LAB 7 PCR PRIMER

DESIGN, DOWNLOAD,
A N D VA L I D AT I O N

SCB252 Fundamentals of
Biotechniques
Objective

•To become familiar with the principle of designing a primer

•To practice primer design and validation using NCBI primer
BLAST
•To become familiar with FlyPrimerBank.
Lab Exercise I - Observe F2 Generation Phenotypes from the Lab 5 (if
applicable)

Material
Genetic crosses performed in lab 5

Methods
1.Observe the F2 progeny of the crosses produced in lab 5 and their phenotypes.
2.Count the total number of F2 generation,
3.Separate flies based on their phenotypes,
4.Count the number of flies in each phenotype.

In Lab notebook:
5.Calculate F2 phenotype and genotype ratios and describe how these observations may fit
your original plan for genetic crosses.
6.Reflect on how this observation fits the law of inheritance, such as Mendel’s law of
segregation and independent assortment.
Introduction

Polymerase chain reaction (abbreviated PCR) is a laboratory technique

for rapidly producing (amplifying) millions to billions of copies of a specific
segment of DNA, which can then be studied in greater detail. PCR involves
using short synthetic DNA fragments called primers to select a segment of
the genome to be amplified, and then multiple rounds of DNA synthesis to
amplify that segment.

https://www.genome.gov/genetics-glossary/Polymerase-Chain-Re
action
How is DNA replicated in cell?
https://www.youtube.com/watch?v=hTF4NZ
C29mU
 PCR

PCR is based on DNA polymerase's ability to create a new DNA

strand that's complementary to the template strand. The
amplification procedure involves: Denaturing, Annealing,
Extention. It is also called as Thermal cycler which exposes
reagents to repeated cycles of heating and cooling to permit
different temperature-dependent reactions—specifically,
DNA melting and enzyme-driven DNA replication.

PCR was invented in 1983 by American biochemist Kary Mullis at

Cetus Corporation. Mullis and biochemist Michael Smith, who
had developed other essential ways of manipulating DNA, were
jointly awarded the Nobel Prize in Chemistry in 1993. The
evolution of PCR has led to a rich tapestry of techniques, each
tailored to specific research needs. Most popular ones like real-
ime quantitive PCR (qPCR) and reverse transcription PCR (RT-
PCR), these variants continue to shape molecular biology
PCR procedure
The key ingredients of a PCR reaction are Taq polymerase, primers,
template DNA, and nucleotides (dNTPs)

Taq polymerase
Like DNA replication in an organism, PCR requires a DNA polymerase enzyme
that makes new strands of DNA, using existing strands as templates. The
DNA polymerase typically used in PCR is called Taq polymerase, after the
heat-tolerant bacterium from which it was isolated (Thermus aquaticus).

T. aquaticus lives in hot springs and hydrothermal vents. Its DNA polymerase
is very heat-stable and is most active around 70oC (a temperature at which
a human or E. coli DNA polymerase would be nonfunctional). This heat
stability makes Taq polymerase ideal for PCR. As we'll see, high temperature
is used repeatedly in PCR to denature the template DNA or separate its
strands.
PCR primers
Like other DNA polymerases, Taq polymerase can only make DNA if it's given
a primer, a short sequence of nucleotides that provides a starting point for
DNA synthesis. In a PCR reaction, the experimenter determines the region of
DNA that will be copied, or amplified, by the primers she or he chooses.

PCR primers are short pieces of single-stranded DNA, usually

around 20 nucleotides in length. Two primers are used in each PCR reaction,
and they are designed so that they flank the target region (a region that will be
amplified). That is, they are given sequences that will make them bind to
opposite strands of the template DNA, just at the edges of the region to be
copied.

The primers bind to the template by complementary base pairing. When the
primers are bound to the template, they can be extended by the polymerase, and the region
that lies between them will get copied.
Two primers bind to template DNA in the flanking regions
during the PCR cycles.
 Lab Exercise VI – PCR amplification
Materials
Ice
Microcentrifuge
Vortex
4 DNA samples from Lab exercise V (on ICE)
Eb Primers(Forward: CCAGGGAACTCCCACGTTATC; Reverse: GGAGCCGATTGAGGATGCT) (On ice) PCR Product 191
Vg Primers(Forward: GGGGCAATACCCAAGAATCTG; Reverse: TTGGTGAACACAACGCAGGA) (On ice) PCR product
122
2 PCR Master Mix (2X) (On ice) stores at -20℃
2 Nuclease-free water (come with the PCR master Mix) (On ice)
2 2-20 ul micropipettes
2 20 – 200 ul micropipettes
2 box of P20-200
2 PCR tubes racks
2 mini PCR machines
8 0.2ml PCR tubes
2 fine-tip markers
Method
1. Gently vortex and briefly centrifuge PCR Master Mix (2X) after thawing (Complete by
instructor).
2. Each group obtain 2 PCR tubes and label them as ①WT-Eb②WT-Vg or ①Eb-Eb②Eb-Vg or ①Vg-
Eb②Vg-Vg or ①2-Eb②2-Vg.
3. Place PCR tubes on ice and add following components: in tube ① add Eb primers, ②add Vg
Vmm = 25ul
primers
Vfp depends on the concentration of
forward primer
Vrp depends on the concentration of reverse primer
Based on your DNA concentration, Vdna= Mdna/Cd

Vwater=50ul – 25ul – Vfp – Vrp - Vdna

4. Gently vortex the samples and spin down with microcentrifuge.

5. Put PCR tubes in Thermol cycler and set up the program named as ‘Flypcr’.
6. After PCR is done, Lab technician will pick them up and stores at -20℃
 Vg Eb commercial primers concentration is 10uM

Our target concentration range is 0.1 – 1 uM

Use the equation: C1xV1 = C2xV2

V1 = C2xV2/C1

DNA template range is 10pg – 1ug 0.01ng – 1000ng

 ‘Flypcr’ program conditions outlined below:For primers containing
less than 25
nucleotides, the approx.
melting temperature
(Tm) can be calculated
using the following
equation:
Tm= 4 (G the
Typically, + C) + 2 (A +
optimum
2 min T)
annealing temperature is 5
degrees Celsius below the
lowest melting temperature
55 of primers. Too high of an
annealing
30S
We use 33 temperature prevents
optimal binding of the
primers to the
templates while too low of
an annealing temperature
Last step infinite hold at 4℃ can lead to non-specific
binding and, subsequently,
b Primers(Forward: CCAGGGAACTCCCACGTTATC; Reverse: GGAGCCGATTGAGGATGCT) (On ice)PCR
non-specific PCRproducts.
Product 191
g Primers(Forward: GGGGCAATACCCAAGAATCTG; Reverse: TTGGTGAACACAACGCAGGA) (On ice) PCR product 12
Tm= 4 (G + C) + 2 (A + T)
The melting temperature, or Tm, The actual Tm is influenced by
is a critical parameter to consider the concentration of Mg2+,
when designing and performing K+, and cosolvents. There are
many molecular biology numerous computer programs
experiments, including PCR and to assist in primer design. The
qPCR. formula given above for Tm is
The Tm of an oligonucleotide simplistic; there are many
duplex is the temperature at primer design programs which
which half of the oligonucleotide use more complex nearest-
molecules are single-stranded and neighbor thermodynamics
half are double-stranded, i.e., the values.
oligonucleotide is 50% annealed
 2
min

55
33
30
S5

Infinite 4 min
Infinit
Hold e
 HOW TO MAKE PRIMERS?

PCR primers are made by combining nucleotides in a chemical reaction.

When adding a nucleotide one at a time, the reactive groups must be
deliberately blocked and unblocked frequently. Primers' key characteristic is
that they must match sequences on the template molecule (must be
complementary to the template strand).
Primer Design and Validation Exercises

Different target genes require specific primer pairs. The first exercise of
this lab will use one gene (eyeless) as an example and teach you to
design primers for PCR experiments by using primer BLAST in NCBI.

In exercise 2, we will briefly describe how to validate primers using the

same tool.

In exercise 3, you will practice downloading primers from FlyprimerBank

and validating them.
Lab Exercise III - PCR Primer Design

Material

NCBI website (https://www.ncbi.nlm.nih.gov/)

NCBI Primer-BLAST (
https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi)
A) Design a primer for a specific transcript.
1. Open NCBI (https://www.ncbi.nlm.nih.gov/ ) and select “Gene” for the search function.
Search for the gene eyeless (ey).
Choose the gene and scroll down the result page, find the genomic viewer, and click on the ey [+8]
green bar shown below.

Click on the green bar

2. More information will show up including four transcript variants for this gene and four
protein variants. (NM is mRNA, NP is protein, NC is a nucleotide.) We only compare mRNA
sequences, so NP data are not analyzed.
 3. Continue scrolling down and find NCBI Reference Sequences (RefSeq), mRNA, and
protein sections. Specific information about all isoforms will be displayed if there is more
than one mRNA transcript. In this case, there are A to D
NMeyeless transcripts.
is mRNA, NP is protein

Reference Assembly

4. Using isoform B as an example, this primer is designed specifically for amplifying

eyeless isoform B cDNA during the PCR. click on the hyperlink NM_166789.2 to go to
the following page.

cDNA (short for complementary DNA) is synthetic DNA that has been
transcribed from a specific mRNA through a reaction using the enzyme reverse
transcriptase. While DNA is composed of both coding and non-coding sequences,
cDNA contains only coding sequences.
5. Click the “Pick Primers” on the right side under customizing the view to enter the
Primer BLAST page.
 350

Once you see the page, PCR Template has been filled out for you. For now, leave everything else blank and
change the maximum value for “PCR product size” to 350 bp. In qPCR reactions, the extension time
generally does not exceed 30 s. According to the conventional Taq enzyme reaction rate of 1 Kb /min, 30 s
can synthesize 500 bp. However, the enzyme activity will decrease with the prolongation of the reaction time.
Therefore, it is more appropriate to set the maximum product length as 350 bp or even lower to be
conservative. An overly short product cannot be separated from the primer dimer. Therefore, the lower limit is
70 bp. If you cannot find any suitable primers, then increase this number, preferably below 500 bp, or the
qPCR reaction conditions (extension time) will have to be changed.
6. The “Exon junction span” option is changed to ”Primer must span an exon-
exon junction”. This means that at least one of the primers crosses the junction
between the exons. This way, even if there is genomic DNA contaminating the cDNA,
it will not be amplified, ensuring accurate quantification.
7. The following options are set as default. “Specificity Check” is chosen as
default, which helps you verify the specificity of a primer. The organism is
automatically filled in for you as “D.mel” (7227 is for fruit fly D. melanogaster,
add more species if needed). The last option, ”Allow splice variants”, is not
used to design a specific primer for this chosen isoform.
8. Click the “Get Primers” button and wait for a few seconds or minutes
depending on the number of search requests. Subsequently, this page returns
10 pairs of primers.
9. Save the screenshot of the graphical view of primer pairs and copy the
primer pair 1 text to your word report. Be sure to indicate for which gene
this primer was designed.
 B) Design a primer for multiple isoforms

Change the range of the forward or reverse primer. The goal is to make sure that the primer
falls in the common interval of all the transcripts since these isoforms have strong
homology, almost only the 5 'or 3' ends are slightly different.

1.Go back to the gene search results for eyeless on NCBI. Click on the green line of ey. Find the
common interval of all transcripts in the genomic region viewer at the top of the gene page. In
this case, the 3’ ends in all isoforms are the same, only the 5’ end is different. Find the longest
transcript isoform (NM_166789.2) and the shortest transcript isoform
(NM_001014694.2).
2. Compare with other isoforms, NM_001014694.2 is missing two exons. Move the
mouse to the red lines indicating the range of exons to calculate the common
range of all transcript variants. In this case, the first exon range is 697673–697874,
the second exon range is 704621–705257. Calculate the length of each exon. Add
the lengths of exon 1 and exon 2 and get the number 873. Starting with exon 3, all
isoforms are sharing exons.
 3. Click on the hyperlink of the longest isoform ( isoform B NM_166789.2) and choose
“pick primers”. The forward primer range begins from 873.
Reference Assembly
4. Other settings are the same as the single isoform primer design except for
choosing “Allow splice variants”. Click on “Submit” and wait until you see a
warning.

5. The following warning is asking which variants you want to include together for this
primer. Choose the desired variants and click “Submit” again.
6. Wait until you see the result with 10 pairs of candidate primers.

7. Save the screenshot of the graphical view of primer pairs and copy the
primer pair 1 text to your word report. Be sure to indicate for which isoform
this primer was designed (Ey Variants ABCD in this case) .
Lab Exercise IV - Validation of Previously Designed Primers Provided by
Instructor

Methods
An eyeless transcript primer will be used as an example.
1.Pick your desired isoform, click on its NM hyperlink, and then click on “pick
primers”.
2. In the pick primers page, input the candidate forward
(TGGTAGGTCAATCAATCACCCAACC) and reverse primers (GCTGCTGTAGTGCCTGATGG)
for validation. Also, in “Exon junction span” choose “Primer must span an exon-exon
junction”.
3. If you see this warning, you can broaden the search by unchecking the
“Exon junction span” option and redoing the search.
4. You can read the result to see how this primer fits your template DNA. This result
also includes the products on potentially unintended templates. The fewer
unintended templates the more specific the primer is to your desired gene.

5. Save the screenshot of the

graphical view of primer pairs
and copy all the detailed
primer reports (all the
products on intended targets
or potentially unintended
templates) to the report.
Remember to evaluate this
primer and provide a
suggestion. Be sure to
indicate which primer was
evaluated and its origin.
Lab Exercise V - FlyPrimerBank Primer
Validation.

Material
Laptop
FlyPrimerBank (https://www.flyrnai.org/flyprimerbank)
NCBI Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi)
Methods
1.Download a pair of primers from FlyPrimerBank (
https://www.flyrnai.org/flyprimerbank).
Type in the” Enter gene identifiers/Primer IDs” box for ey gene.
2. Click on the search button. Suggested primers will be displayed in seconds.
Choose the first pair. Save the primer text in your report.
3. Validate the FlyPrimerBank primers by using NCBI Primer-BLAST
(“pick primers”). Leave the PCR template blank, copy-paste the primers
from the FlyPrimerBank result and choose the organism (Drosophila
melanogaster - taxid:7227). Submit and wait for the result. This is also a
simulation of the PCR experiment using a certain primer.

4. Save the screenshot of

the graphical view of primer
pairs and copy all the
detailed primer reports (all
the products on intended
targets or potentially
unintended templates) in
the report. Remember to
evaluate this primer and
provide a suggestion. Be
sure to indicate which
primer was evaluated
and its origin.
Assignment 7

1.Lab Exercise I: Design primers for Ebony, Vestigial genes. If the gene has multiple isoforms, design a
primer to fit all of them. Follow the Lab Exercise I method and save each result to the report.
Save the screenshot of the graphical view of primer pairs and copy the primer pair 1 text to your word
report. Be sure to indicate for which isoform this primer was designed.

2. Lab Exercise II: Do primer validation for each pair of primers given by your instructor.
Eyeless: CGGCTGTTAAATACTCAGCAC (Forward Primer; TGGGTGATTGACCTACCAAGG (Reverse Primer)
BarH1: GACTCGATGAGCATACTCACCC (Forward Primer); GACCGATTGGGCTTACCGAT (Reverse Primer)

Save the screenshot of the graphical view of primer pairs and copy all the detailed primer reports (all the
products on intended targets or potentially unintended templates) to the report. Remember to evaluate
this primer and provide a suggestion. Be sure to indicate which primer was evaluated and its
origin.

3. Lab Exercise III: Choose one pair of primer for Ebony, Vestigial genes from FlyPrimerBank and validate
it.

Save the screenshot of the graphical view of primer pairs and copy all the detailed primer reports (all the
products on intended targets or potentially unintended templates) in the report. Remember to evaluate this
primer and provide a suggestion. Be sure to indicate which primer was evaluated and its origin.
Types of PCR(To learn more)
RT-PCR,qPCR and RT-qPCR
It’s crucial to address the frequent misunderstanding that RT-PCR, qPCR, and RT-qPCR
are interchangeable. The similarities among these closely related techniques often lead
to incorrect usage of the acronyms. To prevent this, the Minimum Information for
Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines, first
published in 2009, proposed a standardization of abbreviations. They suggested that
‘RT-PCR’ should only be used to denote reverse transcription PCR, not real-time PCR, as
is often misunderstood.
Video: RT-PCR qPCR RT-qPCR
Two methods of detection in real-time PCR (qPCR): non-specific detection with double-stranded DNA-
binding dyes as reporters, and specific detection using fluorescent reporter probe method.
 Result of qPCR
Amplification plot

For both qPCR methods, data is visualized in an amplification plot, with the number of thermal
cycles on the x-axis, and the fluorescent signals detected on the y-axis.
As can be seen, fluorescence remains at background levels during the first thermal cycles.
Eventually, the fluorescent signal reaches the fluorescence threshold, where it is detectable over
the background fluorescence. The cycle number at which this happens is called the threshold cycle
(Ct). If the Ct value for a sample is high, it means that little starting material was present, and vice
versa. Please note that you should always analyze at least three replicates of each sample, as tiny
pipetting errors during qPCR set-up can result in huge differences in Ct values.
The Ct value is sometimes also referred to as crossing point (Cp), take-off point (TOP) or
quantification cycle (Cq) value, with MIQE guidelines suggesting using Cp value to standardize
RT-qPCR One step vs two step
Biotechnology and Society Module III:
Genome Editing Technology in the
Targeted Therapy of Human Diseases

Genome Editing, also called Gene Editing,

is an area of research seeking to modify
genes of living organisms to improve our
understanding of gene function and develop
ways to use it for disease treatment. Genome
editing can be used to correct, introduce, or
delete almost any DNA sequence in many
different types of cells and organisms. While
techniques to modify DNA have existed for
several decades, new methods have made
genome editing faster, cheaper, and more
efficient. Genome editing builds on an earlier
discovery that a broken section of DNA in a
gene triggers a cell’s repair mechanism to
mend the break. Genome editing allows
researchers to mimic this natural process of
DNA repair.
Advanced genome editing methods include Meganucleases, zinc-finger
nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), as well as
the newly developed clustered regularly interspaced short palindromic repeats, and
CRISPR-associated protein 9 (CRISPR/Cas9) methods.

Meganucleases:
https://www.youtube.com/watch?v=LV450LPTRDM

Zinc-finger nucleases (ZFNs):

https://www.youtube.com/watch?v=JArLDYv0Qw4

An Introduction to TALENs
https://www.youtube.com/watch?v=8mxtobkztbE

What is CRISPR?
https://www.youtube.com/watch?v=EPTeaXMVcyY
CRISPR/Cas9 is the most widely used genome editor and is a powerful tool for
understanding gene function. The CRISPR-Cas9 system is faster, cheaper, more accurate, and
more efficient than other genome editing methods. CRISPR-Cas9 was adapted from a
naturally occurring genome editing system that bacteria use as an immune defense. When
infected with viruses, bacteria capture small pieces of the viral DNA and insert them into
their own DNA in a particular pattern to create segments known as CRISPR arrays. The
CRISPR arrays allow the bacteria to "remember" the viruses (or closely related ones). If the
viruses infect the bacteria again, these produce RNA segments from the CRISPR arrays that
recognize and attach to specific regions of the viral DNA. The bacteria then use the Cas9
enzyme to cut the viral DNA and disable the virus.
Scientists adapted the bacterial immune defense
system to edit DNA. Scientists create a guide
RNA, a small piece of RNA with a short "guide"
sequence that attaches (binds) to a specific target
sequence in a cell's DNA, similar to the RNA
segments bacteria produce from the CRISPR array.
This guide RNA also attaches to the Cas9 enzyme.
When introduced in cells, the guide RNA recognizes
the targeted DNA sequence, and the Cas9 enzyme
cuts the DNA at the targeted location, mirroring
the process in bacteria. Once the DNA is cut,
researchers use the cell's own DNA repair
machinery to add or delete pieces of genetic
material, or to make changes to the DNA by
replacing an existing segment with a customized
DNA sequence.
The CRISPR-Cas9 system is being explored as a therapeutic strategy in research and
clinical trials for a wide variety of diseases, including single-gene disorders such as cystic
fibrosis, hemophilia, and sickle cell disease. It also holds promise for the treatment and
prevention of more complex diseases, such as cancer, heart disease, mental illness, and
human immunodeficiency virus (HIV) infection.

Gene Editing Inside the Body Using CRISPR

https://www.youtube.com/watch?v=EPTeaXMVcyY

Why gene editing is so controversial | The World

https://www.youtube.com/watch?v=u70je75CvcA

This Man Claims He Helped Make The World's First Genetically Edited Babies
(HBO)
https://www.youtube.com/watch?v=8afkgBE0OhY
Ethical concerns arise when genome editing, including technologies such as CRISPR-
Cas9, is used to alter human genomes. The National Institute of Health (NIH ) supports
human genome editing approaches in somatic cells and supported the
Somatic Cell Genome Editing Program. Somatic cells are not involved in human
reproduction. Therefore, gene editing is not passed from one generation to the next.
However, changes made to genes in egg or sperm cells or to the genes of an embryo
could be passed to future generations. Germline cell and embryo genome editing have
many ethical challenges, including whether it would be permissible to use this
technology to enhance normal human traits (such as height or intelligence). Owing to
ethical and safety concerns, germline cell and embryo genome editing are currently
illegal in the United States and many other countries.

CRISPR and other gene editing methods, especially ZFNs, are accelerating the
development of gene therapy approaches to treat many human conditions. In 2014, the
first clinical application of genome editing involved the use of ZFNs to make human
cells resistant to HIV-1 by disrupting a gene required for the virus to infect cells. C-C
Motif Chemokine Receptor 5 (CCR5) is an HIV-1 co-receptor required for viral entry. The
clinical trial comprised HIV-1 patients with autologous CD4+ T cells that had been
subject to a targeted CCR5 mutation using a designer ZFN gene editing system (Tebas
et al., 2014).
In 2017, a clinical trial testing ZFNs to
correct Hunter syndrome (MPS II) was
initiated. Hunter syndrome is a lysosome
storage disorder. Children with this condition
have an abnormal accumulation of complex
sugars in their cells, which affects many
systems in their bodies. Hunter syndrome is
caused by an X-linked recessive gene, the
iduronate 2-sulfatase (IDS) gene, which is
responsible for producing the lysosomal
enzyme, I2S. I2S helps break down complex
sugars called glycosaminoglycans (GAGs).
Genetic mutations in the IDS gene result in a
deficiency or a complete absence of I2S,
which results in an abnormal accumulation of
GAGs in the patient’s cells.Hunter syndrome
can cause abnormalities in the skeleton,
heart, and respiratory system in children.

The clinical trial was the first genome editing

approach administered directly to research
participants. The ZFN system was used to
insert the correct copy of the human IDS
 In 2017, Chimeric antigen
receptor T cells (CAR-T )
immunotherapy was approved
by the FDA to treat blood
cancers. The immune system is
highly regulated to avoid
attacking healthy cells. T cell
programmed cell death protein
1 (PD-1) receptor encounters the
programmed death-ligand 1(PD-
L1) molecule on another cell and
recognizes the cell as a “safe”
cell and does not attack that
cell. Cancer cells express a
significant amount of PD-L1 to
prevent T-cell attacks.

*Students will use the material in the “Biotechnology For the CAR_T treatment,
and Society” modules to complete the “Biotechniques scientists harvest T cells from a
Reflection Assignment” for this course. patient’s blood and use CRISPR
to mutate the PD-1 receptor