0% found this document useful (0 votes)
82 views12 pages

Basic Definitions: Indexed Collections and Random Functions: 1.1 So, What Is A Stochastic Process?

- The document defines and provides examples of stochastic processes, which can be thought of as either indexed collections of random variables or as random functions. - A stochastic process is a collection of random variables indexed by a set T that takes values in a common measure space. Alternatively, it can be defined as a random function whose sample paths lie in a set of functions U. - Examples include random variables, random vectors, discrete and continuous-time random sequences, random fields, random set functions, and empirical distributions.

Uploaded by

Michael Hall
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
82 views12 pages

Basic Definitions: Indexed Collections and Random Functions: 1.1 So, What Is A Stochastic Process?

- The document defines and provides examples of stochastic processes, which can be thought of as either indexed collections of random variables or as random functions. - A stochastic process is a collection of random variables indexed by a set T that takes values in a common measure space. Alternatively, it can be defined as a random function whose sample paths lie in a set of functions U. - Examples include random variables, random vectors, discrete and continuous-time random sequences, random fields, random set functions, and empirical distributions.

Uploaded by

Michael Hall
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 12

Chapter 1

Basic Definitions: Indexed


Collections and Random
Functions
Section 1.1 introduces stochastic processes as indexed collections
of random variables.
Section 1.2 builds the necessary machinery to consider random
functions, especially the product -field and the notion of sample
paths, and then re-defines stochastic processes as random functions
whose sample paths lie in nice sets.
This first chapter begins at the beginning, by defining stochastic processes.
Even if you have seen this definition before, it will be useful to review it.
We will flip back and forth between two ways of thinking about stochastic
processes: as indexed collections of random variables, and as random functions.
As always, assume we have a nice base probability space (, F, P ), which is
rich enough that all the random variables we need exist.

1.1

So, What Is a Stochastic Process?

Definition 1 (A Stochastic Process Is a Collection of Random Variables) A stochastic process {Xt }tT is a collection of random variables Xt ,
taking values in a common measure space (, X ), indexed by a set T .

That is, for each t T , Xt () is an F/X -measurable function from to ,


which induces a probability measure on in the usual way.
Its sometimes more convenient to write X(t) in place of Xt . Also, when
S T , Xs or X(S) refers to that sub-collection of random variables.
Example 2 (Random variables) Any single random variable is a (trivial)
stochastic process. (Take T = {1}, say.)
3

CHAPTER 1. BASICS

Example 3 (Random vector) Let T = {1, 2, . . . k} and = R. Then {Xt }tT


is a random vector in Rk .
Example 4 (One-sided random sequences) Let T = {1, 2, . . .} and be
some finite set (or R or C or Rk . . . ). Then {Xt }tT is a one-sided discrete
(real, complex, vector-valued, . . . ) random sequence. Most of the stochastic processes you have encountered are probably of this sort: Markov chains,
discrete-parameter martingales, etc. Figures 1.2, 1.3, 1.4 and 1.5 illustrate
some one-sided random sequences.
Example 5 (Two-sided random sequences) Let T = Z and be as in
Example 4. Then {Xt }tT is a two-sided random sequence.
Example 6 (Spatially-discrete random fields) Let T = Zd and be as in
Example 4. Then {Xt }tT is a d-dimensional spatially-discrete random field.
Example 7 (Continuous-time random processes) Let T = R and = R.
Then {Xt }tT is a real-valued, continuous-time random process (or random motion or random signal). Figures 1.6 and 1.7 illustrate some of the possibilities.
Vector-valued processes are an obvious generalization.
Example 8 (Random set functions) Let T = B, the Borel field on the reals,
+
and = R , the non-negative extended reals. Then {Xt }tT is a random set
function on the reals.
The definition of random set functions on Rd is entirely parallel. Notice that
if we want not just a set function, but a measure or a probability measure,
this will imply various forms of dependence among the random variables in the
collection, e.g., a measure must respect countable additivity over disjoint sets.
We will return to this topic in the next section.
Example 9 (One-sided random sequences of set functions) Let T =
+
B N and = R . Then {Xt }tT is a one-sided random sequence of set
functions.
Example 10 (Empirical distributions) Suppose Zi , = 1, 2, . . . are independent, identically-distributed real-valued random variables. (We can see from Example 4 that this is a one-sided real-valued random sequence.) For each Borel
set B and each n, define
n

1!
Pn (B) =
1B (Zi )
n i=1

CHAPTER 1. BASICS

i.e., the fraction of the samples up to time n which fall into that set. This is
the empirical measure. Pn (B) is a one-sided random sequence of set functions
in fact, of probability measures. We would like to be able to say something
about how it behaves. It would be very reassuring, for instance, to be able to
show that it converges to the common distribution of the Zi (Figure 1.8).

1.2

Random Functions

X(t, ) has two arguments, t and . For each fixed value of t, Xt () is straightforward random variable. For each fixed value of , however, X(t) is a function
from T to a random function. The advantage of the random function
perspective is that it lets us consider the realizations of stochastic processes as
single objects, rather than large collections. This isnt just tidier; we will need
to talk about relations among the variables in the collection or their realizations, rather than just properties of individual variables, and this will help us
do so. In Example 10, its important that weve got random probability measures, rather than just random set functions, so we need to require that, e.g.,
Pn (A B) = Pn (A) + Pn (B) when A and B are disjoint Borel sets, and this is
a relationship among the three random variables Pn (A), Pn (B) and Pn (A B).
Plainly, working out all the dependencies involved here is going to get rather
tedious, so wed like a way to talk about acceptable realizations of the whole
stochastic process. This is what the random functions notion will let us do.
Well make this more precise by defining a random function as a functionvalued random variable. To do this, we need a measure space of functions, and
a measurable mapping from (, F, P ) to that function space. To get a measure
space, we need a carrier set and a -field on it. The natural set to use is T ,
the set of all functions from T to . (Well see how to restrict this to just the
functions we want presently.) Now, how about the -field?
Definition 11 (Cylinder Set) Given an index set T and a collection of fields
Xt on spaces t , t T . Pick any t T and any At Xt . Then At
"

s"=t s is a one-dimensional cylinder set.

For any finite k, kdimensional cylinder sets are defined similarly, and
clearly are the intersections of k different one-dimensional cylinder sets. To
see why they have this name, notice a cylinder, in Euclidean geometry, consists of all the points where the x and y coordinates fall into a certain set
(the base),
" leaving the z coordinate unconstrained. Similarly, a cylinder set
like At s"=t s consists of all the functions in T where f (t) At , and are
otherwise unconstrained.
Definition 12 (Product -field) The product -field, tT Xt , is the -field
over T generated by all the one-dimensional cylinder sets. If all the Xt are the
same, X , we write the product -field as X T .

CHAPTER 1. BASICS

The product -field is enough to let us define a random function, and is


going to prove to be almost enough for all our purposes.
Definition 13 (Random Function; Sample Path) A -valued random function on T is a map X : ' T which is F/X T -measurable. The realizations
of X are functions x(t) taking values in , called its sample paths.
N.B., it has become common to apply the term sample path or even just
path even in situations where the geometric analogy it suggests may be somewhat misleading. For instance, for the empirical distributions of Example 10,
the sample path is the measure Pn , not the curves shown in Figure 1.8.
Definition 14 (Functional of the Sample Path) Let E, E be a measurespace. A functional of the sample path is a mapping f : T ' E which is
X T /E-measurable.
Examples of useful and common functionals include maxima, minima, sample averages, etc. Notice that none of these are functions of any one random
variable, and in fact their value cannot be determined from any part of the
sample path smaller than the whole thing.
Definition 15 (Projection Operator, Coordinate Map) A projection operator or coordinate map t is a map from T to such that t X = X(t).
The projection operators are a convenient device for recovering the individual coordinates the random variables in the collection from the random
function. Obviously, as t ranges over T , t X gives us a collection of random variables, i.e., a stochastic process in the sense of our first definition. The following
lemma lets us go back and forth between the collection-of-variables, coordinate
view, and the entire-function, sample-path view.
Theorem 16 (Product -field-measurability is equvialent to measurability of all coordinates) X is F/ tT Xt -measurable iff t X is F/Xt measurable for every t.
Proof: This follows from the fact that the one-dimensional cylinder sets
generate the product -field. !
We have said before that we will want to constrain our stochastic processes
to have certain properties to be probability measures, rather than just set
functions, or to be continuous, or twice differentiable, etc. Write the set of all
such functions in T as U . Notice that U does not have to be an element of the
product -field, and in general is not. (We will consider some of the reasons for
this later.) As usual, by U X T we will mean the collection of all sets of the
form U C, where C X T . Notice that (U, U X T ) is a measure space. What
we want is to ensure that the sample path of our random function lies in U .
Definition 17 (A Stochastic Process Is a Random Function) A -valued
stochastic process on T with paths in U , U T , is a random function X : '
U which is F/U X T -measurable.

CHAPTER 1. BASICS

Figure 1.1: Examples of point processes. The top row shows the dates of appearances of 44 genres of English novels (data taken from Moretti (2005)). The
bottom two rows show independent realizations of a Poisson process with the
same mean time between arrivals as the actual history. The number of tickmarks falling within any measurable set on the horizontal axis determines an
integer-valued set function, in fact a measure.
Corollary 18 (Measurability of constrained sample paths) A function
X from to U is F/U X T -measurable iff Xt is F/X -measurable for all t.
Proof: Because X() U , X() is F/U X T iff it is F/X T -measurable.
Then apply Theorem 16. !
Example 19 (Random Measures) Let T = B d , the Borel field on Rd , and let
+
= R , the non-negative extended reals. Then T is the class of set functions
on Rd . Let M be the class of such set functions which are also measures (i.e.,
which are countably additive and give zero on the null set). Then a random set
function X with realizations in M is a random measure.
Example 20 (Point Processes) Let X be a random measure, as in the previous example. If X(B) is a finite integer for every bounded Borel set B, then X
is a point process. If in addition X(r) 1 for every r Rd , then X is simple.
The Poisson process is a simple point process. See Figure 1.1.

CHAPTER 1. BASICS

Example 21 (Continuous random processes) Let T = R+ , = Rd , and


C(T ) the class of continuous functions from T to (in the usual topology). Then
a -valued random process on T with paths in C(T ) is a continuous random
process. The Wiener process, or Brownian motion, is an example. We will see
that most sample paths in C(T ) are not differentiable.

1.3

Exercises

Exercise
# 1.1 (The product -field answers countable questions) Let
D = S X S , where the union ranges over all countable subsets S of the index
set T . For any event D D, whether or not a sample path x D depends on
the value of xt at only a countable number of indices t.
(a) Show that D is a -field.
(b) Show that if A X T , then A X S for some countable subset S of T .

CHAPTER 1. BASICS

AATGAAATAAAAAAAAACGAAAATAAAAAA
AAGGCCATTAAAGTTAAAATAATGAAAGGA
CAATGATTAGGACAATAACATACAAGTTAT
GGGGTTAATTAATGGTTAGGATGGGTTTTT
CCTTCAAAGTTAATGAAAAGTTAAAATTTA
TAAGTATTTGAAGCACAGCAACAACTAGGT
Figure 1.2: Examples of one-sided random sequences ( = {A, C, G, T}). The
top line shows the first thirty bases of the first chromosome of the cellular
slime mold Dictyostelium discoideum (Eichinger et al., 2005), downloaded from
dictybase.org. The lower lines are independent samples from a simple Markov
model fitted to the full chromosome.

111111111111110110011011000001
011110110111111011110110110110
011110001101101111111111110000
011011011011111101111000111100
011011111101101100001111110111
000111111111111001101100011011
Figure 1.3: Examples of one-sided random sequences. These binary sequences
( = {0, 1}) are the first thirty steps from samples of a sofic process, one with
a finite number of underlying states which is nonetheless not a Markov chain
of any finite order. Can you figure out the rule specifying which sequences are
allowed and which are forbidden? (Hint: these are all samples from the even
process.)

10

CHAPTER 1. BASICS

10

20

30

40

50

Figure 1.4: Examples of one-sided random sequences. These are linear Gaussian
random sequences, Xt+1 = 0.8Xt + Zt+1 , where the Zt are all i.i.d. N (0, 1), and
X1 = Z0 . Different shapes of dots represent different independent samples of
this autoregressive process. (The line segements are simply guides to the eye.)
This is a Markov sequence, but one with a continuous state-space.

11

1.0

CHAPTER 1. BASICS

0.8

0.6

0.4

0.2

0.0

10

20

30

40

50

Figure 1.5: Nonlinear, non-Gaussian random sequences. Here X1 U (0, 1), i.e.,
uniformly distributed on the unit interval, and Xt+1 = 4Xt (1Xt ). Notice that
while the two samples begin very close together, they rapidly separate; after a
few time-steps their locations are, in fact, effectively independent. We will study
both this approach to independence, known as mixing, and this example, known
as the logistic map, in some detail.

12

0
2

CHAPTER 1. BASICS

0.0

0.2

0.4

0.6

0.8

1.0

Figure 1.6: Continuous-time random processes. Shown are three samples from
the standard Wiener process, also known as Brownian motion, a Gaussian process with independent increments and continuous trajectories. This is a central
part of the course, and actually what forced probability to be re-defined in terms
of measure theory.

13

CHAPTER 1. BASICS

0.0

0.2

0.4

0.6

0.8

1.0

Figure 1.7: Continuous-time random processes can have discontinuous trajectories. Here Xt = Wt +Jt , where Wt is a standard Wiener process, and Jt is piecewise constant (shown by the dashed lines), changing at t = 0.1, 0.2, 0.3, . . . 1.0.
The trajectory is discontinuous at t = 0.4, but continuous from the right there,
and there is a limit from the left. In fact, at every point the trajectory is continuous from the right and has a limit from the left. We will see many such
cadlag processeses.

14

1.0

1.0

CHAPTER 1. BASICS

0.8

0.8

0.6

Fn(x)

0.4

0.6

0.4

Fn(x)

0.2

0.2

0.0

0.0

0.6
0.4
0.0

0.2

Fn(x)

0.8

1.0

20

10

10

12

15

25

Figure 1.8: Empirical cumulative distribution functions for successively larger


samples from the standard log-normal distribution (from left to right, n =
10, 100, 1000), with the theoretical CDF as the smooth dashed line. Because
the intervals of the form (, a] are a generating class for the Borel -field, the
empirical C.D.F. suffices to represent the empirical distribution.

You might also like