(Paula Meleady (Eds.) ) Heterologous Protein Produc (B-Ok - CC)
(Paula Meleady (Eds.) ) Heterologous Protein Produc (B-Ok - CC)
Heterologous
Protein
Production
in CHO Cells
Methods and Protocols
Methods in Molecular Biology
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
Edited by
Paula Meleady
National Institute for Cellular Biotechnology, Dublin City University, Dublin, Ireland
Editor
Paula Meleady
National Institute for Cellular Biotechnology
Dublin City University
Dublin, Ireland
Cover Illustration: The front cover image, kindly provided by Alan Costello (National Institute for Cellular Biotechnology,
Dublin City University), shows Chinese hamster ovary (CHO) cells with inducible green fluorescent protein (GFP)
expression (from Chapter 6).
Since their introduction into the market over 20 years ago, biotherapeutics have consti-
tuted a large and growing percentage of the total pharmaceutical market, as well as approxi-
mately 25% of the R&D pipeline in industry. These biotherapeutics are having a huge
global impact on the treatment of challenging and previously untreatable chronic disease.
Currently biopharmaceuticals generate global revenues of $163 billion, making up about
20% of the pharma market, and predicted to grow to over $320 billion by 2020. The num-
ber of approved products in Europe and the USA has steadily increased to 2016 in 2014,
of which 37 have “blockbuster” status, i.e., sales over $1 billion per year, with monoclonal
antibodies (Mabs) representing the most lucrative single product class [1]. Most signifi-
cantly, nearly 50% of these biopharmaceutical products are produced in a single production
host, i.e., Chinese hamster ovary (CHO) cells. Improving the efficiency of production of
these biologics will be critical in controlling costs to healthcare systems as more of these
drugs come to market.
There has been considerable success in developing high-producing CHO cell culture
processes using approaches such as optimization of media formulation, improvements in
expression vector design, and also improvements in the design of bioreactors. The next
generation of improvements is expected to be made via genetic engineering of the host
(CHO) cell itself to increase or decrease the expression of endogenous genes depending on
the desired outcome, in order to improve the efficiency of the production of therapeutic
protein product. In order to enhance the production capabilities and efficiency of the host
cell line, an increased understanding of cellular physiology of CHO cells is of critical impor-
tance. There are substantial research efforts in progress focusing on the ‘omic analysis and
systems biology of CHO cells to understand CHO cell physiology. The publication of the
draft CHO-K1 genome in 2011 represented a major milestone in CHO systems biology.
This information has been supplemented further with the publication of draft genomes for
Chinese hamster and the CHO-S, CHO DG44 and CHO DXB11 cell lines. Availability of
the genome sequence will facilitate the interpretation and analysis of transcriptomic and
proteomic data to assess the physiological state of the cells under different growth and pro-
duction systems. Combining all levels of regulation through systems biology models will
unveil the underlying complexity inherent in CHO cell biology and will ultimately enhance
and accelerate CHO productive capabilities in the coming decades.
This book includes reviews and protocols for genetic manipulation of CHO cells for
recombinant protein production, including “difficult-to-express” therapeutics. A method is
also included on the use of the recently described genome editing tool, CRISPR/Cas9, and
how this can be applied to CHO cells. The book also includes a review and protocols for
characterization of CHO cells using ‘omic approaches and how these methods can be used
to improve efficiency of recombinant protein production during cell line development.
Analytical methods for characterization of recombinant protein product, such as glycosyl-
ation and host cell protein analysis, are also described in this book.
v
vi Preface
I am deeply grateful to all authors for giving up their valuable time and for contributing
to the book. I would also like to thank the series editor, Prof. John Walker, for help and
guidance during the process of getting the book to publication.
Reference
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
vii
viii Contents
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
Contributors
ix
x Contributors
Abstract
Despite substantial advances in the field of mammalian expression, there are still proteins that are characterized
as difficult to express. Determining the expression bottleneck requires troubleshooting techniques specific
for the given molecule and host. The complex array of intracellular processes involved in protein expres-
sion includes transcription, protein folding, post-translation processing, and secretion. Challenges in any
of these steps could result in low protein expression, while the inherent properties of the molecule itself
may limit its production via mechanisms such as cytotoxicity or inherent instability. Strategies to identify
the rate-limiting step and subsequently improve expression and production are discussed here.
Key words Productivity, Difficult to express, Vector design, Cell engineering, Process optimization
1 Introduction
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_1, © Springer Science+Business Media LLC 2017
1
2 Christina S. Alves and Terrence M. Dobrowsky
2 Strategy and Methods
DNA
Transcripon
NUCLEUS
RNA
CYTOPLASM Secreon
Translaon
Protein
Protein Folding
Post-
Translaonal
Modificaon
Fig. 1 Summary of protein synthesis. RNA is transcribed in the nucleus and then transported to the cytoplasm
and translated by the ribosomes. The proteins become bound to the rough ER, where they undergo folding and
processing before moving to the golgi. Soluble proteins undergo post-translational modifications and are sub-
sequently processed through the secretory pathway
Table 1
Methods for targeted integration
2.3 Transcription Traditionally, transcription has been considered the dominant fac-
tor in controlling protein production.
In a particular study to elucidate the mechanisms and processes-
limiting gene expression in CHO cells, transcription appeared to
be the primary limitation for low- and medium-producing cell
lines, whereas in high-producing cell lines post-translational limita-
tions tended to dominate [6]. Within the process of transcription
the rate-limiting step is likely to be initiation. Due to the highly
condensed nature of DNA into chromatin structures, transcription
complexes often have trouble accessing certain regions of
DNA. Chromatin remodeling, the rearrangement of chromatin
structure by various remodeling complexes, is therefore required
for activation of transcription. Additionally, chromatin as well as
other proteins involved in transcriptional control can be altered by
methylation, acetylation, phosphorylation, and other modifica-
tions to affect whether a gene is active or inactive [24]. The syner-
gistic effect of these modifications, known as the “histone code,”
adds complexity in the form of epigenetic regulation of genes.
Specific methods to affect these features are detailed here.
Unstable protein expression has been observed in CHO cells
where mRNA decreases despite constant transgene copy numbers
[11], which suggests that either the mRNA is degrading or that the
promoter is being silenced. The expression level of mRNA tran-
script for the gene of interest can be determined by quantitative
real-time reverse transcription-PCR (qRT-PCR). There have been
mixed results on the correlation between productivity of a cell line
6 Christina S. Alves and Terrence M. Dobrowsky
and mRNA levels in CHO cells. Some studies showing that high
mRNA levels and gene copy numbers in methotrexate amplified
cells correspond to high specific productivities [4], whereas others
have seen no correlation between mRNA levels and expression
[25]. Despite these conflicting reports, it may still be valuable to
assess mRNA levels of the protein of interest to ensure that the
sequence of interest is being adequately transcribed. Additionally, in
the case of antibodies, using qPCR to determine mRNA levels can
be a useful diagnostic tool for determining the ratio of heavy to
light chain which may be important to ensure assembly of the mAb.
Studies have indicated that it is advantageous to have an excess of
light chain in relation to the heavy chain for optimal antibody pro-
duction [26, 27]. The ratio of heavy to light chain can be influ-
enced by optimizing the quantities of DNA transfected or by the
vector design. If a two-plasmid system is utilized, where the heavy
and light chains are located on different vectors, the mixture of
DNA used at the point of transfection can be used to modulate the
ratio. Alternatively, one can use a single-plasmid system that employs
IRES-mediated bi- or tri-cistronic vectors that enable control of
heavy to light chain expression at different ratios.
2.3.1 Methylation DNA methylation has been reported to repress gene expression,
whereas hypomethylation of DNA in the promoter region can ele-
vate gene transcription activity [28, 29]. Enzymatic methylation of
cytosine at carbon 5 is well known as a fundamental epigenetic
mechanism that results in gene silencing [30]. DNA methylation
often occurs at CpG dinucleotides sites within promoter regions
which subsequently renders the promoter transcriptionally inactive.
Bisulfite treatment of DNA can be used to differentiate between
methylated and unmethylated CpG sites. In this method, sodium
bisulfite converts cytosine residues to uracil residues via deamination
at C4, while 5-methylcytosine remains unaffected [31]. Subsequent
amplification of the region by PCR allows for further analysis via
DNA sequencing [31] or microarray analysis [32]. Methylation-
specific real-time qPCR is a highly sensitive measurement of pro-
moter methylation and has been utilized to correlate hCMV-IE
methylation with unstable protein expression in recombinant CHO
cell lines [28]. Chemical compounds exist that can affect the degree
of DNA methylation, specifically a class of molecules known as DNA
methyltransferase inhibitors (iDNMTs). These compounds, which
include azacytidine, RG-108, and hydralazine, have been tested in
CHO cells for their capacity to increase cellular productivity in tran-
sient gene expression systems with some success [33].
2.3.3 Vector Design The design of vectors to promote active transcription by creating a
Elements favorable chromatin environment around the transgene has been
extensively reviewed [39]. The available methods either alter the epi-
genetic environment of the DNA surrounding the transgene or pre-
vent the surrounding environment from affecting transcription of the
gene of interest [39]. A list of vector design elements for CHO cells
is shown in Table 2. In order to enhance gene transcription and
reduce transgene expression dependence on the surrounding chro-
matin, strong cellular enhancers such as the Locus Control Region
(LCR) have been utilized [40]. The LCR is a cis-acting DNA ele-
ment that controls the expression of human β-globin locus genes.
Unfortunately, these enhancers only function in certain cell lines and
cannot be used as general regulatory elements in all mammalian cells.
Table 2
Vector design elements to enhance transcription
2.4.1 Codon Optimization Because it is often the case that human proteins are being express-
ing in CHO cells and synonymous codons are used with different
frequencies in different organisms (known as codon bias) [51], it is
important to ensure that the transgene sequence is optimized. By
optimizing the DNA sequences for expression in CHO cells, one
can ensure that certain preferred codons are translated more accu-
rately and/or efficiently. Poorly optimized sequences can adversely
affect protein translation, and subsequently protein expression, by
preventing the host from efficiently translating the rare codons.
Codon optimization has been used to increase protein expression
in multiple studies [52, 53] and there are several websites and ser-
vices that will perform codon optimization for expression in CHO
cells of a given amino acid sequence. A list of codon usage for
CHO cells is shown in Table 3.
Another important consideration is the translation initiation
sequence located upstream of the start codon (AUG). The efficient
consensus sequence GCCACC(AUG)G, known as the Kozak
sequence [54], yields high fidelity and efficiency of initiation and is
typically used at the start of the coding sequence.
2.4.2 Splice Sites Splice sites are located between an exon and an intron. The splice
site upstream of an intron is referred to as the donor splice site
(5′–3′ direction), while the one downstream of an intron is
the acceptor splice site (3′–5′ direction). The acceptor splice site
corresponds to the end of an intron (AG) and the donor splice site
corresponds to the beginning of an intron (GT). Splice sites can
10 Christina S. Alves and Terrence M. Dobrowsky
Table 3
Codon usage in Chinese hamster genes
Table 4
Programs available to identify potential splice sites in a DNA sequence
2.5 Protein Folding Proper protein folding is essential for adequate expression of a
and Processing molecule. The ER is responsible for ensuring that proteins are
properly processed and folded and as such there are specific quality
control systems to aid in the efficiency of folding and eliminate
misfolded proteins. When a protein is misfolded in the ER it is
proteolytically destroyed via the ER-associated degradation
(ERAD) pathway. Similarly, the unfolded protein response (UPR),
a signal cascade that protects cells from aggregated protein by
restoring ER function, can be triggered by intracellular accumula-
tion of misfolded protein. Several chaperones and cofactors are
involved in the process of protein folding and assembly and can be
modulated to enhance protein expression.
2.5.1 Chaperones Molecular chaperones are proteins that assist the folding and assem-
bly of intracellular proteins which may be good targets for cellular
engineering to improve protein expression. Heat shock proteins
(HSPs) function as molecular chaperones and are primarily respon-
sible for protein folding, assembly, translocation, and degradation
under cellular stress. Chaperones also prevent newly synthesized
polypeptide chains from aggregating into defective proteins. BiP is
a HSP70 molecular chaperone that binds newly synthesized pro-
teins as they are translocated into the ER, and preserves them in a
state suitable for subsequent folding. Protein disulfide isomerase
(PDI) is an enzyme in the ER that catalyzes the formation and
breakage of disulfide bonds to assist in protein folding [55].
Cyclophilin B (CypB) interacts with other proteins in the ER
including BIP and PDI to form chaperone complexes that facilitate
protein folding. Some work has been done on expressing molecular
12 Christina S. Alves and Terrence M. Dobrowsky
Table 5
Websites that offer free signal peptide prediction algorithms
SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP/)
PrediSi: Prediction of Signal peptides (http://www.predisi.de/)
Signal-BLAST Signal Peptide Prediction (http://sigpep.services.came.
sbg.ac.at/signalblast.html)
2.7 Protein Toxicity Another mechanism that leads to insufficient protein production is
the inherent toxicity of the protein being expressed. Limiting cel-
lular exposure to high concentrations of the protein or adapting
cell lines specifically to be resistant to the toxic protein can improve
growth and subsequently yield. Toxicity of the protein of interest
may diminish a cell’s ability to recover after transfection and selec-
tion. Ultimately, this toxicity will result in the unintentional selec-
tion of low-producing cells from the population. A dose-response
Optimizing ‘Difficult to Express’ Proteins 15
study with purified protein and host cells is often the most direct
determination of cytotoxicity, wherein the toxicity of the purified
protein and buffer to the naive culture is assessed. If the quantity
of purified protein is limiting, similar results can be confirmed by a
less ideal but easy-to-execute experiment utilizing spent media
from a transient transfection. Clarified culture supernatant from a
transiently transfected culture will likely contain a toxic level of
protein but sufficient unprocessed metabolites for continued
growth. Performing a dose-response study using this supernatant
incrementally blended with fresh media may yield similar results to
dosing purified protein. However, toxicity will be confounded
with other supernatant components such as metabolic waste prod-
ucts and the highest concentration available for testing will be
limited.
Protein toxicity can be mitigated by multiple methods. One
approach, likely the most extreme, is to alter the protein itself to
reduce its cytotoxicity. Modifying the protein to produce a more
stable, less toxic form while retaining its intended biological func-
tion can be difficult but possible with extensive knowledge of the
structure function relationship [79]. Introducing stabilizing agents
that can be degraded later can be effective as long as a more com-
plicated downstream purification process is acceptable. N-terminal
tags such as a small ubiquitin-like modifier (SUMO) can be used to
create “dormant fusion” proteins with decreased toxicity that are
capable of being cleaved downstream [80]. An alternative option is
to modify the promoter in the transfected vector rather than the
protein of interest. When the optimum environment for cell
growth varies significantly from that of protein production, an
inducible expression system may be appropriate. An inducible
expression system can enable high cell densities to be achieved
prior to protein production and subsequently alleviate the effects
of toxicity or degradation [81]. Inducible promoter systems are
commercially available [82] for direct implementation. In general,
it can be difficult to ensure that transgene expression is entirely
inhibited prior to the addition of the inducing agent [83].
Therefore, most industrially relevant systems utilize promotor-
transactivator combinations. In these systems, the activity of a con-
stitutively expressed transactivator is controlled via supplementation
of some complementary ligand [84]. The tetracycline (Tet) induc-
ible system, often referred to as Tet-on, allows for the expression of
the protein of interest in the presence of tetracycline. Alternatively,
protein expression could be repressed in the presence of tetracy-
cline, the Tet-off system, and activated by complete media
exchange. The Tet-on system is often preferred for recombinant
protein production as it is relatively straightforward to supplement
culture with tetracycline while removing it would require signifi-
cant liquid handling at scale [85, 86]. Other applications for induc-
ible systems include increasing specific productivity by arresting
16 Christina S. Alves and Terrence M. Dobrowsky
2.8 Protein-Cell In addition to a protein’s ability to limit cell culture growth, the
Adhesion cell culture may limit the availability or stability of protein in the
and Consumption supernatant. Adhesion to lipid head groups or lipoproteins in the
cell membrane can accelerate protein degradation and reabsorp-
tion into the producing cells themselves. One example of such pro-
tein loss is the generation of recombinant Factor VIII (rFVIII)
[93]. Here, 90% of the secreted rFVIII in serum-free conditions
were determined to be bound to cells. This effect was limited by
supplementing culture with a complimentary protein, von
Willibrand Factor (vWF) capable of competitive inhibition [93].
Co-expressing vWF, rather than supplementation, was also found
to have a stabilizing effect [94]. Co-expression of a complex pro-
tein antagonist is not typically the most efficient mitigation strat-
egy and can complicate cell line selection. Chemical inhibition may
be possible and substantially easier to implement. In this current
example, rFVIII can be prevented from binding to host cell culture
by supplementation of o-phospho-l-serine (OPLS) [93, 95].
Implementation of these methods will require specific knowledge
Optimizing ‘Difficult to Express’ Proteins 17
of the protein being produced, its likely binding partners, and their
protein sequence or commercial availability.
2.9 Effects The bioprocess applied to protein expressing cultures will affect
of Bioprocessing the amount and quality of the product. Cell culture parameters
on Protein Expression known to have an effect on specific productivity include pCO2,
osmolality, temperature, dissolved oxygen, and pH [96, 97]. In
addition to specific productivity, the culture environment has been
shown to have a direct effect on post-transcriptional modifications
and impurity profiles [66]. The effect of certain parameters can be
cell line and protein specific which makes general recommenda-
tions difficult. Indeed, process settings can have alternate effects
depending on how other parameters are controlled. For example,
pH control can alter specific productivity of erythropoietin (EPO)
producing culture at one temperature differently than another
[98]. Because these process parameter sensitivities will often be cell
specific they are difficult to predict without in-depth experience
with the cell line of interest.
Defining a well-understood operating space for all process
parameters using Design of Experiment (DOE) methodologies is
recommended and may reveal configurations that allow for suffi-
cient protein expression [99, 100]. Alternatively, shifts in process
parameters during production to temporarily increase productivity
can be useful [101]. While this often results in decreased overall
cell mass, that in turn may be compensated for by maintaining high
process temperature during the growth phase of the culture. A net
increase in productivity with lower temperatures may be the result
of either increased specific productivity or decreased protein deg-
radation at reduced temperatures. Growth arrest and subsequent
increases in specific productivity can also be accomplished through
hyperosmolality or chemical treatment with agents such as sodium
butyrate or DMSO (as discussed earlier) [101, 102]. Addition of a
small molecule inhibitor of cyclin-dependent kinases (CDK) 4/6
mid-way through production can mediate G0/G1 growth arrest
without impacting G2/M phase. This resulted in sustained cell
mass and increased specific productivity without negatively impact-
ing product quality [103]. While improvements in specific produc-
tivity may be obtained through process condition shifts or media
supplementation, the medium formulation itself may be optimized
for a more consistent increase to protein production [104, 105].
Also, temporary increases to specific productivity will likely increase
product titer before cell death becomes a concern, it usually comes
at the expense of product quality such as increased heterogeneity,
decreased biological activity, altered acidic isoforms, and inconsis-
tent sialylated species [69]. Modifications to your bioprocess can
reduce protein loss by limiting these mechanisms. Adjusting your
medium formulation, operating parameters, or harvest procedure
can significantly increase your product yield [106].
18 Christina S. Alves and Terrence M. Dobrowsky
3 Summary
References
1. Ohya T, Hayashi T, Kiyama E et al (2008) 7. Hu Z, Guo D, Yip SSM et al (2013) Chinese
Improved production of recombinant human hamster ovary K1 host cell enables stable cell
antithrombin III in Chinese hamster ovary cells line development for antibody molecules which
by ATF4 overexpression. Biotechnol Bioeng are difficult to express in DUXB11- derived
100:317–324. doi:10.1002/bit.21758 dihydrofolate reductase deficient host cell.
2. Novo JB, Morganti L, Moro AM et al (2012) Biotechnol Prog 29:980–985. doi:10.1002/
Generation of a Chinese hamster ovary cell line btpr.1730
producing recombinant human glucocerebrosi- 8. Alves C, Gilbert A, Dalvi S et al (2015)
dase. J Biomed Biotechnol 2012:875383. Integration of cell line and process develop-
doi:10.1155/2012/875383 ment to overcome the challenge of a difficult
3. Le Fourn V, Girod P-A, Buceta M et al (2014) to express protein. Biotechnol Prog:1–11.
CHO cell engineering to prevent polypeptide doi:10.1002/btpr.2091
aggregation and improve therapeutic protein 9. Lattenmayer C, Trummer E, Schriebl K et al
secretion. Metab Eng 21:91–102. (2007) Characterisation of recombinant
doi:10.1016/j.ymben.2012.12.003 CHO cell lines by investigation of protein
4. Jiang Z, Huang Y, Sharfstein ST (2006) productivities and genetic parameters.
Regulation of recombinant monoclonal anti- J Biotechnol 128:716–725. doi:10.1016/j.
body production in chinese hamster ovary jbiotec.2006.12.016
cells: a comparative study of gene copy num- 10. Reisinger H, Steinfellner W, Stern B et al
ber, mRNA level, and protein expression. (2008) The absence of effect of gene copy
Biotechnol Prog 22:313–318 number and mRNA level on the amount of
5. Nishimiya D, Mano T, Miyadai K et al mAb secretion from mammalian cells. Appl
(2013) Overexpression of CHOP alone and Microbiol Biotechnol 81:701–710.
in combination with chaperones is effective doi:10.1007/s00253-008-1701-1
in improving antibody production in mam- 11. Chusainow J, Yang YS, Yeo JHM et al (2009)
malian cells. Appl Microbiol Biotechnol A study of monoclonal antibody-producing
97:2531–2539. doi:10.1007/s00253-012- CHO cell lines: what makes a stable high pro-
4365-9 ducer? Biotechnol Bioeng 102:1182–1196.
6. Mead EJ, Chiverton LM, Smales CM, von doi:10.1002/bit.22158
der Haar T (2009) Identification of the limi- 12. Hindson BJ, Ness KD, Masquelier D a., et al.
tations on recombinant gene expression in (2011) High-throughput droplet digital PCR
CHO cell lines with varying luciferase pro- system for absolute quantitation of DNA copy
duction rates. Biotechnol Bioeng 102:1593– number. Anal Chem 83:8604–8610. doi:
1602. doi:10.1002/bit.22201 10.1021/ac202028g
Optimizing ‘Difficult to Express’ Proteins 19
13. Huang Y, Li Y, Wang YG et al (2007) An effi- 25. Reinhart D, Sommeregger W, Debreczeny M
cient and targeted gene integration system for et al (2013) Characterization of recombinant
high-level antibody expression. J Immunol IgA producing CHO cell lines by qPCR. BMC
Methods 322:28–39. doi:10.1016/j.jim.2007. Proc 7:P114. doi:10.1186/1753-6561-7-S6-
01.022 P114
14. Wright C, Estes SD (2014) Pharmaceutical 26. Schlatter S, Stansfield SH, Dinnis DM et al
next-generation bioprocess: an industry per- (2005) On the Optimal Ratio of Heavy to
spective of how the ‘ omics era will affect Light Chain Genes for Efficient Recombinant
future biotherapeutic development. Pharm Antibody Production by CHO Cells.
Bioprocess 2:371–375 Biotechnol Prog 21:122–133
15. Büssow K (2015) Stable mammalian pro- 27. Ho SCL, Koh EYC, van Beers M et al (2013)
ducer cell lines for structural biology. Curr Control of IgG LC:HC ratio in stably trans-
Opin Struct Biol 32:81–90. doi:10.1016/j. fected CHO cells and study of the impact on
sbi.2015.03.002 expression, aggregation, glycosylation and con-
16. Turan S, Galla M, Ernst E et al (2011) formational stability. J Biotechnol 165:157–
Recombinase-mediated cassette exchange 166. doi:10.1016/j.jbiotec.2013.03.019
(RMCE): traditional concepts and current chal- 28. Osterlehner A, Simmeth S, Göpfert U (2011)
lenges. J Mol Biol 407:193–221. doi:10.1016/j. Promoter methylation and transgene copy
jmb.2011.01.004 numbers predict unstable protein production
17. Baser B, Spehr J, Büssow K, van den Heuvel in recombinant Chinese hamster ovary cell
J (2015) A method for specifically targeting lines. Biotechnol Bioeng 108:2670–2681.
two independent genomic integration sites doi:10.1002/bit.23216
for co-expression of genes in CHO cells. 29. Wippermann A, Rupp O, Brinkrolf K et al
Methods 95:3–12. doi:10.1016/j.ymeth. (2015) The DNA methylation landscape of
2015.11.022 Chinese hamster ovary (CHO) DP-12 cells.
18. Turan S, Zehe C, Kuehle J et al (2013) J Biotechnol 199:38–46. doi:10.1016/j.
Recombinase-mediated cassette exchange jbiotec.2015.02.014
(RMCE) - a rapidly-expanding toolbox for 30. De Carvalho DD, You JS, Jones PA (2011)
targeted genomic modifications. Gene 515:1– DNA methylation and cellular reprogram-
27. doi:10.1016/j.gene.2012.11.016 ming. Trends Cell Biol 20:609–617.
19. Inao T, Kawabe Y, Yamashiro T et al (2015) doi:10.1016/j.tcb.2010.08.003.DNA
Improved transgene integration into the 31. Clark SJ, Harrison J, Paul CL et al (1994)
Chinese hamster ovary cell genome using the High sensitivity mapping of methylated cyto-
Cre-loxP system. J Biosci Bioeng 120:99– sines. Nucleic Acids Res 22:2990–2997
106. doi:10.1016/j.jbiosc.2014.11.019 32. Adorján P, Distler J, Lipscher E et al (2002)
20. Kawabe Y, Shimomura T, Huang S et al Tumour class prediction and discovery by
(2016) Targeted transgene insertion into the microarray-based DNA methylation analysis.
CHO cell genome using Cre recombinase- Nucleic Acids Res 30:e21. doi:10.1016/
incorporating integrase-defective retroviral S0959-8049(01)80570-0
vectors. Biotechnol Bioeng:1600–1610. 33. Backliwal G, Hildinger M, Kuettel I et al (2008)
doi:10.1002/bit.25923 Valproic acid: a viable alternative to sodium
21. Sakuma T, Takenaga M, Kawabe Y et al butyrate for enhancing protein expression in
(2015) Homologous recombination- mammalian cell cultures. Biotechnol Bioeng
independent large gene cassette knock-in in 101:182–189. doi:10.1002/bit.21882
CHO cells using TALEN and MMEJ-directed 34. Kouzarides T (2000) Acetylation: a regula-
donor plasmids. Int J Mol Sci 16:23849– tory modification to rival phosphorylation?
23866. doi:10.3390/ijms161023849 EMBO J 19:1176–1179. doi:10.1093/
22. Bachu R, Bergareche I, Chasin L a. (2015) emboj/19.6.1176
CRISPR-Cas targeted plasmid integration 35. Jiang Z, Sharfstein ST (2008) Sodium butyr-
into mammalian cells via non-homologous ate stimulates monoclonal antibody over-
end joining. Biotechnol Bioeng 112:2154– expression in CHO cells by improving gene
2162. doi: 10.1002/bit.25629 accessibility. Biotechnol Bioeng 100:189–
23. Lee JS, Kallehauge TB, Pedersen LE, 194. doi:10.1002/bit.21726
Kildegaard HF (2015) Site-specific integration 36. Kyoung MIN (2007) Correlation between
in CHO cells mediated by CRISPR/Cas9 and enhancing effect of sodium butyrate on spe-
homology-directed DNA repair pathway. Sci cific productivity and mRNA transcription
Rep 5:8572. doi:10.1038/srep08572 level in recombinant chinese hamster ovary
24. Peterson CL, Laniel M (2004) Histones and cells producing antibody. J Microbiol
histone modifications. Curr Biol 14:546–551 Biotechnol 17:1036–1040
20 Christina S. Alves and Terrence M. Dobrowsky
37. Yang WC, Lu J, Nguyen NB et al (2014) nant CHOK1SV cell lines and their relation-
Addition of valproic acid to CHO cell fed-batch ship to enhanced productivity. Biochem
cultures improves monoclonal antibody titers. J 472:261–273. doi:10.1042/BJ20150928
Mol Biotechnol 56:421–428. doi:10.1007/ 49. Chong WPK, Sim LC, Wong KTK, Yap MGS
s12033-013-9725-x (2009) Enhanced IFN c production in
38. Kim NS, Lee GM (2002) Inhibition of adenosine-treated CHO cells: a mechanistic
sodium butyrate-induced apoptosis in recom- study. Biotechnol Prog 25:866–873.
binant Chinese hamster ovary cells by consti- doi:10.1021/bp.118
tutively expressing antisense RNA of 50. Dreesen IA, Fussenegger M (2011) Ectopic
caspase-3. Biotechnol Bioeng 78:217–228. expression of human mTOR increases viabil-
doi:10.1002/bit.10191 ity, robustness, cell size, proliferation, and
39. Barnes LM, Dickson AJ (2006) Mammalian antibody production of chinese hamster ovary
cell factories for efficient and stable protein cells. Biotechnol Bioeng 108:853–866.
expression. Curr Opin Biotechnol 17:381– doi:10.1002/bit.22990
386. doi:10.1016/j.copbio.2006.06.005 51. Gustafsson C, Govindarajan S, Minshull
40. Kwaks THJ, Otte AP (2006) Employing epi- J (2004) Codon bias and heterologous pro-
genetics to augment the expression of thera- tein expression. Trends Biotechnol 22:346–
peutic proteins in mammalian cells. Trends 353. doi:10.1016/j.tibtech.2004.04.006
Biotechnol 24:137–142. doi:10.1016/j. 52. Welch M, Villalobos a., Gustafsson C,
tibtech.2006.01.007 Minshull J (2009) You’re one in a googol:
41. Maksimenko O, Gasanov NB, Georgiev P, optimizing genes for protein expression. J R
Lines TPC (2015) Regulatory elements in vec- Soc Interface 6:S467–S476. doi: 10.1098/
tors for efficient generation of cell Lines produc- rsif.2008.0520.focus
ing target proteins. Acta Naturae 7:15–26 53. Chung BK-S, Yusufi FNK, Mariati, et al.
42. Harraghy N, Gaussin A, Mermod N (2008) (2013) Enhanced expression of codon opti-
Sustained transgene expression using MAR mized interferon gamma in CHO cells.
elements. Curr Gene Ther 8:353–366. J Biotechnol 167:326–333. doi: 10.1016/j.
doi:10.2174/156652308786071032 jbiotec.2013.07.011
43. Harraghy N, Buceta M, Regamey A et al 54. Kozak M (1991) Structural features in eukary-
(2012) Using matrix attachment regions to otic mRNAs that modulate the initiation of
improve recombinant protein production. translation. J Biol Chem 266:19867–19870
Methods Mol Biol 801:93–110. 55. Nishimiya D (2014) Proteins improving
doi:10.1007/978-1-61779-352-3_7 recombinant antibody production in mamma-
44. Betts Z, Croxford AS, Dickson AJ (2015) lian cells. Appl Microbiol Biotechnol 98:1031–
Evaluating the interaction between UCOE 1042. doi:10.1007/s00253-013-5427-3
and DHFR-linked amplification and stability 56. Pybus LP, Dean G, West NR et al (2013)
of recombinant protein expression. Biotechnol Model-directed engineering of “difficult-to-
Prog 31:1014–1025. doi:10.1002/btpr.2083 express” monoclonal antibody production by
45. Kwaks THJ, Barnett P, Hemrika W et al Chinese hamster ovary cells. Biotechnol
(2003) Identification of anti-repressor ele- Bioeng xxx:1–14. doi:10.1002/bit.25116
ments that confer high and stable protein pro- 57. Johari YB, Estes SD, Alves CS et al (2015)
duction in mammalian cells. Nat Biotechnol Integrated cell and process engineering for
21:553–558. doi:10.1038/nbt814 improved transient production of a
46. Otte AP, Kwaks THJ, Van Blokland RJM et al “difficult- to-
express” fusion protein by
(2007) Various expression-augmenting DNA CHO cells. Biotechnol Bioeng 112:2527–
elements benefit from STAR-select, a novel 2542. doi:10.1002/bit.25687
high stringency selection system for protein 58. Chollet ME, Skarpen E, Iversen N et al
expression. Biotechnol Prog 23:801–807. (2015) The chemical chaperone sodium
doi:10.1021/bp070107r 4-phenylbutyrate improves the secretion of
47. Mead EJJ, Smales CMM (2011) mRNA the protein CA267T mutant in CHO-K1 cells
translation and recombinant gene expression trough the GRASP55 pathway. Cell Biosci
from mammalian cell expression systems. 5:57. doi:10.1186/s13578-015-0048-4
Compr Biotechnol 1:403–409. doi:10.1016/ 59. De Almeida SF, Picarote G, Fleming JV et al
B978-0-08-088504-9.00043-X (2007) Chemical chaperones reduce endoplas-
48. Mead EJ, Masterton RJ, Feary M et al (2015) mic reticulum stress and prevent mutant HFE
Biological insights into the expression of aggregate formation. J Biol Chem 282:27905–
translation initiation factors from recombi- 27912. doi:10.1074/jbc.M702672200
Optimizing ‘Difficult to Express’ Proteins 21
60. Hwang S-J, Jeon C-J, Cho SM et al (2011) butyrate treatment. J Biotechnol 145:143–159.
Effect of chemical chaperone addition on pro- doi:10.1016/j.jbiotec.2009.09.008
duction and aggregation of recombinant flag- 71. Knappskog S, Ravneberg H, Gjerdrum C et al
tagged COMP-angiopoietin 1 in Chinese (2007) The level of synthesis and secretion of
hamster ovary cells. Biotechnol Prog 27:587– Gaussia princeps luciferase in transfected
591. doi:10.1002/btpr.579 CHO cells is heavily dependent on the choice
61. Liu C-H, Chen L-H (2007) Promotion of of signal peptide. J Biotechnol 128:705–715.
recombinant macrophage colony stimulating doi:10.1016/j.jbiotec.2006.11.026
factor production by dimethyl sulfoxide addi- 72. Hegde RS, Bernstein HD (2006) The surpris-
tion in Chinese hamster ovary cells. J Biosci ing complexity of signal sequences. Trends
Bioeng 103:45–49. doi:10.1263/jbb.103.45 Biochem Sci 31:563–571. doi:10.1016/j.
62. Liu C-H, Chen L-H (2007) Enhanced recom- tibs.2006.08.004
binant M-CSF production in CHO cells by 73. Kober L, Zehe C, Bode J (2013) Optimized
glycerol addition: model and validation. signal peptides for the development of high
Cytotechnology54:89–96.doi:10.1007/s10616- expressing CHO cell lines. Biotechnol Bioeng
007-9078-z 110:1164–1173. doi:10.1002/bit.24776
63. Chakravarthi S, Jessop CE, Bulleid NJ (2006) 74. Haryadi R, Ho S, Kok YJ et al (2015)
The role of glutathione in disulphide bond for- Optimization of heavy chain and light chain
mation and endoplasmic-reticulum-generated signal peptides for high level expression of
oxidative stress. EMBO Rep 7:271–275. therapeutic antibodies in CHO cells. PLoS
doi:10.1038/sj.embor.7400645 One 10:e0116878. doi:10.1371/journal.
64. Jing Y, Borys M, Nayak S et al (2012) pone.0116878
Identification of cell culture conditions to con- 75. Petersen TN, Brunak S, von Heijne G, Nielsen
trol protein aggregation of IgG fusion proteins H (2011) SignalP 4.0: discriminating signal pep-
expressed in Chinese hamster ovary cells. tides from transmembrane regions. Nat Methods
Process Biochem 47:69–75. doi:10.1016/j. 8:785–786. doi:10.1038/nmeth.1701
procbio.2011.10.009 76. Frank K, Sippl MJ (2008) High-performance
65. Rezaei M, Zarkesh-Esfahani SH, Gharagozloo signal peptide prediction based on sequence
M (2013) The effect of different media com- alignment techniques. Bioinformatics 24:2172–
position and temperatures on the production 2176. doi:10.1093/bioinformatics/btn422
of recombinant human growth hormone by 77. Stoops J, Byrd S, Hasegawa H (2012) Russell
CHO cells. Res Pharm Sci 8:211–217 body inducing threshold depends on the vari-
66. Vergara M, Berrios J, Martínez I et al (2015) able domain sequences of individual human
Endoplasmic reticulum-associated rht-PA pro- IgG clones and the cellular protein homeosta-
cessing in CHO cells: Influence of mild hypo- sis. Biochim Biophys Acta 1823:1643–1657.
thermia and specific growth rates in batch and doi:10.1016/j.bbamcr.2012.06.015
Chemostat cultures. PLoS One 10:e0144224. 78. Hasegawa H, Woods CE, Kinderman F et al
doi:10.1371/journal.pone.0144224 (2014) Russell body phenotype is preferen-
67. Walsh G, Jefferis R (2006) Post-translational tially induced by IgG mAb clones with high
modifications in the context of therapeutic intrinsic condensation propensity: relations
proteins. Nat Biotechnol 24:1241–1252. between the biosynthetic events in the ER
doi:10.1038/nbt1252 and solution behaviors in vitro. MAbs
68. De Leon GM, Wlaschin KF, Nissom PM et al 6:1518–1532. doi:10.4161/mabs.36242
(2007) Comparative transcriptional analysis 79. Marotta NP, Lin YH, Lewis YE et al (2015)
of mouse hybridoma and recombinant O-GlcNAc modification blocks the aggrega-
Chinese hamster ovary cells undergoing tion and toxicity of the protein α-synuclein
butyrate treatment. J Biosci Bioeng 103:82– associated with Parkinson’s disease. Nat
91. doi:10.1263/jbb.103.82 Chem 7:913–920. doi:10.1038/nchem.2361
69. Sung YH, Song YJ, Lim SW et al (2004) 80. Peroutka RJ, Elshourbagy N, Piech T, Butt TR
Effect of sodium butyrate on the production, (2008) Enhanced protein expression in mam-
heterogeneity and biological activity of human malian cells using engineered SUMO fusions:
thrombopoietin by recombinant Chinese secreted phospholipase A2. Protein Sci 17:1586–
hamster ovary cells. J Biotechnol 112:323– 1595. doi:10.1110/ps.035576.108.of
335. doi:10.1016/j.jbiotec.2004.05.003 81. Kaufmann H, Fussenegger M (2003)
70. Kantardjieff A, Jacob NM, Yee JC et al (2010) Metabolic engineering of mammalian cells for
Transcriptome and proteome analysis of Chinese higher protein yield. New Compr Biochem
hamster ovary cells under low temperature and 38:457–469
22 Christina S. Alves and Terrence M. Dobrowsky
82. Inducible Protein Expression - T-REx™ System. pression on the synthesis and secretion of
http://www.thermofisher.com/us/en/home/ factor VIII in Chinese hamster ovary cells.
references/protocols/proteins-e xpression- Mol Cell Biol 9:1233–1242. doi:10.1128/
isolation-and-analysis/protein-e xpression- MCB.9.3.1233
protocol/inducible-protein-expression-using- 95. Spiegel PC, Kaiser SM, Simon JA, Stoddard
the-trex-system.html. BL (2004) Disruption of protein-membrane
83. Gossen M, Bujard H (1992) Tight control of binding and identification of small-molecule
gene expression in mammalian cells by inhibitors of coagulation factor VIII. Chem
tetracycline-responsive promoters. Proc Natl Biol 11:1413–1422. doi:10.1016/j.chembiol.
Acad Sci U S A 89:5547–5551. doi:10.1073/ 2004.08.006
pnas.89.12.5547 96. Trummer E, Fauland K, Seidinger S et al
84. Gossen M, Freundlieb S, Bender G et al (2006) Process parameter shifting: Part
(1995) Transcriptional activation by tetracy- I. Effect of DOT, pH, and temperature on
clines in mammalian cells. Science 268:1766– the performance of Epo-Fc expressing CHO
1769. doi:10.1126/science.7792603 cells cultivated in controlled batch bioreac-
85. Zhang Y, Katakura Y, Ohashi H, Shirahata S tors. Biotechnol Bioeng 94:1033–1044.
(1997) Efficient and inducible production of doi:10.1002/bit
human interleukin 6 in Chinese hamster ovary 97. Zhu MM, Goyal A, Rank DL et al (2005)
cells using a novel expression system. Cyto Effects of elevated pCO 2 and osmolality on
technology 25:53–60 growth of CHO cells and production of
86. Fussenegger M, Bailey JE, Hauser H, Mueller antibody- fusion protein B1: a case study.
PP (1999) Genetic optimization of recombi- Biotechnol Prog 21:70–77
nant glycoprotein production by mammalian 98. Yoon SK, Choi SL, Song JY, Lee GM (2005)
cells. Trends Biotechnol 17:35–42. Effect of culture pH on erythropoietin pro-
doi:10.1016/S0167-7799(98)01248-7 duction by Chinese hamster ovary cells grown
87. Bi JX, Shuttleworth J, Al-Rubeai M (2004) in suspension at 32.5 and 37.0 degrees
Uncoupling of cell growth and proliferation C. Biotechnol Bioeng 89:345–356.
results in enhancement of productivity in doi:10.1002/bit.20353
p21CIP1-arrested CHO cells. Biotechnol 99. Mandenius CF, Brundin A (2008) Bioprocess
Bioeng 85:741–749. doi:10.1002/bit.20025 optimization using design-of-experiments
88. Sinacore MS, Drapeau D, Adamson SR methodology. Biotechnol Prog 24:1191–
(2000) Adaptation of mammalian cells to 1203. doi:10.1002/btpr.67
growth in serum-free media. Mol Biotechnol 100. Jiang Z, Droms K, Geng Z et al (2012) Fed-
15:249–257. doi:10.1385/MB:15:3:249 batch cell culture process optimization.
89. Costa AR, Rodrigues ME, Henriques M et al Bioprocess Int 10:40–45
(2011) Strategies for adaptation of mAb- 101. Sunley K, Butler M (2010) Strategies for the
producing CHO cells to serum-free medium. enhancement of recombinant protein produc-
BMC Proc 5(Suppl 8):P112. doi:10.1186/ tion from mammalian cells by growth arrest.
1753-6561-5-S8-P112 Biotechnol Adv 28:385–394. doi:10.1016/j.
90. Langer ES (2011) Trends in perfusion biore- biotechadv.2010.02.003
actors. Bioprocess Int 9:18–22 102. Min Lee G, Koo J (2010) Osmolarity effects,
91. Li L, Shi M, Song Y et al (2009) A single-use, Chinese hamster ovary cell culture. In:
scalable perfusion bioreactor system. Encyclopedia of Industrial Biotechnology.
Bioprocess Int:46–54 John Wiley & Sons, Inc., pp 1–8
92. Kompala DS, Ozturk SS (2006) Optimization 103. Du Z, Treiber D, McCarter JD et al (2015) Use
of high cell density perfusion bioreactors. Cell of a small molecule cell cycle inhibitor to control
culture technologies for pharmaceutical and cell growth and improve specific productivity
cell-based therapies. CRC Press, Taylor and and product quality of recombinant proteins in
Francis Group, Boca Raton CHO cell cultures. Biotechnol Bioeng
93. Kolind MP, Nørby PL, Berchtold MW, 112:141–155. doi:10.1002/bit.25332
Johnsen LB (2011) Optimisation of the fac- 104. Ganne V, Mignot G (1991) Application of sta-
tor VIII yield in mammalian cell cultures by tistical design of experiments to the optimiza-
reducing the membrane bound fraction. tion of factor VIII expression by CHO cells.
J Biotechnol 151:357–362. doi:10.1016/j. Cytotechnology 6:233–240. doi:10.1007/
jbiotec.2010.12.019 BF00624762
94. Kaufman RJ, Wasley LC, Davies MV et al 105. Torkashvand F, Vaziri B, Maleknia S et al (2015)
(1989) Effect of von Willebrand factor coex- Designed amino acid feed in improvement of
Optimizing ‘Difficult to Express’ Proteins 23
production and quality targets of a therapeutic 109. Solovyev VV, Salamov AA, Lawrence CB
monoclonal antibody. PLoS One 10:e0140597. (1994) Predicting internal exons by oligonu-
doi:10.1371/journal.pone.0140597 cleotide composition and discriminant analy-
106. Ellert A, Vikström C (2014) Design of experi- sis of spliceable open reading frames. Nucleic
ments with small-scale bioreactor systems for Acids Res 22:5156–5163. doi:10.1093/
efficient bioprocess development and optimiza- nar/22.24.5156
tion. Bioprocess Int 12(5):10–13 110. Reese MG, Eeckman FH, Kulp D, Haussler D
107.
Pertea M, Lin X, Salzberg S (2001) (1997) Improved splice site detection in
GeneSplicer: a new computational method genie. J Comput Biol 4:311–323. doi:10.1089/
for splice site prediction. Nucleic Acids Res cmb.1997.4.311
29:1185–1190. doi:10.1093/nar/29.5.1185 111. Rogozin IB, Milanesi L (1997) Analysis of
108. Brunak S, Engelbrecht J, Knudsen S (1991) donor splice sites in different eukaryotic
Prediction of human mRNA donor and accep- organisms. J Mol Evol 45:50–59.
tor sites from the DNA sequence. J Mol Biol doi:10.1007/PL00006200
220:49–65. doi: 0022-2836(91)90380-O [pii]
Chapter 2
Abstract
Chinese hamster ovary (CHO) cells represent the predominant platform in biopharmaceutical industry for
the production of recombinant biotherapeutic proteins, especially glycoproteins. These glycoproteins
include oligosaccharide or glycan attachments that represent one of the principal components dictating
product quality. Especially important are the N-glycan attachments present on many recombinant glyco-
proteins of commercial interest. Furthermore, altering the glycan composition can be used to modulate
the production quality of a recombinant biotherapeutic from CHO and other mammalian hosts. This
review first describes the glycosylation network in mammalian cells and compares the glycosylation pat-
terns between CHO and human cells. Next genetic strategies used in CHO cells to modulate the sialylation
patterns through overexpression of sialyltransfereases and other glycosyltransferases are summarized. In
addition, other approaches to alter sialylation including manipulation of sialic acid biosynthetic pathways
and inhibition of sialidases are described. Finally, this review also covers other strategies such as the glyco-
sylation site insertion and manipulation of glycan heterogeneity to produce desired glycoforms for diverse
biotechnology applications.
Key words Chinese hamster ovary (CHO), N-linked glycosylation, Glycoengineering, Sialylation,
Glycosylation site insertion, Heterogeneity
1 Introduction
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_2, © Springer Science+Business Media LLC 2017
25
26 Qiong Wang et al.
2.1 Sialylation Among the numerous sugar moieties found in glycans, the terminal
sialic acid (Neu5Ac) is considered particularly important for the
lifespan of glycosylated proteins. As an electro-negatively charged
acidic 9-carbon moiety, sialic acid is α-glycosidically linked on the
C3- or the C6-hydroxyl group of the terminal galactose in humans,
30 Qiong Wang et al.
Increase biotherapeutic
Enzyme name Enzyme function properties Target protein Reference
ST6GAL1 (+) α2,6-sialyltransferase 1 Capping Gal residues with Increase terminal sialylation to t-PA [36]
α2,6 sialic acid further extend protein half-life EPO [37]
IFN-ɤ [38–40, 61]
IgG [38, 39]
ST3GAL4 (+) α2,3-sialyltransferase 4 Capping Gal residues with Increase terminal sialylation to EPO [43, 46]
α2,3 sialic acid further extend protein half-life
β1,4GALT1(+) β1,4-galactosyltransferase 1 Adding Gal to GlcNac Increase galactosylation which EPO [43]
can indirectly increase
sialylation
CMP-SAS (+) CMP-sialic acid synthase Synthesize the CMP-sialic Overexpress the enzymes in EPO [46, 54,
acid in the nucleus sialylation pathway to further 55]
increase sialylation
GNE/ MNK (+) UDP-GlcNAc 2-epimerase/ Epimerization of GlcNAc Overexpress the enzymes in EPO [46]
ManNAc kinase to MAnNAc/ sialylation pathway to further
phosphorylation of increase sialylation
ManNAc
CMP-SAT (+) CMP-sialic acid transporter Transport CMP-SA from Overexpress the enzymes in INF-ɤ [55, 56]
Cytosol to Golgi sialylation pathway to further EPO
increase sialylation
GnT-IV (+) α-1,3-d-mannoside Adding GlcNac to α1-3 Create tri and tetra antennary INF-ɤ [59–61]
GnT-V β-1,4-N- mannose residue glycans and allow more EPO
(+) acetylglucosaminyltransferase Adding GlcNac to α 1-6 complex and sialylated glycan
α-1,6-d-mannoside mannose residue
CHO Glycoengineering
β-1,6-N-
acetylglucosaminyltransferase
(continued)
31
Table 1
32
(continued)
Increase biotherapeutic
Enzyme name Enzyme function properties Target protein Reference
GnT-I (+) N-acetylglucosaminyltransferase I Transfer UDP-GlcNAc to Increase the first reaction of EPO [63–65]
the terminal α-1,3-linked synthesis of complex glycan
Mannose further increase sialylation
Qiong Wang et al.
Neu 3 (-) Neuraminidase 3 (membrane Release of sialic acid from Reduce activity of sialidase INF-ɤ [76]
sialidase) the Galactose residue further inhibit cleavage of
sialylation
Bcl-xL (+) An anti-apoptotic member of the Anti-apoptosis protein Delay the extracellular Fc-fusion [80]
Bcl-2 family prevents cell death accumulation of sialidase
30Kc19 (+) Cell-penetrating protein Anti-apoptosis Delay the extracellular EPO [82, 83]
accumulation of sialidase
activity further increase in
sialylation
Note: “+” indicates overexpression or introcution, “-” indicates knockdown or inhibition
CHO Glycoengineering 33
Hexosamine Pathway
UDP-GlcNAc
Feedback
UDP-GlcNAc 2-epimerase/
ManNAc kinase inhibition
(GNE/MNK)
ManNAc
UDP-GlcNAc 2-epimerase/
ManNAc kinase CMP-sialic acid
(GNE/MNK) transporter
CMP-Neu5Ac Golgi
ManNAc-6P
N-AcetyIneuraminic
Acid Synthase (NANS)
Neu5Ac-9P
N-AcetyIneuraminic
Acid Phosphatase CMP-Neu5Ac
(NANP) CMP-sialic acid
synthetase
Neu5Ac Neu5Ac
Nucleus
the CHO cells with the cytotoxic lectin Ricinus communis agglutinin
I (RCA-I) was designed to select mutants with defects in the
N-glycosylation pathway upstream of galactose addition as this lectin
was reported to be specific for terminal β1,4-linked galactose [62].
Unexpectedly, genetic analysis of RCA-I-resistant CHO mutants
showed that they are all the same type of mutants with genetic muta-
tions in the GnT-I gene [63], similar to Stanley’s Lec1 mutant. A
plausible explanation is that RCA-I is not specific for terminal β1,4-
linked galactose but possibly binds many glycan structures except for
Man5GlcNAc2 [64]. Without functional GnT- I, the cells fail to
transfer N-acetylglucosamine to Man5GlcNAc2 glycan (Fig. 1). Sur
prisingly, the restoration of functional GnT-I in these mutants led to
an increase in the sialylation of recombinant proteins both in tran-
sient expression and in stably transfected clones [63]. While the
molecular mechanism for this phenomenon remains unknown [65],
recombinant EPO generated in this RCA-1 mutant line displayed
30% greater sialylation compared with the control EPO producing
CHO clone cultured under the same conditions [66]. Moreover,
HPAEC-PAD and MALDI-TOF MS analyses showed that EPO pro-
duced by the GnT I-restored CHO-GnT I-deficient cells also con-
tained a higher content of tri- and tetra-antennary glycans [66].
2.1.3 Inhibition Any attempt to maximize sialic acid content of a therapeutic pro-
of Sialidase Activity tein should also consider the sialidase activity because the glyco-
protein is subject to desialylation and degradation during prolonged
cell culture [29, 67]. Sialidases (neuraminidases, N-acylneuraminosyl
glycohydrolases, EC 3.2.1.18) are exoglycosidases catalyzing the
hydrolytic removal of sialic acid from sialoglycoconjugates (glyco-
proteins, polysaccharides, gangliosides) [68]. The resulting asialo-
glycoprotein product would then be rapidly cleared from the
plasma by asialoglycoprotein receptors in the liver. There are four
sialidases (Neu 1–4) identified in human, mouse, rat, and CHO
cells and their activity has been localized to different subcellular
compartments: Neu1 is located in the lysosome, Neu2 is a cytosolic
protein, Neu3 is located in the plasma membrane, and Neu4 is a
second lysosomal sialidase [67–69]. The functions of these siali-
dases vary in part due to different substrate specificities and subcel-
lular locations [29]. These sialidases can be crucial to various
biological functions such as growth control and differentiation,
tumorigenesis, T-cell activation and immune cell interactions, neu-
ronal differentiation, and genetic defects [68, 70–73]. Therefore,
in mammalian cells, it is often desirable to lower the cellular siali-
dase activity to ensure product quality and consistency for secreted
biotherapeutic glycoproteins.
In mammalian cell culture, some extracelluar sialidase origi-
nates from the cytosol of the CHO cells and is released to the cell
culture supernatant as a result of cell lysis [74]. Gene manipulation
techniques can be applied to inhibit the sialidase’s activity in CHO
CHO Glycoengineering 37
cells and prevent the enzyme from being released into the culture
medium. When gene expression of CHO Neu2 was knocked down
to 40% by homologous recombination or RNA interference
(RNAi), the sialic acid content of the recombinant glycoprotein was
improved but only when cells were in the death phase [67, 75]. In
another study, CHO cells overexpressing recombinant human
interferon gamma (IFN-ɤ) were treated using short interfering
RNA (siRNA) and short-hairpin RNA (shRNA) to reduce expres-
sion of the Neu1 and Neu3 sialidase genes [76]. By knocking down
expression of Neu3, a 98% reduction in Neu3 sialidase activity was
achieved in CHO cells. Accordingly, the sialic acid content on
recombinant IFN-ɤ was found to be increased 33% and 26% for
samples from the cell stationary phase and death phase, respectively,
as compared to corresponding controls [76]. Interestingly, when
using the same siRNA technique to knock down both genes indi-
vidually, Neu3 (located in the plasma membrane) knockdown
almost silenced sialidase activity, while Neu2 (located in the cyto-
plasm) knockdown only reduced sialidase activity to 40%. Unlike
Neu2 knockdown effects that acted exclusively in the death phase,
protein sialylation was enhanced in the whole cell process after
knocking down Neu3 expression, suggesting different mechanisms
of protein sialylation regulation by Neu2 and Neu3 [29].
In addition to silencing the genes for sialidases, other
approaches have focused on inhibiting glycan degradation. Bcl-xL,
an antiapoptotic protein that inhibits the release of proapoptotic
molecules from mitochondria, is well documented for its role in
extending culture longevity by suppressing apoptotic cell death
and improved glycoprotein production [77–79]. Overexpression
of Bcl-xL can enhance the sialylation of glycoproteins produced
from CHO cell lines by reducing cell lysis and delaying the extra-
cellular accumulation of sialidase activity during prolonged cell
culture [80]. Likewise, the investigation of anti-apoptotic
components of silkworm hemolymph revealed Bombyx mori
30Kc19 gene expression can also enhance recombinant protein
production and sialylation in CHO [81, 82]. Stable expression of
the 30Kc19 gene in a CHO cell line producing recombinant
human EPO increased the EPO production and sialylation by
102.6% and 87.1%, respectively [82]. Moreover, with the intro-
duction of 30Kc19 gene the host suspension cells produced recom-
binant human EPO with more complex glycan structures and a
larger content of sialic acid and fucose [83]. The 30Kc19 protein
is able to maintain the activity of glycotransferases involved in the
glycosylation process [83].
2.3 Heterogeneity Another issue with N-glycans of therapeutic proteins is the genera-
of Glycans tion of heterogeneous glycoforms, which present challenges in
protein purification, product consistency, and lot-to-lot reproduc-
ibility, resulting in variable therapeutic efficacy. This diversity can
sometimes adversely affect drug potency and pharmacokinetics
[97, 98]. However, N-glycans can also be crucial for protein fold-
ing, so these difficulties cannot necessarily be overcome by remov-
ing N-glycosylation sites [99]. Heterogeneity is attributed to the
lack of 100% efficiency for each step in mammalian N-glycan
biosynthesis due to variability in enzyme levels, substrate concen-
tration, intracellular location, and the competition of different
enzymes for the same substrates [99].
In order to provide homogenous glycoforms, Zhang et al.
conducted a comprehensive Zinc-finger nuclease knockout screen
of 19 glycosyltransferase genes and identified the key genes that
control decisive steps in N-glycosylation in CHO [100]. The
authors stacked knockouts of GnT-IV-A/GnT-IV-B/GnT-V to
produce almost homogenous biantennary N-glycans [100].
Subsequently, the introduction of ST6Gal-I in CHO ST3Gal4/6
knockout cells produced a normal range of N-glycans with only
α2,6-sialylation, and when combined with a GnT-IV-A/GnT-
IV-B/GnT-V knockout, homogenous biantennary N-glycans
capped by α2,6-sialic acid residues were generated [100].
3 Conclusion
Acknowledgment
References
1. Aggarwal RS (2014) What’s fueling the bio- 7. Gavel Y, Vonheijne G (1990) Sequence differ-
tech engine-2012 to 2013. Nat Biotechnol ences between glycosylated and nonglycosyl-
32(1):32–39 ated Asn-X-Thr Ser acceptor sites - implications
2. Ghaderi D et al (2012) Production platforms for protein engineering. Protein Eng
for biotherapeutic glycoproteins. Occurrence, 3(5):433–442
impact, and challenges of non-human 8. An HJ et al (2003) Determination of
sialylation. Biotechnol Genet Eng Rev 28: N-glycosylation sites and site heterogeneity in
147–175 glycoproteins. Anal Chem 75(20):5628–5637
3. Hossler P, Khattak SF, Li ZJ (2009) Optimal 9. Stavenhagen K et al (2013) Quantitative
and consistent protein glycosylation in mamma- mapping of glycoprotein micro-heterogeneity
lian cell culture. Glycobiology 19(9):936–949 and macro-heterogeneity: an evaluation of
4. Lepenies B, Seeberger PH (2014) Simply bet- mass spectrometry signal strengths using syn-
ter glycoproteins. Nat Biotechnol 32(5): thetic peptides and glycopeptides. J Mass
443–445 Spectrom 48(6):i
5. Walsh G, Jefferis R (2006) Post-translational 10. Varki A, Cummings RD, Esko JD et al (eds)
modifications in the context of therapeutic (2009) Essentials of glycobiology, 2nd edn.
proteins. Nat Biotechnol 24(10):1241–1252 Cold Spring Harbor Laboratory Press, New
6. Palomares LA, Estrada-Mondaca S, Ramirez York
OT (2004) Production of recombinant pro- 11. Aebi M (2013) N-linked protein glycosyl-
teins: challenges and solutions. Methods Mol ation in the ER. Biochim Biophys Acta
Biol 267:15–52 1833(11):2430–2437
CHO Glycoengineering 41
12. Aebi M et al (2010) N-glycan structures: rec- an evolutionary perspective. Chem Rev
ognition and processing in the ER. Trends 102(2):439–469
Biochem Sci 35(2):74–82 28. Harduin-Lepers A et al (2001) The human sial-
13. Butler M, Meneses-Acosta A (2012) Recent yltransferase family. Biochimie 83(8):727–737
advances in technology supporting biophar- 29. Wang Q et al (2015) Strategies for engineering
maceutical production from mammalian cells. protein N-glycosylation pathways in mamma-
Appl Microbiol Biotechnol 96(4):885–894 lian cells. Methods Mol Biol 1321:287–305
14. Swiech K, Picanco-Castro V, Covas DT 30. Ashwell G, Harford J (1982) Carbohydrate-
(2012) Human cells: new platform for recom- specific receptors of the liver. Annu Rev
binant therapeutic protein production. Biochem 51:531–554
Protein Expr Purif 84(1):147–153 31. Cole ES et al (1993) Invivo clearance of tissue
15. Padler-Karavani V, Varki A (2011) Potential plasminogen-activator - the complex role of
impact of the non-human sialic acid sites of glycosylation and level of sialylation.
N-glycolylneuraminic acid on transplant Fibrinolysis 7(1):15–22
rejection risk. Xenotransplantation 18(1):1–5 32. Schauer R (2004) Sialic acids: fascinating sug-
16. Bosques CJ et al (2011) Chinese hamster ars in higher animals and man. Zoology (Jena)
ovary cells can produce galactose-alpha-1, 107(1):49–64
3-galactose antigens on proteins (vol 28, pg 33. Chung CY et al (2015) Assessment of the
1153, 2010). Nat Biotechnol 29(5):459–459 coordinated role of ST3GAL3, ST3GAL4
17. Muchmore EA et al (1989) Biosynthesis of and ST3GAL6 on the alpha 2,3 sialylation
N-glycolyneuraminic acid. The primary site of linkage of mammalian glycoproteins. Biochem
hydroxylation of N-acetylneuraminic acid is Biophys Res Commun 463(3):211–215
the cytosolic sugar nucleotide pool. J Biol 34. Krzewinski-Recchi MA et al (2003)
Chem 264(34):20216–20223 Identification and functional expression of a
18. Chung CH et al (2008) Cetuximab-induced second human beta-galactoside alpha2,6-
anaphylaxis and IgE specific for galactose- sialyltransferase, ST6Gal II. Eur J Biochem
alpha-1,3-galactose. N Engl J Med 358(11): 270(5):950–961
1109–1117 35. Lee EU, Roth J, Paulson JC (1989) Alteration
19. Butler M, Spearman M (2014) The choice of of terminal glycosylation sequences on
mammalian cell host and possibilities for gly- N-linked oligosaccharides of Chinese hamster
cosylation engineering. Curr Opin Biotechnol ovary cells by expression of beta-galactoside
30:107–112 alpha 2,6-sialyltransferase. J Biol Chem
20. Croset A et al (2012) Differences in the gly- 264(23):13848–13855
cosylation of recombinant proteins expressed 36. Minch SL, Kallio PT, Bailey JE (1995) Tissue
in HEK and CHO cells. J Biotechnol plasminogen activator coexpressed in Chinese
161(3):336–348 hamster ovary cells with alpha(2,6)-sialyl-
21. Zhao Y et al (2008) Branched N-glycans reg- transferase contains NeuAc alpha(2,6)Gal
ulate the biological functions of integrins and beta(1,4)Glc-N-AcR linkages. Biotechnol
cadherins. FEBS J 275(9):1939–1948 Prog 11(3):348–351
22. Raju TS, Jordan RE (2012) Galactosylation 37. Schlenke P et al (1997) Expression of human
variations in marketed therapeutic antibodies. α2, 6-Sialyltransferase in BHK-21A cells
MAbs 4(3):385–391 increases the sialylation of coexpressed human
23. Spearman M, Butler M (2015) Glycosylation erythropoietin: NeuAc-transfer onto
in cell culture. Anim Cell Culture 9:237–258 GalNAc(βl-4)GlcNAc-R motives. In: Carrondo
24. Sareneva T et al (1995) N-Glycosylation of MT, Griffiths B, Moreira JP (eds) Animal Cell
human interferon-gamma - glycans at Asn-25 Technology. Springer, The Netherlands,
are critical for protease resistance. Biochem pp 475–480
J 308:9–14 38. Bragonzi A et al (2000) A new Chinese ham-
25. Wright A, Morrison SL (1997) Effect of gly- ster ovary cell line expressing alpha
cosylation on antibody function: implications 2,6-sialyltransferase used as universal host for
for genetic engineering. Trends Biotechnol the production of human-like sialylated
15(1):26–32 recombinant glycoproteins. BBA-Gen
Subjects 1474(3):273–282
26. Sola RJ, Griebenow K (2010) Glycosylation
of therapeutic proteins: an effective strategy 39. Jassal R et al (2001) Sialylation of human
to optimize efficacy. BioDrugs 24(1):9–21 IgG-Fc carbohydrate by transfected rat
alpha2,6-sialyltransferase. Biochem Biophys
27. Angata T, Varki A (2002) Chemical diversity Res Commun 286(2):243–249
in the sialic acids and related alpha-keto acids:
42 Qiong Wang et al.
93. Kronman C et al (1995) Involvement of circulatory residence. Biochem J 354(Pt 3):
oligomerization, N-glycosylation and 613–625
sialylation in the clearance of cholinesterases 97. Ferrara C et al (2006) Modulation of therapeu-
from the circulation. Biochem J 311(Pt tic antibody effector functions by glycosylation
3):959–967 engineering: influence of Golgi enzyme local-
94. Chitlaru T et al (2002) Overloading and ization domain and co-expression of heterolo-
removal of N-glycosylation targets on human gous beta1, 4-N-acetylglucosaminyltransferase
acetylcholinesterase: effects on glycan compo- III and Golgi alpha-mannosidase II. Biotechnol
sition and circulatory residence time. Biochem Bioeng 93(5):851–861
J 363(Pt 3):619–631 98. Elliott S et al (2004) Control of rHuEPO
95. Kronman C et al (2000) Hierarchy of post- biological activity: the role of carbohydrate.
translational modifications involved in the circu- Exp Hematol 32(12):1146–1155
latory longevity of glycoproteins. Demonstration 99. Meuris L et al (2014) GlycoDelete engi
of concerted contributions of glycan sialylation neering of mammalian cells simplifies
and subunit assembly to the pharmacokinetic N-glycosylation of recombinant proteins. Nat
behavior of bovine acetylcholinesterase. J Biol Biotechnol 32(5):485–489
Chem 275(38):29488–29502 100. Yang Z et al (2015) Engineered CHO cells
96. Chitlaru T et al (2001) Effect of human for production of diverse, homogeneous gly-
acetylcholinesterase subunit assembly on its
coproteins. Nat Biotechnol 33(8):842–844
Chapter 3
Abstract
We describe a one-liter transfection of suspension-adapted Chinese hamster ovary (CHO-DG44) cells
using polyethyleneimine (PEI) for DNA delivery. The method involves transfection at a high cell density
(5 × 106 cells/mL) by direct addition of plasmid DNA (pDNA) and PEI to the culture and subsequent
incubation at 31 °C with agitation by orbital shaking. We also describe an alternative method in which 90%
of the pDNA is replaced by nonspecific (filler) DNA, and the production phase is performed at 31 °C in
the presence of 0.25% N, N-dimethylacetamide (DMA).
Key words CHO cells, Transfection, Polyethyleneimine, Orbital shaking, Recombinant protein
1 Introduction
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_3, © Springer Science+Business Media LLC 2017
45
46 Yashas Rajendra et al.
2 Materials
2.4 Transfection 1.
Linear 25 kDa polyethyleneimine (PEI) (Polysciences,
Eppenheim, Germany) is dissolved in water at 1 mg/mL at a
pH of 7.0. When dissolving, lower the pH with 1 N HCl.
When the PEI is in solution, increase the pH to 7.0 with 1 N
NaOH. Filter sterilize the solution, aliquot into sterile 50-mL
tubes, and store at −20 °C. It can be stored frozen for years as
long as repeated freeze–thaw cycles are avoided (see Note 2).
48 Yashas Rajendra et al.
2.5 ELISA 1. 96-well ELISA microtiter plates with flat bottom (Becton-
Dickinson AG, Basel, Switzerland).
2. Blocking buffer: 0.5% casein hydrolysate (Applichem) and
0.05% Tween 20 (Sigma-Aldrich) in PBS (pH 7.1).
3. Capture antibody: Goat anti-human kappa light chain (AbD
Serotec, Dusseldorf, Germany).
4. Coating solution: For each 96-well plate, 11 μL of capture
antibody is mixed with 11 mL of PBS (pH 8.0).
5. Washing buffer: PBS (pH 8.0) with 2% Tween 20.
6. Detection antibody: Alkaline phosphatase-conjugated goat
anti-human gamma heavy chain (Biosource).
7. Standard: Human IgG, whole molecule (ChromPure, Jackson
ImmunoResearch Europe Ltd., Suffolk, UK). Dilute the stan-
dard in blocking buffer to 100 ng/mL and then serially dilute
1:2 with blocking buffer.
8. Substrate buffer: Add 97 mL diethanolamine (Sigma-Aldrich)
to 700 mL H2O and adjust pH to 9.8 with 2 M HCl. Add
0.5 mL 1 M MgCl2 and 2 g NaN3. Adjust volume to 1 L.
9. Substrate: Dissolve 4-nitrophenyl phosphate disodium salt
(NPP) (Applichem) in substrate buffer to 1.5 mg/mL.
10. Stop solution: 3 M NaOH.
11. Microplate reader (e.g., SPECTRAmax™340; Molecular
Devices, Palo Alto, CA, USA).
3 Methods
3.1 Plasmid 1. Transform E. coli strain DH5α with pXLGCHO-A3 by the stan-
Purification dard CaCl2 method and spread onto LB agar plates with
100 μg/mL ampicillin (see Note 4).
2. Incubate the plates overnight (16 h) at 37 °C.
3. With a sterile loop or a pipette tip, transfer a single colony from
the transformed plate to a sterile round-bottom, polypropyl-
ene 14-mL culture tube containing 3 mL LB broth with
100 μg/mL ampicillin.
Large-Scale Transient Transfection of CHO Cells 49
3.2 Routine Cell 1. Subcultivate CHO-DG44 cells every 3–4 days (see Note 5) by
Culture inoculation in 100 mL ProCHO5 medium (when used for cell
culture, the medium contains l-glutamine, hypoxanthine, thy-
midine, and phenol red as indicated in Subheading 2.1) (see
Note 6) in a 250 mL square-shaped glass bottle at an initial
cell density of 0.3 × 106 cells/mL.
2. Determine the cell density and viability by Trypan blue stain-
ing using a Neubauer hemocytometer and an inverted phase
contrast microscope (100× magnification).
3. After cell counting, transfer 3 × 107 cells into a 50-mL centri-
fuge tube and centrifuge at 500 × g for 3 min in a standard
tabletop centrifuge.
4. Remove the medium by aspiration or decanting. Resuspend
the cell pellet in 10 mL of ProCHO5 medium and transfer to
a 250-mL square-shaped bottle containing 90 mL of pre-
warmed ProCHO5 medium.
5. Attach the bottle to a platform mounted on an orbital shaker
using double-sided adhesive transfer tape and agitate at
110 rpm at 37 °C in a 5% CO2 atmosphere without humidity.
Keep the cap of the bottle opened about one quarter of a turn.
Alternatively, vented caps can be used.
3.3 Cell Expansion 1. Count the cells prepared as in Subheading 3.2 after reaching a
for Transfection density of about 5 × 106 cells/mL.
2. Transfer 100 mL of CHO-DG44 cells from the 250-mL bottle
into the 2-L bottle with 400 mL of pre-warmed ProCHO5
medium to reach a cell density of about 1 × 106 cells/mL.
3. Incubate the culture at 37 °C with agitation as described in
Subheading 3.2, step 3, until reaching a cell density of about
5 × 106 cells/mL (approximately 2 days).
4. On the day before transfection, transfer the culture into two
sterile 500-mL centrifuge bottles.
5. Centrifuge for 5 min at 500 × g at room temperature.
Large-Scale Transient Transfection of CHO Cells 51
3.4 Transfection 1. On the day of the transfection, count the cells as described in
Subheading 3.2.
3.4.1 Standard Method
2. Transfer a total of 5 × 109 cells from the overnight culture into
two sterile 500-mL centrifuge bottles (Corning) and centri-
fuge at 500 × g for 5 min at room temperature.
3. Remove the medium by aspiration and resuspend the cells from
the two centrifuge bottles in a total volume of 50 mL by addition
of pre-warmed ProCHO5 medium. Transfer the cells into a 5-L
cylindrical glass bottle with 950 mL of pre-warmed ProCHO5
medium. The cell density is 5 × 106 cells/mL (see Note 8).
4. Add 3 mg of plasmid DNA to the culture and mix immediately
by swirling the bottle (see Note 9).
5. Add 15 mL of the linear 25 kDa PEI solution at 1 mg/mL to
the culture and mix immediately by swirling the bottle (see
Note 10).
6. Place the bottle on an orbital shaker as described in Subheading
3.2, step 6 and incubate at 31 °C in 5% CO2 and 85% humidity
with agitation at 110 rpm (see Notes 11 and 12). Keep the
bottle caps open one quarter of a turn.
7. For secreted proteins, at day 7 post-transfection, harvest the
culture by centrifuging at 4000 × g for 15 min (see Note 13).
8. A schematic diagram of the transfection method is shown in
Fig. 1 (left side).
3.4.2 Low DNA Method 1. On the day of the transfection, count the cells as described in
Subheading 3.2.
2. Transfer a total of 5 × 109 cells from the overnight cultures
into two 500-mL centrifuge bottles and centrifuge at 500 × g
for 4–5 min at room temperature.
3. Remove the medium by aspiration and resuspend the cells from
the two centrifuge bottles in a total volume of 50 mL by the
addition of pre-warmed ProCHO5 medium. Transfer this 50 mL
into a 5-L cylindrical glass bottle with 950 mL of pre-warmed
ProCHO5 medium. The cell density after resuspension is
5 × 106 cells/mL.
52 Yashas Rajendra et al.
Fig. 1 Schematic representation of the standard transfection method and the low pDNA transfection method
4 Notes
1. For pXLGCHO-A3, both the IgG light and heavy chain genes
are expressed from the human cytomegalovirus (HCMV)
major immediate early promoter/enhancer. This is generally
the most favorable promoter for TGE in either CHO or HEK-
293 cells.
2. Once thawed, the PEI solution in 50 mL tubes can be ali-
quoted into 15 mL tubes and either used for transfection that
day or refrozen.
3. Sheared herring sperm DNA can be diluted to a desirable con-
centration in either sterile deionized water or TE (10 mM
Tris–HCl, 1 mM EDTA, pH 7.5).
4. The expression vector used here has a high copy number origin
of replication. This is an important point because a significant
amount of pDNA is necessary for TGE at large scale. The LB
54 Yashas Rajendra et al.
References
1. Daramola O, Stevenson J, Dean G, Hatton D, plasmid DNA utilization in transiently trans-
Pettman G, Holmes W, Field R (2014) A high- fected CHO-DG44 cells in the presence of polar
yielding CHO transient system: coexpression solvents. Biotechnol Prog 31:1571–1578
of genes encoding EBNA-1 and GS enhances 6. Rajendra Y, Hougland MD, Schmitt MG,
transient protein expression. Biotechnol Prog Barnard GC (2015) Transcriptional and post-
30:132–141 transcriptional targeting for enhanced transient
2. Backliwal G, Hildinger M, Chenuet S, gene expression in CHO cells. Biotechnol Lett
Wulhfard S, De Jesus M, Wurm FM (2008) 37:2379–2386
Rational vector design and multi-pathway 7. Monteil DT, Tontodonati G, Ghimire S, Baldi
modulation of HEK 293E cells yield recombi- L, Hacker DL, Bürki CA, Wurm FM (2013)
nant antibody titers exceeding 1 g/l by tran- Disposable 600-mL orbitally shaken bioreactor
sient transfection under serum-free conditions. for mammalian cell cultivation in suspension.
Nucleic Acids Res 36:e96 Biochem Eng J 76:6–12
3. Cain K, Peters S, Hailu H, Sweeney B, Stephens 8. Muller N, Girard P, Hacker DL, Jordan M,
P, Heads J, Sarkar K, Ventom A, Page C, Wurm FM (2005) Orbital shaker technology for
Dickson A (2013) A CHO cell line engineered the cultivation of mammalian cells in suspension.
to express XBP1 and ERO1-Lα has increased Biotechnol Bioeng 89:400–406
levels of transient protein expression. Biotechnol
9. Klockner W, Buchs J (2012) Advances in shaking
Prog 29:697–706
technologies. Trends Biotechnol 30:307–314
4. Rajendra Y, Kiseljak D, Manoli S, Baldi L,
Hacker DL, Wurm FM (2012) Role of non- 10. Klockner W, Diederichs S, Buchs J (2014)
specific DNA in reducing coding DNA require- Orbitally shaken single-use bioreactors. Adv
ment for transient gene expression with CHO Biochem Eng Biotechnol 138:45–60
and HEK-293E cells. Biotechnol Bioeng 11. Rajendra Y, Kiseljak D, Baldi L, Hacker DL,
109:2271–2278 Wurm FM (2011) A simple high-yielding pro-
5. Rajendra Y, Balasubramanian S, Kiseljak D, Baldi cess for transient gene expression in CHO cells.
L, Wurm FM, Hacker DL (2015) Enhanced J Biotechnol 153:22–26
Chapter 4
Abstract
Single-chain fragment variable–fragment crystallizable antibody constructs (scFv-Fc) are homodimeric
proteins representing valuable alternatives to heterotetrameric full-length IgG molecules to study protein
properties and product-dependent cellular behavior. In contrast to naturally occurring antibodies, these
artificial molecules are assembled from functional antibody domains to reduce molecule complexity and
enhance antibody expression levels. The scFv-Fc format retains critical antibody functions such as antigen
binding affinity and antibody effector functions. Here, we present a protocol to convert the full-length
anti-HIV-1 IgG1 antibody 2F5 into a scFv-Fc construct. Variable and constant regions are amplified by
conventional PCR reactions and assembled by a single overlap-extension PCR reaction. The amplified
product is then cloned into a mammalian expression vector suitable for high-titer transient gene expression.
This workflow can be applied to any antibody sequence by adapting the specific primer sequences to the
antibody of choice.
Key words HEK293, Monoclonal antibodies, Transient gene expression, Anti-HIV-1 2F5
1 Introduction
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_4, © Springer Science+Business Media LLC 2017
57
58 Patrick Mayrhofer and Renate Kunert
Fig. 1 Assembly of scFv-Fc fragments. Three individual fragments (i) leader-vH-linker, (ii) linker-vL-hinge,
and (iii) hinge-CH2-CH3 are amplified from heavy- and light chain 2F5IgG plasmid templates with primer
pairs 1 + 2, 3 + 4, or 5 + 6, respectively (a). The three fragments are then assembled to a single open
reading frame by overlap-extension PCR and amplified with primers 1 + 6 (b). The single amplicon is then
cloned into a suitable expression vector using flanking KpnI and XhoI restriction sites (c) for transient
expression of the 2F5scFv-Fc homodimer (d). Primer sequences depicted as small arrows can be found in
Table 1
60 Patrick Mayrhofer and Renate Kunert
Table 1
Primer sequences used for the construction of 2F5scFv-Fc. Overlapping regions, RESTRICTION SITES,
2F5-SPECIFIC SEQUENCES
No Name Sequence
1 KpnI_HC-Leader_for ttGGTACCgccaccatggactggacctg
2 2F5vH+linker_rev agatccaccacctccgctaccgcctcccccagatcctccgccgcc
GCTGCTGATGGTCACGGT
3 2F5vL+linker_for gaggcggtagcggaggtggtggatctGCTCTGCAGCTGA
CCCAGA
4 2F5vL_hinge_rev gctgctcttgggctcCCTCACGTCCACCCTGGTC
5 mutFc_for gagcccaagagcagcgacaagacccacac
6 XhoI_CH3_rev taCTCGAGctatcacttgccgggggac
7 screen_seq_CMV_for atcaacgggactttccaaaa
8 screen_2F5vL_rev GATGGTCAGGGTGAACTCG
2 Materials
2.1 Molecular 1. Use sterile pipette tips, tubes, and autoclaved ultrapure deion-
Biological Transgene ized water (dH2O).
Manipulation 2. Plasmids: Commercially available pCEP4 vector (Invitrogen),
a high-copy number plasmid containing an Epstein-Barr virus
nuclear antigen 1 (EBNA-1) expression cassette and origin of
replication (oriP) required for episomal plasmid replication
and propagation to daughter cells after cell division. High-level
transcription is mediated by a cytomegalovirus (CMV) imme-
diate early enhancer/promoter. For 2F5 template sequences
any plasmid containing heavy- or light chain of the IgG1 anti-
HIV-1 antibody 2F5 can be used.
3. LB-amp medium and agar plates: 10 g/L tryptone, 5 g/L
yeast extract, 170 mM NaCl, pH 7.0, 1.5% agar-agar (Merck)
for plates, 100 μg/mL ampicillin.
4. Plasmid Miniprep Kit I peqGOLD (Peqlab).
5. NucleoBond Xtra Midi EF (Macherey-Nagel).
6. Thermoshaker incubator.
7. Nanodrop 2000 (Thermo Scientific).
8. Bromophenol Blue/Xylene Cyanol FF (BX) DNA loading dye
(6×, Thermo Fisher Scientific).
9. Generuler DNA ladder mix (Thermo Fisher Scientific).
10. Tris-Acetate-EDTA (TAE) Buffer (pH 8.3): 4.84 g/L Tris
base, 1.14 mL glacial acetic acid, 2 mL EDTA (0.5 M, pH 8.0).
scFv-Fc Antibody Cloning 61
3 Methods
12. Discard the flow-through and wash the bound plasmid DNA
with 500 μL “PW” plasmid kit-buffer and 750 μL DNA wash
kit-buffer by centrifugation for 1 min at 10,000 × g and 4 °C
after each washing step.
13. Elute the purified plasmid DNA from the column by adding
100 μL autoclaved deionized water (dH2O).
14. Determine the concentration and quality of the plasmid DNA
solution by Nanodrop (see Note 3). This procedure usually
gives yields higher than 10 μg for a 10 mL E. coli suspension
carrying the pCEP4 vector.
15. Adjust plasmid DNA concentration to 100 ng/μL.
3.1.2 Isolation of Specific 1. To prepare the primer stock solutions resuspend all lyophilized
PCR Amplicons primer samples (Table 1) in dH2O according to manufacturer’s
instructions to give a 100 μM primer master stock solution
that is routinely stored at −20 °C (see Note 4). A 10 μM primer
working stock solution is then prepared and used for setting up
the PCR reactions.
2. For amplifying the three 2F5 fragments in three separate PCR
reactions, a master mix (3×) containing all substances but
primers and plasmid DNA is prepared. First, mix 50.3 μL
dH2O with 15 μL fidelity reaction buffer, 2.3 μL dNTP mix,
and 1.5 μL KAPA DNA polymerase (see Note 5).
3. Mix, vortex, and spin down by centrifugation for 5 s at 10,000 × g.
4. Prepare three PCR tubes, each containing 0.75 μL of one for-
ward primer (primers 1, 3, or 5), 0.75 μL of one reverse primer
(primers 2, 4, or 6), and 0.5 μL plasmid template DNA (50 ng
total per reaction, two tubes containing the 2F5 heavy chain
sequence with primer pair 1 + 2 or 5 + 6 and one tube contain-
ing the 2F5 light chain plasmid with primer pair 3 + 4).
5. Add 23 μL of PCR master mix to each tube.
6. To start the PCR reaction use the thermocycler program 1
(Table 2) to amplify each fragment from the 2F5 template
plasmids.
7. After finishing the PCR reaction, add 5 μL of BX-buffer and
load the amplicons individually on a 1% agarose gel (+0.3 μg/
mL EtBr) for gel-electrophoresis in TAE buffer (+0.3 μg/mL
EtBr) at 100 V for approx. 1 h (see Note 6).
8. To isolate the specific PCR amplicons cut the PCR amplicons
showing the correct size (fragment 1:512 bp, fragment 2:362 bp,
and fragment 3:710 bp) under UV-light (see Note 8).
9. Extract and purify the DNA from the sliced agarose gel using
commercial extraction kits (see Note 9). Elute purified frag-
ments with dH2O.
10. Measure DNA concentrations and adjust concentration to
10 ng/μL (see Note 10).
64 Patrick Mayrhofer and Renate Kunert
Table 2
Thermocycler programs used for PCR amplification
3.3.2 Ligation To find the optimal molar insert: vector ratio and to check for liga-
tion efficiency three parallel reactions are set up.
1. Prepare a master mix (3×) containing 29.2 μL dH2O, 15 μL
linearized pCEP4 vector (50 ng per reaction), 6 μL T4 DNA
ligase reaction buffer, 3 μL T4 DNA ligase.
2. Transfer 17.7 μL of the master mix into each of three tubes.
Add to tube 1: 2.3 μL dH2O, to tube 2: 0.8 μL digested
2F5scFv-Fc insert (8 ng) and 1.5 μL dH2O, and to tube 3:
2.3 μL digested 2F5scFv-Fc insert (23 ng), resulting in a molar
vector: insert ratios of 1:0, 1:1, and 1:3, respectively.
66 Patrick Mayrhofer and Renate Kunert
3.3.4 Colony PCR 1. To prepare a master mix (10×) use 256.8 μL dH2O, 30 μL
ThermoPol buffer, 6 μL dNTP mix, 3 μL forward primer 7
(screen_seq_CMV_for), 3 μL reverse primer 8 (screen_2F5vL_
rev), and 1.2 μL Taq DNA polymerase (see Note 13).
2. Aliquot 30 μL into PCR tubes.
3. Prepare microcentrifuge tubes containing 50 μL LB-amp
medium and one LB-amp agar plate.
4. By using sterile toothpicks or pipette tips transfer a single col-
ony of the overnight LB-amp agar plate into the colony PCR
solution and stir.
5. Transfer the same toothpick or pipette tip into the tube with
liquid LB-amp medium and then streak onto the LB-amp plate
to inoculate the liquid culture and the LB-agar plate as a
backup.
6. Repeat this step for ten individual colonies (see Note 14).
7. Incubate the LB-amp agar backup plate overnight at 37 °C
and the liquid LB-amp tubes at 37 °C and 400 rpm in the
thermomixer.
8. Propagate positive clones after PCR screening in liquid over-
night cultures by adding 50 μL cell suspension to 10 mL fresh
LB-amp medium and incubate at 37 °C and 200 rpm in the
thermoshaker incubator.
9. The next day a cryostock and DNA isolation (“Miniprep”) is
carried out. For cryopreservation of positive colonies mix
625 μL of exponential growth cultures with 375 μL 80% glyc-
erol solution to yield a 30% glycerol cryostock that is stored at
−80 °C.
scFv-Fc Antibody Cloning 67
3.4 Transient 1. HEK293-6E routine cultures are grown and passaged every
Transfection 3–4 days in Freestyle F17 medium supplemented with 4 mM
of Mammalian l-glutamine, 0.1% Kolliphor P188, 15 mg/L phenol red, and
HEK293-6E Cells 25 μg/mL G418.
2. One day before transfection passage cells at 1:2 ratio in fresh
culture medium.
3. For a 15 mL transfection resuspend 15 × 106 cells in exponen-
tial growth phase at high viability (>95%) in 12 mL F17
medium supplemented with 8 mM l-glutamine, 0.1% Kolliphor
P188, and 15 mg/L phenol red in a 50 mL shaker tube
(see Note 17).
4. Transfer 15 μg plasmid DNA in 1.5 mL F17 medium without
supplements and incubate for 3 min.
5. Transfer 15 μL PEIMax-reagent in 1.5 mL F17 medium without
supplements and incubate for 3 min.
6. Transfer 1.5 mL PEIMax/F17 solution to 1.5 mL DNA/
F17 solution and incubate for 3 min to induce polyplex
formation.
7. Add the 3 mL polyplex-solution dropwise under continuous
swirling to the 12 mL cell suspension and incubate the shaker
tube in the climo-shaker at 220 rpm, 50 mm shaking ampli-
tude, 37 °C, 7% CO2 and 85% humidity.
68 Patrick Mayrhofer and Renate Kunert
4 Notes
References
1. Aggarwal S (2014) What’s fueling the biotech 3. Beck A, Wurch T, Bailly C, Corvaia N (2010)
engine-2012 to 2013. Nat Biotechnol 32:32–39 Strategies and challenges for the next gene
2. Hansel TT, Kropshofer H, Singer T, Mitchell ration of therapeutic antibodies. Nat Rev
JA, George AJT (2010) The safety and side Immunol 10:345–352
effects of monoclonal antibodies. Nat Rev Drug 4. Carter PJ (2006) Potent antibody therapeutics
Discov 9:325–338 by design. Nat Rev Immunol 6:343–357
Chapter 5
Abstract
Improving the time integral of viable cell concentration by overcoming cell death, namely apoptosis, is one
of the widely used strategies for efficient production of therapeutic proteins. By establishing stable cell lines
that overexpress anti-apoptotic genes or down-regulate pro-apoptotic genes, the final product yields can
be enhanced as cells become more resistance to environmental stresses. From the selection of high-
expressing clones to verification of anti-apoptotic activity, the method to construct a stable anti-apoptotic
cell line is discussed in this chapter.
Key words Chinese hamster ovary cells, Therapeutic proteins, Apoptosis, Transfection, Selection,
Suspension adaptation, Western blot analysis, Overexpression, siRNA, Cell culture
1 Introduction
Since the 1980s, mammalian cell lines have been used for large-scale
commercial production of therapeutic proteins, including mono-
clonal antibodies and fusion proteins. In order to satisfy the
fast-growing economic demand of biopharmaceuticals, major
improvements have been made to establish high and stable pro-
duction of therapeutic proteins. As a result, a more than 100-fold
increase in product titers from Chinese hamster ovary (CHO) cells
has been achieved [1]. Due to several advantages over other mam-
malian cell lines, CHO cells have been the most widely used host
cell line for therapeutic protein production. CHO cells are known
to be a safe host which is efficient for a gene amplification system
with higher specific productivity and adequate for a serum-free sus-
pension culture [2].
For the cost-effective production of therapeutic proteins with
recombinant CHO (rCHO) cell lines, numerous techniques and
approaches have been used to maximize the production of high-
quality therapeutic proteins. These approaches include the optimiza-
tion of the culture medium and feeding supplements [3], selection of
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_5, © Springer Science+Business Media LLC 2017
71
72 Eric Baek et al.
2 Materials
3 Methods
3.1 Transfection For overexpression of anti-apoptotic genes, one must insert the
target gene sequence into the expression vector pcDNA3.1/
Hygro(+) in the proper orientation (see Note 5). In a similar way,
the target sequence of the siRNA for a pro-apoptotic gene should
be designed and inserted into pSilencer2.1-U6 hygro. The
OligoEngine Workstation 2 program (OligoEngine, Seattle, WA)
is a useful tool for designing the target sequence (see Note 6).
From transfection to selection, the rCHO cell lines should be
maintained in an adherent state. The general overview of cell line
construction is illustrated in Fig. 1. In addition, the rCHO cell
lines should be cultivated in the media supplemented with 7–10%
dFBS in a humidified incubator.
1. One day prior to the transfection, seed the cells at a concentra-
tion of 0.5 × 106 cells/mL in T25-flasks. On the day of trans-
fection, the cells should be at 80–90% confluence.
2. Using Lipofectamine® 2000, transfect the rCHO cell line with
the expression vector according to the manufacturer’s protocol.
Briefly, prepare DNA diluted 8 μg in 500 μL of Opti-MEM
medium and 20 μL of Lipofectamine® 2000 in 500 μL of Opti-
MEM medium, separately. After 5 min of incubation, combine
the diluted DNA and Lipofectamine® 2000 and incubate for
20 min at room temperature. Add the combined mixture of
DNA- Lipofectamine® 2000 to the T25-flask containing
the cells.
3. After 24–48 h of cultivation, discard the media into a waste
bottle.
4. After washing the cells with PBS, detach cells by trypsinization
using 1× trypsin in PBS.
5. Resuspend the cells with fresh IMDM and count the cells to
conduct pool selection.
3. Discard the media, wash the cells with PBS, and count the cells
after trypsinization.
4. Conduct limited dilution by seeding the cells at a concentra-
tion of 0.2–1.0 cells/well onto 96-well plates.
5. With a microscope, observe single-colony formation after
10–14 days; and if single colonies are observed and reach
Construction of Anti-Apoptotic Cell Line 77
3.4 Verification The newly constructed serum-free adapted cell line is ready for
of Anti-Apoptotic Gene testing its ability to inhibit apoptosis in various environments.
In addition, it is important to verify that the engineered gene is
78 Eric Baek et al.
3.4.2 Gel Loading 1. Assemble the equipment for gel electrophoresis according to
the manufacturer’s instructions.
2. Load equal amounts of the samples into the SDS-PAGE gel
(see Note 15).
3. Perform gel electrophoresis running for 2 h at 100 V
(see Note 16).
3.4.3 Gel Transfer 1. When gel electrophoresis is done, remove the gel from the
to the Membrane plastic cover.
2. Soak the gel in transfer buffer.
3. Prior to transfer, activate the PVDF membrane by soaking it in
methanol for 5 min.
4. Stack the membrane and the gel in a cassette as shown in
Fig. 2.
5. Perform electrophoresis for protein transfer for 2 h at 100 V
(see Note 17).
3.4.4 Antibody Binding 1. When the transfer is done, take out the membrane and soak in
and Detection PBS-T. The membrane can be stored at 4 °C until needed.
2. Block the membrane in blocking buffer for 1–2 h at room tem-
perature. Place it on the shaker at 30 rpm (see Note 18).
Construction of Anti-Apoptotic Cell Line 79
Fig. 3 The expected outcome of Western blot analysis for Bcl-2 overexpressed
clones. Compared to the negative control (N), Bcl-2 is highly overexpressed in the
Bcl-2 overexpressed clones
4 Notes
Fig. 4 The expected viable cell concentration, viability, and product yield of the
selected anti-apoptotic clones. Compared to the negative control (N), anti-apoptotic
cell lines show improved viable cell concentration, viability, and product titer
82 Eric Baek et al.
Fig. 5 A kill curve to optimize the concentration of antibiotics on CHO cells. The minimal concentration that
inhibits the growth of the cells is the optimal concentration for selection. In this graph, 300 μg/mL of antibiotics
is the optimal concentration for selection
References
1. Kim JY, Kim YG, Lee GM (2012) CHO cells antibody-dependent cellular cytotoxicity.
in biotechnology for production of recombi- Biotechnol Bioeng 87:614–622
nant proteins: current state and further poten- 3. Hacker D, Jesus MD, Wurm FM (2009)
tial. Appl Microbiol Biotechnol 93:917–930 25 Years of recombinant proteins from reactor-
2. Yamane-Ohnuki N, Kinoshita S, Inoue- grown cells – where do we go from here?
Urakubo M, Kusunoki M, Lida S, Nakano R, Biotechnol Adv 27:1023–1027
Wakitani M, Niwa R, Sakurada M, Uchida K, 4. Borth N, Zeyda M, Katinger H (2000) Efficient
Shitara K, Satoh M (2004) Establishment of selection of high-producing subclones during
FUT8 knockout Chinese hamster ovary gene amplification of recombinant Chinese
cells: an ideal host cell line for producing com- hamster ovary cells by flow cytometry and cell
pletely defucosylated antibodies with enhanced sorting. Biotechnol Bioeng 71:266–273
Construction of Anti-Apoptotic Cell Line 85
5. Kim JD, Yoon Y, Hwang HY, Park JS, Yu S, 13. Cost GJ, Freyvert Y, Vafiadis A, Santiago Y,
Lee J, Baek K, Yoon J (2005) Efficient selec- Miller JC, Rebar E, Collingwood TN, Snowden
tion of stable Chinese hamster ovary (CHO) A, Gregory PD (2010) Bak and Bax deletion
cell lines for expression of recombinant pro- using zinc-finger nucleases yields apoptosis-
teins by using human interferon beta SAR ele- resistant CHO cells. Biotechnol Bioeng
ment. Biotechnol Prog 21:933–937 105:330–340
6. Grav LM, Lee JS, Gerling S, Kallehauge TB, 14. Silva G, Poirot L, Galetto R, Smith J, Montoya
Hansen AH, Kol S, Lee GM, Pedersen LE, G, Duchateau P, Paques F (2011) Mega
Kildegaard HF (2015) One-step generation of nucleases and other tools for targeted genome
triple knockout CHO cell lines using CRISPR/ engineering: perspectives and challenges for
Cas9 and fluorescent enrichment. Biotechnol gene therapy. Curr Gene Ther 11:11–27
J 10:1446–1456 15. Reynolds JE, Yang T, Qian L, Jenkinson JD,
7. Hwang SO, Lee GM (2008) Nutrient depriva- Zhou P, Eastman A, Craig RW (1994) Mcl-1, a
tion induces autophagy as well as apoptosis in member of the Bcl-2 family, delays apoptosis
Chinese hamster ovary cell culture. Biotechnol induced by c-Myc overexpression in Chinese
Bioeng 99:678–685 hamster ovary cells. Cancer Res 54:6348–6352
8. Arden N, Betenbaugh MJ (2004) Life and 16. Majors BS, Betenbaugh MJ, Pederson NE,
death in mammalian cell culture: strategies for Chiang GG (2009) Mcl-1 overexpression leads
apoptosis inhibition. Trends Biotechnol 22: to higher viabilities and increased production
174–180 of humanized monoclonal antibody in Chinese
9. Kim NS, Lee GM (2000) Overexpression of hamster ovary cells. Biotechnol Prog 25:
bcl-2 inhibits sodium butyrate-induced apop- 1161–1168
tosis in Chinese hamster ovary cells resulting in 17. Sauerwald TM, Oyler GA, Betenbaugh MJ
enhanced humanized antibody production. (2003) Study of caspase inhibitors for limiting
Biotechnol Bioeng 71:184–193 death in mammalian cell culture. Biotechnol
10. Yun CY, Liu S, Lim SF, Wang TW, Chung Bioeng 81:329–340
BYF, Teo JJ, Chuan KH, Soon ASC, Goh KS, 18. Kim NS, Lee GM (2002) Inhibition of sodium
Song Z (2007) Specific inhibition of caspase-8 butyrate-induced apoptosis in recombinant
and -9 in CHO cells enhances cell viability in Chinese hamster ovary cells by constitutively
batch and fed-batch cultures. Metab Eng expressing antisense RNA of caspase-3.
9:406–418 Biotechnol Bioeng 78:217–228
11. Figueroa B, Chen S, Oyler GA, Hardwick JM, 19. Sung YH, Lee JS, Park SH, Koo J, Lee GM
Betenbaugh MJ (2004) Aven and Bcl-xL (2007) Influence of co-down-regulation of
enhance protection against apoptosis for mam- caspase-3 and caspase-7 by siRNAs on sodium
malian cells exposed to various culture condi- butyrate-induced apoptotic cell death of
tions. Biotechnol Bioeng 85:589–600 Chinese hamster ovary cells producing throm-
12. Lim SF, Chuan KH, Liu S, Loh SOH, Chung bopoietin. Metab Eng 9:452–464
BYF, Ong CC, Song Z (2006) RNAi suppres- 20. Han YK, Kim YG, Kim JY, Lee GM (2010)
sion of Bax and Bak enhances viability in Hyperosmotic stress induces autophagy and
fed-batch cultures of CHO cells. Metab Eng apoptosis in recombinant Chinese hamster ovary
8:509–522 cell culture. Biotechnol Bioeng 105:1187–1192
Chapter 6
Abstract
MicroRNAs (miRNAs) are small, noncoding RNAs of about 22 nucleotides in length and have proven to
be useful targets for genetic modifications for desirable phenotype in the biotech industry. The use of
constitutively expressed “miRNA sponge” vectors in which multiple, tandem miRNA binding sites con-
taining transcripts are transcriptionally regulated by a constitutive promoter for down regulating the levels
of endogenous microRNAs in Chinese hamster ovary (CHO) cells has shown to be more advantageous
than using synthetic antisense oligonucleotides. The application of miRNA sponges in biotechnological
processes, however, could be more effective, if expression of miRNA sponges could be tuned. In this chap-
ter, we present a method for the generation of stable CHO cell lines expressing a TET-ON-SanDI-
miRNA-sponge that is in theory expressed only in the presence of an inducer.
1 Introduction
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_6, © Springer Science+Business Media LLC 2017
87
88 Alan Costello et al.
2 Materials
2.1 Cloning and PCR 1. Oligos: purchase from Integrated DNA Technology (IDT) or
Screening MWG Eurofins.
2. E. coli DH5α for routine subcloning kit (Invitrogen).
3. SOC medium.
4. Ampicillin, sodium salt: Prepare 100 mg/mL stock by dissolve
1 g of ampicillin in sterilized deionized water to a final volume
of 10 mL. Store aliquots at −20 °C. One mL of 100 mg/mL
stock is used for 1 L of medium to achieve a final concentration
100 μg/mL.
5. Luria Bertani (LB): Dissolve 25 g of powder LB in deionized
water to a final volume of 1 L. Autoclave.
6. Luria Bertani-Agar (LB): Dissolve 25 g of powder LB in deion-
ized water to a final volume of 1 L. Add 15 g agar. Autoclave.
Allow to cool before adding antibiotic.
7. Restriction enzymes (Thermo Fisher Scientific or New England
BioLabs), store at −20 °C.
8. Fast Alkaline Phosphatase (Thermo Fisher Scientific).
9. T4 Polynucleotide Kinase (New England BioLabs).
10. T4 ligase (Roche).
11. 10× T4 Ligation Buffer (New England BioLabs).
12. MyTaq Red DNA Polymerase (Bioline).
13. Petri Dishes.
90 Alan Costello et al.
2.2 Stable CHO Cell 1. TET-ON-SanDI-sponge vector (in house made) or basic vec-
Line Development tors can be purchased from Addgene and modified.
2. CHO cells: ATCC.
3. Medium for transfection: Dulbecco’s Modified Eagle’s Medium
(DMEM)/Nutrient Mixture F12-Ham and CHO-S- SFM
(Thermo Fisher Scientific).
4. Standard Fetal Bovine Serum (FBS).
5. 100× EDTA: add 5.3 mL 0.5 M EDTA to 44.7 mL water.
6. PBS buffer: Dissolve 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4,
and 0.24 g KH2PO4 in 800 mL water, adjust pH to 7.4. Adjust
volume to 1 L with water. Autoclave.
7. 10× Trypsin.
8. Trypsin-EDTA solution: For 500 mL: add 50 mL 10× Trypsin,
and 5 mL 100 X EDTA into 445 mL PBS.
9. Doxycycline hyclate (DOX). To make 50 mg/mL solution:
Dissolve 1 g in 20 mL sterilized water. Store at −80 °C. To
make 100 μg/mL solution, add 1 mL 50 mg/mL solution to
49 mL sterilized water. Store 1 mL aliquots at −20 °C.
10. Polyvinyl alcohol (PVA) (Sigma Aldrich) stock solution: weigh
12.6 g, add water to make up to 100 mL. Autoclave. Use 2 mL
for 100 mL of SFM.
TET-ON-SanDI-miRNA Sponge 91
3 Methods
3.1 Cloning The SanDI sponge oligos contain two miRNA-binding sites
and Screening (MBS) with SanDI overhangs for cloning and a 4–5 nucleotide
of E. coli (nt) spacer between (Fig. 1). The nucleotide composition of the
Transformant Clones spacer can be altered as required. The MBS is a sequence comple-
mentary to the mature miRNA of interest with a 3 bp mismatch
3.1.1 Design SanDI and one nucleotide deletion starting at base 9–12 from the 5′ end
Sponge Oligos for Cloning of the miRNA. This creates a bulge, inhibiting AGOII, a compo-
into the Backbone Vector nent of the RISC complex from degrading the transcript. Mature
miRNA sequences can be found on miRNA databases such as miR-
Base (http://www.mirbase.org/) or in the literature [15].
1. Obtain the mature miRNA sequence from miRBase (http://
www.mirbase.org/) or from the literature.
2. Generate the reverse complement to obtain one MBS at
http://www.bioinformatics.org/sms/rev_comp.html.
3. Manually modify to add mismatched nucleotides, avoiding the
eight nucleotides of the seed region.
4. Add a 4–5 nucleotide spacer and a second MBS unit. This is
the sense sponge oligo.
5. Generate the reverse complement of the sense sponge oligo to
obtain the antisense sponge oligo.
6. Add overhang for cloning into SanDI site.
7. Optional: Input the sense-bulged sponge oligo into the online
miRNA prediction tool http://genie.weizmann.ac.il/pubs/
mir07/mir07_prediction.html or STarMir ohttp://sfold.
wadsworth.org/cgi-bin/starmir.pl. In both web sites, a lower
ddG or ∆G total is expected for the perfectly matched MBS
than the bulged MBS.
8. Oligos can be ordered from any companies that provide oligos
for standard polymerase chain reaction (PCR). Input the
sequence in the 5′–3′ orientation.
9. The same procedure is performed to design negative sponge
oligos using a scrambled (non-miRNA targeting) sequence
(Fig. 1b).
Fig. 1 Cloning oligos into TET-ON-SanDI-sponge vector. (a) Illustrates the Tetracycline inducible sponge vector
with a Tetracycline inducible promoter (tetO) transcriptionally regulates expression of an unstable green fluores-
cent protein (d2GFP) reporter gene. The transcriptional factor rtTA3 presents in the same vector and constitu-
tively expressed. An antibiotic marker (HYG) allows for the selection of stable CHO cell lines. Primers for screening
of sponge insert are red arrow heads. (b) SanDI site with its overhang bases is in red color. (c) An example of a
sponge oligo duplex design with scramble nucleotides (capital letters) for NC (top two lines) or two binding sites
for CHO miR-204 (cgr-miR-204) (bottom three lines). Overhang bases in the duplex for cloning into vector are in
red color, and the spacer sequences between each binding site are in green. The blue turquoise color letters are
modified nucleotides for imperfect pairing of a miRNA and the miRNA sponge at the site of AGOII cleavage.
(d) PCR screening for sponge inserts of different size. Amplicons from different transformant E. coli clones (lanes
2–9), 100 bp DNA ladder (lanes 1 and 10)
TET-ON-SanDI-miRNA Sponge 93
3.1.2 Cloning SanDI- For Oligo Annealing and Phosphorylation (see Note 1).
Sponge Oligos
1. Resuspend the oligos in nuclease-free water to give a 100 μM
into Backbone
stock solution.
TET-ON-SanDI- Vector
2. In a clean 0.2 mL PCR tube make up the following reaction:
1 μL 100 μM Oligo 1
1 μL 100 μM Oligo 2
1 μL 10× T4 Ligation buffer
6.5 μL Nuclease-free water
0.5 μL T4 Polynucleotide Kinase (PNK)
4. Perform PCR reaction with 1 μL cells. Make a PCR master mix
with the following components per reaction:
5 μL 2× MyTaq reaction mix
0.5 μL 10 μM forward primer
0.5 μL 10 μM reverse primer
3 μL Nuclease-free water
3.2.2 Induction Testing DOX is quite toxic to CHO cell viability and unstable at 37 °C;
(See Note 5) therefore, a range of concentrations of DOX (from 10 ng to
2000 ng/mL) should be tested to determine the concentration of
DOX suitable for the induction of the CHO cell line of interest.
This is carried out in 24-well plates containing a 1 mL volume of
media per well as follows:
1. Dilute DOX to concentrations of 0, 10, 100, 1000 ng per
10 μL and 2000 ng per 20 μL.
2. Add 10 μL or 20 μL of each Dox concentration to triplicate
wells on days 0, 2, and 4 of CHO cell culture at a density of
2 × 105 cells/mL.
3. Take cell samples each day up to day 8 to measure cell growth
and viability using the Guava Easycyte “Viacount” programme
(Fig. 2a).
4. Induction testing should be performed using the CHO cell
pools expressing the NC. Carry out the experiment as described
above. Induction of the total mixed population reflected by
the Mean Fluorescence Intensity (MFI) value is read by the
GFP_Plus program (Guava EasyCyte) (Fig. 2b). Flow Cyto
metry (FACS) is used to obtain sub-pools for further charac-
terization in Subheading 3.2.3, with CHO parental cells used
for gating of negative GFP CHO population.
Fig. 2 (continued) induction in CHO DP12 cells. Stable negative control (NC) sponge and miR-204-sponge
expressing cell lines were tested in parallel for induction by the addition of Dox at concentrations of 0, 10, 100,
and 1000 ng/mL, to growth media on day 2, 4, 6 of culture. The % of total GFP-positive population and the mean
fluorescence intensity (MFI) of NC-sponge cell line and miR204-sponge cell line are shown (third panel and
bottom panel, respectively). Statistics were carried out by a two-tailed homoscedastic Student t-test, (*p ≤ 0.05,
**p ≤ 0.01, ***p ≤ 0.001). Experimental replicates (n = 3)
TET-ON-SanDI-miRNA Sponge 97
a 1E+07
9E+06 0 ng/mL
10 ng/mL
8E+06
100 ng/mL
7E+06
1000 ng/mL
6E+06
VCD /ml 2000 ng/mL
5E+06
4E+06 **
3E+06
2E+06
** *** ***
1E+06
*** *** ***
0E+00
0 2 4 6 8 10
Time (days)
110
100
90
80
70
% Viability
60 **
50
0 ng/mL ***
40
10 ng/mL
30
100 ng/mL
20
1000 ng/mL
10
2000 ng/mL
0
0 2 4 6 8 10
b Time (days)
100
NC-spg Day2
% of Population GFP(+)
80 204-spg Day2
NC-spg Day4
204-spg Day4 **
60
NC-spg Day6
204-spg Day6 ** *
40
**
20
0
0 ng/mL 10 ng/mL 100 ng/mL 1000 ng/mL
[Doxycycline]
600
NC-spg Day2 **
500 204-spg Day2
NC-spg Day4
400 204-spg Day4
300 NC-spg Day6
MFI
204-spg Day6
200
100 **
*
0
0 ng/mL 10 ng/mL 100 ng/mL 1000 ng/mL
[Doxycycline]
Fig. 2 Evaluating the effect of Doxycycline on CHO DP12 cell growth and viability and induction testing.
(a) DP12 cells were grown in media supplemented with different concentrations of Doxycycline 0, 10, 100,
1000, and 2000 ng/mL at day 0 of culture at a density of 2 × 105 cells/mL. The effects of these doxycycline
concentrations on cell growth reflected by Viable Cell Density (VCD) value (top panel) and viability (second panel)
are shown. Statistics were carried out by a two-tailed homoscedastic student t-test (*p ≤ 0.05, **p ≤ 0.01,
***p ≤ 0.001). Experimental replicates (n = 2). (b) The TET-ON-SanDI-miRNA sponge vector was tested for
98 Alan Costello et al.
3.2.3 Induction The sub-pools of transfected cells obtained using FACS can initially
for Phenotyping be characterized at the molecular level to determine the level of
and Molecular Analysis endogenous miRNAs and GFP. These characterizations should be
carried out in parallel for both sets of pools, i.e., miRNA-sponge
and NC sponge, in the absence and presence of inducer. Induction
of TET-ON systems can be achieved with as little as 10 ng/mL
DOX (Fig. 2b) which is not detrimental to CHO cells. Experiments
can be set up in 5 mL of suspension cells in a 50 mL reactor tube
for convenience. However, this experiment can also be used in
attached cells if desired. Each cell pool (miRNA sponge and NC)
and condition (induced and un-induced) should be done in trip
licates. Total RNA can be prepared using the standard Triazol
reagent and protocol which is followed by the reverse transcription
reaction using the TagMan® MicroRNA Reverse Transcription kit.
The levels of endogenous miRNAs can then be determined using
the miRNA specific Taqman assays. The choice of endogenous
controls is extremely important to avoid variations among samples;
therefore, commonly used RNA references (e.g., 5S RNA, U6
small noncoding RNA) should be tested before use to normalize
the signals in the miRNA specific Taqman assays. Either β-actin
or Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) can be
used a reference for endogenous genes. Subsequently, a wide range
of bioprocess-related phenotypes of CHO cell pools or sub-pools
expressing the inducible sponge vectors can be further character-
ized such as cell proliferation, life span of the CHO culture, bio-
pharmaceutical product quality, or stress response.
Functional characterization of single, stable clones expressing
the TET-ON miRNA sponge can be isolated by FACS and ana-
lyzed in similar way (see Note 6).
4 Notes
Acknowledgments
References
1. Lewis NE, Liu X, Li Y, Nagarajan H, Yerganian microRNA inhibition. PLoS One 7:e29275.
G, O'Brien E, Bordbar A, Roth AM, doi:10.1371/journal.pone.0029275
Rosenbloom J, Bian C, Xie M, Chen W, Li N, 5. Sanchez N, Kelly P, Gallagher C, Lao NT,
Baycin-Hizal D, Latif H, Forster J, Betenbaugh Clarke C, Clynes M, Barron N (2014) CHO
MJ, Famili I, Xu X, Wang J, Palsson BO (2013) cell culture longevity and recombinant protein
Genomic landscapes of Chinese hamster ovary yield are enhanced by depletion of miR-7 activ-
cell lines as revealed by the Cricetulus griseus ity via sponge decoy vectors. Biotechnol
draft genome. Nat Biotechnol 31:759–765. J 9:396–404. doi:10.1002/biot.201300325
doi:10.1038/nbt.2624 6. Kelly PS, Breen L, Gallagher C, Kelly S, Henry
2. Jadhav V, Hackl M, Druz A, Shridhar S, Chung M, Lao NT, Meleady P, O'Gorman D, Clynes
CY, Heffner KM, Kreil DP, Betenbaugh M, M, Barron N (2015) Re-programming CHO
Shiloach J, Barron N, Grillari J, Borth N cell metabolism using miR-23 tips the balance
(2013) CHO microRNA engineering is grow- towards a highly productive phenotype.
ing up: recent successes and future challenges. Biotechnol J 10:1029–1040. doi:10.1002/
Biotechnol Adv 31:1501–1513. doi:10.1016/j. biot.201500101
biotechadv.2013.07.007 7. Brinster RL, Chen HY, Warren R, Sarthy A,
3. Ebert MS, Neilson JR, Sharp PA (2007) Palmiter RD (1982) Regulation of metallo-
MicroRNA sponges: competitive inhibitors of thionein--thymidine kinase fusion plasmids
small RNAs in mammalian cells. Nat Methods injected into mouse eggs. Nature 296:39–42
4:721–726 8. Mayo KE, Warren R, Palmiter RD (1982) The
4. Kluiver J, Gibcus JH, Hettinga C, Adema A, mouse metallothionein-I gene is transcription-
Richter MK, Halsema N, Slezak-Prochazka I, ally regulated by cadmium following trans
Ding Y, Kroesen BJ, van den Berg A (2012) fection into human or mouse cells. Cell 29:
Rapid generation of microRNA sponges for 99–108
100 Alan Costello et al.
9. Lee F, Mulligan R, Berg P, Ringold G (1981) 15. Hackl M, Jakobi T, Blom J, Doppmeier D,
Glucocorticoids regulate expression of dihy- Brinkrolf K, Szczepanowski R, Bernhart SH,
drofolate reductase cDNA in mouse mammary Höner Zu Siederdissen C, Bort JA, Wieser M,
tumour virus chimaeric plasmids. Nature 294: Kunert R, Jeffs S, Hofacker IL, Goesmann A,
228–232 Pühler A, Borth N, Grillari J (2011) Next-
10. Lee SW, Tsou AP, Chan H, Thomas J, Petrie K, generation sequencing of the Chinese hamster
Eugui EM, Allison AC (1988) Glucocorticoids ovary microRNA transcriptome: identification,
selectively inhibit the transcription of the inter- annotation and profiling of microRNAs as tar-
leukin 1 beta gene and decrease the stability of gets for cellular engineering. J Biotechnol
interleukin 1 beta mRNA. Proc Natl Acad Sci 153(1–2):62–75
U S A 85:1204–1208 16. Zabala M, Wang L, Hernandez-Alcoceba R,
11. Gossen M, Bujard H (1992) Tight control Hillen W, Qian C, Prieto J, Kramer MG (2004)
of gene expression in mammalian cells by Optimization of the Tet-on system to regulate
tetracycline-responsive promoters. Proc Natl interleukin 12 expression in the liver for the
Acad Sci U S A 89(12):5547–5551 treatment of hepatic tumors. Cancer Res
12. Tovar K, Hillen W (1989) Tet repressor bind- 64:2799–2804
ing induced curvature of tet operator DNA. 17. McGee Sanftner LH, Rendahl KG, Quiroz D,
Nucleic Acids Res 17:6515–6522 Coyne M, Ladner M, Manning WC, Flannery
13. Gossen M, Freundlieb S, Bender G, Müller G, JG (2001) Recombinant AAV-mediated deliv-
Hillen W, Bujard H (1995) Transcriptional ery of a tet-inducible reporter gene to the rat
activation by tetracyclines in mammalian cells. retina. Mol Ther 3:688–696. doi:10.1006/
Science 268(5218):1766–1769 mthe.2001.0308
14. Hecht B, Muller G, Hillen W (1993) Non 18. Sinacore MS, Drapeau D, Adamson SR (2000)
inducible Tet repressor mutations map from Adaptation of mammalian cells to growth
the operator binding motif to the C terminus. in serum-free media. Mol Biotechnol 15:
J Bacteriol 175:1206–1210 249–257
Chapter 7
Abstract
Genome editing has become an increasingly important aspect of Chinese Hamster Ovary (CHO) cell line
engineering for improving production of recombinant protein therapeutics. Currently, the focus is directed
toward expanding the product diversity, controlling and improving product quality and yields. In this
chapter, we present our protocol on how to use the genome editing tool Clustered Regularly Interspaced
Short Palindromic Repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) to knockout engineering tar-
get genes in CHO cells. As an example, we refer to the glutamine synthetase (GS)-encoding gene as the
knockout target gene, a knockout that increases the selection efficiency of the GS-mediated gene amplifica-
tion system.
Key words Chinese Hamster Ovary Cells, CRISPR/Cas9, Genome editing, Glutamine synthetase,
Knockout, Recombinant protein production
1 Introduction
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_7, © Springer Science+Business Media LLC 2017
101
102 Lise Marie Grav et al.
2 Materials
2.1 sgRNA 1. Target sequence analysis software, e.g., CRISPy tool available
Expression Plasmid for free online.
Construction 2. Glycerol stock of E. coli transformed with sgRNA expression
plasmid (from Ronda et al. [9]).
3. 2× YT medium.
4. Kanamycin.
5. 500 mL baffled Erlenmeyer shake flask.
6. Sterile pipette tips.
7. Incubator with shaker, 37 °C, 250 rpm.
8. Plasmid midi- or maxiprep kit (Machery-Nagel).
9. Sterile Milli-Q water.
10. NanoDrop 2000 (Thermo Scientific).
11. PCR primers for amplification of sgRNA backbone (for design
instructions see Subheading 3.2.2).
12. Primers containing the sgRNA sequence (for design instruc-
tions, see Subheading 3.2.3).
13. Phusion U polymerase (Thermo Scientific).
14. 5× HF Buffer (Thermo Scientific).
15. dNTPs.
16. PCR tubes.
17. Thermocycler.
18. Fast Digest DpnI enzyme (Thermo Scientific).
19. 10× Green Buffer (Thermo Scientific).
20. 1 kb DNA ladder.
21. 1% agarose gel: 1 g agarose powder (Bio-Rad) dissolved in
100 mL 1× TAE buffer (Sigma).
22. Gel chamber and power source.
23. PCR and gel purification kit (Machery-Nagel).
24. 10× NEBuffer 4 (New England Biolabs).
25. Heat block.
26. USER enzyme (New England Biolabs).
27. 10× BSA (New England Biolabs).
28. 1.5 mL eppendorf tubes.
29. Mach1 competent E. coli cells (Thermo Scientific).
30. Heat block, 37 °C, 300 rpm.
31. Table top centrifuge.
32. Sterile spatula.
104 Lise Marie Grav et al.
2.2 Prepare GFP 2A 1. Glycerol stock with E. coli transformed with GFP 2A peptide-
Peptide-Linked Cas9 linked Cas9 expression plasmid (from Grav et al. [5]).
Expression Plasmid 2. Ampicillin.
3. LB-ampicillin agar plates: 15 g/L Agar, 10 g/L Tryptone,
10 g/L NaCl, 5 g/L Yeast Extract, 60 μg/mL ampicillin.
4. FACS tubes.
5. 30 μm cell strainer.
6. Celigo cytometer or microscope.
7. Humidified incubator, 37 °C, 5% CO2, no shake.
8. 96-well plates, flat bottom (Corning #351172).
9. Clone expansion medium: CD CHO medium (Life Techno
logies) supplemented with 8 mM l-glutamine (Lonza), 1%
Antibiotic-
Antimycotic 100× (Gibco), and 1 μL/mL Anti-
clumping agent (Life Technologies #0010057AE).
10. 96-well plates, V-Shaped (Greiner bio-one #651161).
11. Breathable plastic bag.
3 Methods
target sgRNA
U6 sequence scaffold GFP
5’-GNNNNNNNNNNNNNNNNNNNNGG-3’
2A
promoter termination Cas9
signal
sgRNA plasmid
Fig. 1 Schematic outline of the experimental setup for the method described in this chapter
3.2 sgRNA Plasmid 1. Request the sgRNA plasmid from Ronda et al. [9] and gener-
Construction ate a bacterial glycerol stock (or prepare it from scratch follow-
ing the method described in the publication).
3.2.1 Prepare sgRNA
Backbone Plasmid 2. Use the tip of a sterile pipette tip and scrape the bacterial stock,
add the pipette tip to 100–200 mL of 2× YT medium supple-
mented with 50 μg/mL kanamycin, and incubate overnight at
37 °C with shaking at 250 rpm.
3. Isolate plasmid DNA using a plasmid midi- or maxiprep kit,
resuspend at 1 μg/μL in Milli-Q water. Measure the concen-
tration using Nanodrop 2000.
3.2.2 Amplify sgRNA 1. Use the sgRNA plasmid map, and design and order uracil-
Backbone containing primers to amplify the sgRNA backbone. The prim-
ers should amplify the sgRNA backbone so that it acquires
overhangs after Uracil-Excision Specific Reagent (USER)
treatment that is compatible for USER fusion with the over-
hangs of the annealed primers from Subheading 3.2.3, as
described in Fig. 2b. Alternatively, apply primers previously
published [9].
A Target sequence PAM
N (19) + G NGG
5’ -NNNNNNNNN GNNNNNNNNNNNNNNNNNNNAGGNNNNNNNNNNN- 3’
3’ -NNNNNNNNN CNNNNNNNNNNNNNNNNNNN TCC NNNNNNNNNNN- 5’
Target complementary
B sequence G+N (19)
Forward sgRNA primer NNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Reverse sgRNA primer NNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNN
Anneal primers
Annealed NNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
sgRNA primers NNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNN
+
sgRNA
scaffold
U6 N
NNNN
NN
NNNN NNU
NN
NNN
NN NNN N
NNNN termination
promoter
N
UNN
signal
PCR amplified
backbone
USER treatment
target sgRNA
sequence scaffold
U6 termination
promoter signal
sgRNA plasmid
Fig. 2 An outline of the target gene and target sequence, and a schematic overview of how to construct the
sgRNA expression plasmid. (a) An outline of the target gene showing the target sequence (5′-G+N(19)-3′) and
the PAM sequence (5′-NGG-3′) in relation to each other. (b) Schematic overview of the sgRNA plasmid con-
struction described in Subheading 3.2. A simple way to construct your sgRNA plasmid is by ordering your
target complementary sequence as primers. You can keep your sgRNA “constant” and just exchange the target
complementary sequence. The primers for the target sequence are designed to anneal and give rise to over-
hangs that match overhangs generated after USER treatment of the amplified sgRNA backbone. In this case,
the following uracil containing primers would be used for amplifying the backbone: Fwd: AGCTAGAAA
UAGCAAGTTAAAATAAGGC and Rev.: ACAAGATAUATAAAGCCAAGAAATCGA. After assembly of the annealed
primers and the amplified sgRNA backbone upon USER enzyme treatment, you will attain the complete sgRNA
expression construct
108 Lise Marie Grav et al.
Table 1
PCR program to amplify the sgRNA backbone
Table 2
Components of reaction for assembly of backbone and sgRNA insert
3.2.5 Transformation 1. Add 1.5 μL of USER reaction to 15 μL competent E. coli cells
of sgRNA Plasmid in E. coli in an Eppendorf tube and incubate on ice for 30 min.
2. Heat shock at 42 °C for 30 s.
3. Return to ice and keep it there for 1 min.
4. Add 1 mL 2× YT medium to the Eppendorf tube and incubate
the mixture at 37 °C for 1 h at 300 rpm shake.
5. Pellet the cells at 2000 × g for 3 min.
6. Remove the supernatant, resuspend the pellet in 100 μL 2× YT
medium, and plate it using a sterile spatula on a pre-warmed
(37 °C) kanamycin agar plate.
7. Incubate the plates upside down at 37 °C overnight.
3.2.6 Analyze 1. Pick a colony using a pipette tip and transfer it to 4 mL 2× YT
and Prepare sgRNA medium supplemented with 50 μg/mL kanamycin in a 10 mL
Plasmid bacterial culture tube.
2. Shake cells at 250 rpm at 37 °C for 5 h.
3. Isolate plasmid DNA using a plasmid miniprep kit and use this
for sanger sequencing. Use a primer for sequencing that
anneals before the U6 promoter and covers the target sequence,
to make sure your sgRNA expression cassette does not contain
any mutations using a sequence analysis software, e.g., CLC
Main Workbench.
110 Lise Marie Grav et al.
3.3 Prepare the GFP 1. Request the GFP 2A peptide-linked Cas9 expression plasmid
2A Peptide-Linked (GFP_2A_Cas9) plasmid from Grav et al. [5], and generate a
Cas9 Expression bacterial glycerol stock (or prepare it from scratch following
Plasmid the method described in the publication).
2. Use the tip of a sterile pipette tip and scrape the bacterial stock,
add the pipette tip to 100–200 mL of 2× YT medium supple-
mented with 60 μg/mL ampicillin, and incubate overnight at
37 °C with shaking at 250 rpm.
3. Isolate plasmid DNA using a plasmid midi- or maxiprep kit,
resuspend 1 μg/μL in sterile Milli-Q water. Measure the
concentration using Nanodrop 2000. Use this product for
transfection.
3.4 Transfection 1. Use healthy (above 95% viability) CHO-S cells at a low
of CHO-S Cells passage.
3.4.1 Day 0: Washing 2. Count cells using a NucleoCounter.
and Seeding Cells 3. Harvest 1.5–2 × 106 cells (for a single transfection in 1 × 6
for Transfection well), spin down cells at 200 × g for 5 min, and remove the
supernatant.
4. Wash cells with preheated CD CHO medium supplemented
with 8 mM glutamine (no anti-clumping agent), spin down at
200 × g for 5 min, and remove the supernatant.
5. Inoculate cells at 5–6 × 105 cells/mL in 1 × 6 well with pre-
heated growth medium.
6. Incubate cells at 37 °C, 5% CO2, and shake at 120 rpm for
1 day.
3.4.2 Day 1: Transfection 1. Count cells and inoculate cells at 1 × 106 cells/mL in 3 mL
preheated growth medium in a 6-well plate.
2. Use a total amount of 3.75 μg of plasmid (1:1 (w/w) of sgRNA
plasmid and Cas9 expression plasmid). If you want to use mul-
tiple sgRNAs, see Note 3.
3. Gently mix plasmids with 60 μL OptiPRO™ SFM reduced
serum medium.
4. Dilute 3.75 μL FreeStyle™ MAX reagent in 60 μL OptiPRO™
SFM reduced serum medium. Mix gently and add to plasmid
premix (step 3).
Knockout Generation in CHO Cells using CRISPR/Cas9 111
3.5 Optional: T7 1. Harvest 50 μL cells 2 days after transfection, spin down at
Endonuclease Assay 1000 × g, remove the supernatant, and add 20 μL quick extract
to Check if Your and incubate at 65 °C for 15 min followed by 95 °C for 5 min.
sgRNA Works Store at −20 °C.
2. Design primers using, e.g., NCBI Primer-BLAST tool (http://
www.ncbi.nlm.nih.gov/tools/primer-blast/) so that a prod-
uct between 600 and 1000 bp will be amplified. This product
should span the selected target sequence in your target gene.
The T7 endonuclease will cleave the product where an indel is
present when hybridized to wild-type sequence. Design your
primers so that the PCR product after cleavage will give bands
of different sizes that are separable on an agarose gel.
3. Mix the following components in a PCR tube (prepare one for
quick extract of the transfected pool of cells and one for quick
extract from CHO-S cells):
–– 10 μL 2× Phusion Master Mix.
–– 1 μL Primer Forward (10 μM).
–– 1 μL Primer Reverse (10 μM).
–– 1 μL DNA template (quick extract from step 1).
–– 7 μL Milli-Q water.
4. Place the PCR tube in a thermocycler, and run the following
program as outlined in Table 3:
5. Run 5 μL of the PCR product next to a 1 kb DNA ladder on a
1% agarose gel. There should be only one clear band (if not
redo and/or troubleshoot your PCR).
6. Transfer 10 μL to a new PCR tube.
7. Place the PCR tube in a thermocycler and run the following
T7 endonuclease annealing program as outlined in Table 4.
8. Divide the PCR product into two PCR tubes (5 μL in each
tube).
9. Mix the components for the following two reactions (T7+ and
T7−) as outlined in Table 5.
10. Incubate the PCR tubes for 30 min at 37 °C.
11. Load the products on a 4% E-Gel or equivalent, and run for
approximately 30 min. Your results should be similar to what is
shown in Fig. 3a.
112 Lise Marie Grav et al.
Table 3
PCR program for T7 endonuclease assay
Table 4
T7 endonuclease annealing program
85 00:01 300
−0.2 s−1
4 ∞
Table 5
Components of T7+ and T7− reactions
Fig. 3 Analysis of genome modifications. (a) T7 endonuclease assay of a pool of cells 2 days after transfection,
showing that a sgRNA complementary sequence to a selected target site is capable of generating indels. The
samples are analyzed on a 4% E-Gel, where the two first lanes (1 and 2) are not treated with T7 endonuclease,
and the two last lanes (3 and 4) are treated with T7 endonuclease. Samples in lane 2 and 4 are transfected
with GFP_2A_Cas9 and a sgRNA, while the other two samples are un-transfected. After T7 endonuclease
treatment, the un-transfected sample shows two bands, while the transfected sample shows two additional
bands at expected sizes, designated by arrows. A result like this shows that a selected sgRNA is capable of
generating indels at the target site. The percentage of indels generated in this case is estimated to 9.3, by
using ImageJ software. (b) An example of sanger sequencing analysis of a target sequence region. The align-
ment shows that out of four sequences, in this case, there are one sequence with an indel of −10, one with an
indel of +1, and two that still have the wild-type sequence (no indel)
3.6 Generation 1. Two to three days after transfection, prepare wanted number
of Clonal Cell Lines of 384-well flat-bottom plates (see Note 4) with 30 μL FACS
Using FACS sorting medium.
2. Strain cells through a 30 μm cell strainer into a FACS tube.
3. Using a FACS, sort for GFP-positive single cells into one or
more pre-warmed (37 °C) 384-well plates. If a FACS is not
available, an alternative method can be used (see Note 5).
4. Spin plates at 200 × g for 5 min to make sure cells reach the
medium.
5. Place cells in a breathable plastic bag (to limit evaporation),
and incubate cells at 37 °C, 5% CO2, no shake for 10 days.
6. Check for surviving cells using a microscope or Celigo cytom-
eter. Cell count should preferably be around >1000 in a well or
confluency >50%.
114 Lise Marie Grav et al.
3.7 Analysis of Gene 1. Mix the following components in a PCR tube (per clone you
Modifications: Sanger have generated):
Sequencing –– 10 μL 2× Phusion Master Mix.
–– 1 μL Primer Forward (10 μM).
–– 1 μL Primer Reverse (10 μM).
–– 1 μL DNA template (quick extract from Subheading 3.6).
–– 7 μL Milli-Q water.
2. Place the PCR tube in thermocycler, and run the following
program as shown in Table 6.
3. Run the PCR product on a 1% agarose gel, cut out the band
with the expected amplicon size, and purify it using a gel
and PCR purification kit. Measure the concentration using
Nanodrop 2000.
Table 6
PCR program for analysis of gene modifications
3.8 Expansion 1. Select clones with indels that lead to a frameshift, which indi-
of Clone Candidates cates that you have rendered the gene dysfunctional. Even if
the analysis shows there is a frameshift, it is important to verify
that it is a real knockout, e.g., by western blotting (see Note 8)
and/or a functional assay (see Note 9).
2. Move the selected clones from the 96-well plate when >90%
confluent to a 12-well flat-bottom plate, maintain in the
12-well plate until confluent, and then move to a 6-well flat-
bottom plate, when confluent seed in a 125 mL shake flask at
3 × 105 cells/mL.
3. Take out the samples you need and bank the clones, using 107
cells in 1 mL conditioned medium with 5–10% DMSO. Freeze
in a Styrofoam box at −80 °C the first 24 h before moving to
permanent storage at −180 °C.
4 Notes
putative GS KO
CHO-S
Anti-Vinculin
Anti-GS
1 2
Acknowledgments
References
1. Fischer S, Handrick R, Otte K (2015) The art 6. Wurm FM (2004) Production of recombinant
of CHO cell engineering: a comprehensive ret- protein therapeutics in cultivated mammalian
rospect and future perspectives. Biotechnol cells. Nat Biotechnol 22:1393–1398
Adv 33(8):1878–1896 7. Jun SC, Kim MS, Hong HJ, Lee GM (2006)
2. Lee JS, Grav LM, Lewis NE, Faustrup Kildegaard Limitations to the development of humanized
H (2015) CRISPR/Cas9-mediated genome antibody producing Chinese hamster ovary
engineering of CHO cell factories: application cells using glutamine synthetase-mediated gene
and perspectives. Biotechnol J 10:979–994 amplification. Biotechnol Prog 22:770–780
3. Jinek M, Chylinski K, Fonfara I, Hauer M et al 8. Fan L, Kadura I, Krebs LE, Hatfield CC, Shaw
(2012) A programmable dual-RNA-guided MM, Frye CC (2012) Improving the efficiency
DNA endonuclease in adaptive bacterial immu- of CHO cell line generation using glutamine syn-
nity. Science 337:816–821 thetase gene knockout cells. Biotechnol Bioeng
4. Garneau JE, Dupuis MÈ, Villion M, Romero 109:1007–1015
DA et al (2010) The CRISPR/Cas bacterial 9. Ronda C, Pedersen LE, Hansen HG,
immune system cleaves bacteriophage and plas- Kallehauge TB, Betenbaugh MJ, Nielsen AT,
mid DNA. Nature 468:67–71 Kildegaard HF (2014) Accelerating genome
5. Grav LM, Lee JS, Gerling S, Kallehauge TB, editing in CHO cells using CRISPR Cas9
Hansen AH, Kol S, Lee GM, Pedersen LE, and CRISPy, a web-based target finding
Kildegaard HF (2015) One-step generation of tool. Biotechnol Bioeng 111:1604–1616
triple knockout CHO cell lines using CRISPR/ 10. Freshney RI (2010) Cloning and selection in:
Cas9 and fluorescent enrichment. Biotech culture of animal cells, 6th edn. Wiley,
nol J 10:1446–1456 New York, NY
Chapter 8
Abstract
Therapeutic proteins require proper folding and posttranslational modifications to be effective and
biologically active. Chinese hamster ovary (CHO) cells are by far the most frequently used host for com-
mercial production of therapeutic proteins. However, an unpredictable decrease in protein productivity
during the time required for scale up impairs process yields, time, finance, and regulatory approval for the
desired product. Therefore, it is important to assess cell lines at stages throughout the period of long-term
culture in terms of productivity and various molecular parameters including plasmid and mRNA copy
numbers and location of the plasmid on the host cell chromosome. Here, we describe methods, which are
frequently used to analyze stability of the recombinant CHO cells over long-term culture. These proce-
dures include the following; western blotting, ELISA to evaluate protein production, real-time PCR to
analyze plasmid and mRNA copy numbers, and fluorescent in situ hybridization (FISH) to assess the loca-
tion of the inserted plasmid on host cell chromosomes.
Key words CHO cells, Recombinant protein production, Western blotting, ELISA, Real-time PCR,
FISH
1 Introduction
Chinese hamster ovary (CHO) cells are the most widely used host
cell platform for the production of recombinant proteins that
require complex post-translational modifications. One of the prob-
lems often encountered, however, is that these cell lines are highly
unpredictable and display variable levels of recombinant protein
expression. In addition, it is often observed that cell lines display a
decrease in recombinant protein production during long periods
of culture. It is important for commercial production to obtain cell
lines that maintain stable production over the long-term culture
(i.e., retention of 70% of the starting value by 60 generations, a
period required to scale up to manufacture) [1–3]. If a recombi-
nant cell line fails to retain stability during prolonged culture, it
can create problems for process yield, effective use of time and
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_8, © Springer Science+Business Media LLC 2017
119
120 Zeynep Betts and Alan J. Dickson
2 Materials
2.1 Western Blot 1. RIPA buffer: 0.5% (w/v) Sodium deoxycholate, 0.2% (w/v)
SDS, 1.0% (v/v) Triton X-100, 125 mM Sodium cloride,
2.1.1 Protein Extraction
10 mM Sodium fluoride, 10 mM Sodium orthovanadate,
10 mM Sodium pyrophosphate, 25 mM HEPES, pH 7.5. Add
about 50 mL water to a glass beaker or measuring cylinder.
Weigh 0.5 g Sodium deoxycholate, 0.2 g SDS, 1 g Triton
X-100, 730 mg sodium chloride, 42 mg sodium fluoride,
1184 mg sodium orthovanadate, 446 mg sodium pyrophos-
phate, and 596 mg HEPES. Add water to a volume of
90 mL. Mix and adjust pH and make up to 100 mL with water.
Store at 2–8 °C.
2. PMSF (10 mg/mL): Dissolve 10 mg of PMSF per 1 mL of
Isopropyl alcohol. Shake well to dissolve and store at −20 °C.
3. Aprotinin: 1 mg/mL (see Note 1). Store at −20 °C.
4. Leupeptin: 1 mg/mL (see Note 2). Store at −20 °C.
5. Trypsin solution (1× EDTA in Hank’s Balanced Salt Solution
(HBSS) without calcium or magnesium).
2.1.2 Bradford Assay 1. BSA standard: 100 μg/mL (see Note 3). Store at 2–8 °C.
2. Bio-rad Protein Assay.
2.1.3 SDS- 1. Separating gel buffer: 1.5 M Tris, 14 mM SDS, pH 8.8. Weigh
Polyacrylamide Gel 45.4 g Tris–HCl and 1 g SDS and transfer to a glass beaker or
a measuring cylinder. Add 200 mL water and adjust the
pH. Make up the final solution to 250 mL by adding water.
Store at 2–8 °C.
2. Stacking gel buffer: 0.5 M Tris, 14 mM SDS, pH 6.8. Weigh
15 g Tris–HCl and 1 g SDS and prepare a 250 mL solution as
in the previous step. Store at 2–8 °C.
CHO Cell Line Stability Analysis During Long-Term Culture 123
2.5 Fluorescence 1. Hypotonic solution (75 mM KCl): Weigh 2.8 g KCl and dis-
In Situ Hybridization solve in 500 mL of water.
(FISH) 2. Fixative: Methanol:Acetic acid (3:1). Measure 300 mL of
methanol and transfer to a glass bottle. Add 100 mL of acetic
acid. Mix well and store at −20 °C.
3. 0.5 M EDTA (pH 8.0): Weigh 14.612 g EDTA and dissolve in
70 mL water. Adjust pH to 8.0 and bring the volume up to
100 mL with water.
4. TBE buffer (0.09 M Tris, 0.09 M orthoboric acid and 0.2 mM
EDTA, pH 8.0): Prepare 10× concentrated stock TBE buffer
and dilute the solution to 1× before use (1:10, see Note 13).
5. 2% (w/v) agarose: Add 1 g agarose in 50 mL TBE buffer.
Dissolve agarose by heating in a microwave. Cool it down to
55 °C and add 5 μL EtBr.
6. Loading buffer 10× concentrated (100 mM EDTA [pH 8.0],
100 mM Tris–HCl [pH 7.4], 100 mM Tris–HCl, ~0.5% [w/v]
bromophenol blue, and 25% [w/v] Ficoll): Weigh 2.5 g
Ficoll-400. Measure 1 mL 1 M Tris–HCl (see Note 14) and
2 mL 0.5 M EDTA. Bring the solution to 10 mL with water,
heating to 65 °C. Add 25–50 mg bromophenol blue dye.
7. Pepsin/HCl solution (0.05% [w/v] pepsin, 0.01 M HCl):
Prepare 5% w/v pepsin with water and store in aliquots before
use (see Note 15).
8. 10% FBS/PBS (v/v): Add 10 mL FBS into 90 mL PBS.
9. FISH probe hybridization buffer (10% dextran sulfate (v/v),
50% formamide (v/v), 2× SSC [0.3 M NaCl, 0.03 M tri-
sodium citrate, pH 7.0]): Dilute 20× SSC (see Note 16) into
4× SSC (i.e., 0.4 mL 20× SSC with 1.6 mL water). Add 20 μL
Tween-20 (~3 drops). Add 0.2 g Dextran sulfate and vortex
until dissolved. Place 1 mL of this solution into a clean tube.
Add 1 mL of high grade formamide (carry out in a fume hood).
Mix the solution (see Note 17).
10. 50% formamide/2× SSC (v/v): Mix 50 mL formamide, 10 mL
20× SSC, and 40 mL water. Store at −20 °C in aliquots of
50 mL or make up fresh on the day of use.
11. 1% (v/v) FBS/PBS: Mix 1 mL of FBS with 99 mL of PBS.
126 Zeynep Betts and Alan J. Dickson
3 Methods
3.1.2 Protein 1. Prepare standard BSA solution (100 μg/mL) and dilute the
Quantitation by Bradford cell lysates to an appropriate degree for assessment against the
Assay standard.
2. For the generation of standard curves, add BSA standard and
water to the wells in the range of 5–60 μL up to a total volume
of 60 μL in each well.
3. Add 1 μL of diluted cell lysates and 59 μL water to the other
wells. Analyze cell lysates and standards in duplicate.
4. Dilute Bio Rad protein assay reagent in 1:3 and add 60 μL of
this diluted reagent to all wells.
5. Measure the absorbance at 570 nm in a plate reader after
10–15 min.
6. Calculate the protein amount in cell lysates by comparing to
the standard curve generated with BSA.
3.1.3 SDS- The system consists of a 12.5% (w/v) separating gel overlaid by a
Polyacrylamide Gel 4% (w/v) stacking gel.
1. Prepare separating gel by mixing 6.2 mL Protogel solution
(30% [w/v] Acrylamide), 3.75 mL separating buffer, and
5.05 mL ddH2O in a 50 mL conical tube.
CHO Cell Line Stability Analysis During Long-Term Culture 127
3.1.4 Protein Transfer 1. After the separation, remove the gels from stand and soak them
and Western Blotting in blotting buffer for 20 min.
2. Cut nitrocellulose membrane to the approximate gel size and
place the membrane and two pieces of transfer pad per gel into
blotting buffer for 10 min prior to use.
3. Place a soaked transfer pad onto the lower plate of a Semi-Dry
electroblotter (see Note 21). Place the membrane onto the
pad, and carefully place the gel onto the membrane. Finally,
place the second piece of transfer pad on the top of the gel
(see Fig. 1).
4. Secure the lid and transfer the gel at 15 V for 45–60 min.
5. To assess whether proteins are transferred successfully, stain
the membrane with Ponceau stain. To remove the stain, add a
small amount of TBS-Tween and shake for a few minutes.
128 Zeynep Betts and Alan J. Dickson
Fig. 1 Gel-membrane assembly for the transfer of proteins from SDS-PAGE gels to nitrocellulose membranes
3.2.2 ELISA 1. Coat the wells of a PVC immunoassay plate with the capture
antibody specific for a protein of interest at a final concentra-
tion of 1–10 μg/mL. Load 100 μL per well.
CHO Cell Line Stability Analysis During Long-Term Culture 129
3.3 Plasmid and RNA All procedures should be carried out at room temperature unless
Copy Number Analysis otherwise stated.
by Real-Time PCR
1. Harvest anchorage-dependent cells by removing the medium
3.3.1 Genomic DNA and washing the cell layer with 5 mL PBS. Add 3 mL trypsin
Extraction solution and agitate by hand until the cells are detached. Stop
trypsinization by adding an equal amount of growth medium.
Transfer the cells to a 50 mL tube and centrifuge at 100 × g for
5 min. For suspension cells simply centrifuge at 100 × g for
5 min. Discard the supernatant and resuspend the cells in
10 mL of PBS for counting.
2. Use approximately 2 × 107 cells. Wash the cell pellet three
times in 1× PBS with centrifugation at 100 × g for 10 min
between each wash.
130 Zeynep Betts and Alan J. Dickson
Table 1
Overview of how to calculate the molecular mass of plasmid
Number of bases
Base in plasmida Molecular weight of bases (g/mol) Calculation
A a 331.2 = a × 331.2
C c 307.2 = c × 307.2
G g 347.2 = g × 347.2
T t 322.2 = t × 322.2
Total molecular weight of plasmid Sum of above
(total Mw)
Avogadro constant 6.022 × 1023 molecules/mol
Mass of one plasmid copy (g) Total Mw/6.022 × 1023
Number of bases must include sense and anti-sense strands
a
3.3.4 Data Analysis 1. After the cycles are complete, the SYBR green fluorescence of
each sample can be visualized by using appropriate software.
After a successful real-time PCR experiment, the SYBR green
fluorescence is plotted against the number of cycles, creating
the initial lag, the exponential increase, and the plateau phases.
Set up the threshold within the exponential phase start and
132 Zeynep Betts and Alan J. Dickson
0.25
Plateu
0.2
Fluorescence
0.15
Ct value
0.1
Threshold
0.05
0
10 20 30
Cycle
Fig. 2 Diagram shows the principle of real-time PCR using three representative samples
determine the Ct values for each sample (the cycle value at the
point where the sample line crossed the threshold, see Fig. 2).
The inclusion of standard curves allows the program to calcu-
late the amplification efficiency and the relative quantity of the
target sequence in every sample.
2. To increase accuracy the value of the abundance of each target
sequence can be standardized to the abundance of the house-
keeping gene.
3. Assess the melting curve to check the quality of the amplified
product where a single peak at between 80 and 90 °C indicates
a pure product.
3.3.5 RNA Extraction All tubes, tips, and solutions should be RNase free.
1. For anchorage-dependent cells, remove medium from culture
and lyse cells by adding of 1 mL of denaturing solution per
10 cm2 and passing the cell lysate several times through a
pipette (see Notes 25 and 26).
2. For cells in suspension, pellet cells by centrifugation. Determine
the amount of viable cells and add 1 mL denaturing solution
per 1 × 107 cells to cell pellets directly (see Note 27). Resuspend
the lysate with a disposable 1 mL pipette by pipetting up and
down at least ten times.
3. Aliquot the cell lysate into a 4 mL polypropylene tube.
4. Add 0.1 mL of 2 M sodium acetate to 1 mL of lysate and mix
thoroughly by inversion.
CHO Cell Line Stability Analysis During Long-Term Culture 133
3.3.7 cDNA Synthesis 1. Add 1 μL of Oligo (dT)18 and 1 μL of 10 mM dNTP to DNase
I-treated samples (on ice) and incubate at 65 ° C for 10 min.
Place on ice for 2 min.
2. Prepare the following reaction mix per sample on ice:
●● 4 μL of 5 × RT buffer.
●● 1 μL of RNase inhibitor.
●● 0.25 μL of Reverse Transcriptase (200 U/μL).
●● Up to 10 μL DEPC-treated ddH2O.
3. Add 10 μL of the reaction mix to the tube containing the
sample. Mix the reaction and incubate at 42 °C for 1 h and
terminate the reaction by heating to 70 °C for 15 min.
4. Reactions can be stored at −20 °C until needed.
3.3.8 Preparation 1. Dedicate one sample as the “standard” sample and run on all
of Standard Curve and RNA plates to allow internal comparison of the mRNA content of
Samples the samples.
2. Dilute the cDNA reaction from the standard sample 1:5 in
ddH2O, to give the 100% standard. Prepare serial dilutions
from the 100% standard in ddH2O to give 10% and 1% final
concentrations.
3. Dilute all other samples at a ratio of 1:7 with ddH2O.
Carry out real-time PCR reaction and data analysis as in
Subheadings 3.3.3 and 3.3.4.
3.4 Plasmid Location 1. Grow cells until they are approximately 50% confluent and
Analysis then add colcemid solution at a final concentration of 130 ng/
by Fluorescence mL (w/v). Incubate for 16–20 h, at 37 °C with 5% CO2.
In Situ Hybridization 2. Take out the medium and add trypsin/EDTA solution enough
(FISH) to cover the surface. After approximately 5 min incubation
3.4.1 Preparation
inactivate the enzyme by adding culture medium or serum to
of Metaphase Spreads
the cells. Harvest cells by centrifugation at 100 × g for 5 min.
Resuspend the cell pellets in approximately 100 μL of fresh
growth medium by gently tapping the tube.
3. Add 10 mL of hypotonic solution (75 mM KCl) dropwise,
with gentle mixing, to the resuspended cells.
4. Incubate cells in the hypotonic solution at room temperature for
10 min and then centrifuge at 220 × g for 5 min (see Note 34).
5. Remove supernatant and resuspend the cell pellet in approxi-
mately 100 μL of fresh hypotonic solution.
6. Add 5 mL of ice cold methanol:acetic acid (3:1) to the resus-
pended cells. Prepare the fixative solution fresh.
7. Centrifuge the cells at 220 × g for 5 min and remove the
supernatant.
CHO Cell Line Stability Analysis During Long-Term Culture 135
3.4.2 Preparation 1. Prepare FISH probes with plasmid DNA through incorpora-
of Probes for FISH tion of modified dUTPs via nick translation.
Analyses 2. For each reaction, resuspend 1 μg of plasmid DNA in 16 μL
ddH2O.
3. Add 4 μL digoxigenin (DIG)-nick translation mix to the reac-
tion mixture and incubate whole mixture at 15 °C for approxi-
mately 3 h.
4. Halt the nick translation reaction by transferring the reaction
tube on ice.
5. Separate 5 μL of the reaction product on a 2% agarose gel to
confirm that the plasmid DNA has been reduced to under
300 bp in size. If plasmid size is above 300 bp, resume the
reaction by incubating the reaction mix at 15 °C until plasmid
is the optimal size.
6. When the correct probe length is achieved stop the reaction by
adding 1 μL 0.5 M EDTA (pH 8.0) per 20 μL reaction volume
and heat to 65 °C for 10 min.
7. Nick translated probes can be stored at −20 °C until needed.
3.4.3 Agarose Gel 1. Prepare agarose gel by dissolving 2% (w/v) agarose in TBE
Electrophoresis buffer by boiling in a microwave.
2. Once the gel has cooled to less than 55 °C add ethidium bro-
mide to a final concentration of 0.25 μg/mL.
3. Set the gel and run in horizontal electrophoresis tank with
TBE as running buffer.
4. Mix the samples at a 5:1 ratio with loading buffer and load into
wells. Also load 5 μL of DNA Hyperladder I as a reference.
5. Separate the DNA fragments by electrophoresis at 70 V for
45 min – 1 h, and visualize by UV light.
136 Zeynep Betts and Alan J. Dickson
3.4.5 Antibody Detection The remainder of this procedure must be performed in the dark.
1. Dilute Rhodamine-conjugated Fab fragments 1:10 in 1% (v/v)
FBS/PBS.
2. Apply 25 μL of the diluted antibody to each slide.
3. Cover with a coverslip and incubate in a humidified chamber at
37 °C for 30 min.
4. Wash the slides three times in 2× SSC for 3 min each at 37 °C.
5. Dip the slides quickly dipped in ddH2O and allow to air dry in
the dark.
6. Fix the slides with Prolong anti-fade Gold Dapi and cover with
a 22 mm × 22 mm coverslip.
7. After overnight incubation at room temperature, seal the slides
with nail varnish.
8. Observe and collect the images on a fluorescent microscope
using specific band pass filter sets for FITC and DAPI
(see Fig. 3).
CHO Cell Line Stability Analysis During Long-Term Culture 137
4 Notes
References
1. Bailey LA, Hatton D, Field R, Dickson AJ recombinant monoclonal antibodies. Biotechnol
(2012) Determination of Chinese hamster Bioeng 108:2434–2446. doi:10.1002/bit.
ovary cell line stability and recombinant anti- 23189
body expression during long-term culture. Bio 8. Osterlehner A, Simmeth S, Göpfert U (2011)
technol Bioeng 109:2093–2103. doi:10.1002/ Promoter methylation and transgene copy
bit.24485/abstract numbers predict unstable protein production
2. Barnes LM, Bentley CM, Dickson AJ (2003) in recombinant chinese hamster ovary cell
Stability of protein production from recombi- lines. Biotechnol Bioeng 108:2670–2681.
nant mammalian cells. Biotechnol Bioeng doi:10.1002/bit.23216
81:631–639. doi:10.1002/bit.10517 9. Kim NS, Kim SJ, Lee GM (1998) Clonal vari-
3. Betts Z, Croxford AS, Dickson AJ (2015) ability within dihydrofolate reductase-mediated
Evaluating the interaction between UCOE and gene amplified Chinese hamster ovary cells:
DHFR-linked amplification and stability of stability in the absence of selective pressure.
recombinant protein expression. Biotechnol Biotechnol Bioeng 60:679–688
Prog 31:1014–1025. doi:10.1002/btpr.2083 10. Chusainow J, Yang YS, Yeo JHM et al (2009)
4. Kim SJ, Lee GM (1999) Cytogenetic analysis A study of monoclonal antibody-producing
of chimeric antibody-producing CHO cells CHO cell lines: what makes a stable high pro-
inthe course of dihydrofolate reductase- ducer? Biotechnol Bioeng 102:1182–1196.
mediated gene amplification and their stability doi:10.1002/bit.22158
in the absence of selective pressure. Biotechnol 11. Barnes LM, Bentley CM, Dickson AJ
Bioeng 64:741–749 (2001) Characterization of the stability of
5. Derouazi M, Martinet D, Besuchet Schmutz N recombinant protein production in the
et al (2006) Genetic characterization of CHO GS-NS0 expression system. Biotechnol Bioeng
production host DG44 and derivative recom- 73:261–270
binant cell lines. Biochem Biophys Res 12. Mahmood T, Yang P-C (2012) Western blot:
Commun 340:1069–1077. doi:10.1016/j. technique, theory, and trouble shooting.
bbrc.2005.12.111 N Am J Med Sci 4:429–434. doi:10.4103/
6. Betts Z, Dickson AJ (2016) Ubiquitous chro- 1947-2714.100998
matin opening elements (UCOEs) effect on 13. Feit C, Bartal AH, Tauber G et al (1983) An
transgene position and expression stability in enzyme-linked immunosorbent assay (ELISA)
CHO cells following methotrexate (MTX) for the detection of monoclonal antibodies rec-
amplification. Biotechnol J 11:554–564. ognizing surface antigens expressed on viable
doi:10.1002/biot.201500159 cells. J Immunol Methods 58:301–308
7. Kim M, O'Callaghan PM, Droms KA, James 14. Hornbeck P, Winston SE, Fuller SA (2001)
DC (2011) A mechanistic understanding of pro- Enzyme-linked immunosorbent assays (ELISA).
duction instability in CHO cell lines expressing Curr Protoc Mol Biol 11:112
CHO Cell Line Stability Analysis During Long-Term Culture 141
15. Blin N, Stafford DW (1976) A general method indirect immunofluorescence. Nature 265:
for isolation of high molecular weight DNA from 472–473
eukaryotes. Nucleic Acids Res 3:2303–2308 21. Trask BJ (2002) Human cytogenetics: 46
16. Chomczynski P, Sacchi N (1987) Single-step chromosomes, 46 years and counting. Nat Rev
method of RNA isolation by acid guanidinium Genet 3:769–778. doi:10.1038/nrg905
thiocyanate-phenol-chloroform extraction. Anal 22. Speicher MR, Carter NP (2005) The new cyto-
Biochem 162:156–159. doi:10.1006/abio. genetics: blurring the boundaries with mole
1987.9999 cular biology. Nat Rev Genet 6:782–792.
17. Chomczynski P, Sacchi N (2006) The single- doi:10.1038/nrg1692
step method of RNA isolation by acid guanidin- 23. Rens W, Fu B, O'Brien PCM, Ferguson-Smith
ium thiocyanate–phenol–chloroform extraction: M (2006) Cross-species chromosome painting.
twenty-something years on. Nat Protoc 1:581– Nat Protoc 1:783–790. doi:10.1038/nprot.
585. doi:10.1038/nprot.2006.83 2006.91
18. Gall JG, Pardue ML (1969) Formation and 24. Rigby PW, Dieckmann M, Rhodes C,
detection of Rna-Dna hybrid molecules in Berg P (1977) Labeling deoxyribonucleic acid
cytological preparations. Proc Natl Acad Sci to high specific activity in vitro by nick transla-
U S A 63:378 tion with DNA polymerase I. J Mol Biol 113:
19. Lichter P, Cremer T, Borden J et al (1988) 237–251
Delineation of individual human chromosomes 25. Cox WG, Singer VL (2004) Fluorescent DNA
in metaphase and interphase cells by in situ hybridization probe preparation using amine
suppression hybridization using recombinant modification and reactive dye coupling. Bio
DNA libraries. Hum Genet 80:224–234 techniques 36:114–122
20. Rudkin GT, Stollar BD (1977) High resolu- 26. O'connor C (2008) Fluorescence in situ hybri
tion detection of DNA-RNA hybrids in situ by dization (FISH). Nat Educ 1:171
Chapter 9
Abstract
Cell line development aims to generate and select clones with desirable characteristics. One of the most
important parameters for biopharmaceutical cell selection is cell-specific productivity (Qp) or the quantity
of product produced per cell per day. Fluorescence-activated cell sorting (FACS) is a powerful, high-
throughput technique that facilitates multiparametric characterization and isolation of individual cell
clones from heterogeneous populations. Here, we describe a FACS-based method for section of high-
producing CHO cell clones.
Key words FACS, Flow cytometry, Sort, Cell line development, Biopharmaceutical, Productivity
Abbreviations
FSC Forward scatter
SSC Side scatter
FSC-W Forward scatter-width
FSC-H Forward scatter-height
1 Introduction
Chinese hamster ovary (CHO) cells are one of the most commonly
used systems for the production of recombinant biotherapeutic
proteins. These cells allow complex posttranslational modifications
and protein folding; however, cell productivity is often a limiting
factor for development and large-scale production [1]. During
development, cells are transfected with the recombinant gene of
interest and drug applied to select those that have been stably
transfected. Within this heterogenous cell pool, clones must be
evaluated and those with the highest productivity identified and
isolated. The proportion of high producers within such heteroge-
neous populations is low and these desirable clones tend to be
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_9, © Springer Science+Business Media LLC 2017
143
144 Clair Gallagher and Paul S. Kelly
2 Materials
2.1 CHO Cell Culture 1. Single-use 50 mL bioreactor tubes (Thermo Fisher Scientific).
2. Appropriate CHO cell culture media (i.e., CD OptiCHO
(Thermo Fisher Scientific), CHO-S-SFM II (Thermo Fisher
Scientific), or an alternative CHO line-specific medium.
3. Penicillin-Streptomycin solution (Thermo Fisher Scientific).
4. A panel of appropriate CHO cell populations (see Note 1 and
Fig. 1).
Fig. 1 Schematic describing required FACS antibody controls. In order to establish appropriate FACS setting
and accurately assess antibody secretion, the following controls are recommended: (a) an unlabeled CHO cell
sample to establish appropriate forward/side scatter settings and negative fluorescence. (b) Non-secretor CHO
cells labeled with FITC-conjugated anti-human IgG to allow identification of nonspecific background signal and
to position negative “non-producer” FITC gates. A labeled producer cell sample should also be prepared to act
as a positive control (c and d)
146 Clair Gallagher and Paul S. Kelly
2.4 FACS Settings 1. Shaker incubator (i.e., Kuhner Shaker Climo-Shaker ISF1-XC).
and Clone Isolation 2. 96-well plates (Corning).
3. FACS tubes (BD Falcon).
4. FACS with appropriate lasers (405 nm, 488 nm) for excitation
and detection of DAPI (450 nm) and FITC (530 nm).
Appropriate FACS instruments may include the BD FACSAria
or FACSJazz, depending on specifications. See Note 3.
3 Methods
3.1 CHO Cell Culture 1. Culture a panel of appropriate CHO suspension cell lines at
37 °C, 5% CO2, with rotation (170 rpm) (see Table 1 for fur-
ther details).
2. Media requirements and seeding densities may differ by cell
line; please select appropriate media and conditions for cell
lines in use.
3. Growth curves should be determined for each cell line in
advance so that samples may be taken at appropriate times for
the preparation of conditioned media (exponential), immuno-
labeling (exponential), and DAPI staining (late exponential
and death). See Note 4.
3.2 Conditioned 1. Prepare 10 mL of conditioned media per 96-well collection plate.
Media Preparation 2. Condition the media by seeding cells taken during the expo-
nential growth phase in pre-warmed fresh media at
1 × 106 cells/mL.
3. Incubate the cells in media for 24 h in a shaker incubator at
170 rpm, 37 °C, 80% humidity, 5% CO2.
4. Pellet cells by centrifugation at 800 × g for 5 min.
Selection of High-Producing Clones by FACS 147
Table 1
FACS samples required for isolation of High Qp clones for CHO cell development line
Anti-IgG-
DAPI fluorophore
Sample ID Function Growth phase stained labeled Sort
Unstained/unlabeled Establishing basic FSC, SSC Late exponential No No No
instrument settings and
identification of non-
fluorescent populations
Healthy-DAPI stained Gating for identification and Late exponential Yes No No
exclusion of dead cells
Stressed-DAPI stained Gating for identification and Death Yes No No
exclusion of dead cells
Stained non-producer For detection of nonspecific Late exponential Yes Yes No
cell line fluorophore background
signal. Used to set negative
fluorescence gate
Stained High-Ab Positive control for producer Late exponential Yes Yes No
producer cell line cells. Used to set positive
fluorescence gate
Development cell line Isolation of high Qp clones Late exponential Yes Yes Yes
3.3 Laboratory 1. Wipe down benches, pipettes, and nearby surfaces using 70%
and FACS methanol (see Note 8).
Decontamination 2. Prepare sterile sheath fluid.
3. Decontaminate FACS and prepare for aseptic sort using
instrument-specific instructions.
3.4 Preparation DAPI solutions should be handled and processed in sterile condi-
of DAPI Staining tions to reduce the possibility of bacterial or fungal infection.
Solutions Prepare 5 mg/mL DAPI stock solution by dissolving 10 mg DAPI
in 2 mL of deionized water. Aliquot and store at −20 °C. Prepare
1 μg/mL DAPI working solution by adding 1 μL of DAPI stock
solution (5 mg/mL) to 5 mL DPBS and protect from light
(see Note 9 for further details regarding safe preparation and stor-
age of DAPI solutions).
148 Clair Gallagher and Paul S. Kelly
a
Live cells Dead cells
750 1,000
Count
500
250
0 102 103 104 105
Pacific Blue-A
b
750 1,000 1,250
Fig. 2 FACS histograms displaying DAPI-stained healthy (a) and stressed (b) con-
trol cell samples. Dead cells display increased fluorescence signals and gates
may be applied so that only live cells are sorted. The DAPI stain should also be
used to assess the health of the development line to be sorted as suboptimal
health can greatly reduce post-sort clone survival
a
Negative FITC Positive
2 2.5 3 3.5
Count %
0.5 1 1.5
0 102 103 104 105
FITC-A
b
3
4 Notes
References
1. Li F, Vijayasankaran N, Shen AY et al (2010) course of the cold capture antibody secretion
Cell culture processes for monoclonal antibody assay. J Biotechnol. doi:10.1016/j.jbiotec.
production. MAbs 2:466–479 2009.03.001
2. Borth N, Zeyda M, Kunert R, Katinger H 5. Brezinsky SC, Chiang G, Szilvasi A et al (2003)
Efficient selection of high-producing subclones A simple method for enriching populations of
during gene amplification of recombinant transfected CHO cells for cells of higher specific
Chinese hamster ovary cells by flow cytometry productivity. J Immunol Methods 277:141–
and cell sorting. Biotechnol Bioeng 71:266–273 155. doi:10.1016/S0022-1759(03)00108-X
3. Caron AW, Nicolas C, Gaillet B et al (2009) 6. Slamenová D, Gabelová A (1980) The effects
Fluorescent labeling in semi-solid medium for of sodium azide on mammalian cells cultivated
selection of mammalian cells secreting high- in vitro. Mutat Res 71:253–261
levels of recombinant proteins. BMC Biotechnol 7. Ishikawa T, Zhu B-L, Maeda H (2006) Effect
9:42. doi:10.1186/1472-6750-9-42 of sodium azide on the metabolic activity of
4. Pichler J, Hesse F, Wieser M et al (2009) A cultured fetal cells. Toxicol Ind Health 22:337–
study on the temperature dependency and time 341. doi:10.1177/0748233706071737
Chapter 10
Abstract
Increased understanding of Chinese hamster ovary (CHO) cell physiology has been ushered in upon availability
of the parental CHO-K1 cell line genome. Free and openly accessible sequence information has comple-
mented transcriptomic and proteomic studies. The previous decade has also seen an increase in sensitivity
and accuracy of proteomic methods due to technology development. In this genomic era, high-throughput
screening methods, sophisticated informatic tools, and models continually drive major innovations in cell
line development and process engineering. This review describes the various achievements in ‘omics
techniques and their application to improve recombinant protein expression from CHO cell lines.
Key words CHO cell engineering, CHO genome, Proteomics, Transcriptomics, CHO bioinformatics,
Mass spectrometry
1 Introduction
Chinese hamster ovary (CHO) cells are the preferred hosts for
biotherapeutic manufacturing because of the cells’ robust nature,
adaptability to suspension, growth in serum-free media, and ability
to perform human-like posttranslation modifications of recombi-
nant proteins [1, 2]. Since the approval of the first CHO recombi-
nant protein, tissue plasminogen activator (tPA) [3], more than
160 recombinant products have been successfully expressed in
CHO cells [4]. In addition to monoclonal antibodies and hor-
mones, diverse therapeutic molecules such as heparin [5] have
been successfully expressed in CHO cells. The current market
share of biopharmaceuticals, an estimated $160 billion annually
worldwide, has far exceeded previous predictions [1]. Keeping up
with the rise in demand, volumetric productivity from CHO cells
has risen from 0.05 g/L to >10 g/L in the past 30 years [6, 7].
However, these successes are mostly driven by labor-intensive and
time-consuming empirical processes [8, 9], which are case specific
and not easily reproduced for a new campaign process. In order to
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_10, © Springer Science+Business Media LLC 2017
153
154 Hussain Dahodwala and Susan T. Sharfstein
2 CHO ‘Omics
2.1 CHO Genomics The public availability of the CHO genome [10] has been a great
boon to the scientific and industrial community alike. Like the
human genome endeavor, the effort to complete the CHO genome
was the end result of academic and industrial collaboration on an
international scale. This initiative has enabled a range of systems
biology research [34]. Following the availability of CHO-K1
genome, the Chinese hamster genome was also sequenced [35],
creating a universal reference genome for all CHO cells. Most cell
lines used for recombinant protein expression make use of the
mutagenized dhfr-deficient CHO DG44, suspension adapted
CHO-S, or CHO-DXB11 cell lines. Though most of these cells
CHOmics for Improved Productivity 155
Enhanced
cell growth
Increase in specific
Genomic data productivity
Reduced cell
apoptosis and
necrosis
CHO cells
Transcriptomic Reduced
data cell stress
Improved
product quality
Proteomic data
Fig. 1 Multiple ‘omics data generated for CHO cells can be used to guide cell line and product quality
attributes
Table 1
Representative ‘omics technologies used to generate CHO-specific datasets
Table 1
(continued)
2.2 CHO Sequencing the CHO-K1 genome has complemented and acceler-
Transcriptome ated transcriptome elucidation. Previously, the use of expressed
sequence tags (ESTs) [42] and proprietary microarrays [43]
limited the transcriptome search to a few hundred genes. With the
CHOmics for Improved Productivity 157
2.3 CHO Proteome The CHO cell genome remains fairly constant throughout the
stages of growth and in response to changes in bioprocess condi-
tions, but the proteome is in constant flux. The CHO genome
[44] is predicted to have 24,383 genes [10], but these can be
translated into many times that number of proteins due to isoforms
and alternate splicing, as well as the inclusion of posttranslational
modifications (PTM) [45]. Therefore, investigation of the pro-
teome has the potential to offer complementary and more dynamic
knowledge about factors that will influence higher productivity
phenotype in cells. Despite the lack of genomic information and
158 Hussain Dahodwala and Susan T. Sharfstein
Table 2
Methods employed for CHO proteomic studies
Application to CHO
Technique proteome Ref Major advantage Disadvantage
2D gel Proteomic expression [58] Ease of visualization of Labor intensive,
electro- profiling in various [59] comparative highly semiquantitative
phoresis CHO cells expressed samples
iTRAQ Protein profiling in [12] Stains after cell lysis and is Longer MS run needed
high-producing cells not limited by
incorporation of stable
isotopes
SILAC Studying cellular [64] Greater proteome coverage, Costs more compared to
secretory capacity of captures extracellular, chemical labeling
IgG-producing cells and LMW proteins
MALDI- Identification of O- and [68] Small sample size, precise Requires very rigid sample
TOF N-glycans in molecular weight preparation. Low run
glycosylation mutants to run reproducibility
ESI Detailed structural [70] High accuracy, fast, couples Sensitive to salts, complex
assignments of IgG with LC spectra
produced in CHO cells
SELDI- Characterization of CHO Soft ionization technique Low mass resolution
TOF secretome amenable to studying
low molecular weight
proteins and PTMs
CHOmics for Improved Productivity 159
Table 3
List of resources for ‘omics research
4 ‘Omics Databases
Fig. 2 Genome, transcriptome, and proteome mapping of CHO cell lines. Genome, transcriptome, and proteome
of CHO cell lines are mapped to all metabolic pathways in the Kyoto Encyclopedia of Genes and Genomes (KEGG).
The genes found in the CHO genomic level are represented by yellow. Orange represents the genes expressed at
the mRNA level for exponentially grown in CHO-K1, whereas green shows the genes expressed at the proteome
level. Genes identified as expressed at both proteome and mRNA levels are represented in gray
49. Lingg N, Zhang P, Song Z, Bardor M (2012) cellular structures. Nat Rev Mol Cell Biol
The sweet tooth of biopharmaceuticals: 6:702–714. doi:10.1038/nrm1711
Importance of recombinant protein glycosyl- 61. Tyers M, Mann M (2003) From genomics to
ation analysis. Biotechnol J 7:1462–1472. proteomics. Nature 422:193–197.
doi:10.1002/biot.201200078 doi:10.1038/nature01510
50. Pascoe DE, Arnott D, Papoutsakis ET et al 62. Graumann J, Hubner NC, Kim JB et al (2008)
(2007) Proteome analysis of antibody- Stable isotope labeling by amino acids in cell
producing CHO cell lines with different meta- culture (SILAC) and proteome quantitation of
bolic profiles. Biotechnol Bioeng 98:391–410. mouse embryonic stem cells to a depth of
doi:10.1002/bit.21460 5,111 proteins. Mol Cell Proteomics 7:672–
51. Dorai H (2013) Proteomic analysis of biore- 683. doi:10.1074/mcp.M700460-MCP200
actor cultures of an antibody expressing 63. Cravatt BF, Simon GM, Yates JR (2007) The
CHOGS cell line that promotes high produc- biological impact of mass-spectrometry-based
tivity. J Proteom Bioinform 06:99–108. proteomics. Nature 450:991–1000.
doi:10.4172/jpb.1000268 doi:10.1038/nature06525
52. Schaub J, Clemens C, Schorn P et al (2010) 64. Kantardjieff A, Jacob NM, Yee JC et al (2010)
CHO gene expression profiling in biopharma- Transcriptome and proteome analysis of Chinese
ceutical process analysis and design. Biotechnol hamster ovary cells under low temperature and
Bioeng 105:431–438. doi:10.1002/bit.22549 butyrate treatment. J Biotechnol 145:143–159.
53. Kumar A, Baycin-Hizal D, Wolozny D et al doi:10.1016/j.jbiotec.2009.09.008
(2015) Elucidation of the CHO super-ome 65. Aggarwal K, Choe LH, Lee KH (2006)
(CHO-SO) by proteoinformatics. J Proteome Shotgun proteomics using the iTRAQ isobaric
Res 14:4687–4703. doi:10.1021/acs. tags. Brief Funct Genom Proteom 5:112–120.
jproteome.5b00588 doi:10.1093/bfgp/ell018
54. Valente KN, Lenhoff AM, Lee KH (2015) 66. Sachon E, Mohammed S, Bache N, Jensen ON
Expression of difficult-to-remove host cell pro- (2006) Phosphopeptide quantitation using
tein impurities during extended Chinese ham- amine-reactive isobaric tagging reagents and
ster ovary cell culture and their impact on tandem mass spectrometry: application to pro-
continuous bioprocessing. Biotechnol Bioeng teins isolated by gel electrophoresis. Rapid
112:1232–1242. doi:10.1002/bit.25515 Commun Mass Spectrom 20:1127–1134.
55. Cox J, Mann M (2007) Is proteomics the new doi:10.1002/rcm.2427
genomics? Cell 130:395–398. doi:10.1016/j. 67. Ross PL, Huang YN, Marchese JN et al (2004)
cell.2007.07.032 Multiplexed protein quantitation in
56. Peleg Y, Unger T (2012) Chemical genomics Saccharomyces cerevisiae using amine-reactive
and proteomics. Methods Mol Biol 800:173– isobaric tagging reagents. Mol Cell Proteomics
186. doi:10.1007/978-1-61779-349-3 3:1154–1169. doi:10.1074/mcp.M400129-
57. Chandramouli K, Qian P-Y (2009) Proteomics: MCP200. M400129-MCP200 [pii]
challenges, techniques and possibilities to over- 68. North SJ, Huang HH, Sundaram S et al
come biological sample complexity. Hum (2010) Glycomics profiling of Chinese ham-
Genom Proteom 2009:22. ster ovary cell glycosylation mutants reveals
doi:10.4061/2009/239204 N-glycans of a novel size and complexity.
58. Doolan P, Meleady P, Barron N et al (2010) J Biol Chem 285:5759–5775. doi:10.1074/
Microarray and proteomics expression profil- jbc.M109.068353
ing identifies several candidates, including the 69. Ho CS, Lam CWK, Chan MHM et al (2003)
valosin-containing protein (VCP), involved in Electrospray ionisation mass spectrometry:
regulating high cellular growth rate in produc- principles and clinical applications. Clin
tion CHO cell lines. Biotechnol Bioeng Biochem 24:3–12
106:42–56. doi:10.1002/bit.22670 70. Stadlmann J, Pabst M, Kolarich D et al (2008)
59. Baik JY, Ha TK, Kim YH, Lee GM (2011) Analysis of immunoglobulin glycosylation by
Proteomic understanding of intracellular LC-ESI-MS of glycopeptides and oligosaccha-
responses of recombinant chinese hamster rides. Proteomics 8:2858–2871. doi:10.1002/
ovary cells adapted to grow in serum-free sus- pmic.200700968
pension culture. Biotechnol Prog 27:1680– 71. Tang N, Tornatore P, Weinberger SR (2004)
1688. doi:10.1002/btpr.685 Current developments in SELDI affinity tech-
60. Yates JR, Gilchrist A, Howell KE, Bergeron nology. Mass Spectrom Rev 23:34–44.
JJM (2005) Proteomics of organelles and large doi:10.1002/mas.10066
168 Hussain Dahodwala and Susan T. Sharfstein
72. De Bock M, De Seny D, Meuwis MA et al 80. Feichtinger J, Hernández I, Fischer C et al
(2010) Challenges for biomarker discovery in (2016) Comprehensive genome and epig-
body fluids using SELDI-TOF-MS. J Biomed enome characterization of CHO cells in
Biotechnol. doi:10.1155/2010/906082 response to evolutionary pressures and over
73. Seibert V, Wiesner A, Buschmann T, Meuer time. Biotechnol Bioeng. 113(10):2241–
J (2004) Surface-enhanced laser desorption 2253n/a–n/a. doi:10.1002/bit.25990
ionization time-of-flight mass spectrometry 81. Lewis AM, Abu-Absi NR, Borys MC, Li ZJ
(SELDI TOF-MS) and ProteinChip® technol- (2016) The use of ‘Omics technology to ratio-
ogy in proteomics research. Pathol Res Pract nally improve industrial mammalian cell line
200:83–94. doi:10.1016/j.prp.2004.01.010 performance. Biotechnol Bioeng 113:26–38.
74. Kumar N, Gammell P, Meleady P et al (2008) doi:10.1002/bit.25673
Differential protein expression following low 82. LaMarche BL, Crowell KL, Jaitly N et al (2013)
temperature culture of suspension CHO-K1 MultiAlign: a multiple LC-MS analysis tool for
cells. BMC Biotechnol 8:42. doi:10.1186/ targeted omics analysis. BMC Bioinform 14:49.
1472-6750-8-42 doi:10.1186/1471-2105-14-49
75. Tait AS, Hogwood CEM, Smales CM, 83. Clarke C, Doolan P, Barron N et al (2011)
Bracewell DG (2012) Host cell protein dynam- Predicting cell-specific productivity from CHO
ics in the supernatant of a mAb producing gene expression. J Biotechnol 151:159–165.
CHO cell line. Biotechnol Bioeng 109:971– doi:10.1016/j.jbiotec.2010.11.016
982. doi:10.1002/bit.24383 84. Naderi S, Nikdel A, Meshram M et al (2014)
76. Bantscheff M, Schirle M, Sweetman G et al (2007) Modeling of cell culture damage and recovery
Quantitative mass spectrometry in proteomics: a leads to increased antibody and biomass produc-
critical review. Anal Bioanal Chem 389:1017– tivity in CHO cell cultures. Biotechnol J 9:
1031. doi:10.1007/s00216-007-1486-6 1152–1163. doi:10.1002/biot.201300287
77. Kelly PS, Breen L, Gallagher C et al (2015) 85. Selvarasu S, Ho YS, Chong WPK et al (2012)
Re-programming CHO cell metabolism using Combined in silico modeling and metabolo-
miR-23 tips the balance towards a highly pro- mics analysis to characterize fed-batch CHO
ductive phenotype. Biotechnol J 10:1029–1040. cell culture. Biotechnol Bioeng 109:1415–
doi:10.1002/biot.201500101 1429. doi:10.1002/bit.24445
78. Kremkow BG, Baik JY, MacDonald ML, Lee 86. Clarke C, Doolan P, Barron N et al (2012)
KH (2015) CHOgenome.org 2.0: genome CGCDB: a web-based resource for the investi-
resources and website updates. Biotechnol J gation of gene coexpression in CHO cell cul-
10:931–938. doi:10.1002/biot.201400646 ture. Biotechnol Bioeng 109:1368–1370.
79. Meleady P, Hoffrogge R, Henry M et al (2012) doi:10.1002/bit.24416
Utilization and evaluation of CHO-specific 87. Manyam G, Birerdinc A, Baranova A (2015)
sequence databases for mass spectrometry KPP: KEGG pathway Painter. BMC Syst Biol
based proteomics. Biotechnol Bioeng 9(Suppl 2):S3. doi:10.1186/1752-0509-
109:1386–1394. doi:10.1002/bit.24476 9-S2-S3
Chapter 11
Abstract
In recent years, the publication of genome sequences for the Chinese hamster and Chinese hamster ovary
(CHO) cell lines has facilitated study of these biopharmaceutical cell factories with unprecedented resolu-
tion. Our understanding of the CHO cell transcriptome, in particular, has rapidly advanced through the
application of next-generation sequencing (NGS) technology to characterize RNA expression (RNA-Seq).
In this chapter, we present a computational pipeline for the analysis of CHO cell RNA-Seq data from the
Illumina platform to identify differentially expressed genes. The example data and bioinformatics workflow
required to run this analysis are freely available at www.cgcdb.org/rnaseq_analysis_protocol.html.
Key words Transcriptomics, RNA-Seq, Differential gene expression, Chinese hamster ovary cells,
Biopharmaceutical manufacture, Systems biotechnology
1 Introduction
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_11, © Springer Science+Business Media LLC 2017
169
170 Craig Monger et al.
Fig. 1 RNA-Seq bioinformatics protocol overview. (a) Quality assessment of raw sequencing data and prepro-
cessing of reads to correct potential issues including low base quality. (b) Alignment of reads to the Chinese
hamster reference sequence and calculation of global mapping quality. (c) Counting reads aligned to each
protein-coding gene. (d) Differential expression analysis
2 Materials
2.1 Software This bioinformatics pipeline is configured for the Linux operating
Installation system to ensure compatibility with widely used RNA-Seq data
analysis software. Ubuntu 16.04 LTS (http://www.ubuntu.com)
has been tested for the analysis described in this chapter and is rec-
ommended for users unfamiliar with Linux due to its Windows-
like desktop. The analysis workflow initially utilizes standalone
software (Table 1), while the final stage is carried out within the R
statistical software environment and the Bioconductor DESeq2
package is used for differential expression analysis (see Note 1).
A Bash script (install_software.sh) has been developed to automati-
cally create the required directories, download and install each
An in-Silico CHO Cell RNA-Seq Data Analysis Protocol 171
Table 1
List of software. Standalone software written in Java, Python, and C is required for this analysis as well
as the R statistical software environment and the DESeq2 Bioconductor package. The install_software.
sh script automates the process of installing each program, while the DESeq2 package is installed
during the execution of the differential_expression. R script. The purpose of each program is provided
with respect to the protocol described here (see Note 1)
Table 2
RNA-Seq data and additional resources. The download_data.sh script creates the required directories
and automatically downloads data required for this protocol including the downsampled raw FASTQ
format files and HISAT2 index files for alignment as well as GFF annotation files specifying the location
of features in the Chinese hamster genome. Supplementary files are also provided for RNASeqQC
analysis and annotation of DESeq2 results
Filename Contents
rnaseq_raw_data.tar.gz • Raw RNA-Seq data for forward and reverse reads. 3 biological
replicates were sequenced for the CHO-K1 and CCL39 samples.
hisat_index.tar.gz • Prebuilt HISAT2 index files for the Chinese hamster genome.
C_griseus_v1.0.genomic.tar.gz • Chinese hamster genome FASTA file.
• Chinese hamster GFF annotation file for protein coding genes.
Supplementary_data.tar.gz • RNASeqQC sample information file.
• Chinese hamster GTF annotation file for protein-coding genes.
• CSV file for annotation of differentially expressed genelist.
2.2 Data Download The example data utilized for this protocol originates from a
previously published study focused on the identification of recep-
tors for TLQP-21, a peptide that affects energy metabolism and
stress responses [15]. RNA-Seq was utilized to compare gene
expression differences between CHO-K1 and CCL39 cells (derived
from Chinese hamster lung tissue), which are responsive and non-
responsive to TLQP-21 respectively. Total RNA sequencing on an
Illumina HiSeq 2000 configured to acquire 76 bp paired end reads
was performed for three biological replicates of each cell line.
These data are available for download on the NCBI Sequence Read
Archive (accession: SRA096825). To enable the protocol described
in this chapter to be carried out on a desktop computer, the origi-
nal data has been reduced (downsampled) to 2 million reads per
sample (see Note 5). A Bash script (download_data.sh) is provided
to download the RNA-Seq data for each sample along with addi-
tional resources required. The script automatically stores data in
the required directories for analysis (Table 2).
3 Method
3.1 RNA-Seq Raw 1. Assess the quality of raw data using FastQC. The command
Data QC below analyses all (specified by the “*” character) FASTQ files
and Preprocessing in the raw directory folder and writes the result to the output
folder specified by the “--outdir” flag (see Note 6).
2. Preprocess the reads using Trimmomatic. The command below
$fastqc_directory/fastqc \
--outdir $HOME/rnaseq_analysis/FASTQC_output/raw_fastqc "$raw_data_directory"/*
$fastqc_directory/fastqc \
--outdir $HOME/rnaseq_analysis/FASTQC_output/raw_fastqc "$raw_data_directory"/*
3.2 Reference 1. Align sequence reads to the Chinese hamster genome. The pre-
Genome Alignment processed data, where both read pairs have been retained, is
aligned using HISAT2 and the prebuilt C_griseus_v1.0
HISAT2 index. Alignments are outputted in the Sequence
Alignment/Map (SAM) format. The “-x” option specifies the
HISAT2 index, “-1” and “-2” are the input forward and
reverse reads respectively. The “-S” option specifies the output
file in the SAM format (see Note 11).
2. Sort the SAM file and convert to BAM. Each SAM format file
produced during alignment is sorted based on location within
each scaffold of the Chinese hamster genome and converted to
its equivalent binary format BAM file. For the Samtools view
command the “-bS” option specifies that the input is SAM
format (-S) and that output should be BAM (-b). The output
of Samtools view is then transferred to the Samtools sort
An in-Silico CHO Cell RNA-Seq Data Analysis Protocol 175
a
40
38
36
34
32
30
28
26
Quality Score
24
22
20
18
16
14
12
10
8
6
4
2
0
1 2 3 4 5 6 7 8 9 12-13 18-19 24-25 30-31 36-37 42-43 48-49 54-55 60-61 66-67 72-73 76
Position in read (bp)
b 40
38
36
34
32
30
28
26
Quality Score
24
22
20
18
16
14
12
10
8
6
4
2
0
1 2 3 4 5 6 7 8 9 12-13 18-19 24-25 30-31 36-37 42-43 48-49 54-55 60-61 66-67 72-73 76
Position in read (bp)
Fig. 2 Base quality preprocessing. (a) FastQC boxplots of base qualities scores show a significant portion of
reads have quality values falling below 20 at all nucleotide positions in forward reads for the CHO-K1_1
sample. For each nucleotide the boxes and whiskers show where 25–75% and 10–90% of the quality scores
lie respectively, with the red horizontal line indicating the median quality value. (b) Trimming and filtering using
the Trimmomatic tool significantly improves base qualities across the reads
176 Craig Monger et al.
3. Remove the SAM file. Once the BAM file is generated the SAM
file created during HISAT2 alignment is no longer required
and deleted to reduce storage requirements.
rm $mapped/"$sampleName".sam
3.3 Reference 1. Create a FASTA index for the Chinese hamster genome.
Genome Alignment QC A FASTA index file enables rapid access to sequence within
Chinese hamster FASTA file.
3.4 Calculation 1. Count the number of reads mapping to each gene in the Chinese
of Raw Counts hamster genome. The htseq-count program is utilized to count
the number of reads for each BAM file (the input file format is
specified by the “-f” flag) mapping to each feature present in a
GFF format annotation file (see Note 13). Those features
counted within the GFF file are specified by the “-i” flag, in this
case those with “gene” specified. The “>” character writes the
output to a text file for further processing (see Note 14).
3.5 Differential Gene The remaining stages of this pipeline are executed within R and
Expression Analysis utilize the DESeq2 Bioconductor package.
1. Import the count data and create a DESeq2 object. The count
file location for each sample within the “HTSeq_counts” direc-
tory along with the cell type (e.g., CHO-K1 or CCL39) is
placed in an R data frame. The data frame is utilized as input to
the DESeqDataSetFromHTSeqCount function, which imports
the count data and constructs a DESeq object. The cell type
information is converted to a R factor variable for downstream
sample comparisons.
178
Table 3
Read alignment quality metrics. The RNA-SeQC program outputs a selection of measures of alignment quality for each RNA-Seq sample. For the
Craig Monger et al.
example data utilized in this protocol, an average of 91% of the total reads were aligned to the Chinese hamster genome sequence (mapping rate). The
number of mapped reads that spanned an exon-exon junction is shown (split reads). Over 80% of aligned reads assigned to genes (intragenic rate) and
over 74% to exons (exonic rate) enabling the detection of over 9000 genes and 18,000 mRNAs in each sample. An average profiling efficiency (sequenced
reads vs. exon mapped reads) of 68.3% was achieved
Split Mapping Genes Transcripts Intragenic Exonic Intronic Intergenic Expression Profiling
Sample Mapped Reads Rate (%) Detected Detected Rate (%) Rate (%) Rate (%) Rate (%) Efficiency (%)
CCL39_1 2,263,342 491,468 89.0 9,342 18,138 80.8 74.4 6.4 19.2 66.2
CCL39_2 2,355,486 534,102 93.1 9,340 18,088 82.3 77.1 5.2 17.7 71.7
CCL39_3 2,267,567 494,761 89.7 9,376 18,215 80.8 74.3 6.4 19.2 66.7
CHO-K1_1 2,283,769 512,589 90.4 9,251 18,125 81.4 75.7 5.8 18.5 68.4
CHO-K1_2 2,314,711 505,472 91.7 9,292 18,173 81.1 74.3 6.9 18.9 68.1
CHO-K1_3 2,428,589 535,162 92.2 9,293 18,163 81.3 74.5 6.9 18.6 68.7
An in-Silico CHO Cell RNA-Seq Data Analysis Protocol 179
# create a deSeq2 data object by reading the count files and assign cell type
DESeq_data <- DESeqDataSetFromHTSeqCount(sampleTable = sample_information,
directory = "HTSeq_counts",
design = ~condition)
5.0
2.5
0.0
PC2: 3% variance
group
CCL39
CHO–K1
–2.5
–5.0
–7.5
–20 –10 0 10 20
Fig. 3 Principal component analysis. PCA provides a global overview of the transcriptomic data, identifying
outlying samples and confirming that the biological hypothesis underlying the experimental design can be
observed. In this example, the CHO-K1 and CCL39 samples clearly separate following PCA
4 Notes
DESeq2 differential expression output. A total of 572 upregulated and 924 downregulated protein-coding genes were identified. The ten most up and
downregulated genes are shown here. The corresponding symbol, name, and GenBank ID are shown for each gene. DESeq2 outputs including the fold
change observed in log2 scale as well as the p-value the Bonferroni adjusted p-value
Acknowledgments
References
1. Brinkrolf K, Rupp O, Laux H, Kollin F et al 3. Xu X, Nagarajan H, Lewis NE, Pan S et al
(2013) Chinese hamster genome sequenced (2011) The genomic sequence of the Chinese
from sorted chromosomes. Nat Biotechnol 31: hamster ovary (CHO)-K1 cell line. Nat Bio
694–695 technol 29:735–741
2. Lewis NE, Liu X, Li Y, Nagarajan H et al (2013) 4. Kaas CS, Kristensen C, Betenbaugh MJ, Andersen
Genomic landscapes of Chinese hamster ovary MR (2015) Sequencing the CHO DCB11
cell lines as revealed by the Cricetulus griseus genome reveals regional variations in genomic
draft genome. Nat Biotechnol 31:759–765 stability and haploidy. BMC Genomics 16:160
186 Craig Monger et al.
Abstract
Chinese hamster ovary (CHO) cells are the most commonly used mammalian host cell line for biopharma-
ceutical production because of their ability to correctly fold and posttranslationally modify recombinant
proteins that are compatible with human use. Proteomics, along with other ‘omic platforms, are being
used to understand the biology of CHO cells with the ultimate aim of enhancing CHO cell factories for
more efficient production of biopharmaceuticals. In this chapter, we will describe an efficient protocol
called Filter Aided Sample Preparation (FASP) for the extraction of proteins from CHO cells for proteomic
studies. FASP uses a common ultrafiltration device whereby the membrane pores are small enough to
allow contaminating detergents to pass through, while proteins are too large and are retained and concen-
trated in the filter unit. This method of sample preparation and protein digestion is universally applicable
and can be easily employed in any proteomics facilities as standard everyday laboratory reagents and equip-
ment are used.
Key words Proteomics, Protein solubilization, Filter-aided sample preparation, FASP, Chinese
hamster ovary, LC-MS/MS
1 Introduction
Chinese hamster ovary (CHO) cells are the most commonly used
host cell line for the production of recombinant biotherapeutics.
A greater understanding of the biology of these cells is required to
improve the efficiency of production with the overall aim of
reducing the costs of therapeutics. Systems biology approaches,
including proteomics, are being increasingly used to characterize
recombinant CHO cells to achieve this goal. This chapter outlines
a recently described method, Filter-Aided Sample Preparation
(FASP) [1], which enables protein purification using a standard
ultrafiltration device for efficient detergent removal prior to down-
stream proteomic analyses.
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_12, © Springer Science+Business Media LLC 2017
187
188 Orla Coleman et al.
2 Materials
All solvents and water used must be LC-MS grade. All chemicals
must be of the highest purity.
Table 1
Preparation of Tris–HC1 solutions with varying pH
Table 2
Overview of preparation of KC1 elution buffers
Elution buffer KCl (g) 10 mM KH2PO4 in 25% ACN (mL) KCl concentration (mM)
Elution buffer step 1 0.007 10 10
Elution buffer step 2 0.019 10 25
Elution buffer step 3 0.037 10 50
Elution buffer step 4 0.056 10 75
Elution buffer step 5 0.075 10 100
Elution buffer step 6 0.093 10 125
Elution buffer step 7 0.112 10 150
Elution buffer step 8 0.149 10 200
Elution buffer step 9 0.224 10 300
Elution buffer step 10 0.373 10 500
3 Methods
3.1 Cell Lysis 1. Harvest CHO cells and wash with sterile Phosphate-Buffered
Saline three times. Centrifuge at 1000 × g for 5 min and remove
the supernatant. Snap freeze the cell pellet in a microcentrifuge
tube using liquid nitrogen (take extreme caution when doing
this). Store at −80 °C until cell lysis is performed.
2. Lyse cell pellets corresponding to 2 × 106 cells (approximately
1 mg pellet of cells) with 1 mL of lysis buffer. Suspend the cell
pellet in the lysis buffer and mix the solution well using a
pipette. Further disrupt the cells using a sonicating probe while
maintaining the cell lysate at 4 °C.
3. Heat the lysate for 20 min at 56 °C using a heating block to
denature the protein.
4. Determine the protein concentration using a BCA assay as per
manufacturer’s instructions.
5. Transfer 100 μg protein lysate aliquots into microcentrifuge
tubes and freeze at −80 °C until required (see Note 4).
3.2 Filter Aided 1. Mix 100 μg of protein lysate with 200 μL of 8 M Urea.
Sample Preparation 2. Transfer the solution to a Microcon-10 kDa Centrifugal Filter
(FASP) Unit and spin using a microcentrifuge set to 14,000 × g at
20 °C for 40 min.
3. Discard the filtrate (flow-through) and dilute the concentrate
with 200 μL of Wash buffer 1 and spin using a microcentrifuge
set at 14,000 × g at 20 °C for 40 min.
192 Orla Coleman et al.
3.3 Protein Digestion 1. Dilute the concentrate with 100 μL of 50 mM Ammonium
Bicarbonate.
2. Add 5 μg of sequence-grade trypsin (1:20 enzyme:protein).
3. Add 1 μL of 1% ProteaseMax™ Surfactant (see Note 5).
4. Digest at 37 °C for 3 h, see Note 6.
5. Transfer the Microcon-10 kDa Centrifugal Filter Unit to a
new collection tube and centrifuge at 14,000 × g at 20 °C for
40 min. Retain the filtrate in the collection tube.
6. The FASP ultrafiltration device must be rinsed post-digestion to
elute residual peptides that may be bound to the filter membrane
or walls of the device. Rinse the filter unit with 50 μL of the 0.5 M
NaCl rinse solution and spin at 14,000 × g at 20 °C for 20 min.
7. Store the filtrate that contains the peptides at −80 °C until
required.
3.4 Peptide 1. Add 6 μL of sample acidification buffer to the peptide filtrate
Purification to give a final concentration of 0.1% TFA.
2. Aspirate the 100 μL C18 tip using 100 μL of wetting solution
and discard the solvent flow-through (see Note 7).
3. Repeat step 2.
4. Equilibrate the C18 tip using 100 μL of the equilibration buf-
fer and discard the solvent flow-through.
5. Repeat step 4.
6. Aspirate and dispense the peptide sample into the C18 tip ten
times to allow peptide binding (see Note 8).
7. Wash the C18 tip using 100 μL of the rinse solution and
discard rinse wash.
8. Repeat step 7.
9. Slowly elute the peptide sample using 50 μL of elution buffer
into a new microcentrifuge tube.
10. Repeat step 9 to give a final volume of 100 μL.
11. Concentrate the peptide sample to dryness in a SpeedVac
vacuum dryer.
12. Freeze peptide sample at −80 °C or proceed directly to Strong
Cation Exchange preparation.
FASP for CHO Proteomic Analysis 193
3.5 Strong Cation 1. Condition SCX spin column with 400 μL of 10 mM KH2PO4
Exchange (SCX) Using in 25% ACN pH 3.0 and centrifuge at 2000 × g for 5 min.
Pierce™ Mini Spin Discard the flow-through.
Columns 2. Resuspend the dried peptides from the final step of Subheading
3.4 in 200 μL of 10 mM KH2PO4 in 25% ACN pH 3.0. Apply this
to the conditioned SCX column, centrifuge at 2000 × g for 5 min.
3. Add 200 μL of elution buffer step 1, centrifuge at 2000 × g for
5 min, and collect the flow-through.
4. Repeat this procedure to elute the peptides in a step-wise man-
ner using elution buffer step 2 through to elution buffer step
10, collecting each flow-through.
5. Proceed directly to desalting using peptide purification in
Subheading 3.4 or freeze at −80 °C. Once desalting is com-
plete the peptide samples are ready for LC-MS analysis.
4 Notes
Acknowledgments
References
1. Wisnieskie JR, Zougman A, Nagaraj N, Mann proteomic experiments. J Proteome Res 13(4):
M (2009) Universal sample preparation method 1885–1895
for proteome analysis. Nat Methods 6(5): 5. Deeb SJ, Cox J, Schmidt-Supprian M, Mann M
359–362 (2014) N-linked glycosylation enrichment for
2. Wiśniewski JR, Ostasiewicz P, Mann M (2011) in-depth cell surface proteomics of diffuse large
High recovery FASP applied to the proteomic B-cell lymphoma subtypes. Mol Cell Proteomics
analysis of microdissected formalin fixed paraffin 13(1):240–251
embedded cancer tissues retrieve known 6. Hecht ES, McCord JP, Muddiman DC (2016)
colon cancer markers. J Proteome Res 10(7): A quantitative glycomics and proteomics com-
3040–3049 bined purification strategy. J Vis Exp 109:
3. Wiśniewski JR, Nagaraj N, Zougman A, Gnad e53735. doi:10.3791/53735
F, Mann M (2010) Brain phosphoproteome 7. Baycin-Hizal D, Tabb DL, Chaerkady R, Chen
obtained by a FASP-based method reveals L, Lewis NE, Nagarajan H, Sarkaria V, Kumar
plasma membrane protein topology. J Proteome A, Wolozny D, Colao J, Jacobsen E, Tian Y,
Res 9(6):3280–3289 O’Meally RN, Krag SS, Cole RN, Palsson BO,
4. Erde J, Ogorzalek Loo RR, Loo JA (2014) Zhang H, Betenbaugh M (2012) Proteomic
Enhanced FASP (eFASP) to increase proteome analysis of Chinese hamster ovary cells.
coverage and sample recovery for quantitative J Proteome Res 11(11):5265–5272
Chapter 13
Abstract
The reversible phosphorylation of proteins on serine, threonine, and tyrosine residues is one of the most
important post-translational modifications that regulates many biological processes. The phosphopro-
teome has not been studied in any great detail in recombinant Chinese hamster ovary (CHO) cells to date
despite phosphorylation playing a crucial role in regulating many molecular and cellular processes relevant
to bioprocess phenotypes including, for example, transcription, translation, growth, apoptosis, and signal
transduction. In this chapter, we provide a protocol for the phosphoproteomic analysis of Chinese hamster
ovary cells using phosphopeptide enrichment with metal oxide affinity chromatography (MOAC) and
immobilized metal affinity chromatography (IMAC) techniques, followed by site-specific identification of
phosphorylated residues using LC-MS (MS2 and MS3) strategies.
1 Introduction
The Chinese hamster ovary (CHO) cell is the most commonly used
mammalian host cell line for the production of recombinant bio-
therapeutics [1]. This dominance is likely to continue for the fore-
seeable future due to their ability to correctly fold proteins that are
compatible with human use, their ability to produce proteins with
human-like post-translational modifications, their safety record,
and their track record in industry [2]. There has been considerable
success in developing high-producing CHO cell culture processes
through media optimization and bioreactor design [3, 4]; how-
ever, the bottlenecks in the cellular machinery for the efficient pro-
duction of recombinant proteins are poorly understood. In order
to improve the efficiency of production with the overall aim of
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_13, © Springer Science+Business Media LLC 2017
195
196 Michael Henry et al.
2 Materials
19. Proteome Discover 2.1 (Thermo Fisher Scientific) with
SEQUEST HT and phosphoRS 3.1 [25] and suitable
Cricetulus griseus protein database in fasta format [26].
2.2 Reagents Ensure that all solvents and water are LC-MS grade.
1. DL-Dithiothreitol (DTT).
2. Iodoacetamide.
3. Urea.
4. LC-MS grade water.
5. HEPES.
6. Sequencing-grade modified trypsin (e.g., Promega, Thermo
Fisher Scientific, Sigma Aldrich).
7. ProteaseMax™ Surfactant Trypsin Enhancer (Promega).
8. Trifluoroacetic acid (TFA): use a fume hood when preparing
solutions with this acid.
9. Acetonitrile (ACN).
10. Ammonium Bicarbonate.
11. Halt™ Protease Inhibitor Cocktail (Thermo Fisher Scientific).
12. Halt™ Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific).
13. Ammonium Hydroxide (NH4OH) ACS Reagent (Sigma Aldrich).
14. Potassium Phosphate Monobasic (KH2PO4).
15. Potassium Chloride (KCl).
2.3 Cell Lysis, 1. 50 mM HEPES buffer: Add 1.19 g of HEPES to 100 mL of
Protein Extraction, LC-MS water.
and Protein 2. Lysis Buffer: 0.2% ProteaseMax solution in 8 M Urea, 50 mM
Quantification Ammonium Bicarbonate.
3. 1 mg of recombinant Chinese hamster ovary (CHO) cells
(approximately 1 × 107 cells).
Table 1
Overview of preparation of KC1 elution buffers
Elution buffer KCL (g) 10 mM KH2PO4 in 25% ACN (mL) KCl concentration (mM)
Elution buffer step 1 0.007 10 10
Elution buffer step 2 0.037 10 50
Elution buffer step 3 0.075 10 100
Elution buffer step 4 0.373 10 500
2.5 Peptide 1. Diluent solution: To prepare 1 L add 1.36 g of KH2PO4 and
Fractionation Using 250 mL of acetonitrile to 750 mL of LC-MS grade water and
Strong Cation adjust the pH to 3.0.
Exchange (SCX) Spin 2. Prepare the following 10 mL Potassium Chloride (KCl) elu-
Cartridges tion buffers as outlined in Table 1 using the 10 mM KH2PO4
in 25% acetonitrile pH 3.0 diluent.
2.6 Fe-NTA (IMAC) Wash buffers A and B must be prepared prior to starting the pro-
Phosphopeptide tocol. 300 μL of each wash buffer is required per spin column, i.e.,
Enrichment Buffer sample.
Preparation 1. Wash buffer A: Add 150 μL of the 2× wash buffer stock sup-
plied in the kit to 150 μL of LC-MS grade water.
2. Wash buffer B: Add 150 μL of the 2× wash buffer stock sup-
plied in the kit and 30 μL of acetonitrile to 120 μL of LC-MS
grade water.
2.7 TiO2 The following buffer preparations are for the enrichment of one to
Phosphopeptide six samples, if more samples are being processed scale up the buffer
Enrichment Buffer volumes accordingly or see manufacturer’s protocol.
Preparation 1. Buffer A: Add 401 μL of ACN and 2 μL of TFA to 100 μL of
LC-MS water.
2. Buffer B: Add 400 μL of 90% lactic acid (provided in the kit)
to 1 mL of Buffer A.
3. Elution Buffer 1: Add 20 μL of 30% Ammonium Hydroxide to
380 μL of LC-MS water.
4. Elution Buffer 2: Add 20 μL of Pyrrolidine (provided in the
kit) to 380 μL of LC-MS water.
2.9 Reverse Phase 1. Solvent A: 2% ACN in LC-MS grade water containing 0.1%
Chromatography formic acid. Prepare 100 mL. Use a fume hood to prepare this
Buffers solution.
2. Solvent B: 80% ACN, 20% LC-MS grade water containing
0.8% formic acid. Prepare 100 mL.
3 Methods
3.1 Cell Lysis 1. Harvest cells and wash with prechilled 50 mM HEPES buffer
three times. Centrifuge at 1000 × g for 5 min and remove the
supernatant. Snap freeze the cell pellet in a microcentrifuge
tube using liquid nitrogen (take extreme caution when doing
this). Store at −80 °C until cell lysis is performed.
2. Lyse cell pellets corresponding to 1 × 107 cells with 1 mL of
lysis buffer containing 1× Halt™ Protease Inhibitor cocktail
and 1× Halt™ Protease Inhibitor cocktail. Suspend the cell
pellet in the lysis buffer and mix the solution by vigorous vor-
texing for 5 min.
3. Disrupt the cells using a sonicating probe while maintaining
the lysate at 4 °C.
4. Centrifuge the sample at 14,000 × g for 15 min at 4 °C. Collect
supernatant into a fresh microcentrifuge tube.
5. Determine protein concentration using a BCA assay according
to manufacturer’s instructions.
6. Transfer 500 μg of protein lysate aliquots into microcentrifuge
tubes and freeze at −80 °C until required.
7. Prior to digestion, dilute sample with 50 mM ammonium
bicarbonate to achieve a final urea concentration of 1 M.
3.2 In Solution 1. Adjust the volume of 500 μg protein lysate to 84 μL with
Protein Digestion 50 mM ammonium bicarbonate.
2. Add 1 μL of 0.5 M DTT and heat the lysate at 56 °C for
20 min to reduce the protein.
3. Add 2.7 μL of 0.55 M iodoacetamide and incubate at room
temperature in the dark for 20 min to allow for alkylation.
4. Add 12.5 μL of 1 μg/μL sequence-grade trypsin (1:40
enzyme:protein).
Phosphoproteomic Analysis of CHO Cells 201
3.3 Peptide 1. Remove the top and bottom caps from the graphite spin col-
Concentration umn (see Note 3) and place the column in a 1.7 mL collection
and Desalting tube. Centrifuge at 2000 × g for 1 min and discard the
with Graphite Spin flow-through.
Columns 2. Prime the Graphite spin column using 100 μL of 1 M NH4OH.
Centrifuge at 2000 × g for 1 min and discard the flow-
through.
3. Activate the graphite spin column using 100 μL of ACN.
Centrifuge at 2000 × g for 1 min and discard the flow-
through.
4. Apply the peptide sample from Subheading 3.2 to the graphite
resin and allow sample binding for 10 min with occasional
vortexing.
5. Centrifuge at 1000 × g for 3 min and discard the flow-
through.
6. Wash the graphite spin column using 100 μL of the rinse solu-
tion, centrifuge at 2000 × g for 1 min and discard rinse wash.
7. Repeat step 6.
8. Place the graphite spin column in a new collection tube and
elute the peptide sample using 100 μL of elution buffer into a
new microcentrifuge tube.
9. Repeat step 8 three more times to give a final volume of
400 μL.
10. Concentrate the peptide sample to dryness in a SpeedVac vac-
uum dryer.
11. Freeze peptide sample at −80 °C or proceed directly to Strong
Cation Exchange preparation.
3.4 Strong Cation 1. Condition a SCX spin column with 400 μL of 10 mM KH2PO4
Exchange (SCX) Using in 25% ACN pH 3.0 and centrifuge at 2000 × g for 5 min.
Pierce™ Mini Spin Discard the flow-through.
Columns 2. Resuspend the dried peptides from the final step of Subheading
3.4 in 200 μL of 10 mM KH2PO4 in 25% ACN pH 3.0. Apply
this to the conditioned SCX column and centrifuge at 2000 × g
for 5 min.
202 Michael Henry et al.
3.5 IMAC 1. Resuspend the dried sample from the SCX fractionation proto-
Phosphopeptide col in 200 μL of Binding buffer. Add the sample to a Fe-NTA
Enrichment spin column and incubate for 20 min at room temperature on
a rotator.
2. Remove the bottom cap from the column and place the col-
umn into a microcentrifuge tube and centrifuge at 1000 × g for
1 min. Transfer the column to a new tube.
3. Add 100 μL of wash buffer A to the column and pipette well
to mix contents. Centrifuge the tube at 1000 × g for 1 min.
Transfer column to a new tube.
4. Repeat step 3.
5. Add 100 μL of wash buffer B to the column and pipette well
to mix contents. Centrifuge the tube at 1000 × g for 1 min.
Transfer the column to a new tube.
6. Repeat step 5.
7. Equilibrate the column by adding 100 μL of LC-MS water to
the column and mix contents by pipetting. Centrifuge the col-
umn at 1000 × g for 1 min. Transfer the column to a new tube.
8. Elute the phosphopeptides by adding 50 μL of Elution buffer
to the column and incubate for 5 min at room temperature.
Centrifuge the column at 1000 × g for 1 min and retain the
eluate (flow-through).
9. Repeat step 8 and pool the elution fractions.
10. Acidify the elution fraction by adding 200 μL of 2.5% TFA to
the sample. Proceed to Subheading 3.3.
Fig. 1 Processing workflow for MS2 and MS3 data using Proteome Discoverer 2.1
Phosphoproteomic Analysis of CHO Cells 205
3. Scan Event Filter (11) and (12) (see Fig. 1) selects for MS2
and MS3 data respectively.
4. From Scan Event Filter (11) into Search algorithm SEQUEST
HT (2) (see Fig. 1), apply the following search parameters for
all MS2 data for protein identification: (1) set peptide mass
tolerance to 20 ppm, (2) set MS/MS mass tolerance to 0.6 Da,
(3) allow up to two missed cleavages, (4) set carbamidometh-
ylation as a fixed modification (i.e., Carboxymethyl (C) means
that all calculations will use 161 Da as the mass of cysteine),
(5) set methionine oxidation as a variable modification (where
the methionine residue may or may not be oxidized (Met
+16 Da)), and (6) set serine, threonine, and tyrosine phos-
phorylation as variable modifications (where the serine, threo-
nine, and tyrosine residues may have the addition of a phosphate
group HPO3 (Ser +80 Da, Thr +80 Da, Tyr +80 Da)) (see
Fig. 2a and 2b).
5. From Scan Event Filter (12) into Search algorithm SEQUEST
HT (15) (see Fig. 1), set the following search parameters for all
MS3 (neutral loss) data for protein identification: (1) set pep-
tide mass tolerance to 0.6 Da, (2) set MS/MS mass tolerance
to 0.6 Da, (3) allow up to two missed cleavages, (4) set carb-
amidomethylation as a fixed modification, (5) set methionine
oxidation as variable modification, (6) set serine, threonine,
and tyrosine phosphorylation as variable modifications, and
(7) set neutral loss of phosphoric acid H3PO4 (−98 Da) from
phosphorylated serine, threonine, and tyrosine phosphoryla-
tion as variable modifications (see Fig. 2c).
6. Process the output from SEQUEST through Percolator
(a semi-supervised learning and decoy database search strategy
to distinguish between correct and incorrect identifications
accepting a 1% FDR) [28].
7. Accept only peptides with XCorr scores >1.5 for singly charged
ions, >2.0 for doubly charged ions, and >3.0 for triply charged
ions.
8. Determine the phosphorylation site location in the peptide
sequence through phosphoRS (ptmRS) in Proteome Disco
verer 2.1 [25]. Apply a site probability cut-off score of 75% or
greater for S, T, or Y amino acids [25, 29, 30].
4 Notes
Fig. 2 (a) MS/MS of DGQVINTSQHDDLE showing sequence ladder matching glutamine (Q) to serine (S) and
has a mass difference of 87 Da confirming unmodified serine. (b) MS/MS of DGQVINTS*QHDDL showing a
sequence ladder matching glutamine (Q) to serine (S) and has a mass difference of 167 Da (addition of phos-
phate group (HPO3) confirming phosphorylated serine (+80 ΔM on Serine). (c) MS/MS/MS of DGQVINTS*QHDDL
showing a neutral loss event on serine where the sequence ladder matching glutamine (Q) to serine (S) has a
mass difference of −18 Da which corresponds to the loss of phosphoric acid from the phosphorylated residue
to produce a di-dehydroamino acid
Acknowledgments
References
1. Walsh G (2014) Biopharmaceutical bench- Baycin-Hizal D, Latif H, Forster J, Betenbaugh
marks. Nat Biotechnol 32(10):992–1000 MJ, Famili I, Xu X, Wang J, Palsson BO
2. Wurm FM (2004) Production of recombinant (2013) Genomic landscapes of Chinese ham-
protein therapeutics in cultivated mammalian ster ovary cell lines as revealed by the Cricetulus
cells. Nat Biotechnol 22(11):1393–1398 griseus draft genome. Nat Biotechnol 31(8):
3. Altamirano C, Paredes C, Cairó JJ, Gòdia F 759–765
(2000) Improvement of CHO cell culture 8. Xu X, Nagarajan H, Lewis NE, Pan S, Cai Z,
medium formulation: simultaneous substitu- Liu X, Chen W, Xie M, Wang W, Hammond S,
tion of glucose and glutamine. Biotechnol Andersen MR, Neff N, Passarelli B, Koh W,
Prog 16:69–75 Fan HC, Wang J, Gui Y, Lee KH, Betenbaugh
4. Prentice HL, Ehrenfels BN, Sisk WP (2007) MJ, Quake SR, Famil I, Palsson BO, Wang
Improving performance of mammalian cells in J (2011) The genomic sequence of the Chinese
fed-batch processes through “bioreactor evolu- hamster ovary (CHO)-K1 cell line. Nat
tion”. Biotechnol Prog 23:458–464 Biotechnol 29(8):735–741
5. Kildegaard HF, Baycin-Hizal D, Lewis NE, 9. Brinkrolf K, Rupp O, Laux H, Kollin F, Ernst
Betenbaugh MJ (2013) The emerging CHO W, Linke B, Kofler R, Romand S, Hesse F,
systems biology era: harnessing the 'omics rev- Budach WE, Galosy S, Muller D, Noll T,
olution for biotechnology. Curr Opin Wienberg J, Jostock T, Leonard M, Grillari J,
Biotechnol 24(6):1102–1107 Tauch A, Goesmann A, Helk B, Mott JE,
Puhler A, Borth N (2013) Chinese hamster
6. Gutierrez JM, Lewis NE (2015) Optimizing genome sequenced from sorted chromosomes.
eukaryotic cell hosts for protein production Nat Biotechnol 31(8):694–695
through systems biotechnology and genome-
scale modeling. Biotechnol J 10(7):939–949
1 0. Kaas CS, Kristensen C, Betenbaugh MJ,
Andersen MR (2015) Sequencing the CHO
7. Lewis N, Liu X, Li Y, Nagarajan H, Yerganian DXB11 genome reveals regional variations in
G, O'Brien E, Bordbar A, Roth AM, genomic stability and haploidy. BMC Genomics
Rosenbloom J, Bian C, Xie M, Chen W, Li N, 16:160
208 Michael Henry et al.
11. Baycin-Hizal D, Tabb DL, Chaerkady R, Chen 22. Simon GM, Cravatt BF (2008) Challenges for
L, Lewis NE, Nagarajan H, Sarkaria V, Kumar the 'chemical-systems' biologist. Nat Chem
A, Wolozny D, Colao J, Jacobson E, Tian Y, Biol 4(11):639–642
O'Meally RN, Krag SS, Cole RN, Palsson BO, 23. Angel TE, Aryal UK, Hengel SM, Baker ES,
Zhang H, Betenbaugh M (2012) Proteomic Kelly RT, Robinson EW, Smith RD (2012)
analysis of Chinese hamster ovary cells. Mass spectrometry-based proteomics: existing
J Proteome Res 11(11):5265–5276 capabilities and future directions. Chem Soc
12. Guo Y, Xiao P, Lei S, Deng F, Xiao GG, Liu Y, Rev 41(10):3912–3928
Chen X, Li L, Wu S, Chen Y, Jiang H, Tan L, 24. Thingholm TE, Jensen ON, Robinson PJ,
Xie J, Zhu X, Liang S, Deng H (2008) How Larsen MR (2008) SIMAC (sequential elution
is mRNA expression predictive for protein from IMAC), a phosphoproteomics strategy
expression? A correlation study on human cir- for the rapid separation of monophosphory-
culating monocytes. Acta Biochim Biophys Sin lated from multiply phosphorylated peptides.
40(5):426–436 Mol Cell Proteomics 7(4):661–671
13. Farrell A, McLoughlin N, Milne JJ, Marison 25. Taus T, Köcher T, Pichler P, Paschke C,
IW, Bones J (2014) Application of multi-omics Schmidt A, Henrich C, Mechtler K (2011)
techniques for bioprocess design and optimiza- Universal and confident phosphorylation site
tion in Chinese hamster ovary cells. J Proteome localization using phosphoRS. J Proteome Res
Res 13(7):3144–3159 10(12):5354–5362
14. Choudhary C, Mann M (2010) Decoding sig- 26. Meleady P, Hoffrogge R, Henry M, Rupp O,
nalling networks by mass spectrometry-based Bort JH, Clarke C, Brinkrolf K, Kelly S, Müller
proteomics. Nat Rev Mol Cell Biol 11(6): B, Doolan P, Hackl M, Beckmann TF, Noll T,
427–439 Grillari J, Barron N, Pühler A, Clynes M, Borth
15. Cohen P (2001) The role of protein phosphor- N (2012) Utilization and evaluation of CHO-
ylation in human health and disease. The Sir specific sequence databases for mass spect
Hans Krebs Medal Lecture. Eur J Biochem rometry based proteomics. Biotechnol Bioeng
268(19):5001–5010 109(6):1386–1394
16. Olsen JV, Vermeulen M, Santamaria A, Kumar 27. Liu S, Zhang C, Campbell JL, Zhang H, Yeung
C, Miller ML, Jensen LJ, Gnad F, Cox J, Jensen KK, Han VK, Lajoie GA (2005) Formation of
TS, Nigg EA, Brunak S, Mann M (2010) phosphopeptide-metal ion complexes in liquid
Quantitative phosphoproteomics reveals wide- chromatography/electrospray mass spectrom-
spread full phosphorylation site occupancy dur- etry and their influence on phosphopeptide
ing mitosis. Sci Signal 3(104):ra3 detection. Rapid Commun Mass Spectrom
17. Dephoure N, Gould KL, Gygi SP, Kellogg DR 19(19):2747–2756
(2013) Mapping and analysis of phosphoryla- 28. Spivak M, Weston J, Bottou L, Käll L, Noble
tion sites: a quick guide for cell biologists. Mol WS (2009) Improvements to the percolator
Biol Cell 24(5):535–542 algorithm for peptide identification from shot-
18. Martini M, De Santis MC, Braccini L, Gulluni gun proteomics data sets. J Proteome Res
F, Hirsch E (2014) PI3K/AKT signaling path- 8(7):3737–3745
way and cancer: an updated review. Ann Med 29. Alpert AJ, Hudecz O, Mechtler K (2015)
5:1–12 Anion-exchange chromatography of phospho-
19. Hopkins BD, Hodakoski C, Barrows D, Mense peptides: weak anion exchange versus strong
SM, Parsons RE (2014) PTEN function: the anion exchange and anion-exchange chroma-
long and the short of it. Trends Biochem Sci tography versus electrostatic repulsion-
39(4):183–190 hydrophilic interaction chromatography. Anal
20. Farrell AS, Allen-Petersen B, Daniel CJ, Wang X, Chem 87(9):4704–4711
Wang Z, Rodriguez S, Impey S, Oddo J, Vitek 30. Roitinger E, Hofer M, Köcher T, Pichler P,
MP, Lopez C, Christensen DJ, Sheppard B, Sears Novatchkova M, Yang J, Schlögelhofer P,
RC (2014) Targeting inhibitors of the tumor Mechtler K (2015) Quantitative phosphopro-
suppressor PP2A for the treatment of pancreatic teomics of the ataxia telangiectasia-mutated
cancer. Mol Cancer Res 12(6):924–939 (ATM) and ataxia telangiectasia-mutated and
21. Whitmarsh AJ, Davis RJ (2000) Regulation of rad3-related (ATR) dependent DNA damage
transcription factor function by phosphoryla- response in Arabidopsis thaliana. Mol Cell
tion. Cell Mol Life Sci 57(8–9):1172–1183 Proteomics 14(3):556–571
Chapter 14
Abstract
Chinese hamster ovary (CHO) cells have become the primary expression system for the production of
complex recombinant proteins due to their long-term success in industrial scale production and generating
appropriate protein N-glycans similar to that of humans. Control and optimization of protein
N-glycosylation is crucial, as the structure of N-glycans can largely influence both biological and physico-
chemical properties of recombinant proteins. Protein N-glycosylation in CHO cell culture can be con-
trolled and tuned by engineering medium, feed, culture process, as well as genetic elements of the cell. In
this chapter, we will focus on how to carry out experiments for N-glycosylation modulation through
medium and feed optimization. The workflow and typical methods involved in the experiment process will
be presented.
Key words Chinese hamster ovary cells, N-Glycosylation, Medium and feed optimization, Fed-batch
culture
1 Introduction
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_14, © Springer Science+Business Media LLC 2017
209
210 Yuzhou Fan et al.
2 Materials
Fig. 1 Typical workflow and methods used for modulating recombinant protein N-glycosylation in CHO cell
culture through medium and feed engineering
10.
Agilent 2100 Bioanalyzer (Agilent Technologies, Santa
Clara, CA).
11. Total RNA nano chip (Agilent Technologies).
12. Illumina Hiseq 2000 system (Illumina, San Diego, CA).
2.2 Cell Culture 1. Recombinant protein production cell line (1–2 × 107 cells/
vial) that is cryopreserved in culture medium with 5–10%
DMSO (Sigma, St. Louis, MO) from a working cell bank
stored at −150 °C or lower.
2. Culture medium in this experiment setup is a serum-free and
chemically defined medium. Depending on cell line and culture
process, different media can be used. Here are examples of some
commercially available culture media that are typically used for
CHO cell culture: CD CHO, CD OptiCHO™, CD FortiCHO™
(Life Technologies, Carlsbad, CA), Ex-Cell™ CD CHO
(Sigma), ProCHO™5, PowerCHO-2 CD (Lonza, Switzerland),
BalanCD™ CHO Growth A (Irvine Scientific, Santa Ana, CA),
Cellvento™ CHO-100 (Millipore, Billerica, MA), and
CDM4CHO SFM4CHO (GE Healthcare, Fairfield, CA),
ActiCHO™ P (GE Healthcare). If the medium is l-glutamine
free, additional l-glutamine (Life Technologies) is normally sup-
plemented (usually add up to 4–8 mM) for non-glutamine syn-
thetase-engineered cell lines. Optionally, 1% MEM Non-Essential
Amino Acids (100×) (Life Technologies) and 0.1–1% Anti-
clumping agent (Life Technologies) can also be added to the
culture medium.
3. Base: autoclaved 0.5–2 M NaOH or NaHCO3 or Na2CO3
(Sigma Aldrich).
4. 45% d-(+)-Glucose solution (Sigma Aldrich).
5. 10% ADCF antifoam-irradiated Solution (GE Healthcare).
6. Feed supplement medium (various commercial products avail-
able): feed supplement medium provides cell culture nutrients
such as lipids, amino acids, vitamins, and growth factors.
7. Feed additives: feed additives can be dissolved in culture
medium and/or feed supplement medium to an appropriate
concentration. The amount of feed additives in culture medium,
feed supplement medium, and the final concentration achieved
in the cell culture can be continuously optimized according to
the results of the experiment.
3 Methods
3.1 Thaw Cells 1. Thaw a vial of cells from working cell bank at 37 °C and trans-
and Cell Culture fer the cells to a 125 mL shake flask.
Maintenance 2. Wash the cells with 20 mL of pre-warmed culture medium at
(See Note 1) 37 °C. Spin down the cells at 200 × g, and discard the super-
natant to remove DMSO in the culture.
3. Add 25 mL pre-warmed culture medium to the shake flask and
maintain the culture at 37 °C, 5% CO2, 150 rpm in a humidi-
fied incubator.
4. Perform cell count and viability measurement using a hemocy-
tometer after 1 h.
5. Maintain cell in shake flasks with a 2 or 3-day passage for 1–3
weeks before starting the fed-batch culture. Perform cell count
and viability measurement before each passage (see Note 2).
Seed 0.5 × 106 viable cells/mL or 0.3 × 106 viable cells/mL
before a 2-day or a 3-day passage, respectively.
214 Yuzhou Fan et al.
3.3 Sampling Sampling is typically carried along the fed-batch process to monitor
Strategies cell culture physiology (e.g., growth, metabolism), product quan-
Medium and Feed Related N-Glyco-Engineering 215
3.4 Analytical Samples from cell culture can be further processed using various
Techniques analytical techniques to obtain relevant data that support
N-glycosylation modulation. Here, some of the most commonly
used analytical methods are shown. However, many of them have
detailed procedures themselves, as described in relevant manufac-
turer’s instructions or publications; therefore, only brief descrip-
tions are presented here to give readers an overview of how these
analytical methods work.
3.4.1 Cell Count 1. Load sufficient amount of cell culture in sample vial (for Vi-
and Viability Analysis CELL) or Via1-Cassette (for nucleocounter NC-200).
2. Carry out total cell count and dead cell count using Vi-CELL
or Via1-Cassette. Viable cell count and viability can also be
calculated automatically.
3.4.6 RNA-Seq Method for RNA sequencing of samples from CHO cell culture
and data analysis pipeline has been well developed [66]. In brief,
the major steps include:
1. RNA from 5 × 106 cells is extracted using TRIzol and RNeasy
Cleanup kit.
2. RNA concentration is quantified using NanoDrop ND-1000.
3. RNA integrity is analyzed using total RNA nano chip on
Agilent 2100 Bioanalyzer.
4. cDNA library generation is performed using TruSeq RNA
sample Preparation Kit v2.
5. Paired-end sequencing using Illumina Hiseq 2000 system.
6. Sequencing data treatment includes: (1) adaptamers removal
and low quality ends trimming, using FASTX Toolkit, (2)
quality check by FASTQC, (3) align the reads to CHO-K1
genome using Tophat2, (4) count reads using HTseq.
3.4.7 Proteomics Method for proteomics analysis in CHO cell culture is reported
Analysis in [57]. Briefly, the key procedure is as follows:
Medium and Feed Related N-Glyco-Engineering 219
3.5 Comments Cell culture components, including glucose, amino acids, NH4+
on Medium and Feed etc., can be directly modulated by changing culture medium, feed
Engineering supplement medium, and feeding strategy (e.g., feeding amount
and frequency) and consequently N-glycosylation patterns can be
altered accordingly. Therefore, benchmarking different combina-
tions of culture media and feed supplement media with appropriate
feeding strategies may be applied for medium and feed engineering
as a starting point. One or more current systems biology approaches,
including transcriptomic, proteomic, glycomic, and metabolomic
analysis, may also be implemented in this screening process for
selecting and further improving culture medium and feed supple-
ment medium for a specific production cell line. In particular,
extracellular and intracellular metabolic analysis is very commonly
used in exploring metabolic bottlenecks in cell culture and pro-
vides guidance for further optimizing the medium and feed.
When culture medium and feed supplement medium are
chosen, modification of these media can be done by addition of
different amounts of feed additives or feed additive combinations,
including, but not limited to, glucose, glutamine, other amino
acids, galactose, sodium butyrate, uridine, manganese, and other
nucleotide sugar precursors. Reported effects of various modifica-
tions in media and feed on recombinant protein N-glycosylation
220
Yuzhou Fan et al.
Table 1
Effect of media and feed modifications on recombinant protein N-glycosylation
4 Notes
References
1. Berger M, Kaup M, Blanchard V (2012) lucose metabolism in fed-batch CHO cell
g
Protein glycosylation and its impact on bio- culture affects antibody production and glyco-
technology. Adv Biochem Eng Biotechnol sylation. Biotechnol Bioeng 112(3):521–535.
127:165–185. doi:10.1007/10_2011_101 doi:10.1002/bit.25450
2. Butler M (2006) Optimisation of the cellular 11. Fan Y, Jimenez Del Val I, Muller C, Lund AM,
metabolism of glycosylation for recombinant Sen JW, Rasmussen SK, Kontoravdi C, Baycin-
proteins produced by Mammalian cell systems. Hizal D, Betenbaugh MJ, Weilguny D,
Cytotechnology 50(1–3):57–76. doi:10.1007/ Andersen MR (2015) A multi-pronged investi-
s10616-005-4537-x gation into the effect of glucose starvation and
3. Costa AR, Rodrigues ME, Henriques M, culture duration on fed-batch CHO cell cul-
Oliveira R, Azeredo J (2013) Glycosylation: ture. Biotechnol Bioeng 112(10):2172–2184.
impact, control and improvement during doi:10.1002/bit.25620
therapeutic protein production. Crit Rev
12. Kildegaard HF, Fan Y, Sen JW, Larsen B,
Biotechnol 34(4):281–299. doi:10.3109/073 Andersen MR (2016) Glycoprofiling effects of
88551.2013.793649 media additives on IgG produced by CHO
4. Hossler P, Khattak SF, Li ZJ (2009) Optimal cells in fed-batch bioreactors. Biotechnol
and consistent protein glycosylation in mam- Bioeng 113(2):359–366. doi:10.1002/bit.
malian cell culture. Glycobiology 19(9):936– 25715
949. doi:10.1093/glycob/cwp079 13. Schilling BM, Gangloff S, Kothari D, Leister
5. Bruhlmann D, Jordan M, Hemberger J, Sauer K, Matlock L, Zegarelli SG, Joosten CE, Basch
M, Stettler M, Broly H (2015) Tailoring JD, Sakhamuri S, Lee SS (2008) Production
recombinant protein quality by rational media quality enhancements in mammalian cell cul-
design. Biotechnol Prog 31(3):615–629. ture process for protein production. US Patent
doi:10.1002/btpr.2089 7,332,303
6. Liu B, Spearman M, Doering J, Lattova E, 14. Gramer MJ, Eckblad JJ, Donahue R, Brown J,
Perreault H, Butler M (2014) The availability Shultz C, Vickerman K, Priem P, van den
of glucose to CHO cells affects the intracellular Bremer ET, Gerritsen J, van Berkel PH (2011)
lipid-linked oligosaccharide distribution, site Modulation of antibody galactosylation
occupancy and the N-glycosylation profile of a through feeding of uridine, manganese chlo-
monoclonal antibody. J Biotechnol 170:17– ride, and galactose. Biotechnol Bioeng 108(7):
27. doi:10.1016/j.jbiotec.2013.11.007 1591–1602. doi:10.1002/bit.23075
7. Chee Furng Wong D, Tin Kam Wong K, Tang 15. St Amand MM, Tran K, Radhakrishnan D,
Goh L, Kiat Heng C, Gek Sim Yap M (2005) Robinson AS, Ogunnaike BA (2014) Con
Impact of dynamic online fed-batch strategies trollability analysis of protein glycosylation
on metabolism, productivity and N-glycosy in CHO cells. PLoS One 9(2):e87973.
lation quality in CHO cell cultures. Biotechnol doi:10.1371/journal.pone.0087973
Bioeng 89(2):164–177. doi:10.1002/bit. 16. St Amand MM, Radhakrishnan D, Robinson
20317 AS, Ogunnaike BA (2014) Identification of
8. Nyberg GB, Balcarcel RR, Follstad BD, manipulated variables for a glycosylation con-
Stephanopoulos G, Wang DI (1999) Metabolic trol strategy. Biotechnol Bioeng 111(10):1957–
effects on recombinant interferon-gamma gly- 1970. doi:10.1002/bit.25251
cosylation in continuous culture of Chinese 17. Chen P, Harcum SW (2005) Effects of amino
hamster ovary cells. Biotechnol Bioeng 62(3): acid additions on ammonium stressed
336–347 CHO cells. J Biotechnol 117(3):277–286.
9. Nahrgang S, Kkagten E, De Jesus M, Bourgeois doi:10.1016/j.jbiotec.2005.02.003
M, Déjardin S, Von Stockar U, Marison IW 18. Gawlitzek M, Ryll T, Lofgren J, Sliwkowski
(2002) The effect of cell line, transfection proce- MB (2000) Ammonium alters N-glycan struc-
dure and reactor conditions on the glycosylation tures of recombinant TNFR-IgG: degradative
of recombinant human anti-rhesus D IgGl. In: versus biosynthetic mechanisms. Biotechnol
Bernard A, Griffiths B, Noé W, Wurm F (eds) Bioeng 68(6):637–646
Animal cell technology: products from cells, cells 19. Crowell CK, Grampp GE, Rogers GN, Miller
as products. Springer, The Netherlands, pp 259– J, Scheinman RI (2007) Amino acid and man-
261. doi:10.1007/0-306-46875-1_59 ganese supplementation modulates the glyco-
10. Fan Y, Jimenez Del Val I, Muller C, Wagtberg sylation state of erythropoietin in a CHO
Sen J, Rasmussen SK, Kontoravdi C, Weilguny culture system. Biotechnol Bioeng 96(3):538–
D, Andersen MR (2015) Amino acid and 549. doi:10.1002/bit.21141
224 Yuzhou Fan et al.
20. Chen P, Harcum SW (2006) Effects of elevated intracellular glycosylation activities in CHO
ammonium on glycosylation gene expression cells: effects of nucleotide sugar precursor feed-
in CHO cells. Metab Eng 8(2):123–132. ing. Biotechnol Bioeng 107(2):321–336.
doi:10.1016/j.ymben.2005.10.002 doi:10.1002/bit.22812
21. Slade PG, Caspary RG, Nargund S, Huang CJ 31. Kunkel JP, Jan DC, Jamieson JC, Butler M
(2016) Mannose metabolism in recombinant (1998) Dissolved oxygen concentration in
CHO cells and its effect on IgG glycosylation. serum-free continuous culture affects N-linked
Biotechnol Bioeng 7(113):1468–1480. glycosylation of a monoclonal antibody. J Bio
doi:10.1002/bit.25924 technol 62(1):55–71
22. Zupke C, Brady LJ, Slade PG, Clark P, Caspary 32. Chotigeat W, Watanapokasin Y, Mahler S, Gray
RG, Livingston B, Taylor L, Bigham K, Morris PP (1994) Role of environmental conditions
AE, Bailey RW (2015) Real-time product attri- on the expression levels, glycoform pattern and
bute control to manufacture antibodies with levels of sialyltransferase for hFSH produced by
defined N-linked glycan levels. Biotechnol recombinant CHO cells. Cytotechnology 15
Prog 31(5):1433–1441. doi:10.1002/btpr. (1–3):217–221
2136 33. Lin AA, Kimura R, Miller WM (1993)
23. Lamotte D, Buckberry L, Monaco L, Soria M, Production of tPA in recombinant CHO cells
Jenkins N, Engasser JM, Marc A (1999) under oxygen-limited conditions. Biotechnol
Na-butyrate increases the production and Bioeng 42(3):339–350. doi:10.1002/bit.
alpha2,6-sialylation of recombinant interferon- 260420311
gamma expressed by alpha2,6- sialyltransferase 34. Hossler P (2012) Protein glycosylation control
engineered CHO cells. Cytotechnology 29(1): in Mammalian cell culture: past precedents
55–64. doi:10.1023/A:1008080432681 and contemporary prospects. Adv Biochem
24. Hong JK, Lee SM, Kim KY, Lee GM (2014) Eng Biotechnol 127:187–219. doi:10.1007/
Effect of sodium butyrate on the assembly, 10_2011_113
charge variants, and galactosylation of antibody 35. Zanghi JA, Mendoza TP, Schmelzer AE, Knop
produced in recombinant Chinese hamster RH, Miller WM (1998) Role of nucleotide
ovary cells. Appl Microbiol Biotechnol 98(12): sugar pools in the inhibition of NCAM polysi-
5417–5425. doi:10.1007/s00253-014-5596-8 alylation by ammonia. Biotechnol Prog
25. Andersen DC, Bridges T, Gawlitzek M, Hoy C 14(6):834–844. doi:10.1021/bp9800945
(2000) Multiple cell culture factors can affect 36. Kimura R, Miller WM (1997) Glycosylation of
the glycosylation of Asn-184 in CHO- CHO-derived recombinant tPA produced
produced tissue-type plasminogen activator. under elevated pCO2. Biotechnol Prog
Biotechnol Bioeng 70(1):25–31 13(3):311–317. doi:10.1021/bp9700162
26. Borys MC, Dalal NG, Abu-Absi NR, Khattak 37. Muthing J, Kemminer SE, Conradt HS, Sagi
SF, Jing Y, Xing Z, Li ZJ (2010) Effects of cul- D, Nimtz M, Karst U, Peter-Katalinic J (2003)
ture conditions on N-glycolylneuraminic acid Effects of buffering conditions and culture pH
(Neu5Gc) content of a recombinant fusion on production rates and glycosylation of clini-
protein produced in CHO cells. Biotechnol cal phase I anti-melanoma mouse IgG3 mono-
Bioeng 105(6):1048–1057. doi:10.1002/ clonal antibody R24. Biotechnol Bioeng
bit.22644 83(3):321–334. doi:10.1002/bit.10673
27. Gu X, Wang DI (1998) Improvement of 38. Yoon SK, Choi SL, Song JY, Lee GM (2005)
interferon-gamma sialylation in Chinese Effect of culture pH on erythropoietin produc-
hamster ovary cell culture by feeding of
tion by Chinese hamster ovary cells grown in
N-acetylmannosamine. Biotechnol Bioeng suspension at 32.5 and 37.0 degrees C.
58(6):642–648 Biotechnol Bioeng 89(3):345–356. doi:10.1002/
28. Yang M, Butler M (2002) Effects of ammonia bit.20353
and glucosamine on the heterogeneity of 39. Borys MC, Linzer DI, Papoutsakis ET (1993)
erythropoietin glycoforms. Biotechnol Prog Culture pH affects expression rates and glyco-
18(1):129–138. doi:10.1021/bp0101334 sylation of recombinant mouse placental lacto-
29. Baker KN, Rendall MH, Hills AE, Hoare M, gen proteins by Chinese hamster ovary (CHO)
Freedman RB, James DC (2001) Metabolic cells. Biotechnology 11(6):720–724
control of recombinant protein N-glycan pro- 40. Trummer E, Fauland K, Seidinger S, Schriebl
cessing in NS0 and CHO cells. Biotechnol K, Lattenmayer C, Kunert R, Vorauer-Uhl K,
Bioeng 73(3):188–202 Weik R, Borth N, Katinger H, Muller D (2006)
30. Wong NS, Wati L, Nissom PM, Feng HT, Lee Process parameter shifting: Part I. Effect of
MM, Yap MG (2010) An investigation of DOT, pH, and temperature on the performance
Medium and Feed Related N-Glyco-Engineering 225
Abstract
In the last decades, the number of approved therapeutic proteins drugs is increasing exponentially and a
large number of new therapeutic entities are progressing through clinical trials, solidifying biologics as the
most promising class of pharmaceuticals on the market. Several cell lines are available for biopharmaceuti-
cal processes but mammalian cells are preferred since they give fewer problems for immunogenicity as they
produce human-like post-translational modifications (PTMs). Glycosylation is the most common and
complex (for both bioprocess engineering and quality control) of these modifications. Obtaining the
desired glycosylation pattern is crucial for therapeutic proteins as it can impact significantly stability, half-
life and safety as well as driving molecular processes, modifying the way drug interacts with patients’ cells.
As a consequence, glycosylation (like other PTMs) needs to be regulated and accurately analyzed during
biopharmaceutical production. Herein we describe and discuss the analytical approaches for glycosylation
analysis of therapeutic glycoproteins produced in CHO (Chinese Hamster Ovary) cells. This chapter will
describe glycoprotein purification after separation from producing cell lines, N-glycan release and their
variants fine structural characterization through mass spectrometry techniques.
Key words Glycan analysis, Monoclonal antibodies, CHO cells, Mass spectrometry, Liquid
chromatography
1 Introduction
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_15, © Springer Science+Business Media LLC 2017
227
228 Sara Carillo et al.
2 Materials
2.1 Protein 1. 0.45 and 0.2 μm bottle top filter with SFCA (surfactant-free
A Purification cellulose acetate) membranes (Thermo Scientific™ Nalgene™).
2. 1 mL HiTrap Protein A column (GE Healthcare).
3. Phosphate-buffered saline (PBS) tablets.
4. 0.5 M acetic acid: 28.71 mL glacial acetic acid, ≥99.7%, make
up to 1 L (see Note 1).
5. 1.5 M Tris–HCl buffer: 181.65 g Tris base, adjust to pH 6.8
with HCl, make up to 1 L.
6. 10 kDa molecular weight cutoff (MWCO) ultra-centrifugal
filter units (Amicon), 4 mL capacity.
7. Bradford assay kit (Biorad protein assay dye), bovine gamma
globulin standard (Biorad).
230 Sara Carillo et al.
a)
IgG containing
supernatant
cell pellet
ÄKTA
clarification
PNGase F
1) 2 mM DTT
2) 10 mM IAA Spin
b) 3) Buffer exchange down
50mM ABC
N-glycans
c)
Reductive
amination
3 Methods
3.3 Fluorescent 1. Treat released glycans with 50 μL of 1% formic acid (room
Labeling temperature, 20 min), and reduce sample again to dryness
(see Note 8).
2. Derivatize N-glycans via reductive amination using 10 μL of
0.37 M 2-AB and 0.95 M sodium cyanoborohydride in 30%
v/v acetic acid in dimethyl-sulfoxide (see Note 2) at 65 °C for
2 h (Fig. 1c). For comparative simultaneous analysis it is pos-
sible to use a duplex stable isotope labeling approach [16].
3.4 Excess Dye 1. Upon completion of the labeling reaction, add 5 μL of water
Removal from Labeled and 85 μL of acetonitrile to the sample (see Note 9). Remove
Samples excess fluorophore by HILIC chromatography using a Thermo
Ultimate 3000 RS HPLC equipped with an Acquity BEH
Glycan analytical column, 1.7 μm, 2.1 mm × 50 mm (Waters)
(see Note 10). Gradient conditions are described in Table 1.
2. Collect the fraction eluting off the column in high aqueous
conditions (80% water, approximate retention time 3–6 min)
and concentrate to dryness in a vacuum-centrifuge. Sample
separation from unreacted labeling agent and targeted fraction
collection can be monitored using fluorescence detection.
3.5 Exoglycosidase 1. Transfer an aliquot of the labeled glycan pool into a fresh
Digestion tube and dry down. Add 1 μL of 10× 50 mM ammonium ace-
tate, pH 5.5, the required enzyme or array of enzymes, and
H2O to make up to 10 μL. Incubate overnight (16–18 h) at
37 °C (see Note 11). A typical array of enzymatic digestion is
234 Sara Carillo et al.
Table 1
Gradient conditions for excess dye removal via HLIC chromatography:
eluent A is ammonium formate buffer (pH 4.4), B is acetonitrile, and C is
water
Minutes %A %B %C
Initial 15 85 0
2.5 15 85 0
2.51 0 20 80
5 0 20 80
5.01 15 85 0
8 15 85 0
3.7 MS/MS Data 1. Using Glycoworkbench (see Note 3), draw glycan structure,
Analysis of N-Glycans mass options, and derivatization. In the structure tab, basic
structures from different glycan classes can be inserted and
modified/extended. Change properties of highlighted struc-
tures (right-click, mass options), such as derivatization, reducing
terminal labeling agent, ionization mode, and adducts.
2. Find glycans with a given m/z value. For an experimentally
obtained precursor, a list of possible glycan structures can be
populated based on a database search and provided parameters
by selecting Tools, Profiler, Find all structures with a given
m/z. Search, e.g., for the G0 glycan with a monoisotopic m/z
Glycosylation Analysis of Therapeutic Glycoproteins 235
FA2
FA2[6]G1 Monosaccharide Symbols
N-Acetyl Glucosamine
Mannose
Galactose (G)
Fucose (F)
Sialic Acid (S)
A2
FA2[3]G1
FA2G2
FA2G2S1
Man5
(1) Undigested
(2) + ABS
min 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
Fig. 2 Annotation of 2-AB-labeled anti-IL-8 IgG1 N-glycan profiles following exoglycosidase digestion. The top
profile (1) shows undigested pool of N-glycan, followed by a series of exoglycosidase digestions with (2)
Arthrobacter ureafaciens sialidase, ABS, (3) ABS and Bovine testis galactosidase, BTG and (4) ABS, BTG and
Bovine kidney fucosidase, BKF
Table 2
Gradient conditions for LC-FLR-MS/MS glycan analysis (column, flow rate,
and MS settings as reported in Subheading 2.6). Eluent A is ammonium
formate (pH 4.4), B is acetonitrile
Minutes %A %B
Initial 28 72
1.0 28 72
31.0 43 57
32.0 70 30
36.0 70 30
37.0 28 72
40.0 28 72
236 Sara Carillo et al.
3.8 Method The described method can be performed for structural identifica-
Applicability Examples tion of any oligosaccharide mixture released from mAbs. As an
example, here we report the 2-AA labeled N-glycan analysis from
IgG1 monoclonal antibody produced by CHO DP12 cell line.
3.8.1 IgG1 N-Glycan 20 mL of culture media was transferred to a 50 mL plastic tube.
Analysis IgG1 was purified as reported in Subheading 3.1. Bradford micro-
assay revealed a protein concentration of 0.154 mg/mL, making
up a total of 3.08 mg of IgG1 material.
100 μg of IgG1 was transferred to a 10 kDa cutoff spin filter
and is treated as reported in Subheadings 3.2–3.5 using 2-AA as
the labeling reagent. Three technical replicates were prepared and
on each sample UPLC-FLR-MS analysis was performed in tripli-
cate. Figure 3 shows the HILIC-MS base-peak intensity (BPI)
chromatogram for IgG1 produced by CHO-DP12 cell line.
N-glycan structures were assigned based on a combination of all
described techniques (exoglycosidases digestion, mass spectrome-
try, and mass loss analysis).
4 Notes
2 4 6 8 10 12 14 16 18 20 min
RT (min) Glycan Structure Symbolic Representation Monoisotopic mass + 2-AA Experimental [M-2H]2- (ppm)
Fig. 3 UPLC-MS BPI chromatogram from 2-AA labeled N-glycans released by IgG1 produced in CHO-DP12 cell
line; MS data for each glycan are listed in embedded table
238 Sara Carillo et al.
424.15 1223.94
179.05
Y1β C4α/β
%
[443.14]-1 [835.28]-1
291.09
0
m/z 150 200 250 300 350 400 450 500 550 600 650 700 750 800 850 900 950 1000 1050 1100 1150 1200 1250
Glycosylation Analysis of Therapeutic Glycoproteins
Fig. 4 MSE spectrum of aniline-labeled FA2G2S2 glycan. Signals in the spectrum are assigned, according to Domon and Costello nomenclature, with the help of
GlycoWorkBench software
239
240 Sara Carillo et al.
Acknowledgments
References
1. Pouech C, Lafay F, Wiest L, Baudot R, Léonard 11. Umaña P, Jean-Mairet J, Moudry R, Amstutz
D, Cren-Olivé C (2014) Monitoring the H, Bailey JE (1999) Engineered glycoforms of
extraction of additives and additive degrada- an antineuroblastoma IgG1 with optimized
tion products from polymer packaging into antibody-dependent cellular cytotoxic activity.
solutions by multi-residue method including Nat Biotechnol 17(2):176–180
solid phase extraction and ultra-high perfor- 12. Malhotra R, Wormald MR, Rudd PM, Fischer
mance liquid chromatography-tandem mass PB, Dwek RA, Sim RB (1995) Glycosylation
spectrometry analysis. Anal Bioanal Chem changes of IgG associated with rheumatoid
406(5):1493–1507 arthritis can activate complement via the
2. Durocher Y, Butler M (2009) Expression sys- mannose- binding protein. Nat Med 1(3):
tems for therapeutic glycoprotein production. 237–243
Curr Opin Biotechnol 20(6):700–707. 13. Farrell A, Mittermayr S, Morrissey B, Mc
doi:10.1016/j.copbio.2009.10.008 Loughlin N, Navas Iglesias N, Marison IW,
3. Planinc A, Bones J, Dejaegher B, Van Bones J (2015) Quantitative host cell protein
Antwerpen P, Delporte C (2016) Glycan char- analysis using two dimensional data independent
acterization of biopharmaceuticals: updates LC–MSE. Anal Chem 87(18):9186–9193
and perspectives. Anal Chim Acta 921:13–27. 14. Ruhaak L, Zauner G, Huhn C, Bruggink C,
doi:10.1016/j.aca.2016.03.049 Deelder A, Wuhrer M (2010) Glycan labeling
4. Farrell A, McLoughlin N, Milne JJ, Marison strategies and their use in identification and
IW, Bones J (2014) Application of Multi- quantification. Anal Bioanal Chem 397(8):
Omics Techniques for Bioprocess Design and 3457–3481
Optimization in Chinese Hamster Ovary 15. Royle L, Radcliffe CM, Dwek RA, Rudd PM
Cells. J Proteome Res 13(7):3144–3159. (2006) Detailed structural analysis of N-glycans
doi:10.1021/pr500219b released from glycoproteins in SDS-PAGE gel
5. Rathore A (2014) Defining critical quality bands using HPLC combined with exoglyco
attributes for monoclonal antibody therapeu- sidase array digestions. Method Mol Biol
tic products—process development Forum. 347:125–143
Biopharm Int 27 http://www.biopharmin- 16. Atwood JA, Cheng L, Alvarez-Manilla G,
ternational.com/defining-critical- Warren NL, York WS, Orlando R (2008)
quality-attributes-monoclonal-antibody-ther- Quantitation by isobaric labeling: applications
apeuticproducts to glycomics. J Proteome Res 7(1):367–374.
6. ICH - Quality Guidelines (2014) http://www. doi:10.1021/pr070476i
ich.org/products/guidelines/quality/article/ 17. Domon B, Costello CE (1988) A systematic
quality-guidelines.html nomenclature for carbohydrate fragmentations
7. EMA (2009) Guideline on development, pro- in FAB-MS/MS spectra of glycoconjugates.
duction, characterisation and specifications Glycoconj J 5(4):397–409. doi:10.1007/
for monoclonal antibodies and related prod- bf01049915
ucts—draft http://www.ema.europa.eu/ 18. Harvey DJ (2011) Derivatization of carbohy-
docs/en_GB/document_library/Scientific_ drates for analysis by chromatography; electro-
guideline/2009/09/WC500003074.pdf phoresis and mass spectrometry. J Chromatogr
8. Wright A, Morrison SL (1997) Effect of glyco- B 879(17–18):1196–1225. d oi:10.1016/j.
sylation on antibody function: implications for jchromb.2010.11.010
genetic engineering. Trends Biotechnol 15(1): 19. EUROCarbDB. Tools to analyse MS spectra:
26–32. doi:10.1016/S0167-7799(96)10062-7 GlycoWorkbench
9. Jefferis R (2005) Glycosylation of recombinant 20. Ceroni A, Maass K, Geyer H, Geyer R, Dell A,
antibody therapeutics. Biotechnol Prog Haslam SM (2008) GlycoWorkbench: a tool
21(1):11–16. doi:10.1021/bp040016j for the computer-assisted annotation of mass
10. Shields RL, Lai J, Keck R, O’Connell LY, spectra of glycans. J Proteome Res 7(4):1650–
Hong K, Meng YG, Weikert SH, Presta 1659. doi:10.1021/pr7008252
LG (2002) Lack of fucose on human IgG1 21. Ceroni A, Dell A, Haslam SM (2007) The
N-linked oligosaccharide improves binding GlycanBuilder: a fast, intuitive and flexible soft-
to human FcγRIII and antibody-dependent ware tool for building and displaying glycan
cellular toxicity. J Biol Chem 277(30): structures. Source Code Biol Med 2:3–3.
26733–26740 doi:10.1186/1751-0473-2-3
Chapter 16
Abstract
Host cell protein content during bioprocessing of biotherapeutic proteins generated from cultured Chinese
hamster ovary (CHO) cells is typically measured using immunological and gel-based methods. Estimation
of HCP concentration is usually undertaken using Enzyme-Linked ImmunoSorbent Assays (ELISA),
while estimation of HCP clearance/presence can be achieved by comparing 2D-PAGE images of samples
and by undertaking western blotting of 2D-PAGE analyzed samples. Here, we describe the analyses of
HCP content using these methodologies.
Key words Host cell proteins (HCPs), ELISA, 2D-PAGE, Western blotting
1 Introduction
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2_16, © Springer Science+Business Media LLC 2017
243
244 Catherine E. Hogwood et al.
2 Materials
2.1 Recovery of Host 1. Wash Buffer: 25 mM sodium phosphate, 10 mM sodium chlo-
Cell Proteins ride pH 7.5.
for Analysis 2. General protease inhibitor cocktail.
3. Benzonase nuclease.
4. Centrifugation-based membrane concentrators with molecular
weight cutoff of 5000 Da.
5. Commercially available 2-D Clean Up Kit (GE Healthcare).
6. 2D-PAGE resolubilization buffer: 7 M urea, 2 M thoiurea, 4%
CHAPS, 40 mM DTT, and 0.5% pH 3–10 pharmalytes.
2.2 ELISA Analysis 1. Commercially available CHO host cell protein ELISA kit (e.g.,
of Host Cell Protein Cygnus Technologies HCP ELISA Kit for CHO, 3G Catalogue
Content number P6787-50TAB).
3 Methods
3.1 Recovery of Host Select the method of recovery of HCPs to be used based upon the
Cell Proteins subsequent analysis methodology that will be applied to the sam-
ples (see Notes 1 and 2).
3.1.1 Recovery If the method of subsequent analysis is ELISA based, samples from
for ELISA Analysis any stage of cell culture or downstream processing may be recov-
ered directly from the material to be analyzed. For ELISA analysis
of harvest material from cell culture, remove cellular material by
centrifugation to pellet cells and cell debris and then remove super-
natant material for HCP analysis. Store at −20 °C.
- pH 3 pH11 + - pH 3 pH11 +
A B High
High
MW
MW
Low
Low
Fig. 1 2D-PAGE analysis of the cell culture supernatant of an antibody-producing cell line at harvest when
stained with Coomassie blue (a) or Sypro Ruby (b). The antibody heavy and light chains are the most prominent
bands on the right-hand side of the image. Host cell proteins are also present
3.2 ELISA Analysis ELISA analysis requires appropriate anti-CHO host cell protein
of Host Cell Protein antibodies and standards. In most cases, these will not be directly
Content available for the analyst and commercial reagents will need to be
purchased (see Note 10). In this case, the directions of the manu-
facturer should be followed precisely.
3.3 2D-PAGE The most common approach taken for visualizing total HCP con-
Analysis of Host Cell tent in a sample and comparing HCP content between samples is
Proteins to use a combination of 2D-PAGE and 2D-PAGE western blot-
ting. This allows an assessment of the immunocoverage using a
specific polyclonal anti-HCP reagent. The stained 2D-PAGE gel
(see Fig. 1 for example) is then directly compared to the western
blot analysis (see Note 11).
1. For each sample to be analyzed, an Immobine DryStrip, pH
3–10 Non-Linear 7 cm IPG strip is overlaid onto the 125 μL
sample (see Note 12).
CHO HCP Analysis 247
3.4 2D-PAGE For 2D-PAGE western blotting for HCPs, the initial analysis is
Immunoblotting undertaken up until step 9 as described in Subheading 3.2. After
Analysis of Host Cell this follow the protocol as below.
Proteins 1. Remove the 2D-PAGE gel from the tank and transfer to PVDF
membrane following an appropriate protocol.
2. Remove the membrane from the transfer apparatus and block
with nonfat dried milk powder (5% w/v) in TBST solution for
1 h at room temperature with gentle agitation.
3. Pour off the block solution and wash the membrane with
TBST before discarding this wash.
248 Catherine E. Hogwood et al.
4 Notes
References
Paula Meleady (ed.), Heterologous Protein Production in CHO Cells: Methods and Protocols, Methods in Molecular Biology,
vol. 1603, DOI 10.1007/978-1-4939-6972-2, © Springer Science+Business Media LLC 2017
251
Heterologous Protein Production in CHO Cells: Methods and Protocols
252 Index
N-linked glycosylation��������������������������������������������������26, 38 Selection����������������������������������������������������������� 14, 35, 71, 73
Short interfering RNA (siRNA)���������������������� 30, 37, 73, 75
P Sialylation��������������������������������������������������������������� 13, 29–37
PCR Site specific phosphorylation��������������������������������������������197
overlap-extension PCR������������������������� 58, 59, 62, 64–65 Sort�����������������������������105, 113, 116, 144, 147, 150, 152, 176
real-time PCR������������������������������������������������������������121 Suspension adaptation��������������������������������������������������������77
Phosphopeptide enrichment Systems biotechnology�������������������������������������������������������40
IMAC�������������������������������������������������������������������������197
T
TiO2, 199
Phosphoproteomic�����������������������������������������������������������197 TET-ON���������������������������������������������������� 15, 89, 90, 93–98
Polyethyleneimine (PEI)����������������������������������������������45, 47 Tetracycline (Tet)��������������������������������������������������� 15, 88, 89
Process optimization��������������������������������������������������� 87, 159 Therapeutic proteins������������������� 1, 33, 35, 36, 39, 71, 73, 80
Productivity�����������������������������������80, 88, 102, 120, 121, 143 Transcriptomic������������������������������������������������� 180, 196, 219
Protein folding�����������������������������������������1, 2, 11, 13, 39, 143 Transfection�����������������������������������������������2, 6, 12, 14, 45–55
Protein translation����������������������������������������������������������������9 Transient gene expression (TGE)����������������������� 6, 45, 62, 67
Protein solubilization��������������������������������������������������������188
Proteomics����������������� 154, 159, 160, 187, 196, 215, 218–219 V
Vector design������������������������������������������������������������������6, 18
R
Vector design elements
Real-Time PCR��������������������������������������� 120, 121, 129–134 Matrix associated regions (MARs)�����������������������������7, 8
Recombinant protein production����������������������������� 209, 212 ubiquitous chromatin opening elements
Recombinant proteins��������������������������������������������������������13 (UCOEs)��������������������������������������������������������������7, 8
RNA-Seq�����������������������������������������������������������������169–186
W
S
Western blotting�������������������������������������14, 74, 79, 115, 123,
Secretion��������������������������������������������������������� 2, 12, 148, 149 127–128, 244, 246