regions. Indian major carps (rohu,
catla, mrigal) that spawn naturally can be artificially spawned by adopting
efficient methods of egg collection. The hatching hapa incubation system is
vital in commercial carp seed production. However, due to fluctuations in water
level and the presence of undesirable organisms, hapa hatcheries may incur
huge economic losses at times. So, a proper monitoring system is needed for
MZOL-002 Laboratory Course-II
successful propagation. Hapa hatcheries consist of a breeding hapa and a
series of hatching hapas. The designed hatching hapa may be of fixed type or
floating type. If the perpendicular poles (arms of hapa) are possible to fix, fixed
type hapa is used, else floating type is recommended. In hard bottom, where it
is impossible to use fixed hapas, floating hapas are constructed.

Objectives
After doing this experiment, you should be able to:

 describe the components and management strategies of the breeding

pond (breeding hapa)

 describe the components and management strategies of the hatching

pond (hatching hapa)

21.2 MATERIALS REQUIRED

1. Fish breeding pool (breeding hapa)

2. Fish hatchery (hatching hapa)

3. Camera for recording and observation

21.3 PROCEDURE
1. You will be taken for a local field trip to a nearby aquaculture system or
hapa hatchery.

2. You will be asked to monitor the components and management

strategies of both breeding hapa and hatching hapa.

3. You need to record your observations through cameras and notebooks.

21.4 OBSERVATIONS
(I) Fish breeding pond (breeding hapa)
1. The breeding hapa is a box-like enclosure system (2 m × 1.5 m ×
1.0 m) (Fig. 21.1).

2. The hapa is stitched out of square-meshed fine mosquito net cloth.

3. The hapa is tied on to bamboo poles fixed in ponds or tanks so

that about 0.3 m is above the water level and its bottom is 0.3 m
above the pond bottom.

4. The hapa contains a cloth cover on the top. The cover is provided
with an opening on the broader side for the introduction of the
breeders and removal of the broodfish. After the release of the
breeders, the opening of the hapa is securely closed so that the
breeders may not jump out and escape.

5. The hapa is held tight by tying the four corners both above and
124 below the water level.
Experiment 21 Demonstration of Fish Breeding Pools and Hatcheries
6. The fertilised eggs of major carps appear like shining glass beads
of crystal clear transparency, while unfertilised ones look opaque
and whitish. The size of the eggs from the same species of
different breeders varies considerably. The developing eggs may
be retained in the breeding hapa undisturbed for at least 4-5 hours
after spawning to allow eggs to be water-hardened. The procedure
of fish culture in breeding hapa is shown in Fig. 21.2.

Fig. 21.1: Structure of a breeding hapa

Fig. 21.2: Procedure of fish culture in breeding hapa

(II) Fish hatching pond (hatching hapa)

1. The hatching hapas are double-walled, with outer and inner hapa.

2. The outer hapa (1.5 × 1.0 × 1.0 m) is made of thin muslin cloth,
while the inner hapa (1.0 × 0.75 × 0.75 m) is made of round,
meshed mosquito net cloth (Fig. 21.3). 125
MZOL-002 Laboratory Course-II
3. The eggs are collected from the breeding hapas and are
transferred to the hatching hapas. About 75,000-1,00,000 eggs
may be uniformly spread inside each inner hapa.

4. After hatching of the eggs, the hatchlings escape into the outer
hapa through the meshes of the inner hapa. The inner hapa is left
with egg shells and dead eggs.

5. The hatchlings remain in the outer hapa undisturbed for about two
to three days. During this period, they subsist on the food stored
up in the yolk sac. As their mouths are formed, the hatchlings
begin directive movement and feeding. At this stage, they are
carefully collected from the outer hatching hapa and stocked into
the prepared nurseries.

Fig. 21.3: Structure of a hatching hapa

A local visit to the fish hapa helps to augment the knowledge of fish breeding
systems. Hapas are used to separate fish of different sizes during grading
before they are transferred to other production units. Hapa culture is a simple
technique that requires no expertise, minimum investment, easy transportation
and easy handling. Egg shells or spoiled eggs can be removed easily.
Continuous production at an optimum level is possible with the hapa culture
system.

21.5 PRECAUTIONS
1. Proper care is to be taken for the maintenance of good quality of water
in the pond.

2. The fertilized eggs are to be monitored carefully in the breeding hapa as

well as the hatchlings in the hatching hapa.

126
 EXPERIMENT 22
IDENTIFICATION OF EGGS,
SPAWN, FRY AND FINGERLING
OF CULTIVABLE FISHES OF
INDIA

Structure
22.1 Introduction and Principle 22.3 Procedure
Objectives 22.4 Observations
22.2 Materials Required

22.1 INTRODUCTION AND PRINCIPLE

Temporal and spatial developmental studies of cultivable fishes of India,
especially the major carps, help to understand the post-embryonic stages of
Indian major carps, designated as spawn, fry and fingerling. The
developmental stages of Indian major carps, rohu (Labeo rohita) and catla
(Catla catla) which are freshwater teleosts, belonging to the family Cyprinidae,
are particularly well documented and vividly studied. In embryology, the
number of cells in the blastula is considered as the dictating parameter for
identification and naming of the earlier stages prior to gastrulation. The extent
of development of the blastoderm on the yolk cell is considered as a landmark
for the nomenclature of the various stages of gastrula. The advanced stages,
thereafter, are characterized by the parameters such as the progression of the
migrating primordium of the posterior lateral line. In aquaculture, it is important
to note the nomenclature of the fish seed. The term 'hatchling' refers to the
first emergent larval stage emerging from the fertilized eggs after hatching.
This stage is characterized by the presence of a yolk sac and the absence of a
mouth. The term 'spawn' refers to the next developmental stage formed as
soon as the yolk sac of the hatchling is absorbed. The stage is characterized
by the formation of the mouth. Therefore, the spawn starts taking small
zooplanktons and supplementary feed (example egg yolk, finely powdered oil
cake and rice bran). The term 'fry' refers to the post-spawn smaller sized
zooplankton feeder stage, when the spawn assumes the shape of the fish and
grows to about 1-2 cm. Usually, it takes about 7-10 days for the spawn to grow
up to the fry stage. The term 'fingerlings' refers to the developmental stage
when the fry grows up to 10-15 cm in size or roughly the size of a finger. It
usually takes about 30-60 days for the fry to grow up to the size of a fingerling.
MZOL-002 Laboratory Course-II

Objectives
After doing this experiment, you should be able to:

 identify the various developmental stages of cultivable fish (rohu and

catla), namely, eggs, spawn, fry and fingerling.

22.2 MATERIALS REQUIRED

• Fish hatchery (visit to any local fish hatchery)

• Compound microscope
• Camera for documentation

22.3 PROCEDURE
1. You will be taken on a field trip to a local fish hatchery to observe and
understand the post-embryonic stages of Indian major carps, designated
as spawn, fry and fingerling. Alternatively, you may be shown the
readymade mounted as well as preserved specimens of various
developmental stages which are available for observation under the
microscope.
2. In case you are taken on a field trip, collect the eggs from about 1-2 feet
deep water of the breeding pool by disturbing the bottom and scooping
them with a rectangular spawn-collecting net. Collect the fry and
fingerlings by cast and drag nets.

22.4 OBSERVATIONS
Eggs
(A) Labeo
1. The fertilized eggs are round, sticky, orangish-yellow or reddish in
colour, with an average diameter of about 0.8 mm.
2. The fertilized eggs have a spot (called blasto-disc) at one pole and
can be seen through the naked eye (Fig. 22.1).
3. The animal pole is provided with a cap-like structure that gradually
increases in size.
Hence, the specimen appears to be the fertilized egg of Labeo.

128 Fig. 22.1: Egg of Labeo

Experiment 22 Identification of Egg, Spawn, Fry and Fingerling of
Cultivable Fishes of India
(B) Catla

1. The fertilized eggs are round with light red yolk.

2. The eggs are neither floating nor sticky.

3. Eggs are light red in color with about 4.5-5.4 mm in diameter.

Hence, the specimen appears to be the fertilized egg of Catla (Fig.

22.2).

Fig. 22.2: Egg of Catla

Spawn

(A) 96-hour old spawn of Labeo

1. Average body length 7.6 mm.

2. Presence of crescent-shaped black spots below the notochord in

the caudal region.

3. Presence of a red streak a little above the anal region.

4. Presence of fimbriated lip margins.

Hence, the specimen appears to be 96-hour old spawn of Labeo

(Fig. 22.3).

Fig. 22.3: 96-hour old spawn of Labeo

(B) 7-day old spawn of Labeo

1. Average body length 23 mm.

2. Presence of two black spots on the caudal peduncle.

3. Presence of poorly forked caudal fin. 129

MZOL-002 Laboratory Course-II
4. Presence of two crescent-shaped patches on the caudal fin.

5. Complete separation of the caudal fin from the embryonic fold.

6. Presence of a few orange spots in the membranous part of the

caudal fin.

Hence, the specimen appears to be 7-day old spawn of Labeo

(Fig. 22.4).

Fig. 22.4: 7-day old spawn of Labeo

(C) 96 hour-old spawn of Catla

1. Average body length 7.6 mm.

2. Presence of a semi-circular black spot on the ventral side of the

caudal end of the notochord.

3. Presence of reddish abdominal area above the anus.

4. Presence of thick lip margins.

5. Dorsal fin separating from the embryonic fold.

Hence, the specimen appears to be 96 hour-old spawn of Catla

(Fig. 22.5).

Fig. 22.5: 96-hour old spawn of Catla

(D) 7-day old spawn of Catla

1. Average body length 12 mm.

2. Presence of two faint crescent-shaped black spots behind the

130 caudal rays.
Experiment 22 Identification of Egg, Spawn, Fry and Fingerling of
Cultivable Fishes of India
3. Presence of prominently forked caudal fin.

4. Dorsal fin completely separated from the embryonic fold.

Hence, the specimen appears to be 7-day old spawn of Catla (Fig.

22.6).

Fig. 22.6: 7-day old spawn of Catla

Fry

(A) Fry of Labeo

1. Average body length 100-125 mm.

2. Presence of a diffused transverse band at the caudal peduncle.

3. Presence of whitish or grayish colored maxillary barbels.

4. Number of dorsal fin rays more than 11 in number.

5. Presence of fringed lips.

Hence, the specimen appears to be fry of Labeo (Fig. 22.7).

Fig. 22.7: Fry of Labeo

(B) Fry of Catla

1. Average body length 100-125 mm.

2. Presence of a large head.

3. Presence of convex dorsal profile and concave ventral profile.

4. Presence of diffused spot on the dorsal fin or at the caudal

peduncle.

5. Presence of black first ray of the dorsal fin.

Hence, the specimen appears to be fry of Catla (Fig. 22.8). 131

MZOL-002 Laboratory Course-II

Fig. 22.8: Fry of Catla

Fingerling

(A) Fingerling of Labeo

1. Average body length > 150 mm.

2. Presence of reddish tinge on the dorsal, pelvic, anal and caudal

fins.

3. Margins of the lobes of the caudal fin are grey, while other parts
have a reddish tinge.

4. Presence of fringed lips.

5. Presence of prominent maxillary barbels and small rostral barbels.

Hence, the specimen appears to be fingerling of Labeo (Fig. 22.9).

132 Fig. 22.9: Fingerling of Labeo

Experiment 22 Identification of Egg, Spawn, Fry and Fingerling of
Cultivable Fishes of India
(B) Fingerling of Catla

1. Average body length > 150 mm.

2. Presence of large head.

3. Presence of obscured spots in the body and at the caudal

peduncle.

4. Presence of dark grayish-colored dorsal, anal and caudal fins.

5. Presence of thick, non-fringed lips.

Hence the specimen appears to be fingerling of Catla (Fig. 22.10).

Fig. 22.10: Fingerling of Catla

The knowledge of the various developmental stages of cultivable and edible

fishes is significant in the understanding of successful fish seed propagation.
When fish seeds are collected from the natural breeding pools or induced
breeding is performed, such identification is of great importance for proper
segregation of different stages as well as of different species for selective
stocking of ponds in case of a polyculture system.

133
 EXPERIMENT 23
ANALYSIS OF THE PROXIMATE
COMPOSITION OF FISH

Structure
23.1 Introduction and Principle 23.5 Analysis of Ash Content
(Total Minerals)
Objectives
Materials Required
23.2 Analysis of Moisture or
Water Content Procedure
Materials Required Observations

Procedure 23.6 Precautions

Observations
23.3 Analysis of Crude Protein
Content
Materials Required

Procedure

Observations
23.4 Analysis of Crude Lipid or
Fat Content
Materials Required

Procedure
Observations

23.1 INTRODUCTION AND PRINCIPLE

There exist both inter-specific and intra-specific variations in the chemical
composition of fish. The proximate composition of fish is generally the
percentage composition of the four basic components, namely, moisture
(water), crude protein, crude fat and ash (total minerals). Though crude protein
and ash content do not show much variation, lipid content exhibits an inverse
relationship with moisture content. The proximate composition of fish diet
changes during the spawning season. Usually, the lipid levels increase before
spawning and decrease after spawning. This will further alter the percentage
of all other components in the fish meal as the seasons change.
Experiment 23 Analysis of the Proximate Composition of Fish

Objectives
After doing this experiment, you should be able to:

 comprehend the proximate composition of fish, and

 describe the standard protocols for the analysis of the proximate

composition of fish.

23.2 ANALYSIS OF MOISTURE OR WATER

CONTENT
The moisture content present in the sample (represented as g per 100 g meat)
is defined as the difference in weight after heating the ground fish at a
particular temperature for a defined time period.

23.2.1 Materials Required

1. Minced fish meat

2. Petri dish

3. Hot air oven

4. Desiccator

5. Balance machine

6. Heat-resistant gloves (Fig. 23.1)

Fig. 23.1: Materials required for moisture content analysis

23.2.2 Procedure

1. Take the total pooled minced fish meat in a clean dry Petri dish, kept in a
hot air oven at 105ºC for about 2 hours, cool in a desiccator and finally
take the weight (W1).

2. Take approximately 10-20 grams of fish meat (W2) in the pre-weighed

Petri dish, kept in the oven maintained at 105ºC overnight.

3. Cool the Petri dish in a desiccator and weigh again (W3).

4. Keep the Petri dish in the oven for half an hour, cool as before and
weigh again to obtain similar weight. 135
MZOL-002 Laboratory Course-II
23.2.3 Observations

You will be asked to calculate the moisture content percentage as follows.

23.3 ANALYSIS OF CRUDE PROTEIN CONTENT

In order to analyze the crude protein content, the nitrogenous compounds
present in the fish sample are converted into ammonium sulphate by boiling
with concentrated sulphuric acid. Thereafter, upon distillation with excess
alkali, the ammonia released is analyzed by titration with standardized
sulphuric acid (Fig. 23.2).

23.3.1 Materials Required

1. Minced fish meat

2. Balance machine

3. Acid-proof gloves

4. Digestion unit (along with Kjeldahl flask, sand bath)

5. Copper sulphate

6. Potassium sulphate

7. Concentrated sulphuric acid, N/100 sulphuric acid

8. Conical flask

9. Distillation unit

10. Boric acid

11. Tashiro's indicator solution [0.75 grams/litre methyl red sodium salt +
0.375 grams/litre methylene blue in ethanol 50 % (v/v)]

12. 40% NaOH

13. Phenolphthalein indicator

136 14. Distilled water

Experiment 23 Analysis of the Proximate Composition of Fish

Fig. 23.2: Materials required for crude protein content analysis

23.3.2 Procedure
1. Digestion

i) Following Kjeldahl’s method, weigh about 0.1-0.2 grams of fresh

weight of fish sample inside a Kjeldahl flask.

ii) Add a pinch of finely powdered digestion mixture (copper sulphate

and potassium sulphate) and 10 mL of concentrated sulphuric acid
to the above.

iii) Digest this mixture over a sand bath, initially by heating slowly till
the solution starts boiling and then vigorously until the solution
becomes colourless.
iv) Cool the sample and make up to the desired volume (100 mL)
according to the protein content of the sample.
v) Keep a blank with distilled water.

2. Distillation

i) Place a conical flask containing 10 mL of boric acid along with a

few drops of Tashiro's indicator solution at the receiving end of
the distillation apparatus, so that the tip of the condenser is
somewhat immersed in the boric acid. 137
MZOL-002 Laboratory Course-II
ii) Pipette out about 5 mL of the fish sample into the distillation
apparatus.
iii) Add about 10 mL of 40% NaOH as shown surplus by
phenolphthalein indicator into the distillation unit followed by
rinsing with distilled water.
iv) Make the entire distillation unit air tight.
v) Steam distill the content for about 5 minutes, till the boric acid
solution in the flask is doubled. As the colour of the solution turns
green, lower the flask and wash the condenser tip with distilled
water.

3. Titration
i) Titrate the solution (green solution in the receiving flask) against
N/100 sulphuric acid until the original pink colour returns.

ii) Note the volume of the acid used for titration.

Note: You will be asked to repeat both distillation and titration steps in order to
obtain concordant values.

23.3.3 Observations
You will be asked to calculate the crude protein content percentage as follows.

*Nitrogen content of most fish/meat protein is 16%. Hence 1 gram nitrogen

equivalent of protein is 100/16 or 6.25.

23.4 ANALYSIS OF CRUDE LIPID OR FAT

CONTENT
Following Soxhlet extraction method, crude lipids, soluble in organic solvents,
can be extracted from moisture-free samples by utilizing solvents like
petroleum ether and ethyl ether. The solvent is thereby evaporated and the
crude lipid or fat content of the fish sample is estimated by gravimetrical
method.

23.4.1 Materials Required

1. Minced fish meat

138 2. Balance machine

Experiment 23 Analysis of the Proximate Composition of Fish
3. Cotton plug

4. Cellulose thimble
5. Hot air oven
6. Soxhlet extraction apparatus

7. Ether
8. Dessicator (Fig. 23.3)

Fig. 23.3: Materials required for crude lipid analysis

23.4.2 Procedure
1. Weigh about 5-10 grams of the dried fish sample precisely into a
cellulose thimble and plug with cotton.
2. Place the thimble in a Soxhlet extraction apparatus.
3. Add approximately 200 mL ether and distill for about 16 hours.

4. Cool the Soxhlet extraction apparatus.

5. Filter the solvent into a pre-weighed conical flask (W2).
6. Rinse the flask of the Soxhlet extraction apparatus with little amount of
ether and add the washed contents to the flask. 139
MZOL-002 Laboratory Course-II
7. Remove the ether by evaporation.

8. Dry the flask with the lipid content at 80-100ºC, cooled within a
desiccator, and weigh (W3).

23.4.3 Observations

You will be asked to calculate the crude lipid or fat content percentage as
follows.

23.5 ANALYSIS OF ASH CONTENT (TOTAL

MINERALS)
Ash or total mineral content of the fish sample (grey-white coloured powder) is
defined as the residue obtained after incineration of the dry material at high
temperature.

23.5.1 Materials Required

1. Minced fish meat

2. Heat-resistant gloves

3. Balance machine

4. Desiccator

5. Porcelain crucible

6. Muffle furnace (Fig. 23.4)

7. Clay triangle

140 Fig. 23.4: Materials required for ash content analysis

Experiment 23 Analysis of the Proximate Composition of Fish

23.5.2 Procedure
1. Heat a porcelein crucible to 600ºC in a muffle furnace for about 1 hour,
then cool in a desiccator and weigh (W1).

2. Weigh about 2 grams of the dried fish sample with precision in the
porcelain crucible.

3. Heat the sample at low flame by placing it on a clay triangle to char the
organic matter (W2).

4. Place the charred content inside the previously set (600ºC) muffle
furnace and heat for about 6-8 hours, to obtain a final greyish-white ash
(total minerals).

5. Cool the crucible in a desiccator and weigh (W3).

6. Heat the crucible again for a further 30 minutes to confirm the full
completion of ashing, cool and weigh again.

23.5.3 Observations
You will be asked to calculate the ash (total mineral) content percentage as
follows.

The study of the proximate composition of fish is very significant in

aquaculture and human nutrition. The proximate components provide a clear
comprehension of the energy value assessments of the various cultivable
fishes.

23.6 PRECAUTIONS
1. Handle the hot air oven and the acid reagents with care.

2. Weigh the sample with precision in the balance machine.

141
 EXPERIMENT 24
STUDY OF FEEDING HABITS OF
FISHES BY GUT CONTENT
ANALYSIS

Structure
24.1 Introduction and Principle 24.3 Procedure
Objectives 24.4 Observations
24.2 Materials Required 24.5 Precautions

24.1 INTRODUCTION AND PRINCIPLE

The fish gut content analyses are important to understand the feeding ecology
of various cultivable fish and to explore diverse trophic interactions and
dynamics within aquatic ecosystems. The usual methods of gut content
analysis may be qualitative or quantitative. While the qualitative analysis
encompasses the identification of the organisms in the fish gut contents, the
quantitative methods of analysis may be numerical, gravimetric and
volumetric.

Objectives
After doing this experiment, you should be able to:

 perform the isolation of gut contents from a fish body,

 explain the nature of the gut content of fishes, and

 describe the feeding habit of the cultivable fish and feeding ecology in
terms of trophic dynamics.

24.2 MATERIALS REQUIRED

1. Fish

2. Dissecting tray

3. Dissecting instruments (forceps. fine scissors)

Experiment 24 Study of Feeding Habits of Fishes by Gut Content Analysis
4. Pasteur pipette

5. 0.7% saline

6. 5 % formalin

7. Petri dish, watch glass, glass slides

8. Fixatives, reagents and stains

9. Dissecting binocular or low power of a microscope.

24.3 PROCEDURE
(I) Qualitative Method
1. For analysis of the gut content, cut open the abdomen and locate
the gut. Add a drop of physiological saline solution (0.7% saline for
fish) (Fig. 24.1).

2. Anatomically, the region of the digestive tract between the

oesophagus and the pyloric sphincter constitutes the stomach.
Preserve the stomach, after removal in 5 % formalin, then wipe in
the filter paper and cut open longitudinally (without water), with a
pair of fine scissors.

3. If the stomach appears empty or contains only traces of food (<1

mg content), rinse it with water directly into a Petri dish or watch
glass.

4. If the stomach contains enough amount of food, remove excess

water using absorbent tissue paper. Weigh the stomach contents,
wash in a Petri dish and examine under a microscope.

5. Identify the stomach contents, sort into various taxonomic groups

and assess the numerical percentage. The fragments of
crustaceans (e.g. appendages), polychaetes (e.g. setae) and
molluscs (e.g. radula, mandible or any other mouth parts, shell)
are usually counted as complete animals. Identify the organisms
with the help of dissecting binocular or the low power of
microscope.

6. Before fixing in formalin, you will be asked to record the intensity of

feeding.

Fig. 24.1: Procedure of gut content analysis 143

MZOL-002 Laboratory Course-II
(II) Quantitative Method
(A) Numerical Method: Numerical methods are based on the counts of
various constituents found in the gut content. These methods can be
further classified into four different categories.
(a) Frequency of Occurrence Method: The method deals with
recording the presence or absence of each food constituents and
is the simplest way to understand the relative significance of
different food constituents and to reveal the dietary composition of
a given fish population.
i) Examine the stomach contents, sort the individual food
organisms and identify.
ii) Record the total number of stomachs (fishes) in which each
item occurs and then express as a percentage of the total
number of stomachs (fishes) examined.

(b) Number Method

i) In the number method, count the total number of individuals

of each food constituent in each fish stomach and express as
a percentage of the total number of food constituents in the
sample studied, or as a percentage of the gut contents of
each specimen examined, from which estimate the total
percentage composition.
ii) This method is however suitable for plankton feeders and
piscivorous animals. The numerical method is an easy and
fast method. You must note that, like the frequency of
occurrence method, the differences in the size of food items
are not considered in the number method.

(B) Volumetric Method

i) In the volumetric method, determine the volume of each food type

by the displacement method and express as a percentage of the
144 total volume of the stomach contents.
Experiment 24 Study of Feeding Habits of Fishes by Gut Content Analysis
ii) Measure the volume of each food item by displacement in a
graduated container (e.g., measuring cylinder) with the smallest
possible diameter for precision. This method is important in the
estimation of the diet composition of carnivorous fishes.

iii) Express the volume of a specific food type as the individual food
item volume percentage of the total volume of digestive tract
contents.

(C) Gravimetric Method

i) The gravimetric method refers to the estimation of the weight of

each of the food types, which is usually expressed as percentages
of the weight of the total fish gut contents.

ii) The gravimetric method can be undertaken both by wet weight or

dry weight method. Obtain the dry weight by drying the food items
in an oven at 60-80°C until a constant weight is attained and
thereafter weigh the dried matter. Obtain the fresh (wet) weight by
removing the excess water or surface water by blotting with tissue
paper to remove any trace of water trapped between the food
items.

24.4 OBSERVATIONS
(I) Qualitative Method

Feeding intensity analysis

Depending upon the nature of the stomach observed in fish, the feeding
intensity of various fish may be analyzed.

a) Gorged stomach: In this case, the gut contents are full and occupy the
entire stomach. The stomach wall appears transparent and the
organisms inside the stomach could be seen. 145
MZOL-002 Laboratory Course-II
b) Full stomach: In this case, the foodstuffs occupy the entire cavity of the
stomach.

c) ¾ Full Stomach: In this case, the foodstuffs occupy three-fourths of the

stomach.

d) ½ Full Stomach: In this case, food constituents occupy half of the

stomach.

e) ¼ Full Stomach: In this case, food constituents occupy one-fourth of the

stomach.

f) Trace stomach: In this case, very little or few organisms are found in the
stomach

g) Empty stomach: In this case, no foodstuff is found in the stomach.

However, a small amount of the digested secretion may be present.

h) Regurgitated stomach: In this case, no foodstuff is found in the stomach,

along with the shrunken stomach wall.

Food content
Fish stomachs may include common prey inclusions such as macro
invertebrates, micro invertebrates, ichthyoplanktons and fry. The usual gut
content comprises of crabs, molluscs, plants and shrimp.

(II) Quantitative Method

(A) Numerical Method: Numerical methods are based on the counts
of various constituents found in the gut content. These methods
can be further classified into four different categories.

(a) Frequency of occurrence method

The frequency of occurrence is calculated as following.

Number of stomach in which individual food item occurred/Total number of

146 stomach
Experiment 24 Study of Feeding Habits of Fishes by Gut Content Analysis
Fish = 10/10 × 100 = 100 %
Crab = 7/10 × 100 = 70 %
Mollusc = 4/10 × 100 = 40 %
Plant = 5/10 × 100 = 50 %
Shrimp = 6/10 × 100 = 60 %
(b) Number method

The number method denotes the number of the particular food item observed
in the stomach/Total number of food items × 100.
Fish = 24/75 × 100 = 32.00 %
Crab = 16/75 × 100 = 21.33 %
Mollusc = 12/75 × 100 = 16.00 %
Plant = 12/75 × 100 = 16.00 %
Shrimp = 11/75 × 100 = 14.66%
(B) Volumetric Method

The calculation is done as follows. 147

MZOL-002 Laboratory Course-II
Volume of food item in the stomach/Total volume of stomach contents × 100

Fish = 24/75 × 100 = 32.00 %

Crab = 16/75 × 100 = 21.33 %

Mollusc = 12/75 × 100 = 16.00 %

Plant = 12/75 × 100 = 16.00 %

Shrimp = 11/75 × 100 = 14.66 %

(C) Gravimetric Method

The calculation is done as follows.

Weight of fish in the stomach/Total weight of stomach contents × 100

Fish = 24/75 × 100 = 32.00 %

Crab = 16/75 × 100 = 21.33 %

Mollusc = 12/75 × 100 = 16.00 %

Plant = 12/75 × 100 = 16.00 %

Shrimp = 11/75 × 100 = 14.66 %

The gut content analyses of various fish species helps to unravel the patterns
in the seasonal, geographical and spatial differences in the dietary
composition of fish. The analyses provide a complete picture of food and
feeding habits of commercially important fishes.

24.5 PRECAUTIONS
1. The gut contents need to be isolated carefully.

2. The methods of analyses must be carried out with great accuracy and
precision.

148
 EXPERIMENT 25
FORMULATION AND
PREPARATION OF ARTIFICIAL
FISH FOOD

Structure
25.1 Introduction and Principle 25.3 Procedure
Objectives 25.4 Observations
25.2 Materials Required

25.1 INTRODUCTION AND PRINCIPLE

With the global population expansion, there is a greater demand for food
supply to sustain the population. Since there is a proportional increment in the
market demand for various edible fish and fish products, special emphasis is
laid upon the aquaculture production system and capture fisheries to maintain
the overall production of biomass of fish per surface area. The nature of
culture systems also has a decisive role in feed formulation.

A nutritionist or feed formulator must consider the nature of the water body
(fresh, marine, brackish), characteristics of the cultivable fishes, the feeding
habit of fish, target fish nutrient requirements, anti-nutritional factors, cost of
ingredients and feed additives, pond management and overall production
process. A successful fish breeding technique must encompass an enriched
supply of artificial fish food or diet. A fish may be herbivore, carnivore or
omnivore. Fish nutrition is considered as a significant factor controlling the
survival and growth of aquaculture. The usual formulation includes crude
protein level, energy level (expressed as metabolizable or digestible energy),
specific amino acid levels, crude fiber level and ash level.

In general, protein requirements are typically lower for herbivorous and

omnivorous fish than they are for carnivorous. There are 10 essential amino
acids that must be supplied in the diet, viz., methionine, arginine, threonine,
tryptophan, histidine, isoleucine, lysine, leucine, valine and phenylalanine. Of
these, lysine and methionine are often considered as the first limiting amino
acids. The ability of fish to utilize dietary carbohydrates vary significantly.
Many carnivorous fish use it more efficiently than herbivorous and omnivorous
MZOL-002 Laboratory Course-II
species. Lipids are the best sources of energy in fish. The amount of crude
fiber in fish seeds is usually less than 8% of the diet to limit the amount of
undigested materials entering the culture system. In terms of energy
utilization, the bulk of the energy comes from the oxidation of carbohydrates,
proteins and fats. Both water-soluble and fat-soluble vitamins are important for
fish growth. The major minerals required are calcium, phosphorus,
magnesium, chloride, sodium, potassium and sulphur. Phosphorus is
considered the most critical mineral in fish diet, since water contains very little
phosphorus. Among the trace minerals, copper, iron, manganese, selenium
and zinc are the most important minerals to supplement the fish diet.

Objectives
After doing this experiment, you should be able to:

 comprehend the composition of artificial fish food, and

 describe the various steps in diet formulation or feed formulation.

25.2 MATERIALS REQUIRED

1. Fish feed stuffs (crude protein, additives and supplements)

2. Work sheet

25.3 PROCEDURE
1. Balancing crude protein levels

During the initial balance of crude protein and energy levels, at least
three feed stuffs are used: (i) feedstuff high in protein and high in
metabolizable energy (ME), (ii) feed stuff low or intermediate in protein
and high in ME, and (iii) feed stuff low or intermediate in both protein and
metabolizable energy (ME). This balancing step is carried out by (i) trial
and error, (ii) square method or (iii) algebraic simultaneous equations.

(A) Square method

i) In order to balance a supplementary feed to have 25%

protein, using only two ingredients, viz., fish meal (50 %
protein) and rice bran (8 % protein), construct a square.
Insert the preferred protein level of the feed (25 %) in its
centre.

ii) Place the two feedstuffs, along with their protein content on
each corner at the left-hand side (LHS) of the square and
subtract the levels of protein of each feedstuff from the
desirable protein level of the feed. Place the differences on
the corners of the square diagonally opposite the feedstuff,
150 ignoring plus (+) or minus (-) signs.
Experiment 25 Formulation and Preparation of Artificial Fish Food
iii) Calculate the proportion of fish meal needed as the
difference between the % of protein in the rice bran and the
protein required in the feed under formulation.

iv) Calculate the proportion of rice bran needed as the

difference between the protein percentage of fish meal and
of the feed being formulated.

v) Express these proportions on a % basis, as 40.48 % fish

meal and 59.52 % rice bran, or as a ratio of 17: 25 (parts).

(B) Algebraic equations

You may use algebraic equations to obtain similar percentages.

Let us assume, x = fish meal (Kg/ 100 kg feed) and y = rice bran
(Kg/ 100 kg feed).

2. Checking the levels of indispensable amino acids

i) It is important to check the levels of indispensable amino acids in

the diet formulation. The need for indispensable amino acids is
expressed as the dietary level (as % of the diet) or as % of the
dietary protein level.

ii) To convert an amino acid level from the % of diet to % of protein,

divide the dietary level of each amino acid by the dietary protein
level. If the diet formulation is low in any amino acid, add a
feedstuff that has high levels of that amino acid to the diet at the
expense of another ingredient. 151
MZOL-002 Laboratory Course-II
3. Work sheet preparation

You will be required to make a diet mixing sheet in order to standardize

the feed formulation. See a sample data sheet in the observation table.

i) Fill in the feed ingredients and their amounts first. Based on the
available data on nutrient composition, calculate the nutrients that
will be provided by these ingredients as % (or Kg/100 Kg feed).

ii) By summing up the items, you will obtain the total amounts of each
nutrient supplied by the feedstuffs.

iii) By subtracting these amounts from the level of nutrients required

in the formulated feed, you can determine additional amounts of
nutrients needed and the amounts of other constituents to provide
those nutrients.

25.4 OBSERVATIONS
You must note that soybean meal and peanut meal do not contain any
available phosphorus and hence, dicalcium phosphate needs to be added.
Since dicalcium phosphate contains 18 % available phosphorus, the required
amount/100 Kg = 0.45/ 0.18 = 2.5 Kg, hence, 100 - 39.5 = 60.5 Kg /100 Kg (or
%) of other ingredients. If this amount needs to be supplied by soybean meal
and peanut meal in equal proportions, the nutrients will be provided by 2.44 Kg
protein, 1.51 Kg fat and 0.77 Kg sulphur-containing amino acids per 100 Kg.
Since these do not meet the full requirements for fat and sulphur-containing
amino acids, animal fat and methionine have to be added. You may obtain
similar results by using algebraic equations. Following is a sample example of
work sheet (Table 25.1).

Table 25.1: Work sheet table

% or kg/100 kg of feed

Ingredient Amount Protein Fat Available Sulphur-

(kg) phosphorus containing
amino
acids

Starch 12    

Distiller dried 7.5 2.00 1.10  0.09

solubles

Cotton seed 12.0 4.32 0.38  

meal

Fish oil 3.0  3.00  

Carboxymethyl 2.0    
cellulose

Vitamin mix 0.5    

152
Experiment 25 Formulation and Preparation of Artificial Fish Food
Total 37.0 6.32 4.48 0 0.26

Specifications 100.00 32.00 12.00 0.45 1.20

for feed

Additional 63.0 25.68 7.52 0.45 0.94

nutrients
needed

Dicalcium 2.5   0.45 

phosphate

Soybean meal 27.05 12.71 0.54  0.39

Peanut meal 27.05 12.71 0.81  0.30

Fat 6.15  6.15  

Methionine 0.25 0.25   0.25

Total nutrients 100.0 31.99 11.98 0.45 1.20

supplied

Feed formulation or artificial fish feed is indeed a vital part of fisheries. The
major goal of feed formulation is to employ the knowledge of nutrient supplies,
locally obtainable feed constituents and digestive capability of fish for the
successful production of a nutritionally balanced mixture of feed stuffs.

153
 EXPERIMENT 26
MOLECULAR TECHNIQUES IN
FISH HEALTH MANAGEMENT

Structure
26.1 Introduction and Principle 26.3 Procedure
Objectives 26.4 Observations
26.2 Materials Required 26.5 Precautions

26.1 INTRODUCTION AND PRINCIPLE

Fish health management is an important area in aquaculture systems and
disease diagnosis helps to increase productivity and decrease the economic
loss of the country as a whole. With the progress in the field of fish
biotechnology and molecular genetics research, the fish health management
system has progressed a lot. In fish disease diagnosis, various diagnostic
methods for aquatic infective agents range from microscopic, histological,
microbiological and immunological techniques to advanced molecular
characterization and molecular genetics techniques. With molecular
sequencing methods and advanced diagnostic tools, the precision, sensitivity
and speed of diagnosis have improved significantly in recent times. The
current aquaculture research focuses on various disease-resistant varieties,
rapid and sensitive disease diagnostic kits and the development of economic
and effective vaccines, probiotics and cell lines.

Objectives
After doing this experiment, you should be able to:
 comprehend the basic molecular strategies for maintaining fish health
and breeding, and
 explain the recent progress in the field of molecular tools and
technologies in fish disease diagnosis.

26.2 MATERIALS REQUIRED

1. Tools used in molecular biology
2. Study materials regarding fish health management
Experiment 26 Molecular Techniques in Fish Health Management

26.3 PROCEDURE
1. You will be taken to local aquaculture farms to have practical knowledge
of disease-diagnosis protocols.

2. You may be taken to the local research institutes for efficient exposure to
ongoing research activities and hands-on training with respect to
molecular tools and technologies.

26.4 OBSERVATIONS
(I) Disease diagnosis

• Molecular techniques add to the traditionally used techniques for

the identification of the pathogen (biochemistry, serology and
histology).

• Different variants of PCR technology (Fig. 26.1) have

revolutionized the field of fish disease diagnosis. PCR analysis can
detect even one copy number from the genome of the pathogen,
which formerly may have been left undetected in other traditional
techniques. PCR-based diagnosis methods are accessible for
almost all the WHO Office International des Epizooties (OIE) listed
pathogens. The testing of specific pathogen-free (SPF) fish seeds
is also conducted using PCR techniques.
• Currently, various variants of PCR, namely, Loop-mediated
isothermal amplification (LAMP), Recombinase polymerase
amplification (RPA), etc. are available to facilitate field-level
sensitivity and rapid diagnosis of pathogens without the need for
any costly isothermal amplification machineries (Figs. 26.2, 26.3).
• Monoclonal antibodies produced by hybridoma technology are vital
in fish disease diagnosis and are being utilized in the context of
disease diagnosis, pathogen identification and classification,
epidemiological analyses and vaccine development.

Fig. 26.1: Principle of PCR technology 155

MZOL-002 Laboratory Course-II

Fig. 26.2: Recombinase polymerase amplification (RPA) cycle

Fig. 26.3: RT-LAMP process

156
Experiment 26 Molecular Techniques in Fish Health Management
(II) Probiotics development

• The use of microbes as gut probiotics and water probiotics in

inhibiting the spread of pathogens and preserving healthy gut
microbiota are important in aquaculture.

• The health of pond bottom is crucial in aquaculture and the use of

water probiotics is the answer. The use of water probiotics is
significant in bioaugmentation process, by reducing the organic
load and causing transformation of any toxic compounds such as
ammonia into nontoxic form. Such technique is currently practiced
in shrimp farming.

• Probiotics are known to increase growth, disease resistance and

feed conversion, reduce stress vulnerability and improve overall
vigor and health status (Fig. 26.4).

Fig. 26.4: Use of probiotics in fish health management 157

MZOL-002 Laboratory Course-II
(III) Vaccine development

• Most vaccine development is based on Recombinant DNA

technology. Currently, there exists a single DNA vaccine for
infectious hematopoietic necrosis virus (IHNV), accessible in
Canada only.

• RNA interference (RNAi) based technology is known to offer

immunological protection against various aquatic pathogens.
Despite their limitations, RNAi methods have been effectively used
in shrimp aquaculture (Fig. 26.5).

Fig. 26.5: Vaccine development for fish health management

Fish health management aims to prevent various fish diseases. This includes
maintenance of healthy aquatic systems, good quality feed, prevention of
introduction of any new disease as well as propagation of any existing disease
agents and disease diagnosis methodologies.

26.5 PRECAUTIONS
1. Due to diversity of fish species, proper selection of the molecular
biological tool is required for successful fish health management.

2. The handling of molecular genetics tools need expertise and precision.

158
 EXPERIMENT 27
AQUARIUM DESIGN AND
MAINTENANCE

Structure
27.1 Introduction and Principle 27.3 Procedure

Objectives 27.4 Observations

27.2 Materials Required 27.5 Precautions

27.1 INTRODUCTION AND PRINCIPLE

An aquarium is an artificial pool or a glass container that keeps aquatic
organisms in a simulated natural environment. An ideal aquarium may be
designed for ornamental, research and breeding purposes, in order to
maintain a similar ecological balance as that exists in nature. It is very
important to maintain the physico-chemical as well as biological parameters of
the aquarium, encompassing proper aeration, water flow, temperature, lighting
arrangements, suspended organic matter, sand, gravel or rock particles.
Depending on salinity, aquaria may be (i) marine or (ii) fresh water. Depending
on the geographical distribution, aquaria may be (i) tropical (supporting
organisms that can withstand temperature about 22°C and above) and (ii)
temperate (supporting organisms that are collected from temperate regions of
the world). Before setting up any type of aquaria, an aquarist must have a list
of compatible fish species with available space provided. In this experiment,
you may be asked to set up and maintain a fresh water aquarium, with gold
fish as the fish model.

Objectives
After doing this experiment, you should be able to:

 comprehend the basic design of an aquarium, and

 explain the basic requirements for the maintenance of fish health in

aquarium (fresh water aquarium).
MZOL-002 Laboratory Course-II

27.2 MATERIALS REQUIRED

1. Aquarium tank (with different components)

2. Aquarium fish such as gold fish, Carassius auratus (fresh water

ornamental fish)

27.3 PROCEDURE
(1) Selection of tank

• Choosing the type of aquarium tank is the first step in the

establishment of a fresh water aquarium. An aquarium tank may
be (i) metal frame tank (built with enamelled iron, a light alloy or
stainless steel and glass walls sealed with putty), (ii) plexi-glass
tank (built with high-quality plexi-glass), and (iii) full glass tank
(built with glass only).

• In order to estimate the size of the tank needed, about 4.5 litres of
water are allowed for every 1 cm length of fish (including the tail).
A good recommended size of the tank is 60 cm × 45 cm × 40 cm.

(2) Setting up an aquarium

• The tank must have enough water surface to absorb oxygen

efficiently from the air and a deep front for inspecting. The carrying
capacity of the tank is influenced by the size of the fish, the content
of the tank, feeding management, the status of filtration and
aeration, water temperature and unwanted metabolites found in
the water.

• Place the empty tank on a flat, solid surface out of direct sunlight.
Cover the tank with aquarium cover for protection from pollutants
and predators. It will also help to maintain an even water
temperature and prevent fish from jumping out of the water.

• Provide the tank with an aeration pump, an under-gravel filter, river

gravel bottom and aquatic plants.

• The ideal temperature requirement for gold fish for water should be
around 23°C.

• Aquarium composts comprise of gravel (small stones and pebbles

or a mixture of these with sand) placed at the bottom of the tank in
which plants can be grown. Keep the usual gravel depth as 5-10
cm. Before placing gravel in the aquarium, rinse it under a stream
of water until the water runs clear. Fill the tank about one-third full
with water and install an under-gravel filter. Change the water
every two weeks.

• Plants not only provide hiding places for the fish, but also appear
to reduce algal growth. Place the tallest plants at the back and the
160 shortest in the front.
Experiment 27 Aquarium Design and Maintenance
• Fish health requires an efficient aeration system. The sources of
oxygen in the aquarium comprise diffusion at the surface of the
water and an aeration system.

• An efficient filtration system helps to maintain good water quality

and hence, good fish health. Filtration systems may be both
mechanical and biological. Mechanical filtration eliminates
suspended materials from water by pumping it through a filter
material (glass wool). Biological filtration is dependent on the
activities of beneficial nitrifying bacteria, colonizing the surface of
the gravel and rocks in the aquarium. Under-gravel filters permit
the entire gravel bed to become colonized.

• Fish feed for aquarium fishes may be classified as (i) commercial

foods and (ii) live foods. For ornamental fishes, the requirement of
crude protein level is 30-45%, crude lipid 4-8%, and carbohydrate
30-50% (Fig. 27.1).

Fig. 27.1: Components of an aquarium

27.4 OBSERVATIONS
You can observe the typical gold fish aquarium, note the components and
record the behaviour of goldfish with the camera (Fig. 27.2). 161
MZOL-002 Laboratory Course-II

Fig. 27.2: Gold fish and its behaviour

An aquarium is considered as an ecological model, acting as a self-contained

ecosystem for aquatic organisms (plants and animals). A goldfish aquarium is
one of the most popular aquarium setups that aid in the study of the basic
design and maintenance of any aquarium.

27.5 PRECAUTIONS
1. Ensure that the tank must have enough water surface to absorb oxygen
efficiently from the air.

2. Cover the tank with aquarium cover for protection from pollutants and
predators.

3. Change the water every two weeks.

162
 EXPERIMENT 28
COLLECTION AND
IDENTIFICATION OF AQUATIC
INSECTS AND AQUATIC WEEDS

Structure
28.1 Introduction and Principle 28.3 Procedure
Objectives 28.4 Observations
28.2 Materials Required

28.1 INTRODUCTION AND PRINCIPLE

For qualitative studies of aquatic organisms like planktons, plankton net usage
is an ideal method of collection. The zooplanktons are found at any depth of
the water column since they can undergo vertical mobility within water. These
zooplanktons live at greater depths during the daytime and move to the
surface as the light recedes. Usually, phytoplanktons are smaller in size than
zooplanktons. Zooplanktons may be classified as macroplanktons,
mesoplanktons, microplanktons and nanoplanktons. Lugol's solution or 70%
ethanol is the most preferred reagent for the preservation of zooplanktons, in
case of identification. The aquatic weeds can be collected using a long hook,
plankton nets or simply by hand and then brought to the laboratory for
identification purposes.

Objectives
After doing this experiment, you should be able to:

 explain the basic methods to collect, identify and study aquatic insects
from a local water body, and
 describe the basic methods to collect, identify and study aquatic weeds
from a local water body.

28.2 MATERIALS REQUIRED

1. Plankton net
2. Bucket
MZOL-002 Laboratory Course-II
3. Glass tubes

4. 70% alcohol

5. Watch glass

6. Simple microscope

7. 4% formalin

28.3 PROCEDURE
1. Sieve a bucketful of pond water through appropriate plankton net.

2. Wash the inner side of the net by splashing water from outside. All
planktons will be trapped within the glass tube placed at the bottom for
collection.

3. Add 4% formalin to the glass tube for fixation of the zooplanktons.

4. Collect the zooplanktons in small glass tubes containing 70% alcohol as

a preservative.

5. Transfer the fixed zooplanktons on a watch glass.

6. Observe the zooplanktons under a simple microscope.

7. Identify the aquatic weeds of various types, similarly with the help of a
simple microscope.

28.4 OBSERVATIONS
(I) Aquatic insects: Following aquatic microarthropods (zooplanktons) are
observed.

(A) Cyclops sp.

1. Body club-shaped, elongated with a somewhat broad

anterior and a narrow posterior end.

2. Body is divided into cephalothorax and abdomen.

3. The first thoracic segments fused with the head and covered
dorsally with a carapace.

4. Presence of a median eye (naupliar eye) on the dorsal

surface of the carapace.

5. Thoracic segments 5 and abdominal segments 4.

6. Antennae short; antennules very large.

7. Abdomen with a pair of caudal styles (caudal rami).

8. Presence of two ovisacs or egg sacs on the lateral sides of

the abdomen in females.

164 Hence the specimen appears to be Cyclops sp (Fig. 28.1).

Experiment 28 Collection and Identification of Aquatic Insects and Aquatic Weeds

Fig. 28.1: Cyclops sp.

(B) Daphnia sp.
1. Pelagic zooplankton with body laterally compressed and enclosed
in a bivalve carapace.
2. Head almost round with a beak-like rostrum pointing downwards
3. Carapace drawn into a posterior caudal style or caudal spine.
4. Eyes compound, sessile and large.
5. Presence of large and biramous antennae.
6. Thoracic appendages 5 pairs and leaflike.
7. Abdominal appendages absent.
8. Presence of a brood pouch on the back, in the case of females.
Hence the specimen appears to be Daphnia sp. (Fig. 28.2).

Fig. 28.2: Daphnia sp. 165

MZOL-002 Laboratory Course-II
(C) Cypris sp.

1. Pelagic animal with body bilaterally compressed and enclosed in a

bivalve carapace.

2. Eye stalk short.

3. Antennae and antennules well developed. Second antennae

uniramous.

4. Head with four pairs of appendages.

5. Presence of three pairs of thoracic appendages.

Hence the specimen appears to be Cypris sp (Fig. 28.3).

Fig. 28.3: Cypris sp.

(D) Moina sp.

1. Pelagic animal with an oval body that ends in a pair of caudal

styles.

2. Antennae branched.

3. Rostrum horizontal in position.

Hence the specimen appears to be Moina sp (Fig. 28.4).

Fig. 28.4: Moina sp.

(E) Culex larva

1. Head with a pair of simple and compound eyes.

2. Posterior part of the abdomen forked.

3. 8th abdominal segment with a long respiratory siphon.

4. Abdominal segments with a tuft of bristle hair. Palmate hair is

absent in the abdomen.

166 Hence the specimen appears to be Culex larva (Fig. 28.5).

Experiment 28 Collection and Identification of Aquatic Insects and Aquatic Weeds

Fig. 28.5: Culex larva

(F) Anopheles larva

1. Head with a pair of compound eyes.

2. Abdominal segments with palmate hair.

3. Presence of unforked abdomen.

4. 8th abdominal segment with a very short respiratory siphon.

Hence the specimen appears to be Anopheles larva (Fig. 28.6).

Fig. 28.6: Anopheles larva

(II) Aquatic weeds

Following aquatic weeds are observed.

(A) Pontederia sp. or Eichhornia sp. (Water hyacinth or blue devil)

167
MZOL-002 Laboratory Course-II
1. It is a floating macrophyte.

2. Presence of broad leaves with swollen stalks filled with air to

enable them to float on the water surface.

3. Presence of dense leathery roots.

Hence the specimen appears to be Pontederia sp. or Eichhornia

sp (Fig. 28.7).

Fig. 28.7: Eichhornia sp.

(B) Salvinia sp. (water fern velvet)

1. It is a floating macrophyte, with a delicate stem or rhizome.

2. Presence of oblong, sessile leaves, arranged in two or more

whorls. The second whorl is either lateral or floating in nature and
the third whorl is submerged in water.

3. Lateral leaves may be filled with air to assist in floating.

Hence the specimen appears to be Salvinia sp. (Fig. 28.8).

168 Fig. 28.8: Salvinia sp.

Experiment 28 Collection and Identification of Aquatic Insects and Aquatic Weeds
(C) Pistia (water lettuce)

1. It is a free-floating, perennial macrophyte.

2. Presence of a shell-like rosette of tongue or cup-shaped leaves.
3. Presence of reduced stem, sessile leaves and numerous
branching roots.
Hence the specimen appears to be Pistia sp. (Fig. 28.9).

Fig. 28.9: Pistia sp.

(D) Lemna sp. (duck weed)

1. It is a light green coloured floating, small macrophyte that occurs in
group of one to three.
2. Absence of any distinct stem

3. Leaves with flattened, tiny leaf-like fronds.

Hence the specimen appears to be Lemna sp. (Fig. 28.10).

Fig. 28.10: Lemna sp. 169

MZOL-002 Laboratory Course-II
(E) Azolla sp. (water velvet)

1. It is a small, floating macrophyte, present in stagnant water bodies.

2. Leaves thick, lobed and scale-like and confer reddish-green colour

to the water surface by covering it.

Hence the specimen appears to be Azolla sp. (Fig. 28.11).

Fig. 28.11: Azolla sp.

(F) Hydrilla sp. (water thyme)

1. It is a submerged rooted macrophyte.

2. Presence of fibrous roots.

3. Presence of slender stem.

4. Leaves linearly arranged in whorls.

Hence the specimen appears to be Hydrilla sp. (Fig. 28.12).

170 Fig. 28.12: Hydrilla sp.

Experiment 28 Collection and Identification of Aquatic Insects and Aquatic Weeds
(G) Chara sp. (stonewort)

1. It is a submerged, gregarious, rooted macrophyte.

2. Presence of erect branches with easily distinguishable nodes and

internodes.

Hence the specimen appears to be Chara sp. (Fig. 28.13)

Fig. 28.13: Chara sp.

(H) Vallisneria sp. (eel grass or tape grass)

1. It is a submerged rooted macrophyte with long ribbon like leaves.

2. Presence of long, thread like, twisted, female flowers.

Hence the specimen appears to be Vallisneria sp. (Fig. 28.14).

Fig. 28.14: Vallisneria sp. 171

MZOL-002 Laboratory Course-II
(I) Ceratophyllum sp. (hornwort)

1. It is a submerged non-rooted macrophyte having a fragile algal-like

structure.

2. Absence of roots.

3. Leaf branches are often modified into rhizoids.

4. Leaves arranged in whorls and are repeatedly forked with tiny

teeth-like lateral divisions.

Hence the specimen appears to be Ceratophyllum sp. (Fig. 28.15).

Fig. 28.15: Ceratophyllum sp.

(J) Myriophyllum sp. (parrot head / water milfoil)

1. It is an emergent macrophyte, having a slender, thinly branched

floating system.

2. Roots found freely at lower nodes.

3. Leaves opposite or whorled, with horn-like emergent leaves.

4. Flowers are quite small and found in the axis of emergent leaves.

172 Hence the specimen appears to be Myriophyllum sp. (Fig. 28.16).

Experiment 28 Collection and Identification of Aquatic Insects and Aquatic Weeds

Fig. 28.16: Myriophyllum sp.

The study of freshwater zooplanktons can be used as an indicator of the

quality and productivity of the pond ecosystem. In fish culture systems and
artificial aquaria, zooplanktons are used as natural feed for the fishes. The
qualitative and quantitative studies of zooplanktons are significant in pollution-
related studies. Aquatic weeds, on the other hand, are harmful to aquaculture,
and assessment and management of aquatic weeds are needed for
maintaining healthy aquatic systems.

173
SUGGESTED READINGS
1. Biology of Earthworms. C. A. Edwards, Wilfrid Norman Edwards, J. R.
[Link] US, 2012.

2. Rediscovering Earthworms. C. S. K. Mishra, Suryasikha Samal.

Cambridge Scholars Publisher, 2021.

3. Sutton, S. (2013). Woodlice. Netherlands: Elsevier Science.

4. Rees, P. A. (2017). Examining Ecology: Exercises in Environmental

Biology and Conservation. United Kingdom: Elsevier Science.

5. Prasad, K. V. H. (2022). Insect Ecology: Concepts to Management.

Springer Nature Singapore.

6. The Social Biology of Wasps. (2018). United States: Cornell University

Press.

7. Arbuckle, K. (2008). Courtship Behavior and Mating Success of Wild and

Laboratory-reared Drosophila robusta. (n.p.): University of Arkansas,
Fayetteville.

8. Behavioral Genetics of the Fly (Drosophila melanogaster) (2014). United

Kingdom: Cambridge University Press.

9. Commercial Chicken Meat and Egg Production. (2012). Germany:

Springer US.

10. Poultry Science. (2017). Croatia: IntechOpen.

11. Poultry Science: Fifth Edition. (2019). (n.p.): Waveland Press.

12. Pullin, R. S. V., Jhingran, V. G. (1985). A Hatchery Manual for the

Common, Chinese, and Indian Major Carps. Philippines: Asian
Development Bank.

13. Chakroff, M. (1984). Freshwater Fish Pond Culture and Management.

United States: The Corps.

14. The Early Life History of Fish: The Proceedings of an International

Symposium Held at the Dunstaffnage Marine Research Laboratory of
the Scottish Marine Biological Association at Oban, Scotland, from May
17–23, 1973. (2012). Germany: Springer Berlin Heidelberg.

15. Shaw, R. F. (1980). A Bibliography of the Eggs, Larval and Juvenile

Stages of Fishes: Including Other Pertinent References. United
States: Maine Sea Grant Publications.

16. [Link]

17. AOAC (2000) Association of Analytical Chemists, 17th Edition.

18. Sagar, Mahesh V, Nair Rekha and Gop Ambarish (2019). Stomach
Content Analysis Techniques in Fishes. ICAR-CMFRI-Winter School,
Dec 1-21, 2018 at CMFRI, Kochi-Manual.

19. Aquafeed Formulation (2015) Netherlands: Elsevier Science.

MZOL-002 Laboratory Course-II
20. Kumar, Vikash, Roy, Suvra, Behera, Bijay, Das, Basanta. (2022).
Disease Diagnostic Tools for Health Management in Aquaculture.
10.1007/978-981-16-3215-0_21.

21. Mills, D. (1993). Aquarium Fish. United Kingdom: Dorling Kindersley.

22. Innes, W. T. (2015). Goldfish Varieties and Tropical Aquarium Fishes: A

Complete Guide To Aquaria and Related Subjects. United
States: Creative Media Partners, LLC.

23. Heckman, C. W. (2018). Ecological Strategies of Aquatic Insects. United

States: CRC Press.

24. Korth, R., Semple, D., Temte, J., Watkins, C., Borman, S. (2014).
Through the Looking Glass: A Field Guide to Aquatic Plants. United
States: University of Wisconsin-Extension Lakes/Wisconsin Lakes
Partnership.

25. J.F. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual

3rd ed., Cold Spring Harbor Laboratory Press (2001).

175
SELF-ASSESSMENT QUESTIONS
1. What is the role of CTAB in genomic DNA isolation?

2. Why is it preferable to treat nitrocellulose filter with SDS during transfer

of bacterial colony?

3. What are the three steps of PCR?

4. How is the blue color generated in Lowry method of protein isolation?

5. Mention the functions of ammonium persulfate and TEMED in SDS-

PAGE.

6. How would you chemically assay the α-amylase activity?

7. State the principle of TLC.

8. What is the maximum safe limit of tryptophan in diet?

9. What is the purpose of binning in metagenome analysis?

10. What is the significance of Wallace formula in designing of primers for

PCR?

11. How will you analyze genetic information using ORF Finder?

12. Why is NEB Cutter V3.0 so widely preferred for restriction mapping?

13. Which programme will you use to visualize three-dimensional structure

of protein?

14. What is parsimony?

15. Distinguish between the terms ‘taxis’ and ‘kinesis’ with regard to the
movement of living organisms.

16. How will you set up a choice chamber to study hygrostimuli response?

17. Name any insect showing negative phototaxis behavior.

18. What are the characteristics based on which the concept of eusociality
was developed?

19. What is the chemical basis of rejection behaviour in Drosophila?

20. What is the role of battery cage system in chicken farming?

21. How will you distinguish between breeding hapa and hatching hapa?

22. How will you differentiate between the fry and fingerling of Catla?

23. How will you estimate the crude protein content in a fish sample?

24. Explain the “frequency of occurrence method” with regard to gut content
analysis of fishes.

25. How is balancing of crude protein levels in fish food done using “square
method”?

26. Which are the molecular techniques used to diagnose diseases in

fishes?
MZOL-002 Laboratory Course-II
27. How will you maintain an efficient filtration system in an aquarium?

28. Mention the different identifying features of Daphnia.

29. Explain the utility of discontinuous buffer system in SDS-PAGE.

30. What are the different techniques for cell immobilization?

177