Comment

[Link]

A technical approach to global plant genome

editing regulation
Evan Groover, Elizabeth Njuguna, Kailash Chander Bansal, Anne Muia, Musa Kwehangana,
Christopher Simuntala, Richard Lloyd Mills, Emmanuel Kwakye, Pedro Rocha,
Josephine Amedu, Eduardo Morillo, Mohana Anita Anthonysamy, A. B. M. Khaldun,
Lilian Chimpepo, Massouroudini Akoudjin, D. M. J. B. Senanayake, Dechen Wangmo,
Dessalegn Atnafu, Geronima P. Eusebio, Chalinee Kongsawat & Melinda Kliegman Check for updates

The Innovate Genomics Institute brought and the United Nations Food and Agriculture Organization (FAO).
To broaden the reach of our shared learnings to an international audi-
together regulators from 16 countries to ence, here we describe themes in genome editing regulation, delineate
discuss global capacity building for the the appropriate technical analyses that can be used to validate genome
edits in crops, and offer technical suggestions to support countries in
regulation of genome-edited crops.
meeting their regulatory objectives.
The workshop provided insights into the
suitable use of technical analyses to validate Themes in plant genome editing regulation
Genome editing technologies are generally inexpensive, easy-to-use
edits and raised future considerations approaches for accelerating breeding pipelines and introducing novel
regarding regulation reporting, offering genetic variation into crops without stable transgenesis6. CRISPR tools
and effectors can precisely modify genomes in a sequence-specific man-
suggestions to help countries meet their
ner, resulting in deletions, substitutions, recombination, or sequence
objectives in the ever-growing landscape of insertions in plant DNA6,7. CRISPR reagents can be administered to
genome editing techniques. plants using several modalities, though the most common routes are
biolistic bombardment of DNA and/or ribonucleoprotein into plant
tissue and Agrobacterium-mediated integration of a CRISPR cassette
Since the discovery of CRISPR–Cas, crop developers have made major into host DNA, with subsequent removal of the transgenic construct
advancements using genome editing to adapt, improve, and domesti- in progeny plants by segregation.
cate food crops1,2. In turn, more than thirty countries have developed or CRISPR and related tools are site-directed DNA binding proteins
amended regulations around genome-edited plants, with many more that produce DNA modifications borne from endogenous cellular
in the process of doing the same3. While most regulatory bodies have repair, leading to small-nucleotide deletions or insertions (that is,
converged on a set of core principles for genome editing regulation, site-directed nuclease 1, SDN1), or from the template-mediated intro-
questions remain about how best to use laboratory methods to evaluate duction of deletions, insertions, or substitutions (SDN2)2,8. These
whether genomic modifications meet countries’ stated requirements. types of edit are typically, though not universally, exempt from geneti-
Clarity about how genome-edited plants may be regulated (used cally modified organism (GMO) regulation3,8 (Box 1). Crops that have
inclusively here to refer to statutes, rules, guidance, and any other legal received more substantial edits — such as large DNA insertions or
instruments applied by competent authorities) is critical to democ- substitutions (SDN3) — are variably exempted8. Some countries
ratizing the use of CRISPR and related technologies by ensuring that (for example, UK, USA, Ghana; see Table 1) have specific exemptions
requirements for commercialization are science-based, transparent, for DNA insertions sourced from sexually compatible relatives,
and predictable. Already, new guidance around genome editing has led whereas others (such as New Zealand and South Africa) regulate these
to a proliferation of crop developers from the public sector, academic as genetically modified (GM) products (Box 1). The scientific rationale
laboratories, and small-scale start-ups, resulting in the production of behind the former regulatory approaches maintains that genomic
a variety of crops edited for biotic and abiotic stress tolerance, nutri- mutants that could have occurred naturally or through conventional
tional fortification, enhanced flavor profile, improved agronomic breeding (for example, wide outcrosses, accelerated mutagenesis)
utility, and more4,5. do not pose increased risk when compared to conventionally bred
To equip regulators in low- and middle-income countries (LMICs) products, and therefore should not be regulated differently.
with hands-on laboratory training in genome editing, we convened a To differentiate between gene editing and genetic modification,
Regulatory Capacity Building Workshop for Genome-Edited Agricul- many countries’ genome editing regulations reference the absence of
ture at the Innovative Genomics Institute in January 2024. The training foreign DNA and/or inserted genetic material as a key criterion in crop
brought together 18 regulators from 16 countries (Bhutan, Burkina regulation (Box 1, Table 1). In regulatory reporting, developers typically
Faso, Bangladesh, Ecuador, Ghana, India, Kenya, Nigeria, Malaysia, confirm that all transgenes used in the editing process have been seg-
Malawi, Philippines, Sri Lanka, Uganda, the UK and Zambia), as well regated out of their candidate crop. Although this is straightforward
as representatives from the US Department of Agriculture (USDA), in many crops, it can be difficult in clonally propagated crops (such as
the Inter-American Institute for Cooperation on Agriculture (IICA), banana and potato), which complicates exemption from GMO status9.

nature biotechnology Volume 42 | December 2024 | 1773–1780 | 1773

Comment

sequence(s) and verify the removal of any exogenous DNA used in the
BOX 1 editing process (Table 1). However, there are exceptions: in the USA,
for example, developers can self-determine whether their crop(s) meet
stated exemption requirements. Notably, in many countries, plants
Genetically modified organism grown for commercial purposes — including conventional varieties —
are regulated under plant varietal registration laws, plant variety pro-
or living modified organism tections acts, and/or phytosanitary laws, so an exemption from GMO
regulations does not necessarily mean that a plant is ‘unregulated’.
The terms genetically modified organism (GMO) and living modified Regulators accept a wide range of biochemical, molecular biologi-
organism (LMO) are often used interchangeably. Definitions of GMO cal, and/or sequencing analyses to evaluate genome edited products
are ambiguous owing to its varied use in forums and literature. LMO (Fig. 1). In some cases, no testing is required, or testing protocols are
has an agreed definition in the Cartagena Protocol on Biosafety to unspecified and left up to the developer. For those regulators who
the Convention on Biological Diversity15. have specified testing protocols, these seek to establish whether
The terms ‘foreign DNA’ and ‘transgene’ are often used in the and how genome editing has occurred in a crop, and to show that any
context of GMO or LMO plants; they refer to genetic material transgenic intermediates have been excluded from the plant under
sourced from a non-sexually compatible species and introduced review (Box 2, Fig. 2).
into the recipient plant through in vitro nucleic acid techniques.
In this paper, GMO refers to organisms that contain a transgene(s), Verifying on-target edits
and GM product(s) refers to a product derived from a GMO or LMO. Verification of edits at a target locus is best substantiated by thorough
Across international borders, regardless of their purpose or analysis of sequence data, where the sequence of an edited variety is
genetic provenance, GMOs are subject to stringent regulatory compared to that of an unedited plant of the same genetic background.
assessment. Despite more than three decades of safe product Many genome-edited plants differ from the unedited varieties by only a
deployment, GM product release usually requires safety testing, few DNA bases, so evaluation of a PCR product with Sanger sequencing,
confined field trials, and risk management measures to mitigate risk short-read next-generation sequencing (NGS), or cleaved amplified
to human health and the environment. In an increasing number of polymorphic sequences (CAPS) analysis is suitable to substantiate a
countries, genome edited organisms are now recognized as distinct small edit. When a mutation is larger than 500 base pairs and cannot
from GMOs and are exempt from many of these measures. be assessed using PCR amplicons, alternative methods of sequencing
such as long-read NGS must be used (Box 2).

Likewise, reporting on genome edits can be challenging in highly poly- Verifying the absence of exogenous DNA
ploid genomes and in genes with many sequence-similar homologs, as Transgenes are the predominant method of delivering genome edit-
non-edited, off-target alleles complicate sequence analysis10. In these ing tools, and in sexually propagated plants are typically segregated
cases, it is crucial to employ appropriate technical analyses in deter- out of crop genomes through backcrossing once the desired edit has
mining the regulatory status of an edited plant. To ensure adherence been made2. Demonstrating the absence of a transgene is a crucial
to criteria, and to account for regional differences in technological criterion for genome editing regulatory exemptions in most nations
infrastructure, regulators must be comfortable interpreting a range (Box 2, Table 1). Because transfer DNA (T-DNA) or genomically inte-
of technical analyses to validate edits. grated DNA can be truncated, recombined, silenced, or retained episo-
mally, DNA sequence-based assays that holistically survey the transgene
Technical analysis of genome edits cassette (PCR and Southern blot) are generally better suited for regu-
Most countries represented at our workshop followed a case-by-case latory review than those that report on transgene protein expression
approach, whereby developers seeking regulatory approval complete (western blot or enzyme-linked immunosorbent assay (ELISA)). The
an application describing their edited crop and the edited genetic use of multiple PCR amplicons and/or DNA probes can be used to track

Verifying genome edits

Regulatory approach to testing in surveyed nations Accepted tests in nations with relevant protocol

Testing unspecified or No testing required PCR 83.3

in development 17.4%
30.4% Whole-genome sequencing 58.3

ELISA 50.0
n = 23
respondants CAPS such as
restriction digest 25.0

Other (Southern blot,

antibiotic selection, etc.) 25.0

0 20 40 60 80 100
Testing protocol
in effect Percentage of nations
52.1% where accepted

Fig. 1 | Pre-meeting survey results completed by 23 participants and potential participants to the IGI workshop indicating the testing approaches and accepted
tests by nations for genome edited products. While no testing is required in some countries, regulators may still accept testing data if submitted by a developer.

nature biotechnology Volume 42 | December 2024 | 1773–1780 | 1774

Comment

a Agrobacterium b
plasmid T1 edited plants

SpCas9 tNOS GTCACCTGAATTCTCGGATTTC

pOsU6
pPvUbi KanR
Unedited
LB RB
pSpec
Hemizygote
SpecR
WT/−1-bp
tSpec deletion
ori

Crossing and Homozygote

Transformation transgene –1-bp
segregation deletion

T0 transformants

c d SpCas9
Protospacer PAM EcoRI PAM
Reads TCGGTGTCACCTGAATTCTCGGAT
WT GATC GGT G T C A CC T G AA TTCTCGG ATT C G A 100% AGCCACAGTGGACTTAAGAGCCTA

T0
GATC GGT G T C A CC T G AA TTCTCGG ATT C G A 50% No
T2
GATC GGT G T C A CC T G AA T - CTCGG ATT C G A 50% digest WT T0 T1

T1 GATC GGT G T C A CC T G AA T - CTCGG ATT C G A 100%

Protospacer
Forward primer PAM Reverse primer

150 bp

Fig. 2 | Example data for genome editing validation in a Cas9-mediated from the unedited control indicate successful fixation of a stable edited allele.
knockout. a, Example rendering of Agrobacterium-mediated transformation c, Simulated analysis of next-generation amplicon sequencing of the edited
to create T0 sunflower plants. The inserted T-DNA includes a Cas9 cassette with locus. In T0 plants, the presence of both unedited and edited amplicons (in equal
a single guide, which is used to produce a genome edit at a diploid homozygous parts) indicates a hemizygous edit. In the homozygous plants, uniformly edited
locus and is then segregated out of subsequent generations. The resulting plant amplicons indicate complete fixation of the edited allele. d, CAPs digestion
and its progenitors are tested for genome edits and transgene segregation. b, of control, T0 hemizygote, and T1/T2 homozygote plants, wherein an EcoRI
Simulated Sanger sequencing analysis of unedited, hemizygote, and homozygote restriction site overlaps with the intended Cas9 cut site. In the wild-type (WT)
plants at the intended Cas9 cut site. Expected site of Cas9 editing is denoted with control, the amplicon is fully cleaved by EcoRI, whereas in T0 hemizygotes there is
the dashed line. In hemizygous plants, mixed peaks after the cut site indicate two evidence of both digested and undigested amplicon fragments. In homozygous
or more alleles, probably due to incomplete Cas9 cutting or microchimerism in edited plants, as is the case in the T1 and T2 generations, no digestion is detected
the sampled tissue. In homozygous edited plants, homozygous peaks that differ as EcoRI recognition and cutting is ablated by a genome edit.

transgene segregation, and data from multiple generations of edited with limited off-target potential11 or in downstream analysis of edited
plants can support complete transgene loss. crops. Although off-target events present some concern2, partici-
From our discussions at the workshop, PCR-based analysis of pants at the workshop were unclear how regulators might stand-
both editing outcomes and transgene segregation is the most used ardize or enforce limitations on off-target activity. Many genome
approach in global genome editing regulation (Fig. 1). This is unsurpris- edits are indistinguishable from naturally occurring mutations, and
ing given that the ability to conduct a PCR is widespread, even in labs modern CRISPR tools afford the production of edited plants with
in developing countries. Our analyses of the available analytical tests, similar levels of off-target mutations as typically arise through con-
and the language of regulatory reporting (Box 2), indicate that PCR is ventional breeding2,12,13. As high-quality whole-genome sequencing
sufficient to meet most countries’ regulatory protection goals. Com- remains intractably expensive and technically challenging in many
mon standards for technical analysis can help to streamline consistent crop species14, and because many commercial varieties do not have
reviews among nations with similar regulatory goals. full reference genomes upon which to predicate holistic off-target
analysis, implementing regulatory standards for off-target events
Future considerations is controversial. If off-target edits remain a concern for regulators,
Although many countries have clarified their processes in regulat- national performance trials (currently required in many countries
ing genome edited crops, several major questions remain regarding for both conventionally bred and edited varieties) can identify any
regulatory reporting. Regulators from some countries stipulated unexpected deleterious phenotypic changes.
that off-target events — that is, CRISPR mutagenesis at unintended The extent and depth of data necessary for regulatory assessment
sites — must be considered, either in the selection of guide RNAs was also a topic of discussion. Although many nations have some

nature biotechnology Volume 42 | December 2024 | 1773–1780 | 1775

Comment

Table 1 | GM products and genome editing (GEd) regulation for countries present at the workshop

Country GM crop cultivation and Import of GM products GEd policy, guidelines GEd policy target GEd products exempt in
products and SOPs organism(s) GM policy?

Bangladesh Six GM varieties in No GM crops imported Standard Operating Procedures GEd plants Free from exogenous DNA
cultivation: four Bt so far for Research and Release (SDN1 and SDN2 GEd plants)
eggplant and two Bt of Genome Edited Plants of
cotton. Five rice varieties Categories SDN-1 and SDN-2 in
in pipeline: golden rice Bangladesh (December 2023)
and four salt or drought
tolerant
Bhutan Cultivation of GM crops Import and distribution None N/A N/A
currently prohibited; of GM crops prohibited.
environmental release of No record of importing
viable GMOs prohibited GM crops. GMOs in
non-reproducible form
permitted for import
after safety assessment
Burkina Faso Bt cotton approved No current or previous Guide Technique pour GEd plants, animals i) A bsence of transgene
and previously permits for GMO la Réglementation and microorganisms in the final product:
cultivated; CFTs for Bt importation; CFTs de la Biotechnologie Moderne considered as a
cowpea, Bt maize and required for import of au Burkina Faso: édition conventional crop
Roundup-ready maize any GM crop génomique [Technical Guide ii) Lack of new combinations
for the Regulation of Modern of genetic material from
Biotechnology in Burkina Faso: non-sexually compatible
genomic edition]. GEd rice species
resistant to bacterial blight
defined as a conventional crop
Ecuador Constitutional ban on Import of GM food Technical Guide for the Use of Seeds and crops Seed or crops without foreign
cultivation of GM seeds permitted as long as it Seeds or Crops Obtained by DNA in the genome
and crops is labeled Precision Breeding Technique
(September 2023). PBT GEd
products registered and will be
marketed as conventional.
Ethiopia Bt cotton previously No GM products Guideline for the regulation of GEd plants Proposed for exemption:
approved for cultivation. imported so far Genome Edited Plants in Ethiopia i) All modifications by
CFT approvals for GM developed but not yet officially inserting genes from
blight-resistant potatoes approved; case by case regulation sexually compatible
and GM maize. species and where
Bt-Gt cotton and GM regulatory elements
WEMA/TELA maize (promoters and
approved for national terminators) are also from
performance trials the same species
ii) All deletions/knock outs
provided that there is no
insertion of foreign genetic
material in the end product
iii) Processed products whose
inserted foreign genetic
material cannot be detected
Ghana Bt Cowpea approved Import of GM maize and Guidelines for Genome GEd plants, animals i) End products from SDN-1
for introduction into soybeans for food, feed Editing Applications in Ghana and microorganisms methods that do not
the environment and/or or processing (October 2023); case by case contain inserted nucleic
placing on the market evaluation of GEd products acids or replicated product
ii) All deletions/knock outs
provided that regulatory
elements used are from the
same species (no insertion
of new elements)
iii) Processed products where
foreign gene(s) cannot be
detected
India Bt cotton is the only Ban on imports of Guidelines for Safety Assessment GEd plants SDN1 and SDN2 GEd plants
GM crop approved and GM seeds and grains; of Genome Edited Plants
cultivated since 2002 import restrictions (March 2022); Standard Operating
for foods with GM Procedures for Regulatory Review
ingredients of Genome Edited Plants under
SDN-1 and SDN-2 Categories
(October 2022)

nature biotechnology Volume 42 | December 2024 | 1773–1780 | 1776

Comment

Table 1 (continued) | GM products and genome editing (GEd) regulation for countries present at the workshop

Country GM crop cultivation and Import of GM products GEd policy, guidelines GEd policy target GEd products exempt in
products and SOPs organism(s) GM policy?

Kenya Bt cotton and Bt maize Approval for import of Guidelines for Determining the GEd plants, animals Products without any foreign
approved for cultivation Bt maize Regulatory Process of Genome and microorganisms genetic material exempted
Edited Organisms and Products from Biosafety Act regulation
in Kenya (February 2022). CFT and managed as conventional
determinations made for i) GEd varieties or breeds; case by
maize lines with resistance to case evaluation
maize lethal necrosis (MLN); ii)
GEd nitrogen-fixing bacterial
species with enhanced
nitrogen-fixing capabilities; iii)
GEd sorghum lines resistant to
parasitic weed
Malawi CFTs conducted for Bt Import approvals for Guidelines for Determining the GEd plants i) All GEd products with
cotton, Bt cowpea, GM GM animal feed Regulatory Process of Genome gene inserts from sexually
banana and GM maize Edited Plants and their Products compatible species and
in Malawi (February 2022). regulatory elements
Product-based approach but (promoters and terminators)
process of product development also from the same species
also followed to determine ii) Processed products with
whether transgene is used in undetectable foreign DNA
the process and present in the sequences
final product. Currently, no GEd iii) GEd outcomes similar to
product developed or imported those that could occur
but a laboratory certified for in nature or through
GEd research conventional breeding
Malaysia GM approvals for field Import approvals for No new legislation for GEd crops; N/A N/A
trials of papaya, rubber many GM products expected to be regulated under
and mosquitoes; for food, feed and the Biosafety Act 2007, as this
no applications for processing (for example, would fall under the regulatory
commercial cultivation GM maize, soybean, scope of modern biotechnology.
cotton, canola, potato). Ongoing consultations for
Few other approvals possible regulatory approaches
for non-food, feed or
processing products
Nigeria Approvals for general Approvals for import of National Biosafety GEd plants, animals GEd product without a new
release: Bt cotton, GM soybean, maize and Guidelines on Gene Editing and microorganisms combination of genetic
pod-borer resistant wheat for food, feed (December 2020); product and material; case-by-case
cowpea, TELA maize with and processing process-based approaches. regulation
gene stacks for drought Application for contained use
tolerance and insect research on GEd tomatoes
resistance traits received and approved
Philippines GM corn, eggplant, rice, Around 102 Rules and Procedure to Evaluate PBI plants PBI products without novel
and cotton approved for transformation events and Determine When Product combination of genetic
commercial cultivation authorized for direct of Plant Breeding Innovations material classified as
use as food or for feed (PBIs) are Covered Under the non-GMO and considered
processing, primarily DOST-DA-DENR-DOH-DILG Joint conventional products
sourced through Department Circular No.1 Series
imports of 2021 (JDC, s2021) Based on the
NCBP Resolution No.1 Series of
2020 (Memorandum Circular No.8
s2022); product-based evaluation
Sri Lanka Lab research only, no GMO import prohibition None N/A N/A
commercial cultivation for food, crops and
of GM crops animals
Thailand No commercial GM crops Import of GM crops The Technical Biosafety GEd plants, animals i) Absence of inserted
grown domestically prohibited except for Committee has developed and microorganisms genetic material
GM corn and soybean guidelines for the determination ii) Inserted genetic
used in industrial of organisms developed by GEd, material from a donor
food and animal feed which evaluates exemptions organism capable of
production from GMOs. The Ministry of natural interbreeding
Agriculture and Cooperatives has with a recipient
issued a Ministerial Notification organism, evaluated on a
on Certification of Organisms case-by-case basis
Developed through GEd for Use in
the Agricultural Sector

nature biotechnology Volume 42 | December 2024 | 1773–1780 | 1777

Comment

Table 1 (continued) | GM products and genome editing (GEd) regulation for countries present at the workshop

Country GM crop cultivation and Import of GM products GEd policy, guidelines GEd policy target GEd products exempt in
products and SOPs organism(s) GM policy?

Uganda More than 17 CFT No unprocessed GMOs Draft guidelines for GEd organisms GEd plants, animals N/A
approvals (for example, imported so far; milled and products developed and and microorganisms
cotton, maize, cassava, GM maize imported for currently under internal review.
banana, sweet potato, food emergency aid Determination for novel genetic
Irish potato, soybean combinations. Likely case by case
and rice) exemptions.
UK No GM crops Imports GM animal feed Genetic Technology (Precision Precision-bred PBOs: organisms produced
commercially cultivated; Breeding) Act 2023 animals and plants through precision breeding
GM field trials for technologies such as GEd
research purposes where the genetic changes
ongoing could have arisen through
traditional breeding
USA GM crops approved Permits import of USDA: Revised Biotechnology GEd plants, animals USDA:
for cultivation and GMOs such as GM corn, Regulations and microorganisms; i) Plants that could be
commercialization since soybean and canola FDA: Guidance for Industry: Foods depending on use, developed through
the 1990s Derived from Plants Produced different policies and conventional breeding with
Using Genome Editing agencies apply single targeted genetic
EPA: Final Rule: Exemptions modification
of Certain Plant-Incorporated ii) Plants that contain a plant-
Protectants Derived from Newer trait mechanism of action
Technologies combination that APHIS
FDA: Foods Derived from Plants has already evaluated and
Produced Using Genome Editing: determined are not subject
Guidance for Industry to the regulations
EPA:
i) P
 IPs created through
genetic engineering from a
sexually compatible plant
ii) loss-of-function PIPs
Zambia No GM crops cultivated Processed GMOs Draft guidelines for GEd products GEd plants, animals Proposed for exemption:
approved for food being developed and not yet and microorganisms absence of foreign DNA in the
and feed, mainly from officially approved; case by case genome (SDN1 and SDN 2)
South Africa exemption
APHIS, Animal and Plant Health Inspection Service; EPA, Environmental Protection Agency; FDA, Food and Drug Administration; GM, genetically modified; GMO, genetically modified organism;
GEd, genome edited; PBT, precision breeding techniques; PBO, precision-bred organisms; CFT, confined field trial; PBI, plant breeding innovation; SOP, standard operating procedures; TELA;
transgenic drought-tolerant and insect-protected (TELA) maize; WEMA, Water Efficient Maize for Africa; Bt, Bacillus thuringiensis; Gt, glyphosate tolerant; PIPs, plant-incorporated protectants;
N/A, not applicable. Summary of scientific data in most GEd submission forms: i) taxonomic description of the organism (genus, species); ii) purpose of genome editing activity and intended
use of the GEd organism; iii) description of molecular techniques used; iv) genes or DNA sequence(s) edited; v) type of genome editing done with supporting data and measures taken to
maximize likelihood that the modification is limited to the intended change and minimizes off-target events; vi) molecular description of the target organism’s nucleotide target sequences,
before and after genome editing, with supporting data; vii) molecular description of the genome edited organisms, their functions, and the affected pathways (where applicable) before
and after genome editing; viii) name, pathogenicity, and genetic maps of vectors used, whether or not disarmed and method of disarming; ix) delivery methods used for genome editing
(Agrobacterium, particle bombardment, floral dip, transfection); x) indication of whether the final product contains an inserted foreign DNA sequence(s) or unintended genetic modification or
off-target effects; xi) description of unintended genetic changes or off-target effects; xii) techniques used to remove inserted foreign DNA sequence(s) and evidence of absence; xiii) methods
and data to confirm absence of inserted foreign DNA sequence(s) and off targets in the GEd end products (for example, PCR flanking insertion sites, NGS, Southern blots).

protocols for laboratory analysis, large-scale phenotypic screening transgene is generally sufficient for exempting the products from
is still a major component of regulation in certain nations. Countries biosafety regulations.
such as the USA allow developers to self-evaluate their crops with A few regulators expressed concern about the monitoring and
limited reporting on phenotype, whereas countries such as Bang- traceability of genome edited plants that lack transgenic sequences,
ladesh, Burkina Faso, and the Philippines require data describing as some biosafety ordinances stipulate that any products derived from
the phenotype of the edited plant, typically derived from contained biotechnology be traced (as is the case with GMOs). Although this is not
field trials. Although phenotypic data provide clarity on the effects a major hurdle in SDN3 products — in which introduced or rearranged
of on-target edits, as well as any unintended or pleiotropic effects, it DNA can be identified using untargeted sequence analysis — in SDN1
places a burden of cost and time on the developer and increases the and SDN2 edited plants, genome edits may be challenging or impos-
resources required for regulators to conduct reviews. Furthermore, sible to distinguish from naturally occurring alleles. Relatedly, ques-
regulators must decide whether to make any data submitted to them tions were raised about whether genome edits must be re-evaluated
available to the public. Public reporting is a central component of if they are moved between different varieties, and about the regula-
review in many countries, but total transparency can threaten intel- tory status of multi-edit lines. Currently, almost all nations have some
lectual property protections and expose small developers to com- stated or implicit limit to the number of edits that can be made in a
petition from well-capitalized industry players. In countries that single line, regardless of whether edits can be stacked following regula-
primarily consider the presence of transgenes or foreign DNA in their tory approval. Clarification of these limits and of the status of ‘legacy’
regulatory determination, molecular evidence of the absence of a genome edits is in many cases still forthcoming.

nature biotechnology Volume 42 | December 2024 | 1773–1780 | 1778

Comment

BOX 2

Suitability of accepted analytical tests for verifying genome edits

in plants
Verifying on-target edits a site overlapping with the intended site of editing. The restriction
Sanger sequencing. Sanger sequencing of a short (200–800 bp) site will be removed or modified with a genome edit, so amplicons
PCR product is the most inexpensive and widely accessible method from an edited plant will remain uncleaved, while unedited control
for sequence analysis, and is useful for detecting small deletions, samples will be digested. Assuming complete or near-complete
insertions, and substitutions (Fig. 2b). Sanger data can be used to digestion, gel electrophoresis can differentiate between edited
precisely substantiate editing outcomes using bespoke analysis and unedited amplicons. To use this assay in regulatory review,
software or simple sequence alignment. Sequences of an edited and developers typically provide information about the modified site,
unedited control plant of the same variety are typically provided, including which sequences were modified and which restriction
with the edited line demonstrated to be distinct from a control plant. enzyme is used (Fig. 2d). Although not as precise as sequencing,
Although applicable to almost all released lines thus far, Sanger CAPS is ideal for inexpensively tracking the segregation of mutated
sequencing is not suited for the detection of large deletions (>1 kbp) alleles across multiple generations.
owing to technical limits of the assay. Similarly, Sanger cannot always
account for edited sequences in a plant that is heterozygous at the Long-read and whole-genome sequencing. Long-read NGS and
edited locus, or where a subset of sequence-similar homologous whole- or partial-genome sequencing, which are used to sequence
genes has been edited. In these cases, short-read NGS is preferred. long portions of DNA, are expensive and technically demanding. They
generate substantial amounts of data that require complex technical
Short-read next generation sequencing. Short-read NGS enables analysis and are necessary only in exceptional instances. In the context
deep sequencing of a specific amplicon (typically <600 bp) to account of verifying genome edits, they are most suitable for reviewing large
for a wide range of allelic diversity. Short-read amplicon sequencing deletions16 or large insertions from a sexually compatible relative.
is the preferred method of analysis in highly polyploid species with
many copies of an edited gene (such as wheat, strawberry), in target Verifying the absence of exogenous DNA
genes with many sequence-similar homologs (for example, gliadin PCR amplification. Typically, PCR to detect transgenes is performed
in wheat), or in instances in which a cultivated line is produced and by amplifying overlapping sequences of transfer DNA (T-DNA),
sold as a hemizygote (Fig. 2c). If a sequence with many copies or as well as any vector backbones used in transgenesis (Fig. 3a).
sequence-similar homologous regions is targeted, multiple amplicons Gel electrophoresis can be used to demonstrate the absence of the
might be required to accurately describe editing. While NGS transgenic sequences in all amplified loci. Quantitative PCR (qPCR)
sequencing is not available at all universities, commercial entities, or or digital PCR (dPCR) can also detect the presence or absence of a
research centers, improving access to mail-order sequencing provides transgene, enabling the quantitative investigation of transgene copy
an inexpensive route for highly accurate reporting. When this is not an number, which can be useful when multiple transgenic cassettes may
option, other methods such as CAPS can be used. have been inserted into a host genome.

Cleaved amplified polymorphic sequencing analysis. When Southern blot. Some countries recommend a Southern blot to track
sequencing is not available or no longer required — as might be the transgenes, wherein specific DNA probes are hybridized to transgenic
case for an established edit that has been already cleared through DNA (Fig. 3b). Blots are performed on multiple generations of
regulatory consideration — less descriptive diagnostic tests can be plants and with multiple probes targeted to the transgenic cassette
suitable. An alternative to sequencing is the CAPS assay, wherein and vector backbone. Although functionally equivalent to PCR,
a PCR-amplified fragment (typically <10 kbp) is digested with a Southern blotting can be onerous, ambiguous, and, in some cases,
restriction endonuclease to show that modification has occurred at a inaccessible to developers. As with qPCR and dPCR, Southern
specific site. To perform CAPS, a restriction enzyme is used to cleave blotting can determine the copy number of transgene insertion.

The case for global regulatory capacity building Evan Groover1,2 , Elizabeth Njuguna 1, Kailash Chander Bansal3,
As the next generation of genome editing tools is developed and Anne Muia4, Musa Kwehangana5, Christopher Simuntala6,
expanded, technical training for regulators is useful for keeping their Richard Lloyd Mills7, Emmanuel Kwakye8, Pedro Rocha9,
skills up to date. Most existing regulations reference cisgenesis and Josephine Amedu10, Eduardo Morillo11, Mohana Anita Anthonysamy12,
SDN1–SDN3-type editing, which may not encompass prime editors, A. B. M. Khaldun13, Lilian Chimpepo14, Massouroudini Akoudjin 15,
targeted recombinases, and other new tools for producing novel allelic D. M. J. B. Senanayake16, Dechen Wangmo17, Dessalegn Atnafu18,
variation. To keep pace with innovation, periodic hands-on technical Geronima P. Eusebio19, Chalinee Kongsawat20 & Melinda Kliegman 1
training is a practical avenue for continued dialog between scientists 1
Innovative Genomics Institute, University of California, Berkeley,
and regulators. In a post-workshop survey, most workshop attendees Berkeley, CA, USA. 2Department of Plant and Microbial Biology,
indicated the need for similar training for more regulators from LMICs to University of California, Berkeley, Berkeley, CA, USA. 3Department of
enhance their technical capacity for regulating genome edited products. Bio and Nanotechnology, Guru Jambheshwar University of Science &

nature biotechnology Volume 42 | December 2024 | 1773–1780 | 1779

Comment

a Amplicon Amplicon b BamHI

GATACGGATCCTTGGT
BamHI
ACCTCGGATCCACGTT
Amplicon B Amplicon D Amplicon Ladder NC PC1 WT T0 T1 T2 CTATGCCTAGGAACCA TGGAGCCTAGGTGCAA
A C E
Amplicon A pPvUbi KanR
(1,250 bp) T-DNA
LB SpCas9 RB Plasmid
LB RB Amplicon B
(900 bp) backbone
6.7 kb
Southern probe (750 bp)
Amplicon C
sgRNA pNOS -BamHI
(1,920 bp)
pOsU6 tNOS Unedited T0 T1 T2
Amplicon D control
pPvUbi SpCas9 tNOS KanR (1,650 bp) Plasmid
control
LB Amplicon E 23.7 kb
RB
(670 bp)
Amplicon Amplicon Amplicon Amplicon Actin 9.4 kb
B C D E (485 bp) 6.5 kb

4.3 kb

Fig. 3 | Example data for transgene outcrossing in a Cas9-mediated knockout. (PC1: for example, untransformed T-DNA plasmid) as well as a negative control
a, PCR amplification of plasmid and genomic DNA detects episomal DNA (NC: for example, no DNA template). b, Southern blot analysis detecting
(where plasmid is still present in sample: amplicons A and B) and T-DNA presence T-DNA presence or absence in the target crop genome. Genomic DNA from
or absence in transformed plants (amplicons C–E). To thoroughly account transformed plants is digested with BamHI to shear DNA into fragments,
for truncated and episomal DNA, PCR amplicons are tiled across the T-DNA followed by electrophoresis and hybridization to a DNA probe targeted to Cas9.
construct. Loss of amplicon signal, as in the T2 plant sample, indicates complete Hybridization of T0 plants indicates two discrete T-DNA insertion events, one of
T-DNA loss. PCR results will typically include suitable loading controls which is segregated away in the T1. Further segregation produces T2 plants with
(for example, a gene from a wild-type plant, such as actin), template controls complete transgene absence.

Technology, Hisar, India. 4National Biosafety Authority, Nairobi, Kenya. 4. Whelan, A. I., Gutti, P. & Lema, M. A. Front. Bioeng. Biotechnol. 8, 303 (2020).
5. Bullion, A. & Malhotra, B. Gene-edited crops market growth spurred by regulatory
5
Uganda National Council for Science and Technology, Kampala,
progress and approvals. S&P Global [Link]
Uganda. 6National Biosafety Authority, Zambia, Lusaka, Zambia. en/ci/research-analysis/gene-edited-crops-market-growth-spurred-by-regulatory-
7
Department for Environment Food and Rural Affairs, London, UK. [Link] (2023).
6. Wolter, F., Schindele, P. & Puchta, H. BMC Plant Biol. 19, 176 (2019).
8
National Biosafety Authority, Ghana, School of Nuclear and Allied
7. Zhang, Y., Malzahn, A. A., Sretenovic, S. & Qi, Y. Nat. Plants 5, 778–794 (2019).
Sciences, Accra, Ghana. 9Inter-American Institute for Cooperation 8. Ahmad, A., Jamil, A. & Munawar, N. Front. Plant Sci. 14, 1232938 (2023).
on Agriculture, Edificio IICA, San José, Costa Rica. 10National 9. Goralogia, G. S., Redick, T. P. & Strauss, S. H. In Vitro Cell. Dev. Biol. Plant. 57, 683–699 (2021).
10. Shillito, R. D. et al. In Vitro Cell. Dev. Biol. Plant. 57, 595–608 (2021).
Biosafety Management Agency, Abuja, Nigeria. 11Instituto Nacional
11. Naito, Y., Hino, K., Bono, H. & Ui-Tei, K. Bioinformatics 31, 1120–1123 (2015).
de Investigaciones Agropecuarias, Estación Experimental Santa 12. Bessoltane, N. et al. Sci. Rep. 12, 9330 (2022).
Catalina, Dpto. Nacional Biotecnología, Mejía, Ecuador. 12Department 13. Graham, N. et al. Plant Physiol. 183, 1453–1471 (2020).
14. Sun, Y., Shang, L., Zhu, Q.-H., Fan, L. & Guo, L. Trends Plant Sci. 27, 391–401 (2022).
of Biosafety, Ministry of Natural Resources and Environmental
15. Cartagena Protocol on Biosafety to the Convention on Biological Diversity: Text and Annexes
Sustainability, Putrajaya, Malaysia. 13Bangladesh Agricultural Research (Secretariat of the Convention on Biological Diversity, 2000).
Council, Dhaka, Bangladesh. 14Environmental Affairs Department, 16. Li, S. et al. Nature 602, 455–460 (2022).

Lilongwe, Malawi. 15Agence Nationale de Biosécurité/National

Acknowledgements
Biosafety Agency - Burkina Faso, Ouagadougou, Burkina Faso. The authors thank the ‘Regulatory Capacity Building Workshop for Genome-edited
16
Rice Research and Development Institute, Department of Agriculture, Agriculture’ trainers and administrative staff (D. Savage, L. Tripathi, N. Karavolias, C.
Ibbagamuwa, Sri Lanka. 17Bhutan Food and Drug Authority, Ministry Williams, K. Markel, B. Staskawicz, S. Abrahamson, Z. Lyons and D. O’Neal) for their efforts
to achieve a successful workshop in Berkeley; the other workshop attendees M. Takeuchi, S.
of Health, Thimphu, Bhutan. 18Biosafety and Invasive Alien Species Singh, V. Chinnusamy and S. Chakravarthy for their participation and input in the discussion
Regulation Desk, Ethiopian Environmental Protection Authority, Addis sessions; the USDA-APHIS team for critical reviews and feedback that helped to improve the
Ababa, Ethiopia. 19Biotechnology Office, Bureau of Plant Industry, manuscript; and the Innovative Genomics Institute and the University of California, Berkeley
for the use of seminar rooms and laboratory facilities for training.
Manila, Philippines. 20National Center for Genetic Engineering and
Biotechnology, Pathum Thani, Thailand. Author contributions
e-mail: groover@[Link]; [Link]@[Link] M.K. and E.N. initiated and ran the capacity building workshop where the information
presented in the manuscript was discussed. E.G. developed the training materials and
conducted hands-on laboratory exercises. Regulators and representatives from capacity
Published online: 11 December 2024 building organizations, K.C.B., A.M., M.K., C.S., R.L.M., E.K., P.R., J.A., E.M., M.A.A., A.B.M.K.,
L.C., M.A., D.M.J.B.S., D.W., D.A., G.P.E. and C.K., provided input on individual country
References regulations, discussion of the types of acceptable test and reviewed the manuscript. E.G., E.N.
1. Karavolias, N. G., Horner, W., Abugu, M. N. & Evanega, S. N. Front. Sustain. Food Syst. 5,
and M.K. drafted, edited and finalized the manuscript.
685801 (2021).
2. Pixley, K. V. et al. Nat. Genet. 54, 364–367 (2022).
3. Sprink, T. & Wilhelm, R. in A Roadmap for Plant Genome Editing (eds. Ricroch, A. et al.) Competing interests
425–435 (Springer Nature, 2024). The authors declare no competing interests.

nature biotechnology Volume 42 | December 2024 | 1773–1780 | 1780