Bioconductor Workflow for Microbiome Analysis
Bioconductor Workflow for Microbiome Analysis
RESEARCH ARTICLE
1 2 3
Abstract
High-throughput sequencing of PCR-amplified taxonomic markers version 2
(like the 16S rRNA gene) has enabled a new level of analysis of (revision) view
complex bacterial communities known as microbiomes. Many tools 02 Nov 2016
exist to quantify and compare abundance levels or OTU composition
of communities in different conditions. The sequencing reads have to
version 1
be denoised and assigned to the closest taxa from a reference
24 Jun 2016 view view view
database. Common approaches use a notion of 97% similarity and
normalize the data by subsampling to equalize library sizes. In this
paper, we show that statistical models allow more accurate 1. Leo Lahti , University of Helsinki, Turku,
abundance estimates. By providing a complete workflow in R, we Finland
enable the user to do sophisticated downstream statistical analyses,
whether parametric or nonparametric. We provide examples of using 2. Zachary Charlop-Powers , Rockefeller,
the R packages dada2, phyloseq, DESeq2, ggplot2 and vegan to filter, New York, USA
visualize and test microbiome data. We also provide examples of
supervised analyses using random forests and nonparametric testing 3. Nandita R. Garud, UCSF, San Francisco, USA
using community networks and the ggnetwork package.
Any reports and responses or comments on the
Keywords
article can be found at the end of the article.
microbiome , taxonomy , community analysis
Page 1 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Page 2 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
We have updated the procedure for storing the filtered and trimmed files during the call to dada2, this avoids overwriting the
files if the workflow is run several times.
We have replaced the msa alignment function with AlignSeqs function from from the DECIPHER1 package, making the
workflow more computationally efficient.
We have expanded the phyloseq section and reduced the number of network plots. We have also provided detailed
discussion of our choice not to make the PCoA and PCA plots square.
We have added more detailed instructions in the Github repository as to how one can run only parts of the workflow and how
to generate the full paper from scratch using the [Link] file.
As suggested by reviewers, we have added more extended captions to figures. We have however refrained from providing a
complete evaluation of DADA2 vs. OTUs or pooled/unpooled data to this manuscript. Performing such evaluations well is a
significant undertaking and would take significant space to explain, and our primary purpose here is to demonstrate the many
features of an R/Bioconductor amplicon analysis workflow.
We thank the three reviewers and a commentator who have provided useful feedback and we hope the revision has
enhanced the readability and explained the code more completely.
See referee reports
Introduction
The microbiome is formed of the ecological communities of microorganisms that dominate the living world. Bacteria
can now be identified through the use of next generation sequencing applied at several levels. Shotgun sequencing of
all bacteria in a sample delivers knowledge of all the genes present. Here we will only be interested in the identification
and quantification of individual taxa (or species) through a ‘fingerprint gene’ called 16s rRNA which is present in all
bacteria. This gene presents several variable regions which can be used to identify the different taxa.
Previous standard workflows depended on clustering all 16s rRNA sequences (generated by next generation amplicon
sequencing) that occur within a 97% radius of similarity and then assigning these to ‘OTUs’ from reference trees2,3.
These approaches do not incorporate all the data, in particular sequence quality information and statistical information
available on the reads were not incorporated into the assignments.
In contrast, the de novo read counts used here will be constructed through the incorporation of both the quality scores
and sequence frequencies in a probabilistic noise model for nucleotide transitions. For more details on the algorithmic
implementation of this step see 4.
After filtering the sequences and removing the chimeræ, the data are compared to a standard database of bacteria and
labeled. In this workflow, we have used the labeled sequences to build a de novo phylogenetic with the phangorn.
The key step in the sequence analysis is the manner in which reads are denoised and assembled into groups we have
chosen to call RSVs (Ribosomal Sequence Variants) instead of the traditional OTUs (Operational Taxonomic Units).
This article describes a computational workflow for performing denoising, filtering, data transformations, visualiza-
tion, supervised learning analyses, community network tests, hierarchical testing and linear models. We provide all the
code and give several examples of different types of analyses and use-cases. There are often many different objectives
in experiments involving microbiome data and we will only give a flavor for what could be possible once the data has
been imported into R.
In addition, the code can be easily adapted to accommodate batch effects, covariates and multiple experimental
factors.
The workflow is based on software packages from the open-source Bioconductor project5. We provide all steps
necessary from the denoising and identification of the reads input as raw sequences in fastq files to the comparative
testing and multivariate analyses of the samples and analyses of the abundances according to multiple available
covariates.
Page 3 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Methods
Amplicon bioinformatics: from raw reads to tables
This section demonstrates the “full stack” of amplicon bioinformatics: construction of the sample-by-sequence feature
table from the raw reads, assignment of taxonomy, and creation of a phylogenetic tree relating the sample sequences.
library("knitr")
library("BiocStyle")
opts_chunk$set(cache = FALSE,[Link]="dadafigure/")
read_chunk([Link]("src", "bioinformatics.R"))
[Link](100)
The data we will analyze here are highly-overlapping Illumina Miseq 2×250 amplicon sequences from the V4 region
of the 16S gene6. These 360 fecal samples were collected from 12 mice longitudinally over the first year of life,
to investigate the development and stabilization of the murine microbiome7. These data are downloaded from the
following location: [Link]
if(!file_test("-d", miseq_path)) {
[Link](miseq_path)
[Link]("[Link]
destfile = [Link](miseq_path, "[Link]"))
system(paste0("tar -xvf", [Link](miseq_path, "[Link]"),
"-C", miseq_path, "/"))
}
ii <- sample(length(fnFs), 3)
for(i in ii) { print(plotQualityProfile(fnFs[i]) + ggtitle("Fwd")) }
for(i in ii) { print(plotQualityProfile(fnRs[i]) + ggtitle("Rev")) }
Page 4 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Most Illumina sequencing data shows a trend of decreasing average quality towards the end of sequencing reads.
Here, the forward reads maintain high quality throughout, while the quality of the reverse reads drops significantly at
about position 160. Therefore, we choose to truncate the forward reads at position 245, and the reverse reads at position
160. We also choose to trim the first 10 nucleotides of each read based on empirical observations across many Illumina
datasets that these base positions are particularly likely to contain pathological errors.
We combine these trimming parameters with standard filtering parameters, the most important being the enforcement
of a maximum of 2 expected errors per-read8. Trimming and filtering is performed on paired reads jointly, i.e. both
reads must pass the filter for the pair to pass.
The DADA2 method relies on a parameterized model of substitution errors to distinguish sequencing errors from
real biological variation. Because error rates can (and often do) vary substantially between sequencing runs and PCR
protocols, the model parameters can be discovered from the data itself using a form of unsupervised learning in which
sample inference is alternated with parameter estimation until both are jointly consistent.
Parameter learning is computationally intensive, as it requires multiple iterations of the sequence inference algorithm,
and therefore it is often useful to estimate the error rates from a (sufficiently large) subset of the data.
Page 5 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
In order to verify that the error rates have been reasonably well-estimated, we inspect the fit between the observed error
rates (black points) and the fitted error rates (black lines) in Figure 2.
plotErrors(ddF)
plotErrors(ddR)
The DADA2 sequence inference method can run in two different modes: Independent inference by sample
(pool=FALSE), and inference from the pooled sequencing reads from all samples (pool=TRUE). Independent
inference has the advantage that computation time is linear in the number of samples, and memory requirements
are flat with the number of samples. This allows scaling out to datasets of almost unlimited size. Pooled inference is
more computationally taxing, and can become intractable for datasets of tens of millions of reads. However, pooling
improves the detection of rare variants that were seen just once or twice in an individual sample but many times across
all samples. As this dataset is not particularly large, we perform pooled inference. As of version 1.2, multithreading can
be activated with the arguments multithread = TRUE, which can substantially speed this step.
30 30 30
Quality Score
Quality Score
Quality Score
20 20 20
10 10 10
0 0 0
0 50 100 150 200 250 0 50 100 150 200 250 0 50 100 150 200 250
Cycle Cycle Cycle
40 40 40
30 30 30
Quality Score
Quality Score
Quality Score
20 20 20
10 10 10
0 0 0
0 50 100 150 200 250 0 50 100 150 200 250 0 50 100 150 200 250
Cycle Cycle Cycle
Figure 1. Forward and Reverse Error Profiles, the mean is in green, the median the solid orange line and the
quartiles are the dotted orange lines.
Page 6 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
�� �
�
−1 −1 � �
��
�
��
��� �
� �� � � � �
�� �
� ��� �� � � � �
� �� ��
−2 � � −2 �� �
��
�
�� ��� �
��� ��
�
��� � � �� ��� � ��
� �
��� � � �� � �� � �
�� � �
� �� �� � �� � � �� �� � �� � � ��
�� �� � � �
−3 �
� � � � ���
�
� �
� �� �� �� −3 � �� ��
�
� � � ��
� �
� � � � � � � �
� � � �
� � �
−4 �
� � � � −4 �
−1 −1 �� ������ �
�
���� �� �� ��� � �
�
�� �� � �� ���� �� ���
� �
��� ��� �� �� � � � �� �
−2 �� ��� �
�� �
� −2 �� �� � �� ��
� � ��
Error frequency (log10)
−1 −1 � �
�� � �
� ����� � ��� ���
���� �
�� � � � �
�� � � ���� �� �� �
−2 �
�� �
� ��
�� � −2 �� � �� �
� �
�� �� � � � � �
�� � �� � �� ��� �� � � �
� � � �
� �� � � �� ����� ��� � �
�� �
−3
�
−3
� � � �� � � � �� � �� � �
� ��� � �� � � � �� �
� � � �� � � � � �� �
� �� � ��
� � �� � � ��
−4 �
� −4 �
Figure 2. Forward and Reverse Read Error Profiles, showing the frequencies of each type of nucleotide transition
as a function of quality.
The DADA2 sequence inference step removed (nearly) all substitution and indel errors from the data4. We now merge
together the inferred forward and reverse sequences, removing paired sequences that do not perfectly overlap as a final
control against residual errors.
Notably, chimeras have not yet been removed. The error model in the sequence inference algorithm does not include a
chimera component, and therefore we expect this sequence table to include many chimeric sequences. We now remove
chimeric sequences by comparing each inferred sequence to the others in the table, and removing those that can be
reproduced by stitching together two more abundant sequences.
Although exact numbers vary substantially by experimental condition, it is typical that chimeras comprise a substantial
fraction of inferred sequence variants, but only a small fraction of all reads. That is what is observed here: 1503 of 1892
sequence variants were chimeric, but these only represented 10% of all reads.
Page 7 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Assign taxonomy
One of the benefits of using well-classified marker loci like the 16S rRNA gene is the ability to taxonomically classify
the sequence variants. The dada2 package implements the naive Bayesian classifier method for this purpose9. This
classifier compares sequence variants to a training set of classified sequences, and here we use the RDP v14 training
set10.
GreenGenes and Silva training set fasta files formatted for the assignTaxonomy function are also available for
download at [Link]
The phangorn R package is then used to construct a phylogenetic tree. Here we first construct a neighbor-joining tree,
and then fit a GTR+G+I (Generalized time-reversible with Gamma rate variation) maximum likelihood tree using the
neighbor-joining tree as a starting point.
Page 8 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
## [1] TRUE
The full suite of data for this study – the sample-by-sequence feature table, the sample metadata, the sequence taxono-
mies, and the phylogenetic tree – can now be combined into a single object.
phyloseq
phyloseq12 is an R package to import, store, analyze, and graphically display complex phylogenetic sequencing data
that has already been clustered into Operational Taxonomic Units (OTUs) or more appropriately denoised, and it is
most useful when there is also associated sample data, phylogeny, and/or taxonomic assignment of each taxa. phyloseq
leverages and builds upon many of the tools available in R for ecology and phylogenetic analysis (vegan13, ade414,
ape15), while also using advanced/flexible graphic systems (ggplot216) to easily produce publication-quality graphics of
complex phylogenetic data. The phyloseq package uses a specialized system of S4 data classes to store all related
phylogenetic sequencing data as a single, self-consistent, self-describing experiment-level object, making it easier to
share data and reproduce analyses. In general, phyloseq seeks to facilitate the use of R for efficient interactive and
reproducible analysis of amplicon count data jointly with important sample covariates.
Further documentation
This tutorial shows a useful example workflow, but many more analyses are available to you in phyloseq, and R in
general, than can fit in a single workflow. The phyloseq home page is a good place to begin browsing additional
phyloseq documentation, as are the three vignettes included within the package, and linked directly at the phyloseq
release page on Bioconductor.
Loading Data
Many use cases result in the need to import and combine different data into a phyloseq class object, this can be
done using the import_biom function to read recent QIIME format files, older files can still be imported with
import_qiime. More complete details can be found on the phyloseq FAQ page.
In the previous section the results of dada2 sequence processing were organized into a phyloseq object. This object
was also saved in R-native serialized RDS format. We will re-load this here for completeness as the initial object p0.
library("phylos12eq")
library("gridExtra")
ps = readRDS("data/[Link]")
ps
Page 9 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Shiny-phyloseq
It can be beneficial to start the data exploration process interactively, this often saves time in detecting outliers and
specific features of the data. Shiny-phyloseq17 is an interactive web application that provides a graphical user inter-
face to the phyloseq package. The object just loaded into the R session in this workflow is suitable for this graphical
interaction with Shiny-phyloseq.
Filtering
phyloseq provides useful tools for filtering, subsetting, and agglomerating taxa – a task that is often appropriate or even
necessary for effective analysis of microbiome count data. In this subsection, we graphically explore the prevalence
of taxa in the example dataset, and demonstrate how this can be used as a filtering criteria. One of the reasons to filter
in this way is to avoid spending much time analyzing taxa that were seen only rarely among samples. This also turns
out to be a useful filter of noise (taxa that are actually just artifacts of the data collection process), a step that should
probably be considered essential for datasets constructed via heuristic OTU-clustering methods, which are notoriously
prone to generating spurious taxa.
Taxonomic Filtering
In many biological settings, the set of all organisms from all samples are well-represented in the available taxonomic
reference database. When (and only when) this is the case, it is reasonable or even advisable to filter taxonomic
features for which a high-rank taxonomy could not be assigned. Such ambiguous features in this setting are almost
always sequence artifacts that don’t exist in nature. It should be obvious that such a filter is not appropriate for samples
from poorly characterized or novel specimens, at least until the possibility of taxonomic novelty can be satisfactorily
rejected. Phylum is a useful taxonomic rank to consider using for this purpose, but others may work effectively for
your data.
To begin, create a table of read counts for each Phylum present in the dataset.
##
## Actinobacteria Bacteroidetes
## 13 23
## Candidatus_Saccharibacteria Cyanobacteria/Chloroplast
## 1 4
## Deinococcus-Thermus Firmicutes
## 1 327
## Fusobacteria Proteobacteria
## 1 11
## Tenericutes Verrucomicrobia
## 1 1
## <NA>
## 6
This shows a few phyla for which only one feature was observed. Those may be worth filtering, and we’ll check that
next. First, notice that in this case, six features were annotated with a Phylum of NA. These features are probably
artifacts in a dataset like this, and should be removed.
The following ensures that features with ambiguous phylum annotation are also removed. Note the flexibility in
defining strings that should be considered ambiguous annotation.
Page 10 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
A useful next step is to explore feature prevalence in the dataset, which we will define here as the number of samples
in which a taxa appears at least once.
Are there phyla that are comprised of mostly low-prevalence features? Compute the total and average prevalences of
the features in each phylum.
## Phylum 1 2
## 1 Actinobacteria 120.2 1562
## 2 Bacteroidetes 265.5 6107
## 3 Candidatus_Saccharibacteria 280.0 280
## 4 Cyanobacteria/Chloroplast 64.2 257
## 5 Deinococcus-Thermus 52.0 52
## 6 Firmicutes 179.2 58614
## 7 Fusobacteria 2.0 2
## 8 Proteobacteria 59.1 650
## 9 Tenericutes 234.0 234
## 10 Verrucomicrobia 104.0 104
Deinococcus-Thermus appeared in just over one percent of samples, and Fusobacteria appeared in just 2 samples
total. In some cases it might be worthwhile to explore these two phyla in more detail despite this (though probably not
Fusobacteria’s two samples). For the purposes of this example, though, they will be filtered from the dataset.
Prevalence Filtering
The previous filtering steps are considered supervised, because they relied on prior information that is external to this
experiment (a taxonomic reference database). This next filtering step is completely unsupervised, relying only on the
data in this experiment, and a parameter that we will choose after exploring the data. Thus, this filtering step can be
applied even in settings where taxonomic annotation is unavailable or unreliable.
First, explore the relationship of prevalence and total read count for each feature. Sometimes this reveals outliers that
should probably be removed, and also provides insight into the ranges of either feature that might be useful. This
aspect depends quite a lot on the experimental design and goals of the downstream inference, so keep these in mind. It
Page 11 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
may even be the case that different types of downstream inference require different choices here. There is no reason to
expect ahead of time that a single filtering workflow is appropriate for all analysis.
Sometimes a natural separation in the dataset reveals itself, or at least, a conservative choice that is in a stable region
for which small changes to the choice would have minor or no effect on the biological interpreation (stability). Here no
natural separation is immediately evident, but it looks like we might reasonably define a prevalence threshold in a range
of zero to 10 percent or so. Take care that this choice does not introduce bias into a downstream analysis of association
of differential abundance.
The following uses five percent of all samples as the prevalence threshold.
## [1] 18
0.75
0.50
0.25
0.00
Prevalence [Frac. Samples]
0.75
0.50
0.25
0.00
Tenericutes Verrucomicrobia
1.00
0.75
0.50
0.25
0.00
1e+01 1e+03 1e+05 1e+01 1e+03 1e+05
Total Abundance
Figure 3. Taxa prevalence versus total counts. Each point is a different taxa. Exploration of the data in this way is often
useful for selecting filtering parameters, like the minimum prevalence criteria we will used to filter the data above.
Page 12 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Agglomerate taxa
When there is known to be a lot of species or sub-species functional redundancy in a microbial community, it might
be useful to agglomerate the data features corresponding to closely related taxa. Ideally we would know the functional
redundancies perfectly ahead of time, in which case we would agglomerate taxa using those defined relationships
and the merge_taxa() function in phyloseq. That kind of exquisite functional data is usually not available, and
different pairs of microbes will have different sets of overlapping functions, complicating the matter of defining
appropriate grouping criteria.
While not necessarily the most useful or functionally-accurate criteria for grouping microbial features (sometimes
far from accurate), taxonomic agglomeration has the advantage of being much easier to define ahead of time. This is
because taxonomies are usually defined with a comparatively simple tree-like graph structure that has a fixed number
of internal nodes, called “ranks”. This structure is simple enough for the phyloseq package to represent taxonomies
as table of taxonomy labels. Taxonomic agglomeration groups all the “leaves” in the hierarchy that descend from the
user-prescribed agglomerating rank, this is sometimes called ‘glomming’.
The following example code shows how one would combine all features that descend from the same genus.
## [1] 49
If taxonomy is not available or not reliable, tree-based agglomeration is a “taxonomy-free” alternative to combine data
features corresponding to closely-related taxa. In this case, rather than taxonomic rank, the user specifies a tree height
corresponding to the phylogenetic distance between features that should define their grouping. This is very similar to
“OTU Clustering”, except that in many OTU Clustering algorithms the sequence distance being used does not have the
same (or any) evolutionary definition.
h1 = 0.4
ps4 = tip_glom(ps2, h = h1)
Here phyloseq’s plot_tree() function compare the original unfiltered data, the tree after taxonoic agglomeration,
and the tree after phylogenetic agglomeration. These are stored as separate plot objects, then rendered together in one
combined graphic using gridExtra::[Link].
multiPlotTitleTextSize = 8
p2tree = plot_tree(ps2, method = "treeonly",
ladderize = "left",
title = "Before Agglomeration") +
theme([Link] = element_text(size = multiPlotTitleTextSize))
p3tree = plot_tree(ps3, method = "treeonly",
ladderize = "left", title = "By Genus") +
theme([Link] = element_text(size = multiPlotTitleTextSize))
p4tree = plot_tree(ps4, method = "treeonly",
ladderize = "left", title = "By Height") +
theme([Link] = element_text(size = multiPlotTitleTextSize))
Page 13 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Figure 4. The original tree (left), taxonomic agglomeration at Genus rank (middle), phylogenetic agglomeration at
a fixed distance of 0.4 (right).
This example begins by defining a custom plot function, plot_abundance(), that uses phyloseq’s psmelt()
function to define a relative abundance graphic. We will use this to compare differences in scale and distribution of the
abundance values in our phyloseq object before and after transformation.
Page 14 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
The transformation in this case converts the counts from each sample into their frequencies, often referred to as propor-
tions or relative abundances. This function is so simple that it is easiest to define it within the function call to trans-
form_sample_counts().
plotBefore = plot_abundance(ps3,"")
plotAfter = plot_abundance(ps3ra,"")
# Combine each plot into one graphic.
[Link](nrow = 2, plotBefore, plotAfter)
Subset by taxonomy
Notice on the previous plot that Lactobacillales appears to be a taxonomic Order with bimodal abundance profile in the
data. We can check for a taxonomic explanation of this pattern by plotting just that taxonomic subset of the data. For
this, we subset with the subset_taxa() function, and then specify a more precise taxonomic rank to the Facet
argument of the plot_abundance function that we defined above.
At this stage in the workflow, after converting raw reads to interpretable species abundances, and after filtering and
transforming these abundances to focus attention on scientifically meaningful quantities, we are in a position to con-
sider more careful statistical analysis. R is an ideal environment for performing these analyses, as it has an active
community of package developers building simple interfaces to sophisticated techniques. As a variety of methods are
available, there is no need to commit to any rigid analysis strategy a priori. Further, the ability to easily call packages
without reimplementing methods frees researchers to iterate rapidly through alternative analysis ideas. The advantage
of performing this full workflow in R is that this transition from bioinformatics to statistics is effortless.
We back these claims by illustrating several analyses on the mouse data prepared above. We experiment with several
flavors of exploratory ordination before shifting to more formal testing and modeling, explaining the settings in which
the different points of view are most appropriate. Finally, we provide example analyses of multitable data, using a study
in which both metabolomic and microbial abundance measurements were collected on the same samples, to demon-
strate that the general workflow presented here can be adapted to the multitable setting.
Bacillales Clostridiales
1000
10
Abundance
Erysipelotrichales Lactobacillales
1000
10
F M F M
sex
Bacillales Clostridiales
0.100
0.001
Abundance
Erysipelotrichales Lactobacillales
0.100
0.001
F M F M
sex
Figure 5. Comparison of original abundances (top panel) and relative abundances (lower).
Page 15 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Preprocessing
Before doing the multivariate projections, we will add a few columns to our sample data, which can then be used to
annotate plots. From Figure 7, we see that the ages of the mice come in a couple of groups, and so we make a categori-
cal variable corresponding to young, middle-aged, and old mice. We also record the total number of counts seen in each
sample and log-transform the data as an approximate variance stabilizing transformation.
For a first pass, we look at principal coordinates analysis (PCoA) with either the Bray-Curtis dissimilarity on the
weighted Unifrac distance. We see immediately that there are six outliers. These turn out to be the samples from
females 5 and 6 on day 165 and the samples from males 3, 4, 5, and 6 on day 175. We will take them out, since we are
mainly interested in the relationships between the non-outlier points.
Before we continue, we should check the two female outliers – they have been taken over by the same OTU/RSV,
which has a relative abundance of over 90% in each of them. This is the only time in the entire data set that this RSV
has such a high relative abundance – the rest of the time it is below 20%. In particular, its diversity is by far the lowest
of all the samples.
Page 16 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Figure 6. Violin plot of the relative abundances of Lactobacillales taxonomic Order, grouped by host sex and
genera. Here it is clear that the apparent biomodal distribution of Lactobacillales on the previous plot was the result of a
mixture of two different genera, with the typical Lactobacillus relative abundance much larger than Streptococcus.
120
60
90
40
count
count
60
20
30
0 0
Figure 7. Preliminary plots suggest certain preprocessing steps. The histogram on the left motivates the creation
of a new categorical variable, binning age into one of the three peaks. The histogram on the right suggests that a log
(1 + x) transformation is sufficient for normalizing the abundance data.
The reason for this is that as we are trying to represent the distances between samples as faithfully as possible; we have
to take into account that the second eigenvalue is always smaller than the first, sometimes considerably so, thus we
normalize the axis norm ratios to the relevant eigenvalue ratios.
After documenting the outliers, we are going to compute ordinations with these outliers removed and more carefully
study the output. We see that there is a fairly substantial age effect that is consistent between all the mice, male and
female, and from different litters. We’ll first perform a PCoA using Bray-Curtis dissimilarity.
Page 17 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
� �
�
� �
�� ����
�� � � %LQQHG$JH
Axis>@
��
����
� � �
� ���� � � �
�� ���� �� �� � � �� �
�����������
���
�� � �
��
�� �
�� � �� � �
�
��
�
�
��
�� �
��
�� �
� � �
���
�
� ���
�� � � � � � �
�
����
��
��
�
��
�
�
�
�
� ��
�
�� �
�
�
�
�
�
��
�
���
��
��
���
�
�
��� �
� ���
���
�
��
��
�
�
��
�
��
����
�
�
�
�� �
�� ��
��� � @
� � � ��� ����
� � �� �
���
� �������� � � �� �
�����������
� ���
��� ���
� � �
�
��� ��
� ��� �
� ��
��
��
���� �
�� ����� �� �� � �
� � �� � �� � �� � � �
� � � �
í � � @
�� � @
í
�
í �
250
200
150
count
100
50
� �
��
� �
� � � �
� �
�� � �� �
� �� � �
� �
� � � � �
�
� � � � � �
�
� � � � � �
� � � � � �
� � �
� �
� � � � � � �
� � %LQQHG$JH
Axis>@
� � � � � � � �
� � � � ��� � �� � �
� � � � �� � �� � �
� �� ��
�
� �
�� � �� ��
� � � �� � � @
� �� � �� � � �
� � � � � � �
� � � � � �
� � � � � � � @
� � � � � � �
�� ��
� � � �
� �
� �� � � � �
� � �� � �
� � � �
� � @
� � � � �
� � �
� �� � �� �
� �
� � � � � � �
�� �� � � � �
� � �
� �� �
�
�
� � � � �� � � �
� � � � �� � �
�� �� � �
� � �� � � �� � � �
í � � � � � �� � � � �� ��� � � ��
�� �
� � � �� �
� �� �� � � �
� � � ��
� � � � � � �� � � �
� � � ����
� � � ��� � � � �
� �� �
� � � ���� � � ��
� �
Page 18 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
%LQQHG$JH
� @
� @
$[LV>@
� � �
� �
�
� �� �
�� � ���
� � � �� ��
� � � � �
� � @
� � � � � � � � �
�� � � � � � � ��
� �� � � � ��
� ���� �� ��� �
�� � � ���� � � �
�� �� � �
�
�
� ���
�
� � �� �
�
� �
�
� �
�
�
� � � �
� �
í Litter
� /LWWHU
í
$[LV>@ /LWWHU
Figure 11. A DPCoA plot incorporates phylogenetic information, but is dominated by the first axis.
Phylum
� Actinobacteria
� Bacteroidetes
�
�
�� � ��
�
�����
� � Candidatus_Saccharibacteria
�
�
�
��� ����
� �
�
� �
�
�
���
�
�
��
�
��
�
�
�
��
�
�
� � Cyanobacteria/Chloroplast
&6>@
�
� �
�
��
�
�� ��
�� � 'HLQRFRFFXVí7KHrmus
í
�
��
� Firmicutes
� ���
��
��
� ���
�
í ��
���� �
��
��� ��
��
�
� ��� � Fusobacteria
���
�
�
�
�
�� ��� � �
�� �
�
�
�
�
� �� ��
�
� Proteobacteria
&6>@ � 7enericutes
� Verrucomicrobia
Figure 12. The DPCoA sample positions can be interpreted with respect to the species coordinates in this
display.
%LQQHG$JH
� � @
�
� � �
� � � � �
�
@
Axis>@
� � � �
� �
��
� � �
� � � �
� � �� �
� � �
� � � �
�� � � �
� � @
� � � � � �
�� � � �
� � � � � � �
� � �� �
�� � �� � �
�
� � ��� � �
� � � � � � � ��
� � � � � � �
í � � � �
� � � � � �
� � Litter
� � � �
� /LWWHU
í
/LWWHU
í í í
Axis>@
Figure 13. The sample positions produced by a PCoA using weighted Unifrac.
Phylum
� Actinobacteria
�� � Bacteroidetes
� Candidatus_Saccharibacteria
� � �
� �
Axis>@
� � � Cyanobacteria/Chloroplast
�
� � � � �� � �
� � � � �� �
�� � �� � � �� � � 'HLQRFRFFXVí7KHrmus
�
�� �� � �� � � � � � �
�
�� � � ��
� � ��� �
� �� � �
� ���� ��� ��
�� ��
��
��
�
� ����
� ��
�
�
��� �� ��
���
� �
�
� �� �
�
�
� �
��
���
�
��
� ��
�
� ��
�
�
�
�
�
�
��
�
�
�
��
�
�
�
��
��
�
��
�
��
�
������� � � Firmicutes
� � � � �
�� � ���
�
�� ��
� �� �
� �� �
���� �� � �
�� � ����� �
�� � ���
� � ���
���� �
� �
�
�
��
�
�
�
�
���
��
�� �����
��
����
�� � � �
� �� � �� � � ����� �� �� � �� �� � �
�� ��� ��� ��� �
�
�
� � � ��
� � � �� � �� � �� � �� ���� �
� � � � � �� � Fusobacteria
� � � �
� �
� � �� � � �
í � �
� Proteobacteria
�
Axis>@
� Verrucomicrobia
Figure 14. Species coordinates that can be used to interpret the sample positions from PCoA with weighted
Unifrac. Compared to the representation in Figure 12, this display is harder to interpret.
Page 19 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
The first plot shows the ordination of the samples, and we see that the second axis corresponds to an age effect, with
the samples from the younger and older mice separating fairly well. The first axis correlates fairly well with library size
(this is not shown). The first axis explains about twice the variability than the first, this translates into the elongated
form of the ordination plot.
Next we look at double principal coordinates analysis (DPCoA)18–20, which is a phylogenetic ordination method and
that provides a biplot representation of both samples and taxonomic categories. We see again that the second axis
corresponds to young vs. old mice, and the biplot suggests an interpretation of the second axis: samples that have
larger scores on the second axis have more taxa from Bacteroidetes and one subset of Firmicutes.
Finally, we can look at the results of PCoA with weighted Unifrac. As before, we find that the second axis is associated
with an age effect, which is fairly similar to DPCoA. This is not surprising, because both are phylogenetic ordination
methods taking abundance into account. However, when we compare biplots, we see that the DPCoA gave a much
cleaner interpretation of the second axis, compared to weighted Unifrac.
PCA on ranks
Microbial abundance data is often heavy-tailed, and sometimes it can be hard to identify a transformation that brings
the data to normality. In these cases, it can be safer to ignore the raw abundances altogether, and work instead with
ranks. We demonstrate this idea using a rank-transformed version of the data to perform PCA. First, we create a new
matrix, representing the abundances by their ranks, where the microbe with the smallest in a sample gets mapped to
rank 1, second smallest rank 2, etc.
Naively using these ranks could make differences between pairs of low and high abundance microbes comparable.
In the case where many bacteria are absent or present at trace amounts, an artificially large difference in rank could
occur21 for minimally abundant taxa. To avoid this, all those microbes with rank below some threshold are set to be tied
at 1. The ranks for the other microbes are shifted down, so there is no large gap between ranks. This transformation is
illustrated in Figure 15.
Page 20 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
� F3D5
60 �
���
� �
�
�
� �� ��
���
�� ��
�
�
�
�
�
�� �� � � �
�� �� �
� � � � � ��
� ���� ��
�
� �
�� � � �
� �
��
�� � �
� � ��
�
� �
�
�
�
� � F4D147
� �
� � � �� � � �
� �� � � ��
Thresholded rank
� � �� �
� � � �� �� �
� �� �� �
�
� �� ��
� �
F4D17
� � � �� � � �
� � �� � � � � � �
� � �� � �
� � � �
40 ���
�� �
� ���� � �
�
�
�
� �� ��
�
� �
�
�� ���� ��� ��
��
� �
�
�
�� ��
� � �� � ��� ��� ��
� �
�
� � �� ��� �
� �� �
�
� � M1D25
��
��� � ��
��
�� �� ��
���� � �
� ����� �
�� � ����� �
���
� � ���� � �
��
��
� ���� �
M2D150
� �
� �
� � �
���� � �
20 �����
�� � �
���� ����
� �� �
�� � �
�
�
�
��� � �
�� � � �
� �� ��
� � ��
�� �� �� �
M3D150
� �
����� � �
�� ��� � �
��
�� ����� ��
�� ��
� � ��� �� ��
��� ��� �
��� � ������� �
� �
�
����
�
� �� �� ��
�
M4D25
��� � ��
� � �� �
0
��
�
���
��
��
��
���
�
�
��
�
���
� ��
�
��
�
�
��
���
���
�
��
��
��
��
����
���
��
��
��
�
�
��
��
��
�� �
��
��
�
��
���
� ��
�
�
�
��
���
�
�
��
��
�
�
��
��
�
�
��
�
�
�
� �
�
�
��
�
�
�
��
�
�
��
�
�
��
� �
�
� �
�
� �
��
�
��
���
�
�
��
�
��
�
�
� �
��
��
�
��
�
��
�
��
���
���
�
��
�
���
�
�
��
��
�
��
�
��
�
���
�
���
��
��
�
��
��
��
��
�
���
� �
���
�
��
���
�
� �
��
������ �� �� ����� ��
��������
������������������
0 2 4 6 � M6D13
Abundance
Figure 15. The association between abundance and rank, for a few randomly selected samples. The numbers of
the y-axis are those supplied to PCA.
We can now perform PCA and study the resulting biplot, given in Figure 16. To produce annotation for this figure, we
used the following block.
The results are similar to the PCoA analyses computed without applying a truncated-ranking transformation,
reinforcing our confidence in the analysis on the original data.
Figure 16. The biplot resulting from the PCA after the truncated-ranking transformation.
Canonical correspondence
Canonical Correspondence Analysis (CCpnA) is an approach to ordination of a species by sample table that incorpo-
rates supplemental information about the samples. As before, the purpose of creating biplots is to determine which
types of bacterial communities are most prominent in different mouse sample types. It can be easier to interpret these
biplots when the ordering between samples reflects sample characteristics – variations in age or litter status in the
mouse data, for example – and this central to the design of CCpnA.
The function allows to create biplots where the positions of samples are determined by similarity in both species sig-
natures and environmental characteristics; in contrast, principal components analysis or correspondence analysis only
look at species signatures. More formally, it ensures that the resulting CCpnA directions lie in the span of the environ-
mental variables; thorough treatments are available in 22,23.
Like PCoA and DPCoA, this method can be run using ordinate in phyloseq. In order to use supplemental sample
data, it is necessary to provide an extra argument, specifying which of the features to consider – otherwise, phyloseq
defaults to using all sample_data measurements when producing the ordination.
To access the positions for the biplot, we can use the scores function in the vegan. Further, to facilitate figure anno-
tation, we also join the site scores with the environmental data in the sample_data slot. Of the 23 total taxonomic
orders, we only explicitly annotate the four most abundant – this makes the biplot easier to read.
Page 22 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Figure 17 and Figure 18 plot these annotated scores, splitting sites by their age bin and litter membership, respectively.
We have labeled individual microbes that are outliers along the second CCpnA direction.
Evidently, the first CCpnA direction distinguishes between mice in the two main age bins. Circles on the left and right
of the biplot represent microbes that are characteristic of younger and older mice, respectively. The second CCpnA
direction splits off the few mice in the oldest age group; it also partially distinguishes between the two litters. These
samples low in the second CCpnA direction have more of the outlier microbes than the others.
This CCpnA analysis supports our conclusions from the earlier ordinations – the main difference between the
microbiome communities of the different mice lies along the age axis. However, in situations where the influence
of environmental variables is not so strong, CCA can have more power in detecting such associations. In general, it
can be applied whenever it is desirable to incorporate supplemental data, but in a way that (1) is less aggressive than
supervised methods, and (2) can use several environmental variables at once.
Figure 17. The mouse and bacteria scores generated by CCpnA. The sites and species are triangles and circles,
respectively. The separate panels indicate different age groups.
Figure 18. The analogue to Figure 17, faceting by litter membership rather than age bin.
Page 23 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
ggplot() +
geom_point(data = sites, aes(x = CCA1, y = CCA2), shape = 2, alpha = 0.5) +
geom_point(data = species, aes(x = CCA1, y = CCA2, col = Order), size = 0.5) +
geom_text_repel(data = species %>% filter(CCA2 < -2),
aes(x = CCA1, y = CCA2, label = otu_id),
size = 1.5, [Link] = 0.1) +
facet_grid(. ~ family_relationship) +
guides(col = guide_legend([Link] = list(size = 3))) +
labs(x = sprintf("Axis1 [%s%% variance]", round(evals_prop[1], 2)),
y = sprintf("Axis2 [%s%% variance]", round(evals_prop[2], 2))) +
scale_color_brewer(palette = "Set2") +
coord_fixed(sqrt(ps_ccpna$CCA$eig[2] / ps_ccpna$CCA$eig[1])*0.45 ) +
theme([Link] = element_rect(color = "#787878", fill = alpha("white", 0)))
Supervised learning
Here we illustrate some supervised learning methods that can be easily run in R. The caret package wraps many
prediction algorithms available in R and performs parameter tuning automatically. Since we saw that microbiome
signatures change with age, we’ll apply supervised techniques to try to predict age from microbiome composition.
We’ll first look at Partial Least Squares (PLS)24. The first step is to divide the data into training and test sets, with
assignments done by mouse, rather than by sample, to ensure that the test set realistically simulates the collection of
new data. Once we split the data, we can use the train function to fit the PLS model.
Next we can predict class labels on the test set using the predict function and compare to the truth. We see that the
method does an excellent job of predicting age.
##
## plsClasses (0,100] (100,400]
## (0,100] 64 0
## (100,400] 2 46
As another example, we can try out random forests. This is run in exactly the same way as PLS, by switching the
method argument from pls to rf. Random forests also perform well at the prediction task on this test set, though
there are more old mice misclassified as young.
rfFit <- train(age ~ ., data = training, method = "rf",
preProc = "center", proximity = TRUE)
rfClasses <- predict(rfFit, newdata = testing)
table(rfClasses, testing$age)
##
## rfClasses (0,100] (100,400]
## (0,100] 65 7
## (100,400] 1 39
Page 24 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
To interpret these PLS and random forest results, it is standard to produce biplots and proximity plots, respectively. The
code below extracts coordinates and supplies annotation for points to include on the PLS biplot.
The resulting biplot is displayed in Figure 19; it can be interpreted similarly to earlier ordination diagrams, with the
exception that the projection is chosen with an explicit reference to the binned age variable. Specifically, PLS identifies
a subspace to maximize discrimination between classes, and the biplot displays sample projections and RSV coef-
ficients with respect to this subspace.
ggplot() +
geom_point(data = pls_biplot$scores,
aes(x = Comp.1, y = Comp.2), shape = 2) +
geom_point(data = pls_biplot$loadings,
aes(x = 25 * Comp.1, y = 25 * Comp.2, col = Order),
size = 0.3, alpha = 0.6) +
scale_color_brewer(palette = "Set2") +
labs(x = "Axis1", y = "Axis2", col = "Binned Age") +
guides(col = guide_legend([Link] = list(size = 3))) +
facet_grid( ~ age2) +
theme([Link] = element_rect(color = "#787878", fill = alpha("white", 0)))
A random forest proximity plot is displayed in Figure 20. To generate this representation, a distance is calculated
between samples based on how frequently sample occur in the same tree partition in the random forest’s bootstrap-
ping procedure. If a pair of samples frequently occur in the same partition, the pair is assigned a low distance. The
resulting distances are then input to PCoA, giving a glimpse into the random forests’ otherwise complex classification
mechanism. The separation between classes is clear, and manually inspecting points would reveal what types of
samples are easier or harder to classify.
Figure 19. PLS produces a biplot representation designed to separate samples by a response variable.
Page 25 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
ggplot(rf_prox) +
geom_point(aes(x = X1, y = X2, col = age_binned),
size = .4, alpha = 0.6) +
scale_color_manual(values = c("#A66EB8", "#238DB5", "#748B4F")) +
guides(col = guide_legend([Link] = list(size = 3))) +
labs(col = "Binned Age", x = "Axis1", y = "Axis2")
To further understand the fitted random forest model, we identify the microbe with the most influence in the random
forest prediction. This turns out to be a microbe in family Lachnospiraceae and genus Roseburia. Figure 21 plots its
abundance across samples; we see that it is uniformly very low from age 0 to 100 days and much higher from age 100
to 400 days.
## [1] "Lachnospiraceae" NA
Figure 20. The random forest model determines a distance between samples, which can be input into PCoA to
produce a proximity plot.
150
(0,100]
100
Number of samples
50
0
150
(100,400]
100
50
0
0 1 2 3 4
Abundance of discriminative bacteria
Figure 21. A bacteria in genus Roseburia becomes much more abundant in the 100 to 400 day bin.
Page 26 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
�
�
�
� � � �
litter
�
� �
� � � � Litter 1
�� � � � � Litter 2
� � � �
� �� � �� ��
�� �
� � � � �
� � � id
� �
� �
F003
� �
F004
� �
F005
� � �
F006
� �
�
F007
�
F008
�
�
M001
�
M002
� �
M003
�
� �
M004
� �
� �
M005
�
� � �
M006
�
�
� �
� � �
� �
Figure 22. A network created by thresholding the Jaccard dissimilarity matrix. The colors represent which mouse
the sample came from and the shape represents which litter the mouse was in.
Page 27 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
This test has a small p-value, and we reject the null hypothesis that the two samples come from the same distribution.
From the plot of the minimum spanning tree in Figure 23, we see by eye that the samples group by litter more than we
would expect by chance.
gt$pval
## [1] 0.01
Nearest neighbors
The k-nearest neighbors graph is obtained by putting an edge between two samples whenever one of them is in the set
of k-nearest neighbors of the other. We see from Figure 24 that if a pair of samples has an edge between them in the
nearest neighbor graph, they are overwhelmingly likely to be in the same litter.
�
�
�
�
�
�
� � ��
7.5
������
��� ��� �
�� � �
��� ���
�� �� sampletype
�����
� ����
� �
���
��� � �
����
� � Litter 1
��� �� �
���� ��� �
� ��
��� ��
�� � �
� ������� ��� ���� ���� 5.0
�
Litter 2
count
����
�
��� ��
� �� �
�� �
�� �
�� �
� ���
��� �� � �
� � �
��
� ��� ��� � ����������
���� � � ��� � � �
���
�����
� ��
�� ���
���� �
� � ��
��� ����
��
� ��
��
edgetype
����� �� �� ����� �� �
� � ��� �� 2.5
��� � �� �� �
�� mixed
���
����
� �
�� ������
�
� �
����� �
� ���� ����
� �� � ��
�� pure
����
� ��� �� �
�� �� ����� � ��
� ����� ��
�� � �� ���� �
� ��� �
�� � �� � 0.0
� �
� � ��
� �� � �
� �� � 240 260 280 300
�
Number of pure edges
Figure 23. The graph and permutation histogram obtained from the minimal spanning tree with Jaccard
similarity.
Page 28 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
12.5
�
�� � � �
��� � � � � �
�� � � ��� � �
� � �� �� �
�� � �
� � �� �
�
10.0
� �� ��� � �� � � � � ��� ��
� ��� � � sampletype
�
� � � � �� � � �
�
�� �� � � � ��
�� � � � � � ��
�
�
� �
� �� � � �� �
�
� Litter 1 7.5
� � �� � �
��
�� � �
� �
��
� � � ��
� � � � �� � �� �
� � �
Litter 2
count
� � � �� �
�� � � � � �
�
� � � � � �� � � �� ���
���� � � � � �
�� � � � � � ��
� � � � � � � 5.0
�� �� � �� �� � �� � �
� � � � �
� �
�
�� � �
� � ��
� � edgetype
� �� � ���� � �� �� �� � ��
�� ��
���
� �
� � � mixed
� �� �� � �
� �� � � � �� �� �� �� � � 2.5
� �
�� � �� � � �
� ����
� ��
�
� � � � � pure
� � � � � �� � �
� � �� � � � �
� � ��� � � �
� � � �
�
� � � � � �� � 0.0
� � �� � ��
� � � � �
� � �
� � � � 190 200 210 220 230 240
� � �
Number of pure edges
Figure 24. The graph and permutation histogram obtained from a nearest-neighbor graph with Jaccard
similarity.
We can also compute the analogous test with two-nearest neighbors and the Bray-Curtis dissimilarity. The results are
not shown, but the code is given below.
Distance threshold
Another way of making a graph between samples is to threshold the distance matrix, this is called a geometric graph27.
The testing function lets the user supply an absolute distance threshold; alternatively, it can find a distance threshold
such that there are a prespecified number of edges in the graph. Below we use a distance threshold so that there are
720 edges in the graph, or twice as many edges as there are samples. Heuristically, the graph we obtain isn’t as good,
because there are many singletons. This reduces power, and so if the thresholded graph has this many singletons it is
better to either modify the threshold or consider a MST or k-nearest neighbors graph.
Then we can try a similar procedure with an increased number of edges to see what happens (code given below but
output not shown).
Linear modeling
It is often of interest to evaluate the degree to which microbial community diversity reflects characteristics of the envi-
ronment from which it was sampled. Unlike ordination, the purpose of this analysis is not to develop a representation of
many bacteria with respect to sample characteristics; rather, it is to describe how a single measure of overall community
structure (In particular, it need not be limited to diversity – defining univariate measures of community stability is also
common, for example.) is associated with sample characteristics. This is a somewhat simpler statistical goal, and can
Page 29 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
be addressed through linear modeling, for which there are a range of approaches in R. As an example, we will used
a mixed-effects model to study the relationship between mouse microbial community diversity and the age and litter
variables that have been our focus so far. This choice was motivated by the observation that younger mice have notice-
ably lower Shannon diversities, but that different mice have different baseline diversities. The mixed-effects model is
a starting point for formalizing this observation.
We first compute the Shannon diversity associated with each sample and join it with sample annotation.
To interpret the results, we compute the prediction intervals for each mouse by age bin combination. These are dis-
played in Figure 26. The intervals reflect the slight shift in average diversity across ages, but the wide intervals empha-
size that more samples would be needed before this observation can be confirmed.
��
� �
��
� � �
�� �
� �� �
� � �� � � 9
� � �� � �
�
� �
�
� �
� � �
� �
sampletype
� � � ��� � � � � �
� � �� � � �
� � � � ��� � �
�
�
� Litter 1
� �� ����
� � �
� � �
� � � �
� ����� Litter 2 6
count
� �
� �
� � ��
� � ��� � ��
� � � � � � � �
�� �
�� � � ��
�
�
� � �
� ��
�
�
�
�� edgetype
� � � �
�� � �� ��� � � � �
�
� �� � � mixed 3
� � �
� � � � ��
� � � �
�� �� � � �
�
�� �� �
�� � �� ��
� ��� � �
pure
�� �
� � � � � � �
� � ��
� � � �
�� � � 0
� � �
�
� 450 500 550
�
Number of pure edges
Page 30 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
4.5
� � �
� �
Litter
4.0 �
�
�
� �
� �
� �
�
�
�
�
�
�
� � � �
� � �
� �
� � � �
� � Litter 1
3.5 � � �
� � �
� �
� � � �
� � �
� �
� � � �
� � � � � �
� �
�
� � �
� �
� � � � �
� �
�
�
3.0 �
�
�
�
�
�
� �
Litter 2
�
2.5
2.5
(100,200]
(200,400]
(100,200]
(200,400]
(100,200]
(200,400]
(100,200]
(200,400]
(0,100]
(0,100]
(0,100]
(0,100]
Binned Age
Figure 26. Each point represents the Shannon diversity at one timepoint for a mouse; each panel is a different
mouse. The timepoints have been split into three bins, according to the mices’ age. The prediction intervals obtained
from mixed-effects modeling are overlaid.
Page 31 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
We apply this method to test the association between microbial abundance and age. This provides a complementary
view of the earlier analyses, identifying individual bacteria that are responsible for the differences between young and
old mice.
We digress briefly from hierarchical testing to describe an alternative form of count normalization. Rather than work-
ing with the logged data as in our earlier analysis, we consider a variance stabilizing transformation introduced by
31 for RNA-seq data and in 32 for 16S rRNA generated count data and available in the DESeq2 package. The two
transformations yield similar sets of significant microbes. One difference is that, after accounting for size factors, the
histogram of row sums for DESeq is more spread out in the lower values, refer to Figure 27. This is the motivation of
using such a transformation, although for high abundance counts, it is equivalent to the log, for lower and mid range
abundances it does not crush the data and yields more powerful results. The code below illustrates the mechanics of
computing DESeq2’s variance stabilizing transformation on a phyloseq object.
30
20
DESeq2
10
0
count
30
20
log(1 + x)
10
500 1000
Total abundance within sample
Figure 27. The histogram on the top gives the total DESeq2 transformed abundance within each sample. The
bottom histogram is the same as that in Figure 7, and is included to facilitate comparison.
Page 32 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
## class: DESeqTransform
## dim: 389 344
## metadata(1): version
## assays(1): ''
## rownames(389):
## GCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGAAGATCAAGTCAGCGGTAAAATTGAGAG
GCTCAACCTCTTCGAGCCGTTGAAACTGGTTTTC
## GCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGACTCTCAAGTCAGCGGTCAAATCGCGGG
GCTCAACCCCGTTCCGCCGTTGAAACTGGGAGCC
## ...
## GCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGTGTAGGCGGTTTGCCAAGTTGGGTGTGAAAGCCTTGA
GCTCAACTCAAGAAATGCACTCAGTACTGG
## GCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGATAGTCAGTCAGGTGTGAAATCCTATG
GCTTAACCATAGAACTGCATTTGAAACTAC
## rowData names(5): baseMean baseVar allZero dispGeneEst dispFit
## colnames(344): F3D0 F3D1 ... M6D8 M6D9
## colData names(17): collection_date biome ... age_binned sizeFactor
We use the structSSI to perform the hierarchical testing33. For more convenient printing, we first shorten the names of
each microbe.
Unlike standard multiple hypothesis testing, the hierarchical testing procedure needs univariate tests for each higher-
level taxonomic group, not just every bacteria. A helper function, treePValues, is available for this; it expects an
edgelist encoding parent-child relationships, with the first row specifying the root node.
el <- phy_tree(pslog)$edge
el0 <- el
el0 <- el0[nrow(el):1, ]
el_names <- c(short_names, seq_len(phy_tree(pslog)$Nnode))
el[, 1] <- el_names[el0[, 1]]
el[, 2] <- el_names[[Link](el0[, 2])]
unadj_p <- treePValues(el, abund, sample_data(pslog)$age_binned)
We can now correct p-value using the hierarchical testing procedure. The test results are guaranteed to control several
variants of FDR control, but at different levels; we defer details to 29,30,33.
Page 33 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
ggplot(abund_sums) +
geom_histogram(aes(x = sum), binwidth = 20) +
facet_grid(type ~ .) +
xlab("Total abundance within sample")
The plot opens in a new browser – a static screenshot of a subtree is displayed in Figure 28. Nodes are shaded
according to p-values, from blue to orange, representing the strongest to weakest associations. Grey nodes were
never tested, to focus power on more promising subtrees. Scanning the full tree, it becomes clear that the association
between age group and bacterial abundance is present in only a few isolated taxonomic groups, but that it is quite strong
in those groups. To give context to these results, we can retrieve the taxonomic identity of the rejected hypotheses.
options(width=100)
tax <- tax_table(pslog)[, c("Family", "Genus")] %>%
[Link]()
tax$seq <- short_names
Page 34 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Figure 28. A screenshot of a subtree with many differentially abundant bacteria, as determined by the hierarchical
testing procedure. Currently the user is hovering over the node associated with bacteria GCGAG.33; this causes the
adjusted p-value (0.0295) to appear.
It seems that the most strongly associated bacteria all belong to family Lachnospiraceae, which is consistent with the
random forest results in Section.
Multitable techniques
Many microbiome studies attempt to quantify variation in the microbial, genomic, and metabolic measurements across
different experimental conditions. As a result, it is common to perform multiple assays on the same biological samples
and ask what features – bacteria, genes, or metabolites, for example – are associated with different sample conditions.
There are many ways to approach these questions, which to apply depends on the study’s focus.
Here, we will focus on one specific workflow that uses sparse Canonical Correlation Analysis (sparse CCA), a method
well-suited to both exploratory comparisons between samples and the identification of features with interesting
variation. We will use an implementation from the PMA34.
Since the mouse data used above included only a single table, we use a new data set, collected by the study35. There are
two tables here, one for bacteria and another with metabolites. 12 samples were obtained, each with measurements at
637 m/z values and 20,609 OTUs; however, about 96% of the entries of the microbial abundance table are exactly zero.
The code below retrieves this data.
Page 35 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Our preprocessing mirrors that done for the mouse data. We first filter down to microbes and metabolites of interest,
removing those that are zero across many samples. Then, we transform them to weaken the heavy tails.
We can now apply sparse CCA. This method compares sets of features across high-dimensional data tables, where there
may be more measured features than samples. In the process, it chooses a subset of available features that capture the
most covariance – these are the features that reflect signals present across multiple tables. We then apply PCA to this
selected subset of features. In this sense, we use sparse CCA as a screening procedure, rather than as an ordination
method.
Our implementation is below. The parameters penaltyx and penaltyz are sparsity penalties. Larger values of
penaltyx will result in fewer selected microbes, similarly penaltyz modulates the number of selected metab-
olites. We tune them manually to facilitate subsequent interpretation – we generally prefer more sparsity than the
default parameters would provide.
## 123456789101112131415
cca_res
With these parameters, 5 microbes and 15 metabolites have been selected, based on their ability to explain covaria-
tion between tables. Further, these 20 features result in a correlation of 0.974 between the two tables. We interpret
this to mean that the microbial and metabolomic data reflect similar underlying signals, and that these signals can be
approximated well by the 20 selected features. Be wary of the correlation value, however, since the scores are far from
the usual bivariate normal cloud. Further, note that it is possible that other subsets of features could explain the data
just as well – sparse CCA has minimized redundancy across features, but makes no guarantee that these are the “true”
features in any sense.
Nonetheless, we can still use these 20 features to compress information from the two tables without much loss. To
relate the recovered metabolites and OTUs to characteristics of the samples on which they were measured, we use them
as input to an ordinary PCA.
Page 36 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
# annotation
genotype <- substr(rownames(pca_res$li), 1, 2)
sample_type <- substr(rownames(pca_res$l1), 3, 4)
feature_type <- grepl("\\.", colnames(combined))
feature_type <- ifelse(feature_type, "Metabolite", "OTU")
Figure 29 displays a PCA triplot, where we show different types of samples and the multidomain features (Metabolites
and OTUs). This allows comparison across the measured samples – triangles for Knockout and circles for wild type
– and characterizes the influence the different features – diamonds with text labels. For example, we see that the main
variation in the data is across PD and ST samples, which correspond to the different diets. Further, large values of 15
of the features are associated with ST status, while small values for 5 of them indicate PD status. The advantage of the
sparse CCA screening is now clear – we can display most of the variation across samples using a relatively simple plot,
and can avoid plotting the hundreds of additional points that would be needed to display all of the features.
� 7525 303.12 � PD
10850
1
195.01 � � ST
231.09
� 285.17
Axis2 [2% Variance]
WT
−6 −3 0 3
Axis1 [93% Variance]
Figure 29. A PCA triplot produced from the CCA selected features in from muliple data types (metabolites and
OTUs). Note that we have departed from our convention of fixing the aspect ratio here as the second axis represents
very little of the variability and the plot would actually become unreadable.
Page 37 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Operation
The programs and source for this article can be run using version 3.3 of R and version 3.3 of Bioconductor.
Conclusions
We have shown how a complete workflow in R is now available to denoise, identify and normalize next generation
amplicon sequencing reads using probabilistic models with parameters fit using the data at hand.
We have provided a brief overview of all the analyses that become possible once the data has been imported into the R
environment. Multivariate projections using the phylogenetic tree as the relevant distance between OTUs/RSVs can be
done using weighted unifrac or double principal coordinate analyses using the phyloseq package. Biplots provide the
user with an interpretation key. These biplots have been extended to triplots in the case of multidomain data incorporat-
ing genetic, metabolic and taxa abundances. We illustrate the use of network based analyses, whether the community
graph is provided from other sources or from a taxa co-occurrence computation using a Jaccard distance.
We have briefly covered a small example of using three supervised learning functions (random forests, partial least
squares and) to predict a response variable,
The main challenges in tackling microbiome data come from the many different levels of heterogeneity both at the
input and output levels. These are easily accommodated through R’s capacity to combine data into S4 classes. We
are able to include layers of information, trees, sample data description matrices, contingency table in the phyloseq
data sctructures. The plotting facilities of ggplot2 and ggnetwork allow for the layering of information in the output
into plots that combine graphs, multivariate information and maps of the relationships between covariates and taxa
abundances. The layering concept allows the user to provide reproducible publication level figures with multiple het-
erogeneous sources of information. Our main goal in providing these tools has been to enhance the statistical power of
the analyses by enabling the user to combine frequencies, quality scores and covariate information into complete and
testable projections.
Summary
This illustration of possible workflows for microbiome data combining trees, networks, normalized read counts
and sample information showcases the capabilities and reproducibility of an R based system for analysing bacterial
communities. We have implemented key components in C wrapped within the Bioconductor package dada2 to enable
the different steps to be undertaken on a laptop.
Once the sequences have been filtered and tagged they can be assembled into a phylogenetic tree directly in R using the
maximum likelihood tree estimation available in phangorn. The sequences are then assembled into a phyloseq object
containing all the sample covariates, the phylogenetic tree and the sample-taxa contingency table.
These data can then be visualized interactively with Shiny-phyloseq, plotted with one line wrappers in phyloseq and
filtered or transformed very easily.
The last part of the paper shows more complex analyses that require direct plotting and advanced statistical analyses.
Multivariate ordination methods allow useful lower dimensional projections in the presence of phylogenetic
information or multidomain data as shown in an example combining metabolites, OTU abundances,
Supervised learning methods provide lists of the most relevant taxa in discriminating between groups.
Bacterial communities can be represented as co-occurrence graphs using network based plotting procedures
available in R. We have also provided examples where these graphs can be used to test community structure through
non parametric permutation resampling. This provides implementations of the Friedman Rafsky25 tests for microbiome
data which have not been published previously.
Data availability
Intermediary data for the analyses are made available both on GitHub at [Link]
and at the Stanford digital repository permanent url for this paper: [Link] All other
data have been previously published and the links are included in the paper.
Page 38 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Software availability
Bioconductor packages at [Link] CRAN packages at [Link]
Permanent repository for the data and program source of this paper: [Link]
Archived source as at the time of publication: Zenodo: F1000_workflow: MicrobiomeWorkflowv0.9, doi: 10.5281/
zenodo.5454436
Author contributions
BJC, KS, JAF, PJM and SPH developed the software tools, BJC, KS, JAF, PJM and SPH developed statistical methods
and tested the workflow on the Mouse data sets. BJC, KS, JAF, PJM and SPH wrote the article.
Competing interests
No competing interests were disclosed.
Grant information
This work was partially supported by the NSF (DMS-1162538 to S.P.H.), the NIH (TR32 to KS and R01AI112401 to
SPH), and a Stanford Interdisciplinary Graduate Fellowship supported JAF.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the
manuscript.
Acknowledgments
The authors would like to thank the members of the Relman Lab for their valuable insights on microbiology and
sequencing. The are also grateful to Nandita Garud, Leo Lahti, Zachary Charlop-Powers for reviewing the paper and
to Martina Fu and Shaheen Essabhoy for code testing and suggestions for the revised version.
References
1. Wright ES: Using DECIPHER v2.0 to analyze big biological correction for next-generation sequencing reads. Bioinformatics.
sequence data in R. The R Journal, Page in Press, 2016. 2015; 31(21): 3476–3482.
Reference Source PubMed Abstract | Publisher Full Text
2. Caporaso JG, Kuczynski J, Stombaugh J, et al.: QIIME allows 9. Wang Q, Garrity GM, Tiedje JM, et al.: Naive Bayesian classifier
analysis of high-throughput community sequencing data. Nat for rapid assignment of rRNA sequences into the new bacterial
Methods. 2010; 7(5): 335–336. taxonomy. Appl Environ Microbiol. 2007; 73(16): 5261–7.
PubMed Abstract | Publisher Full Text | Free Full Text PubMed Abstract | Publisher Full Text | Free Full Text
3. Schloss PD, Westcott SL, Ryabin T, et al.: Introducing mothur: 10. Cole JR, Wang Q, Cardenas E, et al.: The Ribosomal Database
open-source, platform-independent, community-supported Project: improved alignments and new tools for rRNA analysis.
software for describing and comparing microbial communities. Nucleic Acids Res. 2009; 37(Database issue): D141–D145.
Appl Environ Microbiol. 2009; 75(23): 7537–7541. PubMed Abstract | Publisher Full Text | Free Full Text
PubMed Abstract | Publisher Full Text | Free Full Text
11. Wright ES: DECIPHER: harnessing local sequence context to
4. Callahan BJ, McMurdie PJ, Rosen MJ, et al.: DADA2: High- improve protein multiple sequence alignment. BMC Bioinformatics.
resolution sample inference from Illumina amplicon data. Nat 2015; 16: 322.
Methods. 2016; 1–4. PubMed Abstract | Publisher Full Text | Free Full Text
PubMed Abstract | Publisher Full Text | Free Full Text
12. McMurdie PJ, Holmes S: phyloseq: an R package for reproducible
5. Huber W, Carey VJ, Gentleman R, et al.: Orchestrating high-
interactive analysis and graphics of microbiome census data.
throughput genomic analysis with Bioconductor. Nat Methods.
PLoS One. 2013; 8(4): e61217.
2015; 12(2): 115–121.
PubMed Abstract | Publisher Full Text | Free Full Text
PubMed Abstract | Publisher Full Text | Free Full Text
13. Oksanen J, Blanchet FG, Kindt R, et al.: vegan: Community Ecology
6. Kozich JJ, Westcott SL, Baxter NT, et al.: Development of a dual-
Package. R package version 2.3-5. 2016.
index sequencing strategy and curation pipeline for analyzing
Reference Source
amplicon sequence data on the MiSeq illumina sequencing
platform. Appl Environ Microbiol. 2013; 79(17): 5112–5120. 14. Chessel D, Dufour AB, Thioulouse J: The ade4 package - i: One-
PubMed Abstract | Publisher Full Text | Free Full Text table methods. R News. 2004; 4(1): 5–10.
7. Schloss PD, Schuber AM, Zackular JP, et al.: Stabilization of the Reference Source
murine gut microbiome following weaning. Gut Microbes. 2012; 15. Paradis E, Claude J, Strimmer K: APE: Analyses of Phylogenetics
3(4): 383–393. and Evolution in R language. Bioinformatics. 2004; 20(2): 289–290.
PubMed Abstract | Publisher Full Text | Free Full Text PubMed Abstract | Publisher Full Text
8. Edgar RC, Flyvbjerg H: Error filtering, pair assembly and error 16. Wickham H: ggplot2: Elegant Graphics for Data Analysis. Springer-
Page 39 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Verlag, New York, 2009. 26. Schilling MF: Multivariate two-sample tests based on nearest
Publisher Full Text neighbors. J Am Stat Assoc. 1986; 81(395): 799–806.
17. McMurdie PJ, Holmes S: Shiny-phyloseq: Web application for Publisher Full Text
interactive microbiome analysis with provenance tracking. 27. Penrose M: Random geometric graphs. Oxford University Press,
Bioinformatics. 2015; 31(2): 282–283. Oxford, 2003; 5.
PubMed Abstract | Publisher Full Text | Free Full Text Publisher Full Text
18. Pavoine S, Dufour AB, Chessel D: From dissimilarities among 28. Benjamini Y, Hochberg Y: Controlling the false discovery rate: a
species to dissimilarities among communities: a double principal practical and powerful approach to multiple testing. J Roy Stat
coordinate analysis. J Theor Biol. 2004; 228(4): 523–537. Soc B. 1995; 57(1): 289–300.
PubMed Abstract | Publisher Full Text Reference Source
19. Purdom E: Analysis of a data matrix and a graph: Metagenomic 29. Benjamini Y, Yekutieli D: Hierarchical fdr testing of trees of
data and the phylogenetic tree. Ann Appl Stat. 2011; 5(4): hypotheses. Technical report, Department of Statistics and
2326–2358. Operations Research. Tel Aviv University, 2003.
Publisher Full Text 30. Benjamini Y, Bogomolov M: Selective inference on multiple
20. Fukuyama J, McMurdie PJ, Dethlefsen L, et al.: Comparisons of families of hypotheses. J R Stat Soc Series B Stat Methodol. 2014;
distance methods for combining covariates and abundances in 76(1): 297–318.
microbiome studies. Pac Symp Biocomput. World Scientific, 2012; Publisher Full Text
213–24. 31. Love MI, Huber W, Anders S: Moderated estimation of fold change
PubMed Abstract | Publisher Full Text | Free Full Text and dispersion for RNA-seq data with DESeq2. Genome Biol.
21. Holmes S, Alekseyenko A, Timme A, et al.: Visualization and 2014; 15(12): 550.
statistical comparisons of microbial communities using R PubMed Abstract | Publisher Full Text | Free Full Text
packages on Phylochip data. Pac Symp Biocomput. 2011; 142–53. 32. McMurdie PJ, Holmes S: Waste not, want not: why rarefying
PubMed Abstract | Publisher Full Text | Free Full Text microbiome data is inadmissible. PLoS Comput Biol. 2014; 10(4):
22. ter Braak C: Correspondence analysis of incidence and e1003531.
abundance data: Properties in terms of a unimodal response PubMed Abstract | Publisher Full Text | Free Full Text
model. Biometrics. 1985; 41(4): 859–873. 33. Sankaran K, Holmes S: structSSI: Simultaneous and Selective
Publisher Full Text Inference for Grouped or Hierarchically Structured Data. J Stat
23. Greenacre M: Correspondence analysis in practice. CRC press, Softw. 2014; 59(13): 1–21.
2007. PubMed Abstract | Publisher Full Text | Free Full Text
Reference Source 34. Witten D, Tibshirani R, Gross S, et al.: Pma: Penalized multivariate
24. Wold S, Ruhe A, Wold H, et al.: The collinearity problem in analysis. R package version. 2009; 1(5).
linear regression. The partial least squares (pls) approach to 35. Kashyap PC, Marcobal A, Ursell LK, et al.: Genetically dictated
generalized inverses. SIAM J Sci Stat Comput. 1984; 5(3): change in host mucus carbohydrate landscape exerts a diet-
735–743. dependent effect on the gut microbiota. Proc Natl Acad Sci U S A.
Publisher Full Text 2013; 110(42): 17059–17064.
25. Friedman JH, Rafsky LC: Multivariate generalizations of the wald- PubMed Abstract | Publisher Full Text | Free Full Text
wolfowitz and smirnov two-sample tests. Ann Statist. 1979; 7(4): 36. Callahan BJ, Sankaran K, Fukuyama JA, et al.: F1000_workflow:
697–717. MicrobiomeWorkflowv0.9. Zenodo. 2016.
Publisher Full Text Data Source
Page 40 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Version 2
[Link]
© 2016 Lahti L. This is an open access peer review report distributed under the terms of the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the
original work is properly cited.
Leo Lahti
Department of Mathematics and Statistics, University of Helsinki, Turku, Finland
The title and abstract appropriately summarize the contents, and the text is fluent to read. The
manuscript aims to cover a vast area, and does good job in summarizing the relevant key aspects
in a single workflow.
The study design, methods and analysis and their suitability are properly described with
appropriate references. The work describes a recommendation for a workflow based on the
author's comprehensive experience in this field. It does not provide thorough comparison or
benchmarking of the methods but relevant research is cited and key comparisons are already
available in the literature. The contribution in this work is to combine the individual elements into
a coherent workflow that describes very typical steps and recommended choices in standard
taxonomic analysis.
* Major comments:
The main shortcoming is that the workflow is not provided in a readily reproducible format. I
cloned the github repository, and could run the analysis rnw files (PartI, PartII, PartIII) individually,
as well as the [Link]. These result in .text file but using pdflatex or latex could not be readily
applied to convert these into the final PDF format. The github site does not mention how the rnw
files should actually be converted into PDF. This is not evident as there are many ways to do this
and the success will depend on the overall setup. The authors could include for instance a simple
shell script or README in the github main directory, showing what steps are taken to get from the
original R/Rnw files to the final PDF reports. This would greatly increase the utility and
reproducibility of this work.
* Minor comment:
- Something is missing from Conclusions. There is paragraph that in its entirety reads as follows:
"We have briefly covered a small example of using three supervised learning functions (random
Page 41 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
forests, partial least squares and) to predict a response variable," - it misses text in parentheses
and ends with a comma.
- Could you cite or discuss in more detail based on your experience whether Friedman Rafsky
method outperforms alternative or at least closely related methods in the pairwise comparison
task ? Not required but would be interesting to know.
- The phyloseq package might serve its purpose better if split in smaller and more compact
packages. The class structure is really useful and valuable, and would deserve its own package.
This would better serve the overall microbiome data analytics community which can build on this
and expand phyloseq capabilities in separate packages, in the same way as certain microarray
data structures became a norm with the RMA and limma packages, with subsequent explosion in
analysis methodologies. I am here just repeating my comment from the first review. Not required
for this manuscript, however.
Competing Interests: I am currently developing the microbiome R package, which utilizes some of
the functionality in the phyloseq package which has a central role in this review. I have done this
development work independently of the authors, following standard open source development
model. It is just one of the many packages I am utilizing, and I do not see a clear competing
interest but like to mention this.
I confirm that I have read this submission and believe that I have an appropriate level of
expertise to confirm that it is of an acceptable scientific standard.
Version 1
[Link]
© 2016 Garud N. This is an open access peer review report distributed under the terms of the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the
original work is properly cited.
Nandita R. Garud
1 Gladstone Institutes, UCSF, San Francisco, CA, USA
2 Gladstone Institutes, UCSF, San Francisco, CA, USA
This article is a valuable resource for the metagenomics field. The thorough examples of several
statistical analyses of metagenomic data will help both the novice and expert in analyzing their
own data. Additionally, this paper sets a standard in the field for documenting analyses.
Both DADA2 and PhyloSeq have much to offer. DADA2 identifies OTUs, which are termed in this
paper ‘Ribosomal Sequence Variants,’ reflecting the extra granularity with which DADA2 is capable
of resolving OTUs. The RSVs identified by DADA2 offer the ability to conduct higher resolution
Page 42 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Below I make a few suggestions for clarification purposes. I enjoyed reading this article and have
already benefited greatly from using DADA2 and PhyloSeq in my own work.
○ I wonder if the examples that the authors provide could be more biologically motivated. For
example, could the authors explain the mouse data set in greater depth in the introduction?
What did Kozich et al. 2013 and Schloss et al. 2012 find in these data sets? Were DADA2 and
PhyloSeq used to analyze the data in these two papers? If not, are the findings different? I
enjoyed reading about the different metagenomic properties of mice of different ages.
More description along these lines in the introduction would make it motivating to
understand why the various preprocessing steps are done and an overview of what is to
come.
○ Page 4 – it could be helpful to illustrate some of the properties of the software with
numbers and data. For example, DADA2 has the ability to infer OTUs from pooled or
unpooled data. Could the authors illustrate the number of RSVs found in the two scenarios?
○ Figure 2 -- Could the authors explain on Page 4 what sequencing error rates are being
inferred (i.e. transition and transversion errors)? Which parameters are inferred to come up
with the solid black line? An explicit reference to Figure 2 in the text could help. Additionally,
headers indicating Forward and Reverse reads in Figure 2 could help to distinguish the
plots.
○ Page 6 – Is the multiple sequence alignment feature capable of multiple methods? If so, do
you advocate for using ClustalW for metageonomic data? Why?
○ I wonder if the authors could give some more guidance on how to construct the PhyloSeq
object from scratch without relying import functions. For example, I tried making a
PhyloSeq object using Metaphlan2 output. Unfortunately I could not figure out how to
merge Metaphlan2 biom files for each sample, and so I had to fiddle with Phyloseq for
sometime to manually create the OTU, sample, and taxa tables for multiple samples.
I confirm that I have read this submission and believe that I have an appropriate level of
expertise to confirm that it is of an acceptable scientific standard.
Page 43 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Thanks for your comments and suggestions. We made several improvements to the revised
manuscript in response:
We added an explicit reference to Figure 2 in the text. The error rates being estimated in
each plot are indicated in the text just above each plot. A2C (A to C) is shorthand for an A
being converted to a C by errors in the amplicon sequencing process.
We added a brief text description of GTR+G+I (Generalized time-reversible with Gamma rate
variation).
We did not expand our evaluation of RSVs vs. OTUs or pooled vs. unpooled
inference. Performing such evaluations well is a significant undertaking and would take
significant space to explain, and our primary purpose here is to demonstrate the many
features of an R/Bioconductor amplicon analysis workflow.
For evaluation of DADA2, our manuscript introducing the method examines differences
between the output of DADA2 and OTU methods and we are writing another manuscript
that looks at performance on datasets with many samples. On the issue of pooled vs.
unpooled results, the short answer is that we find both approaches work well. If just
counting the number of output OTU sequences, pooled inference generally finds more
because of its higher sensitivity to sequences that are found in many samples but are rare
in each. Of note, we generally find these pooled-only sequences to be very highly enriched
for contaminants (eg. kit contaminants), which are expected to distributed in just this way.
We also did not expand much on the biological findings from this dataset in the initial paper
(Stabilization of the murine gut microbiome following weaning, Schloss et al. 2012), as they
were quite limited, essentially boiling down to the observation that gut sample early in life
differed by more on average than samples from later in life. However, the dataset has been
used in a number of studies as an example dataset for testing new methods (as in Kozich et
al. 2013) and that is the way in which we are using it here.
[Link]
© 2016 Charlop-Powers Z. This is an open access peer review report distributed under the terms of the Creative
Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium,
provided the original work is properly cited.
Page 44 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Zachary Charlop-Powers
1 Laboratory of Genetically Encoded Small Molecules, Rockefeller, New York, NY, USA
2 Laboratory of Genetically Encoded Small Molecules, Rockefeller, New York, NY, USA
There is a growing push in the computational sciences for adopting software practices that
promote replicability and provide methodological transparency. In the field of microbiome
research these practices should minimize the standard culprits of error-creep such as file
proliferation, and incompatible formats; they should provide sound default choices for the core
computational steps of sequence clustering and taxonomic assignment; and they should facilitate
reproducible statistical analyses of the resulting data. By providing a step-by-step analysis of a
microbiome dataset that can be completed entirely from within the R statistical computing
environment, this workflow does an admirable job of bringing these best-practices to the world of
microbiome science.
The article takes a reader through the steps of processing raw sequence data and loading the data
into R. It then demonstrates how to use basic exploratory data analysis to get a sense of the data
and finally introduces the use of various statistical packages to search-for and validate patterns.
The majority of the article focuses on the application of statistical concepts to microbiome data
and this is where scientists would like to be spending their time. However, this allocation of ink-
space is only possible because the recent release of the DADA2 package allows the authors (and
subsequent users) to condense all the read-processing portion of the tutorial into a few short
steps. DADA2 provides a new and arguably superior method for clustering raw amplicon reads
and, by processing the reads and assigning taxonomy, it fills in the computational gap required to
work completely within R. The benefits of this workflow are fairly self-evident in the amount of
space in their workflow devoted to data processing versus exploration, however, there are other
benefits as well, of which I will name two. First, by using packages hosted on CRAN or
Bioconductor, the authors can leverage the Bioconductor build system and ensure a fully working
environment, a non-trivial prerequisite in a field with myriad tools. Second, by providing an
integrated set of tools there are few, if any, intermediate files required to analyze a dataset. In
addition to reducing the cognitive burden of a newcomer, this generally reduces the footprint for
errors.
This article is an excellent introduction on how to process and analyze a 16S amplicon dataset.
Because of the relative ease of working entirely within a single environment, and for the sound
design principles used by the core R packages in this analysis, I predict this workflow will become
a useful resource, if not a direct template, for many microbiome scientists learning to process
their data.
I confirm that I have read this submission and believe that I have an appropriate level of
expertise to confirm that it is of an acceptable scientific standard.
[Link]
Page 45 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
© 2016 Lahti L. This is an open access peer review report distributed under the terms of the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the
original work is properly cited.
Leo Lahti
1 Department of Mathematics and Statistics, University of Helsinki, Turku, Finland
2 Department of Mathematics and Statistics, University of Helsinki, Turku, Finland
This work reports a standard R/Bioconductor open source workflow for the analysis of microbial
community profiling data based on (Illumina MiSeq) 16S rRNA amplicon sequencing. The main
contribution of the
paper is to present a compact overview of a typical microbiome analysis workflow in R, and to
integrate accumulated knowledge by the authors regarding best practices in microbiome
bioinformatics based on
the R statistical programming environment.
The workflow covers key steps from raw sequencing data prepreprocessing to standard statistical
testing, data integration, and visualization. The methodologies are rigorous, and represent a
straightforward combination of previously published R tools that are among the state-of-the-art in
the field. Reliance on Bioconductor packages provides further guarantees for high quality of the
software components. All data and code underlying the paper are openly available, and I was also
able replicate the complete workflow after some initial setups. I examined about half of the
examples in more detail, and could reproduce manuscript figures in all cases that I tested.
No new methods are introduced, and the main contribution of the work is to showcase good
statistical practice based on existing software components, some of which have been previously
published by the authors of this manuscript. Appropriate references are provided throughout the
text. Such overview papers are useful, however, as they can provide benchmarks and
recommendations on complete workflows,
where the different analysis steps are not independent in any real study and deserve analysis in
their own right.
The analysis steps are explained in clear language and with sufficient detail. The work is
technically sound. The main drawback is that the manuscript is somewhat scattered as it aims to
cover a large and versatile set of tools in a single paper. The quality of the analysis is high, and the
overview is useful, and the paper could be accepted after taking into account my comments
below.
Major comments
The work is somewhat scattered due to the wide coverage. The paper could benefit from
○
having less figures and and increasing focus on key aspects. For instance the number of
biplots and network figures could be reduced. The data integration part (CCA etc.) is useful
but very brief and probably difficult to comprehend by readers who are new to those
approaches. I would recommend either cutting or expanding this part and also otherwise
checking if the manuscript can be made more compact by removing some examples
(perhaps by moving some examples into supplementary material or online
documentation?).
Page 46 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
○ The examples with DADA2 and the hierarchical testing procedure are particularly useful;
these recently published methods would deserve to become more widely used. Sufficient
details have been given for this work.
○ Instructions on how to exactly use the source files provided in Github are missing. The rnw
files are missing latex headers so I could not readily generate final readable reports from
the rnw files. The code itself was clear, and after some setups I could replicate all analyses
after changing some path definitions and running the code interactively on R command
line. But this relied on my earlier good knowledge on R and automated document
generationsystems. Users who are less experienced with these tools would benefit from
improved instructions on how to run the workflow. The [Link] file in Github should
give more detailed instructions (or link to instructions) on how to exactly reproduce the
complete example workflow and generate the final reports.
○ In the "Infer sequence variants" section it is mentioned that "Sequence inference removed
nearly all substitution and indel errors from the data". How this was quantified to reach this
conclusion?
Minor comments
○ The phyloseq R package has been published earlier and represents an extremely useful
class structure for microbiome profiling data that has high potential of becoming a popular
standard in R. These tools, and their (online) documentation form essential background
material for this manuscript. Better separaration of the data structures and tools in this
manuscript, the R packages (in particular phyloseq) and their documentation. This would
make it easier for the wider R community to build on this work and contribute further tools
that take advantage of the phyloseq data structure. This is not required for this manuscript
but a suggestion for improvement.
○ Is it intentional that figures 8, 10, 11, 12, 13, 14 and some other figures have an unbalanced
Page 47 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
width/height ratio? The figures might seem more clear if the width/height ratio was more
balanced.
I confirm that I have read this submission and believe that I have an appropriate level of
expertise to confirm that it is of an acceptable scientific standard.
Page 48 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
Version 1
Indeed we realized there are a few lines missing in the github repository and the online code, we
are currently preparing a revision that addresses this and the referee's reports.
We hope to have a new version up shortly, the github repository should reflect the changes in code
even before the new article does.
In the meantime if you are still having problems it is also possible to post issues both on the
phyloseq and dada2 repositories:
[Link]
[Link]
Hi,
Nice article. You might go through the walk through fresh as some of the code is missing. For
example, the object you need to make Figure 11 was never made, easy fix, but incomplete
walkthrough. As another example, the function setup_example is not defined. Looks like it is just a
load library, but again, incomplete. One thing that might help is if you converted this article to
.Rmd such that you also published the .Rmd file to the supplementary material or something
similar.
Page 49 of 50
F1000Research 2016, 5:1492 Last updated: 27 NOV 2023
• You can publish traditional articles, null/negative results, case reports, data notes and more
Page 50 of 50
Rank-transformation in PCA analysis of microbiome data offers several advantages over raw data. It mitigates the impact of skewed distributions and avoids issues associated with heavy-tailed data by focusing analysis on ordinal rather than quantitative differences . This approach ensures that relative differences are emphasized over large numerical disparities, particularly reducing the impact of outliers that can skew analyses based on raw abundances . This helps in achieving a more robust analysis of subtle patterns in microbial community structure .
Using PCoA with microbiome data presents challenges such as representing distances faithfully, given that eigenvalues can differ greatly, particularly with phylogenetic data. Non-standard PCoA plots, which adjust aspect ratios to reflect eigenvalue differences, help in accurately depicting the relationships between samples . This ensures that the visualization reflects the true nature of data variance rather than being constrained by a fixed plot shape, thus aiding in better interpretation of effects like those seen in different age groups .
Log transformation is employed in microbiome data analysis as a variance stabilizing transformation, which is necessary to handle the heavy-tailed distribution of microbial abundance data. It mitigates the effects of extreme values, making the data more amenable to conventional statistical methods and visualizations like principal coordinate analysis (PCoA). The transformation reduces the skewness of distributions, enabling improved comparison across samples by emphasizing relative rather than absolute differences .
Age-based categorical variables in microbiome data analysis are used to categorize mice into different age groups (young, middle-aged, and old) for better understanding of their microbiome compositions. These variables allow for stratification of data and facilitate age-specific analysis of microbial abundance and diversity . This segmentation enables researchers to examine age-related differences in microbial communities through statistical methods such as ordination plots and principal coordinate analysis (PCoA).
Pooling samples increases the detection of OTU sequences due to higher sensitivity to rare sequences present across many samples, although it risks contaminant enrichment . Unpooled results, conversely, often detect fewer sequences but with potentially increased specificity to genuine variant signals in individual samples . The choice between pooling and not pooling should balance between breadth of OTU detection and minimizing false positives due to contaminants .
Integrating Bioconductor packages into microbiome data workflows provides robust, high-quality software components for statistical analysis and visualization, ensuring analyses that are replicable and well-supported . It allows leveraging of a community-supported infrastructure for maintaining up-to-date and compatible software, facilitating straightforward deployment and use in R without dealing with complex dependencies . This enhances the efficiency of the workflow, supporting both preprocessing and advanced data exploration .
Weighted Unifrac and DPCoA differ primarily in how cleanly they interpret the microbiome ordination axes. While both methods take phylogenetic relationships into account, DPCoA provides a clearer interpretation of the second axis in terms of taxonomic distribution, especially highlighting samples' relationships with age and abundance of certain taxa such as Bacteroidetes and Firmicutes . Weighted Unifrac, though effective, presents a more complex axis interpretation, which can sometimes obscure these distinctions .
DADA2 workflow enhances the reproducibility and efficiency of microbiome data analysis by providing an integrated suite that consolidates sequence processing and taxonomic assignment within the R environment, minimizing intermediate file handling . It improves error-correction accuracy and is efficiently structured to prevent data misinterpretation—key for replicable scientific findings. By streamlining these processes, DADA2 reduces error potential and facilitates comprehensive data exploration and visualization without the need for extensive procedural steps .
Random forests significantly impact classifying microbiome samples by identifying influential microbial taxa, thereby enhancing model interpretability. In proximity plots, random forests calculate distances between samples based on how often they co-occur in tree partitions, providing insight into sample classification complexity . This method reveals patterns in microbe presence and abundance, offering a clearer separation of sample classes based on influential taxa like Lachnospira . Proximity plots are thus significant for intuitively understanding class separability in high-dimensional microbiome datasets .
PLS biplot contributes to separating samples based on categorical variables such as age by maximizing discrimination between classes in a reduced dimensionality space. In microbiome data, it helps identify components that best separate age groups while accounting for microbial abundance and other variables . The biplot projects sample scores based on maximized variation along axes corresponding to these classes, which aids in visualizing differences across categories such as age bins .