LIVING ENVIRONMENT

The University of the State of New York

REGENTS HIGH SCHOOL EXAMINATION

LIVING ENVIRONMENT
Tuesday, June 17, 2025 — 1:15 to 4:15 p.m., only

Student Name______________________________________________________________

School Name_______________________________________________________________

The possession or use of any communications device is strictly prohibited when taking
this examination. If you have or use any communications device, no matter how briefly, your
examination will be invalidated and no score will be calculated for you.

Print your name and the name of your school on the lines above.

A separate answer sheet for multiple-choice questions in Parts A, B–1, B–2, and D
has been provided to you. Follow the instructions from the proctor for completing the
student information on your answer sheet.

You are to answer all questions in all parts of this examination. Record your
answers for all multiple-choice questions, including those in Parts B–2 and D, on the
separate answer sheet. Record your answers for all open-ended questions directly in
this examination booklet. All answers in this examination booklet should be written
in pen, except for graphs and drawings, which should be done in pencil. You may use
scrap paper to work out the answers to the questions, but be sure to record all your
answers on the answer sheet or in this examination booklet as directed.

When you have completed the examination, you must sign the declaration printed
on your separate answer sheet, indicating that you had no unlawful knowledge of
the questions or answers prior to the examination and that you have neither given
nor received assistance in answering any of the questions during the examination.
Your answer sheet cannot be accepted if you fail to sign this declaration.

Notice …
A four-function or scientific calculator must be available for you to use while taking this
examination.

DO NOT OPEN THIS EXAMINATION BOOKLET UNTIL THE SIGNAL IS GIVEN.

LIVING ENVIRONMENT
 Part A
Answer all questions in this part. [30]
Directions (1–30): For each statement or question, record on the separate answer sheet the number of the
word or expression that, of those given, best completes the statement or answers the question.

1 Which of these components are found in all living 5 Ladybugs that eat plant pests are currently
organisms? raised and sold commercially to gardeners. It was
(1) estrogen and testosterone assumed that all of the imported ladybugs would
(2) insulin and water remain within the garden area and consume only
the harmful insect pests. It is now known that
(3) chlorophyll and hemoglobin
the ladybugs can travel widely, with one study
(4) cytoplasm and ATP
showing that within a few days, 99% had left the
area where they were originally released.
2 Two types of molecules directly involved in
cellular communication are
(1) hormones and nerve cell chemicals
(2) fats and carbohydrates
(3) ATP and carbon dioxide
(4) glucose and oxygen

3 When mountain lions consume large prey, they

often leave large pieces of their prey behind.
The carcass that is left becomes a food source for
other organisms. A scientist reported a count of
24,000 beetles in an area where mountain lions
had left partially eaten carcasses. Wolves, bears,
and other animals also take advantage of the
One environmental concern regarding the use of
remains of the prey. ladybugs to control insect pests could be that
(1) ladybugs are an endangered species and must
The role of the mountain lion in this ecosystem is be collected in the wild
an example of the concept that (2) ladybugs are a safer alternative than the use
(1) ecosystems require a large number of of chemical pesticides
predators to increase the number of prey (3) the migration of introduced ladybugs may
(2) populations are linked with many others in a affect food webs in other areas
stable ecosystem (4) the action of ladybugs may reduce insect pest
(3) large animals waste food, resulting in harm to populations
other organisms in the ecosystem
(4) predators should consume small prey to
6 The best-adapted individuals in a population are
protect the diversity of the ecosystem
most likely to be successful in passing on their
traits to the next generation because
4 Mutations are an important part of evolution.
(1) they were able to survive the conditions of
One reason for this is that mutations
their environment when others could not
(1) that occur in body cells are passed to (2) their offspring will be better able to cope
offspring with any environmental changes that may
(2) are random events that always increase the occur
ability of members to reproduce (3) their genes are the strongest, which will help
(3) occur only in sexually reproducing organisms them attract suitable mates
(4) may result in gene variations that provide a (4) they are less attractive and are less likely to
survival advantage find suitable mates
Living Environment – June ’25 [2]
 7 Some structures found in living organisms are 9 Many species of warblers, including the
shown below. Blackburnian warbler shown below, migrate
from Central and South America to New York
State, where they breed each summer. Warblers
primarily prey on insects and nest in hemlock
trees.

Protein DNA Cell

molecule molecule

Which statement best describes the relationship

among the three structures?
(1) DNA is produced by large protein molecules
that diffuse into the cell.
(2) Protein is composed of DNA that is produced An invasive insect, the wooly adelgid, is killing
in the cell. hemlock trees across the entire state. If this
(3) DNA controls the production of protein in continues, fewer warblers will be able to find
the cell. suitable nesting sites. One consequence of this
(4) A cell is composed entirely of DNA and may be that
protein. (1) there will be more food for birds that prey on
warblers and other small birds
8 Scientists found that over a period of 300 years, (2) fewer acorns will grow on the oak trees that
a pond slowly transformed into a meadow and also grow in the forest
then a forest. During that time, communities (3) insect pest populations will increase because
of organisms were replaced by different fewer warblers are present
communities. (4) more warbler eggs will be hatched in
Central and South America to increase the
The best explanation for why new communities population
were able to replace the older communities is that
(1) the species in the old communities died of 10 Seagrass populations decrease significantly in size
disease when sea turtles overgraze the area in which the
(2) the environment gradually changed, grasses grow. When predators such as sharks have
making the area less favorable for the old a constant presence in the same area, the turtles
communities leave and the seagrass population increases. This
is an example of how organisms
(3) there was a lack of predators for the new
communities of organisms (1) influence other species in a community
(4) the original species suddenly became extinct (2) balance their basic nutritional needs
(3) maintain their own internal stability
(4) depend on physical conditions for survival

Living Environment – June ’25 [3] [OVER]

 11 Strawberry plants grow runners off of the main 13 Mammals, including humans, dolphins, and
parent plant, as shown in the photo below. cows, produce milk for their young. Surprisingly,
researchers have discovered that certain spiders
also produce a milk-like fluid for their young.
The spider leaves droplets of her “milk” around
the nest for the babies after they hatch from their
eggs. After one week, the babies will feed on the
“milk” directly from her body for at least 20 days.

New strawberry plants that are genetically

identical to the parent plant develop along the
runners. This phenomenon can be best explained
by the fact that these strawberry plants are
produced by
Which statement best describes this recent
(1) asexual reproduction, and the new plants discovery?
develop by mitosis and differentiation
(1) It proves that all female animals produce the
(2) sexual reproduction, and the new plants
same hormones to make milk.
develop by meiosis and fertilization
(2) The discovery will allow for the re-
(3) asexual reproduction, and the new plants
classification of spiders as mammals.
develop by meiosis and fertilization
(3) It is an example of parental care for the
(4) sexual reproduction, and the new plants
survival of their offspring.
develop by mitosis and differentiation
(4) The discovery confirms that spiders provide
mammal milk to their offspring.
12 During a class field trip, a student measured and
recorded some abiotic factors present in a pond.
14 As part of the “Charge NY” energy plan, New
Which data did the student most likely include in
York drivers are being encouraged to purchase
their record of abiotic factors?
electrically powered cars. Many believe that this
(1) the number of possible food chains and food will help the environment by
webs
(1) reducing the number of cars on the road,
(2) the diversity of decomposers and their total
since drivers will only be able to go short
mass
distances before having to recharge the
(3) the temperature and pH of the water battery
(4) the size and number of fish species (2) reducing local air pollution by lowering levels
of carbon dioxide and other pollutants
(3) decreasing the number of car sales, since
electric cars are more expensive than
gasoline-powered cars
(4) decreasing the consumption of fossil fuels,
since only renewable energy sources can be
used to generate electricity

Living Environment – June ’25 [4]

 15 The New Mexico whiptail is a female-only 18 Which statement about amino acids and simple
species of lizard that exhibits an unusual form sugars is correct?
of asexual reproduction. Researchers discovered (1) Amino acids are used to build inorganic
that these lizards produce eggs that have a full set molecules, and simple sugars are used to
of chromosomes and have the genetic diversity of build organic molecules.
sexually reproducing lizards. (2) Starches are digested into amino acids, and
proteins are digested into simple sugars.
(3) Amino acids and simple sugars are used as
building blocks in the synthesis of organic
compounds.
(4) Amino acids can enter cells, and simple
sugars cannot enter cells.

19 Protein chains may break. This can cause a

problem for living cells because
Which statement best describes the offspring of
these lizards? (1) if the proteins break, the cell will contain
more proteins than it needs
(1) The offspring are a result of uniting a male
(2) if the chains break, the amino acids will
and female gamete.
poison the cell, destroying organelles
(2) The offspring develop from eggs with twice
(3) the broken proteins will not interact with
the genetic information of the female lizard.
other molecules correctly
(3) The offspring have cells that contain DNA
(4) the broken chains will attack the ribosomes
found only in the female lizard.
of the cell and shut them down
(4) The offspring are genetically identical to
each other and the female lizard.
20 Enzymes are essential to maintaining homeostasis
16 In humans, the placenta is important to the and helping to regulate human metabolism. They
developing embryo. Which essential life functions are also examples of molecules that are
are carried out by the placenta? (1) composed of complex carbohydrates
(1) nutrition, excretion, and reproduction (2) not specific to any life function
(2) respiration, nutrition, and excretion (3) synthesized by the cell membrane
(3) movement, reproduction, and nutrition (4) influenced by pH
(4) coordination, immunity, and movement
21 The process by which DNA molecules separate
17 Injecting individuals with a vaccine composed and add new molecular bases to form another
of killed bacteria protects them from a disease DNA molecule is called
because the proteins from the killed bacteria (1) protein synthesis
(1) serve as food for invading pathogens, which (2) cell membrane synthesis
prevents them from feeding on human (3) replication
proteins (4) mitosis
(2) bind with cell nuclei, preventing live
pathogenic bacteria from binding with the
nuclei later
(3) cause a mild case of the disease, preventing
the immune system from responding to
future infections
(4) stimulate the production of antibodies that
can be produced in response to an infection

Living Environment – June ’25 [5] [OVER]

 22 Which row in the chart below correctly describes activities that occur in each of the two organelles shown?

Row Chloroplast Activity Mitochondrion Activity

(1) uses glucose as it functions makes glucose as it functions
(2) makes glucose as it functions uses glucose as it functions
(3) uses oxygen as it functions makes oxygen as it functions
(4) uses oxygen as an energy source uses carbon dioxide as an energy source

23 The amount of fossil fuels consumed from 1800 until 2017 is shown in the graph below.

Global fossil fuel consumption

Global primary energy consumption by fossil fuel source, measured in terawatt-hours (TWh).

120,000 TWh
Natural gas
100,000 TWh

80,000 TWh
Crude oil
60,000 TWh

40,000 TWh

20,000 TWh Coal

0 TWh
1800 1850 1900 1950 2000 2017

The increased demand for and use of fossil fuels is a direct result of an
(1) increased focus on renewable energy sources (3) increase in atmospheric changes
(2) increased concern for environmental stability (4) increase in industrialization

Living Environment – June ’25 [6]

 24 Some prescription drugs come with a warning that 27 Some medications have been found to damage
these drugs should be avoided during the early mitochondria. This can upset metabolism
stages of pregnancy. The reason that pregnant because mitochondria
women should avoid certain medications early in (1) synthesize energy to make organic
their pregnancy is because the drug may compounds
(1) affect the development of organs in the fetus (2) produce carbon dioxide, which is used for
(2) interfere with meiosis cellular respiration
(3) allow differentiation to occur (3) release oxygen, which is necessary for
(4) interfere with fertilization photosynthesis
(4) produce ATP molecules used for cellular
25 Lions in East Africa are night hunters. They are processes
most successful during the darker phases of the
moon, when they are less visible. Prey animals, 28 The Labrador retriever is a breed of dog that
such as the wildebeest shown below, are also is characterized by a solid yellow, brown, or
influenced by the moon cycles and amount of black coat and a friendly personality. In order
darkness. During the dark phases of the moon, to increase the chances of Labrador retriever
they are less active. puppies having these traits, breeders should
(1) insert the genes for these traits into the cells
of the puppies
(2) increase genetic variation by mating dogs
with different traits
(3) breed only dogs with the desired traits to
produce puppies
(4) use asexual reproduction to breed dogs with
a variety of traits

29 An example of a harmful immune response

occurs when immune cells cause the breakdown
This behavior shows that of
(1) predator behaviors are controlled by the (1) cancerous tissue
carrying capacity of the environment (2) bacteria cells
(2) environmental factors can influence the (3) pathogenic viruses
behavior of predators and their prey (4) transplanted organs
(3) producers directly regulate the number of
predators in community
(4) consumers influence the physical factors in 30 Individuals who use tanning beds have an
the predator’s ecosystem increased risk of getting skin cancer. Their skin
cancer may
(1) be passed to their offspring because it is a
26 The removal of three consecutive base-subunits gene mutation
from a gene would most directly affect the (2) spread in the individual but will not be
(1) membrane of a cell directly passed to their offspring
(2) structure of a protein (3) result in the offspring having immunity to
(3) pH of the cytoplasm skin cancer
(4) size of a cell nucleus (4) help their offspring better adapt to skin
cancer in sunnier climates

Living Environment – June ’25 [7] [OVER]

 Part B–1
Answer all questions in this part. [13]
Directions (31–43): For each statement or question, record on the separate answer sheet the number of the
word or expression that, of those given, best completes the statement or answers the question.

Base your answers to questions 31 through 34 on the information and nitrogen-cycling model illustrated
below and on your knowledge of biology.

Material cycles are necessary to recycle substances needed and used by organisms in
their habitat.
The atmosphere is composed of about 80% nitrogen gas (N2) that cannot be used by
most organisms in that form. It is through the action of many different types of bacteria that
the nitrogen gas can be made available to other organisms.
The diagram below represents a model of the nitrogen cycle.

Denitrification
Atmospheric Nitrogen (N2)

Denitrifying
Ammonium (NH4 ) + bacteria
Fungi
Nitrogen Assimilation
fixation Decomposers Plants Nitrate (NO3-)
Aerobic and anaerobic bacteria

Nitrogen-fixing bacteria Nitrifying

in legume root nodules bacteria
Ammonification
Nitrogen Nitrification
fixation
Ammonium (NH ) 4
+
Nitrite (NO2-)

Nitrogen-fixing soil bacteria Nitrifying bacteria

31 Based on the model, which bacteria are able to convert atmospheric nitrogen gas to nitrogen compounds in
the soil?
(1) aerobic and anaerobic bacteria (3) nitrogen-fixing bacteria
(2) nitrifying bacteria (4) denitrifying bacteria

32 Based on the model, which two organisms carry out opposite processes?
(1) nitrifying bacteria and nitrogen-fixing bacteria in the soil
(2) nitrogen-fixing bacteria in the soil and nitrogen-fixing bacteria in legumes
(3) aerobic bacteria and anaerobic bacteria
(4) denitrifying bacteria and nitrogen-fixing bacteria in the soil

Living Environment – June ’25 [8]

 33 Plants can use nitrates from the soil to make amino acids such as alanine (C3H7NO2).

Two other substances plants take in from their environment that would provide all of the components to
make many alanine molecules are
(1) carbon dioxide (CO2) and water (H2O) (3) water (H2O) and oxygen (O2)
(2) carbon dioxide (CO2) and sunlight (4) glucose (C6H12O6) and oxygen (O2)

34 If all of the aerobic and anaerobic bacteria indicated as decomposers in the model were lost from this
ecosystem, the most likely effect would be
(1) a decrease in the carrying capacity for nitrogen-fixing bacteria
(2) an increase in the number of nitrifying bacteria
(3) a decrease in the carrying capacity for plants
(4) an increase in activity of the nitrifying bacteria

Base your answers to questions 35 and 36 on the information below and on your knowledge of biology.

Male Pacific field crickets make a loud song that travels a long distance to attract females.
They use their wings to create the sound. On the island of Kauai, the loud calls not only
attract mates, but also a specific fly species. The fly deposits larvae on the cricket. As the fly
larvae mature, they eat the cricket from the inside out.
One summer, observers on Kauai noticed that the crickets were unusually quiet. They
also noticed that the wings of these quiet crickets were shaped differently. The scientists
hypothesized that the wing mutation helped crickets escape the fly. They collected the
following data while testing their hypothesis:

Male Pacific Field Crickets

Without Wing Mutation With Wing Mutation
Fly Larvae Present 30 1
Fly Larvae Not Present 70 121
Percent With Larvae 30% 0.8%

35 Which statement most accurately describes the relationship between the data and the original hypothesis?
(1) The data support the hypothesis because crickets with the mutation had fewer fly larvae.
(2) The data support the hypothesis because crickets without the mutation had a greater percentage of
survivors.
(3) The data do not support the hypothesis because crickets with the mutation had more fly larvae.
(4) The data do not support the hypothesis because crickets with the mutation had a smaller percentage of
survivors.

36 Scientists have noticed that crickets with the mutation are still able to attract mates. Based on the data,
which prediction is valid if this particular fly remains part of the cricket’s environment?
(1) The number of crickets with the mutation will decrease because the trait is beneficial to them.
(2) The number of crickets with the mutation will remain the same because the trait is neither beneficial nor
harmful.
(3) The number of crickets with the mutation will increase because the trait gives them an advantage.
(4) The number of crickets with the mutation will increase because the trait is a disadvantage.

Living Environment – June ’25 [9] [OVER]

 For 20 days, two groups of plants, all with stems of the same length, were grown at two
different temperatures. These plants normally grow at a temperature of 25°C. All other
environmental conditions were the same. The stem lengths of the plants were measured
every five days, averaged, and the data recorded in the table below.

Time (days) Length of Stem (mm)

Plants in A Grown at 17°C Plants in B Grown at 27°C
1 15 15
5 25 30
10 42 68
15 54 80
20 71 92

37 Scientists claimed that plants growing in the Group A experimental setup at 17°C would be likely to survive
if the temperature in their natural environment decreased over time to 17°C. Which statement uses data
from the table to support this claim?
(1) Plants in A survived growing at 17°C in their experimental setup and would therefore be likely to survive.
(2) Plants in A require less water. This makes them more likely to survive in cooler temperatures.
(3) Plants in B are growing the most rapidly. A temperature of 17°C will not harm them.
(4) Plants in B will survive and will grow faster at the cooler temperature.

Sea Otters at Risk

A single-celled parasite is responsible for the death of a large number of sea otters.
Scientists have traced the origin of the parasite to multiple sources, including domestic cat feces. Rain
washes some litter box wastes, which contain cat feces, into the ocean kelp forests where sea otters live.

38 Failure to properly dispose of contaminated cat litter is an example of

(1) one way sea otters are negatively affecting large numbers of household pets
(2) how humans are preventing a dangerous parasite from reproducing
(3) a human action that inadvertently could alter the equilibrium in an ecosystem
(4) the release of a substance that could result in a rapid growth of the sea otter population

Living Environment – June ’25 [10]

 Base your answers to questions 39 and 40 on the information below and on your knowledge of biology.

Lead in the Environment

Soil contaminated with lead is a source of lead exposure in people and is a worldwide
health concern. Scientists examined the relationship between exposure to lead in the topsoil
and the occurrence of learning difficulties in children. Soil clings to fingers, toys, and other
objects. When young children are exposed to lead, they can experience difficulty with
remembering, concentrating, and learning.
Lead was used as a gasoline additive until 1996, when it was banned. Emissions from
cars and trucks resulted in a buildup of lead in the soil along the side of the road. In a
recent study, scientists measured the concentration of lead along sections of the interstate
highway system. They then compared the levels of lead in the soil along the side of the road
with the number of children in the area experiencing cognitive difficulties. The scientists
discovered that where the level of lead in the soil is high, the number of children with
learning difficulties is also high.

39 In order to support the claim that lead in the soil can result in learning difficulties in children, the scientists
should
(1) repeat the study comparing lead levels in the soils near rivers with those near highways
(2) support the passage of laws to eliminate the use of lead additives in gasoline
(3) determine if high soil concentration of other metals, such as iron, causes learning difficulties in children
(4) determine if there is a correlation between high levels of lead in the soil and in the blood of children with
learning disabilities

40 After discovering where lead levels in the topsoil are high, what could parents do to reduce the chances of
learning difficulties in their children?
(1) Provide their children with only organic fruits and vegetables.
(2) Have their children wash their hands after playing outside.
(3) Have their children attend school in a different part of the community where lead levels are lower.
(4) Provide their family physician with information about any genetic disorders in the family.

41 Beavers have been migrating north and impacting Arctic ecosystems. By building dams on streams, beavers
are creating new bodies of water where there were none. These new bodies of water contribute to the
thawing of the frozen permafrost soil, which is a huge natural reservoir of stored greenhouse gases. In a
study of beaver dams located on Alaska’s Baldwin Peninsula, there was a total of 94 dams in 2010, and by
2019 there was a total of 409 dams.

Based on these numbers of beaver dams constructed between 2010 and 2019, a reasonable claim that
scientists can make concerning beaver activity in the Arctic is that beavers
(1) are accelerating the rate of global climate change
(2) are producing a more stable Arctic ecosystem through dam-building
(3) have exceeded their carrying capacity in the Arctic
(4) have caused more soil to freeze during the winter months

Living Environment – June ’25 [11] [OVER]

 42 White-tailed deer in New York State breed once a year. The timing of the breeding season and birth of
offspring is represented in the chart below.

White-Tailed Deer Reproductive Cycle Timeline

Female deer reproductive cycle

Deer breeding Birth of

season offspring

Aug. Sept. Oct. Nov. Dec. Jan. Feb. Mar. Apr. May June July

Which statement best helps explain why this breeding cycle is successful for deer?
(1) Giving birth in the spring and early summer ensures that there will be food for the offspring.
(2) Deer avoid giving birth during the fall hunting season.
(3) Fall is the only time of the year male and female deer are in the same locations.
(4) Large deer predators move to cooler locations during the hot summer months.

The diagram below represents human body cells and their interactions with the hormone, insulin.

Normal Insulin
Resistance
Body cells
Body cells

Insulin Insulin

Glucose
Bloodstream

43 Insulin resistance results when the body produces insulin but cells are not able to respond to it. This resistance
could result in
(1) a lower level of glucose in the bloodstream (3) a failure of glucose to leave the cells
(2) an increase of glucose in the cell (4) an increase in glucose in the bloodstream

Living Environment – June ’25 [12]

 This page left blank intentionally.

Living Environment – June ’25 [13] [OVER]

 Part B –2
Answer all questions in this part. [12]

Directions (44–55): For those questions that are multiple choice, record on the separate answer sheet
the number of the choice that, of those given, best completes each statement or answers each question. For all
other questions in this part, follow the directions given and record your answers in the spaces provided in this
examination booklet.

Base your answers to questions 44 through 49 on the information below and on your knowledge of biology.

Why Do Marimo Balls Float and Sink?

Marimo are fuzzy, round balls of a rare algae that is native to some cold, freshwater
lakes. They have been observed to float after dawn and sink after dusk. A group of scientists
conducted experiments to determine the cause of this floating and sinking action.
In one experiment, a marimo ball was placed in a graduated cylinder with 500 mL of
water and exposed to light for four minutes. After four minutes, the light was turned off and
the marimo was kept in the dark for another four minutes. The position of the marimo was
measured each minute by recording the location of the marimo in the graduated cylinder
with respect to the mL lines.

The experimental setup and data table are shown below. The data table gives the position of the top of
the marimo in the cylinder during the eight-minute interval.

Experimential Set-up
Marimo Position in Light and Dark Conditions
mL
500 Time (minutes) Position (mL)
1 100
400 2 225
Light on
300 3 500
4 500
200 5 500
6 425
100 Light off
7 200
Marimo 8 100

Living Environment – June ’25 [14]

 Directions (44–45): Using the information given in the data table, construct a line graph on the grid provided,
following the instructions below.

44 Mark an appropriate scale, without any breaks in the data, on each labeled axis. [1]

45 Plot the data on the grid provided. Connect the points and surround each point with a small circle. [1]

Example:

Marimo Position in Light

and Dark Conditions
Position (mL line)

Time (minutes)

46 State the relationship between the light exposure and the position of the marimo balls. [1]

Note: The answer to question 47 should be recorded on your separate answer sheet.

47 The scientists observed that when the marimo were floating, they were covered with tiny bubbles. They
hypothesized that these bubbles were products of photosynthesis. Therefore, the bubbles were most likely
(1) carbon dioxide (3) glucose
(2) hydrogen (4) oxygen

Living Environment – June ’25 [15] [OVER]

 48 Describe one advantage to the marimo algal balls having the ability to float during the day. [1]

Note: The answer to question 49 should be recorded on your separate answer sheet.
49 In order to determine if the floating of marimo was due to photosynthesis, the scientists treated them with
DCMU, a chemical that prevents cells from carrying out photosynthesis. The DCMU-treated marimo were
exposed to light continuously for 48 hours. No bubbles were observed on the surface of the treated marimo
and they did not float.
Based on these results, scientists can conclude that
(1) gas released during photosynthesis causes marimo to float
(2) warmer temperatures cause marimo to float
(3) photosynthesis is not responsible for marimo floating
(4) DCMU treatment increases the ability to float

Base your answers to questions 50 and 51 on the information and graph below and on your knowledge of
biology.

Adirondack Logging Results

A forested area in the Adirondacks was heavily logged in the early 1900s. The logging
ended in 1915, leaving empty fields of grasses and some shrubs. Over the next 80 years,
until 1995, the abundance of different plant species was recorded periodically to show the
changes that occurred in the area. A graph representing these changes is shown below.

Changes in an Adirondack
Ecosystem Over Time

Spruce
Each Plant Species

Birch trees trees

Relative Mass of

Maple
trees
Grasses Shrubs

Time

Living Environment – June ’25 [16]

 Note: The answer to question 50 should be recorded on your separate answer sheet.

50 Which inference is reasonable, based on the data in the graph?

(1) Spruce grouse, which inhabit spruce forests, became more common over the years.
(2) Mice and other grassland species remained abundant in the area for many years.
(3) Birds living in this area in 1995 preferred shrub habitats over heavily wooded habitats.
(4) Birch trees are likely the most common type of tree species in the area today.

51 Describe how the graph would likely appear 20 or more years after 1995 if the study had continued. Support
your answer. [1]

The diagrams below represent parts of the human male and female reproductive systems.

Male Reproductive System Female Reproductive System

C
B
B

C
A
D

A D

52 Identify one process carried out by both structures labeled A. [1]

Living Environment – June ’25 [17] [OVER]

 The diagram below represents the carrying capacities of an ecosystem for three different species and
the relative population sizes for each species in the area.

Carrying Capacities of
an Ecosystem

Number of Individuals
in the Species
Key
Carrying capacity
Actual population size

1 2 3
Species

53 Which species is most likely to undergo a population increase in the future? Support your answer. [1]

Base your answers to questions 54 and 55 on the diagram below and on your knowledge of biology.
The diagram illustrates the active transport of molecules of A through a portion of a cell membrane.

Active Transport

Energy Use

Molecules of A

54 Explain why this diagram is labeled “Active Transport.” [1]

55 The “Energy Use” label involves a specific molecule produced by this cell. Identify this molecule and
a cellular process that produces it. [1]

Living Environment – June ’25 [18]

 Part C
Answer all questions in this part. [17]
Directions (56–72): Record your answers in the spaces provided in this examination booklet.

Base your answers to questions 56 and 57 on the information below and on your knowledge of biology.

Why Honey Badgers Don’t Care

The honey badger, found in parts of India, Africa, and the Middle East, has been
identified as “the world’s most fearless creature” by the Guinness Book of World Records.
Although they are primarily carnivorous, honey badgers consume a wide variety of food:
rodents, insects, bee larvae, birds, and fruit. Venomous snakes, including cobras and puff
adders, are also favorite items on their menu.
As much as 25% of a honey badger’s diet consists of venomous snakes with fangs. The
adaptation to withstand snake venom has enabled them to be one of the only predators to
feast on this source of meat. They hunt fairly slow-moving prey with fangs rather than fast
prey with claws and teeth.
Snake venom contains more than 100 proteins that could potentially poison a honey
badger—meaning that honey badgers need multiple defenses. Scientists have focused their
research on a nasty class of molecules in cobra venom called alpha-neurotoxins, that paralyze
the muscles associated with breathing. These neurotoxins block a specific receptor and
therefore prevent muscle cells from receiving signals from the nervous system.
Presently, most antivenoms used to treat snake bites are made of proteins produced by
the immune systems of horses and sheep exposed to specific snake venoms. These proteins
attack the venom directly in people bitten by a venomous snake.

56 Explain how the ability of honey badgers to eat venomous snakes is an example of a favorable
adaptation. [1]

57 State why using an antivenom made from horse proteins could result in an allergic reaction. [1]

Living Environment – June ’25 [19] [OVER]

 Base your answers to questions 58 through 60 on the information below and on your knowledge of biology.

Three Billion North American Birds Have Vanished Since 1970

Recent surveys of 529 bird species revealed that since 1970 the North American continent
lost 3 billion birds, 29% of the total. Birds are excellent indicators of environmental health
and are vital to ecosystems. Common bird species control insects, pollinate flowers, spread
seeds, and help regenerate forests. As a result, when these birds disappear, their former
habitats are not the same.

Change in North American Bird Populations Since 1970

Bird decline by habitat (%)
Wetlands
Coasts
Arid lands
Eastern forest
Forest generalist
Habitat generalist
Arctic tundra
Western forest
Boreal forest
Grassland
250 240 230 220 210 0 10

Decline by type (%)

American sparrows
Wood warblers
Blackbirds
Old world sparrows
Larks
Finches
Swallows, nightjars, swifts
Tyrant flycatchers
Starlings
Thrushes
Turkeys and grouse
Raptors
Gnatcatchers
Ducks and geese
Vireos
250 0 50 200

Many factors influence the bird populations. Loss of habitat to urban sprawl, converting
grasslands into farmlands, and the use of pesticides to reduce insect populations have been
particularly hard on some bird species. Changes to natural habitats can reduce nesting sites
and limit flight paths for migratory birds. House cats that are allowed outside and feral cats
contribute significantly to the loss of birds.
However, some birds have increased due to changes in human activities. Studies found
that raptors (predators) such as bald eagles have rebounded after the pesticide DDT was
banned. Waterfowl such as ducks and geese have also increased due to conservation programs.

Living Environment – June ’25 [20]

 58 Explain why the decline in some North American bird populations is having a negative effect on
ecosystems. [1]

59 Identify the habitat that has had the greatest decline in birds since 1970, and describe a cause of the loss of
birds in that habitat. [1]

The bobolink is a small blackbird whose population has undergone a decline of 75% in
some regions. These birds nest in fields of tall grass during the summer across the northern
United States and migrate long distances to winter in southern South America.

60 Describe an action people might take that could reduce the decline in the bobolink population. [1]

Base your answers to questions 61 and 62 on the information below, on the next page, and on your
knowledge of biology.
New research comparing the anatomy and behavior of dogs and wolves found that dogs
have small facial muscles around their eyes which allow them to raise their inner eyebrow.
This makes their eyes appear larger and more infant-like. Wolves do not have these muscles.

Raised eyebrow
muscle

Raised
eyebrow
muscle

Facial musculature in the dog (left) and

wolf (right) with anatomical differences.

Living Environment – June ’25 [21] [OVER]

 Scientists hypothesize that dogs expressing this “puppy-dog eye” trait unconsciously
stimulate a desire in humans to take care of them.
Examine the evolutionary tree below of modern dogs and their relatives.
Canine Evolution

Modern dog

Gray wolf

Coyote

African golden wolf

Golden jackal

Ethiopian wolf

Asian wolf

African wild dog

Side-striped jackal

Black-backed jackal

61 According to the evolutionary tree, identify which species, the African golden wolf or the modern dog, is
most closely related to the gray wolf. Support your answer with evidence from the evolutionary tree. [1]

62 Explain how genes for a trait such as puppy-dog eyes in domesticated dogs could have increased in frequency
over time. [1]

Living Environment – June ’25 [22]

 Base your answers to questions 63 through 66 on the information and graphs below and on your knowledge
of biology.
Breaking Down Plastics
Researchers collected soil contaminated with specific plastics outside a plastic bottle
recycling facility. They discovered a type of bacterium in the soil that was able to depolymerize
(break down) and use these plastics as a source of nutrition. A bacterial enzyme that could
digest large molecules of plastic into their building blocks was isolated. Those building blocks
can be used to produce new plastic products. Scientists have been working to improve the
efficiency of this enzyme by altering the specific molecules the bacteria need to code for the
synthesis of the enzyme. Using this method, many variations of the enzyme were produced
by the altered bacteria, and these variants were tested.
The graphs below show a comparison of the activity of the original enzyme and two
variants produced by the scientists.

Activity of Plastic-Digesting Enzymes

Original Enzyme Two Variations of Enzymes
40 100

Depolymerization (%)
Depolymerization (%)

35 90
80
30
70
25 60
20 50 Key
15 40 Variant 1
30 enzyme
10
20 Variant 2
5 10 enzyme
0 0
0 1 2 3 4 5 6 0 3 6 9 12 15 18 21 24
Time (Days) Time (hours)

63 Using evidence from the graphs, support the claim that the scientists were successful in developing a more
efficient enzyme. [1]

64 Describe a technique the scientists most likely would use to alter the specific molecules in the bacteria
referred to in the reading. [1]

65 Explain how using these modified enzymes can benefit the environment. [1]

Living Environment – June ’25 [23] [OVER]

 66 Explain why these enzymes will break down specific plastics but not react with other substances. [1]

Base your answers to questions 67 through 69 on the partial Arizona desert food web represented below and
on your knowledge of biology.

Arizona Desert Food Web

Red-tailed
hawk
Western
diamondback Elf
rattlesnake owl

Grasshopper
Gila mouse Mantid
Collared
woodpecker lizard

Red
harvester
Antelope Pallid-winged ants
squirrel grasshopper
Wood
rat

Saguaro Prickly Brittlebrush

cactus pear cactus

Desert food webs are complex and often contain more food chains than a grassland or
forest food web. This is important to the stability of the desert ecosystem.

Relationships between organisms can be described as positive, negative, or neutral.

Positive relationship: Both species benefit.

Negative relationship: Either species would benefit if the other species were no longer present.
Neutral relationship: The species have no effect on each other.

Living Environment – June ’25 [24]

 67 Identify the type of relationship between the collared lizard and the grasshopper mouse as positive, negative,
or neutral. Support your answer with information from the food web. [1]

68 People often want to remove top-level predators from an ecosystem. There are a number of reasons for this,
depending on the area and the predator. Explain how removing the red-tailed hawk would affect the prickly
pear cactus population in this food web. Support your answer with information from the food web. [1]

One group of students drew energy pyramid A to model where the energy is located in the Arizona desert
food web. Another group of students drew energy pyramid B for their model.

Model Arizona Desert Energy Pyramids

Producers
A B

69 If energy pyramid B actually represents what is happening in that area of the desert, explain what would
eventually happen and why. [1]

In 1980 the red wolf was declared extinct in the wild. Only one small captive population
survives in North Carolina. Recently a group of canines resembling coyotes but with red fur
were discovered on an island near Texas. They are clearly a kind of coyote, but could possibly
contain some red wolf genetic material.

70 Scientists suggest that breeding the red-coated coyotes that might contain genetic material could help
increase diversity within the existing red wolf population in North Carolina.

Explain why increasing the diversity in the red wolf population could be beneficial to the species. [1]

Living Environment – June ’25 [25] [OVER]

 Base your answers to questions 71 and 72 on the information below and on your knowledge of biology.
A cat owner was devastated by the death of his beloved cat, Garlic. He contacted a
cloning company that was able to produce Garlic 2.0 using DNA from preserved cells of
the original cat. However, the client was disappointed to see that while Garlic 2.0 was very
similar to his original pet, there were slight differences in the cloned cat’s appearance.

Original Garlic Garlic 2.0

71 Other than age or an error in the cloning process, describe one factor that could have led to the differences
observed in Garlic 2.0, as compared to the original cat. [1]

The embryo that became Garlic 2.0 was implanted into another cat, a surrogate mother shown in the photo
below.

Garlic 2.0 (right) and surrogate mother

72 Explain why scientists claimed that the surrogate mother did not determine the genetic makeup of the
Garlic 2.0 embryo. [1]

Living Environment – June ’25 [26]

 Part D
Answer all questions in this part. [13]
Directions (73–85): For those questions that are multiple choice, record on the separate answer sheet the
number of the choice that, of those given, best completes each statement or answers each question. For all
other questions in this part, follow the directions given and record your answers in the spaces provided in this
examination booklet.

Base your answers to questions 73 and 74 on the information below and on your knowledge of biology.

Lemurs of Madagascar
Lemurs are primates found only on the island of Madagascar, which is located about 250
miles off the coast of Africa. The ancestral species of lemurs arrived 40-50 million years ago
(mya), long after Madagascar became an island. This concept is illustrated in the diagram
below.

Africa

Madagascar

Lorises Bushbabies Lemurs

$55 mya $54 mya

$62 mya

Note: The answer to question 73 should be recorded on your separate answer sheet.
73 Since the arrival of the single ancestral species on Madagascar, there are now over 100 species of lemurs.
Which statement is a likely explanation for the current diversity of lemurs?
(1) Genetic variation was limited because they were living on an island.
(2) There were no natural predators and many available niches.
(3) Competition between lemurs stopped natural selection.
(4) Habitats were destroyed after the arrival of humans.

Note: The answer to question 74 should be recorded on your separate answer sheet.
74 Which is an example of physical evidence that could be used to support a possible evolutionary relationship
among lemur species?
(1) similar amino acids (3) similar food choices
(2) similar social behaviors (4) similar skeletal structures

Living Environment – June ’25 [27] [OVER]

 Note: The answer to question 75 should be recorded on your separate answer sheet.
75 Drastic environmental changes are occurring on an island. Which graph below best represents the variation
in finch beak sizes that would most likely provide the greatest chance for survival?

Number of Finches
Number of Finches

400 400

300 300

200 200

100 100

0 0
6 7 8 9 10 11 12 13 14 6 7 8 9 10 11 12 13 14
Beak Depth (mm) Beak Depth (mm)
(1) Number of Finches (3)
Number of Finches

400 400

300 300

200 200

100 100

0 0
6 7 8 9 10 11 12 13 14 6 7 8 9 10 11 12 13 14
Beak Depth (mm) Beak Depth (mm)
(2) (4)

The chart below compares some of the characteristics of four different plant species.

Comparison of Four Plant Species

Plant Flower Enzyme X Leaf Number of
Species Color Present Shape/Color Flower Petals
A blue yes oval/dark green 7
B blue no oval/yellow green 5
C red yes oval/dark green 7
D red no oval/dark green 5

Note: The answer to question 76 should be recorded on your separate answer sheet.
76 According to the information provided in the chart, which two plant species appear to be the most closely
related?
(1) A and B (3) C and A
(2) B and D (4) D and C

Living Environment – June ’25 [28]

 Base your answers to questions 77 and 78 on the information below and on your knowledge of biology.

A gene segment from a species of plant has the following sequence:

ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC

77 This segment was cut with a restriction enzyme that recognizes CCGG and cuts between the C and G.
The fragments were then analyzed using gel electrophoresis.

How many bands would you expect to appear on the gel? [1]

78 Once the gel is running, explain why the segments would move different distances in the gel. [1]

Students in a class performed an experiment. They recorded their resting pulse rates.
Then, they ran in place and immediately recorded their pulse rates again. The data obtained
are shown in the two histograms below.

Class Data Class Data

Resting Pulse Rates Pulse Rates After Activity
Number of Students

Number of Students

12 12
10 10
8 8
6 6
4 4
2 2
0 0
< 50 51–60 61–70 71–80 81–90 > 90 < 50 51–60 61–70 71–80 81–90 > 90

Average Pulse Rate Range (per min) Average Pulse Rate Range (per min)

79 State one hypothesis about the effects of exercise on pulse rate. [1]

Living Environment – June ’25 [29] [OVER]

 A student in a biology class squeezed a clothespin as many times as possible in a 60-second
period. After resting for 20 seconds, they then repeated the experiment, for a total of five
trial periods of “squeezing/resting.” The student recorded their experimental data in the
table below.

Clothespin Data
Number of Clothespin
Trial
Squeezes in 60 Seconds
1 82
2 75
3 58
4 50
5 45

The student reported feeling some burning in their finger muscles after squeezing the
clothespin. The teacher explained that the burning sensation may have been due to a buildup
of waste products in the finger muscles.

80 Predict the number of clothespin squeezes expected if the student had performed a sixth trial. Support your
answer. [1]

Note: The answer to question 81 should be recorded on your separate answer sheet.
81 A recent newspaper headline read, “Expert Warns About Effect of Rock Salt on Plants”. The de-icing
chemical, rock salt, has been used on highways for years. The concern expressed by the expert is most likely
that
(1) the salt will enter the plants and make them too salty and unusable as food
(2) the presence of salt in the environment will cause the plants to lose water
(3) de-icing chemicals always present a safety risk to humans
(4) plants respond more rapidly to salt in colder temperatures

Note: The answer to question 82 should be recorded on your separate answer sheet.
82 Some runners prepare for a race by completing a variety of warmups. These exercises are beneficial because
they
(1) can prevent the production of carbon dioxide in muscle cells
(2) speed up the breakdown of protein that is released during respiration
(3) reduce the need for water in muscle cell metabolism
(4) can increase the flow of blood within the body

Living Environment – June ’25 [30]

 A group of students took their pulse rates. The results are shown in the graph below.

Students’ Pulse Rates

5

Number of Students
4

< 50 51–60 61–70 71–80 81–90 > 90

Pulse (beats/minute)

A student wrote the hypothesis, “Students who smoke tend to have a higher pulse rate
than students who do not smoke.”

83 What additional information is needed to test the student’s hypothesis? [1]

Base your answers to questions 84 and 85 on the diagram below and on your knowledge of biology. The
diagram illustrates different finch species living in a certain area.

Warbler finch: probing Woodpecker finch: probing Mangrove finch: Vegetarian finch:
bill, insect eater, feeds bill,insect eater, uses twig or grasping bill, insect crushing bill,
in trees cactus spine to remove eater, feeds in trees cactus-seed eater
insects from cactus

84 If the common ancestor of the four finches originally lived on an island with few trees, little rain, and very
few insects, identify which finch it might most likely resemble and support your answer. [1]

85 Identify the finch in the diagram most likely to compete with the mangrove finch. Support your answer. [1]

Living Environment – June ’25 [31]

LIVING ENVIRONMENT

Printed on Recycled Paper

LIVING ENVIRONMENT