medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022.

The copyright holder for this

preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

VarLOCK - sequencing independent, rapid detection of SARS-CoV-2

variants of concern for point-of-care testing, qPCR pipelines and
national wastewater surveillance

Xinsheng Nan1, Sven Hoehn1, Patrick Hardinge1, Shrinivas N Dighe1, John Ukeri2, Darius Pease3, Joshua
Griffin3, Jessica I Warrington1,5, Zack Saud6, Emma Hottinger3, Gordon Webster1, Davey Jones4, Peter
Kille1,3, Andrew Weightman1, Richard Stanton6, Oliver K Castell2, James A.H. Murray1, Tomasz P
Jurkowski1,3*

Affiliation
1
Cardiff School of Biosciences, Cardiff University, Sir Martin Evans Building, Museum Avenue, Cardiff,
CF10 3AX, UK.
2
Cardiff School of Pharmacy and Pharmaceutical Sciences, Cardiff University, Redwood Building, King
Edward VII Avenue, Cardiff, CF10 3NB, UK.
3
COVID-19 screening service, Cardiff University, Sir Martin Evans Building, Museum Avenue, Cardiff,
CF10 3AX, UK.
4
School of Natural Sciences, Bangor University, Bangor, Gwynedd, LL57 2UW, UK.
5
Current address: Midatech Pharma (Wales) Ltd, 1 Caspian Point, Caspian Way, Cardiff, CF10 4DQ, UK.
6
Infection & Immunity, School of Medicine, Cardiff University, Heath Park, Cardiff CF14 4XN, UK

Correspondence should be addressed to [email protected]

Abstract
The COVID-19 pandemic continues to pose a threat to the general population. The ongoing vaccination
programs provide protection to individuals and facilitate the opening of society and a return to
normality. However, emergent and existing SARS-CoV-2 variants capable of evading the immune
system endanger the efficacy of the vaccination strategy. To preserve the efficacy of SARS-CoV-2
vaccination globally, aggressive and effective surveillance for known and emerging SARS-CoV-2
Variants of Concern (VOC) is required. Rapid and specific molecular diagnostics can provide speed and
coverage advantages compared to genomic sequencing alone, benefitting the public health response
and facilitating VOC containment. In this work, we expand the recently developed SARS-CoV-2 CRISPR-
Cas detection technology (SHERLOCK) to allow rapid and sensitive discrimination of VOCs, that can be
used at point of care and/or implemented in the pipelines of small or large testing facilities, and even
determine proportion of VOCs in pooled population-level wastewater samples. This technology aims
to complement the ongoing sequencing efforts to allow facile and, crucially, rapid identification of
individuals infected with VOCs to help break infection chains. Here, we show the optimisation of our
VarLOCK assays (Variant-specific SHERLOCK) for multiple specific mutations in the S gene of SARS-CoV-
2 and validation with samples from the Cardiff University Testing Service. We also show the
applicability of VarLOCK to national wastewater surveillance of SARS-CoV-2 variants. In addition, we
show the rapid adaptability of the technique for new and emerging VOCs such as Omicron.
(Word count 238)

NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Short abstract
The COVID-19 pandemic continues to pose a threat as emergent and existing SARS-CoV-2 variants
endanger the efficacy of the vaccination strategy. Rapid surveillance for known and emerging SARS-
CoV-2 Variants of Concern (VOC) would be assisted by effective molecular diagnostics procedures.
Here we develop the recent SARS-CoV-2 CRISPR-Cas detection technology (SHERLOCK) for rapid and
sensitive discrimination of VOCs to complement sequencing and allow rapid identification of
individuals infected with VOC. We show our assays can be implemented with test samples in the
pipelines of large testing facilities, as well as determine the proportion of VOCs in pooled population
level wastewater samples and has potential applicability at point of care. We demonstrate the
optimisation of new VarLOCK assays (Variant-specific SHERLOCK) for multiple specific mutations in the
S gene of SARS-CoV-2 and validate these with samples from the Cardiff University Testing Service, as
well as the applicability of VarLOCK to national-level wastewater surveillance of SARS-CoV-2 variants.
We also demonstrate the rapid adaptability of the technique for new and emerging VOCs such as
Omicron.
Word count 172
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Introduction
Genetic variations in the SARS-CoV-2 genome emerge during viral replication. Whilst mutations are
often inconsequential, several mutations have already emerged conferring phenotypic advantages to
the virus and posing additional challenges for national and global COVID-19 responses. To date the
World Health Organisation (WHO) has assigned five Variants of Concern (VOC) labelled: Alpha –
B.1.1.7, Beta – B.1.351, Gamma – P.1, Delta - B.1.617.2 and most recently Omicron – B.1.1.529. These
variants display increased transmissibility (Alpha < Delta < Omicron), increased risk of severe illness
and hospitalisation (Alpha) and raise concerns about immune response evasion (Beta, Delta,
Omicron), posing increased risks of re-infection and vaccine escape combined with increased
transmissibility. Such variants pose a risk of immune escape and their surveillance have been a
longstanding point of concern.

Genomic sequencing has been extremely successful in identifying new variants, in the tracking of viral
lineages to understand viral introduction events and transmission[1], as well as monitoring virus
evolution during the pandemic in near real-time. Genomic sequencing remains the gold-standard for
tracking viral mutations and identifying emerging Variants of Concern. Once specific mutations of
VOCs are known, which may be identified anywhere in the world, sequencing becomes a powerful
indicator of local prevalence, but it is also a lagging indicator due to the high resource requirements
and potential delays in sequencing. In practice, this currently means results take several days following
a PCR positive SARS-CoV-2 test and only a sub-set of positive patient samples can be sequenced,
corresponding to typically ~10% of positive identified cases in the UK, but varies geographically. This
delay and sub-sampling impact the speed and efficacy of the public health response as it is highly likely
that once known VOCs are picked up through genomic sequencing, there will already be multiple other
undetected cases in the community.

There is therefore a requirement for combining genetic virus surveillance by sequencing with
sequence-specific molecular diagnostics for rapid discrimination of variants in either laboratory or
point of care testing setup, as well as in wastewater samples which provide virus and variant
surveillance at a local and national level. This has the potential to boost the speed and efficacy of the
public health response to new and emerging SARS-CoV-2 VOCs. Such sequence-specific tests, including
nucleic acid amplification and CRISPR-Cas cleavage techniques, rely on sequence complementarity
between the primers/probes and the surveyed sequence. These methods are facile, highly efficient
and can rapidly identify mutations in the genomic sequence probed.

The gold-standard genetic test is qPCR and numerous SARS-CoV-2 assays have been described[2],
targeting multiple mutated loci. However, the bottleneck in reagents and consumables, as well as the
need for point of care testing during the pandemic has spurred the development of alternative
strategies. Of particular interest has been RT-LAMP [3] which can rapidly amplify RNA at a single,
constant temperature with high specificity and sensitivity. However, achieving the specificity required
to discriminate single-point mutations using RT-LAMP is challenging, but the emergence of CRISPR-
Cas based detection has the potential to achieve this with isothermal nucleic acid amplification in a
one-pot reaction[4].

The discovery of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) adaptive
immunity in bacteria and the associated nucleases that cleave foreign RNA/DNA, has led to the
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

development of an increasing number of highly specific genetic tests. CRISPR-Cas-based detection

utilises CRISPR associated enzymes (Cas) specific to a target nucleic acid; Cas13 for RNA, and Cas12
and Cas9 for DNA or cDNA (by converting RNA using reverse transcriptase). Many of these techniques
have been developed commercially for SARS-CoV-2 detection including SHERLOCK (Specific High-
sensitivity Enzymatic Reporter un-LOCKing) [4-6] and DETECTR (DNA Endonuclease-Targeted CRISPR
Trans Reporter) [7].

Given the threat of VOCs to vaccine efficacy, and their more general threat to at risk populations, any
interventions that will help rapidly identify and limit the introduction and spread of such variants, or
enable the acceleration of the public health responses, can be an important tool in public health
management. Consequently, rapid variant-specific testing is a high priority challenge. Despite this,
none are yet widely implemented except for the TaqPath qPCR assay, which serendipitously possesses
S-gene dropout behaviour with Alpha [8] and some Omicron variants. This coincidental property of
the qPCR assay with these variants has proved to be a valuable proxy to rapidly highlight likely
introductions, enabling enhanced testing, contact tracing and isolation and the rapid assessment of
case growth. However, this assay is only employed in a sub-section of testing labs. Whilst, the S-
dropout is otherwise non-specific, its utility in early tracking of these variants clearly highlights the
value of direct variant detection.

Based on the recently developed CRISPR-Cas assay SHERLOCK[5], here we develop a readily adaptable
and rapid molecular diagnostic strategy applicable to all existing VOCs, that can be readily employed
for newly identified variants. In combination with the power of genomic sequencing, this can aid public
health management and allow timely and informed interventions that can help minimise the risk of
concerning immune escape variants becoming established.

We describe the development of a generalisable approach for variant of concern molecular detection
(VarLOCK). We describe optimisation for each mutation of concern, and importantly demonstrate
validation and implementation with the Cardiff University COVID19 Testing Service. We demonstrate
the ability to employ these assays with national wastewater surveillance to identify and map temporal
and geographic population-level variant prevalence. We show this approach, when combined with
LAMP amplification, could be employed widely for near-patient variant-specific diagnostic testing. The
rapid adaptability of VarLOCK for new and emerging VOCs is demonstrated with the development of
an Omicron specific assay within 2 weeks of WHO designating it as a VOC. This may contribute to
current public health efforts by enabling more rapid identification of Omicron infection, as well as
providing a generalisable approach for future VOCs.

Results

Concept of the VarLOCK assay

SARS-CoV-2 variants are characterised by specific sets of mutations selected in the course of virus
evolution. Sub-variants diverge from the main VOC clades through acquisition of additional mutations,
and as some mutations are not fully penetrant individual samples can have diverged mutational
profiles. By identifying the mutations present in the sample’s genome, the variant can be identified.
Mutations may be unique and associated with a single VOC, but many other mutations are shared
between different VOCs potentially associated with the selective advantage they confer. In particular,
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

variants can be differentiated by the composition of mutations in the spike protein gene (S-gene)
(Table 1, Figure 1B).

CRISPR cleavage is sequence specific and guided by the targeting sequence of the guide RNA (gRNA),
and thus by comparing the cleavage using wildtype and mutant specific guide sequences, we reasoned
that the mutational state of the investigated region could be determined. We designed primers to
amplify the target sequences and gRNAs to specifically match wildtype and mutant sequences to
enable the SHERLOCK method to cleave with Cas12b quenched fluorescent probes only when a
specific match is present. We designed assays for various S-gene mutations namely L18F/T20N, T19R,
Δ69-70, D80A, Δ143-145, Δ144, N211I/Δ212/215EPEins, L452R, S477N/T478K, T478K, E484K,
Q493R/G496S, Q498R/N501Y, N501Y, P681R and A701V to enable VOCs to be detected. To account
for potential non-specific cleavage and reporting, a second reaction with the wildtype sequence
specific gRNA was run in parallel, with the differential response informing on the likely presence or
absence of the target mutation.

Selection of variant-defining mutation sites in the S gene

Mutations of SARS-CoV-2 are acquired during genome replication and occur randomly across the
whole genome. The SARS-CoV-2 spike (S) protein plays a crucial role in receptor recognition through
the receptor-binding domain (RBD), followed by membrane fusion. Mutations in the spike protein
likely account for the increased transmissibility and may lead to decreased protection from
immunisation and natural infection[9]. We therefore focused for VarLOCK on the differential
mutations located in the S gene.

First, to identify the variant-specific Spike protein mutations in the SARS-CoV-2, we compared the S-
gene sequences found in Alpha, Beta, Gamma, Delta and Omicron VOCs and Kappa (VOI - B1.617.1)
and selected 19 mutation sites that are VOC characteristic and contain a Cas12b protospacer adjacent
motif (PAM) site (TTN) in their vicinity to allow CRISPR-based detection assays (Figure 1A). We then
designed 16 pairs of gRNAs for the 19 selected mutation sites (Table 1). Each gRNA pair targets the
same region of the S gene, comprising the sequence present in either the Wuhan strain (wt) or the
VOCs specific mutation (mut) (Table 1).
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Figure 1. SARS-CoV-2 Variant of Concern identification by VarLOCK assay. A) illustration of the

VarLOCK assay. The region with wildtype (green) or mutant (pink) sequence of SARS-CoV-2 RNA is
amplified by either RPA, LAMP or PCR. Amplified DNA fragments are subjected to SHERLOCK assay with
a pair of gRNAs matching the wildtype sequence (wt gRNA, green) or the mutant sequence (VOC gRNA,
pink). We aimed to find conditions in which only a perfect match between the gRNA and the amplified
DNA can trigger a collateral nuclease activation of the Cas12b protein to cleave a quenched fluorescent
reporter. This allows nuclease activity to be monitored by the increase in fluorescence. The ratiometric
response of an unknown SARS-CoV-2 variant sample indicates the presence, or absence, of the targeted
mutation and thus enables identification of the VOC. B) Schematic of the genome of SARS-CoV-2 (left)
with blow-up of the Spike protein encoding region showing the location of RBD, S1 and S2. Nineteen
mutation sites were chosen for VarLOCK assay for which gRNA pairs were designed and optimised.
Nucleotide sequences encoding the relevant amino acids are shown in the table and the nucleotide
substitutions/deletions are marked in red. The association of the mutations with various variants of
concern is indicated in the table, creating a barcode-like identification matrix. (C) Application of this
approach to saliva samples successfully identifies original Wuhan, Alpha, Beta, Delta and Omicron
variants with results confirmed by sequencing.
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Mut No. of changes

Variant sites on
Name of gRNA Target sequences Strand position to vs wildtype
Spike protein
PAM sequence
L18F / T20N L18_T20 wt TTAATCTTACAACCAGAACTCAATTA plus
& L18F_T20N TTAATTTTACAAACAGAACTCAATTA plus 3&10 2
T19R T19R TTAATCTTAGAACCAGAACTCAATTA plus 7 1
69-70 wt TTGGTCCCAGAGACATGTATAGCATG minus
Δ69/70
Δ69-70 TTGGTCCCAGAGATAGCATGGAACCA minus 11 6
D80 wt TTGATAACCCTGTCCTACCATTTAAT plus
D80A
D80A TTGCTAACCCTGTCCTACCATTTAAT plus 1 1
Δ144 144 wt TTTGGGTGTTTATTACCACAAAAACA plus
& Δ144 TTTGGGTGTTTACCACAAAAACAACA plus 10 3
Δ143-145 Δ143-145 TTTGGACCACAAAAACAACAAAAGTT plus 3 9
N211I / Δ212 N211 wt TTAATTTAGTGCGTGATCTCCCTCAG plus
/ 215EPEins N211I_Δ212_215EPEins TTATAGTGCGTGAGCCAGAAGATCTC plus 1 12
L452 wt TTACCTGTATAGATTGTTTAGGAAGT plus
L452R
L452R TTACCGGTATAGATTGTTTAGGAAGT plus 3 1
S477N / T478K T478 wt TTACAAGGTGTGCTACCGGCCTGATA minus
& S477N_T478K TTACAAGGTTTGTTACCGGCCTGATA minus 7&10 2
T478K T478K TTACAAGGTTTGCTACCGGCCTGATA minus 7 1
E484 wt TTAAAACCTTCAACACCATTACAAGG minus
E484K
E484K TTAAAACCTTTAACACCATTACAAGG minus 8 1
Q493_G496 wt TTTACAATCATATGGTTTCCAACCCA plus
Q493R / G496S
Q493R_G496S TTTACGATCATATAGTTTCCGACCCA plus 3&11 2
Q498R / N501Y N501 wt TTCCAACCCACTAATGGTGTTGGTTA plus
& Q498R_N501Y TTCCGACCCACTTATGGTGTTGGTCA plus 2&10 2
N501Y N501Y TTCCAACCCACTTATGGTGTTGGTTA plus 10 1
P681 wt TTCTCCTCGGCGGGCACGTAGTGTAG plus
P681R
P681R TTCTCGTCGGCGGGCACGTAGTGTAG plus 3 1
A701 wt TTGGTGCAGAAAATTCAGTTGCTTAC plus
A701V
A701V TTGGTGTAGAAAATTCAGTTGCTTAC plus 4 1

Table 1. gRNA target sequences surrounding the variant sites. The PAM sequence is coloured in green.
The nucleotides substituted in the variants and their corresponding nucleotides in the original Wuhan
SARS-CoV-2 sequence are coloured in red. Both deleted nucleotides and the shifted sequences at Δ69-
70, Δ143-145, Δ144 and Δ212 are also coloured in red.

SHERLOCK offers limited discrimination of single nucleotide variation

First, we tested whether the SHERLOCK assay provides sufficient discrimination for our VarLOCK
approach to differentiate specific variant mutations. We performed SHERLOCK detection assays using
wildtype (wt) and mutant (mut) specific gRNAs on short synthetic DNA templates containing either
wildtype or mutant sequences for the tested SARS-CoV-2 genomic loci, using the reported assay
conditions[5] (Supplementary Table 2 and Figure 2). For each gRNA pair, four sets of assays were
performed (gRNA/template) - wt/wt and mut/mut, to check the on-target performance of the assay,
as well as two discordant sets with wt/mut and mut/wt combinations to check for assay crosstalk
(specificity). In an ideal case, the assays should provide high reporter activity on matching pairs with
only background signal observed for discordant pairs. The detection reactions were followed in real-
time by observing an increase in HEX fluorescence coming from the cleaved quenched fluorescent
reporter and the reaction velocities were extracted for each of the reactions.
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

L18F/T20N T19R Δ69-70 D80A

0.2 0.12
Reaction velocity [a.u./min]

0.16 0.12
0.16
0.09
0.12
0.12 0.08
0.06
0.08 0.08

0.03 0.04
0.04 0.04

0 0 0 0
gRNA: wt wt mut mut wt wt mut mut wt wt mut mut wt wt mut mut
Template: wt mut wt mut wt mut wt mut wt mut wt mut wt mut wt mut

Δ144 L452R T478K E484K

0.2 0.12 0.2
Reaction velocity [a.u./min]

0.12
0.16
0.15 0.09
0.08 0.12
0.1 0.06
0.08
0.04 0.05 0.03
0.04

0 0 0 0
gRNA: wt wt mut mut wt wt mut mut wt wt mut mut wt wt mut mut
Template: wt mut wt mut wt mut wt mut wt mut wt mut wt mut wt mut

N501Y P681R A701V

0.25 0.2 0.15
Reaction velocity [a.u./min]

0.2
0.15
0.1
0.15
0.1
0.1
0.05
0.05
0.05

0 0 0
gRNA: wt wt mut mut wt wt mut mut wt wt mut mut
Template: wt mut wt mut wt mut wt mut wt mut wt mut

Figure 2. Detection specificity is low for single nucleotide substitution with standard conditions. A
representative experiment showing collateral nuclease activities (y axis; arbitrary fluorescence unit
increase/min) triggered by wt gRNA matching wt target (wild type detection), wt gRNA matching
mutation target (wt cross-reaction), mutation gRNA matching wt target (mutation cross-reaction) and
mutation gRNA matching mutation target (mutation detection). Mutations are indicated on the top of
each panel. Average and SD are derived from technical duplicates.

All the assays provided efficient on-target activity, but different targets showed varied levels of
discrimination between the discordant pairs. The Δ69-70, Δ144 and P681R assays differentiated the
wt and the mutant alleles effectively (>10-fold discrimination). However, other assays offered only
limited discrimination (<4 fold) (i.e., D80A or T478K) or failed to discriminate wildtype and mutant
templates (i.e., E484K, L452R or N501Y). Of the 8 pairs of gRNAs for the variants containing single
nucleotide substitution, only two (T19R and P681R) showed clear discriminative activities between
matched and mismatched targets (Figure 2). Not surprisingly the position of the substitution on the
gRNA target sequences relative to PAM and the number of nucleotide exchanges affected the degree
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

of discrimination as observed for the other CRISPR/Cas systems (Table 1). The two deletion sites, Δ69-
70 and Δ144, have the greatest power to discriminate the mut from wt. Single nucleotide exchanges
could only be efficiently discriminated in the P681R assay, for which the substitution is only 3 bp away
from PAM. Interestingly, D80A, for which the substitution is right next to PAM did not show strong
discrimination between the wildtype and mutant templates.

Assay optimisation for efficient discrimination of variants

As observed, the “standard” SHERLOCK conditions afforded only limited discrimination of the VOC-
specific mutations. Whereas more extensive genetic changes could be discriminated, single nucleotide
exchanges distal to the PAM could not. We therefore surveyed various assay conditions and chemical
additives to increase the discriminatory power of the assay. The base-pairing specificity of nucleic
acids can be influenced by numerous factors. For example, in PCR reactions, the specificity of primer
binding to the template is, amongst other factors, dependent on the annealing temperature used and
the reaction ionic strength. We have limited the search to conditions that can be tolerated by the
polymerases and enzymes used in the assay to permit a “single pot” reaction.

We selected several common PCR enhancers that are used to alleviate specificity issues in PCR
amplification: DMSO, trehalose, Gly-Gly, betaine, 1,2-propanediol, as well as GITC which have been
shown to improve amplification efficiency and/or specificity[10-12]. Furthermore, we checked
whether specificity could be enhanced by increasing assay temperature or by using gRNAs with a
shorter spacer sequence as previously observed for CRISPR/Cas9 specificity[13].

PCR enhancers show limited assay selectivity improvement

We selected the gRNAs pairs for L18F/T20N (g18/20 wt and g18/20 mut) and the E484K (g484 wt and
g484 mut) as examples for testing various conditions (Supplementary Figure S1 and S2C). The PCR
enhancers including: DMSO, Gly-Gly, betaine (up to 1 M), trehalose, 1,2-propanediol, or a combination
of these, did not appear to improve significantly VarLOCK specificity (Supplementary Figure S1A-B),
neither did the NEB Q5 high GC enhancer.

Strikingly, addition of salts at increasing concentrations improved template discrimination. Increasing

salt concentration in the reaction mixture of KCl to 150 mM or supplementing with 40-50 mM GITC
significantly improved the specificity for E484K (Figure 3A and Supplementary Figure S1B-C). KCl and
GITC at a similar concentration also improved N501Y specificity (Figure 3A and Supplementary Figure
S1D). Surprisingly, both KCl and GITC at similar concentration did not improve the specificity for
A701V, but inhibited Cas12b activity altogether (Figure 3). Taurine at 200 to 250 mM concentration
improved specificities moderately for L18F/T20N and E484K (Figure 3A), but no beneficial effect was
observed for A701V (Figure 3A). Overall, chemical additives only moderately improved VarLOCK
specificities for some variant sites but did not show a general effect.

The effect of these salts suggests that the low ionic strength of the buffer may contribute to the lack
of specificity, or that unspecific charge interactions between DNA and the ribonucleoprotein (RNP)
(Cas12/gRNA) promote stability of the mis-coupled substrate/RNP complex.
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Shorter gRNAs and increased assay temperature improve selectivity

Decreasing the length of the gRNA spacer sequence has previously been shown to improve the
specificity of Cas9 cleavage [13]. We tested whether a similar effect for Cas12b could be observed and
that shortening the length of the gRNA spacer sequences might increase relative base-paring
specificities through reduction of free energies of annealing between gRNA and its target.

Figure 3. Detection specificity can be improved by interfering stability of intermolecular

interaction, gRNA length and reaction temperature. A) Reactions were performed in
standard buffer or with the indicated concentrations of additives. Reporter activities triggered
by wt or mut gRNA matching or mismatching the targets are calculated as increase of
arbitrary fluorescent unit/min. Representative experiments for mutation E484K, N501Y and
A701V are shown. Average and SD are derived from technical duplicates. B) reaction
performed at 60°C or 65°C. The lengths of target sequences in gRNA are indicated under the
x axis. Average and SD are derived from technical duplicates of a representative experiment.

We tested assay activity and specificity for 7 variant sites with spacer lengths between 23 and 15
nucleotides in reactions performed at two different temperatures. At 60°C, activities remained
comparable for spacer lengths between 19- and 23-nt for all 7 variant sites tested (Figure 3B and
Supplementary Figure S2A, C, E, G). Specificities were increased with 19-nt spacers in gRNA for T478K,
E484K and N501Y, without affecting the on-target signal strength. Further shortening of the spacers
to 17-nt dramatically decreased the activities, except those for L18F/T20N, T19R, L452R and P681R.
None of the gRNAs with a spacer length of only 15-nt supported cleavage activity (Figure 3B and
Supplementary Figure S2A, C, E, G).
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Alternatively, increasing temperature could reduce annealing stabilities of mismatched counterparts

between gRNA and targets, with minimum effects on matched counterparts. As AapCas12b can
tolerate temperatures as high as 100°C [14], we tried to rerun the reactions using the gRNAs with
difference length of spacers at 65°C (Figure 3B and Supplementary Figure S2B, D, F, H). In comparison
with the reactions at 60°C, increasing assay temperature by 5°C did improve specificities significantly.
The most improved variant site was N501Y detected using gRNAs with a 19-nt spacer (Figure 3B).

Combination of approaches
As high specificity detection for variant sites L452R and T478K were not achieved by either altering
gRNA length or temperature, we decided to test if KCL, GITC and taurine at concentrations that were
optimal for E484K and N501Y could also provide a benefit in combination with gRNA length
(Supplementary Figure S3A and B). For L452R gRNAs with 21-, 19- and 17-nt spacers, both GITC and
KCl drastically improved specificities with moderate reduction of activities as a compensation
(Supplementary Figure S3A). Taurine also increased specificities, but to a lesser extent compared to
GITC and KCl, however. We calculated the ratio of activities derived from gRNA/Target-matched and
mismatched reactions as an indicator of specificities (Supplementary Figure S3B). We saw that the
effects of the chemicals were both on gRNAs that match the wildtype sequence (g452wt) and the
variant sequence (g452mut). To evaluate the overall specificities, we took the averages of the two
ratios (g452wt and g452mut) as a combined fold difference for comparison across all reaction
conditions. Almost 8-fold discrimination was achieved for 21-nt gRNA with 50 mM GITC and 21-nt and
17-nt gRNA with 150 mM KCl (Supplementary Figure S3B). Similarly, testing on T478K showed that all
the three chemicals improved specificities (Supplementary Figure S3C). In this case, activities
remained at similar levels in reactions with GITC, taurine and KCl, compared to the standard reaction,
at least for 23- and 21-nt gRNAs (Supplementary Figure S3C). GITC and KCl reduced the activities
slightly for 19-nt gRNAs. The overall fold-differences for matched/mismatched reaction reached 10-
fold with 21-nt gRNA with both GITC and KCl (Supplementary Figure S3D).

Taken together, for the variant sites with more than two nucleotide changes, L18F/T20N, Δ69-70 and
Δ144, specificities can be achieved in standard buffer at 65°C with 23-nt gRNA (see a summary in
Figure 4). Two sites with only single nucleotide substitutions, T19R and P681, can also work well in
standard reaction run at 65°C with 23-, 21- and 19-nt gRNAs targeting sequences. L452R, T478K and
N501Y require shorter gRNA, chemical additives and higher temperature to achieve specificity with
overall fold-difference above 7.
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

A 0.1
L18F/T20N
0.06
T19R
0.2
Δ69-70
0.1
D80A B Wildtype sequence Mutant sequence
gRNA specificity gRNA specificity
Reaction velocity [a.u./min]

0.05

1024

1024
0.08 0.08

512
256
128

128
256
512
0.15

64
32
16

16
32
64
0.04

8
4
2
1
1
2
4
8
0.06 0.06
0.03 0.1 L18F/T20N L18F/T20N 1

0.04 0.04
0.02 T19R T19R 2

0.05
0.02 0.01 0.02
Δ69-70 HV69/ 70de l 3

0 0 0 0 D80A D80 A 4

gRNA: wt wt mut mut wt wt mut mut wt wt mut mut wt wt mut mut

Optimised assay conditions

Template: wt mut wt mut wt mut wt mut wt mut wt mut wt mut wt mut
Δ143-145 Y144 del 5

Δ144 L452R 6

Δ143-145 Δ144 N211I/Δ212/215EPEins L452R N211I/Δ212/215EPEins T478 K 7

2 0.12 2 0.06
L452R
Reaction velocity [a.u./min]

E48 4K 8

0.1
1.5 1.5 S477N/T478K N5 01Y 9

0.08 0.04
T478K P6 81R 10

1 0.06 1
E484K A701V 11

0.04 0.02
0.5 0.5 Q493R/G496S 12

0.02
Q498R/N501Y 13

0 0 0 0
gRNA: wt wt mut mut wt wt mut mut wt wt mut mut wt wt mut mut N501Y 14

Template: wt mut wt mut wt mut wt mut wt mut wt mut wt mut wt mut

P681R 15

A701V 16

S477N/T478K T478K E484K Q493R/G496S

1024

1024
512
256
128

128
256
512
1.2 1.50 0.15 2.5

64
32
16

16
32
64
Reaction velocity [a.u./min]

8
4
2
1
1
2
4
8
1 2
0.8 1.00 0.1
L18F/T20N L18F/T20N 1

1.5 T19R T19R 2

0.6
0.4 0.50 0.05
1 Δ69-70 HV69/ 70de l 3

0.2 0.5 D80A D80 A 4

Δ143-145 n.a. Y144 del 5

n.a.

Standard assay conditions

0 0.00 0 0
gRNA: wt wt mut mut wt wt mut mut wt wt mut mut wt wt mut mut
Template: wt mut wt mut wt mut wt mut wt mut wt mut wt mut wt mut
Δ144 L452R 6

N211I/Δ212/215EPEins n.a. T478 K 7

n.a.
L452R E48 4K 8

Q498R/N501Y N501Y P681R A701V

1.5 0.08 0.08 0.06 S477N/T478K n.a. N5 01Y 9

n.a.
Reaction velocity [a.u./min]

0.05 T478K P6 81R 10

0.06 0.06 E484K A701V 11

1 0.04
0.04 0.04 0.03 Q493R/G496S n.a. 12

n.a.
0.5 0.02 Q498R/N501Y n.a. 13

n.a.
0.02 0.02 N501Y 14

0.01
0 0 0 0 P681R 15

gRNA: wt wt mut mut wt wt mut mut wt wt mut mut wt wt mut mut

Template: wt mut wt mut wt mut wt mut wt mut wt mut wt mut wt mut A701V 16

Figure 4. VarLOCK assay sensitively discriminates single nucleotide exchanges. A) Specificity

plots for representative examples for each mutation performed under optimised conditions
(as listed in Table 2). Average and SD are derived from technical duplicates. B) Specificity
factors of the gRNA (wt blue bars and mutation in orange) are presented as ratio of the two
reaction activities triggered by matched and mismatched target DNA. Please note that the
ratios are displayed on a log scale. The bar graph shows average, and SD of the ratios derived
from 2-5 biological repeats.
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Variants target Reaction Reaction conditions

Mutations (N) gRNA set
detected length temperature (additives)
L18F(C>T) / T20N(C>A) Gamma L18_T20 wt :: L18F_T20N 23,21,19 65 °C standard
T19R(C>G) Delta T19 wt :: T19R 23,21,19 65 °C standard
Δ69-70(CATGTC) Alpha 69-70 wt :: Δ69-70 23 65 °C standard
D80A(A>C) Beta D80 wt :: D80A 23 65 °C standard
Δ143-145(GTGTTTATT) Omicron 144 wt :: Δ143-145 23 65 °C standard
Δ144(TTA) Alpha 144 wt :: Δ144 23 65 °C standard
N211I_Δ212_215EPEins Omicron N211 wt :: N211I_Δ212_215EPEins 23 65 °C standard
L452R(T>G) Delta L452 wt :: L452R 21,19 65 °C 50mM GITC, 150mM KCl
S477N(G>A) /T478K(C>A) Omicron T478 wt :: S477-8mut 21 65 °C 150mM KCl
T478K(C>A) Delta T478 wt :: T478K 21,19 65 °C 150mM KCl, 50mM GITC
Beta
E484K(G>A) E484 wt :: E484K 23 60 °C 150mM KCl, 50mM GITC
Gamma
Q493R/G496S Omicron Q493_G496 wt :: Q493R_G496S 21 65 °C standard

Q498R(G>A)/N501Y(A>T) Omicron N501 wt :: Q498R_N501Y 23 65 °C standard

Alpha
N501Y(A>T) Beta N501 wt :: N501Y 19 65 °C standard
Gamma
P681R(C>G) Delta P681 wt :: P681R 23,21,19 65 °C standard
A701V(C>T) Beta A701 wt :: A701V 23 65 °C standard

Table 2. A summary of detection specificities in optimised conditions. The table shows

positions and amino acid substitutions in the spike protein and the corresponding nucleotide
mutations (in brackets). The VOC, the gRNA sets, the target lengths in gRNA (the preferred
length are shown in Bold). Reaction temperature (in Celsius) and additives (preferred additives
in Bold) are indicated in the table.

Adaptation of the VarLOCK with lateral flow assay

After optimisation of the VarLOCK assays with fluorescence detection, which can be easily applied to
large scale screening, we asked whether this assay could be adapted to point of care lateral flow assay.
We chose two mutation sites, Δ69-70, which probes for a 6-nucleotide deletion, and N501Y with just
a single nucleotide substitution. As shown, specific detection had been clearly observed for both
assays. A very faint non-specific band developed in both no target control (N) and mismatch targets,
which may reflect the property of the batch of the dipstick used. Quantitative image analysis of band
intensity found equivalent signal in these two scenarios in comparison to the VOC match
(Supplementary Figure S5).

Validation of the VarLOCK assay using saliva samples

Next, we sought to check the performance of the VarLOCK assay on positive saliva samples identified
at Cardiff University’s COVID-19 screening service. We randomly selected 11, 14 and 15 positive
samples collected in Nov 2020, between Feb and May 2021, and between Jun and Aug 2021,
respectively. Based on the historical data, in the three selected time periods, the Wuhan, Alpha and
Delta variants were dominant in the population, respectively. We used the VarLOCK assay to probe
the presence of 6 mutations that should provide sufficient information to identify the variant present.
Among these, we selected one mutation specific for each variant: Δ144 for Alpha, A701V for Beta,
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

L18F/T20N for Gamma and T19R for Delta variants. We also included two additional mutations found
within the RBD region of the S gene, T478K, which is unique for the Delta variant, and N501Y, which is
shared between Alpha, Beta and Gamma variants. These mutations are suggested to be responsible
for increased infection rates and reduced protection by vaccination and antibody therapies[15, 16].
A L18F/T20N T19R Δ144 T478K N501Y A701V B
Fold difference [log] Fold difference [log] Fold difference [log] Fold difference [log] Fold difference [log] Fold difference [log] L18F/T2
-2 -1 0 1 2 -2 -1 0 1 2 -2 -1 0 1 2 -2 -1 0 1 2 -2 -1 0 1 2 -2 -1 0 1 2 Collection date​ Sample ID T19R Δ144​ T478K N501Y​ A701V​ VarLOCK VoC​ Note
0N​
1218 Nov 2020 1218 -​ - -​ - -​ -​ wt ​
1617 Nov 2020 1617 -​ - -​ - -​ -​ wt ​
2651 Nov 2020 2651 -​/? - -​ - -​ -​ wt L18F​
2865 Nov 2020 2865 -​ - -​ - -​ -​ wt ​
2962 Nov 2020 2962 -​ - -​ - +​ -​ wt N501Y
4411 Nov 2020 4411 -​ - -​ - -​ -​ wt ​
5424 Nov 2020 5424 -​ - -​ - -​ n.a.​ wt
6221 Nov 2020 6221 -/? - -​ - -​ -​ wt L18F​
6293 Nov 2020 6293 -​ - -​ - -​ -​ wt ​
7354 Nov 2020 7354 -​ - -​ - -​ -​ wt ​
9448 Nov 2020 9448 -​/? - -​ - -​ -​ wt L18F​
16862 Jan 2021 16862 -​ - +​ - +​ -​ ​Alpha ​
18579 Jan 2021 18579 -​ - +​ - +​ -​ Alpha ​
20124 Jan 2021 20124 -​ - +​ - +​ -​ Alpha ​
22899 Feb 2021 22899 -​ - +​ - +​ -​ Alpha ​
26655 Feb 2021 26655 -​ - +​ - +​ -​ Alpha ​
30825 Feb 2021 30825 -​ - +​ - +​ -​ Alpha ​
36009 Feb 2021 36009 -​ - +​ - +​ -​ Alpha ​
40090 Feb 2021 40090 -​ - +​ - +​ -​ Alpha ​
40895 Feb 2021 40895 -​ - -​ - +​ +​ ​Beta ​
43486 Feb 2021 43486 -​/? - -​ - -​ -​ wt L18F​
44677 Apr 2021 44677 -​ - +​ - +​ -​ Alpha ​
44699 May 2021 44699 -​ - +​ - +​ -​ Alpha ​
46291 May 2021 46291 -​ - +​ - +​ -​ Alpha ​
49760 May 2021 49760 -​ - +​ - +​ -​ Alpha ​
105978 Jun 2021 105978 - + - + - - Delta
119457 Jun 2021 119457 - + - + - - Delta
139198 Jun 2021 139198 - + - + - - Delta
167883 Jun 2021 167883 - + - + ? ? Delta
251561 Aug 2021 251561 - + - + - - Delta
257513 Jul 2021 257513 - + - + - - Delta
327880 Aug 2021 327880 - + - + - - Delta
337387 Jun 2021 337387 - + - + - - Delta
360714 Jun 2021 360714 - + - + - - Delta
401510 Jun 2021 401510 - + - + - - Delta
410699 Jun 2021 410699 - + - + - - Delta
430384 Aug 2021 430384 - + - + - - Delta
wt [10 nM] ​control wt [10 nM] -​ - -​ - -​ -​ ​
wt [1 nM] control wt [1 nM] -​ - -​ - -​ -​ ​
mut [10 nM] control mut [10 nM] +​ + +​ + +​ +​ ​
mut [1 nM] control mut [1 nM] +​ + +​ + +​ +​ ​

mut wt mut wt mut wt mut wt mut wt mut wt

Figure 5. Variant identification of the positive saliva samples. A) VarLOCK assay results showing
dominant wildtype signal (blue) or mutant signal (red), calculated as Log10 of fold (wt/mut) differences.
Samples are grouped in three time periods as indicated with different shading of greyness. B) VarLOCK
detection summary for the analysed samples with VOC assignment. Sanger sequencing was used to
confirm the variants for samples and amplicons shaded in green.

The relevant regions of interests were amplified by RT-PCR from saliva samples and the products were
subjected to VarLOCK assays. The results are presented as Log10 of the ratio of the two VarLOCK
activities obtained with wt gRNA and mut gRNA. This provides a simple method to visualise samples
as wildtype or mutant, based on whether the Log10 value is above or below 0 respectively (Figure 5).
This presentation was evaluated with wildtype and mutant control targets, and both 1 and 10 nM
control targets showed similar Log10 value, indicating a tolerance of variabilities of RT-qPCR
amplification in all 6 mutation sites (Figure 5).

Δ144, a signature for Alpha variant, showed that 12 out of 14 samples collected between February
and May 2021 were assigned as Alpha. These 12 samples also carried the N501Y mutation as typically
found in Alpha (Figure 5). The presence of A701V mutation (Beta) was only detected in one sample
(40895). This sample also carried the N501Y mutation. The A701V assay also produced ambiguous
results for 167883. To understand the cause of the ambiguity, we sequenced this sample. Sequencing
suggested that, although this sample had a small portion of C to T substitution, the sample may contain
more than one sequences (Supplementary Figure S7).

The L18F/T20N assay detecting a Gamma specific mutation, did not indicate the presence of this
mutation in any of the samples tested, nor did it conclusively assign the wt sequence in 4 of the tested
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

samples, namely 2651, 6221, 9448 and 43486, suggesting the presence of a different mutation from
L18F/T20N. Indeed, Sanger sequencing of these PCR products showed that all these 4 samples carried
the spike protein L18F mutation (single nucleotide substitution from C to T) (a representative
sequencing result shown in Supplementary Figure S7B). The Delta variant probe T19R showed that all
12 samples had this mutation (Supplementary Figure S5). Sanger sequencing of a few selected
templates was used to validate the VarLOCK results (Supplementary Figure S6). Indeed, samples which
tested positive for mutation in the VarLOCK assay contained the expected sequences when sequenced
(Figure 5B). Interestingly, although no VOCs were designated before December 2020, we detected 3
samples with the L18F mutation out of the 11 samples collected in November 2020. Twelve of the 14
samples collected between January and May 2021 were Alpha variants and all the 12 samples
collected between June and August 2021 were Delta variants.

VarLOCK wastewater
Wastewater monitoring for the detection of SARS-CoV-2 has become an important tool,
complementing hospital and community-based clinical surveillance to identify the presence and
relative rates of transmission of COVID-19 infection within the population of a defined geographical
area [17]. Wales was one of the first countries to implement nation-wide surveillance of COVID-19 in
wastewater, which now covers all of Wales’ major urban areas and ~80% of the Welsh population[18].
Globally, there is increasing interest in local and national wastewater surveillance to monitor the
effect of public health interventions and monitor or inform of possible new local outbreaks ahead of,
or as an alternative to, mass testing. We hypothesised that the VarLOCK assay could be used to
monitor and map the prevalence of variants of concern in close to real time. In principle, this could
provide speed, coverage or resource advantages over symptomatic testing and subsequent
sequencing of selected positive cases. This could be especially useful where sequencing resources are
scarce or when national COVID-19 caseload is high in a highly vaccinated population, but the
emergence or introduction of immune-escape variants with known mutations of concern could risk an
increase in severe disease. To evaluate the feasibility of applying VarLOCK to identify VOCs in
wastewater, VarLOCK assays were used to discriminate between the original Wuhan, Alpha, Beta and
Delta variants retrospectively in wastewater samples collected from three wastewater treatment
works (WwTWs) serving the cities of Cardiff, Swansea and Newport (all urban centres in South Wales),
which were collected weekly from November 2020 to November 2021, as part of the COVID-19 Welsh
Wastewater monitoring programme.

Unlike samples isolated from an individual, where the presence of only one SARS-CoV-2 variant is
normally expected, wastewater samples contain a mixture of numerous individual samples. In
addition, in contrast to samples isolated from an individual, the viral genomes in the wastewater are
highly fragmented, and the samples are complex and contain nucleic acids from a wide range of
sources, posing a hurdle for sequencing. Weekly samples were processed with the VarLOCK assay to
determine the prevalence of different variants. For this the relevant regions were amplified with RT-
PCR and the products analysed with assays probing for Δ69-70, Δ144 (Alpha), T478K (Delta) and A701V
(Beta).

For the Cardiff, Newport and Swansea samples, a differential VarLOCK mutation-specific signal is
observed with time, reflecting the respective introduction and then dominance of the original variant,
Alpha and then Delta VOCs in the country (Figure 6A). The sequential introduction and growth of the
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Alpha variant in Cardiff, followed by Newport and then Swansea is notable and likely reflective of the
tightening of Government COVID19 restrictions in Wales through December 2020 and January 2021,
with limited household mixing, stay-at-home orders and restricted travel accounting for a slow-down
in seeding events with reduced inter-city mixing. In contrast Delta VOC arrival and dominance appears
more uniformly across the cities with this variant becoming established in the U.K. amidst lighter
restrictions. Across the three cities the combined VarLOCK VOC profile maps extremely well to the all-
Wales genomic surveillance data catalogued by the COVID-19 Genomics UK Consortium (COG) (Figure
6B top panel). Positive SARS-CoV-2 detection and VOC identification is also made when community
prevalence is low (e.g. June 2021) indicating the sensitivity of the approach.

Precise caseload quantification by waste-water monitoring is known to be challenging[17]. For

example, here some wastewater samples recorded no observable viral material despite being
collected during a period of known high prevalence. We attributed this to variability of conditions
and/or interplay of timing in the wastewater-processing and sample collection and this would require
further investigation (these null data points have been retained in the presented data to avoid
subjective bias). However, VarLOCK VOC identification in wastewater is observed to be effective at
both high and low community caseload throughout the study. Further to this, we observed VarLOCK
identification of the presence of mutations characteristic of the Beta variant in wastewater samples.
Community transmission of Beta VOC was limited in Wales with the variant not becoming established
in the presence of high Alpha caseload and restrictions reducing transmission, with only 40 cases
across all of Wales recorded by sequencing during this study period. The VarLOCK Beta VOC response
temporally correlates with recorded sequence clusters in Wales (Figure 6B lower panel). Here, the
VarLOCK VOC assay was able to identify the presence of the sparse Beta variant against a backdrop of
high Alpha caseload, showing the sensitivity of the approach. Whilst this study was retrospective,
collectively these data highlight the promising potential for utilising wastewater VarLOCK monitoring
for near-real-time VOC monitoring.

Figure 6. VarLOCK analysis of wastewater samples. Wastewater samples collected weekly between
November 2020 and November 2021 at three urban centres in south Wales were analysed with
VarLOCK assays for original variant, Alpha, Beta and Delta VOCs. The results showed successful
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

application of VarLOCK for variant monitoring in wastewater with the VarLOCK variant signal reflecting
dominant periods of the original variant, Alpha and then Delta VOCs in the country (panel B). The
growth of the Alpha variant can be seen to arrive first in Cardiff, followed by Newport and then
Swansea (panel A). Against a high background of Alpha variant VarLOCK signal indicative of the
presence of the low prevalence Beta variant is observed in the wastewater samples correlating with
sequencing identified clusters in Wales (panel B).

Detection of Omicron variant and subvariants

Recently, a novel SARS-CoV-2 variant B.1.1.529 was identified in Southern Africa and flagged as
containing a potentially concerning number of spike mutations on 23rd November 2021 following
sequence identification in Botswana (3 genomes), Hong Kong ex S. Africa (1 genome, partial) [19].
South African public health recorded an extremely large and rapid increase in SARS-CoV-2 cases and
test positivity in Gauteng Province for the week of 14-20 November 2021 [20] with this rapidly
attributed to Omicron by South Africa Centre for Epidemic Response & Innovation [21, 22]. It was
designated by WHO and named Omicron VOC on 26th November 2021. Local epidemiology studies
showed significant re-infection risk in a population with relatively low vaccination coverage [23] and
early laboratory studies indicated significant reduction in neutralising ability of vaccine and prior-
infection induced antibodies [24-26]. This reinfection and incomplete vaccine protection risk has been
borne out in populations of higher vaccination coverage following Omicron introduction in the U.K.
with the variant rapidly becoming dominant against a background of high Delta caseload. The rapid
spread of Omicron across the globe highlights the global public health challenge in containing VOCs
following their identification. Whilst sequencing has been indispensable in the scientific effort in
monitoring, tracking, understanding and tackling Omicron, the associated lag has hindered
containment or implementation of targeted proactive measures, where rapid molecular diagnostics
could arguably provide important speed and scale advantages. S-gene target failure (SGTF) has proved
a useful proxy for this, enabling rapid assessment of early Omicron case growth in U.K. (2-3 day
doubling) [27] and determining dominance in England by 14th December [28, 29]. However, SGTF is
currently limited to four main qPCR laboratories in the U.K. (Alderley Park, Glasgow, Milton Keynes,
and Newcastle Lighthouse Laboratories) for community (Pillar 2) testing, so many areas and cases
remain under-reported until community transmission is well established. Furthermore STGF occurs
due to fortuitous primer design, and cannot be relied upon for identification of future variants.

In this context we applied our generalisable VOC detection strategy to Omicron, developing and
implementing an assay able to differentiate Omicron from delta, wt and other variants and
additionally positively detect and distinguish between Omicron sub-variants BA.1 and BA.2, where
BA.2 is undetectable by SGTF. Within 4 days from receiving the oligonucleotides, we successfully
developed 5 VarLOCK assays to probe for the presence of Omicron specific mutations in the S gene:
Δ143-145 (BA.1), N211I/Δ212/215EPEins (BA.1), S477N / T478K (BA.1 and BA.2), Q493A/G496S (BA.1)
and Q498R/N501Y (BA.1 and BA.2) (Table 1 and 2). First, the assays were tested and optimized with
synthetic dsDNA templates (Figure 4). In addition, given that the same S gene locations are found
differently mutated in other variants, we cross-validated the specificity of the Omicron assays against
the templates containing other VOC specific sequences (Figure 4). All the assays showed excellent
specificity, ranging between 49.1 and 347.9-fold discrimination.
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Subsequently, we applied the VarLOCK Omicron detection to 10 recently isolated positive saliva
samples collected between the last week of November and mid December 2021. In one of the samples
- 487161, the VarLOCK assays identified the presence of N211I/Δ212/215EPEins, S477N/T478K,
Q493A/G496S, Q498R/N501Y Omicron specific mutations with good confidence. The 6 most recent
positive samples were selected for whole-genome SARS-CoV-2 sequencing using the NimaGen
protocol. In the VarLOCK-identified Omicron saliva sample, deep sequencing reconfirmed the
presence of the detected mutations and Nextstrain server assigned the sample as Omicron (21K). The
other 5 sequenced samples were assigned to the Delta clade (21J), thus reconfirming VarLOCK VOC
detection results obtained.
N211I/Δ212
A 215EPEins T478K S477N/T478K Q493R/G496S Q498R/N501Y N501Y B
Fold difference [log] Fold difference [log] Fold difference [log] Fold difference [log] Fold difference [log] Fold difference [log] N211I
S477N Q493R Q498R
-4 -2 0 2 4 -2 -1 0 1 2 -3 -2 -1 0 1 2 3 -3 -2 -1 0 1 2 3 -3 -2 -1 0 1 2 3 -4 -2 0 2 4 Collection date​ Sample ID Δ212 T478K N501Y​ VarLOCK VoC​
T478K​ G496S N501Y​
215EPEins​
430403 430403 430403 430403 430403 430403 Nov 2021 430403 -​ + -​ - -​ -​ Delta
433961 433961 433961 433961 433961 433961 Nov 2021 433961 -​ + -​ - -​ -​ Delta
444540 444540 444540 444540 444540 444540 Nov 2021 444540 -​ + -​ - - -​ Delta
457253 457253 457253 457253 457253 457253 Nov 2021 457253 -​ + -​ - -​ -​ Delta
459048 459048 459048 459048 459048 459048 Dec 2021 459048 -​ + -​ - -​ -​ Delta
460242 460242 460242 460242 460242 460242 Dec 2021 460242 - - - - - - Unknown
468957 468957 468957 468957 468957 468957 Dec 2021 468957 - + - - - - Delta
471808 471808 471808 471808 471808 471808 Dec 2021 471808 - + - - - - Delta
487161 487161 487161 487161 487161 487161 Dec 2021 487161 + +/? + + + +/? Omicron (BA.1)
513900 513900 513900 513900 513900 513900 Dec 2021 513900 - + - - - - Delta
wt [10 nM] wt [10 nM] wt [10 nM] wt [10 nM] wt [10 nM] wt [10 nM] wt [10 nM] - - - - - -
mut [10 nM] mut [10 nM] mut [10 nM] mut [10 nM] mut [10 nM] mut [10 nM] mut [10 nM] + + + + + +
mut2 [10 nM] mut2 [10 nM] mut2 [10 nM] mut2 [10 nM] mut* [10 nM] - (+/-) - - (+/-) -

mut wt mut wt mut wt mut wt mut wt mut wt

Figure 7. VarLOCK identification of Omicron variant in saliva samples. A) VarLOCK assay results
showing dominant wildtype signal (blue) or mutant signal (red), calculated as Log10 of fold (wt/mut)
differences. For the regions where mutations are present in other VOCs, an additional control was used
with alternative template for the other mutants (mut*) B) VarLOCK detection summary for the
analysed samples with VOC assignment. Illumina sequencing was used to confirm the variants for
samples shaded in green.

Conclusions
As the COVID-19 pandemic continues, SARS-CoV-2 will continue to mutate, and novel variants will
arise. It is likely further variants with transmission advantages afforded by immune escape will
emerge. Once mutational sequences are known, VarLOCK provides a readily implementable means to
monitor their introduction and progression. This can provide new tools in the management of the
pandemic. For example, variant specific testing for travel or events; or enabling more rapid
implementation of enhanced public health measures, such as surge testing or enhanced contact
tracing upon early knowledge of importation or community transmission of VOCs. In this context,
whilst genomic sequencing affords unparalleled insight into viral identification and lineage tracking,
especially in the evolution of novel variants, it requires relatively high viral loads and is subject to delay
and capacity limits, even in well-resourced nations. This lag may contribute to variants gaining an
unstoppable foothold diminishing the effectiveness of public health containment efforts, as seen in
the U.K. with Delta and Omicron VOCs where spread has been rapid. Consequently, faster as well as
more time and resource efficient variant identification methods can contribute to more rapid and
targeted public health responses when necessary.

In this regard, the development of new variant specific VarLOCK assays is rapid. The Omicron detection
assays were developed within four days from the receipt of the required oligonucleotides, which can
be extremely rapidly designed following identification of concerning genomic sequences. This may
also be considered on the basis of predicted mutations that may be of concern to monitor for their
emergence. For example, S477N, Q498R, N501Y mutations, as found in Omicron, were predicted to
substantially increase ACE2 binding if to arise in combination [30]. Here, the reported Omicron
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

VarLOCK assay was designed and tested with synthetic samples before a positive Omicron case had
reached our 3000 sample/day capacity SARS-CoV-2 testing pipeline.

We show here that VarLOCK is applicable to a range of analytical samples, not only enabling variant
identification in saliva samples from positive individuals as part of a PCR testing workflow, but that it
is also applicable to the monitoring of variant prevalence in pooled population samples. Further, the
possibility to use the VarLOCK approach with different amplification approaches (RPA, LAMP and PCR)
with fluorescent or colourimetric readout means it can be integrated into PCR testing pipelines,
coupled with near patient LAMP testing and is even compatible with lateral flow readout.

We have demonstrated that the developed VarLOCK approach is scalable, easily adaptable for
different mutations and readily implemented on different sample types including highly fragmented
pooled population samples. The VarLOCK approach is able to discriminate single nucleotide exchanges
in the identification of VOCs. To achieve this level of specificity optimisation of assay conditions
considering gRNA length, reaction temperature and excipients favouring binding discrimination are
used to enable enhanced SNP identification. This approach significantly improves the selectivity of
previously reported SHERLOCK assays, and by developing targeted VarLOCK assays with a combination
of mutation specific gRNAs we are able to identify the mutational pattern present and enable
successful VOC identification in infected individuals and in wastewater samples from urban
populations. In this regard even low prevalence Beta VOC signatures are observed in South Wales
wastewater during early 2021 amidst a background of very high prevalence Alpha infections,
highlighting the detection sensitivity of the approach to new variant introductions.

The optimised VarLOCK assay is able to discriminate single nucleotide polymorphism in both DNA and
RNA species. Here, we apply it to identify SARS-CoV-2 variants. We show the approach can be rapidly
repurposed for new VOCs with the development and implementation of Omicron specific tests,
including differentiation of BA.1 and BA.2 sub-types. VarLOCK may also be employed for sensitive and
specific identification of other pathogens, for example influenza (A/B), RSV or identification of
antibiotic resistance bacteria, wherever genetic identification, or especially SNP or variant
discrimination, is of importance. This may contribute to future pandemic preparedness, especially as
the approach is readily integrated with existing testing infrastructure. The ability to apply to
population-level wastewater samples may also afford the opportunity for multi-pathogen monitoring
in communities for enhanced public health surveillance.

In summary, the VarLOCK approach allows rapid implementation and development in response to new
pathogens or genetic variants, with the assay being suitable for implementation at point-of-care, for
integration into qPCR testing pipelines and application with wastewater surveillance. When combined
with pathogen genomic sequencing VarLOCK approaches can rapidly translate sequenced variant
information into rapid, sensitive, and specific nucleic acid diagnostics for enhanced public health
benefit.
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Materials and methods

Purification of AapCas12b
pAG001 His6-TwinStrep-SUMO-AapCas12b was a gift from Omar Abudayyeh and Jonathan
Gootenberg (Addgene plasmid # 153162) [4]. The purification procedure of AapCas12b was adapted
from the protocol described for TwinStrep−SUMO−LwaCas13a with modifications [31]. Briefly, protein
expression was induced by adding 0.5 mM IPTG to transformed BL21-CodonPlus (DE3)-RIL cells
(Agilent) and incubated at 18°C for overnight. The cell pellet from 1 L culture was resuspended in 40
ml Lysis Buffer (20 mM Tris pH7.5, 0.5 M NaCl, 10% Glycerol, 1 mM DTT, and 1 mM PMSF) and
sonicated for 10 min at a temperature below 7 °C. Cleared supernatant was incubated with 1 ml Ni-
NTA Agarose (Genaxxon Bioscience, S5377) for 1 hr at 4 °C. After incubation, the slurry was loaded on
a gravity flow purification column. The column was washed with 100 ml of Wash Buffer I (20 mM Tris-
HCl pH 7.5, 0.5 M NaCl and 10 mM imidazole) followed by 100 ml Wash Buffer II (20 mM Tris-HCl pH
7.5, 0.5 M NaCl and 20 mM Imidazole). The His6-TwinStrep-SUMO-AapCas12b protein was cleaved by
His6-Ulp1 (in-house) in SUMO Cleavage Buffer (20 mM Tris pH 7.5, 0.5 M NaCl, 1 mM DTT and 0.15%
Igepal CA-630) at 4°C overnight. Cleaved AapCas12b was eluted in SUMO Cleavage Buffer and dialysed
against Dialysis Buffer I (10 mM Tris-HCl pH 7.5, 0.2 M NaCl, 1 mM DTT and 10% glycerol) for 2 hr and
Dialysis Buffer II (10 mM Tris-HCl pH 7.5, 0.1 M NaCl, 1 mM DTT and 50% glycerol) for 3 hr. Protein
purity and concentration were estimated with SDS-PAGE.

gRNA design, synthesis and purification

As the AacCas12b scaffold-based sgRNA has been reported to produce more robust and specific
nuclease activity in combination with AapCas12b compared to previously used gRNAs, we designed
our gRNA with the AacCas12b gRNA scaffold [4]. In order to synthesise gRNA by in vitro transcription,
we placed the T7 promoter sequence at the 5’ end of the gRNA scaffold to form a 115nt-long oligo
(gRNA-sca-temp, see Supplementary Table 1). We then designed 23-nt target sequences using an
online program by selecting TTN as PAM sequence (http://www.rgenome.net/cas-designer/) [32]. The
target sequences were extended at their 5’ end by adding a 19-nt sequence CAAATCTGAGAAGTGGCAC
identical to the 3’ end of the gRNA scaffold. The reverse-compliment oligos of the extended target
sequences (Table 1) were used together with a forward T7 promoter oligo (Table 1) and gRNA-sca-
temp to generate double-stranded DNA by PCR reaction (with Q5 DNA polymerase, NEB, #M0491L).
gRNA was synthesised using the PCR product as template with T7 RNA polymerase (Thermo Scientific,
#EP0111) and template DNA was removed by DNaseI (Thermo Scientific, #EN0521) digestion. The
gRNAs were further purified using 12% denaturing polyacrylamide gel.

VarLOCK assay
Inspired by the potential for performing LAMP-SHERLOCK-coupled one-pot assay, we chose to
perform the VarLOCK assay in Bst2.0 based buffer omitting dNTP and LAMP primers. For fluorescent
assay, each 20 l VarLOCK reaction contained 20 mM Tris-HCl pH 8.8@25°C, 10 mM (NH4)2SO4, 50 mM
KCL, 8 mM MgSO4, 0.1% Tween 20, 37.5 nM AapCas12b, 12.5 nM gRNA, 200 nM fluorescent reporter
and 10 nM double-stranded target DNA, unless stated otherwise. Fluorescent VarLOCK reaction were
either performed at 60 or 65 °C (as indicated) and the FAM fluorescence was recorded every minute
for 60 minutes with LightCycler 96 System (Roche) or ABI QuantStudio 7 (Thermo Fisher Scientific).
For comparison, the initial reaction rates are calculated using linear regression in MS Excel by fitting
the fluorescence increase during the first six minutes of the reaction. For lateral flow assay (LFA), all
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

components were the same as above, except 375 nM AapCas12b, 125 nM gRNA, 125 nM LFA reporter
and 100 nM double-stranded target DNA were used. LFA samples were incubated at 60 or 65 °C for
60 minutes and subsequently applied to dipsticks for result readout (Milenia HybriDetect 1, TwistDx,
#MILENIA01) according to manufacturer’s instruction. Both fluorescent Reporter (5’-HEX-TTTTTTT-3’-
IABkFQ/) and LFA reporter (5’-6-FAM-TTTTTTT-3’Bio) were purchased from IDT4 (REF#4Joung2020).
To optimise the reaction, double-stranded short DNA, annealed using two complimentary oligos, were
initially used as targets (sequence listed in Supplementary Table 2). For viral samples, RT-PCR products
were generated using primers (listed in Supplementary Table 3) and used as targets in the VarLOCK
assay.

VarLOCK assay with PCR or LAMP products

Synthetic DNA templates harbouring the wt or mutant sequences for PCR or LAMP amplification were
synthesised by IDT or by Twist Bioscience. Inactivated wt and mutant SARS-CoV-19 viral particles were
provided by Dr. Richard Stanton and the viral RNA extracted with BOMB protocol [33]. LAMP primers
were designed using the NEB LAMP primer design tool https://lamp.neb.com/#!/ or Primer Explorer
v5.0 https://primerexplorer.jp/e/ (Eiken, Japan). qPCR primers were designed with IDT PrimerQuest
Tool. Both LAMP and PCR primers were synthesised by IDT or Merck (listed in Supplementary Table
S3). Luna Universal One-Step RT-qPCR Kit (NEB #E3005) was used for qPCR. When using viral RNA as
template, 1x Luna WarmStart® RT Enzyme Mix was included and a 10 min incubation step at 50C was
added before PCR cycles. For the LAMP reaction to produce amplicons for VarLOCK, the reaction mix
contained 1X isothermal buffer (NEB), 10 mM DTT, 0.4 mg/ml PVP, 60 mM KCl, 5 mM each dNTP, 0.8
M betaine, 0.5 µM syto9, 0.32 U/µl Bst v2.0 Warm Start polymerase (NEB), 0.8 µM FIP/BIP, 0.4 µM
LF/LB and 0.2 µM per 10 µl volume. Artificial templates were used for wild type, Alpha and Beta
variants. LAMP amplification was observed on the green channel (490 nm) at 60 °C using a RotorGene
thermo cycler (Qiagen) for 40 minutes.

VarLOCK assay with saliva samples

Saliva samples were extracted in the Cardiff University COVID-19 test laboratory using automated
BOMB protocol [33]. A pilot DNA quantification survey showed that typical concentration of the
amplicons after RT-qPCR from saliva samples reached the range between 10 and 30 ng/l, or a sub-
picomole/l in molar concentration, which is comfortably within the VarLOCK sensitivity range (1 to
100 femtomole/l). Subsequently we did not quantify DNA concentration of the PCR products and
directly used 2 l for VarLOCK assay in 20 l reaction. Optimised conditions were used for each of the
mutation sites (Figure 5A).

Collection and preparation of wastewater samples for VarLOCK assays

Untreated wastewater samples (crude influent) were collected between November 2020 and
November 2021 from Dŵr Cymru/Welsh Water WwTWs at Cardiff, Newport and Swansea, as part of
the Wales COVID-19 wastewater surveillance programme. On each sampling occasion, 500-1000 ml
of crude influent was collected by manual grab sampling between 08.00 and 10.00 h, reflecting peak
sewage flow and aiming to capture the highest community faecal load. Suspended solids were then
removed from a 150 ml aliquot of each sample by centrifugation (3000 g, 4 °C, 30 min), and viral
nucleic acids collected by subsequent PEG (polyethylene glycol 8000) precipitation for >18 hours
based on methods described previously [34, 35] with some minor modifications [36]. PEG precipitates
collected by centrifugation (10,000g, 4 °C, 30 min), and pellets, resuspended in 200 μl of phosphate
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

buffer saline, prior to RNA extraction in the Cardiff University COVID-19 Testing Service laboratory
using automated BOMB protocol [33].

Automated liquid handling

The QPCR and reaction setup was automated on the Opentrons OT-2 robots. The OT-2 programs for
assay assembly are available upon request.

Sanger and Illumina sequencing

PCR products were sequenced using one of the two PCR primers by Eurofins Genomics sequencing
service. Whole genome sequencing was performed utilising NGS library preparation by RT-PCR using
the Nimagen protocol, essentially as described (https://www.protocols.io/view/wastewater-
sequencing-using-the-easyseq-rc-pcr-sar-bx6dpra6). Subsequently, the libraries were reisolated with
SPRI beads, quality of the libraries were checked with TapeStation and the libraries were quantified.
Sequencing was performed on Illumina MiSeq 2x250 Nano cartridge.

Statistics
Each experiment was performed with technical duplicates. Experiments with optimised condition
were repeated between 2 and 5 times and Standard Deviation calculated from these biological
replicates is presented in Figure 5B. Tests of the saliva samples were run with technical duplicates.

Acknowledgements
This work was supported by; UKRI/BBSRC emergency route for time-critical COVID-19 research,
project number: BB/W003562/1 “Rapid Molecular Diagnostics For New & Emerging SARS-CoV-2
Variants of Concern- Protecting Vaccine Efficacy“, awarded to TPJ, OKC, JAHM, PH; Sêr Cymru Welsh
Government award: MA/KW/1457/20 “Novel technologies for point-of-care genetic testing for SARS-
CoV-2" awarded to TPJ, OKC, JAHM, PH; MRC (MR/V028448/1, MR/S00971X/1), Wellcome
(204870/Z/16/Z), and Welsh Government Sêr Cymru calls awarded to RS. Wastewater project funded
by Sêr Cymru awarded to PK and AW; Welsh Government “WeWASH” awarded to DJ, AW, TPJ, PK;
Cardiff University funding in support of the establishment, implementation and operation of the CU
COVID-19 screening service. We would like to thank Cardiff University Biobank for the assistance with
sample collection and Dr. Angela Marchbank (School of Biosciences Genome Research Hub, Cardiff
University) for help with Illumina sequencing. The authors would like to thank all users of Cardiff
University COVID-19 screening service and all Cardiff University staff involved in its realisation.

Author contributions
VarLOCK Conceptualization: XN, TPJ
Study concept, design, direction and development: XN, TPJ, OC, PH, PK, JAHM
Methodology: XN, DP, JG, JW, ZS, EH, GW, SH, PH, SD, JU, TPJ
Investigation: XN, SH, PH, SD, JU, DP, JG, JW, EH, GW, RS
Data analysis and visualization: XN, OC, PH, TPJ
Funding acquisition: OC, PH, JAHM, PK, DJ, AW, TPJ
Project administration: DJ, AW, TPJ
Supervision: JAHM, PH, OC, PK, AW, DJ, TPJ
Writing – original draft: TPJ, OC, XN, PH, JAHM
Writing – review & editing: All authors
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

Ethical approval
I confirm all relevant ethical guidelines have been followed, and any necessary research ethics
committee approvals have been obtained. The Ethical oversight is provided by Research Ethics
Committee Health and Care Research Wales (IRAS Project ID: 214760). Saliva sample collection,
processing and SARS-CoV-2 testing at the Cardiff University is covered by ethical approval
18/WA/0089 (Cardiff University BioBank). All necessary participant consent has been obtained and
the appropriate institutional forms have been archived.

Competing interests
TPJ is a director and shareholder of a small biotech company, Magnacell Ltd. The other authors declare
that there is no conflict of interest.

Data availability statement

All biological materials used in this work can be obtained from Cardiff University Biobank on request.
Data are available on request.

References
1. Volz, E., et al., Assessing transmissibility of SARS-CoV-2 lineage B.1.1.7 in England. Nature,
2021. 593(7858): p. 266-269.
2. Ravi, N., et al., Diagnostics for SARS-CoV-2 detection: A comprehensive review of the FDA-EUA
COVID-19 testing landscape. Biosens Bioelectron, 2020. 165: p. 112454.
3. Notomi, T., et al., Loop-mediated isothermal amplification of DNA. Nucleic Acids Res, 2000.
28(12): p. E63.
4. Joung, J., et al., Detection of SARS-CoV-2 with SHERLOCK One-Pot Testing. N Engl J Med, 2020.
383(15): p. 1492-1494.
5. Gootenberg, J.S., et al., Nucleic acid detection with CRISPR-Cas13a/C2c2. Science, 2017.
356(6336): p. 438-442.
6. Schermer, B., et al., Rapid SARS-CoV-2 testing in primary material based on a novel multiplex
RT-LAMP assay. PLoS One, 2020. 15(11): p. e0238612.
7. Broughton, J.P., et al., CRISPR-Cas12-based detection of SARS-CoV-2. Nat Biotechnol, 2020.
38(7): p. 870-874.
8. Kidd, M., et al., S-Variant SARS-CoV-2 Lineage B1.1.7 Is Associated With Significantly Higher
Viral Load in Samples Tested by TaqPath Polymerase Chain Reaction. J Infect Dis, 2021.
223(10): p. 1666-1670.
9. Huang, Y., et al., Structural and functional properties of SARS-CoV-2 spike protein: potential
antivirus drug development for COVID-19. Acta Pharmacol Sin, 2020. 41(9): p. 1141-1149.
10. Li, L., et al., Development of a direct reverse-transcription quantitative PCR (dirRT-qPCR) assay
for clinical Zika diagnosis. Int J Infect Dis, 2019. 85: p. 167-174.
11. Özay, B. and S.E. McCalla, A review of reaction enhancement strategies for isothermal nucleic
acid amplification reactions. Sensors and Actuators Reports, 2021. 3: p. 100033.
12. Ralser, M., et al., An efficient and economic enhancer mix for PCR. Biochem Biophys Res
Commun, 2006. 347(3): p. 747-51.
13. Matson, A.W., et al., Optimizing sgRNA length to improve target specificity and efficiency for
the GGTA1 gene using the CRISPR/Cas9 gene editing system. PLoS One, 2019. 14(12): p.
e0226107.
14. Teng, F., et al., Repurposing CRISPR-Cas12b for mammalian genome engineering. Cell Discov,
2018. 4: p. 63.
medRxiv preprint doi: https://doi.org/10.1101/2022.01.06.21268555; this version posted January 8, 2022. The copyright holder for this
preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in
perpetuity.
It is made available under a CC-BY-NC 4.0 International license .

15. Planas, D., et al., Reduced sensitivity of SARS-CoV-2 variant Delta to antibody neutralization.
Nature, 2021. 596(7871): p. 276-280.
16. Xie, J., et al., Novel Monoclonal Antibodies and Recombined Antibodies Against Variant SARS-
CoV-2. Front Immunol, 2021. 12: p. 715464.
17. McMahan, C.S., et al., COVID-19 wastewater epidemiology: a model to estimate infected
populations. Lancet Planet Health, 2021. 5(12): p. e874-e881.
18. Government, W., Waste water signals local COVID spikes. 2020: Press release.
19. Peacock, T., B.1.1 descendant associated with Southern Africa with high number of Spike
mutations. 2021: GitHub.
20. Diseases, N.I.f.C., Covid-19 testing summary South Africa week 46. 2021.
21. (CERI), K.-N.R.I.a.S.P.K.a.t.C.f.E.R.a.I., NGS-SA SARS-CoV-2 Omicron Sequencing in South Africa
– BioProject. 2021, NCBI.
22. Africa, N., Prof. Tulio de Oliveira gives a summary of the new #COVID19 variant, the B.1.1.529,
that has been detected in South Africa. 2021, Twitter: Twitter.
23. Pulliam, J.R.C., et al., Increased risk of SARS-CoV-2 reinfection associated with emergence of
the Omicron variant in South Africa. medRxiv, 2021: p. 2021.11.11.21266068.
24. Cathcart, A.L., et al., The dual function monoclonal antibodies VIR-7831 and VIR-7832
demonstrate potent in vitro and in vivo activity against SARS-CoV-2. bioRxiv, 2021: p.
2021.03.09.434607.
25. Cele, S., et al., SARS-CoV-2 Omicron has extensive but incomplete escape of Pfizer BNT162b2
elicited neutralization and requires ACE2 for infection. medRxiv, 2021: p.
2021.12.08.21267417.
26. Sheward, D.J., et al., Quantification of the neutralization resistance of the Omicron Variant of
Concern. Google, 2021.
27. Agency, U.K.H.S., SARS-CoV-2 variants of concern and variants under investigation in England.
Technical briefing 31. . 2021.
28. Agency, U.K.H.S., SARS-CoV-2 variants of concern and variants under investigation in England.
Technical briefing 33. 2021.
29. Agency, U.K.H.S., Omicron daily overview: 17 December 2021. 2021.
30. Zahradnik, J., et al., SARS-CoV-2 variant prediction and antiviral drug design are enabled by
RBD in vitro evolution. Nat Microbiol, 2021. 6(9): p. 1188-1198.
31. Kellner, M.J., et al., SHERLOCK: nucleic acid detection with CRISPR nucleases. Nat Protoc, 2019.
14(10): p. 2986-3012.
32. Park, J., S. Bae, and J.S. Kim, Cas-Designer: a web-based tool for choice of CRISPR-Cas9 target
sites. Bioinformatics, 2015. 31(24): p. 4014-6.
33. Oberacker, P., et al., Bio-On-Magnetic-Beads (BOMB): Open platform for high-throughput
nucleic acid extraction and manipulation. PLoS Biol, 2019. 17(1): p. e3000107.
34. Farkas, K., et al., Concentration and Quantification of SARS-CoV-2 RNA in Wastewater Using
Polyethylene Glycol-Based Concentration and qRT-PCR. Methods Protoc, 2021. 4(1).
35. Lewis, G.D. and T.G. Metcalf, Polyethylene glycol precipitation for recovery of pathogenic
viruses, including hepatitis A virus and human rotavirus, from oyster, water, and sediment
samples. Appl Environ Microbiol, 1988. 54(8): p. 1983-8.
36. Kevill, J.L., et al., A comparison of precipitation and filtration-based SARS-CoV-2 recovery
methods and the influence of temperature, turbidity, and surfactant load in urban wastewater.
Sci Total Environ, 2021. 808: p. 151916.