DBT BET JRF 2019 Solved Question Paper With Answer Key
DBT BET JRF 2019 Solved Question Paper With Answer Key
of
Examination
PART A
1. The major difference between hormones that have intracellular receptors and those
that have cell membrane receptors is that the former is usually:
a. Charged
b. Hydrophilic Ans. d
c. Glycosylated
d. Hydrophobic
2. A patient suffering from allergy has been advised to take anti-histamine drugs. Which
one of the following biological processes is most likely to be the reason for the
allergy?
a. Mast cell degranulation
b. Thymocyte maturation
c. Somatic hypermutation Ans. a
d. Bystander lysis
3. Which one of the following statements is NOT TRUE for an enhancer element?
a. it can be downstream of the gene it regulates
b. it can only regulate a nearby gene
c. it can be upstream of the gene it regulates
Ans. b
d. it can be within the intron of the gene
4. Which one of the following statements about alleles is NOT TRUE?
a. They may occupy different loci in the same chromosome
b. There may be several at one locus
c. One may be dominant over another Ans. a
d. They may show co-dominance
5. Allele ‘A’ is dominant over allele ‘a’ and results in dark skin pigmentation. In a
mating of Aa with Aa, if 6 offspring are produced, the probability of all having dark
pigment is:
a. 0.18
b. 0.75
c. 0.24 Ans. a
d. 0.12
6. A bacterial culture grown in a medium containing radioactive sulphur would
incorporate the radiolabel in the tetra-peptide:
a. serine-cysteine-tyrosine-methionine.
b. threonine-lysine-aspartic acid-glutamic acid.
c. alanine-proline-histidine-glycine. Ans. a
d. tryptophan-phenylalanine-valine-isoleucine
7. Of the dsDNA sequences given below, the sequence that is expected to have a higher
melting temperature is:
a. ATGACATTATTACATTAGTG
b. GCGCGTGCATGCCCGATGCC
c. ATTATTATACGTATTTATAT Ans. b
d. CGCGATCGGGGATTACGAGC
8. A peptide of sequence -SHELR- is isolated from bacteria. Which one of the following
options lists the possible phosphorylation site in this peptide?
a. H
b. L
c. R
d. E Ans. a
d. 168
14. Molecular mass of a protein CANNOT be determined by:
a. MALDI-TOF
b. Gel filtration Chromatography
c. Chromatofocusing
Ans. c
d. SDS-PAGE
15. Lack of reactivity to self HLA is known as?
a. Autoimmunity
b. Complement fixation
c. Clonal selection Ans. d
d. Tolerance
16. The frequency of two alleles in a population is 0.19 (B) and 0.81(b). If the population
is in Hardy-Weinberg equilibrium, what will be the percentage of heterozygous
individuals in the population?
a. 62%
b. 38%
c. 31%
Ans. c
d. 19%
17. Which one of the following intermediate filament proteins is present in the nucleus?
a. Vinculin
b. Lamin
c. Nestin Ans. b
d. Laminin
18. All the DNA strands of a cell containing 4 chromosomes are labelled. After one
division how many chromosomes in the daughter cell will have labelled DNA?
a. 1
b. 2
c. 4 Ans. c
d. 8
19. Which one of the following statements is INCORRECT about facilitated diffusion?
a. Its rate is higher than simple diffusion.
b. The partition coefficient of the solute is irrelevant for it.
c. It can be saturated at high concentration of the solute.
d. It works against the concentration gradient. Ans. d
20. Variable number of tandem repeats (VNTR) in DNA molecule are highly useful in:
a. Fingerprinting
b. Footprinting
c. Gene annotation Ans. a
d. DNA repair
26. An organism exhibits Monod growth with the following growth parameters, µm= 0.6
h-1 & Ks = 4 g/l. The specific growth rate, µ, of the organism at a substrate
concentration of 2 g/l would be:
a. 0.2 h-1
b. 0.3 h-1
c. 0.4 h-1 Ans. a
-1
d. 1.2 h
30. A TE buffer contains 200 mM Tris and 50 mM EDTA. Given the stock solutions – 0.5
M Tris and 0.5 M EDTA, volumes of stock solutions required to make 1 liter of buffer
solution are respectively:
a. 400 ml, 100 ml
b. 200 ml, 50 ml Ans.a
c. 500 ml, 125 ml
d. 100 ml, 25 ml
31. The pH of a 0.001 molar HCl solution in H2O is:
a. 1
b. 2
c. 3
d. 4 Ans. c
32. To make 2 liters of 0.4 M HCl, how many ml of 28% w/w HCl (specific gravity =
1.15) is required?
a. 80.7
b. 90.7
c. 100.7
Ans. b
d. 110.7
33. Two sides of a triangle measure 4 cm and 7 cm. Which one of the following
CANNOT be a measure of the third side?
a. 4 cm
b. 5 cm
c. 8 cm Ans. d
d. 11 cm
34. A boy appears for a test and scores 35% but fails by 10 marks. If he had scored 46%,
he would have passed by 12 marks. What is the pass mark?
For more question papers, please visit: www.easybiologyclass.com
Print less... Save paper... Save trees....Save our Earth! EBC
a. 70
b. 74 Ans. c
c. 80
d. 86
35. If a student runs at 1.5 times his usual speed, he reaches his school 20 minutes early.
If he runs at 0.5 times his usual speed, how late will he reach his school?
a. 60 min
b. 30 min
c. 45 min Ans. a
d. 15 min
36. A stationary car is accelerated at the rate of 5 m/s2. The distance covered by the car
till it reaches a speed of 40 m/s is:
a. 100 m
b. 120 m
c. 160 m Ans. c
d. 200 m
37. Find the missing number in the following series:
4 7 14 17 19 22
12 9 22 19 ? 24
a. 27
b. 25
Ans. a
c. 29
d. 32
38. Identify the next figure in the series
?
a) b)
c) d) Ans. a
39. If the total number of dots on opposite faces of a cubical block is always 9 and no
number is repeated, which of the following figure represents the block:
d. (iv)
40. Find the missing number in the following series:
? 1
71 11
46 26
a. 96
b. 91 Ans. c
c. 101
d. 121
41. If MONEY is to CARROM, MILITARY is to CHESS, COURT is to CRICKET then,
WORLD WIDE WEB is to which of the following?
a. Kho Kho
b. Kabaddi
c. Boxing
d. Badminton Ans. d
42. Which one of the following enzymes can hydrolyze both ester and amide bonds?
a. Methionine racemase
b. Thrombin
c. Chymotrypsin Ans. c
d. Peroxidase
43. In the citric acid cycle operating under aerobic conditions, which one of the following
is not directly involved?
a) NAD+
b) FAD
Ans. c
c) Molecular oxygen
d) Succinate
44. Identify the product(s) obtained when luciferin undergoes the following reaction:
Luciferase
O2
Luciferin
I) II)
III) IV)
Ans. a
a) Only I
b) I and II
c) Only IV
d) I, II and III
49. 14C has a half-life of 5760 years; 100 mg of a sample of 14C will completely disintegrate
in:
a. 23,040 years
b. 1440 years
c. 11,520 years Ans. d
d. infinite time
50. A young scientist was interested in creating a dipeptide using L-alanine and L-glycine.
How many different dipeptides can be generated?
a. One
b. Two
c. Three
d. Four Ans. d
PART - B
51. A patient is suffering from an auto-immune disorder. Exome analysis has revealed a
mutation in the gene ‘AIRE’. Which one of the following biological processes is
likely to be affected in this patient?
a. Positive selection of thymocytes
b. Negative selection of thymocytes
c. Affinity maturation Ans. b
d. Dendritic cell development
52. Which one of the following genes is mutated in nude mice?
a. Foxn1
b. Foxp3
Ans. a
c. Foxp1
d. Prkdc
53. Which one of the following statements is TRUE for long non-coding RNAs?
a. They are less than 22 base pair
b. They are processed in the nucleus by RISC complex
c. They have > 300 amino acid open reading frame Ans. d
d. They may have a poly-A tail
54. Which kind of post-translationally modified protein targets are recognized by
Bromodomain containing proteins?
a. Acetylated protein
b. Glycosylated protein
Ans. a
c. Ubiqutinylated protein
d. Sumoylated protein
55. When dissolved oxygen is lower than the critical concentration in mammalian cell
culture systems, cell viability declines because of:
a. Complete glutamine oxidation
b. Decrease in specific lactate production from glucose
Ans. c
c. Incomplete glutamine oxidation and increase in lactate production from
glucose
d. Accumulation of ammonia
56. Combination of high temperature during processing, low temperature during storage,
and increasing the acidity for prevention of food contamination is known as:
a. Stumbling technology
b. Mixed preservation approach
c. High pressure food preservation Ans. d
d. Hurdle technology
57. The production of ethanol rather than biomass by yeast cells at high concentration of
glucose is known as:
a. Warburg effect
b. Simpson’s effect
c. Crabtree effect Ans. c
d. Olivosky’s effect
Ans. a
64. A tRNA containing an anticodon for leucine was charged with leucine. Subsequently,
the attached leucine was chemically modified to arginine. This tRNA will incorporate:
a. Arginine against codon of arginine in mRNA.
b. Leucine against codon of arginine in mRNA.
c. Arginine against codon of leucine in mRNA.
Ans. c
d. Leucine against codon of leucine in mRNA.
65. Which one of the following statements regarding base excision DNA repair system is
FALSE?
a. It can be triggered by damaged DNA.
b. The pol pathway facilitates replacement of a long polynucleotide stretch of
DNA.
c. The enzymes that remove bases from DNA are glycosylases and lyases.
d. Damaged DNA that has not been repaired causes stalling of DNA polymerase Ans. b
III.
66. Which one of the following result is expected when a mammalian cell in S phase is
fused with another in G2?
a. G2 phase nucleus will wait for the S phase nucleus to complete the replication
and both the nuclei simultaneously enter into M phase.
b. S phase nucleus would immediately enter into G2 phase without completing the
replication phase.
c. Both the nuclei would follow their corresponding cell cycle without influencing
each other.
d. Due to influence of S phase promoting factor, G2 phase nucleus will enter into Ans. a
S phase.
67. Following statements are about chromatin organisation in eukaryotes:
i. The length of DNA per nucleosome varies for individual tissue or species.
ii. Typical nucleosomal packaging pattern is strictly maintained across the genome of
an organism.
iii. While wrapping around the histone core particle, uniform structure of DNA is
maintained.
iv. Histone tail mediated internucleosomal contact is one of the essential factors to
achieve the 30 nm fibre structure.
Select the correct combination of statements.
a. i and iii
b. ii and iii
c. i and iv Ans. c
d. iii and iv
68. Which one of the following techniques can be utilized to study both protein–peptide
and protein–DNA interactions?
a. DNA footprinting
b. 2D-gel electrophoresis
c. Phage display Ans. c
d. ChIP-on-chip assay
69. In genomic DNA denaturation and renaturation experiments, which one of the
following regions would renature the earliest?
a. Single-copy gene
b. Satellite DNA
c. Pseudogenes Ans. b
d. Multi copy gene families
70. Which one of the following represents an autonomous retrotransposon?
a. SINEs
b. LINEs
For more question papers, please visit: www.easybiologyclass.com
Print less... Save paper... Save trees....Save our Earth! EBC
c. P-element
d. Tn10 Ans. b
71. Thallium-208 has a half-life of 3.053 min. How long will a sample containing 120.0
µCi of Thallium-208 take to decay to 7.50 µCi?
a. 6.11 min.
b. 9.36 min.
c. 12.21 min. Ans. c
d. 18.46 min.
72. Injection of nanos transcripts at the anterior end of a fertilized Drosophila egg is
expected to develop in an embryo with:
a. Two heads at both the ends.
b. Two tails at both the ends.
c. A tail in middle and two heads at both the ends. Ans. b
d. A head in middle and two tails at both the ends.
73. If nondisjunction of a chromosome occurs in meiosis II, what will be the product at
the completion of meiosis?
a. All the gametes will be diploid
b. Two gametes will be n + 1, and two will be n – 1
Ans. c
c. One gamete will be n + 1, one will be n - 1, and two will be n
d. Two of the four gametes will be haploid, and two will be diploid
74. Which one of the following changes occurs in a directionally migrating eukaryotic
cell?
a. The ER is fragmented.
b. The mitochondrial membrane potential drops.
c. The nucleus moves towards the back and behind the Golgi. Ans. c
d. The Golgi is fragmented.
75. Underwinding or overwinding of circular dsDNA generates supercoils only when it
does NOT have any of the following:
a. Nicks
b. repeat sequences
c. G:C rich regions Ans. a
d. A:T rich regions
77. The type of transport that does NOT reach Vmax is:
a. Simple diffusion across lipid bilayer
b. Facilitated diffusion via uniporters
c. Movement of ions through ion channels Ans. a
d. Primary active transport via ATP powered pumps
78. What is the minimum number of tRNAs required to recognize all six codons of serine
(UCU, UCA, UCG, UCC, AGU and AGC)?
a. 2
For more question papers, please visit: www.easybiologyclass.com
Print less... Save paper... Save trees....Save our Earth! EBC
b. 3
c. 4 Ans. b
d. 6
79. Which one of the following statements about signal recognition particles (SRPs) is
INCORRECT?
An SRP:
a. contains RNA and protein.
b. is an integral membrane protein.
c. docks with a receptor on the surface of the ER membrane. Ans. b
d. binds to localization signal at the N-terminus of the emerging polypeptide
chain.
80. Which one of the following materials is a bioplastic?
a. Polypropylene
b. Alginate
c. Polyhydroxybutyrate Ans. c
d. Dextran
81. Labeled circular single stranded DNA and linear short DNA (oligo) were annealed to
form a product shown in figure I. Helicase assay was performed using the annealed
product and three proteins A, B, C. Below is the gel profile of the results (figure II).
I II
Which one of the following could be the right conclusion of the results?
a. They got different DNA samples from the same organism with different
lengths and same GC content.
b. They got different DNA samples with same lengths and different GC contents.
c. They got different DNA samples with same length and same GC content.
d. They got different DNA samples from different organisms with different Ans. c
length and same GC content.
84. For efficient translation of certain eukaryotic mRNAs under many physiological and
pathological stress conditions, the small subunit of ribosome binds to the mRNA at
the:
a. 5‵ Cap.
b. Internal ribosome entry sites.
c. Secondary structure at 3‵ UTR. Ans. b
d. Initiation codon.
85. For identifying the distribution of a specific protein in a tissue, which one of the
following types of immunofluorescence microscopic methods has attained the highest
level of resolution?
a. Indirect immunofluorescence microscopy
b. Confocal microscopy
c. Confocal microscopy with deconvolution Ans.c
d. Wide angle microscopy with deconvolution
86. Which one of the following sets of protein factors, named as Yamanaka factors, can
be used to convert mammalian somatic cells into induced pluripotent stem cells?
a. Oct3/4, Sox2, Klf4, c-Myc
b. c-fos, nestin, TGF, c-jun
c. Oct3, snail, FGF, nanos Ans. a
d. Hstf, vimentin, ets, ras
87. Hayflick limit of mammalian cells refers to which one of the following?
a. Cells in primary cell culture undergo senescence after 50-60 passages.
b. Primary cells cultured in vitro do not cross the limit of cell transformation.
c. Cell lines when cultured in vitro have a limit for their surface to volume ratio.
d. Malignant cell lines undergo senescence after 50-60 passages. Ans. a
88. Midblastula transition is a phenomenon that occurs during early development in
certain organisms. It refers to:
a. Transition from maternal to zygotic gene expression
b. Transition of morphology during midblastula stage
c. Transition from two germ layer embryo to three germ layer embryo Ans. a
d. Transition of blastula to gastrula
89. Under which of the following circumstances do T cells develop anergy?
a. With the expression of CD69 on T cells.
b. When the CD4/ CD8 molecules present on T cell surfaces do not recognize
self MHC II/MHC I molecules.
c. When the MHCII molecules present on antigen presenting cells bind to the
Ans. d
peptides with less avidity.
d. When co-stimulatory molecules present on the antigen presenting cells fail to
interact with T cells.
90. A chemist synthesized a new chemical X which is highly mutagenic. He also tested the
capacity of mutation induced by X to be reversed by other known mutagens and
obtained the following results:
a. X causes transversion
b. X causes transition Ans. b
c. X causes single-base insertion
d. X causes single-base deletion
91. What would be the best assay to detect and quantify a small and low abundant peptide
in a biological sample?
a. Lowry’s assay
b. Immuno-diffusion
c. Radioimmunoassay Ans. c
d. Immunoblot
92. A mutation in the coding region of a mammalian gene leads to the loss of a single amino
acid at the N-terminus of the nascent polypeptide. This is possible when:
A. The mutation occurs at 3’-end of coding strand.
B. The mutation leads to shift of ribosome binding site.
C. the first two codons code for methionine. Ansc.
D. the mutation leads to the introduction of premature stop codon.
93. A scientist performs a series of experiments to determine the recombination
frequencies between the following genes. He acquires the following data:
P – Q: 3%; Q – R: 2%; R – S: 13%; P – S: 8%
Which one of the following represents the correct order of genes?
a. PQRS
b. QPSR Ans. c
c. SPQR
d. PRSQ
94. You have two tubes containing bacteriophage labelled with radioactive phosphorous
(tube A) and radioactive Sulphur (tube B) that are devoid of bacteria. You use these
bacteriophage to infect separate E. coli cultures. After infection you separate bacteria
from the virus and check them for radioactivity. You will find:
a. Radioactivity in both bacterial samples.
b. Radioactivity in none of them as bacteria have been totally separated from the
viruses.
c. Radioactivity in bacteria infected with viruses from tube A.
d. Radioactivity in bacteria infected with viruses from tube B. Ans. c
95. Colour blindness (B) in human follows sex-linked recessive mode of inheritance. If a
couple with normal colour vision have a colour-blind son. What will be the genotypes
of the parents?
a. XbXb and XbY
b. XBXb and XBY
c. XbXb and XBY Ans. b
d. XBXB and XbY
96. If the allele A is incompletely dominant over allele a, what is expected in a progeny of
two heterozygous parents?
a. Same phenotypic and genotypic ratios
b. 2:1 phenotypic ratio
c. 3:1 phenotypic ratio
d. 2:1 ratio of homozygous dominant and intermediate phenotypes Ans. a
97. An experiment involves formation of RNA-DNA hybrid. Which one of the following
enzymes could be utilized to degrade only the RNA strand from the RNA-DNA
hybrid?
a. Micrococcal nuclease
b. S1 nuclease Ans. c
c. RNase H
d. RNase P
98. If the intracellular pH of a cell becomes basic, which one of the following will help reduce
the pH?
a. Export of Cl- and import of HCO3-
b. Import of Cl- and export of HCO3-
c. Import of Na+ and HCO3- and export of Cl-
d. Export of Na+ and Cl Ans. b
99. Proteins can act as excellent buffers because of:
a. The wide range of pKa values of side chains found within the proteins.
b. The ability of the terminal regions of the protein to accept or donate H+ ions.
c. Their hydrogen-bonding capabilities in forming secondary & tertiary
structures.
d. The ease with which H+ & OH- ions can be absorbed once the protein is Ans. a
hydrolyzed.
100. Which one of the following statements is INCORRECT in relation to reverse
phase chromatography?
a. The solutes elute with decreasing order of polarity.
b. The stationary phase surface covering the silica particles involves non-polar
functional groups. c
c. The solutes elute with increasing order of molecular weight.
d. The pH of the mobile phase has a profound influence on retention, selectivity
and separation.
101. The DNA gel picture shown below depicts the PCR banding pattern of two
markers (M1 and M2).
The linkage distance between the two markers from a test cross population is:
a. 4 cM
b. 6 cM
c. 8 cM
d. 10 cM Ans. c
103. For engineering virus resistance in plants, which one of the following viral
components is commonly targeted?
a. coat protein
b. replication protein
c. satellite RNA Ans. a
d. movement protein
104. The Bt protein employed for raising insect-resistant plants is not toxic to
humans because:
a. it is inactive under acidic pH
b. it is inactive under basic pH
c. it is inactive at 37°C Ans. a
d. it is rendered inactive by inhibitors
105. In rice, while pyramiding three genes for a trait, two donors were used. One
donor carries two desirable genes, which are present on chromosome #2 and #4, while
other donor has one desirable gene present on chromosome #3. Both the donors were
crossed to produce a biparental F2 population. The theoretical expectations of an
individual carrying all the desirable allele in homozygous condition is one out of:
a. 4
b. 16
c. 64 Ans. c
d. 256
This isoenzyme is a:
a. monomer
b. homodimer
c. homotrimer Ans. b
d. homopentamer
108. Opaque2 gene in maize and Wx gene in rice affects the …………. and ………
content, respectively.
a. protein quality, amylose
b. oil, wax
c. protein quality, wax Ans. a
d. oil, starch
109. Which one of the following is associated with RNA-induced gene silencing in
plants?
a. DNA methylation
b. DNA acetylation
Ans. a
c. DNA degradation
d. DNA restriction
110. The oxidative photosynthetic carbon cycle salvages:
a. C3 carbon
b. C4 carbon
c. CO2
Ans. d
d. C2 carbon
112. Which one of the following plants exhibits both C3 and C4 pathways?
a. Zea mays
b. Oryza sativa
c. Mesembryanthemum crystallinum
Ans. a
d. Arabidopsis thaliana
b. spatially separated
Ans. a
c. temporally coinciding
d. spatially coinciding
114. Light compensation point is the irradiance at which:
a. cell division
b. cell wall biosynthesis Ans. d
c. tonoplast acidification
d. cell wall acidification
116. Plants take up water from the soil predominantly by the apoplastic and symplastic
modes of transport. Which one of the following statements is true?
d. rd22 Ans. c
121. Given below are the names of different phytohormones in the left column. Match
them with their corresponding precursor molecules in the right column.
Phytohormone Precursor molecule
(A) Auxin I. Methionine
(B) Jasmonic acid II. L-Tryptophan
(C) Ethylene III. alpha-linolenic acid
(D) Brassinolide IV. Campesterol
Select the correct combination:
122. Which one of the following is a sulphur containing secondary metabolite in mustard
plant derived from glucose and an amino acid?
a. Glucosinolates
b. Phytoalexins
c. Ecdysones
d. Cyanogenic glycosides Ans. a
123. Disarmed Ti plasmid of Agrobacterium tumefaciens does not result in crown gall
phenotype since it does not possess:
a. ipt and iaaH genes
b. Vir D gene
c. Vir A gene
Ans. a
d. Vir G gene
124. A plant that survives a local pathogen infection, often develops increased resistance
to a subsequent attack by a mechanism called:
a. Systemic Acquired Resistance
b. DAMP-triggered immunity
c. Hypersensitive response
d. Heat Shock Response Ans. a
125. In genetically modified Dhara Mustard Hybrid – 11, male sterility is conferred by
………, while ………….. restores fertility.
a. barnase, barstar
b. barstar, barnase
c. bar, barnase
Ans. a
d. barnase, bar
127. Match the common antibody origin with appropriate generic name/brand name
of the antibody
a Mouse (i) Binatumomab
b Chimeric (ii) Herceptin
c Humanized (iii) Pantimumab
d Human (iv) Retuxan Ans. c
129. What property is involved in the separation of a mixture of analytes using gas
chromatography?
a. Partitioning
b. Conductivity
c. Mass
d. Polarity Ans. a
130. Which organization in India approves and gives regulatory clearance of biologicals?
a. Central Drugs Standard Control Organization (CDSCO)
b. National Institute of Biologicals (NIB)
c. Indian Pharmacopoeia Commission (IPC)
d. Department of Biotechnology (DBT) Ans.a
131. In a crossflow filtration process, if the volumetric flow rate of the feed is 10 times
that of the retentate, the concentration factor is:
a. 9
b. 9/10
c. 1/10 Ans. d
d. 10
132. In a bioprocess, assume that only cell mass is formed. Due to a variation in process
conditions, if the microbial cell yield has halved, what would be the rate of substrate
consumption to maintain the same rate of cell mass production?
a. It would be doubled
b. It would be halved
c. It would be unchanged
Ans. a
d. It would increase four folds
133. In a chemostat, which one of the following would increase the exit cell
concentration?
a. Increase in inlet substrate concentration
b. Increase in dilution rate
c. Increase in inoculum size
d. Increase in impeller size Ans. a
134. The ratio of gassed to ungassed powder (Pg/P) in a bioreactor will be in the range
of:
a. 0.4 – 0.9
b. 1.0 – 2.0
c. 1.2 – 2.4
d. 4.0 – 8.0 Ans. a
135. Scale up of a fermenter is done based on constant impeller tip speed. If the diameter
of the impeller is increased by 10 fold, the agitator speed will:
a. decrease by 10 fold
b. decrease by 100 fold
c. increase by 10 fold
Ans. a
d. increase by 100 fold
136. For an enzyme catalyzed reaction in a batch bioreactor, which one of the following
is true under quasi-steady state conditions:
a. Enzyme-substrate complex concentration remains nearly constant
b. Substrate concentration remains nearly constant
c. Product concentration remains nearly constant
d. Both substrate and product concentration remain nearly constant
Ans. a
137. In a batch reactor, which one of the following is true regarding specific growth rate?
a. It remains constant with time.
b. It continuously increases with time.
c. It continuously decreases with time.
Ans. d
d. It reaches a maximum in the exponential phase.
138. For a Rushton turbine impeller (Reynold’s number greater than 10,000) when RPM
is doubled, the power absorption increases by:
a. 2 fold
b. 4 fold
c. 8 fold Ans. c
d. 32 fold
141. Glycerol is a:
a. Newtonian fluid
b. Pseudoplastic fluid
c. Thixotropic fluid Ans. a
d. Dilatant fluid
142. A catalyst:
a. Reduces the free energy change of the reaction
b. Increases the free energy change of the reaction
c. Reduces the activation energy of the reaction Ans. c
d. Reduces the heat of reaction
143. If the pulse input response curve for a CSTR shows a long tail, it means:
a. Strong internal circulation in the reactor
b. Dead space in the reactor
c. Short circuiting in the reactor Ans. b
144. During mixed acid fermentation by E. coli, which one of the following is NOT
produced?
a) Lactic acid
b) Ethanol
c) Succinic acid Ans. d
d) Citric acid
145. The maximum yield for microbial conversion of Glucose (C6H12O6) to ethanol
(C2H5OH) on a mol/mol basis is approximately:
a. 1
b. 2
c. 3 Ans. b
d. 0.5
146. A substrate is consumed in a zero order reaction such that the concentration falls from
40 g/l to 20 g/l in 4 h. How long will it take the substrate to fall from 20 g/l to 2 g/l:
a. 2.5 h
b. 1.8 h
c. 3.6 h Ans. c
d. 4.8 h
148. The major drawback in using wild type S. cerevisiae for producing ethanol from
biomass hydrolysate is:
a. Low biomass yield of hexose sugars
b. Presence of solid residues Ans. d
c. Low concentration of sugars
d. Non utilization of Pentose sugars
149. Match the physical/chemical property with the corresponding unit operations used
for separation:
a) Density difference (i) Distillation
b) Partition (ii) Filtration
coefficient
c) Relative volatility (iii)Liquid-liquid
extraction
d) Particle size (iv) Centrifugation
a. a-iii b-iv c-i d-ii
b. a-i b-iii c-ii d-iv
Ans. d
c. a-iv b-ii c-iii d-i
d. a-iv b-iii c-i d-ii
150. One microgram of a pure enzyme (MW: 92,000) catalyzed a reaction at a rate of
0.50 µmoles/min under optimum conditions. The specific activity of the enzyme
[(µmoles/min)/mg protein] is:
a. 0.5
b. 5.0
c. 500 Ans. c
d. 5000
151. The ion transport that will be the most affected following mutation in Cystic
fibrosis transmembrane conductance regulator (CFTR) gene is:
a. Sodium
b. Potassium
c. Chloride
d. Calcium Ans.c
152. The organism in which the luciferase gene is termed as “lux” gene is:
a. Algae
Ans. c
b. Insects
c. Bacteria
d. Jelly fishes
153. The first humanized monoclonal antibody approved by the US-FDA for targeted
treatment of breast cancer was:
a. Trastuzumab
For more question papers, please visit: www.easybiologyclass.com
Print less... Save paper... Save trees....Save our Earth! EBC
b. Paliviuzmab
c. Gemtuzumab Ans. a
d. Natalizumab
154. Which one of the following statements is INCORRECT with regard to DNA
vaccines?
a. No risk of infection
b. Proteins produced are likely to be correctly post translationally modified
c. It can persist for an extended time period in the cell
d. Introduced DNA stimulates a protective immune response Ans. d
156. Zinc deficiency among children primarily results in the atrophy of:
a. Thymus
b. Spleen
c. Lymph nodes
Ans. a
d. Peyer’s patches
157. Antigen activated B cells differentiate into antibody producing plasma cells in:
a. Lymphoid follicles
b. Hassall’s corpuscles
c. Lamina propria
d. Phagosome Ans. a
158. Allergenicity of a protein refers to its capacity to activate:
a. Mast cells
b. B cells
c. Dendritic cells Ans. a
d. M cells
159. Secondary immune response to a hapten depends on the:
a. Hapten immunization alone
b. Carrier immunization alone
c. Both hapten and carrier used in the primary immunization
Ans. c
d. Hapten and is independent of the carrier used during immunization
167. Which one of the following contributes to the development of the reproductive tract
in a male foetus?
a. Anti-diuretic hormone
b. Inhibin
c. Anti-Mullerian hormone Ans. c
d. Activin
169. Viral vector that is ideal for expressing therapeutic gene in non-dividing cells is:
a. Lentiviral vector
b. Retroviral vector
For more question papers, please visit: www.easybiologyclass.com
Print less... Save paper... Save trees....Save our Earth! EBC
170. Which one of the following amino acids can be used as a diuretic because of its
importance in metabolism of ammonia?
a. Asparagine
b. Leucine
Ans. a
c. Tryptophan
d. Isoleucine
171. Paralytic shellfish poisoning is a foodborne illness that typically develops after
consumption of shellfish contaminated chiefly with the heat stable and acid stable toxin:
a. Okadaic acid.
b. Mitotoxin.
c. Saxitoxin.
d. Aflatoxin.
Ans. c
172. The antifreeze molecules that prevent intracellular ice formation in marine organisms
are generally:
a. calcium salts.
b. glycoproteins. Ans. b
c. membrane phospholipids.
d. long chain alcohols.
173. Which one of the following transgenes expressed in transgenic fish by an appropriate
inducible promoter, may be used for detecting environmental toxicants?
174. Ballast water may be carried onboard by ships to maintain stability and improve
maneuverability during transit. Introduction of which one of the following is regarded
as the major threat in release of untreated ballast water?
a. pathogenic microbes.
b. terrestrial inputs of pollutants.
c. invasive marine species.
Ans. c
d. algal blooms.
175. Remote sensing of ocean-atmospheric parameters carried out in the microwave
channels is based on the phenomenon of:
a. emission.
b. reflection.
c. scattering.
d. diffraction. Ans. a
For more question papers, please visit: www.easybiologyclass.com
Print less... Save paper... Save trees....Save our Earth! EBC
176. A starch containing wastewater sample with high BOD, CaCl2 and NH4NO3 was
subjected to aerobic oxidation using a designed bacterial consortium. The oxidised
product(s) will have:
182. The figure represents a dot plot comparing two genomes X and Y. The portion
marked N is a/an:
a. Translocation
b. Inversion
c. Repeat Sequence
d. Insertion or deletion (Indel) Ans. b
183. Which one of the following methods is most accurate in rescoring docked ligand-
protein complexes?
a. Molecular mechanics non-bonded energy functions
b. Binding free energy calculations incorporating solvation models
c. X-score – which is an independent score based on an energy function
d. Ensemble scoring of multiple docking algorithms Ans. b
184. A reference set of molecules is experimentally assayed for xenobiotic toxicity using
the MTS assay which is a colorimetric measurement of cell viability. As part of the
lead optimization step in drug discovery, which one of the following steps can be used
to predict the toxicity of a new set of compounds?
a. Estimation of log P values
b. Building a regression model of the reference compounds using molecular
descriptors and toxicity measures
c. Docking of molecules against an essential enzyme like DHFR
d. Building a classifier without molecular descriptors of the reference
Ans. b
compounds
185. In a de novo RNASeq analysis, the typical steps are (1) transcript assembly, (2)
cluster sequence contigs and construct complete de Bruijn graphs for each cluster, and
(3) separate the de Bruijn graph to full length alternatively spliced isoforms or
transcripts from paralogous genes. Which one of the following statements is
INCORRECT in this context?
a. The first two steps are memory intensive
b. The speed of the process is improved by a pre-processing step involving
removal of redundant transcripts with no loss of accuracy
c. It is not possible to distinguish between alternatively spliced and paralogous
transcripts
d. The last step can be parallelized to run on multiple processors Ans. c
186. For Gene Set Enrichment Analysis (GSEA), differentially expressed genes are
grouped into broader functions. A typical tool/resource used for this purpose is:
a. Gene Ontology
b. BLAST against the nr database
c. Pfam database Ans. a
d. PRODOM database
187. Two types of pair-wise sequence alignment of the same hypothetical protein
sequence fragments are illustrated in the figure below. Vertical bars between the
sequences indicate the presence of identical amino acids. * symbols in Figure Y
indicate residues not included in the alignment.
Ans. a
188. Match the items in Group I with Group II with reference to a database search for
identifying homologs of human hemoglobin.
Group I Group II
(P) Sensitivity (1) Measure of how many correct hits are found
(Q) 100% Sensitivity (2) Measure of how many hits found are correct
(R) Specificity (3) Measure indicating that all correct hits are found
(S) 100% Specificity (4) Measure indicating that all hits found are correct
Ans. d
a. Pairing of A and B
b. Pairing of C and D
c. Pairing of A, E and D
d. No pairing of sequences
190. Genes or proteins that display the same activity, but have different origins and are the
product of convergent evolution, are called:
a. Analogs
b. Paralogs
c. Orthologs Ans. a
d. Xenologs
191. Match the type of BLAST programs given in Group I to the particular type of
sequence search task described in Group II
Group I Group II
1 tblastn P A nucleotide sequence is to be used as a query to search for
similar proteins against a nucleotide database
2 tblastx
3 blastx Q A nucleotide sequence is to be used as a query to search
4 blastn against a protein database
a. 2-P, 3-Q
b. 1-P, 3-Q Ans. a
c. 4-P, 3-Q
d. 2-P, 1-Q
194. The structure of two molecules P and Q with three atoms (u, v, w) each, are defined
by coordinates given below.
u v w
P 1,4,1 4,1,1 4,4,1
Q 0,0,1 2,0,1 3,2,1
The root mean square deviation between the two structures is:
a. √3
b. 3
c. 9 Ans. b
d. 27
195. A novel protein from a deep sea archaebacterium was identified and sequenced. The
sequence is expected to be widely divergent from known sequences. Which scoring
matrix will produce the most appropriate alignment in a search for homologs in the
NCBI database?
a. PAM1
b. PAM250 Ans. b
c. BLOSUM90
d. BLOSUM82
196. The measured values of main chain torsion angles of a residue in a polypeptide has
values (Φ=+50, Ψ=+60). What type of secondary structure is it most likely to be
present in?
a. Left-handed α-helix
b. Right-handed α-helix
c. Type II β-turn Ans. a
d. Parallel β-sheet
197. Which one of the following experimental methods is NOT used to determine three-
dimensional structures of biological macromolecules?
a. Nuclear Magnetic Resonance Spectroscopy
b. Fluorescence spectroscopy
c. X-ray crystallography
Ans. b
d. Cryo-Electron microscopy
198. Which one of the following is NOT an assumption of an evolutionary model of the
PAM matrix?
a. Probability of a mutation at one position of a sequence is dependent on the
identity of the amino acid
b. Probability of a mutation is dependent on the position of the mutation
c. Probability of a mutation is independent of the previous mutation at the
position
d. Probability of a mutation is independent of the neighboring residues
Ans. b
199. Which one of the following is a valid assumption regarding the molecular clock
hypothesis in evolution?
a. For a given protein sequence, mutations accumulate at a constant rate in all
lineages
b. For a given protein sequence, mutation rates are different in different
lineages
For more question papers, please visit: www.easybiologyclass.com
Print less... Save paper... Save trees....Save our Earth! EBC