2020 Book ForensicDNATypingPrinciplesApp
2020 Book ForensicDNATypingPrinciplesApp
Shrivastava
Hirak Ranjan Dash
Jose A. Lorente
Jahangir Imam Editors
Forensic
DNA Typing:
Principles,
Applications and
Advancements
Forensic DNA Typing: Principles,
Applications and Advancements
Pankaj Shrivastava • Hirak Ranjan Dash •
Jose A. Lorente • Jahangir Imam
Editors
This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd.
The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721,
Singapore
Contents
v
vi Contents
33 Building of the World’s Largest DNA Database: The China Case . . . 639
Ausma Bernotaite
34 DNA Databases: Risks, Benefits, Privacy, and Human Rights . . . . . 659
Sachil Kumar
Hirak Ranjan Dash completed his Ph.D. from the Department of Life Science,
National Institute of Technology, Rourkela, India, and is currently working as a
DNA fingerprinting expert at the Forensic Science Laboratory, Bhopal, Madhya
Pradesh, India. He received his M.Sc. in Microbiology from Orissa University of
Agriculture and Technology, Odisha, India. His research interests include forensic
microbiology, thanatomicrobiome analysis, molecular microbiology, DNA finger-
printing and genetic manipulation. He has written four books and published
29 research papers, 14 book chapters, 12 conference proceedings, and four popular
science articles.
ix
x About the Editors
human rights (he launched the first-ever database to identify missing people, the
Spanish Phoenix Program, back in 1999); he also created and launched the
DNA-PROKIDS Program in 2004. His areas of interest in forensics also deal with
population variability and analysis of old and ancient DNA samples and databases
expansion and control. Dr. Lorente is also actively working in medical genomics and
he’s the scientific director of the Center for Genomics and Oncological Research
(GENYO), where his team focuses on liquid biopsy and cancer interception.
Dr. Lorente is the founder and first president of the AICEF (Ibero-Latin American
Network of Forensic Sciences), and an honorary member of the AFSN (Asian
Forensic Sciences Network).
Abstract
Forensic DNA typing has overpowered all other known methods in forensics.
Starting with the method which required a reasonably high amount of good
quality of DNA, time taking and a complex process, this little more than three
decade old technology has gone through much advancement to overcome these
issues. The chapter details different steps involved in forensic DNA typing from
its inception to the present including the advancements.
Keywords
Forensic DNA · STR · PCR · RFLP · Capillary electrophoresis
1.1 Introduction
In the 1891 novel, Sherlock Holmes, a fictional private detective said “it has long
been an axiom of mine that the little things are infinitely the most important” (Doyle
and Roden 1993). Certainly he would have never imagined that a thing as little as a
DNA molecule could become a powerful tool aiding the criminal justice system
(Jobling and Gill 2004). Gradually, the field of forensic genetics developed to solve
the legal issues like identification of the victims of mass disasters and
K. Vajpayee
Department of Forensic Science and Anthropology, University of Lucknow, Lucknow, Uttar
Pradesh, India
D. C. Sagar
Disaster Management, Police Head Quarters Bhopal, Bhopal, Madhya Pradesh, India
H. R. Dash (*)
DNA Fingerprinting Unit, Integrated High-Tech Laboratory, Regional Forensic Science
Laboratory, Bhopal, Madhya Pradesh, India
In this method, the DNA molecule is treated with restriction enzymes. Restriction
enzymes have a characteristic property of cutting the DNA at specific base
sequences, the restriction sites. This results in the formation of DNA fragments of
variable length. Further, agarose gel electrophoresis is carried out to separate such
variable length DNA fragments followed by southern blotting. The fragments get
hybridized to short radio labeled probes and can be easily detected by radiography as
1 Forensic DNA Typing: Inception, Methodology, and Technical Advancements 5
bands. The loss or absence of such few restriction sites forms the basis of individu-
ality in humans. Thus, following this technique, a unique RFLP signature for an
individual can be generated. Forensic experts match such signatures originating from
different sources with the one lifted from the crime scene. The DNA probes most
importantly the single locus probes (SLPs) were routinely in this technique for
analyzing the paternity dispute cases.
By the mid of 1980s, variable number of tandem repeats (VNTR) mini satellite
loci became the common method for analysis of DNA. VNTR are the sequences
of few nucleotides commonly called as motifs which are repeated in variable number
of times in every DNA molecule. This variation in number of repeats creates a scope
of individualization among organisms. The mini satellites are the type of VNTR
sequences consisting of 9–100 bp sequences. Minisatellites which were widely in
forensic routine was D1S80 (pMCT118) and other probes like 33.15, 33.6,
pentameric CAC/GTG were also in use in countries like Germany, the USA, and
the UK.
For so long, the RFLP technology proved to be a reliable tool in DNA analysis
but it had few limitations which lead the research community for further discovery of
other markers. The limitations posed were the need of large quantity of
non-degraded DNA, cost-effectiveness, involvement of huge time and labor, and
requirement of much statistical work for analysis. These limitations were then
overcome by PCR-based markers (Primorac et al. 2000; Panneerchelvam and
Norazmi 2003; Roewer 2013; Grover and Sharma 2014).
The polymerase chain reaction (PCR) technique was invented by Kary Mullis in
1985. It allowed the in vitro amplification of DNA sequences using extension of the
complementary primers. The entire process or a single cycle involved—denaturation
of DNA strands caused by high temperature, annealing of complementary primer
and their extension. Since the temperature during the entire process remains very
high which is crucial for denaturation process to occur; a special type of DNA
polymerase, the Taq polymerase aids in extending DNA primers. It takes 25–30
cycles for a DNA segment to be amplified for precise analysis.
Earlier PCR-based marker systems used single nucleotide polymorphisms in
HLA-DQA1 GENE7. This system was based on detection of variations in DNA
using probes. But the discrimination power was low. New set of PCR markers were
the need of an hour. In the mid-1990s, the forensic community started using
microsatellites repeats. The microsatellite repeats are a class of VNTRs consisting
of 2–9 bp. The microsatellite VNTRs also called as short tandem repeats (STRs)
proved to have enormous discriminating power and thus, ideally suited for forensic
caseworks (Budowle et al. 1990; Panneerchelvam and Norazmi 2003; Carracedo and
Sanchez-Diz 2005).
6 K. Vajpayee et al.
Since the advancements in DNA typing technology, the forensic materials can now
be easily assessed for individuality. The first use of DNA fingerprinting in forensic
case work was witnessed in 1986. Sir Allec Jeffreys used the technique to verify the
suspect on a double rape and murder case. Robert Melias was the first suspect to be
identified and convicted by DNA fingerprint technology in 1987. The famous cases
of Glen Woodal v/s State of Virginia in 1992 and the multiple murder trial of
Timothy Wilson Spencer versus the state of Virginia in 1994 gave thrust to the
use of DNA fingerprinting in solving the forensic cases (Panneerchelvam and
Norazmi 2003).
In the present scenario the DNA technology is been used in both civil and
criminal cases. During a disaster or a crime the DNA evidence serves as corrobora-
tive evidence and aids in identification of the victim and criminal as the case maybe.
Meanwhile the DNA profiling also helps in civil disputes related to paternity and
kinship determination. With the advancement in the field of DNA typing
methodologies and its analysis DNA is now serving the criminal justice system
while solving the caseworks. In India several cases of kinship, paternity, murder, and
rape have now been solved with the help of DNA profiling technique (Verma and
Goswami 2014). Few of them are:
• Rajiv Gandhi Assassination case: Mr. Rajiv Gandhi, the ex-prime minister of
India was assassinated in 1991 using human bomb. The flesh collected from the
crime scene (The belt) was handed over to the forensic team who using DNA
typing methods proved the identity of the individuals involved. Similarly the case
associated with the assassination of Mr. Beant Singh, the Chief Minister of
Punjab, was solved using DNA profiling technology.
• Naina Sahani Tandoor case: The famous “Tandoor case” of India was also
solved using DNA typing methodology. Naina Sahani was a young lady. She was
murdered and the body was thrown in the “tandoor” oven. The charred body of
the lady was recovered by the police and the flesh and bones were analyzed for
DNA testing. The analysis proved that the body belonged to Naina Sahani.
• Santosh Kumar Singh vs. State: A young student named Ms. Priyadarshini
Mattoo was murdered by her friend in 2006. Since there was not any evidence
that could prove the culprit guilty, he was acquitted from the trail court. The blood
samples collected from the item found at crime scene and semen collected from
the lady’s undergarments was sent for DNA analysis. The High court on the basis
of the results of DNA profiling held the accused guilty of Ms. Mattoo’s murder.
The decision was also upheld by the apex court of India.
• Gautam Kundu case: The Gautam Kundu case of paternity issue is amongst the
important cases since it lead to the formulation of important guidelines explaining
the purpose and circumstances by Hon’ Supreme of India. The guidelines
included: “(1) that courts in India cannot order blood test as matter of course;
(2) wherever applications are made for such prayers in order to have roving
inquiry, the prayer for blood test cannot be entertained; (3) There must be a strong
1 Forensic DNA Typing: Inception, Methodology, and Technical Advancements 7
prima facie case in that the husband must establish non-access in order to dispel
the presumption arising under section 112 of the Evidence Act, 1872;
(4) The court must carefully examine as to what would be the consequence of
ordering the blood test; whether it will have the effect of branding a child as a
bastard and the mother as an unchaste woman; and (5) No one can be compelled
to give sample of blood for analysis.” These guidelines were asked to be
undertaken when DNA Evidence Acts were not framed (Panneerchelvam and
Norazmi 2003).
• N. D. Tiwari case: Rohit Shekhar born in 1979 claimed himself as the putative
son of Mr. N. D. Tiwari. Although his mother married another man in 1963, she
opted for divorce in 2006. As per the section 112 of the Indian Evidence Act,
1872, paternity can be decided but the court ordered for DNA test, a deviation
from the guidelines posed in Gautam Kundu case. The DNA analysis indicated
that N. D. Tiwari is the biological father of Rohit shekhar. Both parties agreed
upon settlement outside the court but the questions related to distribution of rights
and duties remained unanswered.
• The Black Buck Poaching Case of Jodhpur: It was in 1998 while shooting for a
movie in Jodhpur (India), a very famous cine star got accused of hunting the black
buck (endangered species). The samples of meat were analyzed and the DNA
study revealed the species of the animal. Further the number of animals hunted
was also established.
1.3 Methodology
While working with the SLP and PCR methods scientists found novel method
involving variation within these minisatellites. The method was then termed as
MVR-PCR (minisatellite variant repeat). The technology, however, was compli-
cated. The analysis of mixed samples proved to be a tough task. These altogether
lead to research for new improved methods which could have a better discriminating
power and on the other hand are easy to analyze.
In 1992, STRs came into existence and were used to analyze forensic samples.
These STRs are microsatellite VNTRS having 2–9 nucleotides repeats. Soon they
became the basis of DNA analysis. The STRs, as regards to their structure, are either
complex STRs or simple STRs. The complex STRs show the property of
hypervariability and these are the loci which contains one or more than one run of
repeats having more than one repeat type. Whereas simple STR are the loci consists
of uninterrupted run of one repeat type. In simple STRs the rate of mutation remains
low and can be standardized easily. The STRs are thus selected on the basis of
certain criteria like robustness, size, and presence of artifacts for forensic use. The
STRs being small in size tend to remain stable which had simplified the analysis of
degraded age old DNA samples (Jobling and Gill 2004; Carracedo and Sanchez-
Diz 2005).
8 K. Vajpayee et al.
The STRs are polymorphic in nature. For each STR locus, the STR alleles are
found in variable number of repeat sequences, giving STRs a high discriminating
power. The experts hence agreed upon using more STR loci which will increase the
probability of presence of exact same number of repeat units amongst individuals to
almost rare.
The STRs alleles for a particular locus show codominant behavior. An individual
thus inherits one allele from mother and another from father. This forms the basis of
inclusion in paternity case works. In such cases, the STR alleles of the disputed
person are matched against the STR alleles of alleged father and mother and a perfect
match indicates the inclusion whereas a mismatch excludes them. Thus the discov-
ery of STRs proved to be a boon for forensic experts (Martin et al. 2001;
Panneerchelvam and Norazmi 2003).
The forensic groups from different countries started using various techniques for
STR typing. Earlier denaturing electrophoresis with native gel was used for the
analysis of STRs. The electrophoretic method of analysis was somehow prone to
errors thus hampers the analysis. Recently, multiplex technique for STR typing is
developed which uses primers probed with fluorescent dyes and DNA sequencers.
The technique allowed amplification of STR loci while separating them. Today
many commercial multiplexes are available in the market like SGM Plus (Applied
Biosystems), Promega (Madison, WI), Poweplex16 (Promega) and the Identifiler
(Applied Biosystems) (Martin et al. 2001).
bones, where the nuDNA is fragmented upto such an extent so that its analysis
becomes cumbersome. Cases of missing and mass disaster can be solved using
mtDNA typing technique as they are maternally inherited. The websites useful for
mitochondrial DNA analysis is listed in Table 1.1.
Though the mtDNA typing seems to be a beneficial tool in identification but like
Y chromosome typing it too has got its limitations. The mtDNA typing procedure in
a laboratory requires more skill and care with regards to the contamination. The
molecule gets easily contaminated and would result in mis-analysis. Due to its
matrilineal inheritance it is found present in all the members of matriline. The
property of heteroplasmy also hinders the application of mtDNA typing. Moreover,
the typing methodology is time taking and costly. Thus, making it a complex process
and is only practiced when traditional nuDNA typing fails (Jobling and Gill 2004;
Roewer 2013).
DNA typing or the DNA profiling refers to the process of determining the sequence
of nucleotides in the genome of an individual. The nucleotide sequence is analyzed
for genetic variations among the individuals. The DNA typing involves isolation of
DNA from the cell, quantification, amplification, and sequencing. With the advance-
ment in the field of molecular biology and genetics, the tools to extract DNA
12 K. Vajpayee et al.
simultaneously became rapid, cost effective. Starting from the manual DNA extrac-
tion procedure used by Friedrich Miescher, the process modified several times by
research groups around the globe. Now there are techniques available which extract
sufficient amount of DNA even from tough biological samples like bone and teeth.
These advancements were accompanied by modifications in amplification process
by PCR. The PCRs now days, use high quality efficient polymerases which can also
withstand high temperatures. Thus, provides a better typing methodology (Fig. 1.1).
The first step in DNA profiling is the DNA isolation/extraction process. The process
involves sequential steps to isolate DNA from the cell/nucleated sample. Since DNA
typing involves the analysis of DNA, the DNA extraction process should be such
that enough and sufficient amount of DNA can be isolated and the chemicals
involved in the process do not interact with the DNA so as to hamper its integrity.
Techniques ideal to various types and forms of forensic samples have been devel-
oped. Forensic laboratories practice several manual methods to extract DNA
automated techniques as per the requirement of the sample to be analyzed. The
various techniques can be briefly described as under:
Column-Based Approach
The column-based approach is one of the solid-phase extraction in which the DNA is
adsorbed over the silica bed layered on to the glass beads using highly concentrated
guanidine salts like guanidine hydrochloride, guanidine isothiocyanate, or sodium
iodide. These salts tend to dehydrate the proteins resulting in stable binding of the
DNA. After this, the low ionic solution with pH more than 7.5 is allowed to flow
through the spin column which will efficiently elute the DNA out from the silica bed
(Tereba et al. 2004; Duncan et al. 2003; Boom et al. 1990; Vogelstein and Gillespie
1979). Spin columns from Qiagen (QIAamp® spin columns) are available in the
market which uses this methodology to separate the DNA from cell debris
(McKiernan and Danielson 2017; Butler 2012a, b).
14 K. Vajpayee et al.
FTA-Based Technique
Burgoyne in 1994 described the use of FTA paper to store DNA. The paper is made
up of cellulose fibers and contains chemical which preserves DNA for longer period
of time (Burgoyne 1996). The bactericidal enzyme in the paper prevents the growth
of bacteria. To isolate the DNA, a small section of stain containing FTA paper is
punched out and is washed briefly and the DNA can be purified using FTA purifica-
tion reagent. The bound heme and other proteins elute out in the supernatant. Since
the application of stain on FTA paper causes the cells to lyse, the DNA gets bound to
the fibers of the paper, preserved. This DNA can now be isolated using techniques
like chelex or can be directly used in PCR (Lorente et al. 1998; Kline et al. 2002).
Several robotic automated workstations have been developed which isolate DNA
from FTA paper. The methodology is not as easy as it seems—the static energy
between the paper and the plastic well makes it difficult to stay (Butler 2012a, b).
1 Forensic DNA Typing: Inception, Methodology, and Technical Advancements 15
Chelex Technique
In 1991, forensic community started using ion exchange resins for DNA isolation.
Chelex 100 resin from Bio Rad was amongst the few popular resins. Chelex 100 was
a copolymer of styrene divinylbenzene copolymer along with paired iminodiaetate
ions. As per the protocol provided by Walsh et al. the sample is directly added to the
chelex resin. The mixture is now heated which in turns denatures the DNA and helps
in cell lysis. With the help of centrifugation the resin along with cell debris is
removed and the DNA is contained in the supernatant. This supernatant can directly
be used in PCR. In this approach the resin chelates the divalent ions and thereby
deactivates the nucleases. Although the technique fails to filter out the contaminants
present in sample like heme. It proves to be a simple, single step and rapid procedure
to extract single stranded DNA. This method of DNA extraction is simple, rapid, and
avoids contamination of the DNA. The main disadvantage of the technique lies in its
failure to filter out the contaminants present in sample like heme (McKiernan and
Danielson 2017; Elkins 2013; Butler 2012a, b; Walsh et al. 1991).
Most of the currently available amplification kits available today contain the
recommended global core STR loci. These kits have a high level of tolerance to
potential PCR inhibitors. Besides they can amplify the STR loci from the degraded
samples. The extensive list of PCR kits commercially available now-a-days along
with their marker features is given in Table 1.2.
Table 1.2 List of commercially available STR genotyping kits and their marker features
Manufacturer’s Name
S. No. Name of the kit List of STR markers and Address
1 AmpFlSTR® D8S1179, D21S11, D7S820, ThermoFisher
Identifiler® kit CSF1PO, D3S1358, TH01, D13S317, Scientific, Foster City,
D16S539, D2S1338, D19S433, vWA, CA, USA
TPOX, D18S51, Amelogenin,
D5S818, FGA
2 AmpFlSTR® CSF1PO, D2S1338, D3S1358, ThermoFisher
Identifiler® Plus D5S818, D7S820, D8S1179, Scientific, Foster City,
kit D13S317, D16S539, D18S51, CA, USA
D19S433, D21S11, FGA, TH01,
TPOX, vWA, Amelogenin
3 AmpFlSTR® D8S1179, D21S11, D7S820, ThermoFisher
Identifiler® Direct CSF1PO, D3S1358, TH01, D13S317, Scientific, Foster City,
kit D16S539, D2S1338, D19S433, vWA, CA, USA
TPOX, D18S51, D5S818, FGA,
Amelogenin
4 AmpFlSTR® CSF1PO, FGA, D16S539, D18S51, ThermoFisher
MiniFiler™ kit Amelogenin, D2S1338, D21S11, Scientific, Foster City,
D7S820 CA, USA
5 AmpFlSTR® D3S1358, vWA, D16S539, D2S1338, ThermoFisher
NGM™ kit D8S1179, D21S11, D18S51, Scientific, Foster City,
D19S433, TH01, FGA, D1S1656, CA, USA
D12S391, D10S1248, D22S1045,
D2S441, Amelogenin
6 AmpFlSTR® D3S1358, vWA, D16S539, D2S1338, ThermoFisher
NGM SElect™ kit D8S1179, D21S11, D18S51, Scientific, Foster City,
D19S433, TH01, FGA, Amelogenin, CA, USA
D10S1248, D22S1045, D2S441,
D1S1656, D12S391, SE33
7 AmpFlSTR® D3S1358, vWA, D16S539, D2S1338, ThermoFisher
NGM SElect™ D8S1179, D21S11, D18S51, Scientific, Foster City,
Express D19S433, TH01, FGA, Amelogenin, CA, USA
D10S1248, D22S1045, D2S441,
D1S1656, D12S391, SE33
8 AmpFlSTR® FGA, TH01, vWA, D3S1358, ThermoFisher
NGM Detect™ kit D8S1179, D18S51, D21S11, Scientific, Foster City,
D12S391, D1S1656, D2S441, CA, USA
D10S1248, D22S1045, D16S539,
D2S1338, D19S433, SE33, IQCS,
IQCL, Y indel, Amelogenin
9 GlobalFiler™ kit D3S1358, vWA, D16S539, CSF1PO, ThermoFisher
TPOX, D8S1179, D21S11, D18S51, Scientific, Foster City,
D2S441, D19S433, TH01, FGA, CA, USA
D22S1045, D5S818, D13S317,
D7S820, SE33, D10S1248, D1S1656,
D12S391, D2S1338, Amelogenin,
DYS391, Y indel
(continued)
1 Forensic DNA Typing: Inception, Methodology, and Technical Advancements 17
through which fragments pass. The sample is injected via electrokinetic injection
ports. These injection ports allow high resolution in short distances.
The sample from PCR is mixed with the STR typing kits available in the market
and is diluted so that the sample does not interfere with the electrokinetic injection
process. To ensure DNA denaturation sufficient amount of formamide is added to
sample mix. The sample is now allowed to separate using the high voltage across the
electrodes. The factors effecting the movement and thus separation of the DNA
fragments are the polymer matrix, capillary dimensions, buffer used (100 mmol/L N-
tris-(hydroxymethyl)-methyl-3-aminopropane-sulfonic acid and 1 mmol/L EDTA,
pH 8.0). The polymer solutions generally in use are POP-4, POP-6 and POP-7 with
urea (performance optimized polymer). These are un-cross linked liner polymers of
dimethyl polyacrylamide with 4% and 6% concentrations, respectively. The
fragments are detected by the fluorescent detectors namely a photomultiplier tube
(PMT) or a charge-coupled device (CCD) and is measured in relative fluorescence
units (RFU). The PCR primers are fluorescent labeled and hence the dye gets
incorporated into the DNA fragments. With each fragment passing the window—
carved in the capillary, the laser is focused upon them—illuminating the DNA. The
signals are captured by the detectors and are plotted as peaks (Butler 2012a, b).
Single nucleotide polymorphisms are the single base pair (biallelic) variations such
as insertions, deletions, and substitutions found in the genome of an individual.
SNPs are diverse in nature and estimated to occur once in every 1000 bp. They are
the commonly occurring polymorphism in the human genome. The SNPs occur at
coding as well as noncoding gene sequences. The forensically important SNPs occur
mainly in noncoding regions of the genome. Apart from being useful to forensic
22 K. Vajpayee et al.
The National Cancer Institute has defined the genetic term next generation sequenc-
ing as an advanced technology which is used to sequence the DNA of individual.
NGS can sequence large amount of DNA simultaneously hence is rightly called as
Massively Parallel Sequencing (MPS) technology. Sequencing techniques have
been developed since 1977 when sanger had demonstrated the newly developed
1 Forensic DNA Typing: Inception, Methodology, and Technical Advancements 23
method. While these STR markers have several advantages like having high dis-
criminatory power, the technique holds few drawbacks as well. The STR markers
consist of long nucleotide repeated sequences which are not suitable for the analysis
of degraded forensic samples. Further the profile generated needs to be compared
either to a reference profile or to the profiles selected through databases.
To overcome such limitations the novel concept of forensic DNA phenotyping
has been introduced. In this methodology, DNA sequences are used to infer about
the morphology of the individual. The observable traits or the phenotype of an
individual is controlled by both genetic factors and external environmental factors
(multi-factorial). The genetic data is thus used to predict the characteristic feature of
an individual upto an extent. Phenotypic characters like hair, eye color, skin color,
etc. are now phenotyped using genetic information. Pigmentation genes responsible
for eye color-HERC2, OCA2, SLC24A4, SLC45A2, TYR, and IRF4 are used by
Irisplex System, first tool developed for phenotyping. It has the high accuracy of
likelihood. Similarly, MC1R, SLC45A2, SLC24A5, and HERC2 and an SNP-based
model has been used for hair color determination having 88% accuracy. Later,
HIrisplex System was developed and validated for both hair and eye color markers.
For the skin color SLC24A5, HERC2, and SLC45A2 markers have been
incorporated into the phenotyping kits available in the market. Thus, this methodol-
ogy is still novel and new phenotyping markers are continuously being researched
and incorporated into the kits (Marano and Fridman 2019; Samuel and Prainsack
2019; Kayser 2015).
References
Barbaro A et al (2009) Validation of PrepFiler forensic DNA extraction kit (applied biosystems).
For Sci Int Genet Suppl Ser 2:176–177
Boom R et al (1990) Rapid and simple method for purification of nucleic acids. J Clin Microbiol
28:495–503
Børsting C, Morling N (2015) Next generation sequencing and its applications in forensic genetics.
For Sci Int Genet 18:78–89. https://doi.org/10.1016/j.fsigen.2015.02.002
Brevnov MG et al (2009) Validation of the PrepFiler forensic DNA extraction kit for extraction of
genomic DNA from biological samples. J Forensic Sci 54:599–607
Brión M, Sanchez J, Balogh K, Thacker C, Blanco-Verea A, Børsting C et al (2005) Introduction of
an single nucleodite polymorphism-based “Major Y-chromosome haplogroup typing kit” suit-
able for predicting the geographical origin of male lineages. Electrophoresis 26(23):4411–4420.
https://doi.org/10.1002/elps.200500293
Bruijns B, Tiggelaar R, Gardeniers H (2018) Massively parallel sequencing techniques for
forensics: a review. Electrophoresis 39(21):2642–2654. https://doi.org/10.1002/elps.201800082
Budowle B, Giusti A, Allen R (1990) Analysis of PCR products (pMCT118) by polyacrylamide gel
electrophoresis. Advances in forensic haemogenetics, pp 148–150. https://doi.org/10.1007/978-
3-642-75496-8_44
Budowle B, van Daal A (2008) Forensically relevant SNP classes. Biotechniques 44(5):603–610.
https://doi.org/10.2144/000112806
Burgoyne LA (1996) Solid medium and method for DNA storage. U.S. Patent 5,496,562
Butler J (2012a) Advanced topics in forensic DNA typing. Academic Press, London, pp 141–165
Butler J (2012b) Advanced topics in forensic DNA typing. Academic Press, London, pp 29–47
1 Forensic DNA Typing: Inception, Methodology, and Technical Advancements 25
Miller S, Dykes D, Polesky H (1988) A simple salting out procedure for extracting DNA from
human nucleated cells. Nucleic Acids Res 16(3):1215–1215. https://doi.org/10.1093/nair/16.3.
1215
Moss D et al (2003) An easily automated, closed-tube forensic DNA extraction procedure using a
thermostable proteinase. Int J Legal Med 117:340–349
Panneerchelvam S, Norazmi MN (2003) Forensic DNA profiling and database. Malaysian J Med
Sci 10(2):20–26
Phillips C, Salas A, Sánchez J, Fondevila M, Gómez-Tato A, Álvarez-Dios J et al (2007) Inferring
ancestral origin using a single multiplex assay of ancestry-informative marker SNPs. For Sci Int
Genet 1(3-4):273–280. https://doi.org/10.1016/j.fsigen.2007.06.008
Primorac D, Schanfield MS, Primorac D (2000) Application of forensic DNA testing in the legal
system. Croat Med J 41:32–46
Roewer L (2013) DNA fingerprinting in forensics: past, present, future. Investig Genet 4(1):22.
https://doi.org/10.1186/2041-2223-4-22
Samuel G, Prainsack B (2019) Forensic DNA phenotyping in Europe: views “on the ground” from
those who have a professional stake in the technology. New Genet Soc 38:119–141. https://doi.
org/10.1080/14636778.2018.1549984
Sanchez J, Børsting C, Hallenberg C, Buchard A, Hernandez A, Morling N (2003) Multiplex PCR
and minisequencing of SNPs—a model with 35 Y chromosome SNPs. Forensic Sci Int 137
(1):74–84. https://doi.org/10.1016/s0379-0738(03)00299-8
Sanchez J, Phillips C, Børsting C, Balogh K, Bogus M, Fondevila M et al (2006) A multiplex assay
with 52 single nucleotide polymorphisms for human identification. Electrophoresis 27
(9):1713–1724. https://doi.org/10.1002/elps.200500671
Sobrino B, Brión M, Carracedo A (2005) SNPs in forensic genetics: a review on SNP typing
methodologies. Forensic Sci Int 154(2-3):181–194. https://doi.org/10.1016/j.forsciint.2004.10.
020
Tan S, Yiap B (2009) DNA, RNA, and protein extraction: the past and the present. J Biomed
Biotechnol 2009:1–10. https://doi.org/10.1155/2009/574398
Teama S (2018) DNA polymorphisms: DNA-based molecular markers and their application in
medicine. InTech, Rijeka. https://doi.org/10.5772/intechopen.79517
Tereba AM et al. (2004) Simultaneous isolation and quantitation of DNA. U.S. Patent 6,673,631
Vallone P, Butler J (2004) Y-SNP typing of U.S. African American and Caucasian samples using
allele-specific hybridization and primer extension. J Forensic Sci 49(4):1–10. https://doi.org/10.
1520/jfs2003303
Vallone P, Just R, Coble M, Butler J, Parsons T (2004) A multiplex allele-specific primer extension
assay for forensically informative SNPs distributed throughout the mitochondrial genome. Int J
Legal Med 118(3):147–157. https://doi.org/10.1007/s00414-004-0428-5
Verma S, Goswami G (2014) DNA evidence: current perspective and future challenges in India.
Forensic Sci Int 241:183–189. https://doi.org/10.1016/j.forsciint.2014.05.016
Vogelstein B, Gillespie D (1979) Preparative and analytical purification of DNA from agarose. Proc
Natl Acad Sci U S A 76:615–619
Walsh PS et al (1991) Chelex 100 as a medium for simple extraction of DNA for PCR-based typing
from forensic material. Biotechniques 10:506–513
Walsh S, Liu F, Ballantyne K, van Oven M, Lao O, Kayser M (2011) IrisPlex: a sensitive DNA tool
for accurate prediction of blue and brown eye colour in the absence of ancestry information. For
Sci Int Genet 5(3):170–180. https://doi.org/10.1016/j.fsigen.2010.02.004
Yang Y, Xie B, Yan J (2014) Application of next-generation sequencing technology in forensic
science. Genom Proteom Bioinformatics 12(5):190–197. https://doi.org/10.1016/j.gpb.2014.09.
001
STR Typing and Available Multiplex Kits
Including Validation Methods 2
Anna Barbaro
Abstract
Since the first introduction of DNA typing in 1987, more than 30 years have been
passed and an enormous growth in forensics occurred. DNA test routinely
represents the most important tool for solving forensic caseworks and biological
relationships. Forensic laboratories carry out annually hundreds of DNA tests
because modern technologies allow obtaining conclusive results from a wide
range of biological evidences even if degraded or in small quantities. Repeated
DNA regions selected by the international scientific community for forensic
applications include minisatellites (VNTR) and microsatellites (STR). In particular
STRs became rapidly the first-choice markers for human identification because of
their features and the good polymorphism degree. Once loci were definitively
established, commercial multiplex were developed including initially only few
loci till to current large systems that allow now simultaneous amplification of
European and USA database core loci. Thus nowadays, large commercial STR
kits are widely used either in forensic than in paternity tests because of their easy
use and high discriminatory power. Obviously, to assess new forensic DNA
technologies, two types of validation are required: developmental performed
directly by the manufacturer and internal done by the user—laboratory.
According to the Scientific Working Group on DNA Analysis Methods
(SWGDAM) recommendations, several different steps are required in both cases.
Keywords
STR · Polymorphism · PCR · Multiplex · Validation
A. Barbaro (*)
Department of Forensic Genetics, Studio Indagini Mediche E Forensi (SIMEF), Reggio Calabria,
Italy
Worldwide Association of Women Forensic Experts (WAWFE), Rome, Italy
e-mail: [email protected]
2.1 Introduction
DNA analysis was firstly introduced in the mid-1980s and rapidly developed so that
it now represents the most important tool for solving forensic caseworks, resolving
biological relationships, identifying missing persons or mass disaster victims.
In humans only a small part (0.3%) of genome differs among individuals: this
difference is mainly due to the presence of highly repeated DNA traits available in
almost every chromosome, which constitute more than 40% of the human genome.
Repeated sequences differ on the basis of the total length of the repeated area, the
length of the repeated units and the number of units. Since these regions are
generally placed between genes, they may change from individual to individual,
without affecting the person’s health. Repeated regions selected by the international
scientific community for forensic applications include minisatellites and
microsatellites.
fragments were separated in size by electrophoresis on agarose gel and then trans-
ferred to a nylon membrane for subsequent detection by radioactive or chemilumi-
nescent labelled probes (Southern Blotting) (Jeffreys et al. 1985a; Southern 1975).
Since resulting pattern is unique for each person and it’s the same for every cell,
tissue, and organ, without the possibility to be altered by any known treatment, the
use of this technique made possible the first human DNA identity test. The test was
used in UK in 1985 to solve a controversial immigration case and then in 1987 the
double-murder case of two teenagers, Lynda Mann and Dawn Ashworth, raped and
killed in Narborough (Leicestershire), respectively in 1983 and 1986. Even if
VNTRs analysis was successfully used in forensic caseworks for several years,
anyway its use was limited because a large amount of not degraded DNA was
required for a successful typing and VNTR patterns interpretation was often prob-
lematic, specially in case of mixed samples (Jeffreys et al. 1985b).
The introduction of the polymerase chain reaction (PCR), invented in 1983 by
K. Mullis, was a great revolution that allowed to forensic scientists the analysis of
small biological samples not analyzable with the original procedure (Mullis 1990).
Microsatellites, also named short tandem repeats (STRs), are simpler than VNTRs
and generally contain 2–6 bp repeats (most common is a 4 bases repetition): the unit
is generally repeated many times in “head-tail” manner (Fig. 2.2). While
minisatellites are mainly interspersed in genoma, STRs are generally found in the
centromeric area of a chromosome. It has been estimated the presence of one STR
per every 6–10 kb in the human genome (Jin et al. 1994).
In unrelated individuals STR markers have different numbers of repeat units and
repetition patterns, but the sequence generally does not differ (Table 2.1). It has been
observed that GATA and AGAT are the most common repeats in forensic STR loci.
According to Pattern (Butler 2001) STR may be classified as simple, compound or
complex (Table 2.2). There are hundreds of STR markers in the human genome and
several dozen have been studied to be used in human identity testing (Butler 2012).
In particular, for human identification purposes, the scientific community selected
only sufficiently polymorphic STRs with the following characteristics (Table 2.3)
(Gill et al. 1995; Carracedo and Lareu 1998; Bär et al. 1992, 1997):
Loci placed in “noncoding DNA region” are chosen in order to avoid giving any
additional information about person phenotype or health status. STRs are used in
several fields such as genetic mapping, disease diagnosis, evolutionary biology, but
they rapidly become the first-choice markers for human identification because of
some benefits, which may be summarized in the following ones (Butler et al. 2003):
Table 2.3 Information about most commonly used Autosomal STR Loci (Butler 2012)
Locus Chromosome Chromosomal location Repeat motif Repeat category Allele range GenBank accession
D1S1656 Chr 1 1q42 TAGA Compound 8–20.3 G0782
D2S441 Chr 2 2p14 TCTA/TCAA Compound 8–17 AC079112
TPOX Chr 2 2p25.3 GAAT Simple 4–16 M68651
Thyroid peroxidase intron
D2S1338 Chr 2 2q35 TGCC/TTCC Compound 15–28 AC010136
D3S1358 Chr 3 3p21.31 TCTG/TCTA Compound 8–21 AC099539
FGA Chr 4 4q31.3 CTTT/TTCC Compound 12.2–51.2 M64982
Alpha Fibrinogen
intron
D5S818 Chr 5 5q23.2 AGAT Simple 7–18 AC008512
CSF1PO Chr 5 5q33.1 TAGA Simple 5–16 X14720
Proto-oncogene intron
D6S1043 Chr 6 6q15 AGAT Simple 9–25 G08539
SE33 Chr 6 6q14 AAAG Complex 4.2–37 V00481
Beta actin-related pseudogene
D7S820 Chr 7 7q21.11 GATA Simple 5–16 AC004848
D8S1179 Chr 8 8q24.13 TCTA/TCTG Compound 7–20 AF216671
D10S1248 Chr 10 10q26.3 GGAA Simple 7–19 AL391869
TH01 Chr 11 11p15.5 TCAT Simple 3–14 D00269
Tyrosine Hydroxylase intron
STR Typing and Available Multiplex Kits Including Validation Methods
(continued)
32
STRs small size (2–6 bp repeat) allows easy PCR amplification in multiplex
assays, without the problem of differential amplification. Tetranucleotide STR
repeats are generally preferred to dinucleotide or trinucleotide repeats, while
pentanucleotide and hexanucleotide repeats are less frequently used because they
are less diffused in the human genome. A common problem with STR typing is the
presence of stutters peaks that are produced by Taq-Polymerase slippage during
PCR amplification. Stutters have generally one repeat unit smaller than the true allele
(n 1), but sometimes they show one repeat larger (n + 1). Stutter percentage varies
from locus to locus: in tetranucleotides it’s generally less than 15% of the main
allele, while with dinucleotides or trinucleotides it may increase till to 30% or more.
This makes mixture interpretation very difficult especially when working with low
or degraded DNA samples (Sparkes et al. 1996a, b).
2.4 Mini-STRs
DNA from forensic evidences, found for example at crime scene or in missing
person identifications caseworks, is often in limited quantity or show high degrada-
tion due to the exposition to harsh environmental factors (humidity, heat, UV, etc.)
or to microorganism’s effect. When degradation occurs, DNA is cleaved in small
fragments (average range 80–200 bp) and PCR primers may fail in annealing with
the target regions. In these cases, standard STRs typing may be not produce results or
yields only partial profiles: in fact as DNA molecule fragmentation increases,
dropout of the larger STR loci occurs and this produces a loss of information mainly
from larger PCR products. The problem obviously is enhanced when using large
multiplex PCR, due to the wide size range of amplicons produced (Hill et al. 2008;
Coble and Butler 2005).
Partial DNA profiles unfortunately cannot provide the same discrimination power
than full profiles and often do not give enough information able to include or exclude
an individual as a donor of a sample. The recovery of data from these difficult
samples may be increased analyzing smaller STRs named Mini-STRs. Mini-STRs
were used for the first time during the identification of the World Trade Center
victims: in fact, even if most bone were analyzed by traditional STR analysis,
unfortunately many samples were in so hard conditions, because of heat, fire or
bacterial degradation, that only very poor or negative results were obtained.
In 2001 John Butler and Bruce McCord, from the National Institute of Science
and Technology (NIST), were developing new small primers with the aim to
produce PCR products smaller than the traditional ones. They obtained reduced-
size amplicons by moving the forward and reverse PCR primers very close to the
STR repeat region (Fig. 2.3). Due to this, the use of Mini-STRs increases the chance
34 A. Barbaro
of amplification for larger loci, providing a useful tool for obtaining data from
compromised samples (i.e. bones, teeth, burnt items).
In addition this technology enhances the sensitivity of DNA detection and
produces results even with inhibited or scarce DNA samples such as contact traces
left after a casual handling of objects (“touch DNA”) or cold cases samples,
previously not useful for a DNA test. Another important advantage is that DNA
profiles obtained by typing Mini-STRs are compatible with DNA profiles of samples
processed using traditional STR multiplexes: this allows comparison with old
profiles already stored in national databases.
STRs analysis originally involved silver-stain detection of PCR amplicons after their
separation by gel electrophoresis, but the introduction of a laser multicolour fluores-
cence detection greatly revolutionized DNA typing. To allow laser detection, in each
marker, a fluorescent label is added to the 50 end of one of the PCR primers: this
permits analyzing different markers in the same PCR tube. Nowadays till to five
different fluorescent dyes may be now used for labelling primers, while another
different fluorescent colour is reserved for the internal size standard (Gill et al. 1995).
The ability to amplify multiple STR markers using fluorescent-labelled PCR
primers together with automated laser detection increases the amount of information
collected from a sample. Obviously an accurate selection of different fluorescent dye
colours is required in order to avoid overlapping between PCR products with the
same allele size range, to reduce spectral overlap between dye colours and to ensure
full compatibility with instrumental detection. In comparison with standard silver-
stain detection, less DNA sample is necessary to obtain results from multiplex
amplification; in addition labour-time and cost are reduced since multiple loci are
analyzed in parallel in the same assay, allowing high-throughput analysis (Kimpton
et al. 1994).
In 1994, the Forensic Science Service (FSS) introduced the first-generation
quadruplex that included TH01, vWA, FES/FPS, and F13A1 markers. The discrimi-
nation power of this first multiplex was approximately 1 in 10,000. Due to the low
PD value several efforts were done in order to build a larger multiplex. Then, when
in April 1995 the UK National DNA Database started, the SGM system including
seven STR database core loci (VWA, D8S1179, D21S11, D18S51, TH01, FGA,
D3S1358, D16S539, D2S1338 and D19S433) was developed. In October 1998 FBI
launched USA National DNA Index System (NDIS) including 13 core STR loci
(TH01, vWA, FGA, D8S1179, D18S51, D21S11, CSF1PO, TPOX, D3S1358,
D5S818, D7S820, D13S317 and D16S539) (Werrett 1997; Budowle et al. 1998).
Starting from 1998 a second generation multiplex named SGM Plus was used for
the UK database: SGM Plus kit had eight loci (FGA, TH01, VWA, D3S1358,
D8S1179, D16S539, D18S51 and D21S11) in common with CODIS and included
as additional markers D2S1338, D19S433 and Amelogenin for sex determination.
The discrimination power for SGM Plus was around 1 in 13 trillion for African-
Americans and 1 in 3.3 trillion Caucasian Americans, while the PI for CODIS loci
was around 1.14 1015 for African-Americans and 2.97 1015 for Caucasians.
Once core loci were established, commercial multiplex began to be developed
allowing initially simultaneous amplification of few loci and then of more markers
till to large multiplexes which are now commonly used in forensic laboratories.
36 A. Barbaro
ladder is used for genotype determination: it’s a mixture of all the alleles available
for a particular STR marker and hence it’s artificially obtained by combining DNA
from individuals which have different alleles, representatives of the locus variations
in the population. According to the recommendations of the ISFG DNA Commis-
sion, allelic ladder sequencing is required. Alleles from investigated loci are assigned
by a comparison with ladder alleles even if rare size variants may be found, showing
intermediate mobility respect to ladder alleles. A representative STR DNA profile is
given in Fig. 2.4.
Before to introduce a new kit, obviously manufacturers spend time and resource
in research, thus the advantage for forensic labs in the use of commercial
multiplexes, is the possibility to work with robust STR multiplex assays, in already
optimized and validated reaction protocols using carefully designed and well bal-
anced primers, labelled in adequate different fluorescent-dye combinations.
in the USA and Canada. They developed the guidelines for the validation of DNA
analysis procedures, in accordance with the FBI Director’s Quality Assurance
Standards (QAS) (FBI 2004).
Initially, in 1998, the Federal DNA Advisory Board recommended quality assur-
ance standards to the FBI Director and then the SWGDAM (that replaced
TWGDAM) was charged with this responsibility. Two types of validation (each
one involving several studies) are required to assess new forensic DNA
technologies: developmental and internal. Obviously the laboratory should evaluate
which validation studies are more relevant for the procedure tested and it should
establish the right number of samples required for each study (SWGDAM 2010,
2001).
Guidelines describe the main studies that should be performed by the manufacturer
during the developmental validation process in order to evaluate if methods are
effectively reliable and to establish which are the conditions and the limitations of
the new DNA methodology prior to be effectively introduced in forensics.
According to SWGDAM recommendations, main studies include: Species Specific-
ity, Sensitivity Studies, Precision and Accuracy (Repeatability and Reproducibility),
Mixture Studies. In addition the method performance on some caseworks-like
samples should be evaluated and population studies should be done to create a
population database for the main populations groups (Table 2.5).
40 A. Barbaro
Table 2.5 Main studies required for developmental validation (SWGDAM 2010)
Study Description
Species Ability to detect nonhuman DNA
specificity
Sensitivity Evaluation of the assay range useful to obtain reliable results and
determination of the upper and lower detection limits
Stability Ability to obtain results from biological samples placed on different substrates
Precision Degree of agreement among a series of measurements, values or results
Accuracy Degree of conformity of a measured quantity to its real value
Repeatability Precision and accuracy of results of the same operator or instrument
Reproducibility Precision and accuracy of results among different operators or instruments
Mixture studies Ability to obtain reliable results from mixed samples
Case-type Ability to obtain reliable results using samples that are representative of real
samples laboratory samples.
Population Distribution of genetic markers in relevant population groups
studies
Since the first introduction of DNA typing in 1987, in the last 30 years an enormous
growth has occurred in the use of DNA test either in criminal investigations than in
paternity testing, missing person’s identification, mass disasters (DVI). In particular,
the use of the polymerase chain reaction (PCR) and of large multiplexes allows to
analyze samples in a short time, offering the possibility to obtain useful DNA
profiles and conclusive results from a wide range of biological evidences even if
degraded or in scarce quantity.
Because of this, annually forensic laboratories perform hundreds of test and DNA
typing represents the most powerful tool for identification.
In fact main applications of DNA typing include:
2 STR Typing and Available Multiplex Kits Including Validation Methods 41
Table 2.6 Main studies required for internal validation (SWGDAM 2010)
Study Description
Sensitivity Determination of the target range, limit of detection,
heterozygote balance (e.g. peak height ratio) and the signal to
noise ratio.
Stochastic Evaluation of stochastic effects obtained from the analysis of
low quantity/quality DNA samples.
Precision Degree of agreement among a series of measurements, values
or results
Accuracy Degree of conformity of a measured quantity to its real value
Repeatability Precision and accuracy of results of the same operator or
instrument
Reproducibility Precision and accuracy of results among different operators or
instruments
Mixture studies Ability to obtain reliable results from mixed samples
Contamination Detection of exogenous DNA in reagents, consumables,
samples and laboratory environment
Known, non-probative or mock Results from these samples should be compared with data
evidence samples previously obtained from the same samples to ensure
concordance
1. Forensics Caseworks
Biological samples are recovered at crime scene and genotyped: evidences DNA
profiles are compared between them or with the ones of known people
(i.e. victim, suspect) or with data in national DNA databases in order to find a
match useful to identify the evidence donor and to link different caseworks.
2. Personal Identification
DNA test is the best method to establish the identity of a person, especially in
cases of mass disasters (DVI) or missing persons identification when only parts of
bodies (i.e. bones, teeth) are available.
3. Biological Relationship
Due to the inheritance modality, DNA analysis is routinely used for paternity/
maternity test, kinship analysis as well as to reconstruct complex relationships or
entire family pedigree.
References
Bär W, Brinkmann B, Lincoln P, Mayr W, Rossi U, Budowle B, Eisenberg A, Fourney R, Gill P,
Rand S (1992) Editorial: recommendations of the DNA Commission of the International Society
for Forensic Haemogenetics relating to the use of PCR-based polymorphisms. Forensic Sci Int
55:1–3
Bär W, Brinkmann B, Budowle B, Carracedo A, Gill P, Lincoln P, Mayr W, Olaisen B (1997) DNA
recommendations. Further report of the DNA Commission of the ISFG regarding the use of
short tandem repeat systems. Forensic Sci Int 87(3):179–184
42 A. Barbaro
Budowle B, Moretti TR, Niezgoda SJ, Brown BL (1998) CODIS and PCR-based short tandem
repeat loci: law enforcement tools. In: Proceedings from the Second European Symposium on
Human Identification
Butler JM (2001) Forensic DNA typing: biology, technology, and genetics of STR. Academic
Press, Elsevier
Butler JM (2012) Advanced topics in forensic DNA, typing methodology. Academic Press, Elsevier
Butler JM, Shen Y, Mc Cord BR (2003) The development of reduced size STR amplicons as tools
for analysis of degraded DNA. J Forensic Sci 48:1054–1064
Butler JM, Hill CR (2012) Biology and genetics of new autosomal STR loci useful for forensic
DNA analysis. Forensic Sci Rev 24:15
Carracedo A, Lareu MV (1998) Development of new STRs for forensic casework: criteria for
selection, sequencing and population data and forensic validation. In: Proceedings of the Ninth
International Symposium on Human Identification, pp 89–107
Coble MD, Butler JM (2005) Characterization of new MiniSTR loci to aid analysis of degraded
DNA. J Forensic Sci 50:43–53
FBI (2004) Quality assurance standards for forensic DNA testing laboratories. Revised validation
guideline—scientific working group on DNA analysis methods (SWGDAM). Forensic Sci
Commun 6(3):1
Gill P, Kimpton CP, Urquhart A, Oldroyd N, Millican ES, Watson SK, Downes TJ (1995)
Automated short tandem repeats (STR) analysis in forensic casework - a strategy for the future.
Electrophoresis 16:1543–1552
Gill P, Fereday L, Morling N, Schneider PM (2006) The evolution of DNA databases. Forensic Sci
Int 156(2–3):242–244
Guo F et al (2014) Development of a 24-locus multiplex system to incorporate the core loci in the
Combined DNA Index System (CODIS) and the European Standard Set (ESS). Forensic Sci Int
Genet 8(1):44–54
Hares DR (2012) Expanding the CODIS core loci in the United States. Forensic Sci Int Genet 6:
e52–e54
Hill CR, Kline MC, Coble MD, Butler JM (2008) Characterization of 26 MiniSTR loci for
improved analysis of degraded DNA samples. J Forensic Sci 53:1
Jeffreys AJ, Wilson V, Thein SW (1984) Hypervariable ‘minisatellite’ regions in human DNA.
Nature 314:67–73
Jeffreys AJ, Wilson V, Thein SL (1985a) Individual-specific ‘fingerprints’ of human DNA. Nature
316:76
Jeffreys AJ, Brookfield JF, Semeonoff R (1985b) Positive identification of an immigration test-case
using human DNA fingerprints. Nature 6:317
Jin L, Zhong Y, Chakraborty R (1994) The exact numbers of possible microsatellite motifs. Am J
Hum Genet 55:582–583
Kimpton C, Fisher D, Watson S, Adams M, Urquhart A, Lygo J, Gill P (1994) Evaluation of an
automated DNA profiling system employing multiplex amplification of four tetrameric STR
loci. Int J Legal Med 106:302–311
Mullis K (1990) The unusual origin of the polymerase chain reaction. Sci Am 262(4):56–61. 64
Schumm JW, Gutierrez-Mateo C, Tan E, Selden R (2013) A 27-locus STR assay to meet all United
States and European law enforcement agency standards. J Forensic Sci 58(6):1584–1592
Scientific Working Group on DNA Analysis Methods (2010) Interpretation guidelines for autoso-
mal STR typing by forensic DNA testing laboratories. Approved at the Scientific Working
Group on DNA Analysis Methods meeting, Fredericksburg, Virginia, January 2010
Scientific Working Group on DNA Analysis Methods (SWGDAM) (2001) Training guidelines.
Forensic Sci Commun 3(4):1
Southern EM (1975) Detection of specific sequences among DNA fragments separated by gel
electrophoresis. J Mol Biol 98:503–517
Sparkes R, Kimpton C, Watson S, Oldroyd N, Clayton T, Barnett L, Arnold J, Thompson C,
Hale R, Chapman J, Urquhart A, Gill P (1996a) The validation of a 7-locus multiplex STR test
2 STR Typing and Available Multiplex Kits Including Validation Methods 43
for use in forensic casework (I) Mixtures, ageing, degradation and species studies. Int J Legal
Med 109:186–194
Sparkes R, Kimpton C, Gilbard S, Carne P, Andersen J, Oldroyd N, Thomas D, Urquhart A, Gill P
(1996b) The validation of a 7-locus multiplex STR test for use in forensic casework
(I) Artefacts, casework studies and success rates. Int J Legal Med 109:195–204
Werrett DJ (1997) The national DNA database. Forensic Sci Int 88:33–42
Sequential Advancements of DNA Profiling:
An Overview of Complete Arena 3
Kriti Nigam, Ankit Srivastava, Subhasish Sahoo, I. P. Dubey,
I. P. Tripathi, and Pankaj Shrivastava
Abstract
Keywords
DNA profiling · STRs · DNA markers · NGS
K. Nigam · A. Srivastava
Dr. APJ Abdul Kalam Institute of Forensic Science and Criminology, Bundelkhand University,
Jhansi, UP, India
S. Sahoo
DNA Profiling Unit, State Forensic Science Laboratory, Bhubaneswar, Odisha, India
I. P. Dubey
DNA Profiling Unit, State Forensic Science Laboratory, Bhubaneswar, Odisha, India
Faculty of Science and Environment, MGCGV, Satna, Madhya Pradesh, India
I. P. Tripathi
Faculty of Science and Environment, MGCGV, Satna, Madhya Pradesh, India
P. Shrivastava (*)
DNA Fingerprinting Unit, State Forensic Science Laboratory, Department of Home (Police),
Government of Madhya Pradesh, Sagar, Madhya Pradesh, India
3.1 Introduction
monozygotic twins who have same autogram. Shortly after its development, in 1986,
the technique of DNA profiling was first utilized in solving a criminal case. Colin
Pitchfork, a U.K. resident, was convicted of a double rape and murder because his
DNA profile matched with DNA found at both crime scenes (Jobling and Gill 2004).
Through RFLP, paternity can be excluded with a cumulative probability greater than
99.9% with the use of as few as four probes (Jeffrys et al. 1987) likewise 3–5 probes
can provide an individualized fingerprint in forensic testing (Alghanim and Almirall
2003). Sequences of VNTR serve as the basis for fingerprinting. For many years
RFLP technique served criminal justice system by resolving paternity disputes,
ascertaining criminal identity, studying evolution and migration of wildlife, studying
breeding patterns in animal populations and the detection, etc. However, require-
ment to large quantity of good quality sample, being expensive, tedious and time
consuming, were certain limitations associated with this technique. This leads to the
need of discovery of more efficient and advance techniques of DNA profiling.
3.3.1 Denaturation
This is the first step of PCR amplification in which helix of DNA unwinds to separate
the two strands of DNA by raising the temperature up to 98 C. Now each strand acts
as a template for synthesizing new strand. Ingredients of this step are a primer (like
probes of RFLP), base pairs and a heat stable DNA polymerase usually Taq
polymerase.
3.3.2 Annealing
Primers have been named so because they mark the initial location for the synthesis
of new strand of DNA.
3.3.3 Elongation
In this step, DNA polymerase came into play. Temperature of reaction mixture is
again raised to approximately 75–80 C and Taq polymerase add new nucleotides to
the primer complementary to parent strand.
In order to ascertain whether the desired DNA fragment has been amplified or not
(also known as amplicon or amplimer), agarose gel electrophoresis may be
performed. Results are then compared with molecular weight markers which contain
fragments of DNA of identified size.
HLA stands for human leukocyte antigens—a group of proteins, located on the outer
membrane of all the nucleated cells of our body. Genes of these antigens are
positioned on sixth chromosome. Major histocompatibility complex (MHC) is the
generic name of the genetic province to which HLA loci belong (Hugh et al. 1984).
The MHC contains genes (including HLA) that are liable for immune responses of
body. HLA antigens perform vital task in self-recognition and discriminating self
from non-self. HLA antigens thus, crucially strategize defense mechanism against
foreign substances. Every individual possess a unique set of HLA proteins inherited
from his parents. The first typing method that was used to detect HLA alleles was—
the hybridization of sequence specific oligonucleotide (SSO) probes with
PCR-amplified DNA. Researchers have suggested various alternative SSO typing
methods, chiefly varying on the length, sequence of probes, and their methods of
detection. Initially, P32 SSO probes were used to hybridize with the desired region of
HLA-DQA gene (Saiki et al. 1986a), but shortly afterwards biotin emerge out as an
alternative of conventional P32 label (Saiki et al. 1987). The PCR-SSO technique
was later applied to other allelic sequences also like DP (Bugawan et al. 1988), DQ
(Horn et al. 1988; Morel et al. 1990) and DR (Erlich et al. 1989; Baxter-Lowe et al.
1989).
Although SSO technique is appropriate for investigation of large sample sizes but
it is not a method of choice for analysis of small number of samples. Reverse dot
blotting technique emerged out as a solution of this problem. Procedurally, it
employs same PCR amplification procedure and SSO probes, but these probes are
adhered to a solid support medium. The sample so amplified is labeled and
hybridized on that supporting panel. A single hybridization and stringency wash
permits the determination of polymorphic sequences of the selected sample. Conju-
gate streptavidin horseradish peroxidase is used to detect positive reaction by having
3 Sequential Advancements of DNA Profiling: An Overview of Complete Arena 49
AFLP is a fingerprinting technique based on PCR, which was explained for the first
time by Vos et al. (1995). Then after, many protocols have been declared from time
to time suggesting various modifications, all including following three basic steps:
(1) restriction endonucleases are employed in digesting genomic DNA, forming
DNA fragments along with its ligation to double-stranded adaptors with known
adaptor sequences, comprising of two nucleotides; (2) these DNA fragments are
specifically amplified using primers complementary to adaptor sequences and the
unknown genomic DNA; and (3) labeled fragments are separated by electrophoresis
followed by silver staining (Fry et al. 2009). Fragmented samples are then subjected
to automated analysis. Locus D1S80, with repeat size of 16 bp, is a popular choice
for DNA fingerprinting (Thymann et al. 1993). However, other available choices
include YNZ22, Apolipoprotein-B, and Collagen 2A1 (De Guglielmo et al. 1994).
AFLP profiling can discriminate between illicitly grown marijuana and hemp (Coyle
et al. 2003; Datwyler and Weiblen 2006; Hakki et al. 2003), identify illegal halluci-
nogenic fungi (Coyle et al. 2001; Lee et al. 2000; Linacre et al. 2002), legally
protected owls species and their hybrids (Haig et al. 2004). This automation is the
biggest advantage of this technique allowing a trouble free comparison of DNA
samples in an economic manner.
In spite of the triumph of PCR-based AFLPs, in 1990s there was a switch to PCR of
short tandem repeats (STRs); a technique that utilizes too small repeat units, with a
length of just 2–7 bp. STRs are named as microsatellites or simple sequence repeats.
Since their discovery, they are often referred as ‘gold standard’ in personal identifi-
cation in forensic context. STRs alternatively known as microsatellites are short
repeats of DNA sequences having repetitive units ranging from 1 to 6 bp (Chambers
and MacAvoy 2000; Tautz 1993), entire length ranging up to 100 nucleotides. STRs
are usually located near centromere of chromosome. Another category of these
sequence repetitions is not so long i.e., it consists of 2–6 bp repeats only—popularly
known as minisatellites. This small length of repeat unit makes them capable of
easier amplification. Additionally, they also have a relatively higher resistance to the
problems associated with degraded and contaminated DNA. Nucleotide sequence
mutation might be the probable reason of these variations. STRs are present in both
50 K. Nigam et al.
pro and eukaryotes, including human beings. They are somewhat evenly scattered all
through human genome, consisting about 3% part of the entire genomic structure.
But within chromosomes, they are not so uniformly distributed (Koreth 1996).
Exploration of noncoding regions revealed that majority of STRs is found in those
regions which do not code for any protein. Only about 8% of STRs are positioned in
the coding regions (Ellegren 2000). Length of such repeated units vary among
individuals which is their most significant aspect from forensic point of view. Not
only their length but their densities also vary among chromosomes. Nineteenth
chromosome is found to have highest density of STRs in humans (Subramanian
2003). An individual can be either homozygous i.e., with same number of repeat
units or heterozygous i.e., with different number of repeat units at a certain locus.
Tetranucleotide repeats, abundant in Adenine (A) are used in forensic genotyping
(Goodwin et al. 2011; Nadir 1996). DNA Commission of the International Society
of Forensic Genetics (ISFG) in 1993 assigned nomenclature to STR loci and its
allelic variants. The STR loci are named in a peculiar manner, for example, D1S80,
where D refers to DNA, 1 signifies the chromosome number where on STR locus is
located, S refers to STR, and 80 is its exclusive identifier signifying position of the
repeat i.e., 80th on the 1st chromosome. Name of STRs are given on the basis of base
composition of the repeat unit (in parenthesis). After that the number of times of its
repetition is mentioned in subscript, e.g., (GTA)4, a trinucleotide STR having
sequence GTA is repeated 4 times. The first STR was discovered in the year 1991.
In 1994 only four loci namely, F13A1, THO1, Vwa and FES/FPS were available
(Kimpton et al. 1994; Lygo et al. 1994) but within a year this number got extend to
seven (Gill et al. 1997; Kimpton et al. 1996; Sparkes et al. 1996a, b). By the end of
2000, number of available STR multiplex increased to 16 including amelogenin—a
sex determining marker (Krenke et al. 2002). Today more than 20 STR multiple
systems are available commercially for DNA typing. STR is found to be more
sensitive in comparison to conventional single-locus RFLP methods and more
discriminating when compared to other PCR-based profiling techniques, like
HLA-DQA1 (Saiki et al. 1986b). Since then several researchers have been
conducted researches in this field studying different populations for developing
different standardized protocols across the globe (Butler 2005). Main advantages
of the STRs markers are that by multiplexing, they can test more than ten STR loci in
fast, simple, and simultaneous way (Morretti et al. 2001). Classification of STRs is
made on the basis of length of their repeat units i.e., mononucleotides, dinucleotides,
trinucleotides, and so on. However, tetranucleotides are utilized most due to the
reason of minor stutter products probability, amplicons having one repeat less than
true allele (Romeika and Yan 2013). In multiplex analysis kits, tetra- and
pentanucleotide systems are also incorporated due to their ability to offer results
with an augmented exclusion index. Multiplexing aids simultaneous analysis of
several different loci. This does not merely save time, but also saves the evidences
by utilizing a lesser sample size. Current trends of DNA profiling use multi-allelic
STR markers which not only have structural comparability with original
minisatellites but have much shorter repeats which makes them easier to amplify
using PCR. The Federal Bureau of Investigations (FBI) in 1997 established a
3 Sequential Advancements of DNA Profiling: An Overview of Complete Arena 51
database named CODIS (Combined DNA Index System) that integrated amelogenin
sex loci and 13 autosomal loci in the process of development of STR Typing System
(Sullivan et al. 1993). These 13 STR loci set have efficient distinguishing abilities
having an average probability of random match one in a quadrillion (1 10 15),
which further extended to 20 markers (Budowle et al. 1998) while the standard set of
Europe consisted of 12 STR markers (Gill et al. 2006). These loci are located on
different chromosomes in form of highly polymorphic noncoding regions. Together
with amelogenin, new multiplexes have been introduced in a single reaction within
past few years that can amplify even more than 16 loci (Dixon et al. 2005). STR
profiling has numerous applications including parentage testing, identification of
disaster victims, rape felon’s identification, and many more (Yoshida et al. 2011).
Butler et al. offered a summary of each STR marker (24 forensic autosomal STR
loci) including their classification, length of repeat unit, chromosomal location,
region of STR repeats, etc. (Butler and Hill 2012).
The application of STR multiplexing method to the biological evidences has
changed the entire scenario of our justice system dealing with different heinous
crimes. Multiplex PCR with fluorescently labeled primers has become a vital method
adopted for short tandem repeat’s amplification having applicability in testing
individual identity. STRs have popularly become the preferred markers for various
applications of human identification (HID) due to their unique and polymorphic
nature (Butler 2006). Measurement of length of different variable alleles is the
foundation of individualization by STR profiling (Giardina et al. 2011). Due to its
higher accuracy rate, STR Marker technology has become applicable in routine
criminal investigations. In fact, this is one among the most responsive and exten-
sively acknowledged techniques of scientific community. In the investigative proce-
dure of various offences like manslaughter, assassination, rape, kidnapping, etc.,
STR profiling is a frequent technique today. But the capillary electrophoresis
(CE) based DNA fragment size detection technique is not capable of distinguishing
between alleles of different sequences but of similar lengths in complex paternity
cases based on STR mutation. The upcoming NGS technology can discriminate
these alleles and also helps in identifying mixed samples (Berglund et al. 2011).
Autosomal STRs are greatly used by forensic science laboratories for human
identification as well as for human kinship determination. However, in some com-
plex cases based on kinship relationships, the results of autosomal STRs may be
inconclusive. Consequently, the analysis of STRs located on sex chromosomes came
into play (Roewer 2003).
52 K. Nigam et al.
Y-STRs are short tandem repeats located on Y chromosome and thus, are male
specific. Polymorphic nature of Y chromosome plays a crucial role in differentiating
unrelated males as well as proving lineage in paternal generations (Coble et al.
2009). Forensic significance of these Y-STRs lies in the fact that besides being male
specific, they have a low mutation rate and have specific population allele distribu-
tion (Kayser et al. 2001, 2005, 2007; Kayser 2003). Y-STR is a brilliant way to
recognize male DNA which often gets mixed with female DNA in offences involv-
ing sexual assaults (Kayser 2017; Roewer 2009; Prinz et al. 1997). In such instances,
autosomal STR typing is often complicated or sometimes even unfeasible to give
conclusive results. Detection capabilities of Y-STR for male DNA mixed with
female DNA samples is also far above any discrepancy i.e., 1:2000 (Ballantyne
and Kayser 2013). Presently existing commercial Y-STR m are much vigorous and
even male mixed samples (Gang rape cases), samples contaminated with different
biological fluids, aged and degraded samples could be analyzed successfully
(Brenner 2010). Not only fixing the guilty, Y-STR typing is also important in
exonerating the innocent in false accusations. Despite of numerous advantages,
Y-STR possesses some limitations as well i.e., it represents a single locus and it
requires large databases for study (Willuweit et al. 2011; Ballentyne et al. 2010).
Inability of exclusion of paternally related suspects lowers its credential in compari-
son to autosomal STRs. However, the possible answer of this limitation emerges out
in terms of rapidly mutating Y-STRs (RM Y-STRs). These STRs have high rates of
mutation and thus, can potentially differentiate paternally related suspects
(Ballentyne et al. 2012; Roewer et al. 1992). If we go back in history of Y-STRs,
it was first described by Rower and Epplen in 1922 (Davis et al. 2013). Since then
several advancements have taken place. Various Y-STR kits are now available
commercially. However, two most commonly used ones are PowerPlex® Y23
(Promega Corporation) and Yfiler® Plus PCR Amplification Kit (Thermo Fisher
Scientific, USA). PowerPlex® Y23 employs 17 traditional Y-STR loci along with six
new loci including DYS481, DYS533, DYS549, DYS570, DYS576, and DYS643,
thereby enhancing its discriminating power (Jain et al. 2016; Thompson et al. 2013).
3 Sequential Advancements of DNA Profiling: An Overview of Complete Arena 53
Fig. 3.1 Steps involved in Y screening for determining the male fractions
On the other hand, Yfiler® Plus PCR Amplification Kit allows multiplex amplifica-
tion of 27 Y-STRs including seven RM Y-STRs (Fig. 3.1).
enzymes and proteins required for proper functioning of mitochondria. It codes for
13 proteins, 2 rRNA, and 22 tRNA. Mitochondrial genome imparts its forensic
significance due to its stability and multiple copies. mtDNA in mammals has two
different points of origin of replication. The point of origin of heavy chain is usually
guanine rich and is located within D-loop (Displacement Loop). However, in
contrast to this, point of origin of light chain is usually cytosine rich and is located
nearly opposite to D-loop. The current region of forensic interest is D-loop (Pai et al.
1997). Approximately 1100 bp constitute the noncoding hypervariable regions of
D-loop. This region is named so because of its higher rate of mutation in comparison
to other regions of mtDNA (Quintans et al. 2004). This region is further subdivided
into HV1, HV2, and HV3 regions with position range from 16,024 to 16,365, 73 to
340, and 438 to 574, respectively. From forensic point of view HV3 is rarely
targeted, commonly HV1 and HV2 are examined. mtDNA obtained from calcified
tissues and hair could be a potential tool of personal identification especially in cases
of mass disasters where evidences obtained are often environmentally challenged
(Kavlick et al. 2011). Despite all aforementioned advantages, the biggest challenge
associated with the analysis of mtDNA is the interpretation of heteroplasmy. It refers
to existence of different mtDNA haplotypes within a person (Bar et al. 2000).
However, many researchers consider this phenomenon as a rare event (Payne et al.
2013). Various degraded samples can be analyzed by mitochondrial DNA Analysis
like the hairs without root, teeth, skeletonized remains and various types of
biological material which are degraded environmentally which cannot be processed
by nuclear DNA Analysis. From very less quantity of samples, DNA can be detected
and thus, maternal lineage can be established.
(Sheshanna et al. 2014). This method is utilized for entire mtDNA sequencing
coupled with targeted re-sequencing. Method incorporates preparation of sample,
emulsion PCR and preparation of substrate, basic chemistry of ligation along with
imaging and data analysis. Solid sequencing is an encoding system consisting of two
bases having an accuracy rate of 99.94% (Kircher and Kelso 2010), adequate for
abundant samples to identify SNPs. For last decade, next generation sequencing
(NGS) by Illumina has become widely acceptable. NGS provides a unified platform
to prevail over the extensive range of complicated samples encountered. Genetic
analysis of evidences of mass fatality with NGS let scientists to take out vital
informations even from compromised samples. It is possible to get clue of mutations
and SNPs from the whole genome sequencing where several suspects and victims
are involved. The sequencing can be performed on compromised samples such as
preserved tissues; blood exposed to different temperatures, samples of hair, etc. In
comparison to other techniques tested in laboratories, multiplex mini sequencing of
mtDNA provides elevated rate of success (Kinra 2006).
Autosomal STRs have been used utilized for forensic services long before the
Y-STR and X-STR markers. But these X- and Y-STR markers offer the potential
to provide additional information which autosomal STRs fail to accomplish. The
first major breakthrough in the field of X chromosomal markers was done by Race
and Sanger, when they detected Xga blood group (Tippett and Ellis 1998). Females
have a homologous pair of X chromosome. The use of X-STRs is highly proficient
for determination of kinship especially between father and daughter by increasing
the power of discrimination. In contrast to this, in cases related to questioned
mother–daughter relationships, X chromosome markers fails to provide any specific
information, just like autosomal STRs. In case of mixed stains especially in rape
cases, X-STRs can positively identify female DNA (Shin et al. 2005; Szibor et al.
2000). In reference of X-STR, in the first multiplex study nine loci were analyzed
(in three different multiplexes) including duplex PCR (DXS6789 and DXS6795),
Triplex PCR (DXS7133, DXS9895, and DXS9898), and Quadruplex PCR
(GATA164A09, DXS6803, DXS8378, and DXS7132) (Son et al. 2002). The greater
the number of markers, higher will be degree of discrimination. Currently more than
40 X-STR markers have been identified for forensic purposes (Jedrzejczyk et al.
2010; Machado and Medina-Acosta 2009; Szibor 2007; Szibor et al. 2006).
Since 2005, next generation sequencing (NGS) most commonly referred to, mas-
sively parallel sequencing (MPS) has substantially changed the horizon of genomic
research. NGS is a ‘non-Sanger sequencing’ method that can simultaneously
sequence billions of DNA molecules to minimize the fragment cloning (Yang
56 K. Nigam et al.
et al. 2014; Aly and Sabri 2015; Mostafa et al. 2015). This sequencing technique
works on loop array sequencing that can simultaneously analyze huge data. Several
commercial systems have been introduced based on this sequencing process. This
vital technology has developed in following three sequencing generations:
STR analysis is mainly carried out via separation of DNA through capillary
electrophoresis (CE) based on size of DNA (Butler 2012). Although capillary
electrophoresis fails due to detect internal sequence variation in STR alleles. This
STR allele sequence variation is currently considered to be very crucial in different
cases having traces or compromised DNA samples. Some significant techniques
such as mass spectroscopy and next generation sequencing (NGS) have presently
been used in forensics to learn and recognize the possible the variations in internal
sequence of STR alleles (Pitterl et al. 2010; Planz et al. 2012; Rockenbauer et al.
2014a). Analysis of variation in STR sequence is these days becoming even more
imperative as this will enhance the discrimination of individuals in mixed DNA
samples.
NGS is the key of revealing and exactly identifying STR allele variations. The
CE-based STR assay may identify the alleles as per their relative size in comparison
to a sequenced allelic ladder, albeit variations in internal sequence may exist
(Gettings et al. 2015). An in-depth evaluation of sequence variation of STR alleles
can be made by using by NGS technology. However, such result should be
3 Sequential Advancements of DNA Profiling: An Overview of Complete Arena 57
Several limitations of present CE-based analysis are there which prompted the
forensic fraternity to discover the utility of NGS technology in criminal justice
system. Limitations of existing system includes loss of crucial genomic information
from compromised DNA samples, low-resolution genotyping of current markers,
low-resolution mixture and mtDNA analysis and inability to analyze manifold
genetic polymorphisms using a single workflow in a single reaction. NGS has
revolutionized the existing genomic research by exceptionally improving the time,
speed, cost, accuracy, and sequence length (Berglund et al. 2011; Dalsgaard et al.
2013; Fordyce et al. 2011, 2015; Gelardi et al. 2014; Phillips et al. 2014;
Rockenbauer et al. 2014b; Scheible et al. 2014). The supremacy of NGS technology
has its applications in different genetic arenas, like sex and mitochondrial
chromosomes, autosomes, etc. NGS has impending applications in numerous
aspects of research, including forensic microbiological, plant and animal analyses,
construction of DNA database, phenotypic and ancestry inference, studies of mono-
zygotic twins and species and body fluid identification. DNA sequencing is no
longer a tedious task.
58 K. Nigam et al.
Due to its utility in forensic investigations, DNA analysis has been rendered as an
important tool in criminal justice system. Forensic DNA analysis is often encoun-
tered with limited, contaminated and highly degraded samples, and the need of the
hour is reproducibility, higher precision as well as consideration of time and cost
factors.
Neste et al. established a reference allele database using Illumina’s MiSeq system to
detect mixed and single source DNA samples; they found that genotyping results of
most locus were reliable and stable (Van Neste et al. 2014). NGS technology thus,
can considerably assist the analysis of complex and compromised DNA samples and
consequently can significantly enhance the cost-efficacy and competence of cases of
forensic interest.
Y-STR
Use of Y-STRs explicitly resolves inferential issues of paternal relationships among
male individuals and to determine male DNA mixed with high female background.
NGS technology was used to compare more than 10,000,000 nucleotides of the Y
chromosome of two males who have same ancestry before 13 generations were
compared (Xue et al. 2009). Four genetic distinctions were revealed which suggested
that Y chromosome sequencing could be used to resolve issues related to discrimi-
nation between mixed male samples offspring of the same parents. Van Geystelen
et al. used Y chromosome SNPs to develop AMY-tree and fruitfully confirmed the
variations among 118 unrelated males belonging to 109 diverse geographical
locations (Van Geystelen et al. 2013a, b). From this research, AMY-tree emerged
out as a potential tool for determining Y chromosome pedigrees and identifying
unknown Y-SNPs belonging to diverse geographical locations. NGS technology is
very useful in the Y chromosome sequencing of mixed DNA samples of male
perpetrators belong to the same parent to distinguish them individually.
2010). Another encouraging study was performed with trace blood spot samples
using bisulfate genomic DNA sequencing (Xu et al. 2012).
3.7 Conclusion
DNA profiling has brought a boom in forensic science, but it was not just an
overnight miracle. It is a bonafide result of the tireless efforts of the researchers of
this field over last several decades that DNA profiling technique has emerged and
established itself as an infallible technique for personal identification. This technique
has changed lives of many people, not only those who have been awarded time to
time in making significant contribution to this field, but also to those people who
were waiting for justice. Advancements are being made in this field at a higher pace.
NGS has undoubtedly given birth to the opportunity of extremely responsive and
high-throughput analysis. However, more work is required to fulfill this objective,
especially to overcome the problems with error rate, low-template library prepara-
tion, issues with NGS data processing and mining and type estimations. There is a
need of generation of guidelines for NGS’s applications in field of criminal justice
system. With unremitting translational efforts of forensic scientists and technical
advancements of NGS technology, it is hopefully believed that those days are not far
away when NGS technology would probably become an effortlessly available
customary practice in forensic science.
62 K. Nigam et al.
References
Alghanim HJ, Almirall JR (2003) Development of microsatellite markers in Cannabis sativa for
DNA typing and genetic relatedness analyses. Anal Bioanal Chem 376:1225–1233
Aly SM, Sabri DM (2015) Next generation sequencing (NGS): a golden tool in forensic toolkit.
Archiv Forensic Med Criminol 65(4):260–271
Ayres KL, Chaseling J, Balding DJ (2002) Implications for DNA identification arising from an
analysis of Australian forensic databases. Forensic Sci Int 129:90–98
Ballantyne KN, Kayser M (2013) Additional Y-STRs in forensic: why, which and when. In:
Jaiprakash S, Ray L (eds) Forensic DNA typing (current practices and emerging technologies).
CRC Press, Boca Raton, FL
Ballentyne KN, Goedbloed M, Fang R et al (2010) Mutability of Y-chromosome microsatellites:
rates, characteristics, molecular basis and forensic application. Am J Hum Genet 82:341–353
Ballentyne KN, Keerl V, Wollstein A et al (2012) A new future of forensic Y-chromosome analysis:
rapidly mutating Y-STRs for differentiating male relatives and paternal lineages. Forensic Sci
Int Genet 6:208–218
Bar W et al (2000) DNA commission of the International society of forensic genetics: guidelines for
mitochondrial DNA typing. Int J Legal Med 113(4):193–196
Baxter-Lowe LA, Hunter B, Casper JT, Gorski J (1989) HLA gene amplification and hybridization
analysis of polymorphism. J Clin Invest 84:613–618
Berglund EC, Kiialainen A, Syvanen AC (2011) Next generation sequencing technologies and
applications for human genetic history and forensics. Investig Genet 2:23–37
Binladen J, Gilbert MT, Bollback JP, Panitz F, Bendixen C, Nielsen R et al (2007) The use of coded
PCR primers enables high throughput sequencing of multiple homolog amplification products
by 454 parallel sequencing. PLoS One 2:e197
Bocklandt S, Lin W, Sehl ME, Sanchez FJ, Sinsheimer JS, Horvath S et al (2011a) Epigenetic
predictor of age. PLoS One 6:e14821
Bocklandt S, Lin W, Sehl ME, Sánchez FJ, Sinsheimer JS, Horvath S, Vilain E (2011b) Epigenetic
predictor of age. PLoS One 6:e14821
Bornman DM, Hester ME, Schuetter JM, Kasoji MD, Minard-Smith A, Barden CA et al (2012)
Short-read, high-throughput sequencing technology for STR genotyping. Biotechniques:1–6
Børsting C, Morling N (2015) Next generation sequencing and its applications in forensic genetics.
Forensic Sci Int Genet 18:78–89
Brenner CH (2010) Fundamental problems of forensic mathematics - the evidential value of a rare
haplotype. Forensic Sci Int Genet 4:281–291
Brenner CH, Weir BS (2003) Issues and strategies in the identification of World Trade Centre
victims. Theor Popul Biol 63:173–178
Budowle B, Moretti TR, Niezgoda SJ, Brown BL (1998) CODIS and PCR-based short tandem
repeat loci: law enforcement tools. In: Proceedings of the Second European Symposium on
Human Identification. Promega Corporation, Madison, WI, pp 73–88
Buga W, An TL, Begovich AB, Erlich HA (1990) Rapid HLA-DPB typing using enzymatically
amplified DNA and non-radioactive sequence-specific oligonucleotide probes. Immunogenetics
32:231–241
Bugawan TL, Horn GT, Long CM, Mickelson E, Hansen JA, Ferrara GB, Angelini G, Erlich HA
(1988) Analysis of HLA-DP alleleic sequence polymorphism using the in vitro enzymatic DNA
amplification of DPA and DP-loci. J Immunol 141:4024–4030
Butler JM (2005) Forensic DNA typing: biology, technology, and genetics of STR markers, 2nd
edn. Elsevier Academic Press, New York, NY
Butler JM (2006) Genetics and genomics of core STR loci used in human identity testing. J Forensic
Sci 51(2):253–265
Butler JM (2012) Advanced topics in forensic DNA typing: methodology. Elsevier Inc, Waltham,
MA
3 Sequential Advancements of DNA Profiling: An Overview of Complete Arena 63
Butler JM, Hill CR (2012) Biology and genetics of new autosomal STR loci useful for forensic
DNA analysis. Forensic Sci Rev 24:15
Buyse I, Decorte R, Baens M, Cuppens H, Semana G, Emonds MP et al (1993) Rapid DNA typing
of class II HLA antigens using the polymerase chain reaction and reverse dot blot hybridization.
Tissue Antigens 41:114
Cao Y, Wan LH, Gu LG, Huang YX, Xiu CX, Hu SH et al (2006) Heteroplasmy in human mtDNA
control region. Fa Yi Xue Za Zhi 22:190–192
Chambers GK, MacAvoy ES (2000) Microsatellites: consensus and controversy. Comp Biochem
Physiol B Biochem Mol Biol 126:455–476
Coble MD, Loreille OM, Wadhams MJ et al (2009) Mystery solved: the identification of the two
missing Romanov children using DNA analysis. PLoS One 4(3):e4838
Courts C, Madea B (2010) Micro-RNA – a potential for forensic science? Forensic Sci Int
203:106–111
Courts C, Madea B (2011) Specific micro-RNA signatures for the detection of saliva and blood in
forensic body-fluid identification. J Forensic Sci 56:1464–1470
Coyle HM, Ladd C, Palmbach T, Lee HC (2001) The green revolution: botanical contributions to
forensics and drug enforcement. Croat Med J 42:340–345
Coyle HM, Palmbach T, Juliano N, Ladd C, Lee HC (2003) An overview of DNA methods for the
identification and individualization of marijuana. Croat Med J 44:315–321
Dalsgaard S, Rockenbauer E, Gelardi C, Borsting C, Fordyse SL, Morling N (2013) Characteriza-
tion of mutations and sequence variations in complex STR loci by second generation sequenc-
ing. Forensic Sci Int Genet Suppl Ser 4:e218–e219
Datwyler SL, Weiblen GD (2006) Genetic variation in hemp and marijuana (Cannabis sativa L.)
according to amplified fragment length polymorphisms. J For Sci 51:371–375
Davis C, Ge J, Sprecher C, Chidambaram A, Thompson JM et al (2013) Prototype PowerPlex1 Y23
system: a concordance study. Forensic Sci Int 7:204–208
De Guglielmo MA, Rader JM, Bever RA (1994) Evaluation of Amp-FLP markers and summary of
PCR-based forensic casework. In: Bär W, Fiori A, Rossi U (eds) Advances in forensic
haemogenetics, vol 5. Springer, Berlin
Dixon LA et al (2005) Validation of a 21 locus autosomal SNP multiplex for forensic identification
purposes. Forensic Sci Int 154:62–77
Ellegren H (2000) Heterogeneous mutation processes in human microsatellite DNA sequences. Nat
Genet 24:400–402
Erlich HA, Scharf SJ, Long CM, Horn GT (1989) Analysis of isotypic and allotypic sequence
variation in the HLA-DRb region using the in vitro enzymatic amplification of specific DNA
segments. In: Dupont B (ed) Immunobiology of HLA. Springer, New York, NY, pp 181–187
Fordyce SL, Avial-Arcos MC, Rockenbauer E et al (2011) High-throughput sequencing of core
STR loci for forensic genetic investigations using the Roche genome sequencer FLX platform.
Biotechniques 51:127–133
Fordyce SL, Mogensen HS, Borsting C, Lagac’e RE et al (2015) Second generation sequencing of
forensic STRs using the Ion Torrent™ HID STR 10-plex and the ion PGMTM. Forensic Sci Int
Genet 14:132–140
Frumkin D, Wasserstrom A, Budowle B, Davidson A (2011) DNA methylation-based forensic
tissue identification. Forensic Sci Int Genet 5:517–524
Fry NK, Savelkoul PH, Visca P (2009) Amplified fragment-length polymorphism analysis.
Methods Mol Biol 551:89–104
Gelardi C, Rockenbauer E, Dalsgaard S, Borsting C, Morling N (2014) Second generation
sequencing of three complex STRs D3S1358, D21S11 and D12S391 in Danes and a proposal
for nomenclature of sequenced STR alleles. Forensic Sci Int Genet 12:38–41
Gettings KB, Aponte RA, Vallone PM, Butler JM (2015) STR allele sequence variation: current
knowledge and future issues. Forensic Sci Int 18:118–130
Giardina E, Spinella A, Novelli G (2011) Past, present and future of forensic DNA typing.
Nanomedicine (London) 6:257–270
64 K. Nigam et al.
Gill P, Sparkes R, Kimpton C (1997) Development of guidelines to designate alleles using an STR
multiplex system. Forensic Sci Int 89:185–197
Gill P, Werrett DJ, Budowle B, Guerrieri R (2004) An assessment of whether SNPs will replace
STRs in national DNA databases joint considerations of the DNA working group of the
European Network of Forensic Science Institutes (ENFSI) and the Scientific Working Group
on DNA analysis methods (SWGDAM). Sci Justice 44:51–53
Gill P, Fereday L, Morling N, Schneider PM (2006) The evolution of DNA databases -
recommendations for new European STR loci. Forensic Sci Int 156:242–244
Goodwin W, Linacre A, Hadi S (2011) An introduction to forensic genetics. Wiley Blackwell,
Hoboken, NJ
Grunau C, Clark SJ, Rosenthal A (2001) Bisulfite genomic sequencing: systematic investigation of
critical experimental parameters. Nucleic Acids Res 29:E65–E65
Gunnarsdottir ED, Li M, Bauchet M, Finstermeier K, Stoneking M (2011) High-throughput
sequencing of complete human mtDNA genomes from the Philippines. Genome Res 21:1–11
Haig SM, Mullins TD, Forsman ED, Trail PW, Wennerberg L (2004) Genetic identification of
spotted owls, barred owls, and their hybrids: legal implications of hybrid identity. Conserv Biol
18:1347–1357
Hakki EE, Uz E, Sag A, Atasoy S, Akkaya MS (2003) DNA fingerprinting of Cannabis sativa
L. accessions using RAPD and AFLP markers. Forensic Sci Int 136:31
Hameed IH, Jebor MA, Kareem MA (2015) Forensic analysis of mitochondrial DNA hypervariable
region HVII (encompassing nucleotide positions 37 to 340) and HVIII (encompassing nucleo-
tide positions 438 to 574) and evaluation of the importance of these variable positions for
forensic genetic purposes. Afr J Biotechnol 14(5):365–374
Hanson EK, Lubenow H, Ballantyne J (2009) Identification of forensically relevant body fluids
using a panel of differentially expressed microRNAs. Anal Biochem 387:303–314
Holland MM, McQuillan MR, O’Hanlon KA (2011) Second generation sequencing allows for
mtDNA mixture deconvolution and high resolution detection of heteroplasmy. Croat Med J
52:299–313
Horn GT, Buga Wan TL, Long CM, Erlich HA (1988) HLA class II antigens and susceptibility to
insulin-dependent diabetes mellitus. Proc Natl Acad Sci U S A 85:6012–6016
Hugh H, Fudenberg JRL, Wang A-C, Ferrara GB (1984) Basic immunogenetics, 3rd edn. Oxford
University Press, London
Irwin J, Just R, Scheible M, Loreille O (2011) Assessing the potential of next generation sequencing
technologies for missing persons identification efforts. Forensic Sci Int Genet Suppl Ser
3:447–448
Jain T, Shrivastava P, Bansal DD, Dash HR, Trivedi VB (2016) PowerPlex Y23 system: a fast,
sensitive and reliable Y-STR multiplex system for forensic and population genetic purpose. J
Mol Biomark Diagon 7:3
Jedrzejczyk M, Jacewicz R, Kozdraj A, Szram S, Berent J (2010) Application of X-STR loci in
forensic genetics. Problem Forensic Sci 82:141–150
Jeffreys AJ, Wilson V, Thein SL (1985a) Hypervariable ‘minisatellite’ regions in human DNA.
Nature 314:67–73
Jeffreys AJ, Wilson V, Thein SL (1985b) Individual-specific ‘fingerprints’ of human DNA. Nature
316:76–79
Jeffrys AJ, Brookfield JFY, Semeonff R (1987) Positive identification of a immigration test case
using human DNA fingerprints. Nature 317:818–819
Jobling M, Gill P (2004) Encoded evidence: DNA in forensic analysis. eNat Rev 5:739–752
Kavlick MF, Lawrence HS, Merritt RT, Fisher C, Isenberg A, Robertson JM, Budowle B (2011)
Quantification of human mitochondrial DNA using synthesized DNA strands. J Forensic Sci 56
(6):1457–1463
Kayser M (2003) The human Y chromosome: introduction into genetics and applications. Forensic
Sci Rev 15:78–90
3 Sequential Advancements of DNA Profiling: An Overview of Complete Arena 65
Kayser M (2017) Forensic use of Y-chromosome DNA: a general overview. Hum Genet
136:621–635
Kayser M, Krawczak M, Excoffier L et al (2001) An extensive analysis of Y-chromosomal
microsatellite haplotypes in globally dispersed human populations. Am J Hum Genet
68:990–1018
Kayser M, Lao O, Anslinger K et al (2005) Significant genetic differentiation between Poland and
Germany follows present day political borders, as revealed by Y-chromosome analysis. Hum
Genet 117:428–443
Kayser M, Vermeulen M, Knoblauch H, Schuster H, Krawczak M, Roewer L (2007) Relating two
deep rooted pedigrees from Central Germany by high resolution Y-STR haplotyping. Forensic
Sci Int Genet 1:125–128
Kimpton C, Fisher D, Watson S, Adams M, Urquhart A, Lygo J et al (1994) Evaluation of an
automated DNA profiling system employing multiplex amplification of four tetrameric STR
loci. Int J Legal Med 106:302–311
Kimpton CP, Oldroyd NJ, Watson SK, Frazier RR, Johnson PE, Millican ES et al (1996) Validation
of highly discriminating multiplex short tandem repeat amplification systems for individual
identification. Electrophoresis 17:11283–11293
Kinra SLP (2006) The use of mitochondrial DNA and short tandem repeat typing in the identifica-
tion of air crash victims. Ind J Aerospace Med 50:54–65
Kircher M, Kelso J (2010) High-throughput DNA sequencing-concepts and limitations. Bioessays
32(6):524–536
Kleppe K, Ohtsuka E, Kleppe R et al (1971) Repair replications of short synthetic DNA’s as
catalyzed by DNA polymerases. J Mol Biol 56(2):341–361
Klevan L, Horton L, Carlson DP, Eisenberg AJ (1995) Chemiluminescent detection of DNA probes
in forensic analysis. Electrophoresis 16(9):1553–1558
Koreth J (1996) Microsatellites and PCR genomic analysis. J Pathol 178:239–248
Krenke BE, Tereba A, Anderson SJ, Buel E, Culhane S, Finis CJ et al (2002) Validation of a
16 locus fluorescent multiplex system. J Forensic Sci 47:773–785
Lee JCI, Cole M, Linacre A (2000) Identification of hallucinogenic fungi from the genera Psilocybe
and Panaeolus by amplified fragment length polymorphism. Electrophoresis 21:1484–1487
Lee HY, Park MJ, Choi A, An JH, Yang WI, Shin KJ (2012) Potential forensic application of DNA
methylation profiling to body fluid identification. Int J Legal Med 126:55–62
Li M, Schonberg A, Schaefer M, Chroeder R, Nasidze I, Stoneking M (2010) Detecting
heteroplasmy from high-throughput sequencing of complete human mitochondrial DNA
genomes. Am J Hum Genet 87:237–249
Li C, Zhao S, Zhang N, Zhang S, Hou Y (2013) Differences of DNA methylation profiles between
monozygotic twins’ blood samples. Mol Biol Rep 40:5275–5280
Linacre A, Cole M, Lee JCI (2002) Identifying the presence of ‘magic mushrooms’ by DNA
profiling. Sci Justice 42:50–54
Lygo JE, Johnson PE, Holdaway DJ, Woodroffe S, Whitaker JP, Clayton TM et al (1994) The
validation of short tandem repeat (STR) loci for use in forensic casework. Int J Legal Med
107:77–89
Machado FB, Medina-Acosta E (2009) Genetic map of human X-linked microsatellites used in
forensic practice. Forensic Sci Int Genet 3:202–204
Marchi E (2004) Methods developed to identify victims of the World Trade Centre disaster. Am
Lab 36:30–36
Meissner A, Gnirke A, Bell GW, Ramsahoye B, Lander ES, Jaenisch R (2005) Reduced represen-
tation bisulfite sequencing for comparative high-resolution DNA methylation analysis. Nucleic
Acids Res 33:5868–5877
Meldrum C, Doyle MA, Tothill RW (2011) Next generation sequencing for cancer diagnostics: a
practical perspective. Clin Biochem Rev 32:177–195
Melton T, Holland C, Holland M (2012) Forensic mitochondrial DNA analysis: current practice and
future potential. Forensic Sci Rev 24:101–122
66 K. Nigam et al.
Abstract
DNA analysis is the preferred and often considered to be one of the most reliable
method in forensics and criminal investigation. Forensic DNA typing is utilised in
a wide variety of cases for proving the guilt as well as to prove innocence. From
lifting the exhibits at the crime scene or recovering the pieces of evidence from
the victim or suspect, their transportation, laboratory analysis, and reporting while
maintaining the chain of custody are the tasks which are taken care of by the
investigating agency and forensic DNA analyst. All these steps should be free
from contamination and cross-contamination. This chapter throws light on some
of the critical aspects of forensic DNA analysis, along with a few real case studies
to showcase the importance of forensic DNA examination. With practice, pre-
caution, and precision, from the inception (origin of the DNA evidence) to the end
(reporting and deposition in the court), the optimum potential of DNA evidence
from the crime scene to conviction is discussed.
Keywords
DNA fingerprinting · Chain of custody · DNA sources · DNA technology · DNA
case study · Biological evidence
4.1 Introduction
DNA is the most sensitive and reliable evidence for the assessment of personal
identity and has now become a backbone of the criminal justice system. DNA
analysis is the ‘gold standard’ of forensic science and the preferred method of
personal identification (Lynch 2003), given its exclusivity (with the exception of
identical twins) and usefulness in proving the guilt or innocence especially in sexual
assault cases. The DNA evidence which is collected from the crime scene can
identify and/or eliminate the person from the existing pool of suspects in an investi-
gation making the investigation scientific and thus more reliable. With the continual
advancement in the DNA know-how, the technology has become faster, cheaper and
more accessible. With the help of DNA databases (like Combined DNA Index
System (CODIS) and now expanded CODIS), it is possible to trace or connect the
same suspect locally, nationally, or internationally, watch list of investigating/watch
list of investigating agencies (Ashcroft et al. 2002).
DNA is also known as the ‘blueprint of life’. The information within the DNA
‘blueprint’ is coded by the series of the four different nitrogenous bases, adenine,
guanine, thymine and cytosine, on the sugar-phosphate backbone (Fig. 4.1). DNA is
the sequence of the ‘nucleotide base pairs’ that link the two strands of the double
helix which is composed of sugar and phosphate (Goodwin et al. 2007; Kaye 2007).
With the known exception of RBCs, DNA is found in all the cells of human and
Fig. 4.2 Some of the biological evidences as the potential source of DNA
In the last two decades, there have been several attempts to further work on the
lines of Locards’ Principle of Exchange (Locard 1930), which states that ‘every
touch/contact leaves a trace’ and hence, DNA of the individual would be found on
any surface that was touched/contacted (Phipps and Petricevic 2007; Daly et al.
2012; Polley et al. 2006; Allen et al. 2008). Therefore, another advancement in the
present-day DNA technique is ‘Touch DNA’. Even if a person wore gloves during
the crime, and the gloves are dumped and recovered at someplace near the crime
scene, the inner side of the gloves would be sufficient to reveal the DNA profile of
the individual (Goray et al. 2019).
Although the DNA evidence found may be aged or often degraded, but the
damage still usually would not prevent the DNA analysis. With modern
progressions, it is now possible to obtain a complete DNA profile even from highly
degraded samples. Continual advancements in multiplex kits including several
works on keeping more and more markers in size less than 250 bp in a single
multiplex, use of improved master mix and Taq polymerase have helped in forensic
DNA analysis (Shrivastava et al. 2016).
DNA as evidence has potential use in several fields (Fig. 4.3) including criminal,
civil, immigration and other cases. DNA in the form of biological evidence may be
encountered by the investigators in various type of criminal cases such as (but not
limited to) murder, rape, gang-rape, sexual assault, sexual abuse, child abuse,
unnatural sexual offences (like buccal coitus, sodomy, bestiality, etc.), sexual
perversions (sadism, fetishism, necrophilia, etc.), theft, robbery, mass-graves,
drowning, mutilation of the dead body, necrophagy, black magic related crimes,
disfigured/dismembered/burnt bodies, and wildlife crimes.
DNA as evidence may also be useful in cases of accidental deaths, mass-disasters,
exhumation cases, archaeological cases, etc. Additionally, it can also be utilised in
civil cases such as maternity-paternity dispute cases, immigration cases, adultery,
recognition of legal heirs, in the cases involving the exchange of babies in the
hospital or baby care centre, and identification of the missing person (after elapsed
time). Old, cold and unsolved cases have also been solved with the help of DNA
evidence. The DNA databases of various agencies across the world facilitates law
enforcement by aiding in investigations by successfully identifying suspects and
related sequential/serial crimes committed in one or more jurisdictions.
In the earliest known case, DNA as evidence was used in the rape cum murder
case of a 15-year-old Dawn Ashworth in Leicestershire, England in July 1986
(Hodge 2017; Arnaud 2017). According to the discovery of Dr Alec Jeffreys, the
DNA patterns of individuals were dissimilar and accounted for the individualisation
of the person (Jeffreys et al. 1985a, b, c). In the Ashworth murder case, the police
officer took the help of Dr Alec Jeffreys’ technique. He used the DNA recognition
technique by analysing the blood, and saliva samples of available tracked suspect
Richard Buckland, who had already confessed to Ashworth’s murder. But the result
4 Forensic DNA Evidence: From Crime Scene to Conviction 73
of the matching of DNA of suspect with the sample collected from the crime scene
was found to be a non-match. Further, 4000 samples of men aged between 17 and
34 years from the Leicestershire area were examined. The result stated that the DNA
of these men did not match with the suspect sample. Meanwhile, someone overheard
a man boasting about how he had been paid to give a sample in someone else’s place.
In 1987, the police officer found that local baker Colin Pitchfork had denied giving a
sample for assessing DNA. When Pitchfork’s DNA was examined, it matched with
the crime scene samples. Pitchfork was detained on Sept 19, 1987, convicted and
sentenced to life in prison a year later (Hodge 2017; Arnaud 2017).
Since many years, DNA has turned out to be one of the most powerful tools, to
evaluate the identity of suspects and victims, convict the blameworthy, and vindicate
the innocent. The DNA profiling technology has so advanced and developed now
that degraded samples, archaeological samples, and even world war victim’s
samples can be analysed (Alghafri et al. 2018). Even a slight touch can establish
linkage of someone at a crime scene. With the availability of many techniques for
individualisation by DNA tests, the courts demand further promising result with
greater accuracy (Dash et al. 2020). Few courts require for experts to not only deliver
74 A. Badiye et al.
the DNA profiles but also to give the quantitative assessment of how uncommon the
identifying features among the particular groups and subgroups are (National
Research Council (US) Committee on DNA Forensic Science 1996).
There are some cases that pose challenging conditions for establishing personal
identity. Like in cases of drowning, the body after being submerged in water is often
all swollen up and is in a highly decomposed state. In cases of burning/charring of
the body, all/most of the features permitting personal identification are lost. In cases
of the crushed face, or a mutilated body or severing off of the head from the torso
also prevents identification of the person. Fingerprints of innocent are often not
present on any records to permit comparison and identification. In cases of
skeletonised remains or recovery of skeletons (complete or partial), it becomes
problematic to estimate the sex of the person. In all these seemingly ‘difficult’
cases, DNA-based methods have proved to be better in providing accurate results.
Especially in comparison with the anthropological methods of sex determination
which relies on the anthropometric landmarks of skull, mandible and other bones
(but is often quite confusing in Indian context wherein the population is
non-homogenous), DNA-based methods more often than not offer quick and accu-
rate results.
The crime scene is a place where the crime has occurred, or the evidence related to a
crime are found. In a broader sense, it will also include the victim/survivor, the
assailant, dumping areas (where the dead body or other related evidence may have
been thrown or dumped or disposed of), the weapon of offence, the clothes of all
those involved and surfaces or object touched/used. The presence of DNA usually
proves the presence of a person on the spot or his/her involvement in the crime.
While mere presence or absence of DNA evidence may not be sufficient to rule-in or
rule-out an individual as the perpetrator, but it does shift the burden of proof on such
a person.
It is essential to understand the intricacies of DNA evidence encountered at the
place of occurrence of a crime or on a person involved in a crime. The crime scene is
to be secured to prevent unauthorised access. Crowding of the scene is to be avoided/
minimised at all costs. The pieces of evidence should be searched using an appro-
priate method(s) depending upon the crime scene. Labelling of the location of the
evidence must be followed by the documentation of the crime scene (using any one
or combination of these methods, i.e. notes taking/sketching/photography/videogra-
phy). Once this has been done, the next step of foremost importance would be the
recognition of evidence or the source from which such biological material or
evidence may be obtained that can be a potential source of DNA. The evidence
can occur in varied forms (solid, liquid, semisolid, dried), at different locations
(primary crime scene, secondary crime scene, tertiary crime scene, etc.) and in
different conditions (pure, mixed, contaminated, diluted, etc.). The various sources
of DNA from some of the biological evidences at the scene are shown in Fig. 4.2.
4 Forensic DNA Evidence: From Crime Scene to Conviction 75
These may be found on any of the victim and/or assailant and the objects associated
with them such as the weapon of offence, fingernails of the victim/survivor, cigarette
stub, clothes and garments of the victim and/or assailant and/or witnesses, used
condoms, bedsheets, or surfaces or objects touched or contacted by them.
The crime scene investigation is a complex and meticulous process. For success-
ful conviction, it essential that the evidence is appropriately recognised, collected,
preserved, packed, stored, forwarded to the Forensic Science Laboratory, appropri-
ately analysed in the lab and reported. All these steps should be free from contami-
nation and cross-contamination. A proper chain of custody should be maintained
throughout the process (Badiye et al. 2019). Additionally, taking care of the quality
control issues at every step is also imperative. The expert performing the DNA
analysis should be proficient and well versed with the techniques and other relevant
details so as to face and withstand the scrutiny of the legal and judicial system.
Forensic Science is the field that acts as a bridge between the investigation and
trial. Its knowledge facilitates the crime scene analyst to collect the physical evi-
dence scientifically, the laboratory analyst/scientific officer to appropriately analyse
the evidence and present the findings in the form of a scientific report in the court
of law.
The collection method used should be appropriate and as per the need of the
sample (Dash et al. 2020). Gloves must be used to handle all the exhibits or potential
sources of evidence. Fresh gloves must be used for touching different objects/
evidence stained with biological fluids. To reduce the risk of contamination, the
crime scene analyst must invariably use PPE (personal protective equipment,
i.e. coveralls, gloves, shoe-covers, headgear/headcover, mask, eyewear/safety gog-
gles). The sterile and disposable materials and supplies must be used for collection.
The blood sample, semen, saliva or other stains collected from the crime scene must
be invariably air-dried at room temperature and stored in paper bags rather than
directly in plastic to avoid degradation and prevent microbial contamination. Ade-
quate quantities must be collected so as to ensure multiple testing (if required).
Shreds of evidence, even if of the same type, if obtained from different places/
sources at the crime scene, must be packed separately. For collecting liquid samples,
appropriate preservatives (e.g. EDTA vials for liquid blood samples) must be used. If
appropriate preservatives are not available for liquid samples, they must be stored at
a cold temperature (at 4 C or a freezer at 20 C to reduce microorganisms’ growth
rate and to avoid DNA degradation) and immediately transferred to the lab
(Magalhães et al. 2015). For dried stains, swabbing with the help of sterile swab
((saline) wet and/or dry swabbing) may be used. In sexual assault cases, the
fingernail scrapping of the victim as well as the suspect(s) is of immense importance.
The doctors examining the victim/survivor of rape/sexual assault must keep an
empathetic attitude and must follow the appropriate guidelines of examination and
must not end-up further distressing the survivor. The appropriate method of man-
agement of biological evidence for DNA analysis should be used (Kleypas and
Badiye 2020; Magalhães et al. 2015; Lee and Ladd 2001; Baxter 2015).
76 A. Badiye et al.
• Inclusion: If the DNA profile of the suspect matches with the DNA profile
obtained from the exhibit, the results are considered to be an ‘inclusion’ or
‘non-exclusion’, i.e. the suspect is included (and hence not excluded) as a
possible source of the contributor to the DNA exhibit (Lynch 2003).
• Exclusion: If the DNA profile of the suspect does not match with the DNA profile
obtained from the exhibit, the results are considered to be an ‘exclusion’ or ‘non-
inclusion’ i.e. the suspect may be excluded (and hence not included) as a possible
contributor to DNA exhibit (Lynch 2003).
• Inconclusive Result: As a third possibility, the results may be ‘inconclusive’.
There may be several reasons for the same, including, degraded or contaminated
samples, mixed samples or samples not adequately preserved (Lynch 2003).
4 Forensic DNA Evidence: From Crime Scene to Conviction 77
We discuss herein some fascinating cases that involved the use of DNA as the
primary evidence and have led to solving the mystery of these crimes. The first case
study was of a case of sexual assault (Sect. 4.4.1). The second case study was of a
case of sexual assault followed by the murder of an 8-year-old girl child. The face of
the girl child was disfigured by crushing with a heavy stone. For confirming the
identity of the girl, paternity testing was also conducted (Sect. 4.4.2). The third case
study involved a case wherein a girl was gang-raped by three men but trying to be
‘ahead’ of the investigating agencies, all three of them wore condoms. The outside,
as well as the inside of the condoms, were tested and profiled. The investigating
team, as well as the forensic science laboratory, worked in tandem to effectively
solve this case without the loss of evidence (Sect. 4.4.3). The fourth case study
depicts the advantage of the use of DNA technology over the traditional anthropo-
logical assessments used to determine the sex of the skeletal remains found at a crime
scene (Sect. 4.4.4). The fifth case study involves a case of rape on a minor. The
vaginal swab of the girl child did not reveal the presence of male DNA, but penile
swab of the suspect showed the presence of the girl child’s DNA (Sect. 4.4.5).
In a case of sexual assault blood sample of the victim, the blood sample of the
suspect, undergarment of the victim and vaginal smear slide of the victim were
received for forensic DNA examination. DNA was extracted from the reference
blood sample of the victim and suspect, using an automated DNA extraction system
AutoMateExpress™ (ThermoFisher Scientific) as per the protocol of the manufac-
turer. The differential extraction procedure was followed for obtaining male and
female DNA from undergarment and vaginal smear slide of the victim. Obtained
DNA was quantified using ABI 7500 Real-Time PCR (Thermo Fisher Scientific)
using the manufacturer recommended protocol. Five hundred picogram of DNA was
amplified using ABI Global Filer™ multiplex kit as per recommendations of the
manufacturer. The amplified DNA fragments were run separated using Genetic
Analyser ABI 3500XL as per recommendations of the manufacturer, and the
obtained data were analysed using GeneMapper® ID-X software v1.5. Mixed
autosomal STR profile was detected on the source of both the articles of the victim.
All the alleles in the DNA profile of the victim and accused were observed in the
mixed DNA profile observed on the source of the victim. Thus, the obtained results
confirmed the transfer of male’s DNA on the source objects of the victim (Table 4.1).
78 A. Badiye et al.
Table 4.1 Mixed autosomal STR DNA profile obtained in a case of sexual assault
Article A Article B Article C Article E
Undergarment Vaginal slide Blood sample of Blood sample of
Genetic markers of victim of victim the victim accused
D3S1358 15,16,18 15,16,18 15,18 16
vWA 17,18 17,18 17 18
D16S539 9,11,12,13 9,11,12,13 12,13 9,11
CSF1PO 11,12,13 11,12,13 11,13 11,12
TPOX 8,9,10,11 8,9,10,11 8,11 9,10
D8S1179 8,12,13,16 8,12,13,16 8,16 12,13
D21S11 30,33.2 30,33.2 30 30,33.2
D18S51 13,16 13,16 16 13,16
D2S441 10,11 10,11 10 10,11
D19S433 13,13.2 13,13.2 13 13,13.2
TH01 8,9 8,9 9 8
FGA 19,21,23,26 19,21,23,26 19,21 23,26
D22S1045 11,12,15 11,12,15 11,12 12,15
D5S818 10,11,12 10,11,12 12 10,11
D13S317 9,10,12,13 9,10,12,13 9,13 10,12
D7S820 8,11 8,11 8 8,11
SE33 20,27.2,28.2 20,27.2,28.2 27.2,28.2 20,27.2
D10S1248 14,15,16 14,15,16 15,16 14
D1S1656 11,15,16,17 11,15,16,17 11,16 15,17
D12S391 18,19,20,21 18,19,20,21 20,21 18,19
D2S1338 23,25 23,25 23,25 23
AMELOGENIN XY XY XX XY
DYS391a 11 11 – 11
Y INDELa 2 2 – 2
a
Markers indicative of male DNA
In 2013, an 8-year girl was found brutally murdered by crushing her face with a
heavy stone after cutting her neck. With few clues, a suspect was arrested, and the
high-level investigation team sent the case exhibits for biological examination to
Regional Forensic Science Laboratory, Bhopal. The biological and serological
examination suggested the presence of spermatozoa and also the similar blood
group on the seized exhibits.
After this confirmation, the case was referred for DNA fingerprinting examina-
tion. As per the directions given by DNA Fingerprinting Unit, State Forensic Science
Laboratory, Sagar, Madhya Pradesh, India, the samples from parents of the deceased
were also sent to the laboratory for confirming the identity of the girl child. This was
directed because the head was crushed, and the girl was identified by her dress
(frock). The exhibits on which male mixed DNA was expected were processed using
4 Forensic DNA Evidence: From Crime Scene to Conviction 79
the Phenol Chloroform Isoamyl Alcohol (PCI) differential DNA extraction method,
and the teeth of girl and the reference samples from the parents were processed by
Phenol Chloroform Isoamyl Alcohol (PCI) (Köchl et al. 2005) organic DNA extrac-
tion method. The obtained DNA was amplified with the then-available 15 autosomal
marker AmpflSTR® Identifiler plus PCR Amplification Multiplex kit (ABI/Now,
Thermo Fisher Scientific). The amplicons were run on Genetic Analyser ABI
3100XL, and the obtained data were analysed using GeneMapper® ID software
v3.2. A mixed autosomal STR profile was detected with the source of both the
articles of the victim. All the alleles in the DNA profile of the victim and accused
were observed in the mixed DNA profile obtained from the source of the victim.
Thus, the obtained results confirmed the transfer of the deceased’s DNA on the
source clothes of the accused, and weapon of offence (stone and trowel (a mason
tool) (Table 4.2). The results also confirmed the presence of the DNA of the accused
on the clothes (Frock, Stain 3) of the deceased (Table 4.2). The biological relation-
ship of the girl child (deceased) is confirmed by matching the DNA profile of parents
(Table 4.3).
A lady was sexually assaulted by three persons, who used condoms that were
recovered from the crime scene. The investigating officer contacted the experts at
DNA division and very wisely seized all the three condoms, tied those and sent them
to the DNA Unit, State FSL, Sagar. The laboratory carried out the DNA examina-
tion. In this gang-rape case, the blood sample of the victim, three suspects, along
with a vaginal slide of the victim, were sent for DNA examination. DNA was
extracted from the reference blood sample of victims and suspects, using Phenol
Chloroform Isoamyl Alcohol (PCI) organic DNA extraction method. Outer and
inner portions of all three condoms were processed separately. DNA from condoms
and vaginal smear slide were extracted by phenol-chloroform extraction. Obtained
DNA was quantified using ABI 7000 Real-Time PCR (Thermo Fisher Scientific)
and Quantifiler™ Duo DNA Quantification Kit (Thermo Fisher Scientific) using the
manufacturer’s protocol. One nanogram of DNA was amplified using PowerPlex®
16HS Multiplex kit (Promega Corporation) as per the recommendations of the
manufacturer. The amplified DNA fragments were separated using Genetic Analyser
ABI 3100 as per recommendations of the manufacturer, and the obtained data were
analysed using GeneMapper software v3.2. The obtained genotyping results are
presented in Tables 4.4 and 4.5.
The obtained results, in this case, using autosomal STR, confirmed that all three
condoms were used with the same lady. The profile obtained from the blood sample
and vaginal slide of the victim and DNA profile observed from the outer surface of
all three condoms were the same, confirming that all three condoms were used with
the same lady (Table 4.4). However, three different DNA profiles were observed
from the inner part of all three condoms (Table 4.5), confirming the involvement of
80
Table 4.2 Autosomal STR DNA profile obtained in a case of sexual assault followed by the murder of the 8-year-old girl child
Teeth and muscle Frock of Stones and Frock of Clothes Blood
Vaginal smear slide attached with a piece of deceased stain trowel mason deceased of sample of
Genetic markers and swab of deceased Jaw 1 and 2 tool stain 3 accused accused
D8S1179 10,15 10,15 10,15 10,15 13,14 10,15 13,14
D21S11 28,31 28,31 28,31 28,31 29,31.2 28,31 29,31.2
D7S820 8,10 8,10 8,10 8,10 8,10 8,10 8,10
CSF1PO 11,12 11,12 11,12 11,12 11,12 11,12 11,12
D3S1358 17,18 17,18 17,18 17,18 16,17 17,18 16,17
THO1 6,9 6,9 6,9 6,9 7,9 6,9 7,9
D13S317 11,12 11,12 11,12 11,12 8,8 11,12 8,8
D16S539 11,13 11,13 11,13 11,13 9,13 11,13 9,13
D2S1338 21,23 21,23 21,23 21,23 20,20 21,23 20,20
D19S433 14,14 14,14 14,14 14,14 13,14 14,14 13,14
vWA 18,19 18,19 18,19 18,19 14,19 18,19 14,19
TPOX 8,11 8,11 8,11 8,11 8,8 8,11 8,8
D18S51 17,19 17,19 17,19 17,19 14,15 17,19 14,15
D5S818 11,11 11,11 11,11 11,11 11,13 11,11 11,13
FGA 20,22 20,22 20,22 20,22 22,24 20,22 22,24
AMELOGENIN XX XX XX XX XY XX XY
A. Badiye et al.
4 Forensic DNA Evidence: From Crime Scene to Conviction 81
Table 4.3 Autosomal STR DNA profile in the case of the brutal murder of a girl child confirming
parentage
Blood sample of Teeth and muscle attached with a Blood sample of
Genetic markers Father piece of jaw Mother
D8S1179 14,15 10,15 10,14
D21S11 31,31.2 28,31 28
D7S820 10 8,10 8,13
CSF1PO 11,12 11,12 12
D3S1358 16,17 17,18 17,18
THO1 6,8 6,9 9
D13S317 10,12 11,12 8,11
D16S539 8,11 11,13 11,13
D2S1338 20,21 21,23 23,24
D19S433 11.2,14 14,14 14,16
vWA 17,18 18,19 19
TPOX 9,11 8,11 8
D18S51 12,19 17,19 15,17
D5S818 11,12 11,11 9,11
FGA 22 20,22 20,23
AMELOGENIN XY XX XX
Table 4.4 DNA profile obtained from the outer surface of the three condoms and blood sample
and vaginal slide of the victim
DNA profile obtained DNA profile obtained DNA profile obtained
from outer portion of from the blood from vaginal slide
Genetic markers condom 1, 2 and 3 sample of the victim sample of the victim
D3S1358 14,17 14,17 14,17
TH01 6 6 6
D21S11 29,30 29,30 29,30
D18S51 11,16 11,16 11,16
Penta E 14,16 14,16 14,16
D5S818 10,11 10,11 10,11
D13S317 11,12 11,12 11,12
D7S820 9,12 9,12 9,12
D16S539 12 12 12
CSF1PO 11 11 11
Penta D 10,11 10,11 10,11
vWA 17 17 17
D8S1179 12,13 12,13 12,13
TPOX 11 11 11
FGA 21,23 21,23 21,23
AMELOGENIN XX XX XX
82 A. Badiye et al.
Table 4.5 DNA profile obtained from the inner surface of the three condoms
The inner The inner The inner
portion of portion of portion of Suspect Suspect Suspect
Genetic markers condom 1 condom 2 condom 3 1 2 3
D3S1358 15,17 15,16 16,16 15,16 12,14 15,17
TH01 9,9 7,9.3 9,9 7,9.3 7,10 9,9
D21S11 29,34.2 32.2,34.2 30,32.2 32.2,34.2 24,27 29,34.2
D18S51 14,21 14,16 14,15 14,16 9,11 14,21
Penta E 7,13 7,19 10,12 7,19 8,11 7,13
D5S818 12,13 11,13 11,11 11,13 12,12 12,13
D13S317 11,12 10,11 8,11 10,11 8,12 11,12
D7S820 8,8 11,11 7,10 11,11 13,14 8,8
D16S539 10,11 11,12 11,13 11,12 13,15 10,11
CSF1PO 11,11 9,13 10,12 9,13 12,12 11,11
Penta D 10,14 11,13 10,12 11,13 11,14 10,14
vWA 14,17 15,18 17,19 15,18 19,21 14,17
D8S1179 14,15 10,16 15,17 10,16 17,17 14,15
TPOX 8,11 9,11 9,11 9,11 12,13 8,11
FGA 19,24 20,23 24,24 20,23 21,23 19,24
AMELOGENIN XY XY X,Y X,Y X,Y X,Y
three distinct persons. The two autosomal STR profiles obtained from two different
inner portions of condoms were found to match with the profiles of the two suspects
(Table 4.5).
Table 4.6 Autosomal STR DNA profile obtained from the blood samples of presumed father and
mother and the unidentified skull and femur bone using PowerPlexÛ 16HS Multiplex kit (Promega
Corporation)
Blood sample of the Unidentified Blood sample of the
Genetic markers presumed father skull/femur presumed mother
D3S1358 15,18 17,18 15,17
TH01 8,9 9,9 9,9
D21S11 31.2,32.2 31,31.2 31,32.2
D18S51 14,17 16,17 14,16
Penta E 11,20 11,18 15,18
D5S818 11,11 11,13 11,13
D13S317 11,11 11,11 8,11
D7S820 10,11 10,11 8,10
D16S539 11,11 11,11 11,11
CSF1PO 12,12 11,12 10,11
Penta D 10,10 9,10 9,10
vWA 14,15 14,17 17,18
D8S1179 14,15 15,15 13,15
TPOX 8,11 11,11 8,11
FGA 23,24 22,23 20,22
AMELOGENIN X,Y X,Y X,X
In the sexual cases involving minors (age of girl child less than 10 years), it is
challenging to prove the guilt as the vagina of the girl concerned is not prepared at
this age to bear the force generated during the attempt of an adult penetration. As a
consequence, the vagina of the girl gets ruptured and results in severe bleeding. With
the experience of practically handling cases, as forensic DNA expert, the authors are
of the opinion that these cases are usually linked by observing the immediate transfer
of victim’s blood after the incidence. In these cases, penile swabs and the
undergarments of accused/suspect have been observed to be better objects in proving
the guilt by using forensic DNA technology instead of vaginal slides and swabs. In a
case of sexual assault against a girl child aged 5 years, vaginal swab and slide of the
victim, clothes of victim, undergarment and a penile swab of the suspect along with
referral blood sample of the suspect were received for DNA examination. DNA was
extracted from the reference blood sample of the suspect by Automated DNA
extraction system (12 GC, PSS, Japan). DNA from vaginal swab and slide of the
victim, clothes of victim, undergarment and a penile swab of the suspect was
extracted using Phenol Chloroform Isoamyl Alcohol (PCIA) organic DNA extrac-
tion method. The final obtained DNA was concentrated using 30 KD Microcon
concentration device (Millipore). The final DNA was eluted to 20 μL in Tris EDTA
buffer. Differential extraction method (Butler 2012) was adopted in extracting DNA
from vaginal swab and slide of the victim. Obtained DNA was quantified using ABI
84 A. Badiye et al.
4.5 Conclusion
DNA forensics will continue to progress. Modern DNA forensic methods are
authoritative and subtle. As the sensitivity of DNA techniques increases, so does
the risks of contamination and secondary transfer of DNA material. The issues of
contaminations during every step from sampling, analysis, and finally to report,
Table 4.7 DNA profile observed in the case using AmpflSTR® identifiler plus kit
Article A Article B Article F Article H
Vaginal slide of Vaginal swab of Penile swab of Undergarment of
Genetic markers the victim the victim the suspect the suspect
D8S1179 10,13 10,13 10,13 10,13
D21S11 29,33.2 29,33.2 29,33.2 29,33.2
D7S820 11,11 11,11 11,11 11,11
CSF1PO 9,13 9,13 9,13 9,13
D3S1358 17,18 17,18 17,18 17,18
THO1 7,7 7,7 7,7 7,7
D13S317 8,12 8,12 8,12 8,12
D16S539 10,11 10,11 10,11 10,11
D2S1338 20,21 20,21 20,21 20,21
D19S433 13,16 13,16 13,16 13,16
vWA 13,19 13,19 13,19 13,19
TPOX 8,11 8,11 8,11 8,11
D18S51 15,16 15,16 15,16 15,16
D5S818 11,11 11,11 11,11 11,11
FGA 24,25 24,25 24,25 24,25
AMELOGENIN XX XX XX XX
4 Forensic DNA Evidence: From Crime Scene to Conviction 85
proper sampling and proficiency of scientists dealing with DNA should be taken care
of. With the increasing reliance on the technique, it is rare to see any court reject the
DNA evidence on the basis on the invalidity of the fundamental scientific theory.
However, with practice, precaution and precision, from the inception to the end, we
would be able to utilise the optimum potential of DNA evidence from the crime
scene to conviction.
References
Alghafri R, Pajnič IZ, Zupanc T, Balažic J, Shrivastava P (2018) Rapidly mutating Y-STR analyses
of compromised forensic samples. Int J Legal Med 132:397. https://doi.org/10.1007/s00414-
017-1600-z
Allen RW, Pogemiller J, Joslin J, Gulick M, Pritchard J (2008) Identification through typing of
DNA recovered from touch transfer evidence: parameters affecting yield of recovered human
DNA. J Forensic Identif 58(1):33–41
Arnaud CH (2017) Thirty years of DNA forensics: How DNA has revolutionized criminal
investigations. Chem Eng News 95:16. Available from: https://cen.acs.org/articles/95/i37/
Thirty-years-DNA-forensics-DNA.html
Ashcroft J, Daniels DJ, Hart SV (2002) Using DNA to solve cold cases. U.S. Department of justice
office of justice programs. Available from: https://www.ncjrs.gov/pdffiles1/nij/194197.pdf
Badiye A, Kapoor N, Menezes RG (2019) Chain of Custody (Chain of Evidence). In: StatPearls
[Internet]. StatPearls Publishing, Treasure Island (FL). Available from: http://www.ncbi.nlm.
nih.gov/books/NBK551677/
Baxter E Jr (2015) Complete crime scene investigation handbook. CRC Press, Boca Raton, FL
Butler JM (2012) DNA extraction methods. In: Advanced topics in forensic DNA typing: method-
ology. Elsevier, Waltham, MA
Daly DJ, Murphy C, McDermott SD (2012) The transfer of touch DNA from hands to glass, fabric
and wood. Forensic Sci Int Genet 6:41–46
Dash HR, Shrivastava P, Das S (2020) Principles and practices of DNA analysis: a laboratory
manual for forensic DNA typing. Springer, New York, NY
Goodwin W, Linacre A, Hadi S (2007) An introduction to forensic genetics. John Wiley & Sons,
Ltd, New York, NY
Goray M et al (2019) DNA transfer: DNA acquired by gloves during casework examinations.
Forensic Sci Int Genet 38:167. https://doi.org/10.1016/j.fsigen.2018.10.018
Harris W (2001) How DNA evidence works. HowStuffWorks.com. Available from: https://science.
howstuffworks.com/life/genetic/dna-evidence.htm. Accessed 13 April 2020
Hodge C (2017) The shifting science of DNA in the courtroom. CNN Health. Available from:
https://edition.cnn.com/2017/06/09/health/dna-technology-forensic-evidence/index.html
Jeffreys AJ et al (1985a) Hypervariable minisatellite regions in human DNA. Nature 314:67–73
Jeffreys AJ et al (1985b) Positive identification of an immigration test-case using human DNA
fingerprints. Nature 317:818–819
Jeffreys AJ et al (1985c) Individual-specific fingerprints of human DNA. Nature 316:76–79
Kaye H (2007) The science of DNA identification: from the laboratory to the courtroom (and
beyond). Minnesota J Law Sci Technol 8:4. Available from: https://scholarship.law.umn.edu/
mjlst/vol8/iss2/4/
Kapoor N, Badiye A (2015a) Sex differences in the thumbprint ridge density in a central Indian
population. Egypt J Forensic Sci 5:23–29. https://doi.org/10.1016/j.ejfs.2014.05.001
Kapoor N, Badiye A (2015b) An analysis of whorl patterns for determination of hand. J Forensic
Leg Med 32:42–46. https://doi.org/10.1016/j.jflm.2015.02.015
Kapoor N, Badiye A (2015c) Digital dermatoglyphics: a study on muslim population from India.
Egypt J Forensic Sci 5:90–95. https://doi.org/10.1016/j.ejfs.2014.08.001
86 A. Badiye et al.
Kleypas DA, Badiye A (2020) Evidence collection. In: StatPearls [Internet]. StatPearls Publishing,
Treasure Island (FL). Available from: https://www.ncbi.nlm.nih.gov/books/NBK441852/
Köchl S, Niederstätter H, Parson W (2005) DNA extraction and quantitation of forensic samples
using the phenol-chloroform method and real-time PCR. In: Forensic DNA typing protocols.
Springer, New York, NY, pp 13–29
Lee HC, Ladd C (2001) Preservation and collection of biological evidence. Croat Med J 42
(3):225–228
Locard E (1930) Te analysis of dust traces. Part 1. Am J Police Sci 1:276–298
Lynch M (2003) God’s signature: DNA profiling, the new gold standard in forensic science.
Endeavour 27(2):93–97
Magalhães T, Dinis-Oliveira RJ, Silva B, Corte-Real F, Nuno VD (2015) Biological evidence
management for DNA analysis in cases of sexual assault. Sci World J 2015:365674. https://doi.
org/10.1155/2015/365674. PMID: 26587562; PMCID: PMC4637504
National Research Council (US) Committee on DNA Forensic Science (1996) 6. DNA Evidence in
the Legal System. In: An update. the evaluation of forensic DNA evidence. National Academies
Press, Washington, DC. Available from: https://www.ncbi.nlm.nih.gov/books/NBK232607/
Phipps M, Petricevic S (2007) The tendency of individuals to transfer DNA to handled items.
Forensic Sci Int 168:162–168
Polley D, Mickiewicz P, Vaughn M, Miller T, Warburton R, Komonski D, Kantautas C, Reid B,
Frappier R, Newman J (2006) An investigation of DNA recovery from firearms and cartridge
cases. Can Soc Forensic Sci J 39(4):217–228
Shrivastava P, Jain T, Trivedi VB (2016) DNA fingerprinting: a substantial and imperative aid to
forensic investigation. Eur J Forensic Sci 3(3):23–30
de Villiers WP (2014) Fingerprint comparison evidence has been under sustained attack in the
United States of America for the last number of years: Is the critique with regard to reliability
sufficiently penetrating to warrant the exclusion of this valuable evidence? Int J Law Crime
Justice 42:54. https://doi.org/10.1016/j.ijlcj.2014.01.004
RNA- and DNA-Based Identification of Body
Fluids 5
Arjun Rao, Manisha Rana, Ashish Pradhan, and Moumita Sinha
Abstract
The most common form of evidence to forensic investigators is the body fluids
collected at crime scenes. They ascertain the suspect or victim, they provide
valuable DNA evidences and can play a vital role in acquit an innocent individ-
ual. The determination of a specific bodily fluid is predominantly the initial step
as the body fluid composition is very relevant to the further investigation process.
The ability to identify and report an unexplained stain at the scene of crime
without waiting for the laboratory results is another very important phase in the
forensic body fluids analysis. Many forms of detection methods for body fluids
have been known for over a century, such as alternative light source, immuno-
logical tests, spectroscopic techniques, chemical methods, catalytic tests, and
microscopic methods. Although these modern forms of detection of body fluids
are often definitive, these are done at a time with only one body fluid. Currently
the usage of molecular genetic based approaches using DNA methylation detec-
tion or RNA-based profiling methods has recently conquered to replace the
traditional body fluids identification methods.
Keywords
Blood · Saliva · Semen · Forensic · RNA · DNA
5.1 Introduction
Individual’s involvement in a crime can be detected and identified by the body fluids
traced at the crime scene event. These types of evidences found at the scene of crime
are among the most ubiquitous in nature especially to forensic investigation
purposes. Body fluids identification and detection is a vital part in forensic practices;
however, many biological fluids are invisibly present in the crime scene or present in
very small quantity due to which the easily identification is not possible. The
presence of biological fluids not only provides type and origin of the samples but
also provides clues in reconstructing crime scene and linkages between innocent and
actual criminalists.
Biological fluids like blood (including menstrual stains), semen, saliva, urine and
vaginal stains, skin, and tissues are the prime interest of forensic scientists in various
crime cases. In a crime scene approach the identity of these biological fluids are not
straightforward, due to their invisible presence in very minute quantities. For the
identification of sequence of events at the crime scene, these biological fluids can be
used as crucial indicators. Such as blood stains are a strong indicator of murder,
some form of assault, or struggle, whereas upon the detection of semen or vaginal
stains able to specify physical and or sexual assault.
After potential identification of body fluids at scene of crime, a specific form of
light is required to visualize these stains or the spot chemical examination is
required. The biological identification of these stains previously based on some
limited chemical methods which were often inadequate in sensitivity and specificity,
whereas the confirmatory tests based on some microcrystal tests for the identification
of body fluids in forensic-related cases. The techniques apply were based on
chemical tests, enzyme catalytic reactions, immunological tests, spectroscopic
based tests, and microscopic examinations. The presumptive/preliminary tests
which are also used for screening the biological fluids even at the crime scene or
at the forensic laboratories setup; some of them are, Phenolphthalein (Kastle–Meyer
test), and Luminol test (for minute traces) for blood identification, Phadebas test for
saliva identification, Jaffe’s test for urine identification, Acid Phosphatase test for
semen identification. The other tests are based on microscopic examination (confir-
matory tests) which will convincingly identify the presence and the nature of such
biological fluids. These gold standard evidences contain valuable genetic informa-
tion to identify a suspect or victim as well as either acquit an innocent individual.
Technology has rapidly evolved to reveal the individual identity of an unidentified
stain at the scene of crime scene, without much waiting for the laboratory results to
arrive is a crucial breakthrough in the advancement of body fluids analysis in
forensic scenario. An evident of the last decade is the progressive development of
the laser technology and novel light detectors which have either gave birth to
spectroscopic methods and/or molecular-based approaches for the detection of
biological fluids.
In the field of body fluids detection, the latest developments must culminated in a
range of novel methods and approaches which allows (1) first time identification of
some body fluids, (2) experiments enabling nondestructive research at the scene of
crime for more study via efficient DNA profiling, and (3) research lab-based protein
and RNA techniques allowing for the requirements.
5 RNA- and DNA-Based Identification of Body Fluids 89
For several years, preliminary chemical studies have been utilized and are still
playing a significant role to identify a region of significance for DNA study and
forensic investigation. Ample of reviews and reports for their accuracy and precision
are available (Virkler and Lednev 2009; Gaensslen 1983; Tobe et al. 2007). These
chemical measures are not unique to humans and usually are administered sequen-
tially where there may be a mixed body fluid. Most depend on body fluids enzyme
properties, and many reagents are sample harmful and/or obstruct downstream
procedures.
Stains on dark surfaces or non-visible stains face challenges to detect and
similarly been deciphered with alternative light sources using the auto fluorescence
provided by some body fluids (Kobus et al. 2002; Vandenberg and van Oorshot
2006). The effectiveness of such approaches may be influenced by differences
between body fluids and various surfaces, and application to these light sources
may induce DNA damage in the stain. The super reactive luminol method which is
used in the darker areas to identify the blood stains, but with a broad variety of
chemicals, it provides false positives and devalues any stain that might be needed for
further study (Webb et al. 2006; Quinones et al. 2006).
The reasonable degree of accuracy and sensitivity has been found while using
immuno chromatographic and enzyme-linked immunosorbent assay (ELISA) for
the detection of body fluids (Akutsu et al. 2012a, b; Simich et al. 1999; Casey and
Price 2010). Such measures determine the identity of the antigen in question instead
of the antigen behavior. Environmental conditions may influence antigen–antibody
interaction contributing to false positive or negative outcomes, and the elevated-dose
hook effect affects both of these studies. These experiments are not intended to
identify staining areas or in a systematic fashion, so a part of the sample is extracted
so solubilized in both of these methods prior to the study.
5.4 Blood
Chemical blood tests are susceptible but lacks precision and tend to rely onto the
catalytically activity of the hemoglobin groups and the oxidant, including plant
peroxidases, which can produce false positive results (Virkler and Lednev 2009;
Tobe et al. 2007; Cox 1991). Assays include Leucomalachite Green, named as less
sensitive but also more specified tests; Tetramethylbenzidine (TMB), Ortho-tolidine,
and Phenolphthalein (Kastle–Meyer test), some form of high specificity sensitive
testes for the identification of blood (Gaensslen 1983; Webb et al. 2006; Cox 1991).
Confirmatory yet often cumbersome testing requires a microscopy of red and white
blood cells and the formation of crystals with hemochromogenic crystals
90 A. Rao et al.
5.5 Saliva
An α-amylase-based detection The Phadebas® test is the regular standardized test for
the identification of presence of saliva. Due to the small traces of the α-amylase
enzyme are known to found in different other body fluids such as breast milk, blood,
semen, urine, fecal urine, and other mammals as salivary and pancreatic sources this
test is not confirmatory for the human saliva identification (Kipps and Whitehead
1975; Auvdel 1986; Keating and Higgs 1994). The SALIgAE® test from Abacus
Diagnostics provides an substitute test for saliva based on calorimetric approach,
which is known to be more sensitive target reagent than the Phadebas® test (West
Hills, CA, USA) (Pang and Cheung 2008; Liang and Roy 2014).
False positive values have been traced in breast milk, rat saliva, clean urine and
fecal/feces and semen samples. The RSID™ test for saliva is focused on anti-
amylase antibodies of antihuman salivary (Old et al. 2009). The above test has
been found to be more flexible and more accurate than the two tests Phadebas® and
SALIgAE® tests, respectively (Casey and Price 2010; Pang and Cheung 2008).
5.6 Semen
has been noticed less susceptible while comparing with the other test kits like
ABAcard®, P30 and SERATEC® PSA, and some test results are occupied with
inaccurate results (Boward and Wilson 2013).
The differentiating feature between menstrual blood and vaginal secretions is found
to be very difficult in classification. The identification of the vaginal wall
glycogenated squamous epithelial cells through Lugol’s staining, the endometrial
cells microscopic identification and tracing the lactate dehydrogenase isoenzymes
4 and 5 are not the definitive methods for tracing the vaginal cells (Jones and Leon
2004; Stombaugh and Kearney 1987).
Immunochromatography examinations are known as potential menstrual blood
checks for D-dimers, fibrin which is soluble and degradation drug medically
identified for thrombosis diagnosis (Baker et al. 2011; Holtkoetter et al. 2015).
One different method ELISA is utilized which focuses on estrogen receptor α and
fibrinogen to differentiate the peripheral blood from menstrual blood, whereas none
of the other body fluids showed any cross reactions (Gray et al. 2012).
5.8 Urine
5.9 Sweat
The identification and characterization of common markers are the basis for ELISA
and immunochromatographic studies. 2-DHPLC, MS, and QMS were all inured to
establish protein profiles typical of all six primary forensically important body fluids
i.e., blood, menstrual blood, saliva, semen, vaginal substance, and skin and also
acquire new candidate protein markers for instance osteopontin and uromodulin to
identify urine (Legg et al. 2014). Statherin in Saliva and Semenogelin 1 and 2 in
Seminal fluids are used for the examination of mRNA as markers.
Ribo Nucleic Acid (RNA) and Deoxyribo Nucleic Acid (DNA) are being used
progressively for so many new forensic applications, including: body fluid detection,
assessing postmortem and age decay of RNA; the estimation of injury age through
the analysis of reactive gene expression changes; and determining the cause of death
(Bauer et al. 2003; Anderson et al. 2010; Cecchi 2010; Palagummi et al. 2014).
These approaches including the utilization of messenger RNA, micro RNA, other
forms DNA methylation, and microbial characterization of each and everybody
fluid.
The list of potent markers in various body fluids identified using RNA- and
DNA-based methods are given in Table 5.1.
Most of the body fluids contain several types of cells, each expressing an individual
mRNA transcript pattern. The layout and carrying out of mRNA profiling in research
associated to forensic science is focused on using these multicellular transcriptomes.
mRNA in body fluids deposited on a range of surfaces is now generally understood
to be stable and can be collected in an appropriate quantity and consistency for
analysis of various samples (Bauer et al. 1999; Setzer et al. 2008; Visser et al. 2011;
Kohlmeier and Schneider 2012; Fox et al. 2014; Alvarez et al. 2004).
A benefit of mRNA profiling is that the recovery of RNA from tissues, with a
variety of specific RNA extraction procedures, can be incorporated into a standard
workflow of DNA profiling.
Generalizations between different commercial RNA removal methods have
revealed different yields and diagnose of DNA and RNA, of no better solution
than the other; collective studies have confirmed this finding. The enormous amount
of transcript and consistency by means of substitute markers designed for the
identical fluid with unlike susceptibilities in the same body are attributed to the
capability to detect a messenger RNA transcript that is of significance (Zubakov
et al. 2008; Haas et al. 2014, 2015, 2011; Van den Berge et al. 2014; Fleming and
5 RNA- and DNA-Based Identification of Body Fluids 93
Table 5.1 List of potential markers in various body fluids with their chromosomal location
Body fluid Markers Official symbol Chromosomal location
Blood Ankyrin 1 ANK 1 8p11.21
Glycophorin A GYPA 4q31.21
Beta-spectrin SPTBN1 2p16.2
Alpha hemoglobulin HBA 16p13.3
Beta hemoglobulin HBB 11p15.4
Porphobilinogen deaminase HMBS 11q23.3
Amino-levulinate synthase 2 ALAS2 Xp11.21
Seminal fluid Protamine 1 PRM 1 16p13.13
Protamine 2 PRM 2 16p13.13
Saliva Histatin HTN 4q13.3
Statherin STATH 4q13.3
Vaginal fluid Beta-defensin 1 DEFB1 8p23.1
Mucin 4 MUC4 3q29
Cytochrome P450 CYP2B7P1 19q13.2
Myozenin 1 MYOZ1 10q22.2
Menstrual blood Matrix metallopeptidase 7 MMP7 11q22.2
Matrix metallopeptidase 11 MMP11 22q11.23
Epidermal cells Late cornified envelope 1 C LCE1C 1q21.3
Loricrin LOR 1q21.3
Harbison 2010a, b; Lindenbergh et al. 2012, 2013a, b). In presumptive tests where
these comparisons are made, mRNA profiling is comparable (Haas et al. 2011).
The creation of a robust mRNA quantification method will boost RNA profiling;
excessive template leads to target amplification and an increased incidence of
“nonspecific artifact” (Haas et al. 2011). The present steps are applied to the entire
nucleic acid or Ribo Nucleic Acid which happen to be not human specific and
quantified mostly by utilizing techniques like UV-Visible spectrometry, fluorometry,
Nanodrop ND-1000, Agilent 2100 Bioanalyzer System, or Quant-iTMRiboGreen®
RNA kits (Visser et al. 2011; Grabmuller et al. 2015; Fleming and Harbison
2010a, b; Juusola and Ballantyne 2005).
A flexible method of analysing low-abundance mRNA extracted from minute
amount of samples is by reverse transcriptase polymerase chain reaction (RT-PCR)
(Kohlmeier and Schneider 2012; Zubakov et al. 2008; Fleming and Harbison
2010a, b; Hanson et al. 2012; Haas et al. 2009; Bustin 2000; Juusola and Ballantyne
2007). The most reasonable approach in forensic work is the endpoint reverse
transcriptase PCR in conjunction with capillary electrophoresis, which allows the
concurrent finding of multiple body fluids and thereby minimizes sample utility and
background impacts. Juusola and Ballantyne first introduced this approach in 2005,
followed by others (Fleming and Harbison 2010a, b; Lindenbergh et al. 2012,
2013a, b; Juusola and Ballantyne 2005; Richard et al. 2012; Roeder and Haas
2013). The quantitative RT-PCR (qRT-PCR) measures the variation in between
the focused transcript and a household gene called the ΔCT (Zubakov et al. 2008;
94 A. Rao et al.
Bustin 2000; Juusola and Ballantyne 2007; Nussbaumer et al. 2006). The benefit of
this very reactive method is the possibility of setting numerical thresholds. The
existing dyes limitation, which limits the sum of markers that will be able to reach in
a solo reaction, represents a disadvantage. In order to address this constraint,
enhancements were suggested, such as a high-resolution melting study (Hanson
and Ballantyne 2013a, b).
Findings between RT-PCR and qRT-PCR indicate that perhaps the detected
abundance of mRNA transcript to a large or small DNA portion (Van den Berge
et al. 2014; Harteveld et al. 2013) can still not be allocated with any of these
methods. New techniques have recently been developed such as isothermal amplifi-
cation mediated by real-time RT loops, offering the same sensitivity and precision
but then much simpler and faster studies (Su et al. 2015). The housekeeping genes
constitutively expressed make available a reference point and determine the effi-
ciency of a reaction by means of capillary electrophoresis approaches, and they are
important in quantitative techniques (Bustin 2000; Moreno et al. 2012).
The desired housekeeping genes expressing themselves across all tissues, need
not be different substantially between people and is not greatly influenced by
physiological/pathologic problems. A variety of housekeeping genes, including
ACTB, GAPDH, B2M, S15, UCE, TEF, UBC, 18S RNA and G6PD, are being
used in forensic research (Zubakov et al. 2008; Haas et al. 2014; Fleming and
Harbison 2010a, b; Lindenbergh et al. 2012, 2013a, b; Juusola and Ballantyne
2007; Roeder and Haas 2013; Moreno et al. 2012; Jakubowska et al. 2013; Donfack
and Wiley 2015).
Even between similar samples, RT-PCR can show significant variation. This may
be caused by many factors including different secondary structures of RNA
transcripts, stochastic variations in samples, and inhibition and consistency of
RNA. Housekeeping genes is no exemption and there is overall conformity that
the quantity of transcripts will differ from individual to individual in different fluid
(Fleming and Harbison 2010a, b; Roeder and Haas 2013; Bustin et al. 2005; Park
et al. 2007) e.g., the prevalence of the household genes relative toward the body fluid
as specific genes in buccal cells and semen is quite small and there is probably hardly
any appropriate housekeeping gene meant for every single body fluid. The messen-
ger RNA (mRNA) markers are chosen from a candidate gene method for which the
gene function is normally known (Fleming and Harbison 2010a, b; Lindenbergh
et al. 2012, 2013a, b; Juusola and Ballantyne 2005). Instead, a discovery technique
such as a comparative multicellular transcriptome analysis based on the microarray
or RNA sequencing (transcriptome) analysis can be employed (Zubakov et al. 2008;
Park et al. 2013a, b; Hanson and Ballantyne 2013a, b). Candidate markers dependent
on the specific role of a body fluid, such as hemoglobin, are often more prone to be
precisely expressed.
Furthermost, commonly suggested blood RNA markers may typically classified
proteins involved including the erythrocyte membrane (such as glycophorin A, beta-
spectrin, and ankyrin 1) and the proteins allied with hgb and hemic biosynthesis
(such as α and β hemoglobins, porphobilinogen deaminase and (ALAS 2) amino-
levulinate synthase 2). In the afore-mentioned immunological tests, some proteins
5 RNA- and DNA-Based Identification of Body Fluids 95
(e.g., Glycophorin A) are being used. The tissues, for instance menstrual blood and
saliva, can be classified as being nonspecific due to trace levels of blood markers in
them (Kohlmeier and Schneider 2012; Zubakov et al. 2008; Fleming and Harbison
2010a, b; Lindenbergh et al. 2012; Juusola and Ballantyne 2005; Haas et al. 2009;
Richard et al. 2012; Roeder and Haas 2013; Jakubowska et al. 2013; Donfack and
Wiley 2015; Park et al. 2013a, b).
Protamines—PRM1 and PRM2—are most frequently used for sperm identifica-
tion, and transglutaminases 4 and semenogelines 1 and 2 for seminal fluids include
seminal fluid and spermatozoa markers. Semenogelin is a substratum used by some
for PSA/P30/kallikrein 3. Specific markers also show little, or no, cross-reactivity
(Kohlmeier and Schneider 2012; Fleming and Harbison 2010a, b; Lindenbergh et al.
2012; Juusola and Ballantyne 2005; Haas et al. 2009; Richard et al. 2012; Roeder
and Haas 2013; Nussbaumer et al. 2006; Donfack and Wiley 2015; Park et al.
2013a, b). Among the four peptide groups, statherin and histatin are preferred as
Ribo Nucleic Acid markers for saliva, divided by the salivary glands into saliva. A
significant proportion of the overall salivary peptides contain three proline-rich
proteins. Some keratins were also used (Zubakov et al. 2008; Fleming and Harbison
2010a, b; Lindenbergh et al. 2012; Juusola and Ballantyne 2005, 2007; Haas et al.
2009; Richard et al. 2012; Roeder and Haas 2013; Donfack and Wiley 2015; Park
et al. 2013a, b; Sakurada et al. 2011). In factors such as the daily routine and personal
circumstances of the person are affected by both the amount and content of such
peptides and the complete length and partly damaged mRNA transcripts observed in
saliva and many authors also reported that there can be a wide variability, along with
small amounts of RNA in samples of saliva (Fleming and Harbison 2010a, b; Haas
et al. 2009). Statherin allows to be observed at high levels in nasal secretions and at
low levels in vaginal secretions often.
A specific problem is the differentiation of stratified squamous cells in the skin,
vagina, and mouth, since they are strongly connected structurally. Because of the
similar functionality (protection and secretion) of these cell types, it is difficult to
find observable distinctions between them, especially in non-keratinized oral and
vaginal cells.
The fluid in which the menstrual fluid curves, cervix, endometrium, and fallopian
tubes, and blood differ according to age and health conditions comprises the vaginal
fluid. Early vaginal marker candidates, human beta-defense 1 and mucine 4, are
indeed reliably represented in vaginal secretions, they were also found to be in nasal
secretions, semen, and saliva. These can be used as mucosal markers better (Sijen
2015; Haas et al. 2014; Lindenbergh et al. 2012; Juusola and Ballantyne 2005;
Richard et al. 2012; Roeder and Haas 2013; Donfack and Wiley 2015; Hanson and
Ballantyne 2013a, b; Cossu et al. 2009). Recently, two other candidates’ genes
MYOZ1 and CYP2B7P1, equally appearing responsive markers were found using
transcriptome profiling. CYP2B7P1 has not been identified with any cross-
reactivity, although a skeletal muscle protein, MYOZ1 localized in the tongue,
was noticed in saliva (Hanson et al. 2012). Most authors have been used to classify
vaginal material by microflora, which is defined in the following document
(Giampaoli et al. 2014).
96 A. Rao et al.
5.13 NanoString®
NanoString® nCotunter is a tool for recording and counting of the various mRNA
transcripts, which can use color-coded molecular bar codes to measure the expres-
sion of up to 800 mRNA applicants with one reaction (Malkov et al. 2009;
Brumbaugh et al. 2011). In recent times, NanoString® used as a tool for
distinguishing body fluid with the utilization of messenger RNA in criminal
research. In the first test, 18 mRNAs unique to body fluid and two endogenous
controls were used. Throughout the study, a total RNA was used and the counts of
housekeeping gene GAPDH were normalized. The use of body fluid-based markers
for blood and semen were correctly identified, but the vaginal marker and the mRNA
for saliva were not reliable (Park et al. 2013a, b). In a study a wide variety of
different specimens, including total RRNA extracted from body fluids, were
analysed using direct cell lysates with 23 messenger RNA markers and ten
5 RNA- and DNA-Based Identification of Body Fluids 97
housekeeping genes (Danaher et al. 2015). Samples out of a solo source of semen,
blood, menstrual blood, skin, and vaginal secretions, every part of which showed
gene expression specific to body fluid using an algorithm and maximum likelihood
calculations. Once again, the use of this technique made saliva samples troublesome.
There are a wide range of different messenger RNA markers have been projected
being sensitive and specific in support of body fluids detection in criminal cases and
have also proven their stability in the different stored samples over longer period of
time (Zubakov et al. 2009; Setzer et al. 2008). The recently introduced micro RNA
(miRNA) markers have explored to be alternate tool for body fluids detection in
criminal cases (Zubakov et al. 2010). Non-coding RNA molecules are miRNAs that
are of 18–25 nucleotides length which regulates expression of gene at the post
transcription levels and is also reported that several miRNAs have tissue-specific
expression patterns (Bartel 2004; Jost et al. 2011). Additionally, the very small
strands of miRNA markers make them very less susceptible to dreadful conditions
by environmental factors, which offer advantage biomarkers for body fluids identi-
fication than mRNA markers (Hanson et al. 2009).
The foremost microRNA profiling to criminalistics was reported by Hanson et al.
in 2009, and assessed the miRNA expression in biological fluids relevant to forensic
approach. Using qRT-PCR analysis he explored the expression of 452 human micro
RNAs in saliva, blood, semen, menstrual blood and vaginal fluids. They have
characterized nine microRNA markers viz. miR451, miR135b, miR16, miR10b,
miR205, miR124a, miR658, miR412, and miR372—these markers are expressed
distinctively in genetic experiments related to forensic cases, and have also
established their competences to detect body fluids utilizing as minute as 50 pg of
whole RNA. Zubakov et al. in 2010 have also reported the expression degrees of
718 microRNAs in biological fluids addressed to forensic utilizing genome-based
microarrays and recognized 14 distinctive markers for possible body fluid identifi-
cation. In this authentication test using qRT-PCR, merely blood and semen exclusive
microRNA candidates indicated similar expression degrees, whereas fewer
similarities were identified intended for vaginal secretions, menstrual blood, and
saliva. Another study which was designed similarly but including skin cells was also
reported. In this study they identified 14 new markers which revealed suitable body
fluid exclusive expression arrays and also reported that microRNA-4761-5p can
distinct skin cells and menstrual blood; microRNA-137 can make a distinction
between cells of skin, peripheral blood and saliva; microRNA-4473 can individual-
ize semen and skin cells; microRNA-585-3p can separate vaginal secretion from
skin cells (Luo et al. 2015).
98 A. Rao et al.
The discovery of entire genome studies specified that the genetic material called
DNA relays tissue-distinctive methylation arrays, the possibilities of tissue-
specificity DNA methylation has been intended for examination of different body
fluids identification in forensic fields (Frumkin et al. 2011; Lee et al. 2012). DNA
methylation patterns took place at the CpG dinucleotides-50 position of pyrimidine
ring of cytosine, is largely supposed to express the genes of particular body fluids
(Miranda and Jones 2007). The DNA methylation arrays observed will be depends
upon the different types of cells and chromosome portions called tissue-distinctive
Differentially Methylated Regions (tDMRS) are identified to spectacle unique DNA
methylation profiles. Accordingly, the recognition of DNA methylation at a CpG
location of Differentially Methylated Regions (tDMR) allows for the tissue or else
cell-specific kind of samples of DNA (Byun et al. 2009; Ohgane et al. 2008).
Around 2011, Frumkin et al. described 15 genomic loci to identify saliva, semen,
blood, skin, epidermis, vaginal secretions and urine. Within this research they
applied methylation sensitive restriction enzyme PCR (MSRE-PCR) designed
using an assay for certain markers which are composed up of methylation sensitive
restriction enzyme. These types of restriction enzymes digest the samples of DNA
subsequently multiplex PCR reactions of specified loci of genomic DNA with
fluorescently marked primers, followed by capillary electrophoresis of amplified
products using programmed signal detection method. These particularly designed
assays can be easily incorporated in forensic science laboratories like other
techniques of DNA typing viz. SniPS (SNPs), microsatellites or Short Tandem
Repeats (STRs) which would positively identify the source tissues. Similarly,
Wasserstrom et al. (2013) reported with the advance methodology by build-up a
kit, DNA source identifier (DSI)-Semen™, which was designed to substitute the
microscopic investigation of sperm cells for identification of semen in forensic DNA
samples. This kit was designed on the basis to detect the semen-distinctive DNA
methylation arrays at five genomic loci utilizing MSRE-PCR. The source kit was
ratified with 135 samples of different body fluids and 33 case evidences from
forensic laboratory, which was verified to be vigorous and consistent by presenting
a positive outcome for samples of semen as minute as 31 pg of DNA template (Madi
et al. 2012). In another research carried out by Lee et al. studied the tissue-distinctive
Differentially Methylated Regions possibility for forensic body fluids detection by
bisulfite sequencing approach, which regulates the methylation of DNA via
detecting the nucleotide base alteration as a result of treatment of sodium bisulfite.
Treatment Bisulfite does not affect any methylated cytosine instead alters free or else
unmethylated cytosine of CpG into uracil, which converts into thymine during the
PCR reaction. By means of this methodology, they generated five tDRMs profiles in
combined DNA samples from saliva, blood, menstrual blood, semen, and vaginal
fluids. The tDRMs for USP49 and DACT1 existed recognized as an exclusive
marker for semen—by revealing semen-distinctive hypomethylation and PFN3
tDMR was preferred to characterize the vaginal fluids. In a recent approach proposed
by Madi et al. illustrated the tissue-restricted DNA methylation in biological body
5 RNA- and DNA-Based Identification of Body Fluids 99
fluids which are forensically relevant including saliva, blood, epithelial cells, and
semen. They identified a limited genomic locus with bisulfite modified method and
pyrosequencing technique to observe that the methylation arrays at the FGF7 and
ZC3H12D loci can distinguish the semen sample from more genetic samples
although locus—C20 and BCAs4 can distinguish the saliva and blood samples as
of other biological fluids separately. The outcomes as well specify the DNA
methylation-based methods are invaluable tool for the detection of biological fluids
in criminal cases.
Another method for identifying biological fluid ensues classification of specific cells
by marking the cells in combination with a microscopy at a protein, DNA, and RNA
level. In the case of immunohistochemistry, epidermal cells have been identified and
cytokeratin’s are used to differentiate between vaginal and mouth mucosal cells
(Schulz et al. 2010; Paterson et al. 2006).
As compared directly to epidermal cells, cells of mucosal origin may be distin-
guished since each cytokeratin has a low expression of the other type of cell. In a
different method, immunofluorescence has been suggested for the on-site recogni-
tion of human blood with fluorescently tagged antihuman antibodies, nuclear
(CD45, myeloperoxidase, histone 1), and (glycophorin A) while several washing
steps may find this method unworkable for forensic work (Thorogate et al. 2008).
XY Fluorescent In Situ Hybridisation (FISH) combined with Laser Microdissection
(LMD) and DNA profiling has been shown to be an efficient way of extracting the
data from specific cell groups marked with fluorescent labels, i.e., chromosomes X
and Y (Lynch et al. 2015).
ESR1 (Estrogen Receptor 1) with fluorescently labeled monoclonal antibodies
has been shown to be able to differentiate between vaginal and buccal epithelial cells
with this marker if messenger RNA profiling is out of the question. This displays the
expression of messenger RNA and tissue-specific protein are not always
interconnected (Fleming et al. 2013).
RNA suspension FISH are used to classify and detect epithelial cells using keratin
10 with the fluorescent label LNA sample; subsequently, the epithelial cells were
isolated by LMD and profiled with DNA (Williams et al. 2014). While these labeling
methods that tend to be accurate, the longer time taken to specifically gather labeled
cells by LMD illustrates, instead for general applications, these methods are presum-
ably restricted to particular cases.
5.17 Conclusion
Many forensic laboratories are still in practice with the chemical methods, antigen–
antibody reaction, catalytic reactions, while the current DNA profiling methods are
based on STR profiling which allows personal identity of sample donor. A recent
100 A. Rao et al.
advance in forensics has advocated the usage of other types of evidences which add
more information to the collected evidences. Particularly in recent times several
markers have existed for body fluids detection in forensic community. mRNA
markers usage in recent times have been utmost meticulously explored with the
number of different markers which is sufficient for the body fluids identification in
forensic perspective. The currently used methods have possible approaches for the
quick detection of biological fluids, but then again in majority of the cases tissue-
specific identification is difficult due to cross overreaction with other biological body
fluids present at the crime scene. In this scenario mRNA marker appears as high
sensitivity and tissue specificity for forensic analysis with a new method to over-
power the boundaries of established methods. Similarly, micro RNA methods have
explored to be alternative tool for body fluids identification in forensics. microRNA
profiling has the capabilities to identify or to differentiate the different body fluids
traced at the crime scene. In recent times, profiling through DNA methylation was
recommended as a novel means in criminal cases involving body fluids detection.
Like messenger and micro RNA profiling, DNA methylation profiling as well
appeared highly sensitive and specific, for the parallel assessment of several markers
particular for different tissues in a definite multiplex reaction. In the coming future,
forensic examinations have to progress with a huge deal as the encroachments in
molecular biology studies and forensic genetics.
References
Akutsu T, Watanabe K, Sakurada K (2012a) Specificity, sensitivity, and operability of RSID™--
urine for forensic identification of urine: comparison with ELISA for Tamm-Horsfall protein. J
Forensic Sci 57:1570–1573
Akutsu T, Motani H, Watanabe K, Iwase H, Sakurada K (2012b) Detection of bacterial 16S
ribosomal RNA genes for forensic identification of vaginal fluid. Legal Med 14:160–162
Alvarez M, Juusola J, Ballantyne J (2004) An mRNA and DNA co-isolation method for forensic
casework samples. Anal Biochem 335:289–298
Anderson SE, Hobbs GR, Bishop CP (2010) Multivariate analysis for estimating the age of a
bloodstain. J Forensic Sci 56:186–193
Auvdel ML (1986) Amylase levels in semen and saliva stains. J Forensic Sci 31:426–431
Baker DJ, Grimes EA, Hopwood AJ (2011) D-dimer assays for the identification of menstrual
blood. Forensic Sci Int 212:210–214
Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116:281–297
Bauer M, Kraus A, Patzelt D (1999) Detection of epithelial cells in dried bloodstains by reverse
transcriptase polymerase chain reaction. J Forensic Sci 44:1232–1236
Bauer M, Gramlich I, Polzin S, Patzelt D (2003) Quantification of mRNA degradation as possible
indicator of postmortem interval – a pilot study. Legal Med 5:220–227
Boward ES, Wilson SL (2013) A comparison of ABAcard® p30 and RSID™-semen test kits for
forensic semen identification. J Forensic Legal Med 20:1126–1130
Brumbaugh CD, Kim HJ, Giovacchini M, Pourmand N (2011) NanoStriDE: normalization and
differential expression analysis of NanoString nCounter data. BMC Bioinformatics 12:479
Bustin SA (2000) Absolute quantification of mRNA using real time reverse transcription polymer-
ase chain reaction assays. J Mol Endocrinol 25:169–193
Bustin SA, Benes V, Nolan T, Pfaffl MW (2005) Quantitative real time RT PCR – a perspective. J
Mol Endocrinol 34:597–601
5 RNA- and DNA-Based Identification of Body Fluids 101
Byun HM, Siegmund KD, Pan F, Weisenberger DJ, Kanel G, Laird PW, Yang AS (2009)
Epigenetic profiling of somatic tissues from human autopsy specimens identifies tissue- and
individual-specific DNA methylation patterns. Hum Mol Genet 18:4808–4817
Casey DG, Price J (2010) The sensitivity and specificity of the RSID™ saliva kit for the detection of
human salivary amylase in the forensic science laboratory, Dublin, Ireland. Forensic Sci Int
194:67–71
Cecchi R (2010) Estimating wound age: looking into the future. Int J Legal Med 124:523–536
Cossu C, Germann U, Kratzer A, Baer W, Haas C (2009) How specific are the vaginal secretion
mRNA markers HBD1 and MUC4. Forensic Sci Int Genet Suppl Ser 2:536–537
Cox M (1991) A study of the sensitivity and specificity of four presumptive tests for blood. J
Forensic Sci 36:1503–1511
Danaher P, White RL, Hanson EK, Ballantyne J (2015) Facile semi-automated forensic body fluid
identification by multiplex solution hybridization of NanoString® barcode probes to specific
mRNA targets. Forensic Sci Int Genet 14:18–30
Donfack J, Wiley A (2015) Mass spectrometry based cDNA profiling as a potential tool for body
fluid identification. Forensic Sci Int Genet 16:112–120
Fleming RI, Harbison SA (2010a) The development of an mRNA multiplex RT-PCR assay for the
definitive identification of body fluids. Forensic Sci Int Genet 4:244–256
Fleming RI, Harbison SA (2010b) The use of bacteria for the identification of vaginal secretions.
Forensic Sci Int Genet 4:311–315
Fleming RI, Harbison SA, Lin MH (2013) New RNA methods for the identification of body fluids
and cell types. Forensic Sci Int Genet Suppl Ser 4:e87–e88
Fox A, Gittos M, Harbison SA, Fleming R, Wivell R (2014) Exploring the recovery and detection
of messenger RNA and DNA from enhanced fingermarks in blood. Sci Justice 54:192–198
Frumkin D, Wasserstrom A, Budowle B, Davidson A (2011) DNA methylation-based forensic
tissue identification. Forensic Sci Int Genet 5:517–524
Gaensslen RE (1983) Sourcebook in forensic serology, immunology and biochemistry. US Depart-
ment of Justice, Washington, DC
Giampaoli S, Alessandrini F, Berti A et al (2014) Forensic interlaboratory exercise of the For
FLUID kit for vaginal fluids identification. J Forensic Legal Med 21:60–63
Grabmuller M, Madea B, Courts C (2015) Comparative evaluation of different extraction and
quantification methods for forensic RNA analysis. Forensic Sci Int Genet 16:195–202
Graves HCB (1995) Non prostatic sources of protein-specific antigen: a steroid hormone dependent
phenomenon? Clin Chem 41:7–9
Gray D, Frascione N, Daniel B (2012) Development of an immunoassay for the differentiation of
menstrual blood from peripheral blood. Forensic Sci Int 220:12–18
Haas C, Klesser B, Maake C, Bar W, Kratzer A (2009) mRNA profiling for body fluid identification
by reverse transcription endpoint PCR and real time PCR. Forensic Sci Int Genet 3:80–88
Haas C, Hanson E, Kratzer A, Bar W, Ballantyne J (2011) Selection of highly specific and sensitive
mRNA biomarkers for the identification of blood. Forensic Sci Int Genet 5:449–458
Haas C, Hanson E, Anjos MJ et al (2014) RNA/DNA co-analysis from human menstrual blood and
vaginal secretion stains: results of a fourth and fifth collaborative EDNAP exercise. Forensic Sci
Int Genet 8:203–212
Haas C, Hanson E, Banemann R et al (2015) RNA/DNA co-analysis from human skin and contact
traces – results of a sixth collaborative EDNAP exercise. Forensic Sci Int Genet 16:139–147
Hanson EK, Ballantyne J (2013a) Multiplex high resolution melt (HRM) messenger RNA profiling
analyses for body fluid identification. Forensic Sci Int Genet Suppl Ser 4:e125–e126
Hanson EK, Ballantyne J (2013b) Highly specific mRNA biomarkers for the identification of
vaginal secretions in sexual assault investigations. Sci Justice 53:14–22
Hanson EK, Lubenow H, Ballantyne J (2009) Identification of forensically relevant body fluids
using a panel of differentially expressed microRNAs. Anal Biochem 387:303–314
Hanson E, Haas C, Jucker R, Ballantyne J (2012) Specific and sensitive mRNA biomarkers for the
identification of skin in “tough” DNA evidence. Forensic Sci Int Genet 6:548–558
102 A. Rao et al.
Harteveld J, Lindenbergh A, Sijen T (2013) RNA cell typing and DNA profiling of mixed samples:
can cell types and donors be associated? Sci Justice 53:261–269
Holtkoetter H, Dierig L, Schuerenkamp M, Sibbing U, Pfeiffer H, Vennemann M (2015) Validation
of an immunochromatographic D-dimer test to presumptively identify menstrual fluid in
forensic exhibits. Int J Legal Med 129:37–41
Huang CT, Chen ML, Huang LL, Mao IF (2002) Uric acid and urea in human sweat. Chin J Phys
45:109–115
Jakubowska J, Maciejewska A, Pawlowski R, Bielawski KP (2013) mRNA profiling for vaginal
fluid and menstrual blood identification. Forensic Sci Int Genet 7:272–278
Johnston S, Newman J, Frappier R (2003) Validation study of the Abacus Diagnostics ABAcard®
Hematrace® membrane test for the forensic identification of human blood. Can Soc Forensic Sci
J 36:173–183
Jones EL Jr, Leon JA (2004) Lugol’s test re-examined again: buccal cells. J Forensic Sci 49:64–67
Jost D, Nowojewski A, Levine E (2011) Small RNA biology is systems biology. BMB Rep
44:11–21
Juusola J, Ballantyne J (2005) Multiplex mRNA profiling for the identification of body fluids.
Forensic Sci Int 152:1–12
Juusola J, Ballantyne J (2007) mRNA profiling for body fluid identification by multiplex quantita-
tive RT-PCR. J Forensic Sci 52:1252–1262
Keating SM, Higgs DF (1994) The detection of amylase on swabs from sexual assault cases. J
Forensic Sci Soc 34:89–93
Kind SS (1957) The use of the acid phosphatase test in searching for seminal stains. J Crim Law
Criminol Police Sci 47:597–600
Kipps AE, Whitehead PN (1975) The significance of amylase in forensic investigations of body
fluids. Forensic Sci 6:137–144
Kobus HJ, Silenieks E, Scharnberg J (2002) Improving the effectiveness of fluorescence for the
detection of seminal stains on fabrics. J Forensic Sci 47:819–823
Kohlmeier F, Schneider PM (2012) Successful RNA profiling of 23 year old blood stains. Forensic
Sci Int Genet 6:274–276
Lee HY, Park MJ, Choi A, An JH, Yang WI, Shin KJ (2012) Potential forensic application of DNA
methylation profiling to body fluid identification. Int J Legal Med 126:55–62
Legg KM, Powell R, Reisdorph N, Reisdorph R, Danielson PB (2014) Discovery of highly specific
protein markers for the identification of biological stains. Electrophoresis 35:3069–3078
Liang T, Roy R (2014) Ultraviolet-visible spectrophotometry (UV-VIS) and SALIgAE® qualita-
tive and semi-quantitative tools for the analysis of salivary amylase. J Forensic Res 5:247
Lin MH, Jones DF, Fleming R (2015) Transcriptomic analysis of degraded forensic body fluids.
Forensic Sci Int Genet 17:35–42
Lindenbergh A, De Pagter M, Ramdayal G et al (2012) A multiplex (m)RNA profiling system for
the forensic identification of body fluids and contact traces. Forensic Sci Int Genet 6:565–577
Lindenbergh A, Van den Berge M, Oostra RJ et al (2013a) Development of a mRNA profiling
multiplex from the inference of organ tissues. Int J Legal Med 127:891–900
Lindenbergh A, Maaskant P, Sijen T (2013b) Implementation of RNA profiling in forensic
casework. Forensic Sci Int Genet 7:159–166
Lunetta P, Sippel H (2009) Positive prostate-specific antigen (PSA) reaction in post mortem rectal
swabs: a cautionary note. J Forensic Legal Med 16:397–399
Luo XY, Li ZL, Peng D, Wang L, Zhang L, Liang WB (2015) MicroRNA markers for forensic
body fluid identification obtained from miRCURYTM LNA array. Forensic Sci Int Genet Suppl
Ser 5:e630–e632
Lynch L, Gamblin A, Vintiner S, Simons J (2015) STR profiling of epithelial cells identified by X/Y
FISH labelling and laser microdissection using standard and elevated PCR conditions. Forensic
Sci Int Genet 16:1–7
5 RNA- and DNA-Based Identification of Body Fluids 103
Schulz MM, Buschner MGD, Leidig R et al (2010) A new approach to the investigation of sexual
offenses-cytoskeleton analysis reveals the origin of cells found on forensic swabs. J Forensic Sci
55:492–498
Schweers BA, Old J, Boonlayangoor PW, Reich KA (2008) Developmental validation of a novel
lateral flow strip test for rapid identification of human blood (Rapid Stain Identification™--
blood). Forensic Sci Int Genet 2:243–247
Setzer M, Juusola J, Ballantyne J (2008) Recovery and stability of RNA in vaginal swabs and blood,
semen and saliva stains. J Forensic Sci 53:296–305
Simich JP, Morris SL, Klick RL et al (1999) Validation of the use of a commercially available kit
for the identification of prostate specific antigen (PSA) in semen stains. J Forensic Sci
44:1229–1231
Simons JL, Vintiner SK (2012) Efficacy of several candidate protein biomarkers in the differentia-
tion of vaginal from buccal epithelial cells. J Forensic Sci 57:1585–1590
Stombaugh PM, Kearney JJ (1987) Factors affecting the use of lactate dehydrogenase as a means of
bloodstain differentiation. J Forensic Sci 23:94–105
Su CW, Li CY, Lee JCI et al (2015) A novel application of real-time RT-LAMP for body fluid
identification: using HBB detection as the model. Forensic Sci Med Pathol 11(2):208–215
Thorogate R, Moreira JCS, Jickells S, Miele MMP, Daniel B (2008) A novel fluorescence-based
method in forensic science for the detection of blood in situ. Forensic Sci Int Genet 2:363–371
Tobe SS, Watson N, Daeid NN (2007) Evaluation of six presumptive tests for blood, their
specificity, sensitivity, and effect on high molecular-weight DNA. J Forensic Sci 52:102–109
Van den Berge M, Carracedo A, Gomes I et al (2014) A collaborative European exercise on mRNA-
based body fluid/skin typing and interpretation of DNA and RNA results. Forensic Sci Int Genet
10:40–48
Vandenberg N, van Oorshot RAH (2006) The use of Polilight in the detection of seminal fluid,
saliva and bloodstains and comparison with conventional chemical based screening tests. J
Forensic Sci 51:361–370
Virkler K, Lednev IK (2009) Analysis of body fluids for forensic purposes: from laboratory testing
to non-destructive rapid confirmatory identification at a crime scene. Forensic Sci Int 188:1–17
Visser M, Zubakov D, Ballantyne KA, Kayser M (2011) mRNA based skin identification for
forensic applications. Int J Legal Med 125:253–263
Wasserstrom A, Frumkin D, Davidson A, Shpitzen M, Herman Y, Gafny R (2013) Demonstration
of DSI-semen—a novel DNA methylation-based forensic semen identification assay. Forensic
Sci Int Genet 7:136–142
Webb JL, Creamer TI, Quickenden TI (2006) A comparison of the presumptive luminol test for
blood with four non-chemiluminescent forensic techniques. J Forensic Sci 51:361–370
Williams E, Lin MH, Harbison SA, Fleming RI (2014) The development of a method of suspension
RNA-FISH for forensically relevant epithelial cells using LNA probes. Forensic Sci Int Genet
9:85–92
Yu H, Diamandis EP (1995) Prostate specific antigen in milk of lactating women. Clin Chem
41:54–58
Zubakov D, Hanekamp E, Kokshoorn M, Van Ijcken W, Kayser M (2008) Stable mRNA markers
for identification of blood and saliva stains revealed from whole genome expression analysis of
time-wise degraded samples. Int J Legal Med 122:135–142
Zubakov D, Kokshoorn M, Kloosterman A, Kayser M (2009) New markers for old stains: stable
mRNA markers for blood and saliva identification from up to 16-year-old stains. Int J Legal
Med 123:71–74
Zubakov D, Boersma AW, Choi Y, van Kuijk PF, Wiemer EA, Kayser M (2010) MicroRNA
markers for forensic body fluid identification obtained from microarray screening and quantita-
tive RT-PCR confirmation. Int J Legal Med 124:217–226
Zubakov D, Kokmeijer I, Ralf A et al (2015) Towards simultaneous individual and tissue identifi-
cation: a proof-of-principle study on parallel sequencing of STRs, amelogenin, and mRNAs
with the Ion Torrent PGM. Forensic Sci Int Genet 17:122–128
Statistical Softwares Used in Evaluation
of Forensic DNA Typing 6
R. K. Kumawat, Aditi Mishra, and Pankaj Shrivastava
Abstract
Keywords
R. K. Kumawat (*)
DNA Division, State Forensic Science Laboratory, Rajasthan, Jaipur, India
A. Mishra
Raksha Shakti University, Ahmedabad, India
DNA Fingerprinting Unit, State Forensic Science Laboratory, Department of Home (Police),
Government of Madhya Pradesh, Sagar, Madhya Pradesh, India
P. Shrivastava
DNA Fingerprinting Unit, State Forensic Science Laboratory, Department of Home (Police),
Government of Madhya Pradesh, Sagar, Madhya Pradesh, India
6.1 Introduction
In forensic DNA typing, DNA profiles obtained from crime-related exhibits are used
to link or identify the accused, involve in the crime. As we know, that we do not have
DNA profiles of all the individuals living on the earth. So it is very difficult to
conclude that the DNA profiles obtained from crime-related exhibits are from the
same suspect individuals or is there someone another who might be actual criminal.
Might that suspect happen to match the DNA profiles with the crime-related
evidence? It is answered with the use of population data statistics, and it is necessary
to conclude from DNA testing about the matching or not matching of DNA profile
with crime evidence after calculating the possibility of a random match (Butler
2001). Population statistics is a powerful tool that deals in the measurement of the
uncertainty and provides the probability of random match. The population statistics
for the random match is usually estimated using the frequency of a particular
genotype (DNA) profile in a population. Frequency data of a population might be
prepared using DNA profiles of a small sample size of randomly selected individuals
residing in a particular geographic region. However, there are several software which
are being used in statistical evaluation of genetic data speedily. Recent and most
useful genetic data analysis software are presented as following in two categories.
GenAlEx: Genetic Analysis in Excel software (Peakall and Smouse 2006) is useful
for the analysis of co-dominant, haploid and binary genetic loci and DNA sequences.
This software performs analysis based on frequency and distance.
6 Statistical Softwares Used in Evaluation of Forensic DNA Typing 107
Arlequin software (Excoffier and Lischer 2010) is a useful tool for the analysis of
broad spectrum of genetic data i.e., STRs, RFLP, standard and frequency based data
to analyses inter and intrapopulation statistics.
FORSTAT (Ristow and D’Amato 2017), is a online tool which can be applied for
analysis of forensic importance parameters as well as population genetic analysis can
be done automated and reduced the time and labor. This software overcomes on the
limitations of the PowerStats software. It provides the results in numerical format as
well as graphical form to improve the visualization of the results. This software
needs input file in three digit formats for microvarinet alleles in STRs and two digit
formats for bialleic STR markers (Weblink: https://fdl-uwc.shinyapps.io/forstat/)
(Fig. 6.4).
FORSTAT online tool can calculate following allele frequency based parameters
in a single excel document:
• Homozygosity
• Observed and expected heterozygosity
• Polymorphic information of the genetic data
• Exclusion power
• Matching probability
• Discrimination power
• Paternity index
6 Statistical Softwares Used in Evaluation of Forensic DNA Typing 109
STRAF (Gouy and Zieger 2017) is an online accessing tool to analyze variety of
statistical analysis for genetic data from a single input file. For this software the input
file format needs to be in .txt format and first column should contain the identifica-
tion number of sample and second column needs to be the identification number of
population. This software can be applied to analyze diploid as well as haploid data
and it allows the microvariant alleles of STR data and 0 needs to be put for missing
data (http://cmpg.unibe.ch/shiny/STRAF/) (Fig. 6.5).
This software can perform following analysis:
• Allele frequency
• Gene diversity (GD)
• Observed and expected heterozygosity
• Polymorphic information (PIC)
• Exclusion power (PE)
• Probability of a match (MP)
• Discrimination power (PD)
• Paternity index (PI)
6 Statistical Softwares Used in Evaluation of Forensic DNA Typing 111
• HWE-P value
• LDE
• Principal component analysis (PCA)
POPTREE2 (Takezaki et al. 2009) software can be used for the construction of
phylogenetic tree based on genetic distances. The genetic distance based on allele
frequency of the compared population were used in this software. The boot strap test
is applied in this software to increase the acceptance level of the phylogenetic tree
(Saitou and Nei 1987; Sneath and Sokal 1973; Felsenstein 1985). In POPTREE2, all
the computations can be done through Windows-interface and the display of phylo-
genetic trees can easily be changed, copied to other applications, and printed by
using icons.
Distance measures that can be used for the phylogeny construction are as follows:
various genetic distances such as DA distance (Nei and Chesser 1983), Nei’s genetic
distance (Nei 1972), Fst distance (Latter 1972), (δμ)2 distance (Goldstein et al.
1995), and DSW distance (Shriver et al. 1995) can be used for construction of the
phylogenetic tree (Fig. 6.6).
The structure software (Evanno et al. 2005) is used for the analysis of population
structure using multi locus genetic markers, Restriction Fragment Length
Polymorphisms (RFLPs), and Single Nucleotide Polymorphism (SNPs). This soft-
ware can be used for inferring the distance among populations, identifying of
migrants, admixed, hybrid. To use this software, some parameters are to be set
6 Statistical Softwares Used in Evaluation of Forensic DNA Typing 113
before running it. To obtain acceptable delta K value, iterations should be set as
100 (Fig. 6.8).
There are several online haoplogroup predictor tools (Emmerova et al. 2017). Some
of the most useful tools/softwares are as follows:
Fig. 6.11 Image of home page of World Haplogroup & Haplo-‘I’ Subclade Predictor online
software
OSIRIS (Open Source Independent Review and Interpretation System) is the public
domain application software and considered in light of suggestions of the interdisci-
plinary directorate (Kinship and DNA Advisory Panel, KADAP) consolidated by the
116 R. K. Kumawat et al.
• Displacement (shifting)
• Sample-to-ladder fit for alleles
• Residual displacement (displaced shifting)
• Noise and baseline
• Artifacts
• Clinical testing
• Forensic casework
• Identification such as paternity testing
• Biosample identification
• Kinship analysis and
• Cell line authentication
• Training purposes
6 Statistical Softwares Used in Evaluation of Forensic DNA Typing 117
Apart from these applications, it is used in DNA profiling quality check, DNA
profile analysis, CODIS, automatic reanalysis, and process monitoring. OSIRIS
software is also compatible with mixture interpretation software (Riley et al. n.d.).
OSIRIS software works with all commercial marker systems leading companies
i.e., Applied Biosystems-Now Thermo Fisher scientific, Promega; Qiagen (Web
link: http://www.ncbi.nlm.nih.gov/projects/SNP/osiris/).
This is free software and available in R language. Forensim is a statistical tool being
used for the elucidation of forensic samples containing DNA mixtures (Haned
2011). This was the first open source software, dedicated toward the simulation of
forensic genetics data. It depends upon three object classes for the generation and the
storage of forensic casework data: genotypes, mixtures of DNA samples and allele
frequencies (Web link: http://forensim.r-forge.r-project.org/).
Forensim tool provides different features based on the simulation tools and
statistical tools.
Simulation methods are dedicated to the simulation of genetics data obtained
from forensic casework like:
• Individual genotypes
• Mixed DNA samples
• Individual genotypes (Fig. 6.15)
Statistical methods are dedicated to facilitating the evidentiary value of the DNA
exhibits: It is used to interpret: number of patron in the given mixed stain and to
address the statistical weight of mixed DNA stains. This package also includes some
other methods for statistical analysis:
Fig. 6.16 Image of home page of GenoProof Mixture 3 User Interface software
Genoproof Mixture 3 software is new software used by forensics expert for the
analysis of complex DNA mixtures. This software approach is a fully continuous
model which allows using all the available information of profile and thus increases
the mixture interpretation capabilities. Several other statistical methods are used for
the interpretation of samples containing complex DNA mixtures (Fig. 6.16) (Götz
et al. 2017).
The binary model only holds on presence but not on dropout/dropin events;
semicontinuous model consider for dropout/dropin events however, fully continuous
model not only consider the above events but also the other parameters such as:
prestutter ratio, fragment size, and peakheight. Genopoof Mixture software supports
all the three models for mixture interpretation. It is all in one software (weblink:
https://www.qualitype.de/en/solutions/products/evaluation-software/genoproof-mix
ture/genoproof-mixture-3/).
The following analysis can be done with Genopoof Mixture software:
• Probability of identity
• Data management
• Quality assurance
• Raw data analysis
• Biostatistical calculations
• Mixed sample analysis
120 R. K. Kumawat et al.
6.3.7 EuroForMix
The mixsep software (Tvedebrink 2013, 2011) is a forensic genetics statistical tool to
interpret mixed DNA samples using greedy algorithm. This software is able to
separate the DNA profiles of two or three persons and identification of individual
DNA profile is not influenced by the allele dropin and out, and stutter (Fig. 6.20).
The mixsep software contains six variables for data analysis namely; locus, allele,
height of allelic peak, area of allelic peak, base pair and dye.
However majority of the data are analyzed using first four variables and saved as
CSV file (weblink: http://cran.r-project.org/web/packages/mixsep/)
DNAMIX Software is the tool for forensic geneticist to calculate the likelihood
ratios from forensic samples containing mixed DNA stains. This tool calculates the
complex DNA mixtures and as well as single source contributors. The new version
DNAMIX v.3 is based on the John Storey’s DNAMIX v.1 and v.2. The formulas and
methods explained by Curran et al. 1999 are based on assumption of independence
of all allele’s proportions in the mixture by using Hardy-Weinberg and linkage
equilibrium. The assumptions are completely independence among individuals
however; within the same population low-level dependency between individuals is
ignored. The latest of DNAMIX v.2 is written in FORTRAN 90 and includes
population structure into the calculations. If θ is equal to 0, the likelihood ratios in
DNAMIX v.2 version will be equal to DNAMIX v.1 version (weblink: http://www.
biostat.washington.edu/~bsweir/DNAMIX3/webpage/).
6 Statistical Softwares Used in Evaluation of Forensic DNA Typing 123
Two important points should be remembered while using DNAMIX v.2 version:
large national database, SmartRank software keeps minimum rate of false negative
and false positive errors. This software is successful for searching voluminous DNA
database with complex/partial mixtures containing 0% dropout, 15 or 16 alleles and
maximum four unknown source however, not applicable on DNA containing 50%
dropout (Fig. 6.22) (Benschop et al. 2017).
SmartRank software calculates the likelihood ratio for each tested individual in
the DNA database and distributed for ranked genotypes. SmartRank software also
follows the same model behind LRmix Studio (web link: http://www.LRmixStudio.
org/SmartRank).
This software is used to generate DNA profiles from single or multiple polymerase
chain reactions using a system of soft and hard brackets. The major and minor
donors separated in the DNA profile using allelic balance threshold. In addition to
reproducible alleles, bracket method also permits the irreproducible alleles and keeps
them segregated from confirmed alleles with systems of brackets.
The DNA profile is constructed by the use of qualitative (allele calls) and
quantitative (peak heights) data. This DNA profile contains three layers: (1) a
dominant profile with duplicatable alleles, (2) reproducible alleles whose peak
6 Statistical Softwares Used in Evaluation of Forensic DNA Typing 125
heights are underneath the allelic balance variable threshold, and (3) alleles which
are non-reproducible. The balance of allelic threshold variable can be balanced
through the Graphical User Interface and will decide at what threshold alleles will
be appointed as related to a dominant profile or to a minor donor profile (Fig. 6.23)
(Bekaert et al. 2012).
The script needs information from at least a single PCR replicate of one STR
multiplex kit and can use a maximum of two replicates by two different STR
multiplex kits.
• Faster interpretation
• Easy accessible
• Easily understood in court
• Uses analytical threshold
• Model stutter and peak height
• Model dropout and drop-in
• Integrate DNA profiles from different kits in the same elucidation
126 R. K. Kumawat et al.
• To evaluate the authentic frequency for Y-STR and Y-SNP haplotypes with the
goal that they can be used in analysis of matches in forensic cases.
• It portrays the male ancestries to draw deduction about the causes and family of
human population.
• It provides all the tools and resources related to Y-STRs and Y-SNPs.
Most of the international journal published only those Y-haplotype data that have
been submitted in YHRD database and have accession number.
Y-STR Haplotype Reference Database provides various tools for haplotype
analyses like:
• Validation of Data
• AMOVA (Analysis of Molecular Variance)
128 R. K. Kumawat et al.
• Mixture analysis
• Kinship Analysis
• Multidimensional Scaling plot (MDS)
• GenoProof
• GenoProof Mixture
• VAT
• DNAVIEW
• Rutgers combined linkage-physical human genome map
Mitomap
Mitomap is the database of mitochondrial DNA, which provides comprehensive
information related to mutations and polymorphisms in human mitochondrial DNA.
MITOMAP attempts to bring the broad spectrum of structure and function of
mtDNA, pathogenic, molecular, useful and clinical data into a single unified element
brought together component which can be questioned from a wide range of
perspectives. MITOMAP is right now utilizing the Sybase rational database man-
agement software. It is both a free information system for the mitochondrial
researcher and moreover gives the mtDNA map and clinical information assets for
the Genome and for Online Mendelian Inheritance Man.
Population dataset gives the permission to polymorphic restriction sites: clinical
dataset for base changes and nucleotide positions like disease-associated mutations
130 R. K. Kumawat et al.
and their clinical phenotypes; functional data for genetic element functions of
mtDNA; and gene-gene interaction data for information of mitochondrial DNA.
Mitomap is online database available for both browsing and querying capacity
(Fig. 6.28).
EMPOP
EDNAP Mitochondrial DNA Population Database EMPOP is the largest and high-
quality database which has the following characteristics:
The EMPOP uses some of the tool tools to perform the analysis and interpretation of
mtDNA sequence variation such as:
• Haplogroup Browser
• EMPcheck
• NETWORK
6 Statistical Softwares Used in Evaluation of Forensic DNA Typing 131
• Population data
• PCR primer sequences
• Commercial multiplex STR kits
• Sequence information
• Mutation Rates for Common Loci
• Technology related to STR analysis
• Comprehensive reference lists
• Y chromosome STRs
• Mixture Interpretation
• Tri-allelic pattern
• DNA Marker Information
132 R. K. Kumawat et al.
Population data studies gets revealed in the writing and feed in the STRBase by
posting the STR framework, target population, the quantity of irrelevant people
tested, and the reference. These set of population examines gives a significant device
to finding references that contain STR allele frequencies to help in ascertaining
matching probabilities for DNA profiling cases (Fig. 6.30, Table 6.3).
6 Statistical Softwares Used in Evaluation of Forensic DNA Typing 133
References
Athey TW (2006) Haplogroup prediction from Y-STR values using a Bayesian-allele-frequency
approach. J Genet Geneal 2(2):34–39
Bekaert B, Van Geystelen A, Vanderheyden N, Larmuseau MHD, Decorte R (2012) Automating a
combined composite–consensus method to generate DNA profiles from low and high template
mixture samples. Forensic Sci Int Genet 6(5):588–593
Benschop CCG et al (2017) Validation of SmartRank: a likelihood ratio software for searching
national DNA databases with complex DNA profiles. Forensic Sci Int Genet 29:145–153
Bleka Ø, Storvik G, Gill P (2016) EuroForMix: an open source software based on a continuous
model to evaluate STR DNA profiles from a mixture of contributors with artefacts. Forensic Sci
Int Genet 21:35–44
Bodner M et al (2016) Recommendations of the DNA Commission of the International Society for
Forensic Genetics (ISFG) on quality control of autosomal Short Tandem Repeat allele frequency
databasing (STRidER). Forensic Sci Int Genet 24:97–102
Bright J-A et al (2018) Internal validation of STRmix™–a multi laboratory response to PCAST.
Forensic Sci Int Genet 34:11–24
Butler JM (2001) Forensic DNA typing: biology & technology behind STR markers. Academic
Press, New York, NY
Curran JM, Triggs CM, Buckleton J, Weir BS (1999) Interpreting DNA mixtures in structured
populations. J Forensic Sci 44(5):987–995
Emmerova B, Ehler E, Comas D, Votrubova J, Vanek D (2017) Comparison of Y-chromosomal
haplogroup predictors. Forensic Sci Int Genet Suppl Ser 6:e145–e147
Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using the
software STRUCTURE: a simulation study. Mol Ecol 14(8):2611–2620
Excoffier L, Lischer HEL (2010) Arlequin suite ver 3.5: a new series of programs to perform
population genetics analyses under Linux and Windows. Mol Ecol Resour 10(3):564–567
Felsenstein J (1985) Confidence-limits on phylogenies–an approach using the bootstrap. Evolution
39:783–791. https://doi.org/10.2307/2408678
Gill P, Haned H (2013) A new methodological framework to interpret complex DNA profiles using
likelihood ratios. Forensic Sci Int Genet 7(2):251–263
Gill P, Sparkes R, Pinchin R, Clayton T, Whitaker J, Buckleton J (1998) Interpreting simple STR
mixtures using allele peak areas. Forensic Sci Int 91(1):41–53
Goldstein DB, Linares AR, Cavalli-Sforza LL, Feldman MW (1995) Genetic absolute dating based
on microsatellites and the origin of modern humans. Proc Natl Acad Sci 92(15):6723–6727
Götz FM, Schönborn H, Borsdorf V, Pflugbeil A-M, Labudde D (2017) GenoProof Mixture 3—
new software and process to resolve complex DNA mixtures. Forensic Sci Int Genet Suppl Ser
6:e549–e551
Gouy A, Zieger M (2017) STRAF—a convenient online tool for STR data evaluation in forensic
genetics. Forensic Sci Int Genet 30:148–151
Hammer Ø, Harper DAT, Ryan PD (2001) PAST: paleontological statistics software package for
education and data analysis palaeontol. Electronica 4:1–9
Haned H (2011) Forensim: an open-source initiative for the evaluation of statistical methods in
forensic genetics. Forensic Sci Int Genet 5(4):265–268
Haned H, Slooten K, Gill P (2012) Exploratory data analysis for the interpretation of low template
DNA mixtures. Forensic Sci Int Genet 6(6):762–774
Kling D, Egeland T, Tillmar AO (2012) FamLink–a user friendly software for linkage calculations
in family genetics. Forensic Sci Int Genet 6(5):616–620
Latter BDH (1972) Selection in finite populations with multiple alleles. III. Genetic divergence with
centripetal selection and mutation. Genetics 70(3):475–490
Nei M (1972) Genetic distance between populations. Am Nat 106(949):283–292
Nei M, Chesser RK (1983) Estimation of fixation indices and gene diversities. Ann Hum Genet 47
(3):253–259
134 R. K. Kumawat et al.
Peakall ROD, Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population genetic
software for teaching and research. Mol Ecol Resour 6(1):288–295
Riley SSG, Goor R, Hoffman D, Kalafut T, Noreuil C, Scott T, Sutton J Osiris version 2.2:
intelligent casework and codis str analysis
Ristow PG, D’Amato ME (2017) Forensic statistics analysis toolbox (FORSTAT): a streamlined
workflow for forensic statistics. Forensic Sci Int Genet Suppl Ser 6:e52–e54
Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phyloge-
netic trees. Mol Biol Evol 4(4):406–425
Shriver MD, Jin L, Boerwinkle E, Deka R, Ferrell RE, Chakraborty R (1995) A novel measure of
genetic distance for highly polymorphic tandem repeat loci. Mol Biol Evol 12(5):914–920
Sneath PHA, Sokal RR (1973) Numerical taxonomy. The principles and practice of numerical
classification. W. H. Freeman and Co., San Francisco, CA
Takezaki N, Nei M, Tamura K (2009) POPTREE2: software for constructing population trees from
allele frequency data and computing other population statistics with Windows interface. Mol
Biol Evol 27(4):747–752
Tereba A (1999) Tools for analysis of population statistics. Profiles DNA 2:14–16
Tvedebrink T (2011) mixsep: an R-package for DNA mixture separation. Forensic Sci Int Genet
Suppl Ser 3(1):e486–e488
Tvedebrink T (2013) mixsep: DNA mixture separation. R package version 0.2. Computer Software,
pp 1–2
Part II
Challenges in Forensic DNA Typing
Ancient DNA Analysis and Its Relevance
in Forensic DNA Fingerprinting 7
Mian Sahib Zar and M. Aslamkhan
Abstract
M. S. Zar
Department of Forensic Sciences, University of Health Sciences, Lahore, Pakistan
Center for Synthetic Biology Engineering Research (CSynBER), Shenzhen Institute of Advanced
Technology, Chinese Academy of Sciences, Shenzhen, P. R. China
M. Aslamkhan (*)
Department of Human Genetics and Molecular Biology, University of Health Sciences, Lahore,
Pakistan
e-mail: [email protected]
Keywords
7.1 Introduction
DNA, abbreviation for deoxyribonucleic acid, is the basic life giving material in all
species of animal and plants. It is generally present in the nucleus of cell in the form
of a double helix and called as nuclear DNA. Besides nuclei, DNA is also present in
mitochondria and hence referred as mitochondrial DNA. Genome is the name given
to the total amount of DNA in a species. In human genome, mitochondrial DNA
(mtDNA) consists of 16.5 kbp (kilo base pair) and nuclear DNA is 3 billion bp
(Lander et al. 2001). DNA in humans is present in 46 chromosomes, which exist in
the nucleus of all body cells except the red blood cells (RBCs). The human nuclear
genome contains 5% coding region referred as exons and 95% noncoding region
called as introns. The exons are highly conserved and the introns are highly
polymorphic (Daniel and Walsh 2006). In each human body cell, DNA is present
as a 6–9 ft long coiled thread. On unwinding of all DNA in human body cells it
would reach to the sun and back one thousand times. It is interesting to note that
sequencing reveals 99% similar DNA in all humans. Of the remaining 1% only, it’s
one-tenth, is responsible to make us unique (Feuk et al. 2006). Remember that
human DNA is not unique as more or less of it is shared with many other past and
present species of animals and plants. Thus 98% of human DNA is similar with that
of chimpanzee and 50% is similar to that of banana. If we write the information in a
single cell on paper it needs 46 volumes of Webster dictionary. DNA is a blueprint or
book of life. Human DNA consists of 3.2 billion letters. Human genome sequence
was completed in 2000, by a consortium of 18 laboratories in five countries. There
are three chemical substances in DNA: (a) “deoxyribose sugar”, (b) “phosphate
group” and (c) “nitrogenous base”. Of these three, deoxyribose, sugar and phosphate
group, are similar in DNA of all persons, but the nitrogenous base differs as it
characterizes individual constituent of the polymer. This variation gives
differentiating characters in each person, which helps in individualistic identifica-
tion. Each nitrogenous base consists of, as a general rule, one of the four letters of
nucleotide; A, T, C and G. These four nucleotides—adenine, thymine, cytosine and
guanine are complement to each other in a permanent order or sequence: A pairs
with T and C pairs with G (Fig. 7.1). This complementation of four nucleotides
makes a DNA molecule (Luftig and Richey 2001).
Nucleic acid molecule, as we know, is very long and called as macromolecules,
which means that it is a molecule made up of smaller molecular units, which are
called nucleotides. The nucleotide linked chemically to each other to form a chain. In
DNA, the four nucleotides named as adenine, thymine, cytosine and guanine, as
7 Ancient DNA Analysis and Its Relevance in Forensic DNA Fingerprinting 139
Let us go to the timeline of DNA research, which led us to successfully isolate and
interpret the result of hereditary material. About one and a half century ago, in 1869,
a young Swiss biologist, Johannes Friedrich Miescher, accidently found various
phosphate-rich chemicals from the white blood cell nuclei. Friedrich Miescher got
140 M. S. Zar and M. Aslamkhan
his MD in 1868 from the University of Basal Switzerland. During his studies in
1865, Miescher worked in the organic chemistry laboratory of Adolf Stecker at
Gottingen University, Germany, but due to his illness he had to interrupt his studies.
Unfortunately his illness of typhoid fever impaired his hearing ability and he could
not pursue medical profession like his father and uncle who were chair of Anatomy
at University of Basal. Because of partial deafness, Miescher said good bye to
medical profession and decided to pursue his studies towards physiological chemis-
try and joined University of Tübingen, Germany, at newly established faculty of
natural science, under Felix Hoppe-Seyer, a chemist and physiologist, who later
became the founder of biochemistry. Miescher was interested to study the chemistry
of the nucleus of the white blood cell, but Hoppe-Seyer encouraged him to study
neutrophil instead for the simple reason that it is difficult to get sufficient number of
lymphocytes while it was known to get sufficient number of neutrophils in the pus,
which could be obtained from the bandage of patients. The problem was how to
wash cells off the bandage without damaging them. Miescher solved the problem,
isolated the nuclei and on analyses of the contents he found a new compound from
the nuclei of lymphocytes in 1868.
Young 24-year-old Miescher must have been amazed to find a compound that
could not be characterized as a protein or lipid or a carbohydrate. He simply named it
as “Nuclein” as it was isolated from the nucleus of blood cell. Interestingly Felix
Hoppe-Seyer did not allow Miescher to publish it before his personal verification
that took some time and finally Miescher published his findings in 1871. Nuclein
remained in obscurity for 20 years till 1889, when Richard Altman, a German
Pathologist, found the acidic properties of nuclein and renamed it as “nucleic
acid”. Today, this nucleic acid is known as deoxyribonucleic acid (DNA).
As is known now, nucleic acid research is the hub of current biomedical research.
The reason of anonymity of nucleic acid in the nineteenth century was the publica-
tion of Charles Darwin’s book in 1859, entitled “On the Origin of Species”. The
book generated hot debates on the theory of evolution, nevertheless by the 1870s,
not only the scientific community but also people from the general public had started
believing in evolution as a scientific fact. Another scientific investigation which was
ignored at that time is the work of Gregor Mendel, “Versuche über
Pflanzenhybriden” (Experiments on Plant Hybridization), who read it at two
meetings (8 February and 8 March 1865) at the “Natural History Society of Brno”,
and published it in “Vehandlungen des naturforschenden Vereins Brünn” in 1966.
However, Mendel work remained ignored till its rediscovery in 1900, by De Vries,
Correns and Tsehermak.
In the early 1980s, researchers started extracting DNA from different ancient sources
such as fossil remains, archaeological finds, museum specimens, permafrost ice
cores, fossilized faeces, and other uncommon antique biological sources. Such
extractions were named “Ancient DNA”. In 1984, the field of ancient DNA research
7 Ancient DNA Analysis and Its Relevance in Forensic DNA Fingerprinting 141
To extract and analyze DNA and/or genomes of ancient biological specimens, last
decade saw a substantial development of approaches, that opened a new window to
clearly understand the genotypes of past organisms, to know the place and time of
their extinction and biological variation of species that took place as well as to gain
clear insights that how they were evolved from the previous position/stage towards
the existing (Orlando et al. 2013).
A massive, methodological transformation has undergone in the study area of
ancient DNA technology since 1984 Higuchi and his colleagues initiated its
research. The analysis of DNA from ancient biological samples was a laborious
process at that time. However, the discovery of polymerase chain reaction (PCR)
initiated a rapid progress in the field of ancient DNA research (Mullis and Faloona
7 Ancient DNA Analysis and Its Relevance in Forensic DNA Fingerprinting 143
1987). The organeller DNA, such as chloroplast DNA in plants, and mitochondrial
DNA in animals, is protected by extra membranes and its multiple copies are found
in the cells, therefore, the early analyses of the past organisms were focused on
organeller DNA. However, the analysis of the nuclear DNA/genomes of ancient
material made possible with the discovery of NGS, i.e. next-generation sequencing
techniques. Insights into the geographical area and its extents, the types of organisms
and taphonomy of ancient organisms were clearly understood with advancement in
bioinformatics tools. The advancement in all these technologies provides new
information about the identification of fossils and the precise association between
past and present organisms, communities and populations, and gives insights into
past fossilized life as well as present living organisms from the evolutionary point
within a tree of life with the passage of time and environmental changes.
The new era of ancient DNA technology is very important as it provides new
avenues in understanding the genomes of fossils and past organisms and even
explore about their associations with their existing living organisms. To get new
knowledge and breakouts in the field of aDNA technology, the collaborations and
combination of multiple fields such as genomics, taphonomy, archaeology, anthro-
pology, biochemistry, bioinformatics and chronology are very critical for making
accurate predictions about the future status of existing organisms under future
climatic change scenarios.
The increasing collaborations in multiple research fields, improvement of sophis-
ticated sequencing, coupled with use of tools of bioinformatics, development of
“New Generation Sequencing” based aDNA data sets, improvement of phyloge-
netic, denser ancient DNA material sampling around times of extinction and changes
in the environment make it possible to use a potpourri of phenotypic and genotypic
characters in both fossils and existing organisms. This approach allows us to know as
to how populations and ancient species diverge, how diversification patterns develop
and how they interact, which pave the way to evolve independently through periods
of environmental change (Sjögren et al. 2017).
Extraction of DNA from past organisms has obvious impact in archaeology, anthro-
pology and forensic DNA studies, however, the existing protocols used for DNA
extraction are far from satisfaction (Kalmár et al. 2000). The extraction process of
ancient DNA from the old specimens is very difficult because antique archaeological
material is strongly influenced not only by environmental factors but also by
microbial contamination, sample age, substrate properties, minimum amount of
material to start, as well as presence of PCR inhibitors. From the plant fossils
extraction of DNA is more difficult compared to animal fossils, because generally
animal old skeletal fossils material possesses well-preserved DNA (Brown and
Barnes 2015). In plant fossils, pollen grains are not only well preserved but found
in abundance for ancient DNA extraction. The old skeletal remains contain inorganic
minerals, which create hurdles during the extraction of DNA, therefore, the buffer
144 M. S. Zar and M. Aslamkhan
Ancient DNA technology is an emerging field, which plays a key role in anthropol-
ogy, archaeology, palaeontology, medicine, agriculture and law enforcement
(Papiha et al. 1999; Burger et al. 2000; Pääbo et al. 2004). Some major applications
of aDNA are mentioned as follow:
Genetic markers are required for ancient DNA analysis. These markers must be
polymorphic, i.e. marker level differences must be identifiable in the populations that
are compared or among the individuals being studied. If differences are not per-
ceived, then it will not be possible to differentiate individuals and about their
movements, relationships and evolution. Several calculations are made to know
genetic distance, which depends on genetic discrepancies and their number between
individuals and/or populations. These genetic discrepancies are used to measure
resemblance or dissimilarity between individuals or populations. Often, DNA data
interpretation is carried out through comparison of the new data with previous data
obtained from previous studies on the same genomic region. For this purpose, access
to the previous data stored in the comparative database is crucial. Mitochondrial
genome has the most widespread comparative database, because mitochondrial
DNA (mtDNA) has been studied more than any other genomic DNA.
Mitochondrial DNA molecule is the preferred organelle for the analysis of ancient
DNA because mtDNA persist in multiple copies per cell, having large number of
DNA than nuclear DNA, which has single copy and diploid in any given specimen.
Nuclear DNA is inherited, through haploid number of chromosomes, from both
parents while mitochondrial DNA is inherited only through mitochondria of the
maternal genome. Single-copy-chromosome markers (Y-Chromosomal DNA) are
inherited through the paternal-lineage. If the analysis of mtDNA is successful,
subsequent analysis of nuclear DNA (paternal-lineage or autosomal nuclear loci)
may be attempted for ancient DNA studies.
Based on the results, ancient DNA studies are grouped as (a) DNA yield authentic
and endogenous, (b) DNA yield contaminated or (c) DNA yield nil. This classifica-
tion is actually carried out for authenticity of aDNA analysis. As clarified earlier that
precise interpretation of ancient DNA data needs a well-defined comparative data-
base for identification and classification of the new data. If no resemblance persists
between the new ancient DNA (aDNA) sequences and other earlier reported aDNA
sequences, then the interpretation of significance of newly sequenced aDNA
becomes extremely difficult. In that case, removal of contamination also becomes
very difficult. The uniqueness/variation of a sequence is considered as authentic
ancient DNA data, provided all sources of contamination are recognized and
eradicated. Some time, the novelty of sequences is so thrilling that contamination
looks extremely doubtful, for example, the DNA sequences of Homo
neanderthalensis were clustered outside the range of the current Homo sapiens
DNA sequences (Krings et al. 1997, 1999, 2000; Ovchinnikov et al. 2000; Schmitz
et al. 2002; Serre et al. 2004).
146 M. S. Zar and M. Aslamkhan
murders), chewing gum (saliva), razor blades (missing kids, missing females, etc.),
ski masks (saliva and hair, bank robberies, carjacking, rapes or whenever the suspect
wants to hide his identity), caps (hair), tooth brush (saliva), stamps and envelops
(saliva), ear rings, nasal secretions, ear wax, watches, coffee cups, soft drink cans,
beer bottles, etc., shirts (neck area for sweat), tooth picks, eye glasses (nose piece and
the back of arm), hearing aids, condoms, saliva stains (threatening letters, or
claiming the responsibility of certain crime in a letter), finger rings, bracelets,
telephones, cell phones, computer keyboards, steering wheels and dashboards,
forks and spoons, date pits and mango stones, gun triggers and magazines. Locard’s
principle states that “Wherever there is contact between two objects, there is a
transfer of material between them”.
• In case without any lead, DNA can efficiently and effectively identify suspects by
eliminating possible suspects
• Identification of serial offenders by determining the links with different
crime scene
• DNA analysis would serve as an investigative tool in tandem with finger prints
• Hard evidence in addition to soft evidence to be presented in the court of law
• DNA database profiles may act as deterrence and create awareness to some
habitual offenders from committing crime in future
• Solution of past unsolved cases where DNA evidence was found and available
but could not be used because of non-availability of DNA technology but linked
with a present suspect offender and matched with the present crime scene
• DNA analysis could not be used in pre-DNA-database era and hence offenders
from such cases could not be identified
Jerry Miller Case (DNA That Cleared One Man Implicate Another) The DNA
profile obtained from Item(s) M16 and M17 was searched in the Indiana DNA
148 M. S. Zar and M. Aslamkhan
Database and was found to be consistent with the convicted offender sample of
Jeffery Jones (DOC inmate #974912) (Fig. 7.2).
There are over 50 countries throughout the world that have already passed DNA
Database legislation such as Europe (every country in Europe required by EU
legislation for data sharing), the United States (every state has passed separate
legislation), Australia (every state has passed separate legislation), Canada, Russia,
Kenya, Malaysia, etc. No country has ever reduced the scope of DNA database
testing done (Doleac 2017). Countries have only expanded database utilization
based on:
Each country and state has had to address similar issues that arise in the context of
Forensic DNA data basing in the context of its own legal, historical and cultural
frameworks, for example—destruction of samples in Germany. Each DNA database
legislation is different; there are many issues which, after extensive scientific and
legal research, have been addressed in very similar ways (Levitt 2007; Wallace et al.
2014). Some of these issues include:
• Entry criteria
• Sample collection
• Removal criteria
• Sample retention
• Database access
References
Barbaro A, Cormaci P, Falcone G (2011) Validation of BTA™ lysis buffer for DNA extraction
from challenged forensic samples. Forensic Sci Int Genet Suppl Ser 3:e61–e62
Bender K, Farfán MXAJ, Schneider PM (2004) Preparation of degraded human DNA under
controlled conditions. Forensic Sci Int 139:135–140
Briggs AW, Stenzel U, Johnson PL, Green RE, Kelso J, Prüfer K, Meyer M, Krause J, Ronan MT,
Lachmann M (2007) Patterns of damage in genomic DNA sequences from a Neandertal. Proc
Natl Acad Sci 104:14616–14621
Brown TA, Barnes IM (2015) The current and future applications of ancient DNA in Quaternary
science. J Quat Sci 30:144–153
Burger J, Hummel S, Pfeiffer I, Herrmann B (2000) Palaeogenetic analysis of (pre) historic artifacts
and its significance for anthropology. Anthropol Anz 58:69–76
Butler JM (2001) Forensic DNA typing: biology & technology behind STR markers. Academic
Press, New York, NY
Chakraborty R, Stivers DN, Su B, Zhong Y, Budowle B (1999) The utility of short tandem repeat
loci beyond human identification: implications for development of new DNA typing systems.
Electrophoresis 20(8):1682–1696
150 M. S. Zar and M. Aslamkhan
Daniel R, Walsh SJ (2006) The continuing evolution of forensic DNA profiling-from STRS to
SNPS. Aust J Forensic Sci 38:59–74
Doleac JL (2017) The effects of DNA databases on crime. Am Econ J Appl Econ 9(1):165–201
Feuk L, Carson AR, Scherer SW (2006) Structural variation in the human genome. Nat Rev Genet
7:85–97
Gansauge M-T, Meyer M (2014) Selective enrichment of damaged DNA molecules for ancient
genome sequencing. Genome Res 24:1543–1549
Hänni C, Laudet V, Coll J, Stehelin D (1994) Sequence variant from an Egyptian mummy.
Genomics 22:487–489
Haviland WA, Prins HE, Mcbride B, Walrath D (2013) Cultural anthropology: the human chal-
lenge. Cengage Learning, Boston, MA
Higuchi R, Bowman B, Freiberger M, Ryder OA, Wilson AC (1984) DNA sequences from the
quagga, an extinct member of the horse family. Nature 312:282
Hochmeister MN, Budowle B, Borer UV, Eggmann U, Comey CT, Dirnhofer R (1991) Typing of
deoxyribonucleic acid (DNA) extracted from compact bone from human remains. J Forensic Sci
36:1649–1661
Jakubowska J, Maciejewska A, Pawłowski R (2012) Comparison of three methods of DNA
extraction from human bones with different degrees of degradation. Int J Legal Med 126
(1):173–178
Jones M (2016) Unlocking the past: how archaeologists are rewriting human history with ancient
DNA. Arcade Publishing, New York, NY
Kalmár T, Bachrati CZ, Marcsik A, Raskó I (2000) A simple and efficient method for PCR
amplifiable DNA extraction from ancient bones. Nucleic Acids Res 28:e67–e67
Kelman LM, Kelman Z (1999) The use of ancient DNA in paleontological studies. J Vertebr
Paleontol 19:8–20
Kolman CJ, Tuross N (2000) Ancient DNA analysis of human populations. Am J Phys Anthropol
111:5–23
Krings M, Stone A, Schmitz RW, Krainitzki H, Stoneking M, Pääbo S (1997) Neandertal DNA
sequences and the origin of modern humans. Cell 90:19–30
Krings M, Geisert H, Schmitz RW, Krainitzki H, Pääbo S (1999) DNA sequence of the mitochon-
drial hypervariable region II from the Neandertal type specimen. Proc Natl Acad Sci
96:5581–5585
Krings M, Capelli C, Tschentscher F, Geisert H, Meyer S, Von Haeseler A, Grossschmidt K,
Possnert G, Paunovic M, Pääbo S (2000) A view of Neandertal genetic diversity. Nat Genet
26:144–146
Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, Devon K, Dewar K, Doyle M,
Fitzhugh W, Funke R, Gage D, Harris K, Heaford A, Howland J, Kann L, Lehoczky J, Levine R,
Mcewan P, Mckernan K, Meldrim J, Mesirov JP, Miranda C, Morris W, Naylor J, Raymond C,
Rosetti M, Santos R, Sheridan A, Sougnez C, Stange-Thomann N, Stojanovic N,
Subramanian A, Wyman D, Rogers J, Sulston J, Ainscough R, Beck S, Bentley D, Burton J,
Clee C, Carter N, Coulson A, Deadman R, Deloukas P, Dunham A, Dunham I, Durbin R,
French L, Grafham D, Gregory S, Hubbard T, Humphray S, Hunt A, Jones M, Lloyd C,
Mcmurray A, Matthews L, Mercer S, Milne S, Mullikin JC, Mungall A, Plumb R, Ross M,
Shownkeen R, Sims S, Waterston RH, Wilson RK, Hillier LW, Mcpherson JD, Marra MA,
Mardis ER, Fulton LA, Chinwalla AT, Pepin KH, Gish WR, Chissoe SL, Wendl MC,
Delehaunty KD, Miner TL, Delehaunty A, Kramer JB, Cook LL, Fulton RS, Johnson DL,
Minx PJ, Clifton SW, Hawkins T, Branscomb E, Predki P, Richardson P, Wenning S, Slezak T,
Doggett N, Cheng JF, Olsen A, Lucas S, Elkin C, Uberbacher E, Frazier M et al (2001) Initial
sequencing and analysis of the human genome. Nature 409:860–921
Levitt M (2007) Forensic databases: benefits and ethical and social costs. Br Med Bull 83:235–248
Loreille OM, Diegoli TM, Irwin JA, Coble MD, Parsons TJ (2007) High efficiency DNA extraction
from bone by total demineralization. Forensic Sci Int Genet 1:191–195
Luftig MA, Richey S (2001) DNA and forensic science. N Engl Law Rev 35(3):609–613
7 Ancient DNA Analysis and Its Relevance in Forensic DNA Fingerprinting 151
Abstract
This chapter presents analyses of skeletal remains from World War II using a
forensic approach. Aged bones are challenging samples of biological material for
DNA typing because their DNA content is very low and greatly degraded. The
exceptional risk of contamination and the presence of inhibitors further limit the
success of DNA typing. Because the DNA content is so limited, aged skeletons
are exposed to contamination by people involved in excavation, anthropological
analyses, and genetic testing. To prevent and track potential contamination by
contemporary DNA, a number of standard precautions are used and they are
described. The composition of bones and teeth and their degradation process is
discussed. In addition to morphological structure, special attention is paid to
factors affecting the preservation of DNA in old bones and teeth. Based on the
literature reviewed and some analyses performed, the chapter summarizes which
skeletal elements are most suitable for investigating World War II skeletal
remains. It discusses how to clean and grind bone and tooth samples, how
DNA can be extracted from the powder obtained, and how DNA quality and
quantity can be determined for extracts using real-time quantification. The genetic
markers most frequently examined in aged DNA and the advantages of new,
high-performing sequencing techniques for the development and study of aged
DNA are described. Using innovative methods that may help in retrieving higher-
quality and increased data makes it possible to investigate more degraded DNA.
Storing samples is especially important in laboratories engaged in forensic
genetics. Efficient long-term bone storage is necessary to guarantee sample
stability across time so that new markers as well as new technologies can be
used for future retesting. The results of some aged bone sample storage studies are
Keywords
8.1 Introduction
The amount of DNA in old skeletal remains and its quality depends on the preserva-
tion of tissues that are subjected to various environmental factors after death
(Iwamura et al. 2004). In a living cell, special mechanisms take care of repairing
damaged DNA. DNA repair mechanisms do not function after the death of the
organism because the cellular balance is broken. Due to exposure to bacteria, fungi,
and nucleases, DNA damage continues to occur, resulting in the survival of very
fragmented DNA (Baum et al. 2013). Understanding the composition of bones and
teeth and their degradation process is a key factor in determining DNA content and
plays an important role in selecting suitable samples for obtaining endogenous DNA.
Teeth are anatomically divided into the crown, neck, and root. The outer layer of
the crown is covered with enamel, which is almost entirely of mineral origin and
does not contain cells. The tooth root is covered with cementum, which is a
mineralized tissue consisting of hydroxyapatite, collagen, and other non-collagen
proteins (Higgins and Austin 2013). Cell-free cementum is located in the neck of the
tooth root. Cementum containing cells is located in the apical part of the tooth root
and is a good source of DNA (Mansour et al. 2018). In the dental neck, enamel and
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 155
cementum come into contact. Below both of them, dentine protects the tooth pulp.
The dentine and pulp comprise the majority of the tooth and, unlike the enamel, are
rich in cells (mostly odontoblasts and fibroblasts). The dentine consists of hydroxy-
apatite, collagen type I, and water (Higgins and Austin 2013). The quantity of DNA
recoverable from a particular tooth and from one group of teeth to another greatly
varies; the amount of DNA isolated and its quality are also affected by dental
pathologies, dental procedures that were carried out, how much time has gone by
since the tooth was extracted until the DNA was isolated, and the age of the donor
(Schwartz et al. 1991). Dental pulp is a good source of DNA. The quantity of DNA is
related to the volume of the tooth pulp and the kind of tooth. Teeth with larger pulp
and multi-root teeth are the best source of DNA because they contain many pulp
cells and have more tooth cementum compared to single-root teeth. According to the
recommendations, molars contain the most DNA and are the best for DNA analyses,
followed by premolars (Higgins and Austin 2013). The best teeth for isolating DNA
are as follows: first of all, molars, premolars, canines, and incisors that have not
undergone endodontic treatment, and then molars, premolars, canines, and incisors
that have been treated.
Bones are macroscopically divided into compact and spongy bone. Compact
bone can be found in the outer part of the ends of the long bones (epiphysis), the
outer part of the flat bones, and the middle part of the long bones (diaphysis). Spongy
bone can be found inside the flat bones and inside of the ends of the long bones.
Because of the fragility of spongy bone, it needs an outer protective layer of compact
bone (Camposa et al. 2012). Microscopically, bone consists of cells and an extracel-
lular matrix made up of an organic part and an inorganic part. The organic part
mostly consists of type I collagen plus some other proteins and glycoproteins, and
the inorganic part mostly consists of hydroxyapatite composed of calcium and
phosphate ions (Camposa et al. 2012). Following death, the DNA is maintained
much better in teeth and bones than it is in soft tissue (Iwamura et al. 2004; Camposa
et al. 2012; Kendall et al. 2018). The slow degradation of DNA and the protection
against enzymatic processes in the skeletal remains is influenced by the binding of
negatively charged phosphate groups to hydroxyapatite hydroxyl groups, and the
DNA molecule is bound to collagen as well (Camposa et al. 2012; Coulson-Thomas
et al. 2015). Collagen and hydroxyapatite together form a tight structure that, due to
small pores, prevents collagenases of microorganisms from breaking into the struc-
ture (Turner-Walker 2008). The size of the pores and their interconnection determine
how water, microorganisms, and other particles pass through and out of the structure
(Kendall et al. 2018). The environment that skeletal remains are located in from
death until they are found greatly impacts the degradation of bones and teeth. The
decay of bone cells and the soft tissue in the blood vessels make the bone more
porous. Bone porosity determines the speed and manner in which environmental
factors affect bone changes. Fungi and bacteria present in the soil and cyanobacteria
present in the water can easily break into the bone tissues due to increased porosity
with time, making the bone tissue even more porous (Camposa et al. 2012). In
contrast, the environmental impact can also reduce porosity due to
permineralization, which gradually leads to fossilization, making the bone tissue
156 I. Zupanič Pajnič
better preserved (Kendall et al. 2018). The pores in the teeth are smaller than in bone,
and therefore the DNA in teeth is preserved better than in bones. Thus, it is possible
for DNA to persist for centuries or even millennia (Turner-Walker 2008).
Analysis of aged skeletal remains found at various locations proves that the preser-
vation of DNA is affected not only by the postmortem interval, but primarily by the
environment the remains are subjected to. Factors affecting DNA preservation in
skeletal remains include the soil’s humidity, temperature, geochemical properties,
and pH as well as microorganisms in the soil (Höss et al. 1996; Poinar et al. 1996;
Putkonen et al. 2010; Higgins and Austin 2013). The most important factors for
preserving DNA are the soil temperature and its humidity, and environments that are
very stable with minimal yearly temperature or humidity fluctuation are favorable for
preserving DNA. Wet warm environments dramatically reduce the amount of DNA
because of extensive damage and fragmentation (Smith et al. 2003). The presence of
water, the pH of the environment, and mineralized tissue’s porosity are factors that
influence the solubility of hydroxyapatite. Water helps dissolve mineral ions, and a
decrease in pH increases solubility. Alternating dry and humid environments and
environments with continual water flow are more harmful to DNA preservation than
a continuously wet environment (Turner-Walker 2008; Higgins and Austin 2013;
Kendall et al. 2018). There also exist factors particular to individuals affecting the
preservation of DNA; these include race, age, sex, age, and the type of skeletal
elements (Camposa et al. 2012; Romanini et al. 2012; Mundorff and Davoren 2014).
The assessment of bone and tooth suitability for genetic analysis is difficult, and
investigations are costly and often unsuccessful. Consequently, much recent
research focuses on finding the most appropriate skeletal elements that would
allow the acquisition of well-preserved DNA for genetic typing (Hansen et al.
2017; Pilli et al. 2018). Several studies of using skeletal remains for nuclear DNA
typing determined that teeth yield the best typing results, followed by femurs and
tibias (Edson et al. 2004; Miloš et al. 2007; Misner et al. 2009). These bones are not
always available for use in sampling and genetic testing. In the study to identify
victims of the World Trade Center attack, DNA was extracted from small bones,
including patellae, foot phalanges, and metatarsals; these produced rates that were
comparable to both femurs and tibias (Mundorff et al. 2009). Despite the wide spread
conviction that dense (i.e., cortical) bone contains DNA that is better preserved than
in spongy (i.e., cancellous) bone, a few researchers have reported that commonly
overlooked small skeletal types of the feet and hands have been even more useful
than weight-bearing long bones. Among them, Mundorff et al. (2009) and Mundorff
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 157
and Davoren (2014) found that metatarsals, metacarpals, and phalanges as well as
patellae were very similar to or even better than the femurs and tibias in the DNA that
they yield. It is easy to sample such bones with a disposable scalpel, thereby
reducing potential contamination of DNA. Recent studies of teeth show that, for
genetic typing of skeletal remains, it is most appropriate to sample tooth cementum
in the region of the tooth root and not whole teeth (Mansour et al. 2018). A study
performed by Pilli et al. (2018) compares various skeletal elements with the middle
section of the petrous bone (the temporal bone), which is among the toughest human
bones (Hansen et al. 2017). Pinhasi et al. (2015) determined that the petrous bone is
the most suitable skeletal part for sampling ancient human skeletons. For identifying
which skeletal elements yield superior results in DNA preservation in 70-year-old
skeletons, different skeletal element types were sampled from three World War II
skeletons. The goal was to optimize the sampling process for identifying victims of
World War II (Obal et al. 2019). With the help of measurements such as the quantity
and quality of DNA (measured using qPCR, in which short and long fragments were
targeted and degradation rates determined), and autosomal STR typing success, an
effort was made to determine the best kinds of skeletal elements for identifying the
identity of the victims. The best parameters for assessing skeletal types that show
superior preservation of DNA were the DNA quantity and number of STR loci that
were typed successfully. Among 56 different elements, 15 elements in all three
skeletons yielded a full profile. Among the skeletal types containing the most DNA
on average in all three skeletons studied were mostly bones of the hand and the feet
and metatarsal and metacarpal bones exhibited the highest yield. Among 15 bones
yielding full genetic profiles in the three skeletons, 14 also contained the greatest
average DNA amounts except for tibias, for which the average yield of DNA did not
correspond to the success of profiling because the amount was lower (Obal et al.
2019). Our second study was performed on ancient bones. The aim was to establish
if acquiring sufficient DNA quantities and then profiling the autosomal STR markers
would succeed for small bones of the feet (i.e., metatarsal bones) and of the hands
(i.e., phalanges and metacarpal bones) from ancient skeletons in comparison to
skeletal types suggested by current recommendations (i.e., petrous portion of tem-
poral bones, femurs, and teeth). Therefore, 48 samples of bone from eight skeletons
(six eighteenth-century skeletons and two third-century skeletons) were acquired
from five Slovenian archeological locations. The study sampled six skeletal types
from each skeleton (molar, temporal bone, femur, metacarpal bone, proximal pha-
lanx from the hand, and metatarsal bone). Careful precautions were adhered to for
preventing any contamination. The greatest yields were identified in temporal bones,
and the lowest were in femurs. The degree of success for STR typing was evaluated
based on the number of loci that were successfully typed, and the study confirmed a
robust correlation between the quantity of DNA extracted and the degree of success
for typing STRs. The results indicate that it would be appropriate to involve
metacarpal and metatarsal bones in the sampling strategies for identification even
in the study of ancient bones (Geršak et al. 2019). Based on recent studies performed
by various research groups (including this author’s research on World War II and
ancient skeletons), the present recommendations for preferentially testing long bones
158 I. Zupanič Pajnič
taken from the legs must be re-evaluated, and in the future there should be changes to
the sampling strategy used by laboratories that type bone samples.
Recent forensic studies have focused on identifying which skeletal types offer
superior DNA preservation, but there has been a lack of focus on measuring
variation within particular bone type (Barta et al. 2014; Higgins et al. 2015; Alberti
et al. 2018). As early as 2004, Pääbo noticed that yields of aged DNA might vary
among extracts of different samples taken from the same bone, even when the same
extraction method is used (Pääbo et al. 2004). It is necessary to focus sampling
efforts on sections of bone that will result in maximum recovery of genetic material,
and so it is of great interest to explore the variation in DNA content within a bone in
the future. DNA content variation within a bone was explored by measuring nuclear
DNA quantity and quality (using qPCR in which short and long fragments were
targeted and degradation rates determined) in World War II metatarsal and metacar-
pal bones (data not published yet). To exclude the influence of taphonomic issues
(postmortem interval and the environment that the remains were subjected to),
213 bones from a single World War II mass grave were examined to ensure that
the skeletons had decomposed for the same duration and under the same conditions.
From each bone, DNA was extracted from the compact diaphysis and from spongy
epiphyses. A statistical analysis indicated that DNA yields differed significantly in
extracts from the diaphysis and extracts obtained from the epiphyses of the same
bones in metacarpals and metatarsals. A higher difference in DNA yield between the
diaphysis and epiphyses was found in metacarpals in comparison to metatarsals. On
average, 12 times more DNA was obtained from metatarsal epiphyses than the
diaphysis, and 26 times more from metacarpal epiphyses than the diaphysis. It was
determined that the best place to sample from within metatarsal and metacarpal
bones from World War II is spongy epiphyses (data not published yet).
DNA extraction in dedicated laboratory premises where post-PCR work has never
been carried out (Pääbo 1990). The laboratory may further be equipped with Hepa-
filtered hoods to ensure that no DNA has entered the facility. All of the work for
extraction should be carried out using protective garments, the workspace should be
cleaned using bleach, and UV lights should be used to irradiate it (Pääbo 1989).
Testing of an extraction-negative control and PCR-negative controls must be carried
out in parallel with bone DNA typing to detect any contamination that has been
introduced from reagents at the time of the extraction and amplification procedure.
Excavators, anthropologists, and laboratory researchers (included in the elimination
database) should be typed for the same genetic markers whenever possible, and their
genetic profiles should not match the profiles obtained from bones. Each specimen
should be used to prepare multiple extracts, and these should produce identical DNA
profiles (Pääbo et al. 2004). It is necessary to quantify the number of amplifiable
DNA molecules. An inverse correlation must exist between the size of the amplifi-
cation product and amplification efficiency, which reflects damage and degradation
in the aged DNA template (Pääbo et al. 2004).
To reduce the contamination possibility to a minimum at the author’s laboratory,
the extraction procedure is performed in a room exclusively designed to process
World War II remains. Mechanical cleaning is carried out in a closed cytostatic
C-(MaxPro)3-130 (IskraPio) safety cabinet. To reduce cross-contamination to a
minimum, a maximum of eight bone or tooth samples are processed during each
extraction batch, and a blank control is included with each batch. DNA quantifica-
tion is performed to test whether an inverse correlation exists between the size of the
amplification product and the amplification efficiency. Cleaning in detergent, etha-
nol, and bi-distilled water, plus UV-light irradiation are carried out to minimize
contamination of surfaces from prior handling. The extraction process includes
extraction-negative controls to check their cleanliness. Cleanliness of
amplification-negative controls is checked as well. Analyses of tooth and bone
sample are separated physically and time-wise from sample analyses for the elimi-
nation database and family reference samples. Duplicate analysis is performed for all
bone and tooth samples, extraction-negative controls, and negative template
controls. DNA is extracted from teeth and bones a minimum of two times or from
different skeletal types from the same person to verify the genotyping results, and
results that are reproducible are utilized for interpretation. No contamination of old
bone and tooth DNA samples was detected in the laboratory because strict
precautions to prevent contamination are followed.
When directly handled and washed, the sample surface seems to be contaminated, as
well as (to various degrees, depending on porosity and preservation), bone and tooth
interiors (Gilbert et al. 2005; Salamon et al. 2005; Sampierto et al. 2006). Because of
this, bone and tooth samples are purified and decontaminated in the laboratory.
Samples of bone are cleaned chemically and mechanically, and they are irradiated
160 I. Zupanič Pajnič
with UV light, and the samples from teeth are chemically cleaned and then subjected
to UV-light irradiation prior to being ground into a powder. No procedures for
removing contamination occurring during excavation or storage of remains, or
during collection are 100% efficient, but cleaning may enhance the ratio between
endogenous DNA and contaminating DNA, and it may help reduce the quantity of
inhibitors that are introduced into the extraction (Rohland and Hofreiter 2007). The
samples of bone are cleaned by physically removing the surface with a rotary
sanding device, and they washed successively in detergent, sterile bi-distilled
water, and ethanol. An approximately 1–3 mm layer is stripped from the bone
surface through sanding to reduce any contamination caused by prior handling.
Skeletal remains are cleaned in a MC 3 (IskraPio) closed microbiological safety
cabinet located in premises exclusively designed for handling old skeletal remains.
Between processing each sample, all of the tools used to drill, cut, and grind the
bones are cleaned. They are washed with water, bleach (6% sodium hypochlorite) or
DNA Away™ (Molecular BioProducts) and sterile bi-distilled water (Sartorius-
Stedim Biotech or Millipore), followed by 80% ethanol. After this, all of the material
is sterilized and undergoes UV-irradiation a minimum of overnight, or as long as
72 h. Warming bones may cause endogenous DNA to degrade (Alonso et al. 2001).
To keep the bones from warming while drilling and cutting take place, abrasion and
cutting are performed at a lower speed, and the bone is frequently cooled in liquid
nitrogen. A factor that affects DNA extract quality is the quality of bone powder used
for the extraction procedure. Very fine bone powder must be obtained for extraction
of a sufficient amount of DNA from skeletal remains. Very fine-grained powder
yields improved and more rapid demineralization, and the generation of fine powder
maximizes the sample surface area for eventual contact with the chelating solution
(Rohland and Hofreiter 2007). Rohland and Hofreiter (2007) compared samples
ground into a fine powder with a freezer mill versus samples that were ground into
pieces measuring a few millimeters in diameter with a mortar and pestle; they
determined that higher yields were obtained from the fine powder. The performance
of a Bead Beater MillMix 20 tissue homogenizer (Tehtnica–Domel, Železniki,
Slovenia) was tested for grinding the human bone samples on 60 World War II
femurs and tibias, and it was found to be very successful in the recovery of high-
quality powder from skeletal remains from World War II (Zupanič Pajnič 2017).
Grinding is performed in grinding vials made of metal using metal balls that are
cooled with liquid nitrogen before use. Samples of teeth and bones are cooled with
liquid nitrogen before grinding as well to avoid overheating during powdering.
Grinding is performed at 30 Hz for 1 min. Pulverization of skeletal remains is
performed in premises exclusively designed for handling old skeletal remains. The
grinding vials must be fully cleaned before they are used again. Between samples,
they are washed with water, and then bleach (6% sodium hypochlorite) or DNA
Away™ (Molecular BioProducts), followed by sterile bi-distilled water (Sartorius-
Stedim Biotech or Millipore), and finally 80% ethanol. In the end, the vials undergo
sterilization and UV irradiation a minimum of overnight or as long as 72 h, plus
another 30 min before they are used. There must be an adequate number of grinding
vials for preparing more than one sample each day.
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 161
Harmful effects due to different environmental factors impact the ability to obtain
uncontaminated intact DNA from aged bones, and so it is very important to take
proper steps to guarantee that the highest possible DNA yields are obtained when
analysing poor-condition skeletal remains. The DNA extraction method that is used
as key for the quantity and quality of the DNA acquired, and it has a great effect on
STR typing success (Putkonen et al. 2010; Irwin et al. 2012). Optimization of
extraction methods is necessary for obtaining DNA from old skeletons. Highly
efficient extraction methods are the basis for studying and obtaining any genetic
data from old bones in forensic investigations. The most recent studies indicate that
total demineralization is the optimum method for extracting DNA from old bones
(Jakubowska et al. 2012; Amory et al. 2012) because total demineralization greatly
increases the share of full profiles, and this correlates with better quality of DNA.
The DNA extraction method that was developed at the author’s laboratory for
acquiring DNA of high quality from remains of World War II skeletons was
developed based on a total demineralization process, and it has proved effective
from as little as 0.5 g of powder from tooth or bone (Zupanič Pajnič et al. 2016a;
Zupanič Pajnič 2016). Analysis was performed on 111 teeth and bones taken from
World War II mass graves for evaluation of this method (Zupanič Pajnič 2011), as
well as on 54 samples of skeletal remains from World War II (Zupanc et al. 2013).
No undigested tooth of bone powder remained after the demineralization and lysis
stages because complete decalcification was applied with ethylenediaminetetraacetic
acid (Na2EDTA). Na2EDTA is a powerful chelator that can bind metallic ions like
calcium in the tooth or bone powder, making it possible to remove it. High quantities
of Na2EDTA are needed to dissolve some of the hydroxyapatite matrix that is
specific to tooth and bone samples (Rohland and Hofreiter 2007). To achieve
complete demineralization, 15 mL of 0.5 M Na2EDTA per gram of tooth or bone
powder is required. In theory, this amount of Na2EDTA can only bind the quantity of
calcium in 1 g of tooth or bone powder (Loreille et al. 2007). To totally demineralize
0.5 g of tooth of bone powder, 10 mL of Na2EDTA was used in the extraction
protocol. After decalcification, an extraction buffer, proteinase K, and DTT are
mixed in to the precipitate, and this is incubated for 2–3 h at 56 C. Alongside
calcium chloride, humic acids are general PCR inhibitors that are often encountered
in samples bone taken from soil (Krenke et al. 2008). When PCR inhibitors are
present, this can create imbalances or the loss of peaks at particular STR loci, and
this may produce a genetic profile that is incomplete. The purification of DNA using
an organic extraction method (commonly used in forensic laboratories) is performed
using chloroform and phenol. They are both dangerous, and processing using them
should always be carried out with a vented fume hood. Because they are toxic, using
other efficient methods to purify DNA is much safer. The purification of DNA using
magnetic beads and robotic devices was included in the extraction protocol (Zupanič
Pajnič et al. 2016a; Zupanič Pajnič 2016) and no inhibition was detected. High
efficiency of magnetic particles in DNA purification and PCR inhibitor removal was
also confirmed in some other studies that were not conducted on skeletal remains but
162 I. Zupanič Pajnič
on casework samples (Nagy et al. 2005; Montpetit et al. 2005; Kishore et al. 2006;
Valgren et al. 2008). The purification procedure using automated devices does not
use aggressive organic solvents such as phenol or chloroform, devices are easy to
use, and it is not necessary to prepare reagents (all of the reagents except DTT are
available in the kits). The purification procedure is automated and it requires only
20–30 min to complete. The entire process of extraction is performed in a large filter
tip for single use, and the remainder of the extraction reagents is also safely put in a
cartridge for one-time use. As a result, manual pipetting is not necessary and the
extraction process is less prone to contamination. Purification based on magnetic
particles can be modified for robotic machines from different suppliers or can be
carried out by hand. DNA from skeletal material from World War II was success-
fully purified using Biorobot EZ1 (Qiagen) and the AutoMate Express Instrument
(TFS). It is believed that the established extraction methods (Zupanič Pajnič et al.
2016a, Zupanič Pajnič 2016) will make a contribution to the options for automated
DNA extraction from skeletal remains, thus streamlining procedures for extracting
high-quality DNA from skeletal material in forensic laboratories. In addition, com-
mercial kits for automated DNA extraction from bone samples will make possible
test and result standardization in forensic laboratories, will increase tooth and bone
sample throughput, and will minimize the possibility of human error resulting in
sample mixing.
found in the sample. A quantification screening method that is both effective and
able to identify DNA samples that do not result in useful short tandem repeat (STR)
profiles is greatly desired in forensic genetic laboratories because STR typing has a
strong impact on the costs and time connected with DNA profile development.
Preservation of the sample to allow single nucleotide polymorphism (SNP) or
mitochondrial DNA (mtDNA) analyses is also essential. The great sensitivity of
the new qPCR assays could be applied to identify DNA samples with quantities
below the STR reaction sensitivity and thus for avoiding analysing samples that are
less likely to be amplified, resulting in less expenditure of money and time. When
testing the qPCR PowerQuant assay (Promega) on 60 World War II bone samples, it
was wondered whether the kit is capable of predicting downstream STR typing
success and whether it could be used to screen for autosomal STR typing success.
STR profiles that were full or partial but useful were only produced from bone
extracts in which short autosomal (Auto) PowerQuant targets and long degradation
(Deg) ones were detected. It was determined that, after PowerQuant quantification,
STR typing of old bones should be carried out only when both the Auto and Deg
targets are simultaneously detected. The PowerQuant kit can identify bone DNA
samples that will not produce useful STR profiles and that would be analysed with
greater success using other genetic markers like SNPs and mtDNA (Zupanič Pajnič
et al. 2017).
DNA obtained from aged skeletons has deteriorated to a small size on average,
usually between 100 and 500 bp, and bases become altered due to molecular damage
(Pääbo 1989; Hofreiter et al. 2001). Hydrolytic and oxidative changes are most
probable to damage DNA as time passes. Oxidative changes result in modifications
of bases, whereas damage due to hydrolytic changes causes the deamination of bases
as well as depyrimidination and depurination. Both of these mechanisms diminish
the size and number of fragments that PCR can amplify (Keyser-Tracqui and Ludes
2005). Knowledge of these processes and the effects they have on DNA aids
researchers in using appropriate assays (targeting of short amplicons) in order to
retrieve DNA from aged skeletons. Sex determination was the first study performed
on skeletal remains (Fattorini et al. 1988). Formerly, mitochondrial DNA tests were
regularly used to forensically identify old skeletal remains (Anslinger et al. 2001;
Palo et al. 2007). Recently, some research groups, including the author’s own, have
described successful nuclear DNA typing from old skeletal remains (Lee et al. 2010;
Zupanič Pajnič et al. 2010, 2016b, 2017; Zupanič Pajnič 2013a). Autosomal nuclear
DNA is usually typed for missing person identification because it is specific to
individuals due to recombination and offers kinship information about both parents.
In autosomal DNA, STRs or SNPs are investigated because their high discriminatory
power allows reliable identification of the individual (Zupanič Pajnič et al. 2012;
Zupanič Pajnič 2013a; Quatrehomme et al. 2019; Pilli et al. 2018). Close relatives
are the most suitable for analysing autosomal STRs or SNPs. When close relatives
164 I. Zupanič Pajnič
are not available for identification, it is possible to use distant relatives on the
paternal and maternal sides and lineage markers from mtDNA or from the Y
chromosome analysed. The Y chromosome passes in unchanged form from fathers
to sons, and mtDNA from mothers to all offspring, regardless of sex, and they make
it possible to trace the paternal and maternal lines. When even distant relatives are
not available for identification, externally visible characteristics of skeletal
remains—biogeographical ancestry, or BGA (Phillips et al. 2009; Hollard et al.
2017), eye color (Walsh et al. 2011), and color of the hair (Walsh et al. 2013) are
possible to predict through the recent establishment of DNA phenotyping in
forensics (Kayser and de Knjiff 2011; Kayser 2015).
The HIrisPlex system for predicting parallel color of eyes and hair from DNA
recently showed successful retrieval of eye and hair color information from World
War II skeletal remains recovered from Slovenian mass graves using capillary
electrophoresis technology for separation of phenotypic SNPs and its possible use
for identifying missing persons and disaster victims (Chaitanya et al. 2017). The
HIrisPlex system was applied to 49 samples of DNA acquired from the teeth and
bones of World War II victims, and all 49 of the samples resulted in complete
HIrisPlex profiles except for one MC1R DNA marker (N29insA) that was absent in
83.7% of the samples (Chaitanya et al. 2017).
Until recently, the chief methods for ancestry inference were Y-chromosome
STR/SNP and mtDNA control region and mtDNA SNP analyses because they are
geographically highly differentiated (Karafet et al. 2008). By increasing the phylo-
genetic resolution of Y chromosome, researchers recently proved additional infor-
mativeness in western European populations (Larmuseau et al. 2014, 2017; Ralf
et al. 2015). Analysis of Y-chromosomal and mtDNA markers offers useful infor-
mation for studying paternal and maternal lineages. Nonetheless, they are not
subjected to recombination, and they show only an incomplete picture of an individ-
ual ancestry, particularly in the case of complex admixture within a particular
individual’s genealogy. In contrast, autosomal ancestry-informative markers
(AIMs) or ancestry SNPs that have a broad distribution through the autosomes
offer a fuller image of overall ancestry and they have utility for identifying an
individual’s most likely BGA or population of origin, and they have become the
main markers for investigating individual ancestry (Kosoy et al. 2009; Tasker et al.
2017). AIMs are classified as genetic polymorphisms; they are mainly SNPs with
significant allele frequency divergence between ethnic groups to better characterize
genetic differences between them (Espregueira et al. 2016). It is possible to infer
genetic ancestry by comparing the genetic diversity of a sample with variation
patterns in contemporary populations. In addition to tracing genealogies of
individuals, AIMs can play an important role in identifying missing persons and
the victims of large-scale disasters (Phillips et al. 2007; Kidd et al. 2014; Puente et al.
2016) and in BGA prediction in crime case work (Pereira et al. 2017; Tasker et al.
2017; Hollard et al. 2017). In comparison to STRs, they are very short and can be
used for genotyping difficult forensic samples from badly degraded skeletal remains
with minimal amounts of DNA (Romanini et al. 2015; Silvia et al. 2017; Al-Asfi
et al. 2018). By genetic typing of STRs and SNPs found on Y chromosome and
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 165
sequencing of mtDNA control region and mtDNA coding region SNPs to determine
Y-chromosomal and mtDNA haplogroups, and investigations of AIMs, the BGA of
World War II victims’ skeletons could be determined in the future, and thus their
possible ethnic background. In addition, various databases, such as YHRD (the
Y-Chromosome STR Haplotype Reference Database) and also the EMPOP (the
European Mitochondrial DNA Population Database) can be used to search for
matching haplotypes and determination of BGA in the case of a match. There are
over 150,000 haplotypes of different populations from across the world in the
YHRD database (Willuwiet and Roewer 2007). Because the Y chromosome is
inherited on the paternal line, the matching of haplotypes indicates a common
ancestral paternal line. By searching for ancestry information using the YHRD
database, it is possible to obtain information about matching Y haplotypes and
which population they belong to. The same can be applied to analyses of the
mtDNA control region. MtDNA is inherited on the maternal line, and the matching
of haplotypes indicates a common ancestral maternal line. By using the EMPOP
database (Parson and Dür 2007), which contains more than 34,000 haplotypes of
different populations from all over the world, it is possible to obtain information
about matching mtDNA haplotypes and which population they belong to. Recently,
Polish researchers performed genetic analyses of early World War II Sobibór death
camp victims. Even though they could not identify them through phylogenetic
analyses, they determined that the skeletal remains, originally believed to originate
from victims of Russian–Polish conflicts, actually seem to belong to Jews. This is the
first solid evidence of Holocaust crimes (Diepenbroek et al. 2018), and it shows the
importance of forensic genetics for aiding historical research.
In highly degraded skeletal remains, particularly old ones, STR typing is often not
possible. Advances made recently in massively parallel sequencing (MPS), also
known as next-generation sequencing (NGS), offers strong advantages over
technologies used previously for analysing DNA recovered from human remains
(Knapp et al. 2015). With NGS technology, identification of highly degraded
skeletal remains could be achieved using identity SNPs (Mehta et al. 2017), which
can be used because they are much shorter than STRs. Because of the high copy
number per individual cell, mitochondrial DNA analysis is a key DNA detection
method used by forensic scientists when old skeletal remains have to be identified.
Traditional Sanger sequencing using capillary electrophoresis is time-consuming
and cost-prohibitive, and NGS technology provides many advantages. To predict
eye and hair color, phenotypic SNPs can be analysed with NGS technology and
AIMs to provide BGA information.
samples that have been stored for years in collections at museums, generally at room
temperature, exhibit a poorer amplification success rate in comparison to samples
that have been freshly excavated (Pruvost et al. 2007). According to Malmstrom
(2007), freezing skeletal remains is a preferred method to ensure optimum preserva-
tion of DNA. The main reason for freezing samples is to keep DNA degradation to a
minimum, preventing the loss of cell integrity and maintaining the quantity and
quality of genomic DNA (Lee et al. 2010). Previous studies indicate that there is a
reduction in DNA yield with refrigerated liquid DNA (Lee et al. 2010), with
temperature changes during freezing and thawing of the samples (Lee et al. 2010;
McElderry et al. 2011), and in samples kept in microcentrifuge tubes (Gaillard and
Strauss 2000). In addition, spontaneous decay has been reported with progressive
molecular damage to DNA (Lindahl 1993). When identification of missing persons
based on skeletal remains has been completed, the bone samples typically undergo
long-term storage at 20 C for possible future retesting (Ballou and Stolorow
2013).
Bone samples from World War II can yield low-quantity and low-quality DNA,
and it is necessary to perform duplicate analyses of various genetic markers to
identify World War II victims. No DNA extract generally remains after analyses,
and efficient bone storage is required to guarantee sample stability over time for
possible retesting making use of new markers and technologies. Following molecu-
lar genetic analysis of World War II victims from Slovenia, small femur fragments
are routinely kept at 20 C. Some authors have observed lower DNA recovery
from frozen liquid DNA extracts (Anchordoquyn and Molina 2007; Lee et al. 2010;
Hubel et al. 2014), and a study was performed on World War II femurs frozen for
10 years to investigate how freezing bone samples impacts DNA preservation (Friš
et al. 2019). To achieve this goal, the quantity of DNA acquired from 57 femurs of
World War II victims in a 2009 study (data in Zupanič Pajnič et al. 2010) was
compared with the DNA quantities acquired from the identical bones after 10 years
in a freezer using the same extraction method and quantification kit. The sample of
bone used in this study was adjacent to the one that was used in 2009. The bones
were all stored in their original form for 10 years at a temperature of 20 C. Up to
100 ng DNA/g of powdered bone was acquired from femurs in 2009 and up to 31 ng
DNA/g of powdered bone from the same femurs studied after lengthy storage.
Statistical analysis demonstrated a marked difference in DNA yield from extracts
acquired from World War II bones in 2009 and from extracts acquired from the same
bones kept at 20 C after 10 years, with a greater amount of DNA extracted from
bones in 2009 compared to 2019. As described for frozen liquid DNA extracts (Lee
et al. 2010; Pokines 2016), reduced DNA recovery was also confirmed for frozen
samples of bone, with a marked decrease in yield of DNA after being frozen for
10 years (Friš et al. 2019). The findings showed a reduced DNA recovery for frozen
samples of bone.
The second study on storing World War II bone samples focused on comparing
the yield of DNA obtained from fragments of bone and powdered bone stored in a
freezer (Grdina et al. 2019). Generally not all of the bone powder prepared with a
grinder is used for extraction, and because the powdering procedure is
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 167
time-consuming it was asked whether storing powdered bone would be useful for
future analysis. Hummel (2003) suggests that DNA extraction should take place as
soon as possible after homogenizing of bone samples, and long-term bone powder
storage could lead to degradation of DNA (even at a low temperature). Researchers
concur that storing samples of bone is crucial because preservation of DNA primar-
ily depends on the environmental conditions (Lindahl 1993). Hummel (2003) states
that powdering the bones increases the surface area that is exposed and as a result
oxidative damage to DNA. Considering this, the aim of the study was to investigate
DNA yield in World War II fragments of bone and compare this to the DNA yield
from powdered bone stored under identical conditions for 10 years at a temperature
of 20 C. The samples that were analysed had remained following molecular
genetic identification carried out in 2009 for 88 Slovenian victims buried in the
World War II Konfin Shaft 1 Mass Grave (Zupanič Pajnič et al. 2010). The amount
of DNA acquired from 57 femur fragments was compared to the amount of DNA
acquired from powdered bone from the same femurs that had been frozen for the
same length of time. DNA was extracted from a bone fragment using a piece
sampled next to the one used in 2009. This involved working with old DNA, and
so every precaution was considered to avoid possible contamination. Statistical
analyses showed a difference significant at the 0.05 level in the DNA yield when
comparing bones fragments and powdered bone stored at 20 C for 10 years, and
the findings showed there is a greater amount of DNA in powdered bone than in
fragments of bone. Because the powdering procedure is time-consuming, it is
recommended that, in addition to storing the bone fragment, the powdered bone
also be stored for future analyses (Grdina et al. 2019). The results show that lengthy
storage of bone powder does not necessarily correspond to a lower quantity of DNA
that is extracted from frozen powdered bone when compared to a bone fragment that
is frozen, and it is suggested that powdered bone left over from the initial extraction
of DNA should be stored long term for investigations in the future along with
fragments of bone.
Efforts in forensic research with DNA have focused on the development of
innovative methods for long-term storage of samples because today’s standard is
suboptimal (Lee et al. 2010). Multiple factors have to be considered. Humidity is
important because dry storage with a solid matrix inhibits molecular-level move-
ment, and chemical reactions are thus less likely (Pokines 2016). However, when
moisture is introduced into the sample again or temperature variations occur, it is
again possible for chemical reactions to occur (Pokines 2016). The temperature that
the sample is maintained at also impacts the preservation of DNA, and changes in the
crystallinity values of the bone mineral are visible after a single freezing, and the
decrease in DNA yield is greater after each cycle of freezing and thawing
(McElderry et al. 2011). DNA is damaged by repeated cycles of freezing and
thawing, and it should therefore be defrosted as rarely as possible (Lindahl 1993).
Initial contamination, the effects of light, seal efficiency, and intrinsic bone factors,
such as its type and size, also have to be considered (Lee et al. 2010). Fulton (2012)
states that the best protocol for lengthy storage of aged specimens varies and that it
depends on the way the specimens were collected. Samples that were frozen when
168 I. Zupanič Pajnič
Even though seven decades have elapsed since the end of World War II, identifica-
tion of World War II victims remains relevant because many individuals killed at
that time are still missing and have not been identified. Discovering remains dating
from World War II is a common occurrence in Slovenia. The Slovenian Government
Commission on Concealed Mass Graves has recorded more than 600 hidden mass
graves from World War II over the last quarter century (Ferenc 2008). These killings
that took place in World War II, amounting to almost 100,000 victims, represent one
of the largest-scale losses of life in the modern history of Slovenia. Most victims of
killings during and after the war remain buried and are still unidentified. The victims
did not have court trials and they were not convicted of crimes. There exist no
documents for most mass graves in Slovenia that victim identification could be based
on. For some of them, a list of the victims can be made based on archives. Even for
those, it is difficult to find living relatives because such a long time has elapsed since
the massacres during World War II. The author’s team has been conducting genetic
investigations of victims of World War II from only a few mass graves, where a list
of the Slovenian victims was found in archives. Some of the victims have been
identified because putative relatives (close and/or distant) were available for identi-
fication (Zupanič Pajnič 2008; Zupanič Pajnič et al. 2010, 2018a, b). A 99.9%
recommended posterior probability was applied, with the aim of high confidence
in correctly identifying the individuals (Brenner and Weir 2003; Biesecker et al.
2005; Prinz et al. 2007). By combining various genetic markers and involving both
close and distant relatives, a sufficiently high statistical probability of positively
identifying the victims from mass graves was achieved, even if it was possible to
trace only distant relatives of the victims. This proved that by combining many
genetic markers it is possible to identify victims of World War II despite an absence
of close relatives. Relatives of identified victims have attained certainty about the
disappearance of their loved ones after over seven decades, and they have buried the
identified skeletal remains in family graves. Genetic identifications have helped
reveal information about historical events in Slovenia immediately after World
War II. Recent phylogenetic analysis of Polish World War II death camp victims
and the establishment of their Jewish origin shows the great importance of forensic
genetics for aiding historical research even when it is not possible to identify victims
by name (Diepenbroek et al. 2018).
For traceability of possible contamination, for each mass grave an elimination
database was created. The database included genetic profiles for the nuclear DNA
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 169
(autosomal and Y-chromosomal STRs) and mtDNA of every person that had had
contact with the skeletal remains. When identifying victims of the World War II
mass graves, the chance of contamination occurring during genetic investigation was
minimized. The authenticity of bones’ genetic profiles was checked through clean
isolation and amplification-negative controls used for nuclear DNA, identical
genetic profiles acquired using different PCR amplification kits, and mismatch of
genetic profiles for bones with people included in the elimination database.
Shaft 1 Mass Grave is such a rare case because it was possible to compile a list of its
victims based on archival documents. The methods for extracting and amplifying
DNA that were used for identifying the Konfin Shaft 1 Mass Grave victims proved
very efficient because full genetic profiles were generated for autosomal DNA,
mtDNA haplotypes, and Y-STR haplotypes (Zupanič Pajnič et al. 2010).
In 1944, below Mount Storžič, at an elevation of 1200 m, five men were taken to a
killing site. One of them fell into a shaft during an attempt to escape, and the other
four were killed and their bodies were buried in a hidden mass grave. This grave was
found in 2007 and four skeletons were excavated. One victim was identified based
on an anthropological study, and the other three were identified by genetic methods.
Identification was performed by analysing excavated femurs and teeth and compar-
ing the genetic profiles obtained with the living relatives’ genetic material (Zupanič
Pajnič 2008). Autosomal genetic profiles, Y-chromosome haplotypes, and mtDNA
haplotypes, were acquired from all of the tooth and bone and from reference persons.
When comparing the genetic profiles, all the teeth and bones matched with living
relatives (for the first victim the reference person was a daughter, for the second
victim the reference person was a niece on the maternal line, and for the third victim
the reference persons were a son and a niece on the maternal line). The statistical
analysis exhibited a high confidence that identification was correct with posterior
probabilities (PP) that ranged from 99.9999% to 99.999999%, speaking in favor of
the positive identification of the victims.
During World War II, a young woman was executed in Bohinj and she left behind a
1-year-old daughter. Four decades ago, a skeleton was excavated from an individual
grave in the Bohinj area and only the cranium from the grave was kept at the Little
War Museum (Mali vojni muzej). The burial site conformed to accounts from
witnesses, but initial anthropological and morphological screening was unable to
identify the sex of the remains. In 2015, genetic analysis was performed on the
cranium to determine whether it was from the mother of the presumed daughter
serving as a family reference. The genetic analysis was conducted alongside a more
careful anthropological analysis of the cranium. The genetic examination was carried
out on two molars and a petrous portion of the temporal bone, and the results
acquired from the teeth corroborated the results from the temporal bone. Nuclear
DNA for STR typing was obtained from the temporal bone and from the left second
molar. A complete autosomal genetic profile, which included amelogenin locus,
indicated that the cranium was from a male, and analyses of Y-STRs provided
further confirmation of this. The same conclusions were reached following an
anthropological analysis, which indicated that the cranium had come from a very
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 171
young Caucasoid male. The male sex of the cranium excluded the possibility that it
had belonged to the mother of the female reference used for comparison (Zupanič
Pajnič et al. 2016b).
In 2016, the victims of the single largest massacre of a family in Slovenia were
genetically identified (Zupanič Pajnič et al. 2018b, 2020). Ten people from the same
family were killed in World War II: nine of them in 1942 and one immediately after
the war. During the massacre in 1942, seven members were killed in the forest and
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 173
their bodies were hidden in a mass grave. Soon after these seven people were killed,
the mother and grandmother of the children that had survived were murdered at their
home, and the two of them were buried in the local cemetery. Two children, a 4-year-
old girl and her 3-year-old brother, were the only ones who survived the massacre.
Besides these two children, an uncle also survived the killings in 1942, but he was
murdered immediately after World War II. A total of ten people from the same
family were killed during World War II. Exhumation of the remains started in March
2015, but archeologists exhumed only three female skeletons, which were incom-
plete. Twenty meters from this site, relatives later found bones, and the burial
location of at least three males was excavated in August 2016. The grave excavated
in 2015 was labeled a female grave, and the one excavated in 2016 was labeled a
male grave. The family members were buried in shallow graves in the woods, and
the skeletons that were exhumed were incomplete at both sites. Aside from teeth in
one mandible, no teeth were found. The reason why the skeletons were incomplete
could be because the graves were very shallow, making it very probably that wild
animals scattered the victims’ remains in the woods. The remains underwent tapho-
nomic processes after deposition, which resulted in a poor state of preservation. The
bones that were exhumed were abraded, otherwise damaged, and porous, without
features that would permit anthropologists to macroscopically determine their
laterality. The graves were positioned along a creek in the woods, and so water
exposure caused diagenetic and degradation processes. For the first skeleton recov-
ered from the female grave, the only parts found were a piece of the skull without
teeth, part of a femur, and part of a tibia. For the second, the pieces recovered were
part of the skull, a segment of spine, a humerus, and the right leg bones. The skull
preserved three mandibular teeth: the left and right second molars and also the left
first premolar. For the third skeleton in the female grave, only part of the skull
lacking teeth, a piece of the spine, and a tibia were discovered. In the male grave,
only individual bones (including the diaphysis from six femurs) were recovered by
archeologists, and the number of individuals buried there was at least three. Follow-
ing the removal of the skeletal remains from the two graves, the author’s team was
requested to carry out genetic identification by comparing findings with two living
relatives (the aforementioned daughter and son). Altogether, analysis was made of
12 bones and teeth, and these were compared with the two living relatives. Seven
bones and one molar yielded nuclear DNA for successful STR typing. The female
grave yielded autosomal profiles from only one of the skeletons, and autosomal
profiles were obtained from five of the six femurs in the male grave. The
relationships among the males were further confirmed through analyses of Y-STRs
and STR profiles made it possible to identify four members of the family; an aunt
from the female grave, and from the male grave two uncles plus the father of the
living children, who served as family references. The product rule was applied to
calculate a combined likelihood ratio for autosomal and Y-STRs, and high confi-
dence of having made a correct identification was demonstrated through statistical
analyses, with PP greater than 99.9% for three of the four victims identified. For
identification of the aunt, the PP determined following capillary electrophoresis STR
typing was not high enough. To achieve a better PP, we used the next-generation
174 I. Zupanič Pajnič
References
Al-Asfi M, McNevin D, Mehta B, Power D, Gahan ME, Daniel R (2018) Assessment of the
precision ID ancestry panel. Int J Legal Med 132:1581–1594
Alberti F, Gonzalez J, Paijmans JLA (2018) Optimized DNA sampling of ancient bones using
computed tomography scans. Mol Ecol Resour 18:1196–1208
Alonso A, Andelinović Š, Martin P (2001) DNA typing from skeletal remains: evaluation of
multiplex and megaplex STR systems on DNA isolated from bone and teeth samples. Croat
Med J 42:260–266
Amory S, Huel R, Bilić A, Loreille O, Parsons TJ (2012) Automatable full demineralization DNA
extraction procedure from degraded skeletal remains. Forensic Sci Int Genet 6:398–406
Anchordoquyn TJ, Molina MC (2007) Frontiers in clinical research preservation of DNA. Cell
Preserv Tech 5:180–188
Anderung C, Persson P, Bouwman A, Elburg R, Götherström A (2008) Fishing for ancient DNA.
Forensic Sci Int Genet 2:104–107
Anslinger K, Weichhold G, Keil W, Bayer B, Eisenmenger W (2001) Identification of the skeletal
remains of Martin Bormann by mtDNA analysis. Int J Legal Med 114:194–196
Ballou S, Stolorow M (2013) The biological evidence preservation handbook: best practices for
evidence handlers. U.S. Department of Commerce, National Institute of Standards and Tech-
nology, Washington, DC, pp 9–25
Barta JL, Monroe C, Kemp BM (2014) Mitochondrial DNA preservation across 3000-years-old
northern fur seal ribs is not related to bone density: implications foe forensic investigations.
Forensic Sci Int 239:11–18
Baum DA, Futuyma DJ, Hoekstra HE, Lenski RE, Moore JA, Peichel CL et al (2013) The Princeton
guide to evolution. Princeton University Press, Princeton, NJ, pp 477–479
Biesecker LG, Bailey-Wilson JE, Ballantyne J, Baum H, Bieber FR, Brenner C et al (2005) DNA
identification after the 9/11 World Trade Center attack. Science 310:1122–1123
Brenner CH, Weir BS (2003) Issues and strategies in the DNA identification of World Trade Center
victims. Theoret Popul Biol 63:173–178
Burger J, Hummel S, Hermann B, Henke W (1999) DNA preservation: a microsatellite-DNA study
on ancient skeletal remains. Electrophoresis 20:1722–1728
Camposa PF, Craig OE, Turner-Walker G, Peacock E, Willerslev E, Gilbert MTP (2012) DNA in
ancient bone - where is it located and how should we extract it? Ann Anat 194:7–16
Chaitanya L, Zupanič Pajnič I, Walsh S, Balažic J, Zupanc T, Kayser M (2017) Bringing colour
back after 70 years: predicting eye and hair colour from skeletal remains of World War II
victims using the HIrisPlex system. Forensic Sci Int Genet 26:48–57
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 175
Irwin JA, Just RS, Loreille OM, Parsons TJ (2012) Characterization of a modified amplification
approach for improved STR recovery from severely degraded skeletal elements. Forensic Sci Int
Genet 6:578–587
Iwamura ESM, Soares-Vieira JA, Muñoz DR (2004) Human identification and analysis of DNA in
bones. Rev Hosp Clin Fac Med S Paulo 59:383–388
Jakubowska J, Maciejewska A, Pawłowski R (2012) Comparison of three methods of DNA
extraction from human bones with different degrees of degradation. Int J Legal Med
126:173–178
Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (2008) New
binary polymorphisms reshape and increase resolution of the human Y chromosomal
haplogroup tree. Genome Res 18:830–838
Kayser M (2015) Forensic DNA phenotyping: predicting human appearance from crime scene
material for investigative purposes. Forensic Sci Int Genet 18:33–48
Kayser M, de Knjiff P (2011) Improving human forensics through advances in genetics, genomics
and molecular biology. Nat Rev Genet 12:179–192
Kendall C, Høier Eriksen AM, Kontopoulos I, Collins MJ, Turner-Walker G (2018) Diagenesis of
archaeological bone and tooth. Paleogeogr Palaeocl 491:21–37
Keyser-Tracqui C, Ludes B (2005) Methods for the study of ancient DNA. In: Carracedo A
(ed) Forensic DNA typing protocols. Humana Press Inc, New York, NY, pp 253–264
Kidd KK, Speed WC, Pakstis AJ, Furtado MR, Fang R, Madbouly A et al (2014) Progress toward
an efficient panel of SNPs for ancestry inference. Forensic Sci Int Genet 10:23–32
Kishore R, Hardy WR, Anderson VJ, Sanchez NA, Buoncristiani MR (2006) Optimization of DNA
extraction from low-yield and degraded samples using the biorobot EZ1 and biorobot M48. J
Forensic Sci 51:1055–1061
Knapp M, Lalueza-Fox C, Hofreiter M (2015) Re-inventing ancient human DNA. Investig Genet
6:4
Kosoy R, Nassir R, Tian C, White PA, Butler LM, Silva G et al (2009) Ancestry informative marker
sets for determining continental origin and admixture proportions in common populations in
America. Hum Mutat 30:69–78
Krenke BE, Nassif N, Sprecher CJ, Knox C, Schwandt M, Storts DR (2008) Developmental
validation of a real-time PCR assay for the simultaneous quantification of total human and
male DNA. Forensic Sci Int Genet 3:14–21
Larmuseau MHD, Vanderheyden N, Van Geystelen A, van Oven M, Kayser M, Decorte R (2014)
Increasing phylogenetic resolution still informative for Y chromosomal studies on West -
European populations. Forensic Sci Int Genet 9:179–185
Larmuseau MHD, Otten GPPL, Decorte R, Van Damme P, Moisse M (2017) Defining Y-SNP
variation among the Flemish population (Western Europe) by full genome sequencing. Forensic
Sci Int Genet 31:e12–e16
Lee SB, Crouse CA, Kline MC (2010) Optimizing storage and handling of DNA extracts. Forensic
Sci Rev 22:131–144
Lindahl T (1993) Instability and decay of the primary structure of DNA. Nature 362:709–715
Loreille OM, Diegoli TM, Irwin JA, Coble MD, Parsons TJ (2007) High efficiency DNA extraction
from bone by total demineralization. Forensic Sci Int Genet 1:91–195
Malmstrom H (2007) Ancient DNA as a means to investigate the European Neolithic. Doctoral
dissertation, Uppsala University, Uppsala, Sweden
Mansour H, Krebs O, Sperhake JP, Augustin C, Koehne T, Amling M et al (2018) Cementum as a
source of DNA in challenging forensic cases. J Forensic Legal Med 54:76–81
McElderry JP, Kole MR, Morris MD (2011) Repeated freeze-thawing of bone tissue affects Raman
bone quality measurements. J Biomed Opt 16(071407):1–4
Mehta B, Daniel R, Phillips C, McNevin D (2017) Forensically relevant SNaPshot® assays for
human DNASNP analysis: a review. Int J Legal Med 131:21–37
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 177
role of forensic genetics for disaster victims identification (DVI). Forensic Sci Int Genet 1
(1):3–12
Pruvost M, Schwarz R, Correia VB (2007) Freshly excavated fossil bones are best for amplification
of ancient DNA. Proc Natl Acad Sci U S A 104:739–744
Puente M, Santos C, Fondevila M, Manzo L, EUROFORGEN-NoE Consortium, Carracedo Á,
Lareu MV et al (2016) The global AIMs Nano set: a 31-plex SnaPshot assay of ancestry-
informative SNPs. Forensic Sci Int Genet 22:81–88
Putkonen MT, Palo JU, Cano JM, Hedman M, Sajantila A (2010) Factors affecting the STR
amplification success in poorly preserved bone samples. Investig Genet 1:9
Quatrehomme G, Unité Police d’Identification de Victimes de Catastrophes, Toupenay S,
Delabarde T, Padovani B, Alunni V (2019) Forensic answers to the 14th of July 2016 terrorist
attack in Nice. Int J Legal Med 133:277–287
Ralf A, van Oven M, Zhong K, Kayser M (2015) Simultaneous analysis of hundreds of
Y-chromosomal SNPs for high-resolution paternal lineage classification using targeted semi-
conductor sequencing. Hum Mutat 36:151–159
Rohland N, Hofreiter M (2007) Ancient DNA extraction from bones and teeth. Nat Protoc
2:1756–1762
Romanini C, Catelli ML, Borosky A, Pereira R, Romero M, Salado Puerto M et al (2012) Typing
short amplicon binary polymorphisms: supplementary SNP and Indel genetic information in the
analysis of highly degraded skeletal remains. Forensic Sci Int Genet 6:469–476
Romanini C, Romero M, Salado Puerto M, Catelli L, Phillips C, Pereira R et al (2015) Ancestry
informative markers: inference of ancestry in aged bone samples using an autosomal AIM-Indel
multiplex. Forensic Sci Int Genet 16:58–63
Salamon M, Tuross N, Arensburg B, Weiner S (2005) Relatively well preserved DNA is present in
the crystal aggregates of fossil bones. Proc Natl Acad Sci U S A 102:13783–13788
Sampierto ML, Gilbert MT, Lao O, Caramelli D, Lari M, Berranpetit J, Lalueza-Fox C (2006)
Tracking down human contamination in ancient human teeth. Mol Biol Evol 23:1801–1807
Schwartz TR, Schwartz EA, Mieszerski L, McNally L, Kobilinsky L (1991) Characterization of
deoxyribonucleic acid (DNA) obtained from teeth subjected to various environmental
conditions. J Forensic Sci 36:979–990
Silvia AL, Shugarts N, Smith J (2017) A preliminary assessment of the ForenSeq™ FGx System:
next generation sequencing of an STR and SNP multiplex. Int J Legal Med 131:73–86
Smith CI, Chamberlain AT, Riley MS, Stringer C, Collins MJ (2003) The thermal history of human
fossils and the likelihood of successful DNA amplification. J Hum Evol 45:203–217
Tasker E, LaRue B, Beherec C, Gangitano D, Hughes-Stamm S (2017) Analysis of DNA from post-
blast pipe bomb fragments for identification and determination of ancestry. Forensic Sci Int
Genet 28:195–202
Turner-Walker G (2008) The chemical and microbial degradation of bones and teeth. In: Pinhasi R,
Mays S (eds) Advances in human palaeopathology. John Wiley and Sons Ltd, New York, NY,
pp 1–29
Valgren C, Wester S, Hansson O (2008) A comparison of three automated DNA purification
methods in forensic casework. Forensic Sci Int Genet Suppl Ser 1:76–77
Walsh S, Liu F, Ballantyne KN, van Oven M, Lao O, Kayser M (2011) IrisPlex: a sensitive DNA
tool for accurate prediction of blue and brown eye colour in the absence of ancestry information.
Forensic Sci Int Genet 5:170–180
Walsh S, Liu F, Wollstein A, Kovatsi L, Ralf A, Kosiniak-Kamysz A et al (2013) The HIrisPlex
system for simultaneous prediction of hair and eye colour from DNA. Forensic Sci Int Genet
7:98–115
Willuwiet S, Roewer L (2007) Y chromosome haplotype reference database (YHRD): update.
Forensic Sci Int Genet 1:83–87
Zietkiewicz E, Witt M, Daca P, Zebracka-Gala J, Goniewicz M, Jarząb B et al (2012) Current
genetic methodologies in the identification of disaster victims and in forensic analysis. J Appl
Genet 53:41–60
8 Analyses of Second World War Skeletal Remains Using a Forensic Approach 179
Zupanc T, Balažic J, Štefanič B, Zupanič Pajnič I (2013) Performance of the Human Quantifiler, the
Investigator Quantiplex, and the Investigator ESSplex Plus kit for quantification and nuclear
DNA typing of old skeletal remains. Rom J Legal Med 21:119–124
Zupanič Pajnič I (2008) Molekularno genetska identifikacija domobranskih žrtev (Molecular
genetic identification of Slovenian home guard victims). Zdrav Vestn 77:745–750
Zupanič Pajnič I (2011) Visoko učinkovita metoda ekstrakcije DNA iz skeletnih ostankov (Highly
efficient DNA extraction method from skeletal remains). Zdrav Vestn 80:171–181
Zupanič Pajnič I (2013a) A comparative analysis of the AmpFlSTR identifiler and PowerPlex
16 autosomal short tandem repeat (STR) amplification kits on the skeletal remains excavated
from Second World War mass graves in Slovenia. Revista de medicinæalegalæa 21:73–78
Zupanič Pajnič I (2013b) Genetic identification of Second World War victim’s skeletal remains.
Lap Lambert Academic Publishing, Saarbrucken
Zupanič Pajnič I (2016) Extraction of DNA from human skeletal material. In: Goodwin W
(ed) Forensic DNA typing protocols, methods in molecular biology, vol 1420. Springer Science
& Business Media, LLC, New York, NY, pp 89–108
Zupanič Pajnič I (2017) Evaluation of the quality of bone powder for successful STR typing of
human skeletal remains. Revista de medicinæ alegalæa 25:92–98
Zupanič Pajnič I, Gornjak-Pogorelc B, Balažic J (2010) Molecular genetic identification of skeletal
remains from the Second world war Konfin I mass grave in Slovenia. Int J Legal Med
124:307–317
Zupanič Pajnič I, Gornjak Pogorelc B, Balažic J, Zupanc T, Štefanič B (2012) Highly efficient
nuclear DNA typing of the World War II skeletal remains using three new autosomal short
tandem repeat amplification kits with the extended European Standard Set of loci. Croat Med J
53:17–23
Zupanič Pajnič I, Debska M, Gornjak Pogorelc B, Vodopivec Mohorčič K, Balažic J, Zupanc T et al
(2016a) Highly efficient automated extraction of DNA from old and contemporary skeletal
remains. J Forensic Legal Med 37:78–86
Zupanič Pajnič I, Petaros A, Balažic J, Geršak K (2016b) Searching for the mother missed since the
Second World War. J Forensic Legal Med 44:138–142
Zupanič Pajnič I, Zupanc T, Balažic J, Geršak ŽM, Stojković O, Skadrić I et al (2017) Prediction of
autosomal STR typing success in ancient and Second World War bone samples. Forensic Sci Int
Genet 27:17–26
Zupanič Pajnič I, Bajželj M, Gornjak-Pogorelc B, Inkret J, Balažic J (2018a) Identification of the
Second World War victim using autosomal and Y - STR markers. In: The 11th Haploid Markers
Conference: Inferring ancestry from DNA, 17–19 May, 2018, Bydgoszcz, Poland
Zupanič Pajnič I, Obal M, Bajželj M, Gornjak-Pogorelc B, Inkret J, Balažic J (2018b) Victims of the
biggest Second World War family killing in Slovenia identified via autosomal and haploid
markers. In: The 11th Haploid Markers Conference: Inferring ancestry from DNA, 17–19 May,
2018, Bydgoszcz, Poland
Zupanič Pajnič I, Gornjak Pogorelc B, Zupanc T (2019) Next generation sequencing technology in
Second World victim identification. Forensic Sci Int Genet Suppl Ser 7:123
Zupanič Pajnič I, Obal M, Zupanc T (2020) Identifying victims of the largest Second World War
family massacre in Slovenia. Forensic Sci Int 306:110056
Molecular Tools for Analysis
of Archaeological and Prehistoric Human 9
Bones: A Perspective of Anthropological
and Forensic Relevance
Abstract
Bones and the teeth have been considered as the most prominent preserved
remains of the primates. The chapter describes conventional tools for the purpose
of identification of these materials as well as the present-day DNA typing method
as the advanced tool for typing these evidences. The chapter also reviews
different steps in molecular typing of these evidences along with problems,
challenges and upcoming advancements in the field.
Keywords
Archaeological · Prehistoric · PCR · Human bones · Anthropology · Forensic
relevance
M. Panda
Department of Anthropology, Dr. Harisingh Gour Vishwavidyalaya (A Central University), Sagar,
M. P., India
DNA Fingerprinting Unit, State Forensic Science Laboratory, Department of Home (Police),
Government of Madhya Pradesh, Sagar, M. P., India
A. N. Sharma
Department of Anthropology, Dr. Harisingh Gour Vishwavidyalaya (A Central University), Sagar,
M. P., India
P. Shrivastava
DNA Fingerprinting Unit, State Forensic Science Laboratory, Department of Home (Police),
Government of Madhya Pradesh, Sagar, Madhya Pradesh, India
H. R. Dash (*)
DNA Fingerprinting Unit, Integrated High-Tech Laboratory, Forensic Science Laboratory, Bhopal,
M. P., India
9.1 Introduction
Commonly bones and the teeth are the more survived evidences of vertebrates in the
archaeological findings (Lee-Thorp 2008). Hence considered as the most prominent
preserved remains of the primates during the period of evolution, helps in breaking
the mystery of evolutionary pathway of different primates and Homos. The archaeo-
logical as well as prehistoric bones were mostly found in burial conditions either in
decomposed or in fossilized forms. Wide variety of sampled bones, that is complete
skeletal remains, partial, burnt or damaged as well as scarped and fragmented
samples are recovered from different sites like archaeological sites, mass disaster
areas, war zones and fire scenes and so on. Many curiosity like biological gender,
age since death, race as well as height of the deceased skeletal remains can accurately
determine by the forensic anthropologists, distinguished the human skeletons from
the other mammal remains at various sites using different methods; well-advanced
DNA techniques add twist within those inquiries (Lundy 1998). Wide range of
species recognition as well as ancestry evaluation become possible due to molecular
approaches in bone analysis which increases the applicability of the DNA analysis
(Ubelaker 2018). Besides, information regarding the past related to the civilization
can be known from the bones excavated as the only evidence at different archaeo-
logical sites. Information about the past population like their lifestyle and living
conditions can be known from morbidity-related changes due to infections like
leprosy and syphilis and so on, osteoarthritis and trauma and so on; informs about
origin, evolution of many diseases found at present (Ortner 2003). As an archaeo-
logical specimen, bones are usually numerous in the form of biological materials
than the other soft specimens and those conveniently for vertical diversity study in
the point of genetic, considered as highly informative with their ancient DNA
(aDNA) analysis (Beraud-Colomb et al. 1995). Chemical analysis helps to detect
the dietary habit or nutrition-related information of the past from the skeletal remains
(Allmäe et al. 2012). Both organic and inorganic parts in bones and teeth contain
different geochemical prints as a result of variations in diet of animal at of isotopic
carbon levels (Clementz et al. 2009). Discrimination between human skeletal
remains from the nonhumans should be the prime concern in archaeology and
forensic biology to save time, resources and money before proceeding for any
analysis (Johnson et al. 2017). From anthropological and forensic investigations
point of view, proper age estimation of the old bones is quite necessary with
minimum biasness. During the death investigation, a forensic anthropologist uses
knowledge regarding human body and calculates age by analysis of skeletons with a
first priority (Stanojevich 2012). Different methods are employed by the
investigators to estimate the accurate age of death. Age-related useful indicators
are usually missing or completely destroyed near its all signs in fragmented, gradu-
ally rubber or in partial skeleton remains found at different archaeological sites
(Kerley 1965). Besides these, still many complete skeletal remains are present in
burial conditions, but still problematic in point of the age estimation. There are
notable changes which occur at the molecular level in different tissues of the body
9 Molecular Tools for Analysis of Archaeological and Prehistoric Human Bones: A. . . 183
(Meissner and Ritz-Timme 2010), estimation and assessment of which can form the
base to the prediction of age at death by molecular methods.
This article aimed at gathering the currently used molecular techniques and
methodological information in relation to the human bone study and its relevance
in anthropology and forensic angles. Before proceeding for the molecular analysis,
one should decide wisely that which part of the bone needs to be examined, as this
kind of step is more expensive, destruct the sample may affect the result of the study
(Ubelaker 2018).
The primary stage examination on old bones focuses on different inquiries like the
species determination, explore facts about the age as well as sex of that remains and
the time period to which the remains belong to. Both morphological analyses based
upon the size and shape and molecular techniques are applied in this field. For
example, different methods are useful for the sex determination of recovered skeletal
remains (Bruzek 2002; McGlynn 2007). Even successful sex detection rates are
found upon adult as well as approximate complete skeletal remains but fail to
identify in the cases of poorly preserved skeletons, juvenile samples as well as in
the case of incomplete skeletal remains (Black III 1978a, b; Brown et al. 2007; Bauer
et al. 2013). Different methodology for the analysis of juvenile skeletons found to be
more reliable among males as compared to the females (Weaver 1980; Schutkowski
1993; Scheuer 2002; Galdames et al. 2008; Wilson et al. 2008). Similarly, little
information on past medical emergencies and mediations can be predicted from
trauma signs on skeletons (Robbins Schug 2017) but not able to go through the deep
into the pathophysiology. Recently, Shinde et al. (2018) used a number of morpho-
logical techniques even use for counting the age during the death (Brothwell 1981;
Lovejoy et al. 1985; Brooks and Suchey 1990) of two grave skeletal remains. Hence
here we can say that the morphological analysis of old skeletal remains is still used
by the analyser by its uniqueness, irrespective of their drawbacks. Those sort of
questions along with others likely discussed here related to archaeological skeleton
remains are not solved by the morphological and metric methods quite accurately. In
this regard, molecular tools are considered as an alternative but simultaneously run
with different methodological as well as biasness-related issues.
A good number of ancient samples are available preserving little or no DNA, hence
some of them are useful with respect to the aDNA analysis (Pääbo et al. 2004). Low
amount of very fragmented DNA is recovered from biological remains mixed with
different inhibitors related to that environment as a result of different influencing
factors related to taphonomy (Matheson et al. 2009). A study result indicates that the
184 M. Panda et al.
palaeontological and archaeological bone samples, which are unearthed freshly even
not washed or treated with any solution, contain more DNA approximately sixfold
and yield authentic sequence by twofold (Pruvost et al. 2007). Trace amount of DNA
is preserved in different ancient biological remains with different types of continuous
degradation over time (Rohland and Hofreiter 2007).
Passes of time and interaction with the surrounding environment either make
fragment or modify the threads of genome made up of four-letter bases A, T, G and C
(Linderholm 2016). Ancient DNA (aDNA) needs to be handled with more care
because of their fragile in nature to minimize damage during downstream processing
(Höss et al. 1996; Hofreiter et al. 2001; Hansen et al. 2006). aDNA-related studies
face the challenging issues like most of the samples are contaminated with the
outside DNA and absent of result during their analysis (Pääbo et al. 2004). A sample
contains DNA which tends to be contaminated at any stage, at its finding or at the
time of excavation or during the storage or at laboratory during the downstream
proceedings (Skoglund et al. 2014). To avoid contamination-trained personals along
with sophisticated laboratories as well as advanced instrumentation are necessary for
effective study results (Cooper and Poinar 2000; Mulligan 2005). Sample contami-
nation can easily be identified as well as quantified by modern methods (Malmström
et al. 2007). Also absence of cellular assemblies in the quite old specimens due to
different modifications in biochemical level may create problems to find the
remained DNA from aqueous part during the extraction (Geigl 2002). Hence, the
molecular methods used for the analysis of ancient bone remains are involved with
many methodological as well as processing challenges. To overcome such problems,
many advancements of the technologies in terms of low template specificity and/or
inhibitor tolerance capability have been developed over the time which has been
discussed in detail below.
Different types of protocols are followed for aDNA extraction like silica binding, use
of membrane (Leonard et al. 2000) and alcohol-based methods like isopropanol or
ethanol precipitation (Kalmár et al. 2000). Before proceeding for any analysis, a
number of methods of DNA extraction from the ancient bone were performed, which
involves the common steps like incubate bone powder in buffer (Pääbo 1990;
Cattaneo et al. 1995; Hänni et al. 1995a, b), followed by phenol–chloroform
extraction (Pääbo 1990; Hänni et al. 1995a, b; Perry et al. 1988) or either dialysed
with EDTA and Tris–HCl buffer (Hänni et al. 1995a, b) and finally concentration
DNA yields by isopropanol/ethanol precipitation (Hänni et al. 1995a, b; Cattaneo
et al. 1997) or by microconcentrators (Pääbo 1990; Yang et al. 1998); can eluted
(washed) from silica pellet after separated with silica suspension (Evison et al. 1997;
Prado et al. 1997). A study indicates that during the demineralization of bone prior to
extraction of DNA by different steps, some DNA is released into the supernatant
(Schwarz et al. 2009). From a number of methods developed for the DNA extraction
from ancient bone samples, the precipitation by ethanol or isopropanol is considered
9 Molecular Tools for Analysis of Archaeological and Prehistoric Human Bones: A. . . 185
as the most appropriate method for this purpose (Kalmár et al. 2000). Maximum
aDNA extract can be performed at room temperature from ancient bone and teeth
powder, treating by buffer-containing proteinase K and EDTA, where guanidinium
thiocyanate used in solution at high concentration to bind the DNA to silica; this
minimizes the further degradation and reduces the PCR inhibitors (Rohland and
Hofreiter 2007). An improved silica-in-solution method has advantage over the
previous version in respect to extracting maximized endogamous tiny and
fragmented DNA up to four times due to degradation over time and method has its
significance for the genome-based study of Bronze Age skeletal remains with large
sample size (Allentoft et al. 2015).
Besides those manual methods, several automation techniques are used for DNA
extraction of old bone samples. These minimize the time of extraction, reduce the
chance of contamination of environmental DNA with the endogenous DNA present
in the bone samples. AutoMate Express an automated system used by modified Full
Demineralization (FD) and No Demineralization (ND) protocol for DNA extraction
from old skeletal remains efficiently by minimizing the time length and contamina-
tion (Pajnič et al. 2016). A recent study indicates that an automated DNA extraction
system called Chemagic Magnetic Separation Module I successfully reduces the
amount of PCR inhibitor during the elution of DNA from decomposed or old bone
samples in comparison with routine organic method of DNA extraction, as the
amount of extraction is quite same by both methods (Hong et al. 2017).
Always the aDNA mixed with endogenous DNA as well as DNA from the
surrounding environment (Shapiro and Hofreiter 2014). Territorial environment
always decides how much endogamous DNA is present in the sample along with
playing a vital role for its preservation (Sawyer et al. 2012). Though most of the
ancient samples are recovered in degraded conditions, their mt-DNA remains in
significantly intact form due to their huge number, that is, ~102 to 103 copies per
living cell (Hagelberg and Clegg 1991). Perhaps, the research on molecular level of
ancient sample was started on the remains of Quagga belongs to the extinct family of
Equus (Higuchi et al. 1984). Later, mt-DNA was extracted successfully from
different ancient human samples like skin of Egyptian mummy (Pääbo 1985) as
well as bone (Horai et al. 1989; Hagelberg et al. 1989). However, the applicability of
using mtDNA is limited only to matrilineal lineage analysis.
Successful operation of polymerase chain reaction (PCR) (Mullis and Faloona 1987)
brought an evolution in biology dealing with the nucleic acids, open new chances for
the analysis of aDNA as well as fresh DNA. This amplification technique produces
sufficient copy of supplied segment of nucleic acid (DNA) called as amplicon even
from a trace amount of targeted template. During PCR of different extracted DNA,
many challenges come out most often due to the remained inhibitors and degraded or
fragmented amplicons. Hence, sometimes PCR optimization is necessary when
normal procedure is not able to harvest the copy of chosen amplicon (Lorenz
186 M. Panda et al.
2012). During short tandem repeat (STR) examination, autosomal and Y markers
face different difficulties like the amount of DNA and level of degradation associated
with the former, where the latter only by the degradation level (Putkonen et al. 2010).
polymerase enzyme 2D9 has been reported to show promising result in amplifying
DNA samples in presence of some known inhibitor compounds, that is humic acid,
bone powder, coprolite, peat extract, clay-rich soil, cave deposit and tar (Baar et al.
2011). A study result indicates that three commercially available polymerases: Ex
Taq HS, PicoMaxx HF and FastStart Taq more efficiently amplify the highly
degraded human aDNA amplicons containing impurities like PCR inhibitors in the
reaction medium (Kim et al. 2015). Another study shows the efficient use of a plant
enzyme KAPA3G for amplification of low-quality fragmented DNA samples
extracted from ancient buried bone (Nilsson et al. 2016).
et al. 2001; Stiller et al. 2006), whereas less attention is given to DNA damage,
which is non-by-passable during PCR process (Hansen et al. 2006).
Unlike nuclear DNA, mtDNA preserves its structural integrity even after elon-
gated time period due to its circular structure that minimizes the exonuclease activity
(Butler 2005), smaller size as well as numerous copies present in a single cell
(Schwarz et al. 2009; Gorgan et al. 2013). mtDNA can act as the convenient sample
for profile generating from highly degraded sample where the STR and mini-STR
analysis are tend to be failed (Coble et al. 2004), suitable for prehistoric as well as
aDNA studies from the bone samples. This method is successfully implemented
during the study of bone samples related to the American war (Holland et al. 1993).
As SNPs form the 90% of human DNA variation (Collins et al. 1998), found in
autosomal, X, Y and mitochondrial DNA. SNP study has a greater advantage in the
forensic investigation as degraded ample contains very short length fragments and is
able to initiate 45–55 bp amplicon (Kidd et al. 2006). This maximizes the loci
number in different degraded samples. Different studies on nuclear SNPs were
done on aDNA extracted from human bones dated to archaeological as well as
prehistoric time (Burger et al. 2007; Lalueza-Fox et al. 2007; Watson and Lockwood
2009). The first multiplex autosomal SNP analysis was done on bronze and Iron Age
human bones containing highly degraded aDNA successfully correlated with differ-
ent traits responsible for the pigmentation and biogeographical ancestry tracing
(Bouakaze et al. 2009).
The exact nitrogenous base arrangement of a piece of DNA can be determined by the
sequencing where the genotyping investigates the type of genetic variations present
in the studied genomic strand. Different well-advanced as well as automated
genotyping/sequencing techniques were developed like the electrophoresis mediated
9 Molecular Tools for Analysis of Archaeological and Prehistoric Human Bones: A. . . 189
confirmation, one of the major drawbacks of NGS (Welker et al. 2014). NGS can
also be useful for the fast analysis of mtDNA, which minimizes the coast as well as
the time (Loreille et al. 2011), best suited for the archaeological as well as prehistoric
bone specimens where the mtDNA along with highly degraded or no nDNA is
preserved.
a variety of biological remains up to 50,000 year old (Bronk Ramsey 2008), based
upon the principle that after the death of the living organism, the 14C decay starts to
nitrogen-14 (14N) (Godwin 1962). Mutation clock analysis was proofed as useful
method for the age estimation of old bones that successfully dates the Denisova
finger bone, which was not effectively dated by the carbon-14 method (Meyer et al.
2012a). Similarly, another study successfully applied the concept of recombination
clock to date the age as well as to find generation gap of a past Eurasian population
from their available genome (dated to upper Palaeolithic period); deciphers the
outstanding link between age data comes from 14C and genome-based method
(Moorjani et al. 2016). Most of the time a new date analysis is not considered the
data related to date at different pre-studied sites, though Palaeolithic samples analy-
sis runs simultaneously with controversy related to the correctness as well as their
reliability of used methods (Higham 2011). In a study, some Neanderthal bone
remains were re-dated by a method called preparative high-performance liquid
chromatography (Prep-HPLC) by extracting amino acid hydroxyproline, added
fact to the modern human arrival time in Eastern Europe (Devièse et al. 2017).
Mystery about the past social structure and stratification can be better understood if
light is shed on the biological sex of the archaeological human remains. Morpholog-
ical methods for sex identification are best suited for complete or less fragmented
skeletal remains of adults but fail to detect in juvenile skeletons as well as more
fragmentary skeletons; molecular tools provide reliable and alter method for the
same. Sex identification with aDNA analysis of humans is used in different ways: by
the study of amalogenin gene (Svensson et al. 2012; Shaw et al. 2015), zinc finger
protein genes (of X or Y) (Svensson et al. 2008) and sequence analysis of Y or W
chromosome (Cappellini et al. 2004; Allentoft et al. 2010). Molecular tools for sex
identification sometimes associated with more failure rate as aDNA from archaeo-
logical samples contains reduced amount of sex-specific markers with single copy
(Alonso et al. 2004). PCR multiplex Genderplex can be useful for the sex identifica-
tion of medieval bones from the preserved DNA remains in the samples (Codina
et al. 2009). Amelogenin markers are dominantly used as sex-specified marker but
prone to contamination by modern DNA as well as associated with high in allele
dropout rate in old samples (Skoglund et al. 2013). Possibilities of unfair result
assumes with the presence of trace amount of contamination with exogenous DNA,
which requires more exercise like huge number of clones to be proceed for the
sequence analysis (Helgason et al. 2007). Even in the presence of large amount of
contamination by means of modern DNA in extremely degraded sample retrieved
from the aDNA, sex can be properly defined by a specific feature, that is, the
cytosine–deamination signature mark (Skoglund et al. 2013). By distinguishing
amalogenin gene present on the X chromosome from the pseudo one found on the
male/Y chromosome, sex can be identified (Götherström et al. 1997; Morrill et al.
2008; Gibbon et al. 2009; Quincey et al. 2013). aDNA analysis has become more
192 M. Panda et al.
relaxed with the help of advent of high-throughput shotgun sequencing in large scale
(Green et al. 2006; Meyer et al. 2012a). Chromosomal sex can be identified
accurately from ~70,000 years old sample having 100,000 human shotgun
sequences, that is in quite low depth by means of evaluating sequence alignment
ratio between X and Y chromosome (Skoglund et al. 2013). A study on Neanderthal
genome is the proposed method for sex determination by eliminating different
homologous base sequence region among the sex chromosomes (X and Y) (Green
et al. 2010). An initial step for onsite DNA analysis method was developed, which is
able to extract aDNA with less contamination, effectively amplify <50 pg of same
by means of microfluidic device and identified sex through capillary gel electropho-
resis examination. That was supported by different other analyses related to the
anthropological, Amelogenin and male (Y) chromosome examination (Parton et al.
2013). Another analysis of old DNA retrieved from juvenile skeletal remains dated
back to medieval period with the help of PCR and STR profiling pointing towards
the high male mortality rate, although unable to detect sex with high conformity in
some samples (Tierney and Bird 2015).
A co-amplification method that need not use sequencing was developed recently
to detect the sex of archaeological remains in Turkey. That amplify highly repetitive
DNA (hrDNA) and mtDNA fragments, where the heterogametic sex, that is, female
can be detected by the W chromosome amplification, while for internal positive
control as well as to screen the false-negative outcome, mtDNA fragment was used
(Speller and Yang 2016).
Initial studies in genetic analysis are based on the phylogeographic method (Avise
et al. 1987). This approach implemented by phylogenetic tree analysis on aDNA
informative in the sense to find the dynamicity in speciation process, movement
pattern of a population, and their extension-drop scenario of the interested popula-
tion (Leonardi et al. 2017). Large investigations in population genetics and different
complex issues like the migration route and admixture pattern can be studied from
the nDNA with the help of NGS (Linderholm 2016).
Phylogenetic as well as the phylogeographical data can be gathered with the help of
past DNA, unable to retrieve the information from species presently found (Allentoft
et al. 2015). Genetic difference between the two European economical groups, that
is, Hunter–gatherer with farmers was studied with aDNA from past bone remains
(Skoglund et al. 2012). It is possible to compare the modern human diversity with
the ancient extinct population of Homo, like Denisovans and Neanderthal (Noonan
et al. 2006; Meyer et al. 2012a) can be revealed by analysing whole genome or by
total mtDNA genome (Fu et al. 2013). aDNA analysis by new hydrolysis
9 Molecular Tools for Analysis of Archaeological and Prehistoric Human Bones: A. . . 193
probe-based real-time PCR assay of different medieval bone remains related to the
immunological functioning allele named CCR5-Δ32, which indicates that the allele
frequency for the same in central Europe remained unchanged over a thousand years,
which signifies towards the absence of strong positive selection pressure and earliest
origin of the same (Bouwman et al. 2017).
mtDNA obtained from modern or old bone is useful in personal and species
recognition (Lorente et al. 2001). HVR-I and HVR-II region of mt-DNA is useful
for Hominoid ancestry (Watson et al. 1996), which is rich in cytosine (Lutz-
Bonengel et al. 2004; Chen et al. 2009). These provide hint for the unrelated person
recognition (Amer et al. 2017) due to heteroplasmy nature of mtDNA-HVS (Salas
et al. 2001; Mabuchi et al. 2007). An aDNA recovered from old bone remains helped
anthropologist to discover new species of genus Homo called ‘Denisovans’ an
archaic form, having distinct pattern of evolutionary history in comparison with
Homo sapiens and Homo Neanderthals (Reich et al. 2010).
Besides the study of aDNA, a completely new trend is developed for the ancient
protein (aProtein) analysis from the ancient preserved samples. Different fragmented
fossilized mineralized tissues, like bone, provide information from its protein
sequence where the aDNA extraction is hardly possible or absent completely
(Welker et al. 2015). Different geographical locations like Near East with very hot
and arid climate, where remnants are found related to the human biological and
cultural evolution possesses less chance of retrieval of biomolecules due to the less
probability with their survivalist (Bar-Gal et al. 2003; Larson et al. 2007; Buckley
and Wadsworth 2014). These type of problems in molecular archaeology are
somehow solved by ongoing trend of proteomic analysis alternation to aDNA
study with respect to preserved tissue remnants, time period as well as the sample
area (Cappellini et al. 2014). It is possible to use non-collagen proteins (NCPs) for
phylogenetic analysis as well as identification species where the result is not
obtained from the bone collagen proteins type-I as their age-old survival (Buckley
and Wadsworth 2014). aProtein sequence of extinct hominins can be read by tandem
mass spectroscopy (TMS) helpful in tracing their phylogenetic placement (Welker
et al. 2016). Also, additive information, like food pattern, patho-history, epidemiol-
ogy as well as in vivo physiology, from different samples dated back to archaeolog-
ical as well as palaeontological period can be gained from the focus in sequence
9 Molecular Tools for Analysis of Archaeological and Prehistoric Human Bones: A. . . 195
study (Warinner et al. 2014a, b; Hendy et al. 2016; Procopio et al. 2017). One of the
major limitation of aProtein is that provides quite less information regarding the
phylogenetic analysis as compared to the whole aDNA study suitably applicable to
quite long time scale (Welker 2018). Different lifestyle information of the ancient
Edo citizens, like obesity, stress, disease and starvation, was gathered from the first
shotgun proteomic analysis of archaeological bones (Sawafuji et al. 2017). As a
whole, this provides a platform for proteomic analysis of different hominin fossil
contains contaminated, less or no endogenous DNA, which focus light into dark
process of their evolution. Single amino acid polymorphisms (SAPs) analysis can be
possible from late Pleistocene fossilized bones, which help in differentiating
Neanderthals and Denisovans as well as Homo sapiens having recovered aDNA
(Meyer et al. 2012a, b; Castellano et al. 2014; Brown et al. 2016; Welker et al. 2016).
New methods of data analysis by targeting amino acid hydroxyproline of archaeo-
logical bones tend to be more informative over 14C method, also effective to
eliminate the modern contamination from bone collagens (Devièse et al. 2017).
References
Adler CJ, Haak W, Donlon D, Cooper A, Genographic Consortium (2011) Survival and recovery of
DNA from ancient teeth and bones. J Archaeol Sci 38(5):956–964
Adler CJ, Dobney K, Weyrich LS, Kaidonis J, Walker AW, Haak W, Bradshaw CJ, Townsend G,
Sołtysiak A, Alt KW and Parkhill J (2013) Sequencing ancient calcified dental plaque shows
changes in oral microbiota with dietary shifts of the Neolithic and industrial revolutions. Nat
Genet 45(4):450
196 M. Panda et al.
Collins FS, Brooks LD, Chakravarti A (1998) A DNA polymorphism discovery resource for
research on human genetic variation. Genome Res 8(12):1229–1231
Cooper A, Poinar HN (2000) Ancient DNA: do it right or not at all. Science 289(5482):1139–1139
Cooper A, Weyrich LS, Farrer AG (2015) The relevance of ancient DNA to contemporary disease.
Pathology 47:S28
Dabney J, Meyer M, Pääbo S (2013) Ancient DNA damage. Cold Spring Harb Perspect Biol 5(7):
a012567
Deguilloux MF, Pemonge MH, Mendisco F, Thibon D, Cartron I, Castex D (2014) Ancient DNA
and kinship analysis of human remains deposited in Merovingian necropolis sarcophagi (Jau
Dignac et Loirac, France, 7th–8th century AD). J Archaeol Sci 41:399–405
Devièse T, Karavanić I, Comeskey D, Kubiak C, Korlević P, Hajdinjak M et al (2017) Direct dating
of Neanderthal remains from the site of Vindija cave and implications for the middle to upper
Paleolithic transition. Proc Natl Acad Sci U S A 114(40):10606–10611
Evison MP, Smillie DM, Chamberlain AT (1997) Extraction of single-copy nuclear DNA from
forensic specimens with a variety of postmortem histories. J Foren Sci 42(6):1032–1038
Feng X (2009) Chemical and biochemical basis of cell-bone matrix interaction in health and
disease. Curr Chem Biol 3(2):189–196
Fondevila M, Phillips C, Naverán N, Cerezo M, Rodríguez A, Calvo R et al (2008) Challenging
DNA: assessment of a range of genotyping approaches for highly degraded forensic samples.
Forensic Sci Int Genet Suppl Ser 1(1):26–28
Freire-Aradas A, Phillips C, Lareu MV (2017) Forensic individual age estimation with DNA: from
initial approaches to methylation tests. Forensic Sci Rev 29(2):121–144
Fu Q, Mittnik A, Johnson PL, Bos K, Lari M, Bollongino R et al (2013) A revised timescale for
human evolution based on ancient mitochondrial genomes. Curr Biol 23(7):553–559
Furtwängler A, Reiter E, Neumann GU, Siebke I, Steuri N, Hafner A et al (2018) Ratio of
mitochondrial to nuclear DNA affects contamination estimates in ancient DNA analysis. Sci
Rep 8(1):14075
Galdames ICS, Matamala DAZ, Smith RL (2008) Blind test of mandibular morphology with sex
indicator in subadult mandibles. Int J Morphol 26:845–848
Gamba C, Fernández E, Tirado M, Pastor F, Arroyo-Pardo E (2011) Brief communication: ancient
nuclear DNA and kinship analysis: the case of a medieval burial in san Esteban Church in
Cuellar (Segovia, Central Spain). Am J Phys Anthropol 144(3):485–491
Geigl EM (2002) On the circumstances surrounding the preservation and analysis of very old DNA.
Archaeometry 44(3):337–342
Gibbon V, Paximadis M, Štrkalj G, Ruff P, Penny C (2009) Novel methods of molecular sex
identification from skeletal tissue using the amelogenin gene. Forensic Sci Int Genet 3(2):74–79
Gill P, Curran J, Elliot K (2005) A graphical simulation model of the entire DNA process associated
with the analysis of short tandem repeat loci. Nucleic Acids Res 33(2):632–643
Godwin H (1962) Half-life of radiocarbon. Nature 195(4845):984
Gokhman D, Lavi E, Prüfer K, Fraga MF, Riancho JA, Kelso J et al (2014) Reconstructing the DNA
methylation maps of the Neandertal and the Denisovan. Science 344(6183):523–527
Gorgan L, Druică R, Ştefan A, Ciorpac M (2013) Comparative DNA degradation in bones
fragments. Int J Crim Invest 3(1):33–43
Götherström A, Lidén K, Ahlström T, Källersjö M, Brown TA (1997) Osteology, DNA and sex
identification: morphological and molecular sex identifications of five neolithic individuals from
Ajvide, Gotland. Int J Osteoarchaeol 7(1):71–81
Graham EAM (2007) DNA reviews: ancient DNA. Forensic Sci Med Pathol 3(3):221–225
Green RE, Krause J, Ptak SE, Briggs AW, Ronan MT, Simons JF et al (2006) Analysis of one
million base pairs of Neanderthal DNA. Nature 444(7117):330
Green RE, Malaspinas AS, Krause J, Briggs AW, Johnson PL, Uhler C et al (2008) A complete
Neandertal mitochondrial genome sequence determined by high-throughput sequencing. Cell
134(3):416–426
9 Molecular Tools for Analysis of Archaeological and Prehistoric Human Bones: A. . . 199
Green RE, Krause J, Briggs AW, Maricic T, Stenzel U, Kircher M, Hansen NF (2010) A draft
sequence of the Neandertal genome. Science 328(5979):710–722
Haak W, Brandt G, de Jong HN, Meyer C, Ganslmeier R, Heyd V et al (2008) Ancient DNA,
strontium isotopes, and osteological analyses shed light on social and kinship organization of the
later stone age. Proc Natl Acad Sci U S A 105(47):18226–18231
Hagelberg E, Clegg JB (1991) Isolation and characterization of DNA from archaeological bone.
Proc R Soc Lond Ser B Biol Sci 244(1309):45–50
Hagelberg E, Sykes B, Hedges R (1989) Ancient bone DNA amplified. Nature 342(6249):485–485
Hänni C, Brousseau T, Laudet V, Stehelin D (1995a) Isopropanol precipitation removes PCR
inhibitors from ancient bone extracts. Nucleic Acids Res 23(5):881
Hänni C, Begue A, Laudet V, Stéhelin D, Brousseau T, Amouyel P, Duday H (1995b) Molecular
typing of Neolithic human bones. J Archaeol Sci 22(5):649–658
Hansen AJ, Mitchell DL, Wiuf C, Paniker L, Brand TB, Binladen J et al (2006) Crosslinks rather
than strand breaks determine access to ancient DNA sequences from frozen sediments. Genetics
173(2):1175–1179
Helgason A, Pálsson S, Lalueza-Fox C, Ghosh S, Sigurðardóttir S, Baker A et al (2007) A statistical
approach to identify ancient template DNA. J Mol Evol 65(1):92–102
Hendy J, Collins M, Teoh KY, Ashford DA, Thomas-Oates J, Donoghue HD et al (2016) The
challenge of identifying tuberculosis proteins in archaeological tissues. J Archaeol Sci
66:146–153
Higham T (2011) European middle and upper Palaeolithic radiocarbon dates are often older than
they look: problems with previous dates and some remedies. Antiquity 85(327):235–249
Higuchi R, Bowman B, Freiberger M, Ryder OA, Wilson AC (1984) DNA sequences from the
quagga, an extinct member of the horse family. Nature 312(5991):282
Hofreiter M, Jaenicke V, Serre D, Haeseler AV, Pääbo S (2001) DNA sequences from multiple
amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucleic Acids
Res 29(23):4793–4799
Holland MM, Fisher DL, Mitchell LG, Rodriquez WC, Canik JJ, Merril CR, Weedn VW (1993)
Mitochondrial DNA sequence analysis of human skeletal remains: identification of remains
from the Vietnam war. J Forensic Sci 38(3):542–553
Hong SB, Kim Y, Park JH (2017) High-efficiency automated DNA extraction method for degraded
old skeletal samples. Forensic Sci Int Genet Suppl Ser 6:e365–e367
Horai S, Hayasaka K, Murayama K, Wate N, Koike H, Nakai N (1989) DNA amplification from
ancient human skeletal remains and their sequence analysis. Proc Jpn Acad Ser B 65
(10):229–233
Höss M, Dilling A, Currant A, Pääbo S (1996) Molecular phylogeny of the extinct ground sloth
Mylodon darwinii. Proc Natl Acad Sci U S A 93(1):181–185
Johnson V, Beckett S, Márquez-Grant N (2017) Differentiating human versus non-human bone by
exploring the nutrient foramen: implications for forensic anthropology. Int J Leg Med 131
(6):1757–1763
Juras A, Chyleński M, Krenz-Niedbała M, Malmström H, Ehler E, Pospieszny Ł et al (2017)
Investigating kinship of Neolithic post-LBK human remains from Krusza Zamkowa, Poland
using ancient DNA. Forensic Sci Int Genet 26:30–39. https://doi.org/10.1016/j.fsigen.2016.10.
008
Kalmár T, Bachrati CZ, Marcsik A, Raskó I (2000) A simple and efficient method for PCR
amplifiable DNA extraction from ancient bones. Nucleic Acids Res 28(12):e67–e67
Karger BL, Guttman A (2009) DNA sequencing by CE. Electrophoresis 30(S1):S196–S202
Keller A, Kreis S, Leidinger P, Maixner F, Ludwig N, Backes C et al (2017) miRNAs in ancient
tissue specimens of the Tyrolean iceman. Mol Biol Evol 34(4):793–801
Kerley ER (1965) The microscopic determination of age in human bone. Am J Phys Anthropol 23
(2):149–163
Kidd KK, Pakstis AJ, Speed WC, Grigorenko EL, Kajuna SL, Karoma NJ et al (2006) Developing a
SNP panel for forensic identification of individuals. Forensic Sci Int 164(1):20–32
200 M. Panda et al.
Kim K, Bazarragchaa M, Brenner CH, Choi BS, Kim KY (2015) Extensive evaluation of DNA
polymerase performance for highly degraded human DNA samples. Forensic Sci Int
251:171–178
King CE, Debruyne R, Kuch M, Schwarz C, Poinar HN (2009) A quantitative approach to detect
and overcome PCR inhibition in ancient DNA extracts. Biotechniques 47(5):941–949
Lalueza-Fox C, Römpler H, Caramelli D, Stäubert C, Catalano G, Hughes D et al (2007) A
melanocortin 1 receptor allele suggests varying pigmentation among Neanderthals. Science
318(5855):1453–1455
Larson G, Albarella U, Dobney K, Rowley-Conwy P, Schibler J, Tresset A et al (2007) Ancient
DNA, pig domestication, and the spread of the Neolithic into Europe. Proc Natl Acad Sci U S A
104(39):15276–15281
Lee HY, Park MJ, Kim NY, Sim JE, Yang WI, Shin KJ (2010) Simple and highly effective DNA
extraction methods from old skeletal remains using silica columns. Forensic Sci Int Genet 4
(5):275–280
Lee EJ, Renneberg R, Harder M, Krause-Kyora B, Rinne C, Müller J et al (2014) Collective burials
among agro-pastoral societies in later Neolithic Germany: perspectives from ancient DNA. J
Archaeol Sci 51:174–180
Lee-Thorp JA (2008) On isotopes and old bones. Archaeometry 50(6):925–950
Leonard JA, Wayne RK, Cooper A (2000) Population genetics of ice age brown bears. Proc Natl
Acad Sci U S A 97(4):1651–1654
Leonardi M, Librado P, Der Sarkissian C, Schubert M, Alfarhan AH, Alquraishi SA et al (2017)
Evolutionary patterns and processes: lessons from ancient DNA. Syst Biol 66(1):e1–e29
Lindahl T (1993) Instability and decay of the primary structure of DNA. Nature 362(6422):709–715
Linderholm A (2016) Ancient DNA: the next generation–chapter and verse. Biol J Linn Soc 117
(1):150–160
Loreille O, Koshinsky H, Fofanov VY, Irwin JA (2011) Application of next generation sequencing
technologies to the identification of highly degraded unknown soldiers’ remains. Forensic Sci
Int Genet Suppl Ser 3(1):e540–e541
Lorente JA, Entrala C, Alvarez JC, Arce B, Heinrichs B, Lorente M et al (2001) Identification of
missing persons: the Spanish “phoenix” program. Croat Med J 42(3):267–270
Lorenz TC (2012) Polymerase chain reaction: basic protocol plus troubleshooting and optimization
strategies. JoVE 63:e3998
Lovejoy CO, Meindl RS, Pryzbeck TR, Mensforth RP (1985) Chronological metamorphosis of the
auricular surface of the ilium: a new method for the determination of adult skeletal age at death.
Am J Phys Anthropol 68(1):15–28
Lundy JK (1998) Forensic anthropology: what bones can tell us. Lab Med 29(7):423–427
Lutz-Bonengel S, Sänger T, Pollak S, Szibor R (2004) Different methods to determine length
heteroplasmy within the mitochondrial control region. Int J Leg Med 118(5):274–281
Mabuchi T, Susukida R, Kido A, Oya M (2007) Typing the 1.1 kb control region of human
mitochondrial DNA in Japanese individuals. J Forensic Sci 52(2):355–363
Malmström H, Svensson EM, Gilbert MTP, Willerslev E, Götherström A, Holmlund G (2007)
More on contamination: the use of asymmetric molecular behavior to identify authentic ancient
human DNA. Mol Biol Evol 24(4):998–1004
Malmström H, Vretemark M, Tillmar A, Durling MB, Skoglund P, Gilbert MTP et al (2012)
Finding the founder of Stockholm–a kinship study based on Y-chromosomal, autosomal and
mitochondrial DNA. Ann Anat 194(1):138–145
Maricic T, Pääbo S (2009) Optimization of 454 sequencing library preparation from small amounts
of DNA permits sequence determination of both DNA strands. Biotechniques 46(1):51–57
Marquez-Grant N (2015) An overview of age estimation in forensic anthropology: perspectives and
practical considerations. Ann Hum Biol 42(4):308–322
Matheson CD, Marion TE, Hayter S, Esau N, Fratpietro R, Vernon KK (2009) Removal of metal
ion inhibition encountered during DNA extraction and amplification of copper-preserved
9 Molecular Tools for Analysis of Archaeological and Prehistoric Human Bones: A. . . 201
Perry WL, Bass WM, Riggsby WS, Sirotkin K (1988) The autodegradation of deoxyribonucleic
acid (DNA) in human rib bone and its relationship to the time interval since death. J Forensic Sci
33(1):144–153
Prado VF, Castro AKF, Oliveira CL, Souza KT, Pena SDJ (1997) Extraction of DNA from human
skeletal remains: practical applications in forensic sciences. Gen Anal Biomol Eng 14(2):41–44
Procopio N, Chamberlain AT, Buckley M (2017) Intra-and Interskeletal proteome variations in
fresh and buried bones. J Proteome Res 16(5):2016–2029
Pruvost M, Schwarz R, Correia VB, Champlot S, Braguier S, Morel N et al (2007) Freshly
excavated fossil bones are best for amplification of ancient DNA. Proc Natl Acad Sci U S A
104(3):739–744
Putkonen MT, Palo JU, Cano JM, Hedman M, Sajantila A (2010) Factors affecting the STR
amplification success in poorly preserved bone samples. Investig Genet 1(1):9
Quincey D, Carle G, Alunni V, Quatrehomme G (2013) Difficulties of sex determination from
forensic bone degraded DNA: a comparison of three methods. Sci Justice 53(3):253–260
Rådström P, Knutsson R, Wolffs P, Lövenklev M, Löfström C (2004) Pre-PCR processing:
strategies to generate PCR-compatible samples. Mol Biotechnol 26(2):133–146
Reich D, Green RE, Kircher M, Krause J, Patterson N, Durand EY et al (2010) Genetic history of an
archaic hominin group from Denisova cave in Siberia. Nature 468(7327):1053
Robbins Schug G (2017) A hierarchy of values: the bioarchaeology of complexity, order, health,
and hierarchy at Harappa. In: Klaus H, Harvey AR, Cohen MN (eds) Bones of complexity:
osteological indicators of emergent Heterarchy and hierarchy. University Press of Florida,
Gainesville, MD, pp 263–289
Rohland N, Hofreiter M (2007) Ancient DNA extraction from bones and teeth. Nat Protoc 2
(7):1756
Rossen L, Nørskov P, Holmstrøm K, Rasmussen OF (1992) Inhibition of PCR by components of
food samples, microbial diagnostic assays and DNA-extraction solutions. Int J Food Microbiol
17(1):37–45
Rothe J, Melisch C, Powers N, Geppert M, Zander J, Purps J et al (2015) Genetic research at a
fivefold children's burial from medieval Berlin. Forensic Sci Int Genet 15:90–97
Salas A, Lareu MV, Carracedo A (2001) Heteroplasmy in mtDNA and the weight of evidence in
forensic mtDNA analysis: a case report. Int J Leg Med 114(3):186–190
Sanger F, Coulson AR (1975) A rapid method for determining sequences in DNA by primed
synthesis with DNA polymerase. J Mol Biol 94(3):441–448
Sawafuji R, Cappellini E, Nagaoka T, Fotakis AK, Jersie-Christensen RR, Olsen JV et al (2017)
Proteomic profiling of archaeological human bone. R Soc Open Sci 4(6):161004
Sawyer S, Krause J, Guschanski K, Savolainen V, Pääbo S (2012) Temporal patterns of nucleotide
misincorporations and DNA fragmentation in ancient DNA. PLoS One 7(3):e34131
Scheuer L (2002) A blind test of mandibular morphology for sexing mandibles in the first few years
of life. Am J Phys Anthropol 119(2):189–191
Schneider E, El Hajj N, Haaf T (2014) Epigenetic information from ancient DNA provides new
insights into human evolution. Brain Behav Evol 84(3):169–171
Schrader C, Schielke A, Ellerbroek L, Johne R (2012) PCR inhibitors–occurrence, properties and
removal. J Appl Microbiol 113(5):1014–1026
Schutkowski H (1993) Sex determination of infant and juvenile skeletons: I. Morphognostic
features. Am J Phys Anthropol 90(2):199–205
Schwarz C, Debruyne R, Kuch M, McNally E, Schwarcz H, Aubrey AD et al (2009) New insights
from old bones: DNA preservation and degradation in permafrost preserved mammoth remains.
Nucleic Acids Res 37(10):3215–3229
Shapiro Á, Hofreiter M (2014) A paleogenomic perspective on evolution and gene function: new
insights from ancient DNA. Science 343(6169):1236573
Shaw KJ, Brown KA, Brown TA, Haswell SJ (2015) Sex identification of ancient DNA samples
using a microfluidic device. In: Microchip capillary electrophoresis protocols. Humana Press,
New York, pp 93–98
9 Molecular Tools for Analysis of Archaeological and Prehistoric Human Bones: A. . . 203
Shinde V, Lee H, Yadav Y, Waghmare P, Jadhav N, Hong JH et al (2018) A young couple’s grave
found in the Rakhigarhi cemetery of the Harappan civilization. Anat Cell Biol 51(3):200–204
Shved N, Haas C, Papageorgopoulou C, Akguel G, Paulsen K, Bouwman A et al (2014) Post
mortem DNA degradation of human tissue experimentally mummified in salt. PLoS One 9(10):
e110753
Skoglund P, Malmström H, Raghavan M, Storå J, Hall P, Willerslev E et al (2012) Origins and
genetic legacy of Neolithic farmers and hunter-gatherers in Europe. Science 336(6080):466–469
Skoglund P, Storå J, Götherström A, Jakobsson M (2013) Accurate sex identification of ancient
human remains using DNA shotgun sequencing. J Archaeol Sci 40(12):4477–4482
Skoglund P, Northoff BH, Shunkov MV, Derevianko AP, Pääbo S, Krause J, Jakobsson M (2014)
Separating endogenous ancient DNA from modern day contamination in a Siberian Neandertal.
Proc Natl Acad Sci U S A 111(6):2229–2234
Smith O, Gilbert MTP (2018) Ancient RNA. In: Paleogenomics. Springer, Cham, pp 53–74
Smith RW, Monroe C, Bolnick DA (2015) Detection of cytosine methylation in ancient DNA from
five native American populations using bisulfite sequencing. PLoS One 10(5):e0125344
Speller CF, Yang DY (2016) Identifying the sex of archaeological Turkey remains using ancient
DNA techniques. J Archaeol Sci Rep 10:520–525
Stanojevich V (2012) The role of a forensic anthropologist in death investigation. J Forensic Res 3
(6):3
Stiller M, Green RE, Ronan M, Simons JF, Du L, He W et al (2006) Patterns of nucleotide
misincorporations during enzymatic amplification and direct large-scale sequencing of ancient
DNA. Proc Natl Acad Sci U S A 103(37):13578–13584
Svensson EM, Götherström A, Vretemark M (2008) A DNA test for sex identification in cattle
confirms osteometric results. J Archaeol Sci 35(4):942–946
Svensson EM, Telldahl Y, Sjöling E, Sundkvist A, Hulth H, Sjøvold T, Götherström A (2012) Coat
colour and sex identification in horses from iron age Sweden. Ann Anat 194(1):82–87
Taubenberger JK, Reid AH, Janczewski TA, Fanning TG (2001) Integrating historical, clinical and
molecular genetic data in order to explain the origin and virulence of the 1918 Spanish influenza
virus. Philos Trans R Soc Lond Ser B Biol Sci 356(1416):1829–1839
Tierney SN, Bird JM (2015) Molecular sex identification of juvenile skeletal remains from an Irish
medieval population using ancient DNA analysis. J Archaeol Sci 62:27–38
Tsangaras K, Greenwood AD (2018) Paleovirology: viral sequences from historical and ancient
DNA. In: Paleogenomics. Springer, Cham, pp 139–162
Ubelaker DH (2018) Recent advances in forensic anthropology. Forensic Sci Res 3(4):275–277
Venanzi FM, Rollo F (1990) Mummy RNA lasts longer. Nature 343(6253):25
Vidaki A, Daniel B, Court DS (2013) Forensic DNA methylation profiling—potential opportunities
and challenges. Forensic Sci Int Genet 7(5):499–507
Wall JD, Kim SK (2007) Inconsistencies in Neanderthal genomic DNA sequences. PLoS Genet 3
(10):e175
Warinner C, Rodrigues JFM, Vyas R, Trachsel C, Shved N, Grossmann J et al (2014a) Pathogens
and host immunity in the ancient human oral cavity. Nat Genet 46(4):336
Warinner C, Hendy J, Speller C, Cappellini E, Fischer R, Trachsel C et al (2014b) Direct evidence
of milk consumption from ancient human dental calculus. Sci Rep 4:7104
Watson CL, Lockwood DN (2009) Single nucleotide polymorphism analysis of European archaeo-
logical M. leprae DNA. PLoS One 4(10):e7547
Watson E, Bauer K, Aman R, Weiss G, von Haeseler A, Pääbo S (1996) mtDNA sequence diversity
in Africa. Am J Hum Genet 59(2):437
Weaver DS (1980) Sex differences in the ilia of a known sex and age sample of fetal and infant
skeletons. Am J Phys Anthropol 52(2):191–195
Welch L, Gill P, Tucker VC, Schneider PM, Parson W, Mogensen HS, Morling N (2011) A
comparison of mini-STRs versus standard STRs—results of a collaborative European (EDNAP)
exercise. Forensic Sci Int Genet 5(3):257–258
204 M. Panda et al.
Welker F (2018) Elucidation of cross-species proteomic effects in human and hominin bone
proteome identification through a bioinformatics experiment. BMC Evol Biol 18(1):23
Welker F, Duijm E, van der Gaag KJ, van Geel B, de Knijff P, van Leeuwen J, Gravendeel B (2014)
Analysis of coprolites from the extinct mountain goat Myotragus balearicus. Quat Res 81
(1):106–116
Welker F, Collins MJ, Thomas JA, Wadsley M, Brace S, Cappellini E et al (2015) Ancient proteins
resolve the evolutionary history of Darwin’s South American ungulates. Nature 522(7554):81
Welker F, Hajdinjak M, Talamo S, Jaouen K, Dannemann M, David F et al (2016) Palaeoproteomic
evidence identifies archaic hominins associated with the Châtelperronian at the Grotte du Renne.
Proc Natl Acad Sci U S A 113(40):11162–11167
Wilson IG (1997) Inhibition and facilitation of nucleic acid amplification. Appl Environ Microbiol
63(10):3741
Wilson LA, MacLeod N, Humphrey LT (2008) Morphometric criteria for sexing juvenile human
skeletons using the ilium. J Forensic Sci 53(2):269–278
Yang DY, Eng B, Waye JS, Dudar JC, Saunders SR (1998) Improved DNA extraction from ancient
bones using silica-based spin columns. Am J Phys Anthropol 105(4):539–543
Yeap SS, Beaumont M, Bennett A, Keating NA, White DA, Hosking DJ (1998) Genetic and
environmental factors affecting bone mineral density in large families. Postgrad Med J 74
(872):349–354
Zhenilo SV, Sokolov AS, Prokhortchou EB (2016) Epigenetics of ancient DNA. Acta Naturae 8
(3):72–76
Usefulness of Mini-STRs in Analyzing
Degraded DNA Samples and Their Forensic 10
Relevance
Abstract
Keywords
Mini-STRs · Degraded samples · DNA analysis · Forensic case works
M. Thakar · B. Joshi
Department of Forensic Science, Punjabi University, Patiala, Punjab, India
P. Shrivastava (*)
DNA Fingerprinting Unit, State Forensic Science Laboratory, Department of Home (Police),
Government of Madhya Pradesh, Sagar, Madhya Pradesh, India
10.1 Introduction
With the advent of forensic DNA profiling technique in 1985 by professor Sir Alec
Jeffreys from Leicester University, UK, human identity testing was recognized. It
was perceived that nucleotides were repeated more than a few times in a specific
combination (termed as Variable Number of Tandem Repeats, VNTRs) and varied
between individuals. It could be identified using Restriction Fragment Length
Polymorphism (RFLP) as it focused on the use of restriction enzymes to cut the
surrounding regions of VNTRs in DNA. These RFLP probes are highly variable
among individuals but need more effort, time and proficiency to generate a DNA
profile. Also, the call for processing large numbers of DNA samples could not be
achieved using these probes since multilocus RFLP methods are not amenable to
automation. These limitations have been best achieved with short tandem repeat
(STR) DNA markers which comparatively have a high power of discrimination and
quick analysis speed (Butler 2005). STR markers have noticeably become the
authoritative tool for human identification. These are of extremely polymorphic
type and vary in the length of different allele. This variability in the number of
repeats makes STR markers valuable in identification process. The nomenclature is
generally based on the length of the repeat unit. Trinucleotides contain three
nucleotides in the repeat unit, tetranucleotides encompass four, pentanucleotides
cover five, likewise hexanucleotides comprises of six repeat units in the core repeat.
Among various types of STR systems being used for forensic DNA typing,
tetranucleotide repeat have become more popular than di- or trinucleotides since
they are less prone to slippage of polymerase during enzymatic amplification
(Kimpton et al. 1994). Characteristics of STR markers like, low mutation rate, low
stutter characteristic, compact size, makes it best suited for forensic samples analysis
(Gill et al. 1996; Butler 2011). STRs narrow allele size range is amenable to
multiplexing by means of PCR technique. This technique validated the analysis of
several different loci at the same time (Kimpton et al. 1993; Lygo et al. 1994). The
“first-generation multiplex” involved four loci TH01, FES/FPS, VWA and F13A1
which had a matching probability of approximately 1 in 10,000 (Kimpton et al.
1994). The matching probability has been increased remarkably with the develop-
ment of second-generation multiplex. Different manufactures like AmpF‘STR®
SGM Plus™, Identifiler™ (Applied Biosystems, USA), PowerPlex® 16 System
(Promega, USA) or Investigator IDplex® (Qiagen, Germany) have made these
multiplex STR kits commercially available (Collins et al. 2004). The set of
13 CODIS STR loci expanded now to 20 STR loci markers has been accepted
globally as a common way for communication to deal in most of the forensic
situations (Hares 2015). These accessible kits can efficiently create STR amplicons
in the size range of 100–450 bp (Krenke et al. 2002).
In numerous caseworks, the evidentiary value of the samples is usually lost since
bodies are recovered after a longer duration of time. Forensic scientists meet up with
several samples ranging from stain samples or ancient skeletal remains. DNA
profiling for the aim of victim identification in mass disaster cases are always
problematic due to a high degree of fragmentation of various body parts or due to
10 Usefulness of Mini-STRs in Analyzing Degraded DNA Samples and Their Forensic. . . 207
Fig. 10.1 PCR primers for mini-STR markers are redesigned to bind closer to each repeat region
a high level of intermix of remains. DNA in such samples often exists in an uneven
manner. Such is the case when dealing with samples of fire cases (Heinrich et al.
2009) or bodies submerged in water for prolonged time (Phengon et al. 2008;
Dhanardhono et al. 2013; Mameli et al. 2014). The reason of such breakdown
includes exposure of DNA to light, humidity or fire for longer duration of time.
Sometimes presence of any bacterial or microbial growth and other environmental
contaminants also leads to fragmentation of DNA in the samples (Bar et al. 1988;
Bender et al. 2004). Thus the quality and quantity of evidences recovered, determine
the suitability of techniques to be applied for further analysis. Such low level DNA
analysis is highly vulnerable to bigger risk of laboratory-based contamination.
Stochastic effects such as allele dropouts, allele drop-ins, imbalance of heterozygote
peak height and area and inconsistent peak size of stutter products also becomes
advent in aforesaid situations (Clayton et al. 1998; Gill et al. 2000; Benschop et al.
2013). The process of cell death and DNA degradation is associated with enzymatic
and nonenzymatic degradation of DNA. This further correlates with the failure of
PCR amplification of degraded DNA samples (Takahashi et al. 1997; Alaeddini et al.
2010).
There has been considerable expansion in methodology used to genotype such
compromised or fragmented samples. Mini-STRs have been established as a helpful
tool for genotyping of samples in a degraded state (Dixon et al. 2006; Welch et al.
2011; Senge et al. 2011). The PCR amplicons length of these markers are usually
compacted by moving the primers closer to the target region in order to create the
smallest possible amplicons, as shown in Fig. 10.1. This provides the utmost
likelihood of success when attempting to amplify highly fragmented DNA (Wiegand
and Kleiber 2001; Tsukada et al. 2002; Coble and Butler 2005). A direct association
between amplicon size and profile success rates has been established (Bender et al.
2004; Chung et al. 2004; Fondevila et al. 2008a, b). Additionally these mini-STRs
208 M. Thakar et al.
The conception of generating smaller size PCR amplicons by shifting the primers
adjoining to STR repeat region gained potential for the analysis of non-CODIS STR
loci. A range of norms for the selection of these non-CODIS markers included high
heterozygosities, narrow allele size ranges and “clean” flanking regions adjacent to
the STR repeat region for the primer binding. A total of 47 non-CODIS loci, capable
of generating amplicon less than 125 bp in size were selected initially. Out of these, a
set of two miniplexes having allele sizes less than 24 bp and heterozygosity value
greater than 0.70 were selected finally. These six loci were also characterized among
African Americans, Caucasians, and Hispanics from US population. These new loci
successfully amplified all the degraded bone samples which, when used with the
PowerPlex 16 kit gave partial profiles at 32 cycles of amplification. Along with its
10 Usefulness of Mini-STRs in Analyzing Degraded DNA Samples and Their Forensic. . . 209
utility in typing degraded samples, these novel mini-STRs were expected to aid in
the identification of closely related individuals which often require additional genetic
information (Coble and Butler 2005).
Further new primer sets were designed for another eight non-CODIS capable of
generating smaller amplicons (Table 10.3). These new loci proved to highly effec-
tive in the analysis of degraded DNA samples and also in some complex kinship
analysis for instance sibling verification or deficient paternity cases (Asamura et al.
2007a, b). Additional 20 non-CODIS mini-STR loci were also characterized and
210
Table 10.2 Comparison of amplicon sizes (bp) of mini-STRs loci in MiniFiler v/s other STR kits
D7S820 D13S317 D21S11 D18S51 D16S539 FGA CSF1PO
Manufacturer (bp) (bp) (bp) (bp) (bp) (bp) (bp)
AmpFlSTR® Minifiler™ Applied 136–176 88–132 153–211 113–193 81–121 125–281 89–129
Biosystems
PowerPlex® 16 Promega 215–247 176–208 203–259 290–366 264–304 322–444 321–357
PowerPlex® 21 system Promega 269–313 302–350 203–259 134–214 84–132 265–411 318–362
PowerPlex® Fusion system Promega
GlobalFiler™ kit Applied 262–298 149–243 182–239 261–342 227–267 223–378 282–318
Biosystems
PowerPlex® Fusion 6C Promega 269–313 308–358 203–259 134–214 84–132 143–289 318–362
system
M. Thakar et al.
10 Usefulness of Mini-STRs in Analyzing Degraded DNA Samples and Their Forensic. . . 211
In the recent past, analysis of X-STR loci is proved to be more informative over
autosomal STRs, particularly in the cases of kinship analysis and parentage testing.
These STR markers of X-chromosomes offer more successful analysis in some
characteristic cases of kinship testing, like father–daughter duos or close blood
relatives (Szibor et al. 2003; Gomes et al. 2012). Further, X-STR system also has
the potential to solve siblingship status and to determine paternal grandmother–
granddaughter relationships (Edelmann et al. 2004; Toni et al. 2006). To confirm the
success of X-STR system for examining highly degraded DNA samples, new primer
sets have been created to produce amplicons that are as small as possible. A mini-X
STR multiplex system was successfully generated for all eight X-linked STR loci
(DXS7423, DXS6789, DXS101, GATA165B12, DXS7133, DXS7424, DXS8378
and GATA31E08). These X-linked loci generated PCR amplicons in a range of
length from 76 to 169 bp having more detection sensitivity. Also, the statistical
measure of these eight loci pointed towards a high utility for analyzing degraded
DNA and Japanese forensic practice (Asamura et al. 2006).
The (Q8) German DNA database systems for D3S1358, FGA, TH01, SE33,
D18S51,VWA, D8S1179 and D21S11 along with the gender typing marker
Amelogenin has been customized with mini-STR markers. The Q8 is found to be
best suited mainly for flaccid and degraded stains. The amplicon lengths of the STR
markers have been significantly reduced as compared to commercially established
DNA database kits. The most sensitive fluorescent dyes (FAM, JOE and TET) were
used to improve the typing success for feeble stains. A higher success rate was
attained with the Q8 kit in comparison with a well-established MPX2 commercial kit
(Muller et al. 2007).
The AmpFlSTR® MiniFiler™ PCR Amplification Kit has been designed and
made commercially available to obtain information from forensic samples where
STR markers failed to give desired results. The MiniFiler™ kit effectively amplified
eight of the largest sized loci (D2S1338, D7S820, D13S317, D16S539, D21S11,
D18S51, CSF1PO and FGA) present in the AmpFlSTR® Identifiler® PCR Amplifi-
cation Kit. An entire set of the STR loci amplified by the MiniFiler™ kit has been
formerly characterized by further associations and can also be found in commercial
STR multiplexes like the Identifiler and SGM Plus kits. The MiniFiler™ kit primers
were constructed to achieve shorter amplified products (less than prevailing
generated using other commercially accessible Applied Biosystems kits) with pow-
erful signal strength and balanced peak heights from human samples. Initially,
singleplex reactions were approved by employing redesigned primer sets to ensure
locus-specific amplification. Then multiplex PCR studies were implemented by
means of primer concentration adjustment and empirical attainment measure to
achieve sensitive, balanced and precise signals for the eight STR loci and the sex
determining marker in a single PCR reaction. The MiniFiler™ kit STR loci have a
length in between 71and 250 bp. To embody the co-amplification of eight loci within
this limited size range, a five-dye fragment analysis system has been developed at
Applied Biosystems which are at present used in the AmpFlSTR SEfiler™,
Identifiler and Yfiler kits. The five dyes (6-FAMTM, NEDTM, PET, VIC and
LIZ) widen the fluorescent detection range to 660 nm, thereby implementing more
loci to be multiplexed in a single PCR (Mulero et al. 2008).
In conformity with the validation provisions in the SWGDAM guidelines any unique
DNA typing kit must be evaluated with casework-related samples or samples from
non-probative casework before it can be enforced in forensic casework. A set of nine
studies were completed to validate the significance of MiniFiler™ PCR Amplifica-
tion kit in forensic caseworks (Luce et al. 2009).
The use of low copy number (LCN) polymerase chain reaction (PCR) has been
performed for the validation of the Q8 concept by analyzing 50 biological stains
having limited and extremely degraded DNA. The sensitivity of LCN PCR is
214 M. Thakar et al.
advanced by increasing the number of cycles or via nested PCR primer. However
LCN PCR is often influenced with artefacts like false alleles caused by slippage
artefacts during the initial PCR cycles, allele dropouts as well as sporadic contami-
nation. To minimize PCR errors, the number of cycles is generally accustomed to the
confined amount of template DNA. The Q8 multiplex has shown full concordance
with the other commercial kits. Also, Q8 multiplex has analysed more loci in
comparison with the two commercial kits, MPX2 and Nonaplex (Muller et al. 2009).
The newly designed primers of mini-STRs have the potential to supplement the
currently used STR systems. To access the performance of these mini-STR assays,
concordant studies with globally accepted STR markers have been performed. These
mini-STR primers for the 13 CODIS STRs plus the Penta D, Penta E, and D2S1338
markers afford fully concordant results with the commercial STR kits and even
enhanced signal from degraded DNA exhibits (Butler et al. 2003). A full concor-
dance has also been observed between Identifiler® and Minifiler™ kits for the
analysis of about 1308 degraded samples. Full concordance in 99.7% of allele
calls was observed between both of the kits (Hill et al. 2008).
A comparative study of the common markers of Identifiler® and MiniFiler™ kit
for typing casework samples showed no inconsistencies in the profiles generated
from both the kits. This further suggested the use of mini-STR kit to incorporate
low-level DNA profiles in STR databases (Lopes et al. 2009).
Fondevila et al. (2008a, b) compared the performance of standard STRs with mini-
STRs and autosomal SNPs for the examination of naturally degraded samples. All
submitted skeletal samples were recovered in a high rainfall and organic rich, acidic
soil environment. The choice of an improved extraction procedure was considered as
a significant factor for DNA recovery and typing success of degraded samples. An
assessment of internal PCR control (IPC) indicated the inhabitance of PCR
inhibitors. The authors suggested considering suitable evaluation of inhibition
would be sufficient in choosing typing methods for degraded samples. This approach
allowed successful amplification of mini-STRs and SNP multiplexes at all loci,
which otherwise failed to amplify when tried with standard STRs loci. Marjanović
et al. (2009) performed DNA testing for the identification of World War II skeletal
remains recovered from exposed unknown graves in Slovenia. Standard autosomal
STRs along with Y-STRs and mini-STRs analysis collectively used to identify
missing persons after more than a half century. Out of 48 exhumed skeletal remains,
41 DNA profiles were generated that led to a positive identification of 6 remains. The
216 M. Thakar et al.
for the testing of degraded skeletal remains, recovered from mass graves. These
graves were resulted from the conflicts during 1992 to 1999 in the former
Yugoslavia. The International Commission on Missing Persons (ICMP) was set up
to identify around 40,000 missing individuals. The skeletal remains were recovered
after a postmortem interval of 7–15 years. Though the primer sets used to get short
amplicons were selected in new combinations to primarily target the largest loci of
PP16. Success rate for the mini-amplicon multiplexes was 100% particularly for the
bone samples recovered from the grave enclosed by lime. There was a limited
percentage recovery of alleles when same processed with PowerPlex 16 kit by
Promega.
The efficacy of mini-STRs has been successfully fulfilled the examination of touch
DNA samples originated on different substrates (cars, tools, clothing, weapons,
gloves, etc.). The study has been completed by considering the success rate before
and after employment of the five extra loci that were added to the ESS for amplifi-
cation of low amounts of degraded DNA. The statistical and descriptive results show
an increased success rate after implementation of extra loci and after the implemen-
tation of mini-STR analysis (Nieuwerburgh et al. 2014).
The recognition of a body found in the Mediterranean Sea from has been
achieved by DNA profiling of mandibular body. That body was apparently exposed
to seawater for several months, which yielded 200 pg of low copy DNA. Use of
Minifiler™ kit along with other traditional STR kits offered a full profile (Mameli
et al. 2014).
10.11 Conclusion
The use of these mini-STR markers has greatly increased the power of discrimina-
tion in cases where the existing STR markers multiplex systems often give incon-
clusive results. Mini-STRs have been proven as an additional tool for identification
of skeletal remains, the DNA sample of whose could not be amplified when
performed otherwise. The location of such biological forensic evidences offers a
great challenge to further investigation which in return requires a good collection and
preservation skills. It offers an alternative approach for processing a number of
compromised biological specimens in forensic situations. A comparison study has
been completed between standard STR profiling with DNA repair enzyme incuba-
tion, and genotyping with mini-STR and single nucleotide polymorphisms (SNPs) in
progressively degraded, UV-irradiated DNA samples. The study demonstrated that
most of the standard STR markers fail to amplify, while mini-STRs and especially
(tri-allelic) SNPs showed even higher percentage of detected alleles (Westen and
Sijen 2009). The choice of mini-STR markers also supplements the core STR loci
10 Usefulness of Mini-STRs in Analyzing Degraded DNA Samples and Their Forensic. . . 219
References
Alaeddini R, Walsh SJ, Abbas A (2010) Forensic implications of genetic analyses from degraded
DNA—a review. Forensic Sci Int Genet 4:148–157
Andrade L, Bento AM, Serra A, Carvalho M, Gamero JJ, Oliveira C, Batista L, Lopes V, Balsa F,
Corte-Real F, Anjos MJ (2008) AmpFISTR® Minifiler™ PCR amplification kit: the new
miniSTR multiplex kit. FSI Genet Supp Ser 1:89–91
Asamura H, Sakai H, Kobayashi K, Ota M, Fukushima H (2006) MiniX-STR multiplex system
population study in Japan and application to degraded DNA analysis. Int J Legal Med
120:174–181
Asamura H, Fujimori S, Ota M, Fukushima H (2007a) MiniSTR multiplex systems based on
non-CODIS loci for analysis of degraded DNA samples. Forensic Sci Int 173:7–15
Asamura H, Sakai H, Ota M, Fukushima H (2007b) MiniY-STR quadruplex systems with short
amplicon lengths for analysis of degraded DNA samples. Forensic Sci Int Genet 1:56–61
Bar W, Kratzer A, Machler M, Schmid W (1988) Postmortem stability of DNA. Forensic Sci Int 39
(1):59–70
Bender K, Farfan MJ, Schneider PM (2004) Preparation of degraded human DNA under controlled
conditions. Forensic Sci Int 139:135–140
Benschop C, Haned H, Sijen T (2013) Consensus and pool profiles to assist in the analysis and
interpretation of complex low template DNA mixtures. Int J Legal Med 127(1):11–23
Butler JM (2005) Forensic DNA typing: biology, technology, and genetics of STR markers, 2nd
edn. Elsevier Academic Press, Burlington. ISBN: 0-12-147952-8
Butler JM (2011) Advanced topics in forensic DNA typing: methodology, 1st edn. Academic Press,
San Diego. eBook ISBN: 9780123878236. Hardcover ISBN: 9780123745132
Butler JM, Shen Y, McCord BR (2003) The development of reduced size STR amplicons as tools
for analysis of degraded DNA. J Forensic Sci 48(5):1054–1064
Butler JM, Hill CR, Decker AE, Kline MC, Vallone PM (2008) Characterization of new autosomal
STR loci. FSI Genet Suppl Ser 1:95–96
Chung DT, Drabek J, Opel KL, Butler JM, McCord BR (2004) A study on the effects of
degradation and template concentration on the amplification efficiency of the STR Miniplex
primer sets. J Forensic Sci 49(4):733–740
Chung U, Shin KJ, Park MJ, Kim NY, Yang WI, Cho SH, Lee HY (2007) Population data of nine
miniSTR loci in Koreans. Forensic Sci Int 168:e51–e53
Clayton TM, Whitaker JP, Sparkes R, Gill P (1998) Analysis and interpretation of mixed forensic
stains using DNA STR profiling. Forensic Sci Int 91:55–70
Coble MD, Butler JM (2005) Characterization of new MiniSTR loci to aid analysis of degraded
DNA. J Forensic Sci 50(1):43–53
Collins PJ, Hennessy LK, Leibelt CS, Roby RK, Reeder DJ, Foxall PA (2004) Developmental
validation of a single-tube amplification of the 13 CODIS STR loci, D2S1338, D19S433, and
amelogenin: the AmpF‘STR® Identifiler PCR amplification kit. J Forensic Sci 49
(6):1265–1277
Constantinescu CM, Barbarii LE, Iancu CB, Constantinescu A, Neagu E, Iancu D, Girbea G (2012)
Challenging DNA samples solved with MiniSTR analysis. Rom J Leg Med 20:51–56
Decorte R, Liu CF, Vanderheyden N, Cassiman JJ (2008) Development of a novel miniSTR
multiplex assay for typing degraded DNA samples. FSI Genet Suppl Ser 1:112–114
Dhanardhono T, Wulandri N, Bhima SKL, Ahmad HJ, Widodo PT (2013) DNA profiling of
disaster victim identification in Trenggalek shipwreck case. FSI Genet Supp Ser 4:e5–e6
220 M. Thakar et al.
Dixon LA, Dobbins AE, Pulker HK, Butler JM, Vallone PM, Coble MD, Parson W, Berger B,
Grubwieser P, Mogensen HS, Morling N, Nielsen K, Sanchez JJ, Petkovski E, Carracedo A,
Sanchez-Diz P, Ramos-Luis E, Brion M, Irwin JA, Just RS, Loreille O, Parsons TJ,
Syndercombe-Court D, Schmitter H, Stradmann-Bellinghausen B, Bender K, Gill P (2006)
Analysis of artificially degraded DNA using STRs and SNPs—results of a collaborative
European (EDNAP) exercise. Forensic Sci Int 164:33–44
Dogra D, Shrivastava P, Chaudhary R, Gupta U, Jain T (2015) Population genetics for autosomal
STR loci in Sikh population of central India. Hereditary Genet 4(1):1–8
Edelmann J, Lessig R, Klintschar M, Szibor R (2004) Advantages of X-chromosomal
microsatellites in deficiency paternity testing: presentation of cases. Int Congr Ser
1261:257–259
Fondevila M, Phillips C, Naveran N, Cerezo M, Rodriguez A, Calvo R, Fernandez LM,
Carracedo A, Lareu MV (2008a) Challenging DNA: assessment of a range of genotyping
approaches for highly degraded forensic samples. FSI Genet Suppl Ser 1:26–28
Fondevila M, Phillips C, Naveran N, Fernandez L, Cerezo M, Salas A, Carracedo A, Lareu MV
(2008b) Case report: identification of skeletal remains using short-amplicon marker analysis of
severely degraded DNA extracted from a decomposed and charred femur. Forensic Sci Int Genet
2:212–218
Gill P, Urquhart A, Millican E, Oldroyd N, Watson S, Sparkes R, Kimpton CP (1996) A new
method of STR interpretation using inferential logic-development of a criminal intelligence
database. Int J Legal Med 109:14–22
Gill P, Whitaker J, Flaxman C, Brown N, Buckleton J (2000) An investigation of the rigor of
interpretation rules for STRs derived from less than 100pg of DNA. Forensic Sci Int 112
(1):17–40
Gomes C, Magalhaes M, Alves C, Amorim A, Pinto N, Gusmao L (2012) Comparative evaluation
of alternative batteries of genetic markers to complement autosomal STRs in kinship
investigations: autosomal indels vs. X-chromosome STRs. Int J Legal Med 126(6):917–921
Goodwin W, Ballard D, Simpson K, Thacker C, Syndercombe Court D, Gow J (2004) Case study:
paternity testing—when 21 loci are not enough. In: Doutremepuich C, Morling N (eds) Progress
in forensic genetics, vol 10. Int Cong Ser. 1261, Amsterdam, pp 460–462
Grubwieser P, Mühlmann R, Parson W (2003) New sensitive amplification primers for the STR
locus D2S1338 for degraded casework DNA. Int J Legal Med 117:185–188
Grubwieser P, Mühlmann R, Berger B, Niederstätter H, Pavlic M, Parson W (2006) A new
“miniSTR-multiplex” displaying reduced amplicon lengths for the analysis of degraded DNA.
Int J Legal Med 120:115–120
Hares DR (2015) Selection and implementation of expanded CODIS core loci in the United States.
Forensic Sci Int Genet 17:33–34
Heinrich A, Schwark T, Simeoni E, Wurmb-Schwark NV (2009) Genetic identifications of fire
deaths. FSI Genet Suppl Ser 2:253–254
Hellmann A, Rohleder U, Schmitter H, Wittig M (2001) STR typing of human telogen hairs-a new
approach. Int J Legal Med 114:269–273
Hill CR, Kline MC, Coble MD, Butler JM (2008) Characterization of 26 MiniSTR loci for
improved analysis of degraded DNA samples. J Forensic Sci 53(1):73–80
Israr M, Shahid AA, Rahman Z, Zar MS, Shahzad MS, Husnain T, Pfeifer C, Wiegand P (2014)
Development and characterization of a new 12-plex ChrX miniSTR system. Int J Legal Med
128:595–598
Jain T, Shrivastava P, Bansal DD, Dash HR, Trivedi VB (2016) PowerPlex Y23 system: a fast,
sensitive and reliable Y-STR multiplex system for forensic and population genetic purpose. J
Mol Biomark Diagn 7:287
Kimpton CP, Gill P, Walton A, Urquhart A, Millican ES, Adams M (1993) Automated DNA
profiling employing multiplex amplification of short tandem repeat loci. PCR Methods Appl
3:13–22
10 Usefulness of Mini-STRs in Analyzing Degraded DNA Samples and Their Forensic. . . 221
Kimpton CP, Fisher D, Watson S, Adams M, Urquhart A, Lygo J, Gill P (1994) Evaluation of an
automated DNA profiling system employing multiplex amplification of four tetrameric STR
loci. Int J Legal Med 106:302–311
Krenke BE, Tereba A, Anderson SJ, Buel E, Culhane S, Finis CJ, Tomsey CS, Zachetti JM,
Masibay A, Rabbach DR, Amjott EA, Sprecher CJ (2002) Validation of a 16-locus fluorescent
multiplex system. J Forensic Sci 47(4):773–785
Lopes V, Andrade L, Carvalho M, Serra A, Balsa F, Bento AM, Batista L, Oliveira C, Corte-Real F,
Anjos MJ (2009) Mini-STRs: a powerful tool to identify genetic profiles in samples with small
amounts of DNA. FSI Genet Suppl Ser 2:121–122
Luce C, Montpetit S, Gangitano D, O’Donnell P (2009) Validation of the AmpF‘STR®
MiniFilerTM PCR amplification kit for use in forensic casework. J Forensic Sci
54(5):1046–1054
Lygo JE, Johnson PE, Holdaway DJ, Woodroffe S, Whitaker JP, Clayton TM, Kimpton CP, Gill P
(1994) The validation of short tandem repeat (STR) loci for use in forensic casework. Int J Legal
Med 107(2):77–89. (abstract)
Mameli A, Piras G, Delogu G (2014) The successful recovery of low copy number and degraded
DNA from bones exposed to seawater suitable for generating a DNA STR profile. J Forensic Sci
59(2):470–473
Marjanović D, Durmić-Pašić A, Kovačević L, Avdić J, Džehverović M, Haverić S, Ramić J,
Kalamujić B, Bilela LL, Škaro V, Projić P, Bajrović K, Drobnič K, Davoren J, Primorac D
(2009) Identification of skeletal remains of communist armed forces victims during and after
world war II: combined Y-chromosome short tandem repeat (STR) and MiniSTR approach.
Croat Med J 50:296–304
Martin P, Garcia O, Albarran C, Garcia P, Alonso A (2006) Application of mini-STR loci to
severely degraded casework samples. Int Congr Ser 1288:522–525
Mulero JJ, Chang CW, Lagac RE, Wang DY, Bas JL, McMahon TP, Hennessy LK (2008)
Development and validation of the AmpF‘STR® MiniFilerTM PCR amplification kit: a
MiniSTR multiplex for the analysis of degraded and/or PCR inhibited DNA. J Forensic Sci
53(4):838–852
Muller K, Klein R, Miltner E, Wiegand P (2007) Improved STR typing of telogen hair root and hair
shaft DNA. Electrophoresis 28:2835–2842
Muller K, Klein R, Miltner E, Wiegand P (2009) Q8—a short amplicon multiplex including the
German DNA database systems. Forensic Sci Int Genet 1(2):205–207
Nastainczyk M, Schulz S, Kleiber M, Immel UD (2009) STR analysis of degraded DNA using a
miniplex. Forensic Sci Int Genet Supp Series 2:53–54
Nieuwerburgh FV, Hoofstat DV, Neste CV, Deforce D (2014) Retrospective study of the impact of
miniSTRs on forensic DNA profiling of touch DNA samples. Sci Justice 54(5):369–372
Opel KL, Chung DT, Drabek J, Tatarek NE, Jantz LM, McCord BR (2006) The application of
Miniplex primer sets in the analysis of degraded DNA from human skeletal remains. J Forensic
Sci 51(2):351–356
Park MJ, Lee HY, Chung U, Kang SC, Jin Shin K (2007) Y-STR analysis of degraded DNA using
reduced sized amplicons. Int J Legal Med 121:152–157
Parsons TJ, Huel R, Davoren J, Katzmarzyk C, Milos A, Selmanovic A, Selmanovic L, Coble MD,
Rizvic A (2007) A application of novel ‘mini-amplicon’ STR multiplexes to high volume
casework on degraded skeletal remains. Forensic Sci Int Genet 1:175–179
Phengon P, Wongwigggarn S, Panvisavas N (2008) Analysis of DNA from degraded tissue. FSI
Genet Suppl Ser 1:439–441
Pizzamiglio M, Marino A, Coli A, Floris T, Garofano L (2006) The use of mini-STRs on degraded
DNA samples. Int Congr Ser 1288:498–500
Ricci U, Giovannucci Uzielli ML, Klintschar M (1999) Modified primers for D12S391 and a
modified silver staining technique. Int J Legal Med 112(5):342–344
Romano C, Luise ED, Martino DD, Spitaleri S, Saravo L (2006) A novel approach for genotyping
of LCN-DNA recovered from highly degraded samples. Int Congr Ser 1288:577–579
222 M. Thakar et al.
Schneider PM, Martin PD (2001) Criminal DNA databases: the European situation. Forensic Sci Int
119:232–238
Senge T, Madea B, Junge A, Rothschild MA, Schneider PM (2011) STRs, mini STRs and SNPs—a
comparative study for typing degraded DNA. Legal Med 13:68–74
Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked
markers for forensic purposes. Int J Legal Med 117:67–74
Takahashi M, Kato Y, Mukoyama H, Kanaya H, Kamiyama S (1997) Evaluation of five polymor-
phic microsatellite markers for typing DNA from decomposed human tissues—correlation
between the size of the alleles and that of the template DNA. Forensic Sci Int 90:1–9
Toni C, Presciuttini S, Spinetti I, Rocchi A, Domenici R (2006) Usefulness of X-chromosome
markers in resolving relationships: report of a court case involving presumed half sisters. Int
Congr Ser 1288:301–303
Tsukada K, Takayanagi K, Asamura H, Ota M, Fukushima H (2002) Multiplex short tandem repeat
typing in degraded samples using newly designed primers for the TH01, TPOX, CSF1PO, and
vWA loci. Legal Med 4:239–245
Vullo C, Borosky A, Romanini C, Catelli L, Yamamoto T (2010) Frequency data for 12 mini STR
loci in Argentina. Forensic Sci Int Genet 4:e79–e81
Wang H, Ruan J, Shen C, Zhang Y, Liu W, Meng H, Yang X, Yan J, Liao S, Fan S, Jia X, Wei X
(2014) Polymorphic distribution and forensic effectiveness study of eight miniSTR in Chinese
Uyghur ethnic group. Mol Biol Rep 41:2371–2375
Welch L, Gill P, Schneider PM, Parson W, Mogensen HS, Morling N (2011) A comparison of mini-
STRs versus standard STRs-results of a collaborative European (EDNAP) exercise. Forensic Sci
Int Genet 5:257–258
Westen AA, Sijen T (2009) Degraded DNA sample analysis using DNA repair enzymes, mini STRs
and (tri-allelic) SNPs. FSI Genet Suppl Ser 2:505–507
Whitaker JP, Clayton TM, Urquhart AJ, Millican ES, Downes TJ, Kimpton CP, Gill P (1995) Short
tandem repeat typing of bodies from a mass disaster: high success rate and characteristic
amplification patterns in highly degraded samples. Biotechniques 18(4):670–677
Wiegand P, Kleiber M (2001) Less is more—length reduction of STR amplicons using redesigned
primers. Int J Legal Med 114:285–287
Yong RYY, Gan LSH, Coble MD, Yap EPH (2007) Allele frequencies of six miniSTR loci of three
ethnic populations in Singapore. Forensic Sci Int 166:240–243
Yoshida K, Sekiguchi K, Kasai K, Sato H, Seta S, Sensabaugh GF (1997) Evaluation of new
primers for CSF1PO. Int J Legal Med 110:36–38
Capillary Electrophoresis Issues in Forensic
DNA Typing 11
Shuchi Kaushik and Vivek Sahajpal
Abstract
Keywords
DNA analysis · Forensic analysis · Gel-based technology · High-throughput
sequencing · STRs
S. Kaushik (*)
State Forensic Science Laboratory, Sagar, Madhya Pradesh, India
V. Sahajpal
State Forensic Science Laboratory, Directorate of Forensic Services, Shimla, Himachal Pradesh,
India
11.1 Introduction
The discipline dealing with civil and criminal justice and makes use of numerous
techniques implied in physical and biological sciences is Forensic science. It is the
amalgamation of other branches of science such as biology, chemistry, physics,
toxicology, pathology, odontology, entomology, anthropology, psychology, etc.
(Bell 2006; Houck and Siegel 2006; Bogusz 2000). Therefore it can be said that
forensic science covers broad interdisciplinary areas and technologies, and a lot of
work has been going on across the globe to improve the mechanisms of instruments
already in use and also to develop new techniques for better performance and results.
One of the greatest achievements in this field is the introduction of
DNA (Deoxyribonucleic Acid) typing methods and instrumentation to analyze
even the minute differences among the genetic makeup of two individuals.
The judiciary system has benefited immensely by the modern and advanced
techniques, especially by DNA profiling. These techniques help the law enforcement
agencies to differentiate between the suspect and the innocent based on match–
mismatch results. The trace amount of DNA sample in biological evidence present at
the scene of the crime is sufficient enough to do the examination. Thus, the actual
culprit can be reliably charged and the falsely accused person can be excluded
(Butler 2001; Budowle et al. 2000).
Short tandem repeats (STR) were considered to be useful markers for
differentiating two individuals as these are tandem repeat sequences unique to any
individual. These 2–7 base pair repeats are repeatedly present adjacent to each other
in variable number and thus generate an exclusive DNA profile for any person. The
high utility of these STR loci in DNA typing was first adopted by the forensic and
judicial system in the early 1990s and since then continued to be considered as the
most accepted and admissible biological evidence in the court of justice (Butler
2006). Since then, rigorous efforts have been made by a forensic human identity
testing committee to standardize the use of STRs in forensic studies (Butler et al.
2004; Budowle et al. 2000; Edwards et al. 1991; Kimpton et al. 1993). It has been
more than two decades since the 13 STR markers, including CSF1PO, FGA, TH01,
TPOX, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539,
D18S51, and D21S11, were selected by the core of the FBI Laboratory’s Combined
DNA Index System (CODIS) in November 1997 (Budowle et al. 1999). In 2015, the
original 13 CODIS Core Loci was expanded and seven new loci were introduced
into it after reviewing the validation data obtained from two available PCR amplifi-
cation kits: D1S1656, D2S441, D2S1338, D10S1248, D12S391, D19S433, and
D22S1045. Multiplex PCR amplification is required to analyze all these markers
in a single test. This idea is made possible by the availability of commercial STR
multiplex systems, which make use of chemical dyes producing spectra of different
fluorescence (Table 11.1).
The major advantage of using STR marker kits over the other DNA typing
methods is the ease in their use, rapid analysis, and very low amount of DNA can
also be analyzed as in case of degraded samples. As reported by the National
Commission on the Future of DNA Evidence, these kits will continue to not only
11 Capillary Electrophoresis Issues in Forensic DNA Typing 225
simplify the use of STRs in coming 5–10 years but also help in the enlargement of
large and valuable DNA databases (Gill 2002; National Institute of Justice 2000).
The present review discusses about the role of capillary electrophoresis in DNA
typing methods and issues pertaining to its performance.
Sample Separation on
the basis of size and
fluorescence color
Fig. 11.1 Schematic illustration of separation and detection of STR alleles with genetic analyzer
The different sized bands of amplified DNA are obtained upon electrophoresis,
which is subjected to either ultraviolet (UV) absorbance or laser-induced fluores-
cence (LIF) detector, so as to separate the polymerase chain reaction (PCR) products.
The sensitivity of the UV detector is not up to the mark, and LIF has a unique
requirement of fluorescence tag. Further, both the detector systems lack in providing
the information required to determine the structure of the detected solute directly.
The internal size standard with a different dye color is also usually
co-electrophoresed to calibrate sizes. The specialized software based on the internal
size standard’s curve then analyzes the electropherogram of multicolored data and
determines the size of STR alleles (Fig. 11.1).
The alleles are compared to the previously sequenced allelic ladder to generate
the STR genotype profile (Butler et al. 2004). In the earlier capillary electrophoresis
(CE) system such as ABI 310, the allelic ladder runs along with the internal size
standard in one injection, and sample alleles with the same internal size standard are
run in subsequent injections on the capillary in a sequential fashion (Lazaruk et al.
1998). However, the current technology uses capillary arrays, each array comprising
of 4–24 capillaries with respect to different models of Sequencers. Hence the ladder
can be run with samples simultaneously in a single injection, thus taking care of
variations that may creep up during different injections.
There are specific characteristics required to be exhibited by separation and
detection techniques used for accurate DNA typing of fluorescently labeled STR
markers and these include: (1) reliable sizing methods for size range between 75 and
500 bp; (2) highly precise run-to-run comparison of allelic ladders with the sequen-
tially processed STR samples; (3) efficient color differentiation of different dye sets
used; (4) high resolution to detect microvariant alleles which are usually varying by
1 bp.
11 Capillary Electrophoresis Issues in Forensic DNA Typing 229
The use of CE systems in analyzing forensic DNA typing leads to primarily two
applications of this technology: forensic casework and the DNA database. Both
applications have their issues and challenges.
The database of DNA profiles generated during forensic studies is a useful forensic
tool as it facilitates the rapid comparison of profiles. The updating of the database
with new DNA profiles regularly increases the probability of a case-to-case match or
case to convicted offender match. The most common problems related to forensic
DNA database are (1) the backlog of convicted offender samples, which are not yet
processed and included in the database and (2) second review of electropherograms
of generated profiles is very time-consuming. It delays the uploading of convicted
offender profiles into the database. However, many DNA laboratories have now
developed highly automated and “expert” systems to handle this situation, which not
only generates the DNA profile in the rapid time frame but also evaluates the
electropherogram using specific criteria detailed by the examining laboratory.
There have been rigorous attempts by the researchers to develop rapid, automated,
and sensitive instrumentation for capillary electrophoresis. Earlier, the most com-
mon platform used globally for STR testing was the ABI 310 Genetic Analyzer. In
230 S. Kaushik and V. Sahajpal
this single capillary instrument, about 48 DNA samples are processed in a serial
fashion in a 24 h time period. There were many assumptions from the use of ABI
310 genetic analyzer such as DNA is a sphere that is not actually. The conditions for
an unknown run are the same as the ladder run, but they are not. The ROX dye
(carboxyrhodamine, an inert or passive fluorescent dye) migrates relatively the same
as the FAM (fluorescein amidite) dye, but it does not. A calibration for one ladder is
suitable for an entire run, which is accurate sometimes but not always. Temperature
is constant, but to what precision it is unknown. Thus at this rate of approximately
one sample per 30-min processing and other inappropriate assumptions, it cannot
match the parallel processing potential throughput of a multilane slab-gel system.
Further, in the 310 system, the autosampler calibration needs to be carried out prior
to initiating a new run. This was indeed, time-consuming. None the less, the ABI
310 remains the most important model for training purposes for learning automated
capillary electrophoresis.
However, the search for updated and more advanced instruments for rapid,
automated systems lead to the availability of an updated version of the genetic
analyzer in 2001. It was a 16-capillary ABI 3100, which soon dominated many
laboratories as being the choice of instrument for the next level of throughput. Its
four capillary versions, ABI 3100 Avant, were also available. The polymer injection
in ABI 310 and ABI 3100 was based on a syringe system, wherein the polymer was
filled into a syringe and the syringe was mounted onto the instrument. The polymer
injections were, however, carried out by the instrument from the syringe. These
models gave the flexibility to the user to fill polymer into the syringe as per the
requirement. Hence if a limited number of runs were to be carried out, the user could
fill a limited volume of polymer into the syringe. ABI 3100 was followed by ABI
3130 and ABI 3130 XL models with 4 and 16 capillaries, respectively. The models
were based on ABI 3100 platform; however, in these models, the syringe system for
loading polymer was replaced by a polymer delivery pump. Hence a standard vial
containing POP was attached to the polymer delivery pump assembly and filling of
the unit and capillaries became automated. ABI 3100 and ABI 3130 are currently in
use, but manufacturing is discontinued. These models were followed by ABI 3500
series (ABI 3500 and ABI 3500 XL, 8 and 24 capillary, respectively). These
machines have further made automated CE more user-friendly, as the user is not
required to prepare dilutions of anode or cathode buffer; instead, the buffers come as
ready to load trays, where the concentrations have been highly optimized, thus
bringing in more precision to the CE work. Further, the reagents come with
RFID (Radio Frequency Identification) tags, such that the machine keeps the log
of loaded reagents, including their life/expiry. This makes the system highly reliable
and precise that provides an assurance of quality, which is vital in forensic DNA
analysis. Nowadays several commercial capillary array electrophoresis (CAE)
instruments are available, such as ABI 3700 or ABI 3730 (96-capillary),
SpectrumMedix (96–384 capillary), which increases the sample throughput
capabilities by offering parallel run of up to 384 capillaries in an independent
environment and also demonstrates the potential of multi-capillary CE systems to
give reliable results (Butler et al. 2004; Durney et al. 2015a). However, as far as
11 Capillary Electrophoresis Issues in Forensic DNA Typing 231
Data Review by
Genotype
Data Collection by Analyst by using
Assignment to
software Expert system
Alleles
software
Comparison to
Peak Identification Confirmation of
Allelic Ladder by
by GenScan results by second
Genotyper
software analyst
software
Fig. 11.2 Schematic representation of steps involved in data processing by genetic analyzer
forensic DNA typing for HID (Human Identity) is concerned, the mainstay
instruments remain ABI 3100, 3130, and 3500 series. These systems work in a
simple generalized systematic stepwise process, which is graphically summarized in
Fig. 11.2.
These instruments were developed by using the prototypes of Huang et al. (1992),
Kambara and Takahashi (1993), and Ueno and Yeung (1994), respectively. The
molecular dynamics instrumentation includes confocal detector system with four
photomultiplier tubes having appropriate filters and dichroic beam splitters to focus
the laser beam, which excites the fluorescent molecules in the liquid sheath, cool
CCD (charge-coupled device) camera for accumulating and imaging the emitted
light, and a scanner to assemble the data from all the capillaries. Research has been
advanced in order to improve the detection system. Kambara et al. intercalated a
glass rod of the same external diameter with each capillary and thus ameliorated the
light transmission with side illumination (Schmalzing et al. 1997). Similarly, another
group used a single beam to illuminate and collect light from all the capillaries
(Woolley and Mathies 1994). Further development in this direction continued in the
form of using capillaries in a wheel-like fashion (Woolley et al. 1997; Medintz et al.
2001). The most advanced kind of CAE instrument makes use of a low power laser
line generator, holographic transmission grating, and a back-illuminated CCD chip
(Schmalzing et al. 1999).
The common problem associated with most of the CAE instruments is the
limitation of reading length to 500 bp only, while there is a requirement to sequence
at least 800 bp with 99% accuracy. Thus to combat this problem, Endo et al.
proposed a solution of using gradients of electric field strength in an acceleration,
plateau, decreased, and a constant cycle ranging from 90–130 V/cm up to 220 V/cm
at a column temperature of 60 C (Carey and Mitnik 2002).
232 S. Kaushik and V. Sahajpal
Ueda et al. adopted microfabricated chips with 6-mm separation channels and highly
sensitive silicon intensified target camera for rapid analysis of triplet repeat DNA
fragments in 12 s, which was 20 times faster than other conventional separation
capillary zone electrophoresis (CZE) instrumentations (Ueda et al. 2000).
The higher density capillary arrays can be generated by microfabrication, which
facilitates physical assemblies and makes a direct link between capillaries and other
devices on the chip. There is continuous progress in the development of microfluidic
systems, which gives the researcher a liberation to assay a wide array of samples
such as buccal cells (Gelfi et al. 1998) and whole blood from multiple donors in a
very cost-effective and rapid manner (Fisher and Lerman 1983; Gelfi et al. 1994,
1996).
Although several modifications have also been done in microfabrication tech-
nique such as the inclusion of gas or liquid chromatography to the instrument (Terry
et al. 1979; Manz et al. 1990) or fabrication of individual CE chips to separate
fluorescent dyes (Manz et al. 1992; Jacobson et al. 1994b) or fluorescently labeled
amino acids (Harrison et al. 1993; Effenhauser et al. 1993; Fan and Harrison 1994),
yet questions pertaining to usefulness of these techniques for resolving DNA at a
higher level or fabrication of multiple separation channels in a single chip remained
answered since a long time. It was reported in one study that glass substrates can be
modified for excellent high-speed resolution of DNA fragments by using photogra-
phy and chemical etching methods on microfabricated CE separation channels, thus
establishing the feasibility of integrated devices for electrophoretic DNA analysis.
resolution of at least five fluorescent dyes without any pull-ups, (2) maintenance of
single-base resolution ranging from 50 to 250 or 500 bp, and (3) adoption of time-of-
flight mass spectrometry approaches.
The innovative steps taken for the development of capillary electrophoresis in
advancing DNA separation methods paved to new scientific discoveries in terms of
generating novel sieving gels, artificial gels, aptamers, or novel mechanisms of DNA
separations. A recent report suggested an alternative analysis method for stability
and conformation analyses. In this study, the use of monophosphate nucleosides
supports the sequence-based selectivity of DNA fragments (Zhang and McGown
2013). Capillary electrophoresis may be modified by the use of metal ions, which
influence the conformational changes in DNA (Li et al. 2009). Indirect molecular
detection can be done by using DNA aptamers because the aptamer displacement is
associated with conformational changes. Thus, it can be used as a molecular label in
multiplexed separation based assays (Perrier et al. 2014).
adjust the size of the fabricated matrix according to the available DNA fragments in
the experiment (Kounovsky-Shafer et al. 2013; Russell et al. 2014).
The matrix made up of monodispersed colloidal crystals is a high-performance
fabricated microfluidic choice for obtaining optimal resolution in DNA analyses at
low cost when compared with a matrix composed of different size colloidal particles
(Nazemifard et al. 2012).
11.6 Conclusion
DNA typing technologies are playing a crucial role in forensic analysis and human
identification studies. Many pieces of research are conducted globally to modernize
and ease this process. The factors which played a critical role in the advancement of
DNA typing include the use of STRs, multiplex PCR, multichannel laser-induced
fluorescence, and use of entangled polymer buffers in capillary electrophoresis.
DNA analysis technologies have been developed a lot with the advent of capillary
electrophoresis, which is not only used for sequencing and sizing but also the
discovery of aptamers and affinity studies. There are lot many advantages of
capillary electrophoresis in separating macromolecules like DNA, which makes it
an excellent choice for DNA analysis such as the injection, separation, detection are
automated in advanced capillary electrophoresis techniques with ease to retrieve the
peak information from the automatically stored data. It has excellent sensitivity and
resolving power and the use of this technique makes rapid separations possible in
real time.
Although with the emergence of novel approaches, capillary electrophoresis
techniques have evolved from development stages to validated and applied methods,
yet further optimization of capillary electrophoresis methods will continue to be
pivotal in expanding the field of DNA analysis.
Thus the development of techniques to better understand separations in capillary,
such as artificial matrices, suggests that better results can be obtained by reviewing
following factors: (1) precision and resolution of DNA typing systems are must for
reliable identification of STR, (2) effect of temperature results in a differential
response, (3) for reproducibility denaturation plays a significant role, (4) polymeric
buffer and injection media composition control the separation efficiency and preci-
sion. The automation of testing procedures, including PCR, robustness, and long-
term stability of these systems, may enhance the sample throughput and thus must be
taken under consideration while doing complex assays.
References
Ahuja S, Jimidar MI (2008) Capillary electrophoresis methods for pharmaceutical analysis, 1st edn.
Elsevier, Amsterdam
Bell S (2006) Forensic chemistry. Pearson-Prentice Hall, Upper Saddle River
11 Capillary Electrophoresis Issues in Forensic DNA Typing 235
Bogusz MJ (ed) (2000) Handbook of analytical separations. Forensic science, vol 2. Elsevier,
Amsterdam
Budowle B, Moretti TR, Baumstark AL, Defenbaugh DA, Keys KM (1999) Population data on the
thirteen CODIS core short tandem repeat loci in African Americans, U.S. Caucasians,
Hispanics, Bahamians, Jamaicans, and Trinidadians. J Forensic Sci 44:1277–1286
Budowle B, Smith J, Moretti T, DiZinno JA (2000) DNA typing protocols: molecular biology and
forensic analysis. Eaton Publishing, Natick, MA, pp 157–188
Butler JM (2001) Forensic DNA typing: biology and technology behind STR markers. Academic
Press, San Diego, CA
Butler JM (2006) Genetics and genomics of core short tandem repeat loci used in human identity
testing. J Forensic Sci 51:253–265
Butler JM, Buel E, Crivellente F, McCord BR (2004) Forensic DNA typing by capillary electro-
phoresis using the ABI prism 310 and 3100 genetic analyzers for STR analysis. Electrophoresis
25:1397–1412
Carey L, Mitnik L (2002) Trends in DNA forensic analysis. Electrophoresis 23:1386–1397
Chan YC, Zohar Y, Lee Y-K (2009) Effects of embedded submicron pillar arrays in microfluidic
channels on large DNA electrophoresis. Electrophoresis 30(18):3242–3249
Choi W, Shin GW, Hwang HS, Pack SP, Jung GY, Jung GY (2014) A multiplex single nucleotide
polymorphism genotyping method using ligase-based mismatch discrimination and CESSCP.
Electrophoresis 35(8):1196–1203
Duffy DC, McDonald JC, Schueller OJA, Whitesides GM (1998) Rapid prototyping of microfluidic
systems in poly(dimethylsiloxane). Anal Chem 70:4974–4984
Durney BC, Lounsbury JA, Poe BL, Landers JP, Holland LA (2013) A thermally responsive
phospholipid pseudogel: tunable DNA sieving with capillary electrophoresis. Anal Chem 85
(14):6617–6625
Durney BC, Crihfield CL, Holland LA (2015a) Capillary electrophoresis applied to DNA: deter-
mining and harnessing sequence and structure to advance bioanalyses (2009–2014). Anal
Bioanal Chem 407:6923–6938. https://doi.org/10.1007/s00216-015-8703-5
Durney BC, Bachert BA, Sloane HS, Lukomski S, Landers JP, Holland LA (2015b) Reversible
phospholipid nanogels for DNA fragment size determinations up to 1,500 base pairs and
integrated sample stacking. Anal Chim Acta 880:136. https://doi.org/10.1016/j.aca.2015.03.009
Edwards A, Civitello A, Hammond HA, Caskey CT (1991) DNA typing and genetic mapping with
trimeric and tetrameric tandem repeats. Am J Hum Genet 49:746–756
Effenhauser CS, Manz A, Widmer HM (1993) Glass chips for high-speed capillary electrophoresis
separations with submicrometer plate heights. Anal Chem 65:2637–2642
Fan ZH, Harrison DJ (1994) Micromachining of capillary electrophoresis injectors and separators
on glass chips and evaluation of flow at capillary intersections. Anal Chem 66:177–184
Fisher SG, Lerman LS (1983) DNA fragments differing by single base-pair substitutions are
separated in denaturing gradient gels: correspondence with melting theory. Proc Natl Acad
Sci U S A 80:1579–1583
Gelfi C, Righetti PG, Cremonesi L, Ferrari M (1994) Detection of point mutations by capillary
electrophoresis in liquid polymers in temporal thermal gradients. Electrophoresis 15:1506–1511
Gelfi C, Cremonesi L, Ferrari M, Righetti PG (1996) Temperature-programmed capillary electro-
phoresis for detection of DNA point mutations. BioTechniques 21:926–932
Gelfi C, Curcio M, Righetti PG, Sebastiano S, Citterio A, Ahmadzadeh H, Dovichi N (1998)
Surface modification based on Si-O, Si-C sublayers and a series of n-substituted acrylamide top
layers for capillary electrophoresis. Electrophoresis 19:1677–1682
Gettings KB, Ballard D, Bodnerc M, Borsuk LA, King JL, Parsonc W, Phillips C (2019) Report
from the STRAND Working Group on the 2019 STR sequence nomenclature meeting. Forensic
Sci Int Genet 43:102165
Gill P (2002) Role of short tandem repeat DNA in forensic casework in the UK—past, present, and
future perspectives. BioTechniques 32:366–372
236 S. Kaushik and V. Sahajpal
Hares DR (2015) Selection and implementation of expanded CODIS core loci in the United States.
Forensic Sci Int Genet 17:33–34
Harrison DJ, Fluri K, Seiler K, Fan Z, Effenhauser CS, Manz A (1993) Micromachining a
miniaturized capillary electrophoresis-based chemical analysis system on a chip. Science
261:895–897
Holzgrabe U (2008) The need for CE methods in pharmaceutical monographs. In: Ahuja S, Jimidar
MI (eds) Capillary electrophoresis methods for pharmaceutical analysis, 1st edn. Elsevier,
Amsterdam, pp 245–258
Holzgrabe U, Brinz D, Kopec S, Weber C, Bitar Y (2006) Why not using capillary electrophoresis
in drug analysis? Electrophoresis 27:2283–2292
Houck MM, Siegel JA (2006) Fundamentals of forensic science. Elsevier/Academic Press,
Burlington
http://www.sigmaaldrich.com/catalog/product/aldrich/542342?lang¼en®ion¼US
Huang XC, Quesada MA, Mathies RA (1992) DNA sequencing using capillary array electrophore-
sis. Anal Chem 64:967–972
Hwang HS, Shin GW, Jung GY, Jung GY (2014) A simple and precise diagnostic method for spinal
muscular atrophy using a quantitative SNP analysis system. Electrophoresis 35(23):3402–3407
Jacobson SC, Hergenroder R, Koutny LB, Warmack RJ, Ramsey JM (1994a) Effects of injection
schemes and column geometry on the performance of microchip electrophoresis devices. Anal
Chem 66:1107–1113
Jacobson SC, Hergenroeder R, Koutny LB, Ramsey JM (1994b) High-speed separations on a
microchip. Anal Chem 66(7):1114–1118
Kambara H, Takahashi S (1993) Multiple-sheath flow capillary array DNA analyser. Nature
361:565–566
Kim SJ, Shin GW, Choi SJ, Hwang HS, Jung GY, Seo TS (2010) Triblock copolymer matrix-based
capillary electrophoretic microdevice for high-resolution multiplex pathogen detection. Electro-
phoresis 31(6):1108–1115
Kimpton CP, Gill P, Walton A, Urquhart A, Millican ES, Adams M (1993) Automated DNA
profiling employing multiplex amplification of short tandem repeat loci. PCR Methods Appl
3:13–22
Kounovsky-Shafer KL, Hernández-Ortiz JP, Jo K, Odijk T, de Pablo JJ, Schwartz DC (2013)
Presentation of large DNA molecules for analysis as nanoconfined dumbbells. Macromolecules
46(20):8356–8368
Kovacs GTA, Petersen K, Albin M (1996) Fabricating large arrays of microwells with arbitrary
dimensions and filling them using discontinuous Dewetting. Anal Chem 68:407A–412A
Lazaruk K, Walsh PS, Oaks F, Gilbert D, Rosenblum BB, Menchen S, Scheibler D, Wenz HM,
Holt C, Wallin J (1998) Genotyping of forensic short tandem repeat (STR) systems based on
sizing precision in a capillary electrophoresis instrument. Electrophoresis 19:86–93
Li T, Zhang D, Luo W, Lu M, Wang Z, Song Y, Wang H (2009) Metal cation mediated-capillary
electrophoresis of nucleic acids. Anal Chem 82(2):487–490
Liu S, Shi Y, Ja WW, Mathies RA (1999) Optimization of high-speed DNA sequencing on
microfabricated capillary electrophoresis channels. Anal Chem 71:566–573
Manz A, Miyahara Y, Miura J, Watanabe Y, Miyagi H, Sato K (1990) Design of an open-tubular
column liquid chromatograph using silicon chip technology. Sens Actuators B Chem 1:249–255
Manz A, Harrison DJ, Verpoorte EMJ, Fettinger JC, Paulus A, Ludi H, Widmer HM (1992) Planar
chips technology for miniaturization and integration of separation techniques into monitoring
systems. J Chromatogr 593:253–258
Medintz IL, Berti L, Emrich CA, Tom J, Scherer JR, Mathies RA (2001) Genotyping energy-
transfer-cassette-labeled short-tandem-repeat amplicons with capillary array electrophoresis
microchannel plates. Clin Chem 47:1614–1621
Moretti TR, Baumstark AL, Defenbaugh DA, Keys KM, Brown AL, Budowle B (2001a) Valida-
tion of STR typing by capillary electrophoresis. J Forensic Sci 46:661–676
11 Capillary Electrophoresis Issues in Forensic DNA Typing 237
Moretti TR, Baumstark AL, Defenbaugh DA, Keys KM, Smerick JB, Budowle B (2001b) Valida-
tion of short tandem repeats (STRs) for forensic usage: performance testing of fluorescent
multiplex STR systems and analysis of authentic and simulated forensic samples. J Forensic
Sci 46:647–660
National Institute of Justice (2000) The future of forensic dnatesting: predictions of the research and
development Working Group of the National Commission on the Future of DNA Evidence,
Washington, DC. http://www.ojp.usdoj.gov/nij/pubs-sum/183697.htm
Nazemifard N, Wang L, Ye W, Bhattacharjee S, Masliyah JH, Harrison DJ (2012) A systematic
evaluation of the role of crystalline order in nanoporous materials on DNA separation. Lab Chip
12(1):146–152
Olson DW, Dorfman KD (2012) Experimental study of the effect of disorder on DNA dynamics in
post arrays during electrophoresis. Phys Rev E 86(4):041909
Ou J, Carpenter SJ, Dorfman KD (2010) Onset of channeling during DNA electrophoresis in a
sparse ordered post array. Biomicrofluidics 4(1):013203
Ou J, Joswiak MN, Carpenter SJ, Dorfman KD (2011) Plasma thinned nanopost arrays for DNA
electrophoresis. J Vac Sci Technol A 29(1):011025
Park S-G, Olson DW, Dorfman KD (2012) DNA electrophoresis in a nanofence array. Lab Chip 12
(8):1463–1470
Perrier S, Zhu Z, Fiore E, Ravelet C, Guieu V, Peyrin E (2014) Capillary gel electrophoresis-
coupled aptamer enzymatic cleavage protection strategy for the simultaneous detection of
multiple small analytes. Anal Chem 86(9):4233–4240
Righetti PG, Gelfi C, D’Acunto MR (2002) Recent progress in DNA analysis by capillary
electrophoresis. Electrophoresis 23:1361–1374
Russell AJ, Del Bonis-O’Donnell JT, Wynne TM, Napoli MT, Pennathur S (2014) Separation
behavior of short single- and double-stranded DNA in 1 micron and 100 nm glass channels.
Electrophoresis 35(2–3):412–418
Schmalzing D, Koutny L, Adourian A, Belgrader P, Matsudaira P, Ehrlich D (1997) DNA typing in
thirty seconds with a microfabricated device. Proc Natl Acad Sci U S A 94:10273–10278
Schmalzing D, Adourian M, Koutny L, Ziaugra L, Matsudaira P, Ehrlich D (1998) DNA sequenc-
ing on microfabricated electrophoretic devices. Anal Chem 70:2303–2310
Schmalzing D, Koutny L, Chisholm D, Adourian A, Matsudaira P, Ehrlich D (1999) Two-color
multiplexed analysis of eight short tandem repeat loci with an electrophoretic microdevice. Anal
Biochem 270:148–152
Simpson PC, Roach D, Woolley AT, Thirsen T, Johnston R, Sensabaugh GF, Mathies RA (1998)
High-throughput genetic analysis using microfabricated 96-sample capillary array electropho-
resis microplates. Proc Natl Acad Sci U S A 95:2256–2261
Terry SC, Jerman JH, Angell JB (1979) A gas chromatographic air analyzer fabricated on a silicon
wafer. IEEE Trans Electron Devices 26:1880–1886
Ueda M, Kiba Y, Abe H, Arai A, Nakanishi H, Baba Y (2000) Fast separation of oligonucleotide
and triplet-repeat DNA on a microfabricated capillary electrophoresis device and capillary
electrophoresis. Electrophoresis 21:176–180
Ueno K, Yeung ES (1994) Simultaneous monitoring of DNA fragments separated by electrophore-
sis in a multiplexed array of 100 capillaries. Anal Chem 66:1424–1431
Wang CH, Ho CH, Chou YC (2013) Sieving DNA molecules by length dependence in artificial
nano-channel matrices. J Appl Phys 113(2):024701–024707
Wätzig HK (2002) Kapill are lektrophorese in der pharmazeutischen Industrie. Pharm Ind
64:1183–1185
Wenz H, Robertson JM, Menchen S, Oaks F, Demorest DM, Scheibler D, Rosenblum BB, Wike C,
Gilbert DA, Efcavitch JW (1998) High-precision genotyping by denaturing capillary electro-
phoresis. Genome Res 8(1):69–80
Woolley AT, Mathies RA (1994) Ultra-high-speed DNA fragment separations using
microfabricated capillary array electrophoresis chips. Proc Natl Acad Sci U S A
91:11348–11352
238 S. Kaushik and V. Sahajpal
Woolley AT, Sensabaugh GF, Mathies RA (1997) High-speed DNA genotyping using
microfabricated capillary array electrophoresis chips. Anal Chem 69:2181–2186
Zhang X, McGown LB (2013) Sequence-based separation of single-stranded DNA using
nucleotides in capillary electrophoresis: focus on phosphate. Electrophoresis 34(12):1778–1786
Human Trafficking and DNA Analysis
12
María Saiz, Maria Jesus Alvarez-Cubero, Begona Lorente-Remon,
Luis Javier Martínez-Gonzalez, and Jose A. Lorente
Abstract
One of the most impact and widespread violations of human rights is human
trafficking. Historical events and laws defining human trafficking have changed
along recent years. Here we report the principal consequences of human traffick-
ing indicating differences among sex and countries all over the world. Here we
highlight the increasing rates of human trafficking in the cases of people escaping
from war and persecutions, which have become in the recent years one of the
most vulnerable events for human trafficking. Moreover, it is reported the
reinforced role of universal and global laws for unifying this problem and victims.
Finally, forensic strategies such as DNA typing have been one of the most
relevant options for having a specific human identification in relevant cases
such as human trafficking.
M. Saiz · B. Lorente-Remon
Laboratory of Genetic Identification, Faculty of Medicine, University of Granada, Granada, Spain
M. J. Alvarez-Cubero
Department of Biochemistry and Molecular Biology III, Faculty of Medicine, University of
Granada, Granada, Spain
GENYO (University of Granada-Andalusian Government—Pfizer, Centre for Genomics and
Oncological Research), Granada, Spain
L. J. Martínez-Gonzalez
GENYO (University of Granada-Andalusian Government—Pfizer, Centre for Genomics and
Oncological Research), Granada, Spain
J. A. Lorente (*)
Laboratory of Genetic Identification, Faculty of Medicine, University of Granada, Granada, Spain
GENYO (University of Granada-Andalusian Government—Pfizer, Centre for Genomics and
Oncological Research), Granada, Spain
e-mail: [email protected]
Keywords
12.1 Introduction
The United Nations Office on Drugs and Crime (UNODC) has reported that a total of
63,251 victims were detected in 106 countries and territories between 2012 and
2014. A clear majority (around 70%) of these victims were females; moreover, the
trends in men are increasing these late years; however, with clear differences among
countries. Children remain being the second most commonly detected group of
victims (after women) of trafficking globally, ranging from 25 to 30% of the total
during the period of 2012–2014 (UNODC 2016).
The main purposes of human trafficking are wide; ranking the main aims the
sexual exploitation and forced labour. But there are also victims used as beggars, for
forced marriages, pornography or organ trafficking, etc. Around 72% of the cases are
related to sexual exploitation, contrasting to the 20–30% for forced labour in women
trafficking victims; around 85.7% for forced labour and a 6.8% in trafficking for
sexual exploitation in men trafficking victims. There are also differences among the
countries in the human trafficking aims, for example in the Western and Southern
Europe comparing to the Central and the South-Eastern Europe (UNODC 2016).
Recent circumstances of people fugitives from war and persecutions are also
becoming trafficking vulnerable victims. A recent situation like this has happened in
Syria with a large amount of refugees victims of the latest conflict in this region
(UNODC 2016).
Moreover, one of the most increasing cases of current human trafficking is
focused on organ illegal transplants, making organ trafficking a relevant problem.
According to the WHO (World Health Organization) around 11,000 human organs
were obtained on the black market in 2010. It is a reality in many parts of the world,
like Indonesia, China, India, South Africa, Brazil, among others. This is mainly due
to the increasing demand of organ transplants, especially kidney (What You Need to
Know about Illegal Human Organ Trafficking | Big Think n.d.).
Therefore, this problem affects the whole world and multiple projects and
institutions act to minimize it (Más Allá de las Fronteras: Explorando los Enlaces
entre Trata, Globalización y Seguridad 2010). FBI provides victims with assistance
benefits and improves current cases, mainly by the Office for Victim Assistance with
victim specialists nationwide (Human Trafficking/Involuntary Servitude—FBI n.d.).
Many of the current projects, which are focused on human trafficking, include as
the main tool for making human identification the use of DNA typing. It is currently
widely used in immigration, with high relevance in important cases such as whether
to advance or stop with the requests for immigration or international adoptions.
Moreover, biological tests can also raise information on unidentified human remains
and missing persons. Taking these two applications into account, genetic
12 Human Trafficking and DNA Analysis 241
We have to guarantee children to be treated kindly and following the national and
international standards. Many initiatives have been created to prove that
governments know the importance of the problem of human trafficking and the
need to exterminate the oppression of children. International agreements and policies
must be in place to follow and detect the signs, to transfer the data and to intercon-
nect all this information for having an active prosecution of committers as well as for
the reintegration of child victims. Global coordination plays a critical role, but legal
and social difficulties exist by data inclusion entree and disclosure among countries.
This considerably minimizes the progress of establishing a comprehensive and
efficient counter-trafficking system (Saiz et al. 2016).
12.2.1 UNODC–UN.GIFT
In exertion to protect children (and women) and to combat human trafficking, the
United Nations initiated the UN-Global Initiative to Fight Human Trafficking (UN.
GIFT) in March 2007 http://www.unodc.org/ (United Nations Office on Drugs and
Crime n.d.). The UN.GIFT was launched to encourage the whole fighting against
human trafficking based on international agreements reached by the United Nations.
So far, around 150 groups have signed the procedure for the prevention, suppression
and punishment against human trafficking which ended in the Palermo Convention
against the transnational organized crime.
In March 2007, the International Labour Organization (ILO) launched the UN.
GIFT by the Office of the High Commissioner for Human Rights in Human Nations
(OHCHR), the Organization for Safety and Cooperation in Europe (OSCE), the
International Organization for Migrations (IOM), the United Nations Office on
Drugs and Crime (UNODC) and the United Nations Children’s Fund (UNICEF).
The Global Initiative is established on a not laborious standard: human trafficking
is a crime of such scale and barbarism that it cannot be handled with effectively by
governments not working together. This problem needs a universal, multi-
stakeholder approach based on national efforts all over the world. By promoting
and facilitating collaboration and organization, UN.GIFT proposes to do synergies
among the anti-trafficking activities of UN agencies, international organizations and
other participants to create the most active and cost-effective strategies and good
practices (UNODD 2009). UN.GIFT aims to activate state and non-state actors to get
rid of human trafficking through the reduction of both the vulnerability of possible
victims and the claim for exploitation in all its forms. These guarantee a satisfactory
assurance and support to those who fall victim and encouraging the effective
242 M. Saiz et al.
Fig. 12.1 Shares of adults and children among detected victims of human trafficking, by regions.
(Figure edited from the Global Report on Trafficking in Persons 2016 (UNODC 2016))
prosecution of the criminals implicated, whilst maintaining the essential all persons
human rights.
For the execution of its mission, UN.GIFT grows the knowledge and social
conscience on human trafficking; promotes operative rights-based responses and
inspires the relation of corporations for combined action against human trafficking
(Fig. 12.1).
Fig. 12.2 Main causes of human trafficking reported by IOM in 2016 (International Organization
for Migration 2017)
to prevent persons trafficking since 1994. By the moment, it has put into effect more
than 500 projects in more than 85 countries and has provided support to nearly
90,000 trafficked persons. Its main objectives are to counter persons trafficking and
to give protection to victims from the trade as well as offering options of harmless
and bearable reintegration and/or return to their home countries.
IOM has assisted about 8500 trafficked persons in 2016. Eighty-six percent of
these persons were adults and 14% were under 18 years old. Of all these cases, 43%
were women and 57% were men (International Organization for Migration 2017).
The main purposes of human trafficking are shown in Fig. 12.2.
This initiative shows that administrations are conscious of the real problem of
human trafficking and that several footsteps should be done to fight against child
trafficking. However, there are many difficulties to overcome in human trafficking.
International agreements to recognize, search for, communicate and share data, as
well as stop the criminals and support the victims have to be well known. Worldwide
legal and political management plays a critical role, but legal and social difficulties
hamper the development of the application of a system against human trafficking.
The concept “child labour” is often defined as work that denies children of their
childhood, their potential and their dignity and that is damaging to physical and
mental growth. Children separated from their families, being enslaved, exposed to
serious dangers and illnesses and/or abandoned to shift for themselves on the streets
of huge cities—often at a very early age are the most extreme forms of child labour.
244 M. Saiz et al.
Fig. 12.3 Percentage of children’s involvement in child labour and hazardous work (5–17 years
age range), 2000–2016 (Internation Labour Office 2017)
The National Center for Missing & Exploited Children® (NCMEC) was established
in 1984. It is the main nonprofit organization in the U.S. working with law enforce-
ment, families and the specialists who help them on questions related to missing and
sexually exploited children. This organization provides information and resources to
minor victims of abuses, families and authorities as well as to other kinds of
professionals.
Thirty years ago, police could add information about stolen cars, stolen guns,
even stolen horses into the FBI’s crime database—but not stolen children. Several
tragic cases began to awaken the nation to the problem that there was no coordinated
national system for addressing missing children cases. In 1979, 6-year-old Etan Patz
disappeared from a New York street on his way to school. Over the next several
years, 29 children and young adults were found murdered in Atlanta. Then in 1981,
6-year-old Adam Walsh was kidnapped from a Florida shopping mall and later
found brutally assassinated. That is why NCMEC was created (Sedlak et al. 2002).
In the same year, the Congress of the United States approved the law of support of
missing children and the National Resource Center and Clearinghouse on Missing
and Exploited Children was established. Currently, there is a national free phone-
line for missing children available 24 h 7 days a week. Only in 2017, the operation
centre of NCMEC received more than 10,093 calls regarding possible child sex
trafficking. To date, more than 4.5 million of calls have been received. Around
246 M. Saiz et al.
800,000 reports of missing children each year are received. Most of them are rapidly
found. The NCMEC is involved in the most severe cases in those the minor is in a
high risk. In 2017, NCME received 25,000 new cases reports of missing children and
has analysed more than 12,900 attempted child kidnappings to identify trends and
help develop safety tips for families (NCMEC 2015). The organization works with
the distribution of photos and posters of children to catch public attention through its
website, www.missingkids.com and a programme of spreading the photos that
gather organizations and companies handling the distribution of pictures of the
missing children and millions of people all around the world (NCMEC 2015;
Sedlak et al. 2002).
Fig. 12.4 Proportion of human trafficking cases reported in the total of calls received in the NHTH
University of North of Texas (UNT-HC) and with private financial support. Cur-
rently, the collaboration has extended to China, India, Indonesia, Philippines, Nepal,
Sri Lanka, Thailand, Brazil, Guatemala and Mexico. In 2010, the “First International
Congress of DNA-PROKIDS: Genetic identification against children trafficking”,
called together scientists, international organizations, NGOs and law enforcement
agencies. The main aim was to establish a global alliance against human trafficking
through the use of new technologies in genetic identification.
The main mission of DNA-PROKIDS is to identify the victims and return them to
their families (reunification), to hamper traffic in human beings thanks to identifica-
tion of victims and to gather information on the origins, the routes and the means of
this crime and main elements for the work of law enforcement agencies.
DNA-PROKIDS is composed of three tiers. The first tier is at the national level
with two genetic databases per country. One is for DNA profiles and non-genetic
data obtained from children who, after proper investigation, are found in an illegal
situation (e.g. not living with the natural family because these children were
kidnapped or “adopted” illegally etc.). The other consists of DNA profiles and
non-genetic data voluntarily provided by relatives (parents, siblings and other family
members and whenever possible or “adoptive” mothers) or from personal items of
reported missing children. The DNA profiles in these two databases are compared
regularly to support in identifying missing children. DNA-PROKIDS first-tier pilot
programmes are effectively in Guatemala and Mexico followed by Brazil and China.
The power of identity testing and database searching will be most successful if DNA
analysis is performed in every single case of a child being given to adoption.
Moreover, when possible, the mother (or other available biological relatives) should
also be tested to confirm her relationship to the child and their right to give up the
248 M. Saiz et al.
child. Employment of this act alone would decrease crimes related to children, where
children who had been kidnapped, are sold for adoption.
The second tier is at international level. It will lead to the development of the
infrastructure needed to share data among countries through several existing links
and connections as far as through the creation of new, specific associations.
Agreements from participating laboratories are required to identify an unique set
of DNA markers for routine genotyping of all samples in relation to the programme;
what non-genetic data that should be collected; the information that can be shared
following confidentiality requirements that may differ per state and head off suffi-
cient and sustainable financial support to establish such programmes in several
countries.
The third tier is focused on data generation. There will be a universal automatic,
compulsory inclusion (with signatory countries) in the database of (1) any reported
child found out of his/her family (with illegitimate reasons); (2) children who are
going to be adopted (previous any adoption it will be essential to confirm that the
child has not been informed as missing anywhere in the world) and (3) the immediate
inclusion of voluntary relatives of missing children (Fig. 12.5).
Many efforts are done to raise the database and facilitate communications
between countries, like collaborations with INTERPOL in criminal investigations
that will make criminals disinclined to commit these actions against children
(exploitation, illegal adoptions and trafficking).
12 Human Trafficking and DNA Analysis 249
It is known that the most common way of human identification is focused on STRs
profiles of different parts of the genome (nuclear, Y-chromosome, X-chromosome or
mitochondrial one). All of them are largely validated and included in CODIS, as
official loci/markers used for identification such as those of:
whether they have pets, their health status, if they smoke and whom they kiss; all of
these data result very informative in a forensic scenario (Clarke et al. 2017).
Moreover, it is also crucial and proved that oral microbiome is heritable (Demmitt
et al. 2017). So samples that serve as reservoirs for microbiome are diverse, such as
human (skin, stool, hair, oral cavity); environment (soil, surfaces, air) and objects
(cell phones, shoes, frames) (Clarke et al. 2017).
Concerning human trafficking, it is also of special interest that microbial
communities differ in composition and function across different geographical
locations, even with a deep precision of different cities. These variations are mainly
due to the variations in climate, rainfall, altitude and soil as well as the metabolic
properties of their host or energy sources available in the environment (Clarke et al.
2017).
Epigenome could be defined as a network of changes that modify the genome
without altering the DNA sequences, having relevance in the activation of several
genes or cells. One of the main molecules that play a relevant role in forensic field
(as in biomedical field) are the microRNAs (miRNAs), short, non-coding RNAs of
small size (19–24 nucleotides). They are stable molecules and specific for specific
types of tissues and fluids, which reinforce their relevant role in forensic field. For
example, it has been described that miRNA-16 and miRNA-451 are present in
blood; semen with miRNA-135b and miRNA-10b; saliva with miRNA-205 and
miRNA-658; vaginal secretion miRNA-124a and miRNA-372 and menstrual blood
with miRNA-451 and miRNA-412. This opens a new tool with a relevant applica-
tion in forensic scenes such as crimes, as a relevant way to identify the origin of the
biological source (Dumache et al. 2017).
There are other regions, that although they are not new, they are highly relevant in
population genetics and are often geographically oriented. The most common ones
are haplogroups in Y chromosome (Y-DNA) and mitochondrial DNA (mtDNA).
The Y-DNA haplogroups comprise many branches called subhaplogroups or
subclades and form a phylogenetic tree of mankind. The branch lengths are delimited
by the mutation rates of Y-STRs and Y-SNPs. The way used to name the different
levels of the branch is defined by letters, A through T. Their subhaplogroups or
subclades are expressed as letters and numbers (G2, R1b1, E3b1b, etc.). This tree is
updated periodically according to new developments in the field. Currently, there are
several softwares that help to classify Y-chromosome data properly such as
Haplogroup Classifier, yHaplo; among others. One of the main interests of this
gene in forensic field is the possibility of having an effective molecular tool to
analyse the Y-STR haplotypes and know their haplogroups which allow us to
discover the geographical origins of individuals (Mahal and Matsoukas 2017). All
of this makes this chromosome as a crucial element of interest for human trafficking
analysis.
The mtDNA haplogroups acts also as relevant markers for population genetics
and it is also used the representation in clades as trees like it was explained in
Y-DNA. Moreover, thanks to NGS technologies, we can improve the information of
this genome, doing complete mtDNA sequencing for making a better reconstruction
of difficult populations.
12 Human Trafficking and DNA Analysis 251
Similarly, as in Y-DNA there are several database and software applications that
improve the use of mtDNA in forensic field such as EMPOP database (EMPOP n.d.;
Parson and Dur 2007), PhyloTree software and Haplogrep2 (Arias et al. 2018).
12.3.2 Databases
Scientific and technical advances have generated and continue generating an extraor-
dinary amount of information, which must be stored in a rational and orderly form
for its later use. Databases are an organized way for data collection, which is a place
where any type of information is stored. Nowadays, all databases are generated in
electronica support (usually in computers or computerized) in an arranged and
coherent manner, then it is automatically retrieved according to previously
established parameters (Martin et al. 2001). Its access is quite regulated, depending
on the importance of the stored data; those that contain information about the
“privacy” of the people are the ones with more restrictions. Databases are always
linked to the regulations of the Data Protection Act, 1998 (DPA) based on the
principles of “good information handling”. These principles show the specific rights
in relation to personal information, including certain requirements on those
organizations that process these data. These rules have been recently updated in
Europe in the “2018 reform of EU data protection rules”. Stronger rules on data
protection have been established and more control over their personal data
(Tikkinen-Piri et al. 2018).
In the scientific field, there are no doubts that one of the most important ways of
knowledge is generated data from diverse investigations (Machado and Silva 2014).
Entire and diverse fields of knowledge, such as epidemiology or biostatistics, have
the base on the mathematical study of the data from different research, with the only
aim of obtaining solid and objective results.
DNA analysis development allowed the establishment of genetic databases with a
forensic interest. There are two types of forensic genetic databases: criminal and civil
databases (Butler 2012).
At the moment there is still controversy about suspects “samples collection that in
some cases are taken without their consent or without their knowledge”. In some
relevant investigations, some samples have been taken indirectly such as hairs,
toothbrush, biological materials that remain in prison cells, other objects from the
accused or indirectly from relatives. In the same way, try to obtain DNA from
clinical samples that come from the suspect.. So, there should be limits to solve
issues such as obtaining reference samples that may be controlled by ethical rules,
not just under legal rules (Lorente et al. 1996). Obtaining the sample fraudulently
could cast doubt on the entire database.
Therefore, there is no doubt about the need of accumulating data and no one can
limit its free generation and their utility to society in general and to individuals in
particular. However, it is essential that these actions are made in agreement with each
country. Information in databases is especially sensitive and its use must be perfectly
limited and restricted to law cases authorized. DNA databases have a great potential
for criminal research and they prove their worth for cases with unknown offenders,
serial offenders and/or co-offenders (De Moor et al. 2017).
There are some limitations in databases use. The practical benefit and usefulness
of databases when fighting on human trafficking should not make us lose perspective
of what they really are and their place in the criminal process. It will be equally taken
into account legal and ethical problems that could be raised from the existence of
excessively broad or even universal databases.
It would be necessary to consider that databases should be another instrument to
help police investigation, never the only way. A complete police investigation must
lead a suspect or suspects that criminalistics analyses will confirm or exclude.
At this moment, we believe that the uncontrolled databases spread (to all types of
crimes or people), far from providing practical solutions; it would lead to a situation
in which many people would be allegedly related to crimes. Several biological
samples could be found as clues because they could be easily transported such as
hair or cigarette butts.
It doesn’t seem ethically correct to “make suspects” of large population groups,
for example, all male inhabitants of a city or specific regions, just because a person
has been sexually assaulted and semen has been found. This type of attitudes, far
from being beneficial to forensic science, in our opinion, has become an obstacle and
a brake on the progression and development. This situation makes that normal
citizen feel more and more controlled and unprotected; the use of DNA databases
in crime control cannot be allowed to compensate the lack of other actions, such as
an adequate crime prevention policy and the reintegration of criminals. The “fear of
being all registered” will not prevent criminal acts; however, education in this field
will demonstrate that violence path only entails more violence and the lack of
freedom.
In conclusion, the use of different databases combining their information, from
different polices and DNA databases create new opportunities for networking
analysis but always respecting the approved laws by all governments sharing
their data.
12 Human Trafficking and DNA Analysis 253
References
Arias L, Barbieri C, Barreto G, Stoneking M, Pakendorf B (2018) High-resolution mitochondrial
DNA analysis sheds light on human diversity, cultural interactions, and population mobility in
northwestern Amazonia. Am J Phys Anthropol 165(2):238–255. https://doi.org/10.1002/ajpa.
23345
Butler JM (2012) Advanced topics in forensic DNA typing: methodology. Elsevier Academic
Press, San Diego
Clarke TH, Gomez A, Singh H, Nelson KE, Brinkac LM (2017) Integrating the microbiome as a
resource in the forensics toolkit. Forensic Sci Int Genet 30:141–147. https://doi.org/10.1016/j.
fsigen.2017.06.008
De Moor S, Vander Beken T, Van Daele S (2017) DNA databases as alternative data sources for
criminological research. Eur J Crim Policy Res 23(2):175–192. https://doi.org/10.1007/s10610-
016-9327-9
Demmitt BA, Corley RP, Huibregtse BM, Keller MC, Hewitt JK, McQueen MB et al (2017)
Genetic influences on the human oral microbiome. BMC Genomics 18(1):659. https://doi.org/
10.1186/s12864-017-4008-8
Dumache R, Rogobete AF, Sandesc D, Bedreag OH, Ciocan V, Muresan C et al (2017) Use of
circulating and cellular miRNAs expression in forensic sciences. J Interdiscip Med 2(3):235.
https://doi.org/10.1515/jim-2017-0074
EMPOP (n.d.). https://empop.online/. Accessed 8 June 2018
Human Trafficking/Involuntary Servitude—FBI (n.d.). https://www.fbi.gov/investigate/civil-
rights/human-trafficking. Accessed 8 June 2018
Internation Labour Office (2017) Global estimates of child labour. Geneva. http://www.ilo.org/
wcmsp5/groups/public/@dgreports/@dcomm/documents/publication/wcms_575499.pdf
International Organization for Migration (2017) Global trafficking trends in focus. Key trends from
IOM victim of trafficking data. https://www.iom.int/sites/default/files/our_work/DMM/MAD/
A4-Trafficking-External-Brief.pdf
Lorente M, Lorente JA, Budowle B, Villanueva E (1996) Science and conscience: regulation or
guidelines for forensic hameogenetics? Springer, Berlin, pp 689–691. https://doi.org/10.1007/
978-3-642-80029-0_214
Lorente JA, Entrala C, Alvarez JC, Lorente M, Villanueva E, Carrasco F, Budowle B (2000)
Missing persons identification: genetics at work for society [2]. Science 290(5500):2257–2258
Machado H, Silva S (2014) “Would you accept having your DNA profile inserted in the National
Forensic DNA database? Why?” Results of a questionnaire applied in Portugal. Forensic Sci Int
Genet 8(1):132–136. https://doi.org/10.1016/j.fsigen.2013.08.014
Mahal DG, Matsoukas IG (2017) Y-STR Haplogroup diversity in the Jat population reveals several
different ancient origins. Front Genet 8:121. https://doi.org/10.3389/fgene.2017.00121
Martin PD, Schmitter H, Schneider PM (2001) A brief history of the formation of DNA databases in
forensic science within Europe. Forensic Sci Int 119(2):225–231. https://doi.org/10.1016/
S0379-0738(00)00436-9
Más Allá de las Fronteras: Explorando los Enlaces entre Trata, Globalización y Seguridad (2010)
Bangkok
Microbiome | Definition of Microbiome by Merriam-Webster (n.d.). https://www.merriam-webster.
com/dictionary/microbiome. Accessed 8 June 2018
NCMEC (2015) National Center for Missing & Exploited Children annual report. http://www.
missingkids.com/content/dam/ncmec/en_us/publications/ncmec2015.pdf
Office IL (2012) IPEC action against CHILD LABOUR 2010–2011: progress and future priorities.
International Programme on the Elimination of Child Labour
Organization for Security and Co-operation in Europe (2017) 2016–2017 report on the OSCE
special representative and co-ordinator for combating trafficking in human beings. Vienna.
http://www.osce.org/secretariat/360796?download¼true
254 M. Saiz et al.
Palmbach TM, Blom J, Hoynes E, Primorac D, Gaboury M (2014) Utilizing DNA analysis to
combat the world wide plague of present day slavery—trafficking in persons. Croat Med J 55
(1):3–9. https://doi.org/10.3325/cmj.2014.55.3
Parson W, Dur A (2007) EMPOP-A forensic mtDNA database. Forensic Sci Int Gene 1:88–92
Polaris (n.d.). https://polarisproject.org/. Accessed 30 Jan 2018
Poliakov E, Cooper DN, Stepchenkova EI, Rogozin IB (2015) Genetics in genomic era. Genet Res
Int 2015:364960. https://doi.org/10.1155/2015/364960
Saiz M, Alvarez-Cubero MJ, Alvarez JC, Lorente JA (2016) Forensic genetics against children
trafficking: missing children genetic identification. In: Morewitz SJ, Colls CS (eds) Handbook
of missing persons. Springer, Cham, pp 177–189. https://doi.org/10.1007/978-3-319-40199-7_
13
Sedlak A, Office of Justice Programs, Office of Juvenile Justice and Delinquency Prevention,
NISMART (2002) National estimates of missing children: an overview. US Department of
Justice, Office of Justice Programs, Office of Juvenile Justice and Delinquency Prevention
Tikkinen-Piri C, Rohunen A, Markkula J (2018) EU general data protection regulation: changes and
implications for personal data collecting companies. Comput Law Secur Rev 34(1):134–153.
https://doi.org/10.1016/J.CLSR.2017.05.015
United Nations Office on Drugs and Crime (n.d.). https://www.unodc.org/. Accessed 30 Dec 2018
UNODC (2016) Global report on trafficking in persons 2016. Vienna. http://www.unodc.org/
documents/data-and-analysis/glotip/2016_Global_Report_on_Trafficking_in_Persons.pdf
UNODD (2009) UN.GIFT—global initiative to fight human trafficking
What You Need to Know about Illegal Human Organ Trafficking | Big Think (n.d.). http://bigthink.
com/philip-perry/what-you-need-to-know-about-human-organ-trafficking. Accessed 8 June
2018
Part III
Case Studies/Applications in Forensic DNA
Typing
Autosomal STR Typing and Case Studies
13
Pankaj Shrivastava, Shivani Dixit, Varsha Srivastava,
Hirak Ranjan Dash, and R. K. Kumawat
Abstract
Autosomal STRs are the gold standard and are the most commonly used STR
markers in forensic DNA typing. Most of the autosomal STRs present at the
surrounding of the centromere of an autosomal chromosome are responsible for a
unique DNA fingerprint in an individual. The updated information about the
autosomal STR based kits is discussed along with the case studies to showcase
the importance and utility of autosomal STR markers in forensic DNA typing.
With the advancement in the technology, not only the number of STR markers
has been increased but the inhibitor tolerance of the multiplex, reduced time of
polymerase chain reaction (PCR), and the inclusion of one or more Y chromo-
somal markers have increased its utility in many folds.
Keywords
Autosomes · STRs · Multiplex PCR · Case study
The most common variant of DNA profiling today for criminal cases and other types
of forensic uses is called autosomal “STR” (Short Tandem Repeat) analysis
(Ellegren 2004; Britten and Kohne 1968). Human genome is made up of 23 pairs
of chromosomes, out of which 22 pairs are called autosomes, and last pair is sex
chromosome (Broman et al. 1998; Ghebranious et al. 2003). Autosomes determine
somatic characters of an individual and also contribute to the unique genetic makeup
of an individual, which is inherited from parents. The pattern of this inheritance is
peculiar. Every child gets 50% of autosomal genetic information from its biological
father and rest 50% from its biological mother and can be genetically identified by
comparing its autosomal genetic pattern with biological parents (Butler 2005)
(Fig. 13.1). “Microsatellite DNA” or simple sequence repeats (SSRs) of most usually
short tandem repeats (STRs) are 2–7 bp (base pair) length of a repeated sequence of
DNA, mostly found at surrounding regions of the centromere of an autosomal
chromosome (Kasai et al. 1990; Butler 2011). These autosomal STRs have a high
degree of utility in forensic DNA applicability and admissibility in court of justice
because of generating a unique DNA fingerprint of an individual (Biémont and
Vieira 2006; Srivastava 2006; Butler 2007). A short tandem repeat (STR) in DNA
occurs when a pattern of two or more nucleotides is repeated, and the repeated
sequences are adjacent to each other (Butler 2007). These repeats are called tandem
as the head to tail core sequence is the same, but the numbers of repeats are variable
(Kasai et al. 1990). In a child, from a pair of STR alleles, one STR allele comes from
the biological mother, and the other STR allele comes from the biological father at
each of the genetic sites. Autosomal STR based DNA typing is nothing but a
comparative evaluation of these STR profiles obtained from different individuals.
The STRs are popular DNA markers because these can be amplified easily in
multiplex reactions by polymerase chain reaction (PCR) (Sambrook et al. 1989).
These STRs exhibit the characteristics of single copy STR inheritance from each
parent (Butler 2006). Furthermore, the highly polymorphic nature of STR repeats
13 Autosomal STR Typing and Case Studies 259
Fig. 13.2 DNA profile match linking suspect with the crime by autosomal STR
makes these markers useful for establishing identity of persons by DNA fingerprint-
ing, which is also used as strong biological evidence in the court of law (Butler 2006,
2007). This technique is used to establish identification and provides connections
between biological evidence and the suspect in a criminal investigation. The DNA
profile generated from the biological samples received from the crime scene is
compared with the DNA profile of the samples from suspect. If the two DNA
profiles match, then it is concluded that the evidence came from that suspected
person (Fig. 13.2). This technique is also used to identify bodies, track down blood
relatives, and also for diagnosis of different diseases (Butler 2007).
DNA is the “blueprint” for the proteins in a human body as the sequences present
in it code for a variety of proteins. DNA that actually codes for proteins cannot vary
much; therefore close to 99.7% of our DNA is the same for all (Butler 2011). Usage
of DNA for differentiation among people, therefore, is a tricky matter. We have a
junk region in our genome, which does not code for any protein (Biémont and Vieira
2006). They are rich in tandem repeat regions called variable number tandem repeats
(VNTRs) (Kasai et al. 1990). Useful differences and polymorphism in the DNA
must be found in these remaining 1% of non-coding DNA regions, which is not
known to code for anything specific. Because this part of DNA is non-coding, it is
quite variable, which makes it an attractive tool for possible usage in distinguishing
among individuals. These regions are the basis of STR analysis. A collection of these
can give excellent evidence of a person’s identity statistically because the likelihood
of two unrelated people having the same number of repeated sequences in these
regions is highly remote.
260 P. Shrivastava et al.
The need for common nomenclature of STRs was felt considering the need for
inter-laboratory reproducibility and for data comparison. Therefore designation or
guidelines for nomenclature of STRs were framed by the International Society of
Forensic Genetics (ISFG) (Bar et al. 1997). It was decided that
– The coding strand should be used for STRs within protein-coding genes (as well
as in the intron of the genes). One such example is vWA (GenBank: M25716)
(Bar et al. 1997).
– For repetitive sequences like many of the D#S## loci, the sequence originally
described in the literature or the first public database entry shall become the
standard reference for nomenclature (Bar et al. 1997).
It was also decided by the forum that if any nomenclature is already established
and being used, but if does not follow the above guideline, the existing nomenclature
should be used to avoid any confusion (Bar et al. 1997).
Autosomal chromosomes are not involved in gender determination, and STRs on
these chromosomes are called autosomal STRs. Another type of STRs used for
forensic purposes is called Y-STRs, which are present on the male sex-determining
Y chromosome and X-STRs, which are present on the X chromosome. Profiles
generated by autosomal STRs are statistically more relevant than profiles generated
by Y-STRs and X-STRs. Since autosomal DNA undergoes recombination, chances
of having the same profile by two individuals are more than the world population
(Kayser 2017). The only exception is identical twins that develop from the same cell,
so share the same genetic composition. Only males have a Y chromosome, and all
males get these from their fathers, i.e., Y chromosomes are paternally inherited
(Fig. 13.3). A Y-STR profile can offer substantial power of exclusion, but this type
of profile certainly can’t be used for establishing identity.
13 Autosomal STR Typing and Case Studies 261
The 1990s was the start when the use of STR markers was first described as a useful
tool for forensic human identification (Edwards et al. 1991, 1992). Just after this, the
FSS (Forensic Science Services in the United Kingdom) started a massive drive for
searching new loci and their population testing for the forensic purpose (Kimpton
et al. 1993) followed by few other groups, including Europeans (Frégeau and
Fourney 1993). The first multiplex, which was developed and tested for the forensic
use by FSS, was a multiplex of four STR markers, namely TH01, VWA, FES/FPS,
and F13A1, which is commonly known as “first-generation multiplex” (Kimpton
et al. 1994). This was followed by second-generation multiplex (SGM) again from
FSS, which included TH01, VWA, FGA, D8S1179, D18S51, and D21S11 loci
along with amelogenin as a sex-determining marker. In 1994, Promega
Co. launched its first STR kit, which was a three marker multiplex known as
“CTT.” This first commercially available STR multiplex included CSF1PO,
TPOX, and TH01 and was based on silver stain analysis (Fig. 13.4).
In 1996, FBI Laboratory initiated the establishment of core STR loci to initiate a
national DNA database. This was named as CODIS (Combined DNA Index Sys-
tem). Twenty-two working DNA laboratories participated in this initiative of FBI,
and this exercise continued from April 1996 to November 1997. In this exercise, the
17 STR loci, namely CSF1PO, F13A01, F13B, FES/FPS, FGA, LPL,TH01, TPOX,
vWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51,
andD21S11, were evaluated for inclusion in CODIS database establishment. Finally,
after long interactions and collaborative exercises on the final STR Project, which
was held on November 13–14, 1997, 13 core STR loci were adopted, which were
declared as CODIS national DNA database (Olaisen et al. 1998). The 13 finally
selected CODIS core loci were CSF1PO, FGA, TH01, TPOX, vWA, D3S1358,
D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, and D21S11 (Butler
2011). Based on the population-based studies globally out of these 13 CODIS STR
loci, FGA, D18S51, and D21S11 have been observed as the three most polymorphic
markers. In contrast, TPOX, CSF1PO, and TH01 have been comparatively observed
as low polymorphic markers. These three markers were the same, which were part of
the first commercially available multiplex CTT, hence despite their low polymorphic
character, these three made their place in CODIS 13 because, by that time, this CTT
multiplex was extensively used in the United States.
In 1999, forensic DNA setups in European countries adopted the European Standard
Set (ESS) of seven STR loci (FGA, TH01, vWA, D3S1358, D8S1179, D18S51, and
D21S11) (Schneider 2009). Out of these seven markers, six markers were part of the
SGM marker panel, and D3S1358 was additionally included. Five additional
markers were accepted to be the part of ESS, namely D2S441, D10S1248,
D22S1045, D1S1656, and D12S391 in April 2009, thus extending the total of
7ESS loci to 12.
In April 2011, the FBI Laboratory proposed an expanded set of core STR loci
intending to avoid chances of adventitious matches for enhancing global compati-
bility and further to increase the power of discrimination for forensic purpose. The
primary candidate loci for this expanded CODIS included the CODIS13 loci.
Additionally, those loci were preferred, which were part of then commercially
available multiplex kits in the United States (Butler 2006) and also which were in
use globally for forensic DNA database studies (Schneider 2009). The loci with any
published association with any linked medical condition or association with some
decease were not taken into consideration (Hares 2015). The Working Group
developed and published an implementation timeline for the public in June 2011
(Butler 2005). Based on the available three PCR amplification multiplex kits which
included the candidate loci, namely GlobalFiler™ and GlobalFiler™ Express (Life
Technologies now ThermoFisher Scientific) and PowerPlex® Fusion (Promega),
11 CODIS laboratories were notified as a consortium for conducting validation
studies (as per FBI Quality Assurance Standards) for selection of expanded
CODIS (Hares 2015). The compilation of the data generated by CODIS laboratories,
along with its review and analysis, was executed with the help of the National
Institute of Standards and Technology. And finally, as a result of this extensive
exercise, newly expanded CODIS loci were selected, and laboratories were asked for
its implementation by January 1, 2017 (Table 13.1).
Many commercial kits by different manufacturers like Promega, Applied
Biosystem/Life Technologies (now ThermoFisher Scientific), Qiagen, and many
others are available nowadays for autosomal STR analysis (Tables 13.2 and 13.3).
13 Autosomal STR Typing and Case Studies 263
These kits follow the multiplex process, which allows the co-amplification of
incorporated loci in a single reaction of PCR. The reaction mix contains properly
designed primers, fluorescent dyes along with Taq polymerase, dNTPs, buffer, etc.
DNA profiling today is PCR based and uses simple sequences or short tandem
repeats (STR). These STR loci are targeted with sequence-specific primers and
amplified using PCR. Subsequent fragment analysis is carried out to identify the
allele sizes. The PCR amplicons are separated and detected using electrophoresis.
Single-base differences also need to be differentiated; therefore, PCR products are
resolved by automated DNA sequencing technologies with software that recognizes
allele patterns by comparing them with a “ladder,” which is nothing but a group of
fragment sizes with known molecular weights. Repeats of a specific sequence at
specific locations are identified in the genome, and a genetic profile of an individual
is created.
A statistical analysis is generally made to determine the genotype frequency of
the population. The Hardy–Weinberg Equilibrium (HWE) analysis provides the
frequency of the observed genotype for each STR allele. The individual STR
genotypes frequencies are multiplied together to assess the complete frequency
profile, which gives the overall profile frequency. The generated DNA profiles
from samples and suspects can be stored in a database which is used for comparative
evaluation for the purpose of criminal investigation. Combined DNA Index System
(CODIS), current DNA database maintained by the FBI contains case samples and
samples from convicted individuals that are compared. As and when the new profile
is entered, it is compared with these existing profiles in the database.
Autosomal STR based multiplex kits are used to decipher information in a wide
variety of criminal cases (Table 13.4).
Investigator
AmpFlSTR® AmpF‘STR™ PowerPlex® AmpFlSTR® Investigator 24plex Go
Genetic PowerPlex® AmpFlSTR® Profiler AmpFlSTR® AmpFlSTR® Identifiler™ PowerPlex® ESX AmpFlSTR® AmpfISTRIdentifiler NGM Decaplex Investigator® Global PowerPlex PowerPlex and 24plex SureID® PowerPlex Sure ID VeriFiler VersaPlex™
markers 16 Identifiler® Plus™ ID SEfiler™ Sinofiler™ Direct 16 HS 17 System NGM™ Plus SElect™ SE IDplex Plus Filer 21 Fusion QS 23comp Fusion 6C PanGlobal Plus GlobalFiler IQC 27PY
D3S1358 Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y N Y Y Y Y Y
vWA Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y N Y Y Y Y Y
D16S539 Y Y N Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y
CSF1PO Y Y N N Y Y Y Y N Y N N Y Y Y Y Y N Y Y Y Y Y
D6S1043 N N N N Y N N N N N N N N N Y N N N N Y Y N Y
D8S1179 Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y N Y Y Y Y Y
D21S11 Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y N Y Y Y Y Y
D18S51 Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y N Y Y Y Y Y
D5S818 Y Y Y N Y Y Y N N Y N N Y Y Y Y Y N Y Y Y Y Y
D2S441 N N N N N N N Y Y N Y N N Y N Y Y Y Y Y Y Y Y
D19S433 N Y N Y Y Y N Y Y Y Y Y Y Y Y Y Y N Y Y Y Y Y
FGA Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y N Y Y Y Y Y
D10S1248 N N N N N N N N Y N Y N N Y N Y Y Y Y Y Y Y Y
D22S1045 N N N N N N N Y Y N Y N N Y N Y Y N Y Y Y Y Y
D1S1656 N N N N N N N Y Y N Y N N Y Y Y Y Y Y Y Y Y Y
D13S317 Y Y Y N Y Y Y N N Y N N Y Y Y Y Y N Y Y Y Y Y
D7S820 Y Y Y N Y Y Y N N Y N N Y Y Y Y Y N Y Y Y Y Y
PentaE Y N N N N N Y N N N N N N N Y Y N N Y Y Y N Y
PentaD Y N N N N N Y N N N N N N N Y Y N N Y Y Y N Y
TH01 Y Y N Y N Y Y Y Y Y Y Y Y Y Y Y Y N Y Y Y Y Y
D12S391 N N N N Y N N Y Y N Y N N Y Y Y Y Y Y Y Y Y Y
D2S1338 N Y N Y Y Y N Y Y Y Y Y Y Y Y Y Y N Y Y Y Y Y
TPOX Y Y N N N Y Y N N Y N N Y Y Y Y Y N Y Y Y Y Y
SE33 N N N Y N N N Y N N Y Y N Y N N Y N Y Y N N N
D18S1364 N N N N N N N N N N N N N N N N N Y N N N N N
D13S325 N N N N N N N N N N N N N N N N N Y N N N N N
D5S2800 N N N N N N N N N N N N N N N N N Y N N N N N
D9S1122 N N N N N N N N N N N N N N N N N Y N N N N N
D4S2366 N N N N N N N N N N N N N N N N N Y N N N N N
D3S1744 N N N N N N N N N N N N N N N N N Y N N N N N
D11S2368 N N N N N N N N N N N N N N N N N Y N N N N N
D21S2055 N N N N N N N N N N N N N N N N N Y N N N N N
D20S482 N N N N N N N N N N N N N N N N N Y N N N N N
D8S1132 N N N N N N N N N N N N N N N N N Y N N N N N
D7S3048 N N N N N N N N N N N N N N N N N Y N N N N N
D19S253 N N N N N N N N N N N N N N N N N Y N N N N N
D17S1301 N N N N N N N N N N N N N N N N N Y N N N N N
D22- N N N N N N N N N N N N N N N N N Y N N N N N
GATA198B05
D6S474 N N N N N N N N N N N N N N N N N Y N N N N N
D14S1434 N N N N N N N N N N N N N N N N N Y N N N N N
D15S659 N N N N N N N N N N N N N N N N N Y N N N N N
Amelogenin Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y
P. Shrivastava et al.
13
DYS391 N N N N N N N N N N N N N Y N Y Y N Y Y N Y Y
DYS576 N N N N N N N N N N N N N N N N N N Y N N N Y
DYS570 N N N N N N N N N N N N N N N N N N Y N N N Y
Y indel N N N N N N N N N N N N N Y N N N N N Y Y Y N
IQCS N N N N N N N N N N N N N N N N N N N N Y Y N
IQCL N N N N N N N N N N N N N N N N N N N N Y Y N
QS1 N N N N N N N N N N N N N N N N Y N N N N N N
QS2 N N N N N N N N N N N N N N N N Y N N N N N N
Autosomal STR Typing and Case Studies
267
268 P. Shrivastava et al.
Table 13.4 Types of cases in which autosomal STR typing plays a vital role in forensic DNA
examination
Types of cases Questions which can be answered
Parentage disputes • Biological relationship of the child with parents
• Maternity of the child
• Paternity of child
Identification of • Identification of recovered biological material
mutilated remains
Transfer of biological
material
1. Cases of sexual • Transfer of male DNA to the source of the spot (clothing,
assault condom, bed sheet, etc.)
• Blood on males’ genital in case of assault with minors
• Transfer of female DNA on the clothing of suspect (transfer of
blood in cases of assault with minors)
• Transfer of female DNA (vaginal fluid) on the fingers of a male
if case study dictates finger insertion into the female genital
• Blood on any object used for insertion in cases of assault
2. Cases of murder • Transfer of victim’s DNA on the source of spot or accused
• Source of any biological material in the crime scene or on any
object found there, e.g., hair, cigarette stub, chewing gum
3. Cases of theft Transfer of DNA of the suspect on the spot
on ABI 7500 Real-Time PCR (Thermo) using Investigator Quantiplex Pro RGQ Kit
following the manufacturer’s protocol. Five hundred picogram of DNA was
amplified using PowerPlex(R) Fusion 6C multiplex system as per the
recommendations of the manufacturer except reducing the reaction volume to
10 μl microliter. The amplified DNA fragments (amplicons) were separated on
Genetic Analyzer ABI 3500XL using a 36 cm capillary array, POP™-4, and the
obtained data were analyzed using GeneMapper(R)ID-X software v1.5. The results in
the performed DNA test showed the match of the girl child with the parents on all the
tested markers included in the multiplex system (Table 13.5). The results in the case
come up as false allegations on hospital administration, and the girl child was found
to be the biological offspring of the tested couple.
Table 13.5 Autosomal STR profile obtained in a suspected case of child swapping in one hospital
Genetic markers Blood sample of father Blood sample of child Blood sample of mother
Amelogenin XY XX XX
D3S1358 16, 17 15, 16 15
D1S1656 16, 19 13, 19 13,15
D2S441 11, 11.3 11, 12.3 11, 12.3
D10S1248 15 14, 15 14, 15
D13S317 10, 11 8, 11 8, 11
PentaE 8, 19 8, 16 14, 16
D16S539 11, 12 11, 13 11, 13
D18S51 14 14,17 16, 17
D2S1338 17, 23 17,18 18, 24
CSF1PO 10, 12 10 10, 13
PentaD 11, 12 11, 13 11, 13
THO1 6 6,9 6, 9
vWA 15, 18 17, 18 14, 17
D21S11 31.2, 33.2 29,31.2 29, 31.2
D7S820 8, 11 8, 8 8
D5S818 12 10, 12 10, 12
TPOX 10, 11 8,11 8
D8S1179 14, 15 10, 14 10
D12S391 23 19, 23 17, 19
D19S433 12, 15.2 12, 13 12, 13
SE33 16, 25.2 16, 22.2 17, 22.2
D22S1045 15, 16 14, 15 14, 15
FGA 22, 24 22, 23 19, 23
DYS391a 11 – –
DYS576a 18 – –
DYS570a 18 – –
a
Markers indicative of male DNA
Table 13.6 Autosomal STR profile obtained in a case of paternity resulted in the exclusion
Genetic markers Blood sample of father Blood sample of child Blood sample of mother
Amelogenin X, Y X X
D3S1358 16, 17 18 18
D1S1656 11, 18 12 12, 16
D2S441 11, 14 11 11
D10S1248 13, 14 15, 16 13, 16
D13S317 11, 12 11 9, 11
Penta E 10, 16 12, 17 7, 17
D16S539 9, 12 8 9, 8
D18S51 12 11, 19 11, 19
D2S1338 20, 25 20, 24 20, 24
CSF1PO 10, 11 9, 12 9, 12
PentaD 10, 11 9, 11 9, 10
THO1 6, 9.3 7, 9 6, 9
vWA 15, 18 17 16, 17
D21S11 29, 31.2 28 28, 31.2
D7S820 10, 11 9 9
D5S818 12, 13 12 11, 12
TPOX 8, 11 8 8, 10
D8S1179 10, 11 14, 15 14, 15
D12S391 19, 20 17 17, 18
D19S433 14, 14.2 14, 15 14, 15
SE33 15, 31.2 15, 16 15, 16
D22S1045 15 17 16, 17
FGA 20, 21 20, 25 20, 25
DYS391a 10 – –
DYS576a 15 – –
DYS570a 18 – –
a
Markers indicative of male DNA
Table 13.7 Autosomal STR profile obtained in a murder case in forensic DNA examination
Article C Article G Article H
Article A clothes Article D knife Article F knife clothes (accused clothes (accused Article I transparent
Genetic markers cotton (spot) (deceased) (accused 1) (accused 2) 1) 2) tape (accused 1)
D3S1358 15,16 15,16 15,16 15,16 15,16 15,16 15,16
Vwa 14,18 14,18 14,18 14,18 14,18 14,18 14,18
D16S539 12,13 12,13 12,13 12,13 12,13 12,13 12,13
CSF1PO 10,12 10,12 10,12 10,12 10,12 10,12 10,12
TPOX 9 9 9 9 9 9 9
D8S1179 15 15 15 15 15 15 15
D21S11 29,32.2 29,32.2 29,32.2 29,32.2 29,32.2 29,32.2 29,32.2
D18S51 15 15 15 15 15 15 15
D2S441 11,12 11,12 11,12 11,12 11,12 11,12 11,12
Autosomal STR Typing and Case Studies
PCR amplification becomes a challenging task with old samples which are not
preserved properly. There are several factors which effect the success like the
amount and quality of isolated DNA and the presence of PCR inhibitors. PCR
amplification also hugely depends upon the procedure and methodology used. The
following are some of the issues related to the amplification of autosomal STRs.
Analysis of degraded samples: The success of STR typing using autosomal STR
based multiple kits depends upon various factors, including the amount of extracted
DNA, the extent of DNA degradation, and purity of extracted DNA, i.e., the
presence of inhibitors in extracted DNA (Opel et al. 2010; Kontanis and Reed
2006; Wilson 1997).
The multiplex kits being used for forensic purposes have short tandem repeats
(STRs) length up to 500 bp. Forensic samples that are recovered from various
adverse conditions are sometimes degraded as well. There has been the introduction
of miniSTRs with reduced fragment size up to 200 bp (Mulero et al. 2008; Welch
et al. 2011) with the expectation to enhance the efficacy of STR based identification.
However, new generations multiplex autosomal STR kits which facilitate the usage
of more loci with less than 200 base pairs size and with improved quality buffers also
do not provide a satisfactory result for a wide variety of degraded samples.
Null alleles and shifted alleles: Another concern with autosomal STR kits of
different commercial brands is the concordance in allele calls. Differences in primer
design for the same loci incorporated in different STR based multiplex kits may
result in null alleles or shifted allele calls (Westen et al. 2014).
Nucleotide variation but same allele call: The autosomal STR markers included
in commercially available multiplex kits work on identifying the number of repeats.
However, the variation in nucleotide sequences is not accessed by these multiplex
systems (Oberacher et al. 2008).
DNA typing of touched objects: Though there have been many studies on touch
DNA, still the theoretical and practical reality is different. Successful STR typing is
reported on used cups, electrical switches, and used lipsticks (Webb et al. 2001;
Sweet and Hildebrand 1999). Low DNA yield with touch DNA objects accounts for
many STR artifacts. Some of the common issues are stutter artifacts, allele drop-in
and drop-out, and peak imbalance, which makes it challenging to identify the real
allele call from the sample.
Analysis of DNA typing of mixed samples: Mixed samples are another chal-
lenge for forensic DNA experts. The high content of one contributor frequently
results in masking the lower contributor in the mixture. This is a common phenome-
non which is observed while dealing with samples from sexual assault cases. There
have been many studies on this since the inception of DNA technology in 1985 (Gill
et al. 1985), but even after more than three decades, there is no standard approach to
deal with mixed samples.
DNA profiling is based on comparison: Regardless of any genetic marker used
for forensic DNA typing, the obtained results can be helpful only in the identification
of individuals who are already known to the investigating officials (Kayser and De
274 P. Shrivastava et al.
Knijff 2011). This is another area which is being discussed globally for the last
decade.
Ethical Statement All the samples analyzed and reported here were taken from
routine casework examination performed by the author at DNA Fingerprinting Unit,
State Forensic Science Laboratory, Sagar, MP, India, as per the standard guidelines
for DNA fingerprinting examination in the country. The referral blood samples were
collected with pre-informed written consent from the donors following the Declara-
tion of Helsinki (Rickham 1964).
References
Bar W et al (1997) DNA recommendations further report of the DNA commission of the ISFH
regarding the use of short tandem repeat systems. Int J Legal Med 110(4):175–176
Biémont C, Vieira C (2006) Junk DNA as an evolutionary force. Nature 443(7111):521–524
Britten RJ, Kohne DE (1968) Repeated sequences in DNA. Science 161(3841):529–540
Broman KW, Murray JC, Sheffield VC, White RL, Weber JL (1998) Comprehensive human
genetic maps: individual and sex-specific variation in recombination. Am J Hum Genet 63
(3):861–869
Butler JM (2005) Forensic DNA typing: biology, technology, and genetics of STR markers.
Elsevier, New York
Butler JM (2006) Genetics and genomics of core short tandem repeat loci used in human identity
testing. J Forensic Sci 51(2):253–265
Butler JM (2007) Short tandem repeat typing technologies used in human identity testing.
Biotechniques 43(4):Sii–SSv
Butler JM (2011) Advanced topics in forensic DNA typing: methodology. Academic Press, San
Diego
Edwards A, Civitello A, Hammond HA, Caskey CT (1991) DNA typing and genetic mapping with
trimeric and tetrameric tandem repeats. Am J Hum Genet 49(4):746
Edwards AL, Hammond HA, Jin L, Caskey CT, Chakraborty R (1992) Genetic variation at five
trimeric and tetrameric tandem repeat loci in four human population groups. Genomics 12
(2):241–253
Ellegren H (2004) Microsatellites: simple sequences with complex evolution. Nat Rev Genet 5
(6):435–445
Frégeau CJ, Fourney RM (1993) DNA typing with fluorescently tagged short tandem repeats: a
sensitive and accurate approach to human identification. BioTechniques 15(1):100–119
Ghebranious N, Vaske D, Yu A, Zhao C, Marth G, Weber JL (2003) STRP screening sets for the
human genome at 5 cM density. BMC Genomics 4(1):6
Gill P, Jeffreys AJ, Werrett DJ (1985) Forensic application of DNA ‘fingerprints’. Nature 318
(6046):577
Hares DR (2015) Selection and implementation of expanded CODIS core loci in the United States.
Forensic Sci Int Genet 17:33–34
Kasai K, Nakamura Y, White R (1990) Amplification of a variable number of tandem repeats
(VNTR) locus (pMCT118) by the polymerase chain reaction (PCR) and its application to
forensic science. J Forensic Sci 35(5):1196–1200
Kayser M (2017) Forensic use of Y-chromosome DNA: a general overview. Hum Genet 136
(5):621–635
Kayser M, De Knijff P (2011) Improving human forensics through advances in genetics, genomics
and molecular biology. Nat Rev Genet 12(3):179
13 Autosomal STR Typing and Case Studies 275
Kimpton CP, Gill P, Walton A, Urquhart A, Millican ES, Adams M (1993) Automated DNA
profiling employing multiplex amplification of short tandem repeat loci. Genome Res 3
(1):13–22
Kimpton C et al (1994) Evaluation of an automated DNA profiling system employing multiplex
amplification of four tetrameric STR loci. Int J Legal Med 106(6):302–311
Kontanis EJ, Reed FA (2006) Evaluation of real-time PCR amplification efficiencies to detect PCR
inhibitors. J Forensic Sci 51(4):795–804
Mulero JJ et al (2008) Development and validation of the AmpF‘STR® MiniFiler™ PCR amplifi-
cation kit: a miniSTR multiplex for the analysis of degraded and/or PCR inhibited DNA J
Forensic Sci 53(4):838–852
Oberacher H, Pitterl F, Huber G, Niederstätter H, Steinlechner M, Parson W (2008) Increased
forensic efficiency of DNA fingerprints through simultaneous resolution of length and nucleo-
tide variability by high-performance mass spectrometry. Hum Mutat 29(3):427–432
Olaisen B et al (1998) DNA recommendations 1997 of the International Society for Forensic
Genetics. Vox Sang 74(1):61–63
Opel KL, Chung D, McCord BR (2010) A study of PCR inhibition mechanisms using real time
PCR. J Forensic Sci 55(1):25–33
Rickham PP (1964) Human experimentation. Code of ethics of the world medical association.
Declaration of Helsinki. Br Med J 2(5402):177
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY
Schneider PM (2009) Expansion of the European standard set of DNA database loci—the current
situation. Profiles DNA 12:6–7
Srivastava V (2006) DNA fingerprinting in the criminal justice system: an overview. DNA Cell Biol
25(3):181–188
Sweet D, Hildebrand D (1999) Saliva from cheese bite yields DNA profile of burglar: a case report.
Int J Legal Med 112(3):201–203
Webb LG, Egan SE, Turbett GR (2001) Recovery of DNA for forensic analysis from lip cosmetics.
J Forensic Sci 46(6):1474–1479
Welch L et al (2011) A comparison of mini-STRs versus standard STRs-results of a collaborative
European (EDNAP) exercise. Forensic Sci Int Genet 5(3):257–258
Westen AA et al (2014) Comparing six commercial autosomal STR kits in a large Dutch population
sample. Forensic Sci Int Genet 10:55–63
Wilson IG (1997) Inhibition and facilitation of nucleic acid amplification. Appl Environ Microbiol
63(10):3741
Y Chromosome Short Tandem Repeats
Typing 14
Rashed Alghafri
Abstract
R. Alghafri (*)
General Department of Forensic Sciences and Criminology, Dubai Police G.H.Q, Dubai, United
Arab Emirates
Department of Biology, United Arab Emirates University, Al Ain, United Arab Emirates
Faculty of Health Science and Medicine, Bond University, Gold Coast, QLD, Australia
other databases which are used for genealogy studies. Moreover, the utilization of
these databases to estimate the rarity of Y-STR haplotypes and its involved
statistical uncertainties following different approaches has been discussed.
Keywords
14.1 Introduction
For STR loci, which are spread all over the genome, there are two main mutation
mechanisms. The first mechanism, which is presented during replication of the
DNA, is the slippage of the DNA polymerase enzyme incident and incorrect
reattachment to DNA strands. Whereas, the second mechanism takes place through
the crossover of chromosomes during recombination which, whenever it is asym-
metric, is mainly due to the configuration of the repetitive loci structure (Schlotterer
and Tautz 1992; Shriver et al. 1993). In comparison, repetitive DNA sequences are
more susceptible to show DNA polymerase enzyme dissociation than other
sequences across the genome (Kuhner et al. 2007). The nature of repetitive structure
allows increasing the probability of misaligning incidents to take place in the
detached strands of DNA during the hybridization process. This process will lead
to the production of secondary structures such as loop-, hairpin-, or triplex-shaped
DNA strands. Consequently, an additional repeat will be added or a repeat will be
skipped by the enzyme, depending on the reattachment position (Shriver et al. 1993;
Pearson and Sinden 1998). Such errors can be identified and repaired during the
DNA replication process using two pathways: first, by proofreading capability of
exonucleases which is involved in the nascent strand synthesis, and second, it can
also be achieved by the DNA mismatch repair system. Previously, it has been shown
by different studies that proofreading exonucleases process is inefficient in
identifying addition or loss of repeats; therefore, in STR region of DNA, there is
only mismatch system left to correct any error incidents (Schlotterer and Tautz
1992). The main reason behind deficiency of proofreading exonuclease in repetitive
DNA sequences is the existence of repeat dislocation of the mismatch by the 30
terminus in the replicated DNA strand and, therefore, cannot be identified (Kroutil
et al. 1996; Sia et al. 1997). DNA mismatch repair system involves a number of
proteins which are critical to start the repairing process of DNA. These proteins are
MutSα, MutLα, Exo1, RPA, PARP-1, PCNA, RFC, and DNA polymerase δ (Harfe
and Jinks-Robertson 2000). In the mismatch repairing processes, there are two
pathways, first pathway is a straightforward process directed by the break in 50
strand. The process starts with an activation of exonuclease protein (Exo1) with an
aid of MutSα and MutLα proteins. After that, RPA and PARP-1 proteins will attach
to both the broken and the stabilized DNA strands, respectively, through which the
PARP-1 will detect the broken strand. Next, the strand displacement process will
begin with the aid of RPA, PCNA RFC, and DNA polymerase δ (Harfe and Jinks-
Robertson 2000). The second pathway is complex since it starts the process of DNA
dislocation after endonuclease activation in which it skips the hydrolysis step of the
broken strand. During such mismatch repair pathway, the process can be started at
either 50 or 30 strand breaks (Harfe and Jinks-Robertson 2000; Li 2008). Due to the
fact that DNA mismatch repair system is too complicated as well as the fact of
having only this mechanism to fix such errors within repetitive regions of DNA
sequence, it is expected that this region of DNA sequence will experience a high rate
of mutations compared to other sequences. This also leads to the conclusion that any
defects that occur within DNA mismatch system will result in increasing the
mutation rate above normal (Tiraby and Fox 1973).
280 R. Alghafri
Previous studies have estimated the mutation rates of STR loci to be between
105 and 102 per loci per generation (Edwards et al. 1992; Weber and Wong 1993;
Brinkmann et al. 1998). Nowadays, STR loci which are mostly used in the commer-
cial kits for forensic DNA typing are having mutation rates between 1 103 and
6.4 103. These estimations were done by analyzing a large number of proven
family members of DNA samples (Short Tandem Repeats Internet Database
[Online] 2014). STR locus mutation rates are affected by different aspects, one
good example is the germline differences. Due to the high number of divisions
which sperm cells undergo compared to oocytes, it has been concluded that mutation
rates are usually higher in male germline compared to female germline (Weber and
Wong 1993; Brinkmann et al. 1998). Another aspect is the length of the repeat size in
simple STR loci, where studies have shown that dinucleotide and trinucleotide
repeat STR loci have higher mutation rates than tetranucleotide and pentanucleotides
repeat STR loci and eventually will present higher diversity in allele sizes (Kruglyak
et al. 1998; Sup Lee et al. 1999). On the other hand, in complex STR loci studies, it
was determined that the factor with the most impact on mutation rates is the longest
strand of homogeneous repeat number (Klintschar and Wiegand 2003), despite the
following studies which have determined that the total number of repeats found
within complex STR loci is more impactful on mutation rates compared to longest
strand of homogeneous repeat number (Ballantyne et al. 2010). Additionally, it has
also been realized that the mutation rate is increasing along with the increasing
number of repeats within the same STR locus, this correlation was concluded in a
study conducted using model organisms by utilizing publicly available data of
human and nonhuman STR locus mutation rates extracted from previous
publications. Notably, such correlation was also detected in nonhuman STR loci
(Seyfert et al. 2008).
Y-STRs were introduced to forensic practice in the mid-1990s. It has been ratified
for both forensic applications and kinship analysis (Kayser et al. 1997; Schneider
et al. 1998; Kayser 2017). The Europe core set of Y-STR loci known as minimum
haplotype consisted of seven loci as listed in Table 14.1 (Kayser et al. 1997). The
number of loci was further extended by the addition of two loci, namely DYS438
and DYS439 by the Scientific Working Group on DNA Analysis Methods
(SWGDAM). The minimal and the extended haplotype was attainable by using the
Y-Plex-5™ (DYS389I/II, DYS392, DYS438, DYS439) and Y-Plex 6™ (DYS19,
DYS390, DYS391, DYS393, DYS389II, DYS385) multiplex Y-STR kits (Pascali
et al. 1998).
282 R. Alghafri
Table 14.1 Currently available commercially and in-house available Y-STR assays
Minimal Powerplex PowerPlex Yfiler
haplotype Y® Yfiler® Y23® Plus® RM Y-STR
DYS19 DYS19 DYS19 DYS19 DYS19
DYS389I DYS389I DYS389I DYS389I DYS389I
DYS389II DYS389II DYS389II DYS389II DYS389II
DYS390 DYS390 DYS390 DYS390 DYS390
DYS391 DYS391 DYS391 DYS391 DYS391
DYS392 DYS392 DYS392 DYS392 DYS392
DYS393 DYS393 DYS393 DYS393 DYS393
DYS385ab DYS385ab DYS385ab DYS385ab DYS385ab
DYS437 DYS437 DYS437 DYS437
DYS438 DYS438 DYS438 DYS438
DYS439 DYS439 DYS439 DYS439
DYS448 DYS448 DYS448
DYS456 DYS456 DYS456
DYS458 DYS458 DYS458
DYS635 DYS635 DYS635
YGATAH4 YGATAH4 YGATAH4
DYS481 DYS481
DYS533 DY533
DYS549
DYS570 DYS570 DYS570
DYS576 DYS576 DYS576
DYS643
DYS460
DYS627 DYS627
DYS518 DYS518
DYS449 DYS449
DYF387S1 DYF387S1
DYF399S1
DYF403S1ab
DYF404S1
DYS612
DYS626
DYS526ab
DYS547
An extensive study conducted in the year 2004, with the purpose of identifying
novel Y-STR loci with the potentiality of forensic application, resulted in acquiring
166 novel Y-STR markers; totaling the markers to 219 (Kayser et al. 2004).
Subsequently, this led to the development of several commercial Y-STR multiplex
kits. The frequently used kits which have been approved for casework investigations
include: AmpF‘STR Yfiler® PCR Amplification Kit (Applied Biosystems™) and
the Powerplex Y® Kit (Promega™), which amplifies 17 Y-STR and 12 Y-STR loci,
14 Y Chromosome Short Tandem Repeats Typing 283
Although the Y-STR male specificity is certainly the utmost advantage in forensic
DNA typing, it has its own drawbacks. The low effective population size of Y
chromosomes means an increased susceptibility to genetic drift, inducing extreme
variation of allele frequencies as a result of such random events. Such events can
entirely eradicate a specific male lineage, lessening the population’s genetic diversity
(Charlesworth 2009).
According to previously conducted studies, Y-STRs have proven to be relatively
as discriminating as autosomal STRs. Nonetheless, the Y chromosomes lack recom-
bination, resulting in high number of shared haplotypes between male individuals.
Concurrently, it was justified that autosomal and Y chromosome STRs possess an
identical range of mutation rates (Roewer et al. 1992). Although presently utilized
Y-STRs are capable of distinguishing between various male lineages, they are yet
unable to resolve these lineages down to the individual level when determining
paternal relatives (Gusmaúo et al. 2003).
Consequently, the usage of the current Y-STR kits in forensic DNA profiling will
portray identical Y-STR haplotype in most of the cases of paternally related male
subjects (Mulero et al. 2006; Thompson et al. 2012; Kayser 2017). Additionally,
during extensive population substructure, identical haplotypes may also be found
among unrelated male entities from the same community, stemming as a result of
non-random mating in that subpopulation. Ultimately, this will cause haplotype
frequencies to differ from estimations depending on the sum of the population.
Generally, the contribution of few males in finding a subpopulation would lead to
some haplotypes to be more frequent in the subpopulation in contrast to the wider
population. Thereupon, highly sub-structured populations necessitate their own
database to achieve the true value of a match when individuals from such
populations are accused (Lewontin and Hartl 1991; Charlesworth 2009).
Since majority of the populations display differing levels of substructure, several
unrelated males may share identical Y-STR haplotypes (Gusmaúo et al. 2003;
Hedman et al. 2004). Hence, Y-STR evidential value is incredibly weak due to
loci linkage and sub-structuring in comparison to autosomal STR loci. The eviden-
tial value of a matching Y-STR haplotype is often articulated as haplotype fre-
quency. The Y-STR haplotype discrimination capacity (DC) can also depict the
evidential power of Y-STRs in the applicable male population. The approximation
of the number of unique haplotypes detected in the samples of the population is
284 R. Alghafri
known as discrimination capacity (Kayser et al. 1997). The current Y-STR multiplex
kits have been improved by increasing the number of loci amplified in order to raise
the evidential value with victory (Purps et al. 2014). Certainly, it is necessary to
further enhance the Y-STR system discrimination capacity toward male
individualization.
Providing the facts mentioned above pertaining to Y-STRs, it is coherent that there
are two methods to increase the Y-STR haplotype discrimination capacity. The first
method is to increase the number of loci examined in the analysis which will
sequentially increase the likelihood of observing loci with different alleles, therefore
aiding in the identification of male individuals. The differences in alleles, driven by
mutation events, will lead to segregating a lineage into two distinct haplotypes. This
approach was attempted prior to the release of Yfiler® amplification kit. A total of
20 novel single-copy Y-STR loci were analyzed by utilizing a single multiplex
reaction, on 74 US population male samples. This resulted in an increase in haplo-
type resolution in contrast to the six Y-STR loci available in Y-Plex™ 6 kit (Butler
et al. 2002). In addition, a comparative study was conducted which focused on
37 Y-STR loci, including 17 loci which are available in Yfiler® amplification kit. A
total of 656 US population male samples were studied. Three of the samples had
identical haplotypes which could be discriminated by the addition of a Y-STR locus:
DYS522 or DYS576. Out of the additional 20 Y-STR loci analyzed, only seven loci
showed a high level of differentiation which was equal to the whole set of the
20 Y-STR loci, which reflects the high resolution and discrimination imposed by
these markers (Decker et al. 2007).
Another study was conducted where the authors analyzed a total of 590 male
samples from 51 different populations globally, belonging to eight different regions.
Novel 49 simple single-copy Y-STRs analogous to the 17 known Y-STRs present in
the Yfiler® amplification kit were used. The results revealed that greater than 95% of
male individuals displayed unique haplotypes in comparison to the Yfiler® kit where
90% of male individuals showed unique haplotypes. The loci with the maximum
mutation rates, DYS570 and DYS576, immensely contributed in differentiating the
male individuals. Although the highest number of Y-STR loci was 67 in this study,
there was still 20 Y-STRs haplotypes shared across 47 male individuals, knowing
that these male individuals do not share close paternal biological relationship
(Vermeulen et al. 2009).
The second method in striving for improving the discrimination capacity of
Y-STRs is the usage of a panel comprising of Y-STR loci with higher mutation
rates than the loci that are commonly included in multiplexes such as Yfiler® or
Powerplex®. In the year 2004, a study was carried out to assess the suitability of
particular Y-STR loci for forensic applications. However, the mutation rates of these
loci were unidentified (Kayser et al. 2004). A following in-depth study was then
conducted focusing on 186 loci. The mutation rates of these loci were estimated in
14 Y Chromosome Short Tandem Repeats Typing 285
2000 father–son pairs from Poland and Germany (Ballantyne et al. 2010). The
results indicated that 13 loci had mutation rates of 1 102 and higher. While the
remaining Y-STR loci displayed a mutation rate of 1 103 and lower. This
included 12 tetranucleotide loci and 1 trinucleotide locus. Out of the 13 Y-STRs,
4 were multi-copy markers and 9 were single copy markers. Thence, a total of
21 alleles can generally be amplified by using these 13 RM Y-STR markers, termed
as rapidly mutating Y-STRs (RM Y-STRs) (Ballantyne et al. 2010) (Table 14.2).
Several studies conducted prior to the discovery of the 13 RM Y-STRs in 2010 had
already included one or more single-copy RM Y-STRs in an in-house developed
multiplex kits (Redd et al. 2002; Hanson and Ballantyne 2007a, b; Rodig et al. 2008;
D’Amato et al. 2009, 2010; Vermeulen et al. 2009; Hedman et al. 2011). However,
multi-copy loci comprising DYF387S1, DYF399S1, DYF403S1, and DYF404S1
have been examined comparatively lesser than the single-copy loci. This is
supposedly due to the complications involved in the genotyping and sequencing of
these loci. Multi-copy loci interpretations are usually complex for two of the
following reasons. First, the imbalance in the amplified peaks can alter genotyping
correctly. Second, when more than one male has contributed to the sample, mixture
of samples, imbalance of the peak height makes assigning specific alleles to
contributors troublesome. Therefore, the usage of multi-copy Y-STR loci have
been eluded in forensic DNA typing multiplex kits. Nonetheless, multi-copy
Y-STRs have high discrimination capacity since each copy has an independent
mutation probability, thence, increasing the mutation probability in accordance
with the number of copies present in the locus.
In the year 2012, Ballantyne et al. engaged three multiplex panels amplifying
13 RM Y-STRs to examine 604 unrelated male individuals from 51 different
population samples (HGDP-CEPH). Thirteen RM Y-STR displayed greater haplo-
type diversity (HD) and power of discrimination (PD) in comparison to the
17 Y-STRS in Yfiler® multiplex kit (Applied Biosystems) (Ballantyne et al.
2012). This set of loci was exceedingly beneficial in increasing the differentiation
between close and distant male relatives by 4.4-fold of average male relative
differentiation compared to the Yfiler® kit (Ballantyne et al. 2012).
Moreover, a comprehensive study conducted using 12,272 male individuals
representing main populations around the world showed that 99% of them were
fully discriminated using RM Y-STRs. In the substantial number of samples, the
haplotype diversity was found to be exceedingly high. Amidst 111 populations
globally, only six haplotypes were shared between populations within the same
geographical region (Ballantyne et al. 2014). Even though the significance of RM
Y-STRs has already been illustrated, two in-house developed multiplex kit which are
thus far not commercialized have the potential to multiplex all the 13 RM Y-STRs
(Alghafri et al. 2013, 2015; Zhang et al. 2017). These multiplexes were affirmed to
be beneficial in forensic casework studies accompanied with other human
Table 14.2 Details of the 13 RM Y-STRs
286
Allele ranges
Repeat Base Mutation
Locus Repeat type Repeat motif (variants in bold type) number pairs rate
DYF387S1 Tetra, (AAAG)3(GTAG)1(GAAG)4N16(GAAG)9 (AAAG)13 28–38 241–281 1.58 102
complex
DYF399S1 Tetra, (GAAA)3N7–8(GAAA)10–23 10–23 261–313 7.73 102
complex
DYF403S1a Tetra, (TTCT)10–17N2–3(TTCT)3–17 12–39 310–438 3.10 102
complex
DYF403S1b Tetra, (TTCT)12N2(TTCT)8(TTCC)9(TTCT)14N2(TTCT)3 40–59 414–490 1.18 102
complex
DYF404S1 Tetra, (TTTC)10–20N42(TTTC)3 10–20 171–211 1.24 102
complex
DYS449 Tetra, (TTTC)12–18N22(TTTC)3N12(TTTC)12–18 24–37 309–361 1.22 102
complex
DYS518 Tetra, (AAAG)3(GAAG)1(AAAG)14–22(GGAG)1(AAAG)4N6(AAAG)11–19 23–35 243–291 1.84 102
complex
DYS526a Tetra, (CCCT)3N20(CTTT)11–17(CCTT)6–10N113(CCTT)10–17 10–17 138–166 2.72 103
complex
DYS526b Tetra, (CCCT)3N20(CTTT)11–17(CCTT)6–10N113(CCTT)10–17 29–42 345–397 1.25 102
complex
DYS547 Tetra, (CCTT)9–13T 36–48 410–458 2.36 102
complex (CTTC)4–5N56(TTTC)10–22N10(CCTT)4(TCTC)1(TTTC)9–16N14(TTTC)3
DYS570 Tetra, simple (TTTC)14–24 10–21 246–286 1.24 102
DYS576 Tetra, simple (AAAG)13–22 13–23 170–210 1.43 102
R. Alghafri
14
Fig. 14.1 2800M positive control haplotype analyzed by RM-Yplex (Alghafri et al. 2015)
identification kits. Besides, this will also allow scrutinizing more populations for RM
Y-STRs rapidly and effortlessly. Despite the extremely high discrimination capacity
of these markers, a discovery of additional 27 new rapidly mutating loci was
announced in the 27th International Society of Forensic Genetics Congress, which
are expected to have a tremendous discrimination among close male relatives as well
as non-related male individuals (ISFG Meeting 2017, South Korea) (Figs. 14.1 and
14.2).
Fig. 14.2 9948 positive control haplotype analyzed by RM Y-STR assay (Zhang et al. 2017)
Table 14.3 Comparison between C-Type and E-Type genotyping interpretation methods
Haplotype 1 Haplotype 2
Electropherogram
counted twice. Such effect is mostly used in the autosomal STR interpretation where
heterozygote and homozygote terms are used.
290 R. Alghafri
There are two main methods for estimating the weight of the Y-STR haplotype
matches, those are counting method and likelihood ration with incorporating the
potential of the co-ancestry in the same population. The later approach was achieved
by different models which will be explained later in this chapter. The commonly
used method is the counting method which is estimation for the rarity of a haplotype.
In order to reflect the uncertainty in the point estimate which is provided by the
counting method, sampling correction factors such as upper and lower limits of
confidence have been used in this method. Three main steps should be followed in
order to estimate the rarity of a profile. First, Y-STR haplotype should be generated.
Second, searching the Y-STR haplotype against relevant database. Third, reporting
the rarity of the Y-STR haplotype using genetic and statistical methods. Because of
how difficult, costly, and the intensive labor work needed in analyzing all male
individuals in all populations, there should at least be a haplotype database devel-
oped for each population carefully in an attempt to represent as much as possible of
the male individual’s haplotypes presented in the population. Therefore, as per
recommendation of the International Society of Forensic Genetics (ISFG) (Gusmão
et al. 2017), at least 500 random samples from each population should be collected,
analyzed, and studied. The larger the number of the haplotypes studied in the
population, the more realistic estimation will be obtained in estimating the rarity
of a haplotype. As a solution for the rare haplotypes or those haplotypes which might
not be shown in the database, it is recommended to use a minimum frequency of
such haplotypes as per the equation:
3
Haplotype frequency ¼
N
where, N is the total number of haplotypes in the database (Butler 2013). It is very
important to choose the right wordings in reporting the result of a match between
reference haplotype and evidence haplotype. This is due to the fact that such match is
associated with paternal lineage instead of specific individual knowing that there are
other reference samples which most likely will be matching such evidence that are
coming from father, brothers, sons, and other close male relatives in addition to the
random match between non-relatives when some types of Y-STR are in use.
In 2001, the DNA commission of the ISFG has published general recommendations
regarding Y-STR analysis and interpretation (Gill et al. 2001) which then has been
updated and republished in 2006 (Gill et al. 2006). In addition, the Scientific
Working Group on DNA Analysis Methods (SWGDAM) has established an inter-
pretation guideline for Y-STR haplotypes in 2009 (SWGDAM 2009) aiming at the
standardization of the interpretation and analysis, which will help sharing of data
14 Y Chromosome Short Tandem Repeats Typing 291
Having these guidelines in place helped laboratories to produce the same results
which can be compared to any haplotypes generated from different forensic labora-
tory around the world. The agreement on using a specific set of Y-STRs and
continuously updating that set helped commercializing these sets and also made
companies focusing on enhancing these kits to be more robust, sensitive, and precise
for forensic and kinship applications. Because of analyzing the same set of Y-STRs,
following the recommended nomenclature, especially with the complex types of
Y-STRs, and also using single-source developed allelic ladder included in the kits,
the development of easily-accessible online Y-STR databases was achieved. There
are two main Y-STR haplotype databases: U.S. Y-STR Database and YHRD.org
databases. All haplotyped in the databases are anonymous and can be used to
estimate the frequency of specific haplotypes.
292 R. Alghafri
Unlike autosomal STR, Y-STR cannot be presented in courts following the power of
discrimination and weight of autosomal STRs by applying “product rule” for
probability determination because of the lack of recombination in amelogenin
chromosomes. Therefore, counting method as mentioned above is the best approach
to estimate the rarity of a specific Y-STR haplotype in a relevant database. This
simply can be obtained by dividing the number of times a haplotype has been
observed in the database divided by the total number of available haplotypes in
database. Therefore, the larger the number of haplotypes in the database of male
individuals, the better rarity estimation will be obtained.
In 2005, David Balding has published a simple method for estimating lineage
markers haplotype rarity in order to obtain a useful and conservative weight of
evidence according to the following equation:
xþ2
p¼
Nþ2
where p is determined by adding two observations, including evidence and suspect
to the haplotype count (x) resulted from a specific haplotype database enquiry and
also to the population database itself. For example, if an enquiry retained two counts
in YHRD minimal haplotype database, the result will be:
xþ2 2þ2 4
p¼ ¼ ¼ ¼ 0:002%
N þ 2 197, 102 þ 2 197, 104
and this is more conservative than straight counting method which will be 0.001%.
Xx
N k
p0 ð1 p0 ÞNk ¼ 0:05
k¼0
k
Estimating the frequency of haplotype following the simple counting method which
depends on the total number of the population samples does not take into account
population substructure effect which will eventually affect the result. Therefore, an
equation for the match probability (ṕ) was derived from Balding–Nichols DNA
profile match probability theory which takes into account population substructure as
follows:
p ¼ θ þ pð 1 θ Þ
an appropriate and relevant (θ) value might be challenging especially in the partial
Y-STR haplotypes. The more loci are used in the haplotype in question, the less (θ)
value will be and vice-versa. Consequently, in partial profile with less loci, the
number of shared haplotypes within and among population will increase, and
eventually, (θ) value will increase and at some point, such correction will not
cover the upper limit of the count proportion and as a results (θ) correction might
not be truly powerful in practical basis (Budowle et al. 2009).
Taking into account the continuous increasing in the number of loci involved in the
newly developed kits as well as the use of highly discriminating loci such as RM-Y-
STR, it will be more often that no match is resulting when Y-STR haplotype is
searched in the database. Therefore, in order to effectively assign weight to a rare
haplotype, Charles Brenner has recommended an approach called “kapa model”
which helps predicting the rarity of the future haplotypes which might be observed.
It takes into account a fraction of singletons, once observed haplotypes, in the
database. Since it has been shown previously that almost 95% of the haplotypes
available in the YHRD database are singletons for 17 loci available in the Yfiler® kit,
it means 95% of the time that a new Yfiler® haplotype will show no match in the
database (Butler 2013). The likelihood ratio is estimated by “Kappa Model” by using
the following equation:
N
LR ¼
1k
where (N ) is the number of samples in the database, and kappa (k) is the fraction of
the singletons in the database. Taking into account the fraction of singletons above
for the Yfiler® haplotypes in the YHRD which was found to be 95%, and therefore,
the likelihood ratio will be estimated as follows:
N N N
LR ¼ ¼ ¼ ¼ 20 N
1 k 1 0:95 0:05
Therefore, the likelihood ratio is 20 times stronger for rare 17 loci haplotypes
which exaggerate the value of haplotype as evidence in the forensic applications.
This approach has also been endorsed by another research study in Denmark
(Andersen et al. 2013). Moreover, it has been implemented in YHRD online
Y-STR database, as an option, in addition to other methods for estimating the rarity
of Y-STR haplotypes. When such approach will be applied for RM Y-STR database
the likelihood ratio is expected to be much greater since it has been shown that these
markers can differentiate males by up to 99% (Ballantyne et al. 2014). So, it will
exaggerate the likelihood ratio by 100 times.
296 R. Alghafri
One of the major advantages that Y-STR typing has in forensic DNA typing is the
easiness of mixture interpretations. This is because only one allele per contributor is
expected at each single-allelic locus. Therefore, it is easy to predict the number of
male contributor to a biological stain. Such feature is considered very helpful
especially in sexual assault cases where there is more than one preparator. Whereas
multi-allelic loci are very complicated in mixture analysis especially those which has
more than two alleles per locus, in spite of such loci might be helpful in
differentiating close male relatives when there is only one contributor to the
biological stain.
14.5 Summary
Y-STR typing is a useful tool for different application including genetic genealogy
and forensic DNA typing. The researches of Y-STR haplotypes are growing rapidly
aiding better understanding of population substructures and also enriching the
database such as U.S. Y-STR and YHRD which will help obtaining better estimation
of haplotype frequency using the approaches discussed earlier in this chapter. It will
also help predicting biogeographical ancestry and even surnames with certain set of
loci. Commercially available kits for Y-STR typing are improving continuously to
increase the discriminating capacity of males especially close relatives. A lot of
promising efforts by different researchers around the globe help increasing the value
of Y-STR haplotypes in forensic cases to aid justice.
References
Alghafri R (2015) An evaluation of rapidly mutating Y-STR multi-allelic markers. Forensic Sci Int
Genet Suppl Ser 5:e647–e649
Alghafri R, Goodwin W, Hadi S (2013) Rapidly mutating Y-STRs multiplex genotyping panel to
investigate UAE population. Forensic Sci Int Genet Suppl Ser 4(1):e200–e201
Alghafri R, Goodwin W, Ralf A, Kayser M, Hadi S (2015) A novel multiplex assay for simulta-
neously analyzing 13 rapidly mutating Y-STRs. Forensic Sci Int Genet 17:91–98
Andersen MM et al (2013) Estimating Y-STR allelic drop-out rates and adjusting for interlocus
balances. Forensic Sci Int Genet 7:327–336
Ballantyne KN et al (2010) Mutability of Y-chromosomal microsatellites: rates, characteristics,
molecular bases, and forensic implications. Am J Hum Genet 87:341–353
Ballantyne KN et al (2012) A new future of forensic Y-chromosome analysis: rapidly mutating
Y-STRs for differentiating male relatives and paternal lineages. Forensic Sci Int Genet
6:208–218
Ballantyne KN et al (2014) Toward male individualization with rapidly mutating Y-chromosomal
short tandem repeats. Hum Mutat 35:1021–1032
Brenner CH (2013) Understanding Y haplotype evidence—(forget what you know from autoso-
mal). Presentation at ISFG 2013 meeting. http://isfg2013org/wp-content/uploads/2012/06/
Understanding-Y-haplotype-evidence-for-ISFG-sitepdf. Accessed 4 Apr 2017
14 Y Chromosome Short Tandem Repeats Typing 297
Hedman M et al (2004) Analysis of 16 Y STR loci in the Finnish population reveals a local
reduction in the diversity of male lineages. Forensic Sci Int 142:37–43
Hedman M, Neuvonen AM, Sajantila A, Palo JU (2011) Dissecting the Finnish male uniformity:
the value of additional Y-STR loci. Forensic Sci Int Genet 5:199–201
Holland MM, Parsons TJ (1999) Mitochondrial DNA sequence analysis—validation and use for
forensic casework. Forensic Sci Rev 11:21–50
Jobling MA, Tyler-Smith C (2003) The human Y chromosome: an evolutionary marker comes of
age. Nat Rev Genet 4:598–612
Jobling MA, Pandya A, Tyler-Smith C (1997) The Y chromosome in forensic analysis and paternity
testing. Int J Legal Med 110:118–124
Kayser M (2017) Forensic use of Y chromosome DNA: a general overview. Hum Genet
136:621–635
Kayser M, Sajantila A (2001) Mutations at Y-STR loci: implications for paternity testing and
forensic analysis. Forensic Sci Int 118:116–121
Kayser M et al (1997) Evaluation of Y-chromosomal STRs: a multicenter study. Int J Legal Med
110:125
Kayser M et al (2003) Y chromosome STR haplotypes and the genetic structure of U.S. populations
of African, European, and Hispanic ancestry. Genome Res 13:624–634
Kayser M et al (2004) A comprehensive survey of human Y-chromosomal microsatellites. Am J
Hum Genet 74:1183–1197
Kayser M et al (2005) Significant genetic differentiation between Poland and Germany follows
present-day political borders, as revealed by Y-chromosome analysis. Hum Genet 117:428–443
Klintschar M, Wiegand P (2003) Polymerase slippage in relation to the uniformity of tetrameric
repeat stretches. Forensic Sci Int 135:163–166
Kroutil LC et al (1996) Exonucleolytic proofreading during replication of repetitive DNA. Bio-
chemistry 35:1046–1053
Kruglyak S et al (1998) Equilibrium distributions of microsatellite repeat length resulting from a
balance between slippage events and point mutations. Proc Nat Acad Sci U S
A. 95:10774–10778
Kuhner F et al (2007) Force-induced DNA slippage. Biophys J 92:2491–2497
Lewontin RC, Hartl DL (1991) Population genetics in forensic DNA typing. Science
254:1745–1750
Li G-M (2008) Mechanisms and functions of DNA mismatch repair. Cell Res 18:85–98
Mulero JJ et al (2006) Development and validation of the AmpFLSTR Yfiler(R) PCR amplification
kit: a male specific, single amplification 17 Y-STR multiplex system*. J Forensic Sci 51:64–75
Oota H et al (2001) Human mtDNA and Y-chromosome variation is correlated with matrilocal
versus patrilocal residence. Nat Genet 29:20–21
Pascali VL, Dobosz M, Brinkmann B (1998) Coordinating Y-chromosomal STR research for the
courts. Int J Legal Med 112:1–1
Pearson CE, Sinden RR (1998) Trinucleotide repeat DNA structures: dynamic mutations from
dynamic DNA. Curr Opin Struct Biol 8:321–330
Poznik GD et al (2013) Sequencing Y chromosomes resolves discrepancy in time to common
ancestor of males versus females. Science 341:562–565
Purps J et al (2014) A global analysis of Y-chromosomal haplotype diversity for 23 STR loci.
Forensic Sci Int Genet 12:12–23
Quintana-Murci L, Fellous M (2001) The human Y chromosome: the biological role of a "func-
tional wasteland". J Biomed Biotechnol 2001:18–24
Quintana-Murci L, Krausz C, McElreavey K (2001) The human Y chromosome: function, evolu-
tion and disease. Forensic Sci Int 118:169–181
Redd AJ et al (2002) Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci
Int 130:97–111
Rodig H et al (2008) Evaluation of haplotype discrimination capacity of 35 Y-chromosomal short
tandem repeat loci. Forensic Sci Int 174:182–188
14 Y Chromosome Short Tandem Repeats Typing 299
Roewer L et al (1992) Simple repeat sequences on the human Y chromosome are equally
polymorphic as their autosomal counterparts. Hum Genet 89:389–394
Roewer L et al (2005) Signature of recent historical events in the European Y-chromosomal STR
haplotype distribution. Hum Genet 116:279–291
Schlotterer C, Tautz D (1992) Slippage synthesis of simple sequence DNA. Nucleic Acids Res
20:211–215
Schneider PM et al (1998) Tandem repeat structure of the duplicated Y-chromosomal STR locus
DYS385 and frequency studies in the German and three Asian populations. Forensic Sci Int
97:61–70
Seyfert AL et al (2008) The rate and spectrum of microsatellite mutation in Caenorhabditis elegans
and Daphnia pulex. Genetics 178:2113–2121
Shi W et al (2010) A worldwide survey of human male demographic history based on Y-SNP and
Y-STR data from the HGDP-CEPH populations. Mol Biol Evol 27:385–393
Short Tandem Repeats Internet Database [Online] (2014). http://www.cstl.nist.gov/strbase/muta
tion.htm. Accessed 7 Apr 2017
Shriver MD et al (1993) VNTR allele frequency distributions under the stepwise mutation model: a
computer simulation approach. Genetics 134:983–993
Sia EA, Jinks-Robertson S, Petes TD (1997) Genetic control of microsatellite stability. Mutat Res
DNA Repair 383:61–70
Sibille I et al (2002) Y-STR DNA amplification as biological evidence in sexually assaulted female
victims with no cytological detection of spermatozoa. Forensic Sci Int 125:212–216
Stumpf MPH, Goldstein DB (2001) Genealogical and evolutionary inference with the human Y
chromosome. Science 291:1738–1742
Sup Lee J et al (1999) Relative stabilities of dinucleotide and tetranucleotide repeats in cultured
mammalian cells. Hum Mol Genet 8:2567–2572
SWGDAM (2009) Y-STR interpretation guidelines. Forensic Sci Commun 11
Thompson R, Zoppis S, McCord B (2012) An overview of DNA typing methods for human
identification: past, present, and future. Humana Press, Totowa, NJ
Thompson JM et al (2013) Developmental validation of the PowerPlex- Y23 system: a single
multiplex Y-STR analysis system for casework and database samples. Forensic Sci Int Genet
7:240–250
Tiraby JG, Fox MS (1973) Marker discrimination in transformation and mutation of pneumococ-
cus. Proc Nat Acad Sci U S A 70(12):3541–3545
Tully G et al (2001) Consiideration by the European DNA profiling (EDNAP) group on the working
practices, nomenclature and interpretation of mitochondrial DNA profiles. Forensic Sci Int
124:83–91
Underhill PA et al (2000) Y chromosome sequence variation and the history of human populations.
Nat Genet 26:358–361
Van Oven M et al (2014) Seeing the wood for the trees: a minimal reference phylogeny for the
human Y chromosome. Hum Mutat 35:187–191
Vermeulen M et al (2009) Improving global and regional resolution of male lineage differentiation
by simple single-copy Y-chromosomal short tandem repeat polymorphisms. Forensic Sci Int
Genet 3:205–213
Vuichard S et al (2011) Differential DNA extraction of challenging simulated sexual-assault
samples: a Swiss collaborative study. Investig Genet 2:11
Weber JL, Wong C (1993) Mutation of human short tandem repeats. Hum Mol Genet 8:1123–1128
Willott GM, Allard JE (1982) Spermatozoa—their persistence after sexual intercourse. Forensic Sci
Int 19:135–154
300 R. Alghafri
Abstract
The chapter describes potential and utility of X-STRs in forensic DNA analysis.
The presently available X-STR multiplex systems, details of known X-STR
markers, analysis of X-STR data, and its utility in forensic DNA analysis are
also detailed. Besides the analysis of X-STR analysis using capillary electropho-
resis system, the chapter also describes possibility of X-STR analysis using the
next-generation sequencing.
Keywords
X STR · Forensic DNA analysis · Lineage markers · X chromosome
The DNA profiling or DNA fingerprinting was discovered by Sir Alec Jeffreys in
1985, while conducting an experiment Jeffreys discovered that few regions of DNA
contained repetitive sequences and the repetitions were in a tandem (one after the
other) fashion. The number of repetitions of these sequences was different in
different individuals.
These repeated DNA sequences in human genome are present in various sizes.
The repeated sequences are labeled by the length of their repeat unit and the number
of continuous repeat units (Ellegren 2004). Longer repeat units usually have
S. Kakkar
Department of Forensic Medicine, Post Graduate Institute of Medical Education and Research
(PGIMER), Chandigarh, India
R. K. Kumawat
DNA Division, State Forensic Science Laboratory, Jaipur, Rajasthan, India
P. Shrivastava (*)
DNA Fingerprinting Unit, State Forensic Science Laboratory, Department of Home (Police),
Government of Madhya Pradesh, Sagar, Madhya Pradesh, India
Fig. 15.1 DNA site cut by a restriction enzyme at the sticky ends
Fig. 15.2 Different length fragments produced by restriction enzymes in different individuals
100–1000 bases in one core repeat. The technique used to analyze these long repeats
was known as restriction fragment length polymorphism (RFLP). The technique
consisted of cutting the DNA at palindromic sequences (sticky ends) by specific
restriction enzymes and created fragments of different lengths in different
individuals. This formed the basis of individual identification (Figs. 15.1 and 15.2).
Drawback of RFLP analysis: The RFLP analysis required very good quality DNA
as the repeat size was 100–1000 bp long. But in forensic getting a good quality
evidentiary sample is not always feasible as the crime samples undergo the exposure
to harsh environmental conditions and sometimes are degraded and putrefied. So
after RFLPs, variable number tandem repeats (VNTRs), also known as mini-
satellites came into the light. In VNTRs, repeat sequence range is from 10 to
100 bp and these are repeated 5–50 times and the number of repeat varies in each
and every individual (Fig. 15.3).
DNA fragments with repeat units containing 2–10 bp in length are known as short
tandem repeats (STRs). STRs are also known as microsatellite markers. More than
15 X-STRs: Potentials and Applications 303
Fig. 15.3 VNTRs, variable number of repeats placed in a tandem fashion varying individual to
individual
90% of these markers are found in the Junk DNA, i.e., noncoding DNA, only 8–10%
are located in the coding regions (Ellegren 2000; Fan and Chu 2007). STRs are
spread in the entire genome and form nearly 3% of the total human genome (Lander
et al. 2001). Their distribution, however, is not consistent, they are observed less
commonly in subtelomeric portions of DNA (Koreth et al. 1996). Chromosome
19 has the maximum density of STR (Subramanian et al. 2003). After every 2000 bp,
on an average one STR occurs. The alleles in STR regions typically range from 50 to
300 bp. In forensic practice, the STR markers that are most commonly used consist
of tetranucleotide repeats, i.e., each repeat motif contains 4 bp. The repeats are
placed in a tandem fashion. Most common STR markers used for human identifica-
tion are rich in adenine (A) (Nadir et al. 1996). STR segments do not code for any
proteins or phenotypic characters as they lie in the junk region of DNA. The
nomenclature of STRs is as, e.g., D2S1338, where D represents DNA, 2 represents
the location of STR, i.e., chromosome number 2, S stands for single copy sequence,
and 1338 is the unique identity number assigned to the STR. All the chromosomes
including 22 autosomal pairs, X and Y sex chromosomes have STR regions.
In autosomal STR markers inheritance, a person receives one allele from father
(paternal) and one from the mother (maternal). For every locus, individual with both
the alleles same from mother and father is homozygous and heterozygous in case of
different alleles from mother and father. While in case of X STRs inheritance
daughter receives one of her two X alleles from the father (paternal) and the other
one from the mother (maternal), on the other side since the son has one X chromo-
some, he receives only one allele (on all the X STR loci) from the maternal side only.
And in case of Y-STR inheritance, son receives Y chromosome from the father as a
haplotype so all the alleles from father to son are inherited as it is.
Status of STR analysis so far: Two types of STR analysis have been used so far to
resolve the paternity cases: Autosomal STRs and Y-STR (El-Alfy and El-Hafez
2012; Hill et al. 2009; Jobling et al. 1997; Kayser and Sajantila 2001). The autoso-
mal STR analysis is the most common practice in forensic laboratories, which is
done on the markers present on the autosomal chromosomes. Nowadays, various
autosomal STR kits are commercially available such as AmpFISTR® Identifiler®
Plus, GlobalFilerTM, VeriFilerTM Plus (Thermo Fisher Scientific), PowerPlex® 21,
PowerPlex® Fusion 5C and PowerPlex® Fusion 6C (Promega), and Qiagen Investi-
gator 24 Plex (Qiagen) and are being used in forensic DNA testing. These autosomal
STR kits simultaneously co-amplify the various STR markers. For example
304 S. Kakkar et al.
the AmpFlSTR® Identifiler® Plus PCR Amplification Kit is a multiplex system that
amplifies autosomal15 STR loci (tetranucleotide) in a single reaction and also one
gender-informing marker, Amelogenin.
• Along with D2S1338 and D19S433, all the 13 loci of Combined DNA Index
System (CODIS) loci are amplified by this kit.
• These 15 loci are accepted worldwide for forensic use.
The need for new markers: The prerequisite of autosomal STR analysis was
requirement of both the parents to set the identity of an individual as every individual
gets one copy from father and one from mother. Moreover, the mutation rate is high
in autosomal chromosomes (Kayser and Sajantila 2001). Same was the problem with
Y-STR analysis as it could tell only the paternal inheritance because the son gets Y
chromosome from father and daughter has no Y chromosome. For maternal inheri-
tance, mitochondrial DNA analysis was done, as the mitochondrial DNA from
mother only passes to the child (girl and boy both) and mitochondrial DNA from
the father which is present in the tail of the sperm gets digested at the time of
fertilization (Gyllensten et al. 1985; Schwartz and Vissing 2002). Mitochondrial
DNA analysis could only be used for the study of maternal inheritance because an
individual doesn’t get mitochondrial genes from father as the mitochondria are
present in sperm tail and tail of the sperm is vanished at the time of fertilization.
Moreover, mitochondrial DNA analysis requires strict standardization protocols and
the analysis is time-consuming too (Parson et al. 1998). So, in this scenario, a
particular set of markers was needed which could be capable of kinship analysis in
difficult situations like deficiency paternity and sibship and half sibship analysis.
The X chromosome is 150 million base pair (Mb) in humans, with a low gene
density. The X chromosome is physically the most stable amongst all other nuclear
chromosomes and this is the only chromosome which still retains syntenic loci
between mouse and human (Waterston et al. 2002). According to Lyon’s hypothesis,
individuals with more than one copy of X chromosome have only one X active per
cell. This is why Chromosome X monosomies, trisomies, and polysomies are
compatible with life (Lyon 1961).
The population genetics studies of X chromosome were started after the DNA
sequencing technology came into limelight and first detailed sequence of X chromo-
some was revealed in 1997 and 1998 (Schaffner 2004; Ziȩtkiewicz et al. 1997,
1998). The first phylogenetic tree of X chromosome appeared in 1999 (Jaruzelska
et al. 1999; Kaessmann et al. 1999), whereas the first phylogenetic tree of mitochon-
drial DNA was published in 1987 (Cann et al. 1987) and that of Y was published in
1989 (Lucotte et al. 1989). X and Y both the sex chromosomes were originated from
a single autosome around 300 million years ago (Lahn and Page 1999). The use of X
chromosomal STRs is being explored in various forensic caseworks. The X-STRs
15 X-STRs: Potentials and Applications 305
are supposed to offer additional information in various kinship cases than provided
by the autosomal STRs. Any kinship situation under investigation where at least one
female is involved is better studied by X-STRs, which can further be applied to cases
of incest, missing person identification, immigration disputes, deficiency paternity,
or other questioned kinship (Tables 15.1, 15.2, 15.3 and 15.4; Figs. 15.4, 15.5, 15.6
and 15.7). Genetic data of the most common used 12 X-STR linked markers of the
Investigator® Argus X-12 kit/Investigator® Argus X-12 kit with quality sensor have
been published in the handbook the abovementioned kit as follows:
Other X-STR markers explored so far: Nakamura et al. (2013) studied 18 X-STR
markers in Japanese population and designed a multiplex PCR for the markers
(Nakamura et al. 2013). To these 18 X-STR markers, Fukuta et al. (2018) added
nine more markers which may exist in linkage disequilibrium and method for the
calculation of likelihood ratios in kinship test using all the 27 markers (18 + 9) was
designed (Fukuta et al. 2018).
List of all the X-STR markers explored so far:
Table 15.2 Localization and other genetic information of 12 X-STR markers of Investigator®
Argus X-12 kit on X chromosome
GenBank®
Accession Ref. Allele
Locus number Repeat motif of the reference allele allele range
Amelogenin M55418 – – –
X
Amelogenin M55419 – – –
Y
DXS7132 G08111 [TCTA]13 13 8–20
DXS7423 AC109994 [TCCA]3 TCTGTCCT [TCCA]12 15 8–19
DXS8378 G08098 [CTAT]12 12 7–15
DXS10074 AL356358 [AAGA]14 14 4–21
DXS10079 AL049564 [AGAG]3 TGAAAGAG [AGAA]17 21 14–25
AGAG [AGAA]3
DXS10101 AC004383 [AAAG]3 GAAAGAAG [GAAA]3 A 28.2 24–38
[GAAA]4 AAGA [AAAG]5
AAAAAGAA [AAAG]13 AA
DXS10103 BV680555 [TAGA]2 CTGA [CAGA][TAGA]11 19 15–21
[CAGA]4[TAGA]
DXS10134 AL034384 [GAAA]3 GAGA [GAAA]4 AA [GAAA] 35 28–46.1
GAGA [GAAA]4 GAGA [GACAGA]3
[GAAA] GTAA [GAAA] 3 AAA
[GAAA]4 AAA [GAAA]15
DXS10135 AC003684 [AAGA] 3 GAAAG [GAAA]20 23 13–39.2
DXS10146 AL034384 [TTCC]3 [TTCC]3 TTCC CTCCCTTCC 26 24–46.2
[TTCC] [TCCC] TTCTTCTTTC
[TTCC]2 TTTCTT [CTTT]2 CTTC
[CTTT]2 T[CTTT]2
DXS10148 AC003684 [GGAA]4[AAGA]12[AAAG]4 N8 22 13.3–38.1
[AAGG]2
HPRTB M26434 [AGAT]12a 12 6–19
Source: Handbook, Investigator Argus, X-12, Qiagen, Germany
a
[AGAT] is the most common repeat structure; for variations, see NIST and reference 3
Table 15.3 Allelic ladder fragments used in Investigator® Argus X-12 kit
Dye
Locus label Repeat numbers of allelic ladder
Amelogenin 6- X, Y
FAM
DXS10103 6- 15, 16, 17, 18, 19, 20, 21
FAM
DXS8378 6- 9, 10, 11, 12, 13, 14, 15
FAM
DXS7132 6- 10, 11, 12, 13, 14, 15, 16, 17
FAM
DXS10134 6- 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 38.3, 39.3, 40.3, 41.3, 42.3,
FAM 43.3, 44.3
DXS10074 BTG 4, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 16.2, 17, 18, 19, 20, 21
DXS10101 BTG 24, 24.2, 25, 25.2, 26, 26.2, 27, 27.2, 28, 29, 29.2, 30, 30.2, 31, 31.2,
32, 33, 33.2, 34, 34.2, 35
DXS10135 BTG 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37.2, 39.2
DXS7423 BTY 13, 14, 15, 16, 17, 18
DXS10146 BTY 24, 25, 26, 27, 28, 29, 30, 31, 32, 32.2, 33, 33.2, 34, 34.2, 35.2, 39.2,
40.2, 41.2, 42.2, 43.2, 44.2, 45.2, 46.2
DXS10079 BTY 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 25
HPRTB BTR 9, 10, 11, 12, 13, 14, 15, 16, 17
DXS10148 BTR 13.3, 18, 19, 20, 21, 22.1, 23.1, 24.1, 25.1, 26.1, 27.1, 28.1, 29.1, 30.1,
31, 38.1
Source: Handbook, Investigator Argus, X-12, Qiagen, Germany
According to the 1991 report of the International Society for Forensic Genetics
(ISFG) before using DNA polymorphism for paternity testing, mutation rates must
be known so that mismatches can be attributed to mutation events (“1991 report
concerning recommendations of the DNA Commission of the International Society
for Forensic Haemogenetics relating to the use of DNA polymorphisms” 1992).
308 S. Kakkar et al.
Fig. 15.4 Chromosome X ideogram, positioning of X-STR markers used in forensic casework.
The order and positioning of the markers are based on the work published by Marshfield, NCBI.
Rest of the information regarding the linkage group and genetic distances were taken from www.
chrx-str.org
Fig. 15.5 DNA size standard, BTO 550 electropherogram showing fragments length in basepair
15 X-STRs: Potentials and Applications 309
Fig. 15.6 Electropherogram of allelic ladder of Investigator® Argus X-12 kit (with quality sensor)
310 S. Kakkar et al.
mutation rate for maternal transfer was found to be 4.22 104 and for paternal
transfer, it was 1.74 103 it has been reported in many studies that the paternal
mutations are more frequent for both autosomal (Dauber et al. 2012; Fan and Chu
2007; Weber and Wong 1993) and X STRs (Tomas et al. 2012). Higher paternal
mutation rates corroborate the idea that the mechanism of STR mutation may be
independent of recombination phenomena (Ellegren 2004; Kayser et al. 2000).
Recombination in males tends to be higher near the telomere, whereas in females
it is higher near the centromere. The measured recombination rate of X chromosome
is two-third of the genome average (Kong et al. 2002). The linkage disequilibrium is
expected to be greater on X chromosome. Haplotype studies have a vital role in the
determination of the phylogeny of a region. Since there is a single copy of X
chromosome in males, it is easier to study the haplotype. Whereas haplotype studies
cannot be performed on autosomal data. Y and mt DNA can also be used for
haplotype studies for paternal and maternal inheritance, respectively. Since
autosomes and X chromosome take part in recombination at every generation, this
feature makes them a good pick for historical studies as different regions will show
different histories. But recombination renders problematic phylogenetic studies, so
while studying X-based phylogenies, the doer must be restricted to the areas with
high linkage disequilibrium.
The mutation rates and other population genetic parameters of various forensic
STR markers have been reported and research suggests that smaller population of the
X chromosome makes it more prone to genetic drift than autosomes, which makes
the populations differ more in their X chromosomes than in autosomes (Table 15.5).
X-STR markers have not been studied extensively in forensic casework so far.
Unlike autosomal chromosomes, all the X STR markers are present on the same
chromosome in linkage groups. Since the markers are linked, they are inherited in
the same pattern as that of the parents. The markers located on X chromosome have a
particular inheritance pattern: since women are dizygous and men are hemizygous,
haplotype studies can be better performed with X-STR. And due to hemizygous
nature of X chromosome in males, the propensity of any random person sharing the
same allele in a population is reduced. Male individuals inherit their X-chromosome
from their mother, while female individuals receive one X from mother and another
from father (as a haplotype), so female individuals fathered by same man share the
same paternal X chromosome. The unique inheritance pattern and linkage between
the X-STR markers make them a better choice for kinship analysis.
of the fetus and the mother. The aborted fetus also consists of fetal organs, maternal
blood, and other tissues. Efficient paternity testing of these materials can be done by
Y-STR analysis in case of a male fetus. But when the fetus is female, autosomal and
X-STR are used and among them X-STR was found to be more efficient. While in
the case of incest X-STR has a limitation as all the alleles of the aborted fetus will be
the same as that of the daughter abused by the father. So no conclusive proof of
paternity can be presented. It has been reported that X STR markers may help to
expose a female profile in male background, such as vaginal cells on a penis or
female cells from male fingernail scrapings (Szibor 2007). To identify female traces
in male contamination X-STR markers are more efficient than autosomal markers
because the merging of female alleles with male alleles will only happen if the
female is homozygous at all loci (Szibor et al. 2003). Cases of a gang rape where
brothers or paternal cousins are involved cannot be solved by Y-STR as all the
brothers and paternal cousins share the same Y-haplotype, which makes it difficult to
discern whether the case was of gang rape or not. In such doubtable situation, X-STR
can solve the purpose as the offenders will be having a different X STR profile since
the X chromosome is inherited from the mother to the son.
Mixed DNA profiles may be obtained in forensic casework which makes the
individualization a difficult task. In a male–female mixture, autosomal STRs can
detect the sex of the contributors when both of the contributors are of the same
gender or the male contributor is the minor in the mixture (Budowle et al. 2009).
Mixed profiles are usually obtained in cases like mass disasters and in sexual assault,
where the sample from the victim is mixed with that of the accused. Various methods
have been described earlier to cope with such situations of mixed profile analysis
(Buckleton et al. 2016). A multiplex system, MIXplex, consisting of sex chromo-
some X and Y markers have been reported to aid in mixture interpretation in cases of
sexual assaults and is even helpful in deciphering the number of contributors
(Diegoli et al. 2013) But the mixture analysis methods given so far can resolve the
mixture of unrelated individuals where the linkage is not taken into consideration.
Mixed profiles of relatives have been reported to be resolved by some scientists
(Fung and Hu 2004, 2008; Hu and Fung 2005). Dørum et al. (2016) have worked on
the calculation of the likelihood ratios for mixed profiles involving close relatives
(Dørum et al. 2016). Also, the MIXplex can clarify situations where the male allele is
not amplified at the amelogenin locus due to a deletion on the Y chromosome
without Y chromosome typing (Kashyap et al. 2006; Steinlechner et al. 2002).
314 S. Kakkar et al.
As the mutation rates in autosomes are higher, the propensity of false-positive results
increases, but it has been reported that false-positive results can be reduced by
studying extra loci to confirm the kinship. The problem with studying extra loci is
that the rate of mutation also tends to be 1.6 times more (Tamura et al. 2015). Chen
et al. (2009) reported that X-STR analysis is helpful in confirming mutations in
parentage casework analysis. Any mismatch seen in the routine parentage, analysis
by autosomal STRs can be confirmed by X-STR analysis (Chen et al. 2009). Better
likelihood ratios (LRs) have been reported by the use of X chromosomal markers in
paternity cases (Szibor et al. 2005a, b). Bayesian networks (BNs) describe rules for
the inheritance of alleles in various blood relationships. These rules can include
inheritance of various markers like autosomal, X chromosomal, mitochondrial, and
Y chromosomal. BN is a graphical tool that can represent independent and probabi-
listic variables. BNs have been designed to derive LRs for half-sisters/half-sisters
and mother/daughter/paternal grandmother relationships. These networks are
validated against known formulae and are useful in other pedigree-related studies
as well. These networks are applicable to motherless cases also (Hatsch et al. 2007).
Loci DXS10079-DXS10074-DXS10075 and DXS6801-DXS6809-DXS6789 at X
chromosome have been reported to provide stable haplotype blocks that can help to
solve complex kinship cases (Castaneda et al. 2012). The usefulness of X-STRs has
also been reported in deficiency paternity cases (Aquino et al. 2009). Increased
Paternity Index (PI) and more reliable results have been reported in cases of
deficiency paternity with the use of X-STRs rather than autosomal STRs
(Trindade-Filho et al. 2013). In case of deficiency paternity, the mother of the
putative father (Grandmother) can be used to establish the identity of the grandchild
(Szibor et al. 2003). Genotypes of Chromosome X markers of the grandmother can
also be reconstructed. If the grandmother has several daughters, the paternal origin of
the most of the X alleles can be determined and so the X Chr genotype of the
grandmother can be deciphered. If the brothers of the alleged father are present the
data become even more informative, if the brothers carry different alleles it
represents the grandmother is heterozygous on the contrary same alleles in brothers
represent that the grandmother is homozygous (Szibor et al. 2003).
X-STR markers are advantageous in deficiency cases where samples from the
paternal relatives are available for matching. Even in cases when none of the parents
is present X STR can be of great importance, like in the case of two sisters or half-
sisters. Though the proof of paternity in this case is less reliable as the sisters usually
inherit partially matching haplotypes from the mother. Tillmar et al. (2011) used
three different models to check the utility of X-STR markers in various sorts of
relationship testing and found that if the mother is available, pedigrees like two
maternal half-sisters or two females with common father can be better identified by
the use of X-STRs and better likelihood ratios can be achieved (Tillmar et al. 2011).
Investigator® Argus X-12 kit by Qiagen has been reported to be useful for sibship
analysis as its likelihood ratios (LRs) were found to be relatively similar to the LRs
15 X-STRs: Potentials and Applications 315
of autosomal STRs (Zidkova et al. 2014). Autosomal STR-based studies have been
conducted on calculation likelihood ratios in sibship analysis (Musanovic et al.
2012; Tzeng et al. 2000; Wenk et al. 1996). But no studies pertaining to the LR in
case of X-STR analysis have been published so far. Some complex paternity
pedigrees like grandparent grandchildren, avuncular, and half-siblings cases are
indistinguishable by unlinked autosomal STRs but have been reported to be distin-
guished by the use of linked X-STR markers (Pinto et al. 2011, 2012). X-STRs have
been reported to complement the information given by the autosomal STRs in
certain complex paternity cases (Krawczak 2007).
Maternity analysis by X-STR: Some situations may demand the mother/child
testing, e.g., due to increased rates of illegitimate paternity it is better to check
maternity while identifying unknown corpses or skeletonized remains. Maternity in
mother–son duo can be best assessed by X-STR as the exclusion chances in such
cases are similar to that of X-STRs in father–daughter cases, on the other side, in
case of mother–daughter testing, the X-STRs are similar to autosomal STRs and do
not provide any extra advantage. Maternity can also be assessed by mitochondrial
DNA but the technique is comparatively expensive, requires more time and
standardization, and doesn’t always produce the level of certainty required in
forensic (Parson et al. 1998). When population data for the individuals involved
are not available, X-STR can be a better alternative for studying maternity.
Amelogenin locus has the genes that code for the tooth enamel protein (von Wurmb-
Schwark et al. 2007). AMELlocus has two homologous genes AMEL X and AMEL
Y. AMEL X is located on the distal short arm of the chromosome X in the p22.1–
p22.3 region. AMEL Y is located near the centromere of the Y chromosome at p11.2
(Nakahori et al. 1991).
Mutations: many cases of mutations in amelogenin gene have been reported
(Kashyap et al. 2006; Santos et al. 1998; Steinlechner et al. 2002). Mutation in the
primer binding site of AMEL X leading to amplification failure has been published
lately (Maciejewska and Pawłowski 2009; Ou et al. 2012). Translocation in the SRY
(sex-determining region Y) to X has led to the development of male reproductive
organs and secondary sex characters in XX individuals (Ma et al. 2012; Steinlechner
et al. 2002) in such cases amelogenin has failed to detect the sex of an individual.
homology with the short arm of the Y chromosome (Mukerjee et al. 2013). Allele of
DXYS156 on Y chromosome can be distinguished from the alleles on X chromo-
some by detecting the presence of a Y-specific adenine insertion in the repeat unit
(Calì et al. 2002). The polymorphism in the DXYS156 marker can be detected by
using single primer pair amplifying both X and Y alleles due to high sequence
similarity in the flanking region of the repeat unit of DXYS156 (Chen et al. 1994).
There have been reports of DXYS156 polymorphism in almost all the studied
populations. Y counterpart of the same shows more polymorphism than the X
counterpart (Mukerjee et al. 2013). In case of Amelogenin test failure, DXYS156
locus has been used successfully for sex determination.
The STS gene codes for a membrane-bound enzyme named steroid sulfates, which
hydrolyze steroid sulfates, a metabolic precursor for estrogen, androgen, and choles-
terol (Reed et al. 2005). STS gene is located on the X chromosome at p22.31. Size of
the gene is 146 kb. STS gene consists of 10 exons and 9 introns.
Mutations in the STS gene are associated with X-linked ichthyosis, a skin disease
which affects the XY individuals (Alperin and Shapiro 1997; Shapiro et al. 1989),
additional copies of this gene are reported in both male and female (Furrow et al.
2011).
A pseudogene of the same is reported to exist on Yq and named as STSP1 (Yen
et al. 1988). The sequence homology between STS and STSP1 is 84.5%. Though
STSP1 doesn’t code for a functional protein. Primer sets targeting a 35 kb sequence
in the first intron of STS and its homologs sequence in STSP1 produces two different
kinds of amplicons that allow the identification of STS and STSP1 and determination
of sex.
Before STR markers are used for forensic casework, its allelic distribution in a
particular population has to be known so that the allelic distribution in the population
can be considered as standard against which casework analysis is done and to
compute the value of match between the genetic profiles of two individuals (Diegoli
2015). The minimum number of unrelated individuals recommended to create a
population database is 100–250 (“1991 report concerning recommendations of the
DNA Commission of the International Society for Forensic Haemogenetics relating
to the use of DNA polymorphisms” 1992; Schneider 2007). Population studies are
also done to see the interrelatedness of various populations. Studies based on genetic
relatedness among the individuals play an important role in many areas of genetics
and forensics. Knowledge of relatedness is used to estimate genetic parameters such
as heritability and genetic correlations in genetic analyses (Falconer and Mackay
1996). Estimation of breeding values in artificial selection relies on knowledge of
15 X-STRs: Potentials and Applications 317
Table 15.6 Formulae for evaluating the forensic efficiency of genetic markers [Reprinted from
Szibor et al. (2003)]
No. Formula References
X X
1. f 3 ð1 f i Þ2 þ
i i
f ð1 f i Þ3
i i
Ge et al. (1968)
X 2
þ i<j f i f j f i þ f j 1 f i f j
X X
2. f 3 ð1 f i Þ2 þ
i i
f ð1 f i Þ2
i i
Kishida et al. (1997)
X
þ i<j f i f j f i þ f j 1 f i f j
P P P 2
3. Desmarais et al. (1998)
1 i f 2i þ i f 4i 2
i<j f i
P P
4. 1 2 i f 2i þ i f 3i Desmarais et al. (1998)
5. P 2 2 P 4 Desmarais et al. (1998)
1 2 i fi þ i fi
P
6. 1 i f 2i Desmarais et al. (1998)
Formula 1: MEC for AS markers in trios
Formula 2: MEC FOR Chr X markers in trios involving daughter
Formula 3: MEC FOR Chr X markers in trios involving daughter (Desmarais version)
Formula 4: MEC FOR Chr X markers in father/daughter duos
Formula 5: Power of discrimination (PD) in females
Formula 6: PD for Chr X in males
fi( fj): population frequency of the ith and jth marker allele
318 S. Kakkar et al.
Polymorphic information content (PIC) and the expected heterozygosity (Hexp) are
the two parameters that are valid for both AS and Chr X markers (Botstein et al.
1980). Formulas were made for MEC (mean exclusion chance) calculation in
kinship testing (Table 15.6).
Formula 1 can also be used for Chr X STR markers while working on a deficiency
paternity case in which paternal grandmother is investigated instead of alleged
father. While MEC (calculated by formula 1) is compared with MEC (formula 2),
the latter one is always higher showing the better efficiency of X-STR markers in
paternity cases involving daughter (Szibor et al. 2003). Formula for the mean
exclusion chance of Chr X markers in father–daughter duo (formula 4) was given
by Desmarais et al. (1998); this formula can also be used in testing of mother/son
duo. While formula 2 for MEC calculation is equal to formula 3 (Desmarais et al.
1998). The product rule is applied to calculate the forensic parameters in case of
unlinked markers like autosomal STRs but since the markers present on X chromo-
some are linked the product rule cannot be applied but it has been reported that
where linkage equilibrium is assumed the product rule can be applied for the
calculations involving linked markers, e.g., in pedigrees like paternal half-sisters,
parenthood, and paternal grandmother–granddaughter (Gill et al. 2012; Pinto et al.
2013).
15 X-STRs: Potentials and Applications 319
15.4.7 MiniX-STRs
The utility of X-STRs in forensic analysis has rendered them a place in the latest
technology, next-generation sequencing (NGS) also called the massive parallel
sequencing (MPS). Though this technology has not made its place in regular forensic
analysis but because of its alluring usages many forensic scientists are taking interest
and it is being explored. Along with the use of STR markers, NGS technology
supports the use of different kind of markers like single nucleotide polymorphisms
(SNPs). The SNPs are comparatively less challenging to analyze and may also help
in predicting the biogeographical ancestry of an unknown crime sample and external
character like eye color, hair color of the sample donor (Borsuk 2016). Also, it has
been reported that sample in very trace amounts and degraded states can be analyzed
by NGS analysis, which is the main problem faced by every forensic analyst as the
evidence samples are usually in degraded state and are present in very minute
quantities (Alvarez-Cubero et al. 2017). Two biotech giants, Illumina (MiSeq) and
Thermo Fisher Scientific (Ion Torrent Inc.), have developed panels for the forensic
use of the NGS technology.
Platform for forensic use of NGS technology (Alvarez-Cubero et al. 2017)
Panel
available for
forensic
analysis Ion torrent (PGM) Illumina (MiSeq)
Application • Analysis of highly degraded or • Forensic profiling for DNA
trace DNA database
• Missing person identification • Missing person identification
• Kinship analysis • Disaster victim identification
• More efficient mixture profiling
Kit • HID-Ion AmpliSeq identity panel • ForenSeq DNA signature prep kit
and
• HID-ion AmpliSeq ancestry panel
Markers • 200 genetic markers: 27 global
autosomal STRs, 24 Y-STRs, 7
(continued)
320 S. Kakkar et al.
Numerous freely available software can be found online to calculate the likelihood
ratios in various sorts of pedigrees. Softwares like Familias, FamLink, and FamLink
X. These softwares use different computer programs and various sorts of pedigree
analyses and likelihood ratio calculations for autosomal and X STR markers.
Familias: This software is commonly used for forensic cases to establish pater-
nity, identify victims or analyze genetic evidence at crime scenes when kinship is
involved and also for the difficult situations including inbred families, mutations,
and missing data from degraded DNA. The software can be used for the purpose of
identification in mass disasters, familial searching, non-autosomal marker analysis,
and relationship inference using linked markers. Analysis by Familias focuses on
more statistical issues such as estimation and uncertainty of model parameters.
Although designed for use with human DNA, the principles can be applied to
nonhuman genetics for animal pedigrees and/or analysis of plants for agriculture
purposes (Egeland et al. 2015).
FamLink: this statistical software available freely online has a user-friendly
interphase allowing the linkage calculations. It uses the Merlin computing program
for pedigree analysis. Merlin performs fast haplotyping, detection of genotype
errors, and pair linkage analyses. FamLink calculates the likelihood ratios from the
15 X-STRs: Potentials and Applications 321
linked autosomal STR markers (Phillips et al. 2012; Tamura et al. 2015) data by
overlooking the impact of linkage in pedigree analysis. FamLink software has the
potential to analyze complex pedigrees as well (Kling et al. 2012).
FamLink X: it is a freeware available online for the calculation of likelihood ratios
for X-STR data for different pedigrees like parentage, deficiency paternity, complex
paternity, etc. While calculating the likelihood ratios, the software takes into
account, linkage, linkage disequilibrium, and mutations as well. This software is
based on Markov chain model to study the inheritance pattern, which allows to
account for LD (Kling et al. 2015a, b). One step Markov chain is used to deal with
linkage between the neighboring markers, i.e., linkage equilibrium and multistep
Markov chain are used to manage linkage disequilibrium (Kling et al. 2015b).
15.5 Summary
X-STRs have been used to resolve a variety of forensic cases. The potential of X-
STRs is summarized in the figure.
Forensic applications of
X-STRs
Parentage sex
Sexual Incest determi-
Mixture deficiancy Mini
assault cases nation
analysis paternity maternity X-STRs
and analysis
complex
paternity
322 S. Kakkar et al.
References
1991 Report concerning recommendations of the DNA Commission of the International Society for
Forensic Haemogenetics relating to the use of DNA polymorphisms (1992) Forensic Science
International, Ireland
Afonso Costa H, Morais P, da Silva C, Matos S, Marques Santos R, Espinheira R et al (2014)
X-chromosome STR markers data in a Cabo Verde immigrant population of Lisboa. Mol Biol
Rep 41(4):2559–2569. https://doi.org/10.1007/s11033-014-3114-9
Alperin ES, Shapiro LJ (1997) Characterization of point mutations in patients with X-linked
ichthyosis effects on the structure and function of the steroid sulfatase protein. J Biol Chem
272(33):20756–20763
Alvarez-Cubero MJ, Saiz M, Martínez-García B, Sayalero SM, Entrala C, Lorente JA, Martinez-
Gonzalez LJ (2017) Next generation sequencing: an application in forensic sciences? Ann Hum
Biol 44(7):581–592
Amir RE, Van den Veyver IB, Wan M, Tran CQ, Francke U, Zoghbi HY (1999) Rett syndrome is
caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet
23(2):185
Aquino J, Peixe C, Silva D, Tavares C, de Carvalho EF (2009) A X-chromosome STR hexaplex as a
powerful tool in deficiency paternity cases. Forensic Sci Int Genet Suppl Ser 2(1):45–46
Bertagnolli MM, Redston M, Compton CC, Niedzwiecki D, Mayer RJ, Goldberg RM et al (2011)
Microsatellite instability and loss of heterozygosity at chromosomal location 18q: prospective
evaluation of biomarkers for stages II and III colon cancer—a study of CALGB 9581 and
89803. J Clin Oncol 29(23):3153–3162
Bohossian HB, Skaletsky H, Page DC (2000) Unexpectedly similar rates of nucleotide substitution
found in male and female hominids. Nature 406(6796):622–625. https://doi.org/10.1038/
35020557
Borsuk L (2016) Forensic applications of next generation sequencing. NIST, Gaithersburg
Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man
using restriction fragment length polymorphisms. Am J Hum Genet 32(3):314–331. http://
www.pubmedcentral.nih.gov/articlerender.fcgi?artid¼1686077&tool¼pmcentrez&
rendertype¼abstract
Brinkmann B, Klintschar M, Neuhuber F, Hu J, Rolf B (1998) Mutation rate in human
microsatellites: influence of the structure and length of the tandem repeat. Am J Hum Genet
62(6):1408–1415
Buckleton JS, Bright J-A, Taylor D (2016) Forensic DNA evidence interpretation. CRC Press, Boca
Raton
Budowle B, Onorato AJ, Callaghan TF, Manna AD, Gross AM, Guerrieri RA et al (2009) Mixture
interpretation: defining the relevant features for guidelines for the assessment of mixed DNA
profiles in forensic casework. J Forensic Sci 54(4):810–821
Buekers TE, Lallas TA, Buller RE (2000) Xp22. 2-3 loss of heterozygosity is associated with
germline BRCA1 mutation in ovarian cancer. Gynecol Oncol 76(3):418–422
Calì F, Forster P, Kersting C, Mirisola MG, D’Anna R, De Leo G, Romano V (2002) DXYS156: a
multi-purpose short tandem repeat locus for determination of sex, paternal and maternal
geographic origins and DNA fingerprinting. Int J Legal Med 116(3):133–138
Cann RL, Stoneking M, Wilson AC (1987) Mitochondrial DNA and human evolution. Nature
325:31. https://doi.org/10.1038/325031a0
Castaneda M, Mijares V, Riancho JA, Zarrabeitia MT (2012) Haplotypic blocks of X-linked STRs
for forensic cases: study of recombination and mutation rates. J Forensic Sci 57(1):192–195.
https://doi.org/10.1111/j.1556-4029.2011.01916.x
Chen H, Lowther W, Avramopoulos D, Antonarakis SE (1994) Homologous loci DXYS156X and
DXYS156Y contain a polymorphic pentanucleotide repeat (TAAAA) n and map to human X
and Y chromosomes. Hum Mutat 4(3):208–211
15 X-STRs: Potentials and Applications 323
Chen D-P, Tseng C-P, Tsai S-H, Wang M-C, Lu S-C, Wu T-L et al (2009) Use of X-linked short
tandem repeats loci to confirm mutations in parentage caseworks. Clin Chim Acta 408
(1–2):29–33
Dauber E-M, Kratzer A, Neuhuber F, Parson W, Klintschar M, Bär W, Mayr WR (2012) Germline
mutations of STR-alleles include multi-step mutations as defined by sequencing of repeat and
flanking regions. Forensic Sci Int Genet 6(3):381–386
Desmarais D, Zhong Y, Chakraborty R, Perreault C, Busque L (1998) Development of a highly
polymorphic STR marker for identity testing purposes at the human androgen receptor gene
(HUMARA). J Forensic Sci 43(5):1046–1049
Diegoli TM (2015) Forensic typing of short tandem repeat markers on the X and Y chromosomes.
Forensic Sci Int Genet 18:140–151
Diegoli TM, Linacre A, Coble MD (2013) Forensic science international: genetics supplement
series a gonosomal marker multiplex to aid in mixture interpretation. Forensic Sci Int Genet
Suppl Ser 4(1):e184–e185. https://doi.org/10.1016/j.fsigss.2013.10.095
Dørum G, Kling D, Tillmar A, Vigeland MD, Egeland T (2016) Mixtures with relatives and linked
markers. Int J Legal Med 130(3):621–634
Egeland T, Kling D, Mostad P (2015) Relationship inference with familias and R: statistical
methods in forensic genetics. Academic Press, San Diego
El-Alfy SH, El-Hafez AFA (2012) Paternity testing and forensic DNA typing by multiplex STR
analysis using ABI PRISM 310 genetic analyzer. J Genet Eng Biotechnol 10(1):101–112
Ellegren H (2000) Heterogeneous mutation processes in human microsatellite DNA sequences. Nat
Genet 24(4):400
Ellegren H (2004) Microsatellites: simple sequences with complex evolution. Nat Rev Genet 5
(6):435
Falconer DS, Mackay TFC (1996) Introduction to quantitative genetics, 4th edn. Longman, Harlow
Fan H, Chu J-Y (2007) A brief review of short tandem repeat mutation. Genomics Proteomics
Bioinformatics 5(1):7–14
Fukuta M, Gaballah MH, Kato H, Aoki Y (2018) A simple method for calculating the likelihood
ratio in a kinship test using X-chromosomal markers incorporating linkage, linkage disequilib-
rium, and mutation. Legal Med 32:9. https://doi.org/10.1016/j.legalmed.2018.02.002
Fung WK, Hu Y (2004) Interpreting DNA mixtures with related contributors in subdivided
populations. Scand J Stat 31(1):115–130
Fung WK, Hu Y-Q (2008) Statistical DNA forensics: theory, methods and computation. Wiley,
Chichester
Furrow A, Theisen A, Velsher L, Bawle EV, Sastry S, Mendelsohn NJ et al (2011) Duplication of
the STS region in males is a benign copy-number variant. Am J Med Genet A 155
(8):1972–1975
Gao HM, Wang C, Han SY, Sun SH, Xiao DJ, Wang YS et al (2017) Analysis of the 19 Y-STR and
16 X-STR loci system in the Han population of Shandong province, China. Genet Mol Res 16
(1)
Ge JKR, Ann WF, Lichte K, Steffens C (1968) Zur Verwendung des Polymorphismus der sauren
Erythrocytenphosphatase bei der Vaterschaftsbegutachtung 146
Gill P, Phillips C, McGovern C, Bright J-A, Buckleton J (2012) An evaluation of potential allelic
association between the STRs vWA and D12S391: implications in criminal casework and
applications to short pedigrees. Forensic Sci Int Genet 6(4):477–486
Gornik KC, Grubić Z, Štingl K, Đurišević IT, Begović D (2011) Application of microsatellite loci
on the chromosome X for rapid prenatal detection of the chromosome X numerical
abnormalities. Croat Med J 52(3):392
Graham EAM (2005) Mini-STRs. Forensic Sci Med Pathol 1(1):65–67
Guo F (2017) Population genetic data for 12 X-STR loci in the northern Han Chinese and StatsX
package as tools for population statistics on X-STR. Forensic Sci Int Genet 26:e1–e8. https://
doi.org/10.1016/j.fsigen.2016.10.012
324 S. Kakkar et al.
Lahn BT, Page DC (1999) Chromosome four evolutionary strata on the human X chromosome.
Science 286(5441):964–967. https://doi.org/10.1126/science.286.5441.964
Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, International Human Genome
Sequencing Consortium (2001) Initial sequencing and analysis of the human genome. Nature
409(6822):860–921. https://doi.org/10.1038/35057062
Li WH, Yi S, Makova K (2002) Male-driven evolution. Curr Opin Genet Dev 12(6):650–656.
https://doi.org/10.1016/S0959-437X(02)00354-4
Li X, Zheng J, Yao J, Ding M, Pang H, Wang B (2014) Population data of 12 X-chromosome STR
loci in Yanbian Korean samples from China. Forensic Sci Int Genet 13:143. https://doi.org/10.
1016/j.fsigen.2014.07.012
Lim EJ, Lee HY, Sim JE, Yang WI, Shin K-J (2009) Genetic polymorphism and haplotype analysis
of 4 tightly linked X-STR duos in Koreans. Croat Med J 50(3):305–312
Lin M, Liu QS, Huang YL, Che M, Li CQ, Liu YB et al (2011) Population genetics investigation of
12 X chromosome short tandem repeats in the She ethic minority in Fujian. China J Fam Plann
19:628–631
Liu YJ, Su WM, Yue JT, Shi SX, Guo LH (2013) Genetic polymorphisms of twelve
X-chromosomal STR loci in Han population from Henan Province. J Forensic Med 29:297–299
Lucotte G, Guérin P, Hallé L, Loirat F, Hazout S (1989) Y chromosome DNA polymorphisms in
two African populations. Am J Hum Genet 45(1):16–20
Lynch M, Walsh B (1998) Genetics and analysis of quantitative traits, vol 1. Sinauer, Sunderland,
MA
Lyon MF (1961) Gene action in the X-chromosome of the mouse (Mus musculus L.). Nature 190
(4773):372–373. https://doi.org/10.1038/190372a0
Ma Y, Kuang J-Z, Zhang J, Wang G-M, Wang Y-J, Jin W-M, Hou Y-P (2012) Y chromosome
interstitial deletion induced Y-STR allele dropout in AMELY-negative individuals. Int J Legal
Med 126(5):713–724
Maciejewska A, Pawłowski R (2009) A rare mutation in the primer binding region of the
Amelogenin X homologue gene. Forensic Sci Int Genet 3(4):265–267
Makova KD, Li W-H (2002) Strong male-driven evolution of DNA sequences in humans and apes.
Nature 416(6881):624–626. https://doi.org/10.1038/416624a
Martins JA, Kawamura B, Cardoso AE, Cicarelli RMB (2014) Brazilian genetic database of
chromosome X. Mol Biol Rep 41(6):4077–4080. https://doi.org/10.1007/s11033-014-3277-4
Mukerjee S, Mukherjee M, Ghosh T, Kalpana D, Sharma AK (2013) Differential pattern of genetic
variability at the DXYS156 locus on homologous regions of X and Y chromosomes in Indian
population and its forensic implications. Int J Legal Med 127(1):1–6
Musanovic J, Filipovska-Musanovic M, Kovacevic L, Buljugic D, Dzehverovic M, Avdic J,
Marjanovic D (2012) Determination of combined sibship indices “gray zone” using 15 STR
loci for central Bosnian human population. Mol Biol Rep 39(5):5195–5200
Nadir E, Margalit H, Gallily T, Ben-Sasson SA (1996) Microsatellite spreading in the human
genome: evolutionary mechanisms and structural implications. Proc Natl Acad Sci U S A 93
(13):6470–6475
Nakahori Y, Hamano K, Iwaya M, Nakagome Y (1991) Sex identification by polymerase chain
reaction using X-Y homologous primer. Am J Med Genet 39(4):472–473. https://doi.org/10.
1002/ajmg.1320390420
Nakamura Y, Samejima M, Tamaki K, Minaguchi K (2013) Multiplex PCR for 18 X-chromosomal
STRs in Japanese population. Legal Med 15(3):164–170
Orrico A, Lam C-W, Galli L, Dotti MT, Hayek G, Tong S-F et al (2000) MECP2 mutation in male
patients with non-specific X-linked mental retardation. FEBS Lett 481(3):285–288
Ou X, Chen W, Chen H, Zhao F, Zheng J, Tong D et al (2012) Null alleles of the X and Y
chromosomal amelogenin gene in a Chinese population. Int J Legal Med 126(4):513–518
Parson W, Parsons TJ, Scheithauer R, Holland MM (1998) Population data for 101 Austrian
Caucasian mitochondrial DNA d-loop sequences: application of mtDNA sequence analysis to
a forensic case. Int J Legal Med 111(3):124–132
326 S. Kakkar et al.
Peris K, Keller G, Chimenti S, Amantea A, Kerl H, Höfler H (1995) Microsatellite instability and
loss of heterozygosity in melanoma. J Investig Dermatol 105(4):625–628
Phillips C, Ballard D, Gill P, Carracedo A, Lareu MV (2012) The recombination landscape around
forensic STRs: accurate measurement of genetic distances between syntenic STR pairs using
HapMap high density SNP data. Forensic Sci Int Genet 6(3):354–365
Pinto N, Gusmão L, Amorim A (2011) X-chromosome markers in kinship testing: a generalisation
of the IBD approach identifying situations where their contribution is crucial. Forensic Sci Int
Genet 5(1):27–32
Pinto N, Silva PV, Amorim A (2012) A general method to assess the utility of the X-chromosomal
markers in kinship testing. Forensic Sci Int Genet 6(2):198–207
Pinto N, Gusmão L, Egeland T, Amorim A (2013) Paternity exclusion power: comparative
behaviour of autosomal and X-chromosomal markers in standard and deficient cases with
inbreeding. Forensic Sci Int Genet 7(2):290–295
Reed MJ, Purohit A, Woo LWL, Newman SP, Potter BVL (2005) Steroid sulfatase: molecular
biology, regulation, and inhibition. Endocr Rev 26(2):171–202
Rizki A, Lundblad V (2001) Defects in mismatch repair promote telomerase-independent prolifer-
ation. Nature 411(6838):713
Ross MT, Grafham DV, Coffey AJ, Scherer S, McLay K, Muzny D et al (2005) The DNA sequence
of the human X chromosome. Nature 434(7031):325
Santos FR, Pandya A, Tyler-Smith C (1998) Reliability of DNA-based sex tests. Nat Genet 18
(2):103
Schaffner SF (2004) The X chromosome in population genetics. Nat Rev Genet 5(1):43–51. https://
doi.org/10.1038/nrg1247
Schneider PM (2007) Scientific standards for studies in forensic genetics. Forensic Sci Int 165
(2–3):238–243
Schwartz M, Vissing J (2002) Paternal inheritance of mitochondrial DNA. N Engl J Med 347
(8):576–580
Shapiro LJ, Yen P, Pomerantz D, Martin E, Rolewic L, Mohandas T (1989) Molecular studies of
deletions at the human steroid sulfatase locus. Proc Natl Acad Sci U S A 86(21):8477–8481
Shrivastava P, Jain T, Gupta U, Trivedi VB (2015) Genetic polymorphism study on 12 X STR loci
of investigator Argus X STR kit in Bhil tribal population of Madhya Pradesh, India. Legal Med
17(3):214–217. https://doi.org/10.1016/j.legalmed.2014.11.004
Steinlechner M, Berger B, Niederstätter H, Parson W (2002) Rare failures in the amelogenin sex
test. Int J Legal Med 116(2):117–120
Subramanian S, Mishra RK, Singh L (2003) Genome-wide analysis of microsatellite repeats in
humans: their abundance and density in specific genomic regions. Genome Biol 4(2):R13
Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1
(2):93–99
Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked
markers for forensic purposes. Int J Legal Med 117(2):67–74. https://doi.org/10.1007/s00414-
002-0352-5
Szibor R, Hering S, Edelmann J (2005a) The HumARA genotype is linked to spinal and bulbar
muscular dystrophy and some further disease risks and should no longer be used as a DNA
marker for forensic purposes. Int J Legal Med 119(3):179–180
Szibor R, Hering S, Kuhlisch E, Plate I, Demberger S, Krawczak M, Edelmann J (2005b)
Haplotyping of STR cluster DXS6801-DXS6809-DXS6789 on Xq21 provides a powerful
tool for kinship testing. Int J Legal Med 119(6):363–369. https://doi.org/10.1007/s00414-005-
0550-z
Tamura T, Osawa M, Ochiai E, Suzuki T, Nakamura T (2015) Evaluation of advanced multiplex
short tandem repeat systems in pairwise kinship analysis. Legal Med 17(5):320–325
Tillmar AO, Egeland T, Lindblom B, Holmlund G, Mostad P (2011) Using X-chromosomal
markers in relationship testing: calculation of likelihood ratios taking both linkage and linkage
disequilibrium into account. Forensic Sci Int Genet 5(5):506–511
15 X-STRs: Potentials and Applications 327
Tomas C, Pereira V, Morling N (2012) Analysis of 12 X-STRs in Greenlanders, Danes and Somalis
using Argus X-12. Int J Legal Med 126(1):121–128
Trindade-Filho A, Ferreira S, Oliveira SF (2013) Impact of a chromosome X STR Decaplex in
deficiency paternity cases. Genet Mol Biol 36(4):507–510
Tzeng CH, Lyou JY, Chen YR, Hu HY, Lin JS, Wang SY, Lee JCI (2000) Determination of sibship
by PCR-amplified short tandem repeat analysis in Taiwan. Transfusion 40(7):840–845
Uchigasaki S, Tie J, Takahashi D (2013) Genetic analysis of twelve X-chromosomal STRs in
Japanese and Chinese populations. Mol Biol Rep 40(4):3193–3196
von Wurmb-Schwark N, Bosinski H, Ritz-Timme S (2007) What do the X and Y chromosomes tell
us about sex and gender in forensic case analysis? J Forensic Legal Med 14(1):27–30. https://
doi.org/10.1016/j.jcfm.2005.09.003
Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, Agarwal P et al (2002) Initial
sequencing and comparative analysis of the mouse genome. Nature 420(6915):520–562. https://
doi.org/10.1038/nature01262
Weber JL, Wong C (1993) Mutation of human short tandem repeats. Hum Mol Genet 2
(8):1123–1128
Wenk RE, Traver M, Chiafari FA (1996) Determination of sibship in any two persons. Transfusion
36(3):259–262
Wu XJ, Chen CQ, Jia X, Sun HM, Luo SM, Wei WX et al (2014) Genetic polymorphisms of
12 X-STR loci in Guangdong Zhuang population. Forensic Sci Technol 4:23–26
www.chrx-str.org (n.d.). http://www.chrx-str.org/
Xu H, Fu Y-X (2004) Estimating effective population size or mutation rate with microsatellites.
Genetics 166(1):555–563
Yen PH, Marsh B, Allen E, Tsai SP, Ellison J, Connolly L et al (1988) The human X-linked steroid
sulfatase gene and a Y-encoded pseudogene: evidence for an inversion of the Y chromosome
during primate evolution. Cell 55(6):1123–1135
Zeng X, Ren Z, Chen J, Lv D, Tong D, Chen H, Sun H (2011) Genetic polymorphisms of twelve
X-chromosomal STR loci in Chinese Han population from Guangdong Province. Forensic Sci
Int Genet 5(4):e114–e116. https://doi.org/10.1016/j.fsigen.2011.03.005
Zhang S-H, Zhu R-X, Li L, Li C-T (2011) [Forensic application of investigator Argus X-12 kit in
Han population from East China]. Fa Yi Xue Za Zhi 27(5):365–368. http://europepmc.org/
abstract/MED/22259866
Zidkova A, Capek P, Horinek A, Coufalova P (2014) Investigator® Argus X-12 study on the
population of Czech Republic: comparison of linked and unlinked X-STRs for kinship analysis.
Electrophoresis 35(14):1989–1992
Ziȩtkiewicz E, Yotova V, Jarnik M, Korab-Laskowska M, Kidd KK, Modiano D et al (1997)
Nuclear DNA diversity in worldwide distributed human populations. Gene 205(1–2):161–171.
https://doi.org/10.1016/S0378-1119(97)00408-3
Ziȩtkiewicz E, Yotova V, Jarnik M, Korab-Laskowska M, Kidd KK, Modiano D et al (1998)
Genetic structure of the ancestral population of modern humans. J Mol Evol 47(2):146–155.
https://doi.org/10.1007/PL00006371
Applications of Mitochondrial DNA
in Forensic Science 16
Moumita Sinha, Manisha Rana, and Pushpesh Kushwaha
Abstract
Keywords
mtDNA · D-Loop · Profiling · Forensic · Recombination
16.1 Introduction
16.1.1 Mitochondria
variety of tissue exclusive isoforms, is used for this purpose (Bandelt et al. 2006)
(Fig. 16.1).
The human mitochondrial DNA was revealed in the 1980s as the fundamental
mechanism for transcription (Clayton 1982). Two main sites are launched for
transcript: ITH1 and ITL, both in the noncoding region at 150 bp. Strong beach
transcription begins at position 561 in a strong beam promoter; light beach
transcriptions start at position 407 inside a light beach, along with elements of
enhancer right upstream binding the mitochondrial transcript factor A (TFAM or
mtTFA). TFAM allows a two-way version, isolated from the DNA template.
In stoichiometry, theBM1 and BM2 transcription factors join 1:1 to the heart and
perform a critical part when the transcription begins (Falkenberg et al. 2002). The
beam is transliterated as a solo polycistronic precursor that is later sort out and
improved until the proteins encoded by mtDNA are synthesized on mitochondrial
ribosomes in the mitochondrial matrix. While the fundamental processes following
this phase are familiar, the monitoring processes are merely explained (Gagliardi
et al. 2004).
In comparison to nuclear DNA that only repeats one time in the course of each
cell cycle, mt DNA is processed constantly in non-tissues, for instance, the muscle of
the skeleton and the brain (Bogenhagen and Clayton 1977; Birky 2001). Conse-
quently, mitochondrial DNA is self-contained of cell cycle replication. The correct
16 Applications of Mitochondrial DNA in Forensic Science 333
replication process of mtDNA is asymmetrical to the strand. The heavy strand leads
to a replication process starting at OH according to this model (Clayton 1982) with
rift of an initial transcript synthesized with the light beam promoter. As the heavy
strand reproduction reaches the origin of replication for the light strand, the light
strand is synthesized in the opposite direction. Current experimental data does
support a substitutional symmetric or rolling-circulation strand model, which starts
to replicate MtDNA in a crucial 5.5 kb region flanked by the D-Loop and the ND4
gene at various points (Bowmaker et al. 2003). Such duplication bubbles then
continue bidirectionally, ending at OH and stopping succinctly in the OL region,
until the replication process is completed, and the rear strand rates the binding of
Okazaki fragments.
It is common to say, but recently this has been called into question, that mitochon-
drial DNA is transmitted only along the matrilineal lines (Giles et al. 1980). The
problem of paternal transmission was posed by a surplus of homoplasms and the
apparent inversion of the intermolecular mtDNA rebound rate with the genetic gap
(Awadalla et al. 1999), and by the fact that paternalistic mtDNA is associated with
the analyses of individual development (Awadalla et al. 1999).
Post Studies after above findings created questions on the explanations given. The
excessive homoplasmy identified in earlier reports is clarified in different recombi-
nant measures in various data sets (Mcaulay et al. 1999; Elson et al. 2001) along with
sequencing artifacts (Hagelberg et al. 1999). The latest study of the deletion of
paternal small pathogenic mtDNA found that paternal mtDNA leakage can occur
(Schwartz and Vissing 2002).
Indeed, in the past decade several substantial number of families with mtDNA
disease were researched around the world and other cases of paternal transmission
have not been reported. Therefore, there is little evidence that mtDNAs are recovered
in vivo (Howell 1997). Latest research of Kraytsberg and his colleagues has
provided an exciting proof of recombination in vivo (Kraytsberg et al. 2004),
which, however, is also used to create entities that may perhaps yield confusing
outcomes (Bandelt et al. 2006).
In addition, the available evidence suggests that paternal mtDNA leaking is
extremely rare, and while it does occur, a major recombination of paternal and
maternal mtDNAs is highly unlikely. So there seems to be no reason to question,
nevertheless as of the population genetics perspective, the conventional doctrine of
maternal transmission.
The findings are still vital on the way to explain the exact molecular mechanisms
in the rear of strict motherly transmission. Although paternal mitochondria were
originally thought to not have entered the oocyte, this is not the case. In a study, the
recently implanted embryo in uterus have found paternal mtDNA molecules in them
(St John et al. 2000). The father’s mitochondrial DNA is likely to be killed by an
effective ubiquitis process (Sutovsky et al. 1999).
Mitochondria exists as a key organelle intended for the manufacture of ATP in the
form of energy for cells. Human beings contain DNA in mitochondria as mtDNA,
which is around 16,500 base pairs as well as individual-specific. This makes mtDNA
useful when DNA is compromised or degraded in forensic science. Human
mtDNA is highly preserved, and it is recombined with similar copies of itself
when recombine. However, the mutation rate of mitochondrial DNA is tenfold
greater than DNA of nucleus. This property makes the creation of species extremely
useful in the matrilineal line for several generations. Some of the most important
applications of mtDNA in forensic science are as follows:
16 Applications of Mitochondrial DNA in Forensic Science 335
1. Identification of largely decayed bodies where only the teeth, bones, or hair is
available.
2. Maternal dispute cases.
3. Baby swapping.
4. Identification of ancient DNA.
5. Phylogenetic studies.
The first DNA sequence research (Sanger et al. 1977), also regarded as the first-
generation sequences, was published by Sanger in 1977. The incorporation of
ddNTPs into the freshly synthesized DNA molecules contributes to the completion
of the stretching cycle and subsequent awareness of the individual nucleotide in each
location in the chain. The method of Sanger sequencing can generate readings of
25–1200 nucleotides, which allow reading of up to 96 kb of nucleotides within 2 h.
Since 2005, modern methods of DNA sequencing were developed (Bruijns et al.
2018), often referred to as next-generation sequencing (NGS).
The synthesis-sequence approaches, for instance Roches “454” pyrosequencing
approach and Illuminas “HiSeq,” enable sequencing within 1–2 week, capable of
analyzing 80 million bp in 2 h, and able to analyze 6 billion base pairs. Sequencing
through hybridization and ligation, for instance-ABI SOLiD 3plus, results in 60 gb
per exercise of functional deoxyribose nucleic acid details. The sequenced DNA
fragments will vary from 35 to 75 nt while in the analysis with SOLiD with
453 pyrosequencing and major parallel sequencing (MPS) technologies (Bruijns
et al. 2018; Ondov et al. 2010; Shendure et al. 2005) the fragments are 100–1000 nts
long. (Bruijns et al. 2018; Dames et al. 2010). Personal Genome Machine™ (PGM)
via Ion Torrent utilizes a pH-based identification technique by introducing a radio-
active material to a series (Rothberg et al. 2011). Once this occurs, protons are
emancipated and a proportional electrical signal is produced. Data processing is
performed via the CMOS (Complementary Metal Oxide Semiconductor) capable of
calculating millions to billions instantaneous sensing responses, with a sensor
surface on the bottom of the well layer. Finally, a portable real-time sequence device
(MION) (Oxford Nanopore Technologies) enables extremely long reading lengths
in hundered kb. In forensics the NGS tools were easily used (Bruijns et al. 2018). In
the form of forensic sampling (Parson et al. 2013) and heteroplasm experiments
(Magalhães et al. 2015), for example, Ion Torrent’s PGM device was used. Though
PGM has proven resilient and accurate to detect and measure mixture and
heteroplasm, the reporting of the mtDNA in certain regions with significant feature
biases and fake positive results mainly triggered by problems of alignment in the
research algorithms has been troublesome. In recent years, the accurate identification
of mitochondrial DNA Complete Genome Panel (Woerner et al. 2018) was used
with S5 Ion Technique (Thermo Fisher Scientific) and Desktop MiSeqFGx
Sequencer (Ilumina). Both structures provide consistent mtDNA haplotypes esti-
mate. Some additional findings on the usage of forensic molecular genetics
336 M. Sinha et al.
If two mitochondrial DNA sequences, one commencing from a sample proof and
one as of a reference lending library, cannot be ruled out as they come from precisely
the similar resource, some detail on the rarities of the mtDNA profile should be
given. The traditional method is to calculate how many times in a population sample
a given order is found (Budowle et al. 1999). In general, the population databanks
utilized in forensics include numerous convenient specimens which reflect, in terms
of facts, the main populations of possible contributors. The EDNAP Mitochondrial
DNA Population Database is the most important mtDNA Haplotype database
(EMPOP, http://www.empop.org).
EMPOP was developed and planned in its early stages to function like a popula-
tion reference databank exclusively for assessment of mitochondrial DNA proof
throughout the world, with the purpose to endow mtDNA data with the superior
quality. The design and research capabilities of this online database have developed
over the past few years, while mtDNA data consistency remains the key objective of
the EMPOP database. EMPOP is not just a population reference resource but also a
direct result intended for forensic genetics researchers as well as other disciplines. It
also acts as a quality control device. EMPOP is the most robust dataset, especially
from the point of view of community covered by this database, although there is a
338 M. Sinha et al.
Fig. 16.3 Steps of massively parallel sequencing (MPS) with coupling of hybridization
enrichment
16.9 Conclusion
For the past 25 years, mitochondrial DNA typing is used internationally to address
various human identity problems linked to organized crime, small offences, criminal
attacks, major accidents, and incidents of disappearances. Advances in mtDNA
typing are incredible, varying from analyzing tiny fragments within days to decoding
many entire mtDNA genomes in a few hours. The mtDNA genome may include
details on ancestors, including knowledge on health/disease, as a genetic marker of
lineage. While there are many widely recognized explanations for researchers to
collect knowledge on the possible history of a suspected perpetrator, others never-
theless consider it unethical to establish the genetic structure behind such diseases.
Therefore, emerging technologies that enable the sequencing of mitochondrial DNA
should be wisely utilized in the field of forensic identification and for the purposes
expected. These remain issues with respect, in particular, to the topic of
heteroplasmy and in recent times with the flexibility of biparental heirlooms, the
allowability of mtDNA research in court. Clear explanation of biparental ancestry
molecular pathways for mtDNA, the capacity to evaluate the conditions when this
happens, and the potential to extremely reliably diagnose and classify the
heteroplasmy are big challenges that need to be dealt with in order to render
mtDNA a viable alternate resource in forensic identification of humans.
References
Amorim A, Pinto N (2018) Bigdata in forensic genetics. Forensic Sci Int Genet 37:102–105
Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich
DP, Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R, Young IG (1981) Sequence and
organization of the human mitochondrial genome. Nature 290:457–465
Andrews RM, Kubacka I, Chinnery PF, Turnbull DM, Lightowlers RN, Howell N (1999) Reanaly-
sis and revision of the Cambridge reference sequence. Nat Genet 23:147
Awadalla P, Eyre-Walker A, Maynard Smith J (1999) Linkage disequilibrium and recombination in
hominid mitochondrial DNA. Nature 286(5449):2524–2525
Ballard D (2016) Analysis of mitochondrial control region using sanger sequencing. Human Press,
New York, pp 143–115
Bandelt HJ, Richards M, Macaulay V (eds) (2006) Human mitochondrial DNA and the evolution of
Homo sapiens, vol 18. Springer-Verlag, Berlin Heidelberg
Birky CW (2001) The inheritance of genes in mitochondria and chloroplasts: laws, mechanisms,
and models. Annu Rev Genet 35:125–148
Bogenhagen DF, Clayton DA (1977) Mouse L cell mitochondrial DNA molecules are selected
randomly for replication throughout the cell cycle. Cell 11:719–727
Bowmaker M, Yang MY, Yasukawa T, Reyes A, Jacobs HT, Huberman JA, Holt IJ (2003)
Mammalian mitochondrial DNA replicates bidirectionally from an initiation zone. J Biol
Chem 278:50961–50969
Brandon MC, Ruiz-pesini E, Mishmar D, Procaccio V, Marie T, Nguyen KC, Douglas C (2009)
MITOMASTER—abio informatics tool for the analysis of mitochondrial DNA sequences. Hum
Mutat 30(1):1–6
Brandstätter A, Niederstätter H, Parson W (2004a) Monitoring the inheritance of heteroplasmy by
computer-assisted detection of mixed basecalls in the entire human mitochondrial DNA control
region. Int J Legal Med 118:47–54
16 Applications of Mitochondrial DNA in Forensic Science 341
Brandstätter A, Peterson CT, Irwin JA et al (2004b) Mitochondrial DNA control region sequences
from Nairobi (Kenya): inferring phylogenetic parameters for the establishment of a forensic
database. Int J Legal Med 118:294–306
Bruijns B, Tiggelaar RM, Gardeniers HJGE (2018) Massively parallel sequencing techniques for
forensics: a review. Electrophoresis 39(29):2642–2654
Budowle B, Wilson MR, DiZinno JA, Stauffer C, Fasano MA, Holland MM, Monson KL (1999)
Mitochondrial DNA regions HVI and HVII population data. Forensic Sci Int 103(1):23–35
Chaitanya L, Ralf A, Van Oven M, Kupiec T, Chang J, Lagacé R, Kayser M (2015) Simultaneous
whole mitochondrial genome sequencing with short overlapping amplicons suitable for
degraded DNA using the ion torrent personal genome machine. Hum Mutat 36(12):1236–1247
Chaitanya L, Van Oven M, Brauer S, Zimmermann B, Huber G, Xavier C, Kayser M (2016) High-
quality mtDNA control region sequences from 680 individuals sampled across the Netherlands
to establish a national forensic mtDNA reference database. Forensic Sci Int Genet 21:158–167
Churchill JD, Stoljarova M, King JL, Budowle B (2018) Massively parallel sequencing enabled
mixture analysis of mitochondrial DNA samples. Int J Legal Med 132(5):1263–1272
Clayton DA (1982) Replication of animal mitochondrial DNA. Cell 28:693–705
Dames S, Durtschi J, Geiersbach K, Stephens J, Voelkerding KV (2010) Comparison of the illumin
a genome analyzer and Roche 454 GS FLX for resequencing of hypertrophic cardiomyopathy-
associated genes. J Biomol Tech 21(2):73–80
Duan M, Chen L, Ge Q, Lu N, Li J, Pan X, Qiao Y, Tu J, Lu Z (2019) Evaluating heteroplasmic
variations of the mitochondrial genome from whole genome sequencing data. Gene
699:145–154
Eduardoff M, Xavier C, Strobl C, Casas-Vargas A, Parson W (2017) Optimized mt DNA control
region primer extension capture analysis for forensically relevant samples and highly
compromised mt DNA of different age and origin. Genes 8(10):237
Elson JL, Andrews RM, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N (2001) Analysis of
European mt DNAs for recombination. Am J Hum Genet 68(1):145–153
EMPOP-EDNAP (n.d.) Mitochondrial DNA population database. http://www.empop.org
Falkenberg M, Gaspari M, Rantanen A, Trifunovic A, Larsson NG, Gustafsson CM (2002)
Mitochondrial transcription factors B1and B2 activate transcription of human mt DNA. Nat
Genet 31:289–294
Gagliardi D, Stepien PP, Temperley RJ, Lightowlers RN, Chrzanowska-Lightowlers ZM (2004)
Messenger RNA stability in mitochondria: different means to an end. Trends Genet 20:260–267
Gilbert MT, Hansen AJ, Willerslev E, Rudbeck L, Barnes I, Lynnerup N, Cooper A (2003)
Characterization of genetic miscoding lesions caused by postmortem damage. Am J Hum
Genet 72:48–61
Giles RE, Blanc H, Cann HM, Wallace DC (1980) Maternal inheritance of human mitochondrial
DNA. Proc Natl Acad Sci U S A 77:6715–6719
Goto Y, Nonaka I, Horai S (1990) A mutation in the tRNALeu (UUR) gene associated with the
MELAS subgroup of mitochondrial encephalomyopathies. Nature 348:651–653
Guillen M, Lareu MV, Pestoni C, Salas A, Carracedo A (2000) Ethical-legal problems of DNA
databases in criminal investigation. J Med Ethics 26(4):266–271
Hagelberg E, Goldman N, Lió P et al (1999) Evidence for mitochondrial DNA recombination in a
human population of island Melanesia [published correction appears in Proc R Soc Lond B Biol
Sci 2000; 267(1452):1595–1596]. Proc Biol Sci 266(1418):485–492
Hofreiter M, Paijmans JL, Goodchild H, Speller CF, Barlow A, Fortes GG et al (2015) The future of
ancient DNA: technical advances and conceptual shifts. Bio Essays 37:284–293
Hollard C, Keyser C, Delabarde T, Gonzalez A, Vilela Lamego C, Zvénigorosky V, Ludes B (2017)
Case report: on the use of the HID-ion AmpliSeqTM ancestry panel in a real forensic case. Int J
Legal Med 131(2):351–358
Holt IJ, Harding AE, Morgan-Hughes JA (1988) Deletions of muscle mitochondrial DNA in
patients with mitochondrial myopathies. Nature 331:717–719
342 M. Sinha et al.
Howell N (1997) mt DNA recombination: what do in vitro data mean? Am J Human Genet 61
(1):19–22
Iborra FJ, Kimura H, Cook PR (2004) The functional organization of mitochondrial genomes in
human cells. BMC Biol 2:9. https://doi.org/10.1186/1741-7007-2-9
Just RS, Scheible MK, Fast SA, Sturk-Andreaggi K, Higginbotham JL, Lyons EA, Irwin JA (2014)
Development of forensic-quality full mtGenome haplotypes: success rates with low template
specimens. Forensic Sci Int Genet 10(1):73–79
Just RS, Irwin JA, Parson W (2015) Mitochondrial DNA heteroplasmy in the emerging field of
massively parallel sequencing. Forensic Sci Int Genet 18:131–139
King MP, Attardi G (1988) Injection of mitochondria into human cells leads to a rapid replacement
of the endogenous mitochondrial DNA. Cell 52:811–819
Kraytsberg Y, Schwartz M, Brown TA, Ebralidse K, Kunz WS, Clayton DA, Vissing J, Khrapko K
(2004) Recombination of human mitochondrial DNA. Science 304(5673):981
Lopopolo M, Børsting C, Pereira V, Morling N (2016) A study of the peopling of Greenland using
next generation sequencing of complete mitochondrial genomes. Am J Phys Anthropol 161
(4):698–704
Ma K, Zhao X, Li H, Cao Y, Li W, Ouyang J, Liu W (2018) Massive parallel sequencing of
mitochondrial DNA genomes from mother-child pairs using the ion torrent personal genome
machine (PGM). Forensic Sci Int Genet 32(2017):88–93
Maciejewska A, Jakubowska J, Pawłowski R (2013) Whole genome amplification of degraded and
nondegraded DNA for forensic purposes. Int J Legal Med 127(2):309–319
Magalhães S, Marques SL, Alves C, Amorim A, Alvarez L, Goios A (2015) Evaluation of
heteroplasmy detection in the ion torrent PGM. Forensic Sci Int Genet Suppl Ser 5:e13–e15
Man YW, Griffiths PG, Brown DT, Howell N, Turnbull DM, Chinnery PF (2003) The epidemiol-
ogy of Leber hereditary optic neuropathy in the North East of England. Am J Hum Genet 72
(2):333–339
Marshall C, Sturk-Andreaggi K, Daniels-Higginbotham J, Oliver RS, Barritt-Ross S, McMahon TP
(2017) Performance evaluation of a mitogenome capture and Illumina sequencing protocol
using non-probative, case-type skeletal samples: implications for the use of a positive control in
a next-generation sequencing procedure. Forensic Sci Int Genet 31:198–206
Mcaulay V, Richards M, Sykes BC (1999) Mitochondrial DNA recombination—no need to panic.
Proc R Soc B 266:2037–2039. https://doi.org/10.1098/rspb.1999.0883
MITOMAP (n.d.) A human mitochondrial genome database. https://www.mitomap.org
Ondov BD, Cochran C, Landers M, Meredith GD, Dudas M, Bergman NH (2010) An alignment
algorithm for bisulfite sequencing using the applied biosystems SOLiD system. Bioinformatics
26(15):1901–1902
Ovchinnikov IV, Malek MJ, Kjelland K, Drees K (2016) Whole human mitochondrial DNA
sequencing. Humana Press, New York, pp 157–171
Park S, Cho S, Seo HJ, Lee JH, Kim MY, Lee SD (2017) Entire mitochondrial DNA sequencing on
massively parallel sequencing for the Korean population. J Korean Med Sci 32(4):587–592
Parson W, Strobl C, Huber G, Zimmermann B, Gomes SM, Souto L, Lagace R (2013) Forensic
science international: genetics evaluation of next generation mtGenome sequencing using the
ion Torrent Personal Genome Machine (PGM). Forensic Sci Int Genet 7:543–549
Parson W, Gusmão L, Hares DRR, Irwin JAA, Mayr WRR, Morling N, Parsons TJJ (2014) DNA
Commission of the International Society for Forensic Genetics: revised and extended guidelines
for mitochondrial DNA typing. Forensic Sci Int Genet 13:134–142
Peck MA, Brandhagen MD, Marshall C, Diegoli TM, Irwin JA, Sturk-Andreaggi K (2016)
Concordance and reproducibility of an Ext generation mtGenome sequencing method for high
quality samples using the Illumina MiSeq. Forensic Sci Int Genet 24:103–111
Poletto MM, Malaghini M, Silva JS, Bicalho MG, Braun Prado K (2019) Mitochondrial DNA
control region diversity in a population from Parana state—increasing the Brazilian forensic
database. Int J Legal Med 133(2):347–351
16 Applications of Mitochondrial DNA in Forensic Science 343
Prinz M, Carracedo A, Mayr WR, Morling N, Parsons TJ, Sajantila A, Schneider PM (2007) DNA
Commission of the International Society for Forensic Genetics (ISFG): recommendations
regarding the role of forensic genetics for disaster victim identification (DVI). Forensic Sci Int
Genet 1(1):3–12
Röck AW, Dür A, Van Oven M, Parson W (2013) Concept for estimating mitochondrial DNA
haplogroups using a maximum likelihood approach (EMMA). Forensic Sci Int Genet 7
(6):601–609
Rothberg JM, Hinz W, Rearick TM, Schultz J, Mileski W, Davey M, Bustillo J (2011) An
integrated semiconductor device enabling non-optical genome sequencing. Nature 475
(7356):348–352
Ruiz-Pesini E, Lott MT, Procaccio V, Poole JC, Brandon MC, Mishmar D, Wallace DC (2007) An
enhanced MITOMAP with a global mt DNA mutational phylogeny. Nucleic Acids Res 35
(Suppl 1):823–828
Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc
Natl Acad Sci U S A 74(12):5463–5467
Schwartz M, Vissing J (2002) Paternal inheritance of mitochondrial DNA. N Engl J Med
347:576–580
Shendure J, Porreca GJ, Reppas NB, Lin X, McCutcheon JP, Rosenbaum AM, Church GM (2005)
Molecular biology: accurate multiplex polony sequencing of an evolved bacterial genome.
Science 309(5741):1728–1732
Shih YS, Bose N, Gonçalves BA, Erlich AH, Calloway DC (2018) Applications of probe capture
enrichment next generation sequencing for whole mitochondrial genome and 426 nuclear SNPs
for forensically challenging samples. Genes 9(1):49
St John J, Sakkas D, Dimitriadi K, Barnes A, Maclin V, Ramey J, Barratt C, De Jonge C (2000)
Failure of elimination of paternal mitochondrial DNA in abnormal embryos. Lancet 356
(9225):257–258
Strobl C, Eduardoff M, Bus MM, Allen M, Parson W (2018) Evaluation of the precision ID whole
MtDNA genome panel for forensic analyses. Forensic Sci Int Genet 35:21–25
Sutovsky P, Moreno R, Ramalho-Santos J et al (1999) Ubiquitin tag for sperm mitochondria.
Nature 402:371–372
Templeton JEL, Brotherton PM, Llamas B, Soubrier J, Haak W, Cooper A, Austin JJ (2013) DNA
capture and next-generation sequencing can recover whole mitochondrial genomes from highly
degraded samples for human identification. Investig Genet 4(1):1–13
Turchi C, Stanciu F, Paselli G, Buscemi L, Parson W, Tagliabracci A (2016) The mitochondrial
DNA make up of Romanians: a forensic mtDNA control region database and phylogenetic
characterization. Forensic Sci Int Genet 24:136–142
Van Oven M, Kayser M (2008) Updated comprehensive phylogenetic tree of global human
mitochondrial DNA variation. Hum Mutat 30:386–394
Wallace DC (1997) Mitochondrial DNA in aging and disease. Sci Am 277:40–47
Wallace HM, Jackson AR, Gruber J, Thibedeau AD (2014) Forensic DNA databases ethical and
legal standards: a global review. Egypt J Forensic Sci 4(3):57–63
Woerner AE, Ambers A, Wendt FR, King JL, Moura-Neto RS, Silva R, Budowle B (2018)
Evaluation of the precision ID mtDNA whole genome panel on two massively parallel sequenc-
ing systems. Forensic Sci Int Genet 36:213–224
Yasmin M, Rakha A, Noreen S, Salahuddin Z (2017) Mitochondrial control region diversity in
Sindhi ethnic group of Pakistan. Legal Med 26:11–13
Young B, King JL, Budowle B, Armogida L (2017) A technique for setting analytical thresholds in
massively parallel sequencing-based forensic DNA analysis. PLoS One 12(5):e0178005
Zeviani M, Moraes CT, DiMauro S (1988) Deletions of mitochondrial DNA in Kearns-Sayre
syndrome. Neurology 38:1339–1346
SNP in Forensic DNA Testing
17
Rohit Saluja, Pankaj Shrivastava, and Swapnil Sinha
Abstract
Single nucleotide polymorphisms (SNPs) are the most common mutations found
in humans and are special molecular signatures providing intricate information
pertaining to human migration patterns, ancestral history, and predisposition to
diseases. In present modern forensic era, SNPs in the human populations are
being used by investigative agencies across the world as productive and some-
times definitive evidence in solving cases especially pertaining to suspect/victim
identification or establishing relatedness. In the present book chapter, we have
provided a comprehensive account of the use of SNPs in forensic sciences. We
have explained the various conventional and most modern cutting edge strategies
and approaches of typing SNPs. Most importantly we have detailed the numerous
applications of SNP genotyping in DNA forensics including disaster victim
identification, suspect identification at the crime scene, and establishing precisely
the disputes related to paternity. We have also included a few landmark case-
studies which used SNP typing to reach conclusive verdict.
Keywords
SNP · Genotyping · NGS · Kinship-analysis
R. Saluja
Department of Biochemistry, All India Institute of Medical Sciences, Bibinagar, India
P. Shrivastava
DNA Fingerprinting Unit, State Forensic Science Laboratory, Department of Home (Police),
Government of Madhya Pradesh, Sagar, Madhya Pradesh, India
S. Sinha (*)
BioAptagen Laboratories Private Limited, Guwahati, India
e-mail: [email protected]
17.1 Introduction
Forensic DNA testing and analysis, as compared to other molecular biology fields, is
faced with scarce sample amount which is often highly degraded and contaminated.
But in spite of these challenges, DNA testing is emerging as a very important tool in
forensics. Single nucleotide polymorphism (SNP) is defined as a point mutation
(base change, in/del) whose allele frequency is >1% in a population. SNPs are the
most common genetic variation found in humans. It can be heterozygous (mutation
on one allele only) or homozygous (mutation on both alleles). SNPs are of special
interest in population genetics as they provide valuable information related to human
migration and ancestral history including predisposition to diseases. SNPs can be
detected in any given DNA/population with high accuracy and precision using cost-
effective methods, and now in the post-genomic era, SNPs across genomes can be
genotyped in massively parallel fashion using Next-Generation Sequencing technol-
ogy. Since SNPs are signatures of populations, many investigative agencies across
the world are using SNPs as productive and sometimes definitive evidence in solving
cases especially pertaining to suspect/victim identification or establishing related-
ness (kinship analysis).
This chapter is focused on the use of SNPs in forensic DNA testing and interpre-
tation. The chapter also details the various methods and chemistries used for SNP
genotyping. Also included in the chapter are few interesting case-studies where
SNPs are used as a prime evidentiary support to identify suspects/victims so as to
provide a glimpse how SNPs could be used real time in forensics.
Over 20 years, a number of new and sensitive technologies for SNP profiling have
been developed. Modern technologies are high-throughput and very precise. Below
is the description of landmark SNP profiling technologies and their principles. The
aim of this section of the chapter is to understand the various methodologies used in
SNP genotyping and to choose the most appropriate techniques according to the
forensic need.
Fig. 17.2 (a) TaqMan assay technology (b) Schematic representation of LightCyclar chemistry
the probes find exact complementary match, they hybridize adjacent to each other in
close proximity. First the fluorescein dye is excited and the wavelength emitted is
captured by LC Red for its own excitation. This energy transfer is only possible
when both probes are positioned close to each other. The fluorescence intensity of
the light emitted by LC Red is measured. When the PCR cycles progress, the
florescence intensity increases and is proportional to the amount of DNA amplified
during PCR. One of the major advantage of FRET methods is their real-time SNP
detection and therefore no post-PCR steps are required. This allows ease of SNP
genotyping with precision but a major limitation of FRET-based methods is lack of
multiplexing which makes this procedure expensive.
SNP site. The target sample DNA is PCR amplified and a fluorescent label
(e.g. SYBR Green) is added along with PCR amplification. The labeled PCR
products are then hybridized to the oligo microarray. The hybridization is probe-
specific and the fluorescence is scanned. This method provides parallel detection of
many SNPs on a single array. One limitation of this process is difficulty in designing
the optimal conditions for large multiplexing. But the GeneChip system
(Affymetrix) has optimized using 6–10 ASO probes for each SNP. The test probes
include all possible sequences at the polymorphic site penultimate nucleotides
flanking the SNP, similar to tiling array (Fodor et al. 1991; Pease et al. 1994). This
method can be used for typing large number of SNPs, fulfilling current forensic
requirements.
These methods are based on polymerase chain reactions. There is one type of
reactions involving minisequencing where the polymorphic site is typed by
incorporation of ddNTP by DNA polymerase complementary to the base of the
sample DNA. The second type of reaction involves allele-specific extension of the
polymorphic site only if the primers have a perfect match with the template. Below
are the descriptions of signature primer extension methods used in SNP typing in
forensics:
the detector is directly proportional to the mass (e/m ratio) of the DNA fragment. The
mass of single base extended is measured in a very precise manner and the detection
of nucleotide added is done. The resolution of this method is very high as it is totally
based on mass of the individual nucleotide added at the end of the DNA target. There
are many approaches SNP typing based on MALDI-TOF chemistry. The most
popular is the MassEXTEND assay (Sequenom) (Braun et al. 1997) and PinPoint
assay (ABI) (Haff and Smirnov 1997). One limitation of this technology is the
requirement of extra pure DNA as a small contamination will result in noise mass
measurement and spurious interpretation. The assay can also be multiplexed upto
20-plex (Kim et al. 2003) by adding a non-human tail sequence at the 50 -end of the
primer.
17 SNP in Forensic DNA Testing 351
Fig. 17.5 Allele-specific primer extension done using microarray for multiplex-SNP detection
352 R. Saluja et al.
Over the last decade, NGS technology has completely changed the way genomics
was approached. With its high-throughput capacity of massively parallel DNA
sequencing, low cost as compared to Sanger sequencing and rapid results, NGS
methods have become an important toolkit for genomic research including forensics.
Since the advent of Roche 454 Flex sequencing technology in 2005 (Margulies et al.
2005), NGS methods have undergone rapid modifications and development for
optimal output, which are very sensitive and cost-effective. The utility of next-
generation sequence reads is highlighted by the facts that the length of the sequence
is much shorter than that from a capillary sequencers and that each NGS platform has
a unique error model. Both of these features are instrumental in forensic DNA
analysis where sample DNA is mostly fragmented and low in quantity and the
error check is crucial when these methods are used for SNP typing in forensics.
Explained below are very recent NGS platforms that are used for SNP typing which
are or could be used in forensic DNA testing:
250 nucleotides/cell in a 100 flow capacity. The resulting reads yield 100 Mb of
quality data on average in about 8–10 h run.
Fig. 17.7 Schematic representation of the strategy used in ABI SOLiD method
(Fig. 17.8). Massively parallel DNA sequencing is next carried out by Illumina’s
patented Sequence By Synthesis (SBS) process. In SBS technology, all four
nucleotides are added to the flow cell channels and PCR is carried out. The
nucleotides are labeled uniquely and the 30 -OH group is chemically blocked to
stop the incorporation of the next complementary base. After each incorporation of
nucleotide, imaging step follows during which each flow cell lane is imaged.
Following imaging, the 30 OH blocking group is chemically removed for the next
incorporation of base by DNA polymerase. Data is analyzed by alignment of
sequence reads to a reference genome to look for SNPs and other genetic variations.
Illumina have introduced a number of platforms based on the above described
chemistry. Choice of platforms depends on experimental needs and type of data to
be acquired. Like the NextraXT offers efficient library preparation methods in record
time. The benchtop MiniSeq™ System has an output ranging from 1.8 to 7.5 Gb
sequencing while the NovaSeq™ 6000 System can generate 6 Tb and 20 B reads in
approximately 2 days. The HiSeq 3000/4000 Series offers cost-effective production-
scale sequencing.
17 SNP in Forensic DNA Testing 355
In recent years, SNPs have emerged as novel genetic markers getting sufficient
spotlight in forensic field. As SNPs are the most common polymorphisms in human
genome having low mutation rate and ease of their profiling using relevant
automated technology, their use in forensics is becoming increasingly crucial.
Given below are some major applications of SNPs in forensic DNA testing:
The World Health Organization (WHO) defines disaster as “serious disruption of the
functioning of society causing widespread human, material, economic or environ-
mental losses.” Disasters can be natural like floods, earthquake, fire, epidemics or it
could be manmade like wars, any major terrorist attack, plane crash, and road
mishaps. Whatever the cause, disasters result in huge loss of human life. One of
the major issues during any disaster is the identification of victims. Traditionally,
Disaster Victim Identification (DVI) is done by identification of personal effects like
documents, IDs, and other belongings or more reliably by collection and analysis of
356 R. Saluja et al.
establish the ethnicity of the victim and further investigations could be carried out for
precise identification (Phillips et al. 2009).
• Paternity testing: DNA paternity testing helps to determine the true biological
father/mother of a child with almost 99.9% accuracy. Generally mouth swab
samples of are collected followed by DNA extraction and PCR amplification of
specific loci containing informative SNPs/other polymorphisms and are analyzed
by any chosen method of genotyping.
• Sibling testing: In this kinship testing the biological relationship between two
alleged individuals is established through its DNA polymorphism information.
This testing is generally performed when the biological parents of the people
involved are not present or alive. The test procedures and SNP markers used are
similar to that done in paternity testing.
• Lineage/Ancestry profiling: In forensic studies, where there is little or no infor-
mation of possible suspect/victim and database, information obtained by DNA
ancestry studies can be very crucial in narrowing the search criteria and
identifying the potential suspect. Use of DNA ancestry is relatively new to
forensics, but in future it could be pivotal in crime scene investigation or missing
person links including victims of disasters. Walsh et al. (2011) have devised a
method, called IrisPlex for the accurate prediction (precision value ~90%) of
individual’s ancestral information based on blue and brown eye color. They have
used 6 SNPs which are associated with blue and brown eye color. The allele
frequencies of these SNPs vary and are phenotypically associated with eye color.
Han et al. (2008) conducted a genome-wide association study on population of
European ancestry and found 173 SNPs on gene loci IRF4 and SLC24A4
associated to hair color and skin pigmentation.
• Ethnicity testing: One of the most accurate information provided by SNP genetic
markers is that of ethnicity. Humans in the course of evolution, harbor mutations
throughout their genome. Migration, disease pressure, environmental changes
manipulate our genome in such a way so as to make survival fittest in our
358 R. Saluja et al.
surrounding habitat: the classic Darwin’s theory of evolution. There are many
SNPs which are specific to populations and some are even confined to one
population group. These individual SNPs or most of the time haplotypes
(a group of closely placed SNPs) provide valuable information of person’s ethnic
group. With the availability of human SNP (dbSNP) and haplotype (HapMap
project) databases on many populations across the world, ethnicity testing is
proving to be an important information provider especially in cases of victim
identification during disasters. Klimentidis and Shriver (2009) have shown asso-
ciation of facial features of various ethnic groups in Americas with various SNP
markers and validated their findings using facial reconstruction (molecular photo
editing).
Following the Anthrax attack in USA in 2001, the Federal Bureau of Investigation
has developed a new field of Microbial Forensics which detects and identifies
microorganisms found in biological crime scene ultimately tracing the trail to its
source (McEwen et al. 2006). Considering the serious consequences of potential
biological warfare, FMA has emerged as a very important tool. SNP diagnostic
PCRs done on human samples found at the crime scene for profiling the presence of
17 SNP in Forensic DNA Testing 359
SNPs have found important and definitive application in forensic field and have been
employed regularly to gather valuable information on suspects/victims. There are
voluminous case-studies where SNP genotyping is employed as a part of investiga-
tion. Few of these interesting case-studies are mentioned below:
tissue samples. First, MtDNA analysis was carried on 17 tissue samples, profiling
HV1 gene markers which revealed the common source of the perpetrator. Further
analysis connected the perpetrator maternally to the family member of one of the
four suspects. Standard genetic marker procedures confirmed the identification of
the prime suspect. This case is of special interest as application of DNA
genotyping played the central role in identification of the perpetrator.
• Melanie Road Murder Case:
In 1984, Melanie Road, 17, was sexually assaulted and murdered in Bath,
Somerset. Police collected blood and semen samples from Melanie’s clothing
and crime scene. The blood group analysis revealed nothing and due to lack of
conclusive evidences and non-availability of DNA tests at that time, failed to grab
the real culprit. The police kept and preserved all the samples. As scientific
techniques advanced, various tests were performed with the evidentiary samples
on police persistence. In 1990s the DNA of the sample was run against the
available police databases but there was not match found then as no kin or the
culprit was ever arrested. In 2014, the culprit’s daughter was arrested following a
domestic violence case in which, according to the police protocol, she was
cautioned and released but her DNA sample was collected and uploaded on
national database. In 2015, familial DNA testing for Melanie’s murder was
rerun and a match was found on culprit’s daughter. The police then arrested
Christopher Hampton on June 1, 2015, whose mouth swab samples were a perfect
match to the semen and blood samples collected from Melanie’s murder site.
After 32 years of murder, Melanie Road finally got justice with the help of DNA
forensics.
Given below is a list of most commonly used SNP databases for forensic purposes.
The most common problem with SNP typing in forensics is the scarcity of DNA
obtained from crime scene or disaster site. Although, modern SNP typing techniques
for example various NGS methods require relatively low amount of DNA, still many
times DNA methods cannot be applied as the starting quantity is too low. Sometimes
low-quantity DNA makes it almost impossible to rerun the test if first run fails or is
inconclusive. Another problem pertaining to sample quality is high fragmentation
and degradation. This especially happens in DVI where samples are hugely degraded
as a result of disaster.
Even though DNA forensics came into existence in 1990s but still many countries
cannot use this useful and sometimes definitive tool in their police investigation as
the main procedure. This is because many countries including India does not have a
detailed genetic variation database. FBI has CODIS, which is a huge DNA resource
of covering large ethnic groups across USA. The public SNP databases like dbSNP
and ALFRED have populations covering many continents but still more databases
are required which cover many populations who are never been genotyped.
When any crime scene or disaster site is scanned for DNA evidence, samples
obtained contain mixing of two or more individuals. Sample mixing is a serious
problem in DVI where there is huge intermixing of samples. Sometimes during
disasters, e.g. airplane crash, human samples are mixed with microflora of soil or
environment which makes downstream analysis and interpretation difficult. The
sample intermixing becomes a serious problem when the test SNP markers are
present in heterozygous form. Mixed SNP profiles of many individuals have a direct
association with choice of markers to be analyzed and also on the statistical method
for the interpretation of results.
References
Braun A, Little DP, Koster H (1997) Detecting CFTR gene mutations by using primer oligo base
extension and mass spectrometry. Clin Chem 43:1151–1158
Budowle B, van Daal A (2008) Forensically relevant SNP classes. BioTechniques 44:603–610
362 R. Saluja et al.
Decorte R (2010) Genetic identification in the 21st century—current status and future
developments. Forensic Sci Int 201:160–164
Dixon LA, Murray CM, Archer EJ, Dobbins AE, Koumi P, Gill P (2005) Validation of a 21-locus
autosomal SNP multiplex for forensic identification purposes. Forensic Sci Int 154:62–77
Dixon LA, Dobbins AE, Pulker HK, Butler JM, Vallone PM, Coble MD, Parson W, Berger B,
Grubwieser P, Mogensen HS, Morling N, Nielsen K, Sanchez JJ, Petkovski E, Carracedo A,
Sanchez-Diz P, Ramos-Luis E, Briōn M, Irwin JA, Just RS, Loreille O, Parsons TJ,
Syndercombe-Court D, Schmitter H, Stradmann-Bellinghausen B, Bender K, Gill P (2006)
Analysis of artificially degraded DNA using STRs and SNPs—results of a collaborative
European (EDNAP) exercise. Forensic Sci Int 164:33–44
Fierer N, Lauber CL, Zhou N, McDonald D, Costello EK, Knight R (2010) Forensic identification
using skin bacterial communities. Proc Natl Acad Sci U S A 107:6477–6481
Fodor SP, Read JL, Pirrung MC, Stryer L, Lu AT, Solas D (1991) Light-directed, spatially
addressable parallel chemical synthesis. Science 251:767–773
Haff LA, Smirnov IP (1997) Single-nucleotide polymorphism identification assays using a thermo-
stable DNA polymerase and delayed extraction MALDI-TOF mass spectrometry. Genome Res
7:378–388
Han JL, Kraft P, Nan H, Guo Q, Chen C, Qureshi A (2008) A genome-wide association study
identifies novel alleles associated with hair color and skin pigmentation. PLoS Genet 4:
e1000074
Kidd KK, Pakstis AJ, Speed WC, Grigorenko EL, Kajuna SL, Karoma NJ, Kungulilo S, Kim JJ, Lu
RB, Odunsi A, Okonofua F, Parnas J, Schulz LO, Zhukova OV, Kidd JR (2006) Developing a
SNP panel for forensic identification of individuals. Forensic Sci Int 164:20–32
Kim S, Shi S, Bonome T, Ulz ME, Edwards JR, Fodstad H, Russo JJ, Ju J (2003) Multiplex
genotyping of the human beta2-adrenergic receptor gene using solid-phase capturable
dideoxynucleotides and mass spectrometry. Anal Biochem 316:251–258
Klimentidis YC, Shriver MD (2009) Estimating genetic ancestry proportions from faces. PLoS One
4:e4460
Lilje L, Lillsaar T, Rätsep R, Simm J, Aaspõllu A (2013) Soil sample metagenome NGS data
management for forensic investigation. Forensic Sci Int Genet 4:e35–e36
Livak KJ, Flood SJ, Marmaro J, Giusti W, Deetz K (1995) Oligonucleotides with fluorescent dyes
at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic
acid hybridization. PCR Methods Appl 4:357–362
Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA (2005) Genome sequencing
in microfabricated high-density picolitre reactors. Nature 437:376–380
McEwen SA, Wilson TM, Ashford DA, Heegaard ED, Kournikakis B (2006) Microbial forensics
for natural and intentional incidents of infectious disease involving animals. Rev Sci Tech
25:329–339
Morimoto C, Manabe S, Fujimoto S, Hamano Y, Tamaki K (2017) Discrimination of relationships
with the same degree of kinship using chromosomal sharing patterns estimated from high-
density SNPs. Forensic Sci Int Genet 33:10–16
Nassir R, Kosoy R, Tian C, White PA, Butler LM, Silva G, Kittles R, Alarcon-Riquelme ME,
Gregersen PK, Belmont JW, De La Vega FM, Seldin MF (2009) An ancestry informative
marker set for determining continental origin: validation and extension using human genome
diversity panels. BMC Genet 10:39
Pease AC, Solas D, Sullivan EJ, Cronin MT, Holmes CP, Fodor SP (1994) Light-generated
oligonucleotide arrays for rapid DNA sequence analysis. Proc Natl Acad Sci U S A
91:5022–5026
Phillips C, Prieto L, Fondevila M, Salas A, Gómez-Tato A, Alvarez-Dios J, Alonso A, Blanco-
Verea A, Brión M, Montesino M, Carracedo A, Lareu MV (2009) Ancestry analysis in the 11-M
Madrid bomb attack investigation. PLoS One 4:e6583
17 SNP in Forensic DNA Testing 363
Walsh S, Liu F, Ballantyne KN, van Oven M, Lao O, Kayser M (2011) IrisPlex: a sensitive DNA
tool for accurate prediction of blue and brown eye colour in the absence of ancestry information.
Forensic Sci Int Genet 5:170–180
Ziętkiewicz E, Yotova V, Gehl D, Wambach T, Arrieta I, Batzer M, Cole DE, Hechtman P,
Kaplan F, Modiano D, Moisan JP, Michalski R, Labuda D (2003) Haplotypes in the dystrophin
DNA segment point to a mosaic origin of modern human diversity. Am J Hum Genet
73:994–1015
SNP Testing in Forensic Science
18
Moumita Sinha and I. Arjun Rao
Abstract
SNP is the abbreviation for single nucleotide polymorphism (SNP) which occurs
at particular site in the genome as variant of single nucleotide. These variations
are represented in different population and individuals to some considerable
degree. The presence of SNPs is ubiquitous not only in human genome but also
among some plants and microorganisms like bacteria. The popularity of SNPs
among forensic researchers has been fascinated due to their capable advantages in
parentage testing. SNPs have low mutation rates and are very capable in the
identification and examination of degraded samples with small amplicons. SNPs
provide valuable information on geographical origin and individual identification
of unknown humans, plants and microorganisms samples.
Keywords
SNP · Forensic · Testing · DNA · Detection
18.1 Introduction
carried out, (d) presence of no stutter peaks are associated with SNP analysis which
can make interpretation difficult and (e) above all, SNP markers ease the prediction
of ethnic origin and some physical traits of the unknown samples.
SNP markers are potential genetic markers for identification in forensic
investigations with higher degree of challenges while typing SNP markers. The
foremost challenge is SNP markers are least informative in case of low amount of
DNA analysis, as they are mostly bi-allelic. Therefore, their discriminating power is
lower than STR markers. But with the advancement of molecular genetics
techniques like multiplex PCR, this problem is resolved so far with 35plex for Y
chromosome SNPs (Sanchez et al. 2003).
the other two bases on the other side. Whereas the set of oligonucleotides is traced at
two or three various locations, this may assist in the replication and help in
eliminating the false negative results (probably due to improper hybridization). It
is also noted down that the SNP locus and the DNA sequences neighboring this locus
affects the hybridization efficacy. Therefore, it may be very challenging to adjust the
different conditions for detecting the panel of SNPs using an array, whereas the new
methods are getting prepared to overcome this difficulty (Sobrinoa et al. 2005).
Each individual genomic DNA to be genotyped for SNPs is utilized for a chain of
PCR reactions for the amplification of the short genome region which have different
SNPs. For a reliable amplification a set of primers are first defined which converts
the SNP to STS. In this process the amplified PCR products are fluorescently
labeled, whereas the rest of the PCR products from a single individual are collected
and utilized for hybridization with DNA chip technology. During this the PCR
products which are not hybridized during the reaction are removed by cleaning
and only purely base pair PCR products that attached with the oligonucleotides spots
on the DNA chip are allowed. A new way to measure the fluorescence is through the
fluorescence scanner at specific spot on the chip, and with the help of image analysis
software the output data are analyzed. As each oligonucleotide position on the chip is
known, the presence of alleles at different SNP loci is construed. This technique
observes and identifies all the SNP loci of the individuals to be tested (Sobrinoa et al.
2005).
joined to a graphene transistor and has a reciprocal arrangement for a particular SNP.
The other is a ‘weak’ strand in which some of the nucleotides are replaced with a
different molecule to weaken its bonds to the normal strand. SNP strands would then
be able to tie all the more firmly to the typical strand to dislodge the frail one. The
DNA tweezers at that point have a net electric charge that is effortlessly distin-
guished by the graphene transistor (Hwang et al. 2018).
Indeed, in forensic cases there are biological specimens which are not acquiescent to
examination even after screening with STR; usually, these forensic samples contain
too little amount of DNA or are excessively destroyed. Advanced techniques are
370 M. Sinha and I. A. Rao
Wild Life DNA forensics is a juvenile branch and is most importantly concerned
with the identification and recognization of suspected DNA samples for Species
identification. Wildlife cases involves illegal trafficking of wildlife products like
processed woods of trees, animal materials present in processed traditional medicine,
etc. as they lost their morphological features their identification demands informa-
tion regarding their species origin (Deguilloux et al. 2002; Hsieh et al. 2003; Wetton
et al. 2005; Peppin et al. 2008). Correct identification and individual characterization
of plant materials is necessary for the effective conservation of endangered plant and
animal species and to confirm their justifiable usages. In the past few years molecular
tools established provides easy resources for allocating known and unknown plant
species. These newly developed molecular techniques are comparably greater than
earlier developed phenotypic tools or methods which may answer many evolution-
ary and taxonomic questions. Single nucleotide polymorphisms (SNP),
microsatellites, amplified fragment length polymorphism (AFLP) and random
amplified polymorphic DNA (RAPD) are some of the molecular methods which
are recently been used for plant species identifications studies, whereas these
techniques have their own limitations and fruitful advantages. These studied molec-
ular techniques differ in their power of resolving to identify the genetic base
differences, data generated and applicability towards specific taxonomic levels.
SNPs are the most reliable genetic markers both in animal and plant genomes and
appeared as one of the mew generation marker for wide applications (Coles et al.
2005; Gómez and Maloo 2009; Miller and Henry 2003).
A recent new technique in molecular identification for plant DNA polymorphism
is developed based on micro array platform called as diversity array technology
(DArT) (Jaccoud et al. 2001). A novel SNP genotyping technique was described by
Van-Eijk et al. (2004) which is based on SNP wave, a chip-based SNP array which
uses thousands of oligonucleotide probes attached to a glass, silicon wafer solid
surface which allows many SNPs to be examined instantaneously (Rapley and
Harbron 2001). The SNaPshot multiplex kit developed by ABI PRISM is designed
to read up to 10 single nucleotide polymorphisms (SNPs) at known locations from
nearly 10 DNA samples in a single tube. The process includes preparing the sample
reactions using DNA template and primer, SNaPshot reaction performance by
thermal cycler and treatment of final extension of the PCR products followed by
automated gel electrophoresis of the samples and analyze the data.
Populace genetic structure identification of castor bean (Ricinus communis) using
diverse SNPS from genome wide comparisons showed low genetic diversity level
and mixed genotypes, which may lead to nominal geographic structuring of castor
bean populations worldwide (Foster et al. 2010). A recent study on single nucleotide
primer extension (SNuPE) assay of gyrB targeted gene, has reported the utility of
gene in categorizing bacteria belongs to the family Burkholderia cepacia, which are
difficult for identification using common molecular methods (Coenye et al. 2001).
The novel SNP-based methods assures successful detection of specific genetic
variations in samples within short duration, which indicates potential features of
372 M. Sinha and I. A. Rao
such methods in medical treatments also detecting successfully and distinct the
specific genetic variations which may successfully apply in medical treatments
since its positive feature to analyze number of samples in short period (Fierer et al.
2010). Therefore, more number of scientific approaches are required for identifica-
tion of plant DNA identification, because plants carries low genetic diversity
among them.
The major factors of non-human animal DNA identification are now genomic
markers which indicate polymorphisms at DNA level. Furthermore, due to the
potential nature as well as the varying biochemical consequences of different
molecular genetics procedures, a range emerges upon which to make decisions as
per the convenience of these techniques. On using molecular markers for non-human
animal genetic studies, two key issues must be addressed. The genotyping technique
must be straightforward and cost-effective to generate significantly large amount of
genotype data which is often required from the scientific point of view of most of the
molecular biologist.
Somewhat from the statistical point of view, certain features such as the use of
relationships of dominance, relevant information quality, neutrality, map positions
or genetic independence of markers are vitally important depending on the type of
study to be carried out. Regardless of the chosen method, the source data must be as
accurate as possible.
Perhaps from the molecular biology point of view, the three chief alternative
forms at the DNA level are single nucleotide variations, currently termed SNPs used
for single nucleotide polymorphisms; insertions or deletions (Indels) of different
lengths vary between 1 to several hundred base pairs and VNTR, for alterations as
the number of tandem repeats (Vignal et al. 2002).
The identification of genetic species is established on the separation and explora-
tion of DNA markers which exhibit difference between species, but usually are
conserved in species. Within animals, the gene-regions inside mitochondrial DNA,
chiefly cytochrome b (Parson et al. 2000) and cytochrome oxidase subunit I (COI)
(Hebert et al. 2003a, b), are the very often used markers, as their mutation rate links
almost with species evolution.
In wildlife DNA profiling, the option of markers is the similar as for an extensive
variety of genetic analyses of the nature and population. Disciplines for instance
molecular ecology and genetics of preservation ascertain and employ SNP markers
and microsatellite to an extensive variety of species, which can be extremely
valuable for wildlife discipline (Linacre 2006).
The most widely used approaches are SNPs for the particular identification of
organisms (São-Bento et al. 2009; Kitpipit et al. 2012; Kohnemann and Pfeiffer
2011). The primary species-specified are based on the inclusion, as a matter of
principle design, of SNPs in the target animal species, on the restriction of the
18 SNP Testing in Forensic Science 373
fragment length of polymorphism (RFLP), where SNPs may alter the number of
identifying sites in a sequence (Cooper and Cooper 2013). One benefit of the use of
SNP loci is that mixtures of two or more species can be classified unlike DNA
sequence information. Species mixtures, particularly where humankind is a species,
regularly prevent the generation of interpretable results by traditional DNA series.
The popularity of SNPs in species specific identification can increase the sensitivity
of the test with no loss of specificity (Linacre and Tobe 2009).
Microorganisms were used to conduct illegal activities, which were in recent times
underlined by the terrorist attack on the USA in the fall of 2001, in which letters
holding anthrax were used. The answers to these questions are: health and protection
of the first respondents, inquiries into contaminated locations, sample collection,
transmission of the samples, isolation and detection of the pathogen, and the source
trace of the bioagent. Source traceability of a pathogen is important for the advance-
ment of criminal investigations and conviction of the culprit (s) (Keim 2003).
A number of questions had to be answered in connection with anthrax attacks
about the relationship and cause of the cases in the four nations, the link and origin of
anthrax bacteria isolated in various states, and the identity of a pathogen releaser at
home or abroad (Keim 2003). Microbial forensics have been based on the use of
microbes as tools for bio-threats or their products (e.g. toxins).
In the last 15 years, the technical developments and application of the immensity
and assets of the microbial environment have encouraged the meadow to spread to
new extents where microbes and their commodities may help in time since death and
even in human identification (Fierer et al. 2010; Pechal et al. 2014) and also support
other forms of forensic investigations. In order to extend the use of microbes ahead
of bioterrorism and biocrime investigation, a further thorough conception in the
discipline of microbial forensics is essential.
The accountability for identifying microbial samples to generate forensic leads in
judicial (and civil) cases should now be widely known as microbial forensics.
Microbial forensics can use conventional analytical techniques, existing molecular
technologies, and modern innovative techniques throughout the course of an inves-
tigation into the crime of bioterrorism which can still only be developed to identify
and track the pathogen (Keim 2003).
Dr. Randal S. Murch already proposed in 1995 that forensic science should be
used to investigate and solve bioterrorism circumstances (Murch 2003). For micro-
bial forensics research laboratory research, molecular sequences, microbial biology,
biochemical markers, electron microscopy, crystallography, and mass spectrometry
may be involved (Yang and Keim 2012).
The categories of genetic markers, including repeated parts, insertions and
deletions, mobile components, islands of virulence factors, genes of virus and
tolerance, genes of homekeeping, functional generics, entire genome pieces, asexual
and sexual reproduction, horizontal gene transfer, are among the forms of genetically
374 M. Sinha and I. A. Rao
modifiable genes that may influence microbial forensic proof (Budowle et al. 2005).
The extension of the discipline of microbial forensics widens to the field of forensic
assay of human individuality. The studies can be pooled to comprise more data for
enhanced correlations and stronger likelihoods of eliminating people wrongly
identified with biological evidence by using short-tandem repeat (STRs) and SNPs
testing (Schmedes et al. 2016). Owing to the related phylogenetic association
between several microorganisms, certain molecular genetic markers could not dis-
tinguish them. The separation of closed pathogen species can in these cases be made
possible by conservative SNPs within realistic coding sequences. Many SNPs have
also been discovered for genetic typing by the use of entire genome sequence
(Morelli et al. 2010).
18.4 Conclusion
References
Budowle B (2004) SNP typing strategies. Forensic Sci Int 146:S139–S142
Budowle B, van Daal A (2008) Forensically relevant SNP classes. Biotechniques 44(5):603–608
Budowle B, Planz J, Campbell R, Eisenberg A (2004) SNPs and microarray technology in forensic
genetics: development and application to mitochondrial DNA. Forensic Sci Rev 16:22–36
Budowle B, Johnson MD, Fraser CM, Leighton TJ, Murch RS et al (2005) Genetic analysis and
attribution of microbial forensics evidence. Crit Rev Microbiol 31:233–254
Coenye T, Mahenthiralingam E, Henry D et al (2001) Burkholderia ambifaria sp. nov.: a novel
member of the Burkholderia cepacia complex comprising biocontrol and cystic-fibrosis related
isolates. Int J Syst Evol Microbiol 51:1481–1490
Coles ND, Coleman CE, Christensen SA, Jellen EN, Stevens MR, Bonifacio RA, Rojas-Beltran JA,
Fairbanks DJ, Maughan PJ (2005) Development and use of an expressed sequenced tag library
in quinoa (Chenopodium quinoa Willd.) for the discovery of single nucleotide polymorphisms.
Plant Soc 168:439–447
Cooper JE, Cooper ME (2013) Wildlife forensic investigation: principles and practice. CRC Press,
Boca Raton
18 SNP Testing in Forensic Science 375
Cooper DN, Smith BA, Cooke HJ, Niemann S, Schmidtke J (1985) An estimate of unique DNA
sequence heterozygosity in the human genome. Hum Genet 69:201–205
Deguilloux M, Pemonge M, Petit R (2002) Novel perspectives in wood certification and forensics:
dry wood as a source of DNA. Proc R Soc Lond B Biol Sci 269(1495):1039–1046
Divne AM, Allen M (2005) ADNA microarray system for forensic SNP analysis. Forensic Sci Int
154:111–121
Fierer N, Lauber CL, Zhou N, McDonald D, Costello EK, Knight R (2010) Forensic identification
using skin bacterial communities. Proc Natl Acad Sci U S A 107:6477–6481
Foster JT, Allan GJ, Chan AP, Rabinowicz PD, Ravel J, Jackson PJ, Keim P (2010) Single
nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis).
BMC Plant Biol 10:13–23
Gad SC (2007) Handbook of pharmaceutical biotechnology. Wiley, Hoboken
Gill P, Werrett DJ, Budowle B, Guerrieri R (2004) An assessment of whether SNPs will replace
STRs in national DNA databases—joint considerations of the DNA working group of the
European Network of Forensic Science Institutes (ENFSI) and the Scientific Working Group
on DNA Analysis Methods (SWGDAM). Sci Justice 44:51–53
Gómez JMJ, Maloo JN (2009) Sequence diversity in three tomato species: SNPs, markers and
molecular evolution. BMC Plant Biol 9:85
Hebert PDN, Ratnasingham S, de Waard JR (2003a) Barcoding animal life: cytochrome oxidase
subunit 1 divergences among closely related species. Proc R Soc Lond Ser B Biol Sci 270
(suppl_1)
Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003b) Biological identifications through DNA
barcodes. Proc R Soc Lond B Biol Sci 270(1512):313–321
Holden AL (2002) The SNP consortium: summary of a private consortium effort to develop an
applied map of the human genome. Biotechniques 32:S22–S26
Hsieh HM, Huang LH, Tsai LC, Kuo YC, Meng HH, Linacre A, Lee JC (2003) Species identifica-
tion of rhinoceros horns using the cytochrome b gene. Forensic Sci Int 136(1–3):1–11
Hwang MT, Wang Z, Ping J, Ban DK, Shiah ZC, Antonschmidt L, Lee J, Liu Y, Karkisaval AG,
Johnson ATC, Fan C, Glinsky G, Lal R (2018) DNA nanotweezers and graphene transistor
enable label-free genotyping. Adv Mater 30(34):1802440
Jaccoud D, Peng K, Feinstein D, Kilian A (2001) Diversity arrays: a solid state technology for
sequence information independent genotyping. Nucleic Acids Res 29:25e
Keim P (2003) Microbial forensics: a scientific assessment. A Report from American Academy of
Microbiology
Kohnemann S, Pfeiffer H (2011) Application of mtDNA SNP analysis in forensic casework.
Forensic Sci Int Genet 5:216–221. https://doi.org/10.1016/j.fsigen.2010.01.015
Kitpipit T, Tobe SS, Linacre A (2012) The complete mitochondrial genome analysis of the tiger
(Panthera tigris). Mol Biol Rep 39:5745–5754
Linacre A (2006) Application of mitochondrial DNA technologies in wildlife investigations—
species identification. Forensic Sci Rev 18(1):1–8
Linacre A, Tobe SS (2009) Species identification using DNA loci. Taylor & Francis Group, London
Miller PT, Henry R (2003) Single-nucleotide polymorphism detection in plants using a single-
stranded pyrosequencing protocol with a universal biotinylated primer. Anal Biochem
317:166–170
Morelli G, Song Y, Mazzoni CJ, Eppinger M, Roumagnac P et al (2010) Yersinia pestis genome
sequencing identifies patterns of global phylogenetic diversity. Nat Genet 42:1140–1143
Murch RS (2003) Microbial forensics: building a national capacity to investigate bioterrorism.
Biosecur Bioterror 1:117–122
Okimoto R, Dodgson JB (1996) Improved PCR amplification of multiple specific alleles (PAMSA)
using internally mismatched primers. Biotechniques 21(1):20. 24, 26
Parson W, Pegoraro K, Niederstatter H, Foger M, Steinlechner M (2000) Species identification by
means of the cytochrome b gene. Int J Legal Med 114:23–28
376 M. Sinha and I. A. Rao
Pechal JL, Crippen TL, Benbow ME, Tarone AM, Dowd S, Tomberlin JK (2014) The potential use
of bacterial community succession in forensics as described by high throughput metagenomic
sequencing. Int J Legal Med 128:193–205
Peppin L, McEwing R, Carvalho GR, Ogden R (2008) A DNA based approach for the forensic
identification of Asiatic black bear (Ursus thibetanus) in a traditional asian medicine. J Forensic
Sci 53:1358–1362
Rapley R, Harbron S (2001) Molecular analysis and genome discovery. Wiley, Chichester
Sanchez JJ et al (2003) Multiplex PCR and minisequencing of SNPs—a model with 35 Y
chromosome SNPs. Forensic Sci Int 137(1):74–84
São-Bento M, Carvalho M, Bento AM, Andrade L, Lopes V, Serra A, Balsa F, Anjos MJ, Corte-
Real F (2009) Y-chromosome SNP analysis in the Brazilian population of São Paulo state
(Ribeirão Preto). Forensic Sci Int Genet Suppl Ser 2(1)):427–428
Schmedes SE, Sajantila A, Budowle B (2016) Expansion of microbial forensics. J Clin Microbiol
54(8):1964–1974
Sobrinoa B, Brion M, Carracedoa A (2005) SNPs in forensic genetics: a review on SNP typing
methodologies. Forensic Sci Int 154:181–194
Twyman RM (2005) Single nucleotide polymorphism (SNP) genotyping techniques—an overview.
Encyclopedia of Diagnostic Genomics and Proteomics
Van-Eijk MJT, Broekhof JLN, van der Poel HJA, Hogers RCJ, Schneiders H, Verstege KJE, van
Aart JW, Geerlings H, Buntjer JB, van Oeveren AJ, Vos P (2004) SNPWave: a flexible
multiplexed SNP genotyping technology. Nucleic Acids Res 32:e47
Vignal A, Milan D, Sancristobal M, Eggen A (2002) A review on SNP and other types of molecular
markers and their use in animal genetics. Genet Sel Evol 34:275–305
Wang DG, Fan JB, Siao CJ, Berno A, Young P, Sapolshy R, Chandona G, Perkins N et al (1998)
Large scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the
human genome. Science 280:1077–1082
Wetton JH, Tsang KW, Khan H (2005) Inferring the population of origin of DNA evidence within
the UK by allele-specific hybridization of Y-SNPs. Forensic Sci Int 152:45–53
Yang R, Keim P (2012) Microbial forensics: a powerful tool for pursuing bioterrorism perpetrators
and the need for an international database. J Bioterr Biodef S3:007. https://doi.org/10.4172/
2157-2526.S3-007
Part IV
Non-human Forensic DNA Typing
DNA Analysis of Domestic Animals
19
Kamlesh Kaitholia, Pushpesh Kushwaha, Manisha Rana, Ila Gautam,
and Ankit Srivastava
Abstract
Keywords
STR · DNA · Forensic · Nonhuman · DNA markers
19.1 Introduction
Table 19.1 Conventional tools and techniques for forensic analysis of domestic animals
Techniques Applications
Morphological analysis Examination of morphological features such as skin
coat, eyes, tails, muzzles, dental patterns, etc. and bone
examination for species identification
Footprint analysis Useful in species identification, age estimation, and
sometimes in individual identification through unique
features in pugmark pattern
Bitemark analysis Determination of dental features such as intercanine
distance, dental arch shape, teeth morphology,
malalignment may provide a lead in the species
identification
Microscopic analysis Morphological examination, scale pattern
identification, and elemental analysis of hair which are
the most common evidence found at the crime scene
through scanning electron microscope
Serological analysis Antigen–antibody interaction-dependent techniques
such as ELISA, immunodiffusion assays, western blot
assay, etc. are useful in species identification and
diagnosing infectious diseases
Molecular analysis DNA polymer-based techniques are considered to be
reliable for species as well as individual identification.
Determination of age, sex, and parental lineage is also
possible through a variety of techniques such as
RFLP-PCR, STR, SNP, mtDNA, and DNA
methylation. Protein polymer-based markers are being
focused on better discrimination in animals
Infrared thermography Analysis of body temperature to diagnose
physiological status of animal—detection of any
disease, pregnancy, feeding efficiency, and stress
response
Radioisotopic analysis Analysis of radioisotopic signature and quantity of
stable isotopes and trace elements within the skeletal
remain is useful in determination place of origin, and
geographic mobility as well as estimation of time since
death
Inductively coupled plasma–atomic Trace element signature in skeletal remains is
emission spectroscopy (ICP-AES) examined to determine their origin and differentiation
according to species, domestication status, and feeding
type
Table 19.2 Comparative account of various molecular techniques for forensic analysis of domestic animals
Characteristics RFLP RAPD AFLP STR SNP
Principle Includes digestion with Random Analysis of heterosite restriction Based on tandem Difference in DNA
restriction enzyme and primers for fragment in the genome by PCR repeat flanking sequence due to single
hybridization with probe PCR amplification sequence base–pair mutation
amplification
Classification Hybridization based PCR-based PCR-based PCR-based Sequence based
Genomic Moderate Moderate Moderate Moderate Highest
abundance
Level of Moderate Moderate Moderate Low Moderate
DNA Analysis of Domestic Animals
polymorphism
Dominance Codominance Dominance Dominance Codominance Codominance
Locus Yes No No Yes Yes
specificity
Loci per assay 1 to few Many Many 1–20 1–1000
Required DNA High Low Medium Low Low
quantity
Reproducibility High Low Mid–high High High
Used Yes No No No No
restriction
enzyme
Laborious High Low Medium Low Low
Automation No Yes Yes Yes Yes
Specialized Radioactive isotopes Agarose gel Polyacrylamide gel Agarose/ Agarose gel
equipment polyacrylamide
gel
383
384 K. Kaitholia et al.
Hair, skin, bones and teeth, body fluids such as blood, saliva, semen, and feces are
the commonly encountered biological evidence related with pet animals. Collection,
preservation, storage, and transportation of biological evidences for laboratory
examination are important steps in genetic analysis of pet animals. Negligence
during collection and handling of multiple biological samples may often result in
cross-contamination resulting in deterioration ultimately debasing the accuracy of
analysis. Thus, proper collection and handling are necessary for accurate results
(Gaur and Reddy 2017).
Isolation of DNA from the collected samples is done through several methods that
include PCI extraction method, silica-based extraction, Chelex method, organic
extraction, and microconcentration to separate DNA from other non-DNA organic
or inorganic PCR-inhibiting material (Lincoln and Thompson 1998).
The isolation step is followed by quantitation of the extracted DNA. The quality and
quantity of the isolated DNA are checked through various methods such as UV
absorbance-based NanoDrop spectrophotometer, agarose gel electrophoresis,
hybridization, and real-time PCR (Gaur and Reddy 2017).
19.2.4.1 Amplification
Extracted DNA fragments are amplified exponentially using polymerase chain
reaction (PCR). DNA can be amplified from a very small quantity of sample. The
method was developed in 1983 by Kary Mulis and is based on the principle of
naturally occurring process of DNA replication during cell division where each
19 DNA Analysis of Domestic Animals 385
Table 19.3 List of genetic markers useful for DNA analysis of domestic animals
Animals Locus Chromosomal location References
Cattle BM1818 D23S21 Bishop et al. (1994)
BM1824 D1S34 Barendse et al.
(1994)
BM2113 D2S26 Sunden et al. (1993)
CSRM60 D10S5 Baylor College of
Medicine Human
Genome Sequencing
Center (2006)
CSSM66 D14S31 Barendse et al.
(1994)
ETH3, ETH10 D19S2, D5S3 Solinas-Toldo et al.
(1993)
ETH225 D9S2 Steffen et al. (1993)
HAUT27 D26S21 Thieven et al. (1997)
ILSTS006 D7S8 Brezinsky et al.
(1993)
INRA023 D3S10 Vaiman et al. (1994)
SPS115 D15 Baylor College of
Medicine Human
Genome Sequencing
Center (2006)
TGLA53, TGLA122, D16S3, D21S6, D20S1, Georges and Massey
TGLA126, TGLA227 D18S1 (1992)
BM2113, BM1824, Vázquez et al.
SPS115, ETH3, ETH125, (2004)
ETH10, TGLA227,
TGLA126, TGLA122
STRs: FCB19, FCB, Eenennaam et al.
BM410, RM00, TGLA12, (2007)
BM181, TGLA9, ETH1,
ETH15, BM20, ADCY,
SPS11, BM182, INRA2,
RM06, TGLA12, BR,
BM420, ETH22, TGLA221,
BM88, BM211, CYP2
SNP: BTA_AY849380,
BTA_AY863214,
BTA_AY842475,
BTA_AY939849
BTA_AY842473,
BTA_AY860426,
BTA_AY842474,
BTA_AY851163,
BTA_AY916666,
BTA_AY773474,
BTA_AY942198,
BTA_AY842472,
BTA_AY914316,
(continued)
386 K. Kaitholia et al.
19.2.4.2 Genotyping
The amplified product is then subjected to genotyping that is processed by analyzing
the DNA sequence. Various techniques of genotyping including restriction fragment
length polymorphism (RFLP), random amplified polymorphic DNA (RAPD),
amplified fragment length polymorphism (AFLP), short tandem repeat (STR), and
single nucleotide polymorphism (SNP) have been introduced.
stutter bands. (d) Less information about the mutation rates. (e) Information regard-
ing functional trait biodiversity is not provided by them (Yang et al. 2013).
The Sanger sequencing was started in 1977. It is the process of DNA replication
where one strand operates as the template for generating new DNA strand that occurs
within the cells. It uses a little volume of both normal bases as well as modified bases
(Linacre and Tobe 2013). Sequencer provides an automatic and specific process for
genotyping STR and SNP loci simultaneously from a single amplification step of
multiplexed PCR. Real-time quantitative PCR (qPCR) based techniques fit the
requirements of specificity and sensitivity and are commonly used in human
forensics for the purpose of quantification currently. Very less amount of DNA
can be amplified and sequenced. Through sequencing, maximum information of
polymorphic nature can be dogged. This is due to qPCR technology, which
empowers the detailed evaluation of templates of nuclear DNA, which further
establishes the success of next nuclear STR and SNP analyses. The same mechani-
zation has also been practiced in quantification of nuclear DNA of domestic animals
(Kanthaswamy 2015).
References
Arif IA, Khan HA, Bahkali AH et al (2011) DNA marker technology for wildlife conservation.
Saudi J Biol Sci 18:219–225. https://doi.org/10.1016/j.sjbs.2011.03.002
394 K. Kaitholia et al.
Arora R, Bhatia S, Mishra BP (2011) Genetic variation and relationship of six Indian sheep breeds
adapted to the northwestern arid zone of Rajasthan. Biochem Genet 49:449–457. https://doi.org/
10.1007/s10528-011-9421-0
Barendse W, Armitage SM, Kossarek LM, Shalom A, Kirkpatrick BW, Ryan AM, Clayton D, Li L,
Neibergs HL, Zhang N et al (1994) A genetic linkage map of the bovine genome. Nat Genet
6:227
Baylor College of Medicine Human Genome Sequencing Center (2006) Bovine Whole Genome
Assembly release Btau_3.1. http://www.hgsc.bcm.tmc.edu/projects/bovine/
Berger C, Berger B, Parson W (2009) Canine DNA profiling in forensic casework: the tail wagging
the dog. Forensic Sci Rev 21:1–14
Binns MM, Holmes NG, Rolliman A, Scott AM (1995) The identification of polymorphic micro-
satellite loci in the horse and their use in thoroughbred parentage testing. Br Vet J 151:9–15
Bishop MD, Kappes SM, Keele JW, Stone RT, Sunden SL, Kawkins GA, Toldo SS, Fries R, Grosz
MD, Yoo J et al (1994) A genetic linkage map for cattle. Genetics 136:619–639
Bock JH, Norris DO (2016) Forensic plant science. Elsevier, Amsterdam
Breen M, Lindgren G, Binns MM, Norman J, Irvin Z, Bell K, Sandberg K, Ellegren H (1997)
Genetical and physical assignments of equine microsatellites—first integration of anchored
markers in horse genome mapping. Mamm Genome 8:267–273
Brezinsky L, Kemp SJ, Teale AJ (1993) ILSTS006: a polymorphic bovine microsatellite. Anim
Genet 24:73
Buitkamp J, Antes R, Wagner V (1999) DNA profiling in veterinary medicine. In: Epplen JT,
Lubjuhn T (eds) DNA profiling and DNA fingerprinting. Birkhäuser, Basel, pp 53–70. https://
doi.org/10.1007/978-3-0348-7582-0_4
Bulut Z, Kurar E, Ozsensoy Y et al (2016) Genetic diversity of eight domestic goat populations
raised in Turkey. Biomed Res Int 2016:1–6. https://doi.org/10.1155/2016/2830394
Butler JM, David VA, O’Brien SJ, Menotti-Raymond M (2002) The MeowPlex: a new DNA test
using tetranucleotide STR markers for the domestic cat. Profiles DNA, Promega Corporation 5
(2):7–10. http://www.promega.com/profiles/502/ProfilesInDNA_502_07.pdf
Carneiro M, Ferrand N, Nachman MW (2008) Recombination and speciation: loci near centromeres
are more differentiated than loci near telomeres between subspecies of the European rabbit
(Oryctolagus cuniculus). Genetics 181:593–606. https://doi.org/10.1534/genetics.108.096826
Carneiro M, Afonso S, Geraldes A et al (2011) The genetic structure of domestic rabbits. Mol Biol
Evol 28:1801–1816. https://doi.org/10.1093/molbev/msr003
Cassidy BG, Gonzales RA (2005) DNA testing in animal forensics. J Wildl Manag 69:1454–1462.
https://doi.org/10.2193/0022-541x(2005)69[1454:dtiaf]2.0.co;2
Charoensook R, Gatphayak K, Brenig B, Knorr C (2019) Genetic diversity analysis of Thai
indigenous pig population using microsatellite markers. Asian Australas J Anim Sci
32:1491–1500. https://doi.org/10.5713/ajas.18.0832
Ciampolini R, Cecchi F, Spinetti I et al (2017) The use of genetic markers to estimate relationships
between dogs in the course of criminal investigations. BMC Res Notes 10:414. https://doi.org/
10.1186/s13104-017-2722-6
Coogle L, Bailey E, Reid R, Russ M (1996) Equine dinucleotide repeat polymorphisms at loci
LEX002, 003, 004, 005, 007, 008, 009, 010, 011, 013 and 014. Anim Genet
27(2):126–127
Duguay SA (1994) In memory of the journal pioneer.http://www.journalpioneer.com/. Accessed 31
Aug 2018
Dunisławska A, Łachmańska J, Sławińska A, Siwek M (2017) Next generation sequencing in
animal science—a review. Anim Sci Paper Rep 35:205–224
Eenennaam ALV, Weaber RL, Drake DJ et al (2007) DNA-based paternity analysis and genetic
evaluation in a large, commercial cattle ranch setting 1. J Anim Sci 85:3159–3169. https://doi.
org/10.2527/jas.2007-0284
Eggleston-Stott ML, DelValle A, Bautista M, Dileanis S, Wictum E, Bowling AT (1997) Nine
equine dinucleotide repeats at microsatellite loci UCDEQ136, UCDEQ405, UCDEQ412,
19 DNA Analysis of Domestic Animals 395
Abstract
Wildlife crime has globally reached to billion-dollar industry, which has put
wildlife at risk for local extirpation. It is our major duty to combat such blatant
industry to maintain ecological stability. Combating wildlife crime and increasing
sustainability use of wildlife not only will help in conserving animals but also the
mainkind. Wildlife forensics in today’s world has become an imperative proce-
dure in monitoring illegal wildlife trade. DNA forensics is a major part in this
procedure to fight against wildlife crime and providing stability species diversity.
DNA forensics aid in identification of species with no morphological characters,
pedigree, population, and gender of different samples seized by law enforcement
agencies, thus helping in winding-up of cases efficiently.
Keywords
Wildlife · DNA · Forensics · Wildlife crime · PCR
20.1 Introduction
Andaman and Nicobar island with high endemism. Due to encompassing globally
rich biodiversity in the South-East Asia, India has also become a hub for illegal
wildlife trade providing center position for easy transport of wildlife parts and
products from East to West or vice versa across international boundaries. Millions
of individual belonging to different species such as pangolin, tigers, elephant, bear,
tortoise, and so on are targeted for meat, ornamental body parts, and products used in
traditional medicine (Graham-Rowe 2011). Identifying the altered parts and
derivatives belonging to wildlife is another serious challenge among the law enforce-
ment agencies to confiscate the materials. However, continuing advancement in the
forensic tools used in wildlife identification has been assisting experts and law
enforcement agencies in effective implementation of Wildlife (Protection) Act,
1972 of India. DNA forensics deals with species identification based on the investi-
gation of the specific genes (Ogden et al. 2009). In India, species identification of the
wildlife materials is authorized by the four government institutions, viz., Zoological
Survey of India, Botanical Survey of India, Forest Research Institute, and Wildlife
Institute of India as per the Gazette of India–July 2017.
Molecular technology is the most efficient and robust technology used for identifi-
cation of samples whose morphological characteristics are lost or degraded and
cannot be identified by conventional methods. Many studies have shown the appli-
cability of the DNA marker technology in identifying species from various type of
seizures such as confiscated meat samples (Verma and Singh 2003; Ghosh et al.
2019; Jabin et al. 2019), cooked and dried meats (Wong et al. 2004), dried shark fins
(Chapman et al. 2003), eggshells (Moore et al. 2003), animal hairs (Branicki et al.
2003; Sahajpal and Goyal 2010), bone (Prado et al. 2002), ivory (Wasser et al. 2004,
2007), rhinoceros horns (Hsieh et al. 2003), turtle shell (Lo et al. 2006), feathers
(Mukesh et al. 2013), and fish scales (Kumar et al. 2007).
DNA barcoding is a method by which species are identified by generating
species-specific data and compared against the reference databases. Wildlife forensic
cases like meat or products or animal derivatives are often processed or degraded but
molecular techniques allow us to isolate DNA even from such samples and subse-
quently specific gene is amplified which is then sequenced and compared with
public database of NCBI/Genbank. Percent identity gives the information about
matched sequence and identity of unknown sample from present databases.
Molecular markers are used in DNA forensic analysis to identify the unknown
samples, gender, individual, pedigree, and population. These can be mitochondrial
or nuclear gene or repeats which have variation among different species but are
generally conserved within species. Use of nuclear markers is not quite developed
yet and limited data is available; however, it can be used for individual identification,
population, and pedigree analysis. Mitochondrial markers such as cytochrome B,
cytochrome C oxidase I, 12S rRNA, 16S rRNA, and so on (Mukesh et al. 2013;
Hebert et al. 2003; Thakur et al. 2017) are dominantly used for species identification
20 DNA Forensics in Combating Illegal Wildlife Trade: Present, Past, and Future. . . 401
in DNA forensics. Mitochondrial markers are inherited from mother to next genera-
tion without any recombination process and thus, can assign the unidentified speci-
men to particular species efficiently even from very low-quality degraded sample.
The primary method involves DNA extraction from biological samples, out of
which a certain gene is amplified through PCR. The amplified product is sequenced
and then generated sequence is compared with reference databases. A measure of
similarity is calculated between the query sequence and the sequence available on
database and most similar species is attributed to the unknown sample. Various
databases available and commonly used are NCBI/EMBL/DDBJ database (www.
insdc.org) and BOLD (www.barcodinglife.com).
20.2.1 Application
DNA forensics has been successfully used in cases which have been forwarded to
ZSI for investigation. Nuclear markers have been used in cases where pedigree needs
to be understood or to find relationship between different individuals.
For instance, in a recent case, ZSI was requested to undertake genetic analysis of
three baby Chimpanzees seized and housed at New Alipore Zoo, Kolkata. Genetic
study was done to understand the pedigree relationship among three Chimpanzees.
Nuclear markers (STRs) were used for analysis but since, we did not have STRs
specifically designed for Chimps, and we attempted heterologous markers developed
for human for their possible applicability in Chimps. Analyzing genealogical rela-
tionship statistically, we attempted to establish four possible categories, that is,
unrelated (U), half-siblings (HS), full siblings (FS), and parent–offspring
(PO) with 19 loci, but we found that none of the analyzed individuals was genetically
related. This can be interpreted that analyzed Chimps would have been brought from
distinct geographical locations and therefore demonstrated different genetic make-
up (Thakur et al. 2018).
In another case, we received seized objects, suspected to be originated from
Elephant by DRI, Darjeeling, West Bengal, India. It was informed that an elephant
was also found dead in Nepal at Budhabare area which was close to the Indo-Nepal
border and the concern was raised that the ivory recovered and seized by DRI,
Darjeeling might have originated from the said elephant. In this connection of above-
mentioned seizure, ZSI received elephant remains (piece of ivory and flesh) from the
elephant found dead at Jhapa District, Eastern Nepal. It was asked whether or not it
matches with the DNA of the seized ivories by DRI, Siliguri, India. DNA
extractions, PCR, genotyping based on fluorescent markers, and scoring of alleles
were undertaken. PCR and genotyping were done at least in three replicates to
conclude the findings. The results of genetic profiling have been conclusive to
provide evidences that the two seizures were from two different individuals (Singh
et al. 2019).
Mitochondrial markers were used in identification of species from degraded
biological samples with no morphological characteristics such as raw meat, cooked
meat, tissue samples, scales, and blood samples. In another case, ZSI received seized
402 G. Jabin et al.
raw meat sample suspected to be civet and another case of seized raw meat suspected
to be of deer. Samples were analyzed for identification using mitochondrial markers
Cyt b, 12S rRNA, and 16S rRNA. Upon identification, we found the former sample
was originated from Asian Palm civet (Schedule II, WPA 1972) and later was of
cattle. Thus, gives us enough validation against wildlife criminals as well as innocent
(Ghosh et al. 2019; Jabin et al. 2019)
Another case received was roasted meat sample seized at Airport destined to the
USA, upon identification, we found that the sample was identical to Oriental house
rat (Basu et al. 2020). It was a case of suspense as to why roasted rat will be sent to
another country?
20.3 Conclusion
DNA forensics plays a vital role in identification of highly degraded samples and has
been implicated in various forensic studies (Verma and Singh 2003; Wong et al.
2004; Sahajpal and Goyal 2010; Thakur et al. 2018; Ghosh et al. 2019). Recent
developments in molecular techniques have allowed us to solve many wildlife crime
cases efficiently and end the cases with better results for combating wildlife crime.
However, there are some limitations in genetic analysis of some samples in case
of hair; DNA can be isolated only when follicle is present at the root of hair.
Similarly, some samples which are preserved in formalin cannot be processed well
as amplification during PCR is inhibited by formalin. It is also quite difficult to
extract DNA from old or ill-stored samples but new techniques are developing to
process such samples. New and developed techniques may allow us to better
understand our work and reduce limitations in way to curb the wildlife crime. It is
expected that the work will help law enforcement agencies to detain those at fault in
efficient way and aid in wildlife conservation. Thus, not only maintaining wildlife
diversity but also reducing the risk lurking on human survivability by maintaining
ecological balance.
References
Branicki W, Kupiec T, Pawlowski R (2003) Validation of cytochrome b sequence analysis as a
method of species identification. J Forensic Sci 48:83–87
Basu S, Jabin G, Ghosh A et al (2020) Ascertaining suspected wildlife trade from detained parcels
under international shipment. Proc Zool Soc 73:320–323. https://doi.org/10.1007/s12595-019-
00312-7
Chapman DD, Abercrombie DL, Douady CJ, Pikitch EK, Stanhope MJ, Shivji MS (2003) A
streamlined, biorganelle, multiplex PCR approach to species identification: application to global
conservation and trade monitoring of the great white shark, Carcharodon carcharias. Conserv
Genet 4:415–425
Ghosh A, Basu S, Khatri H, Chandra K, Thakur M (2019) Ascertaining species of origin from
confiscated meat using DNA forensics. DNA Mit B 4(1):329–331
Graham-Rowe D (2011) Endangered and in demand. Nature 480:8–10
20 DNA Forensics in Combating Illegal Wildlife Trade: Present, Past, and Future. . . 403
Hebert PDN, Ratnasingham S, DeWaard JR (2003) Barcoding animal life: cytochrome c oxidase
subunit 1 divergences among closely related species. Proc R Soc Lond Ser B Biol Sci 270(Suppl
1):96–99
Hsieh HM, Huang LH, Tsai LC, Kuo YC, Meng HH, Linacre A et al (2003) Species identification
of rhinoceros horns using the cytochrome b gene. Forensic Sci Int 136:1–11
Jabin G, Ghosh A, Basu S, Khatri H, Singh SK, Chandra K, Sharma LK, Thakur M (2019) Wildlife
forensics in nullifying the false accusation: a case to deal with raw meat. DNA Mit B 4
(1):736–739
Kumar R, Singh PJ, Nagpure NS, Kushwaha B, Srivastava SK, Lakra WS (2007) A non-invasive
technique for rapid extraction of DNA from fish scales. IJEB 45(11):992–997
Lo CF, Lin YR, Chang HC, Lin JH (2006) Identification of turtle Shell and its preparations by
PCR-DNA sequencing method. J Food Drug Anal 14(2):153–158
Moore MK, Bemiss JA, Rice SM, Quattro JM, Woodley CM (2003) Use of restriction fragment
length polymorphisms to identify sea turtle eggs and cooked meats to species. Conserv Genet
4:95–103
Mukesh SSK, Shukla M, Sharma LK, Mohan N, Goyal SP, Sathyakumar S (2013) Identification of
galliformes through forensically informative nucleotide sequencing (FINS) and its implication
in wildlife forensics. J Forensic Res 4:195
Ogden R, Dawnay N, McEwing R (2009) Wildlife DNA forensics-bridging the gap between
conservation genetics and law enforcement. Endanger Species Res 9:179–195
Prado M, Franco CM, Fente CA, Cepeda A, Vázquez BI, Barros-Velázquez J (2002) Comparison of
extraction methods for the recovery, amplification and species-specific analysis of DNA from
bone and bone meals. Electrophoresis 23:1005–1012
Sahajpal V, Goyal SP (2010) Identification of a forensic case using microscopy and forensically
informative nucleotide sequencing (FINS): a case study of small Indian civet (Viverricula
indica). Sci Justice 50(2):94–97
Singh SK, Jabin G, Basumatary T, Bhattarai GP, Chandra K, Thakur M (2019) Resolving the
transboundary dispute of elephant poaching between India and Nepal. Forensic Sci Int Synergy.
https://doi.org/10.1016/j.fsisyn.2019.07.007
Thakur M, Javed R, Kumar VP, Shukla M, Singh N, Maheshwari A, Dong Dong W, Zhang YP
(2017) DNA forensics in combating food frauds: a case study from China in identifying canned
meat labeled as deer origin. Curr Sci 112(12):2449–2442
Thakur M, Chandra K, Sahajpal V, Samanta A, Mitra A (2018) Functional validation of human-
specific PowerPlex 21 system (Promega, USA) in chimpanzee (Pan troglodytes). BMC Res
Notes 11:695
Verma SK, Singh L (2003) Novel universal primers establish identity of an enormous number of
animal species for forensic application. Mol Ecol Notes 3:28–31
Wasser SK, Shedlock AM, Comstock K, Ostrander EA, Mutayoba B, Stephens M (2004) Assigning
African elephant DNA to geographic region of origin: applications to the ivory trade. Proc Natl
Acad Sci U S A 101:14847–14852
Wasser SK, Mailand C, Booth R, Mutayoba B, Kisamo E, Clark B et al (2007) Using DNA to track
the origin of the largest ivory seizure since the 1989 trade ban. Proc Natl Acad Sci U S A
104:4228–4233
Wong KL, Wang J, But PPH, Shaw PC (2004) Application of cytochrome b DNA sequences for the
authentication of endangered snake species. Forensic Sci Int 139:49–55
The Utility of DNA Barcoding Technology
in the Authentication of Medicinal Plants 21
in Illegal Trade: A Critical Review
Abstract
DNA barcoding technology is the utilization of short segments of DNA for the
rapid and accurate identification of closely related species. The technology offers
advantages over other taxonomic methods of identification, as it requires very
minute tissue specimen. DNA barcoding is a project with mission to provide
unique genomic database for the identification of all types of eukaryotes. The
utilization of barcode has helped so far to discover new species which were once
considered merged with species having similar morphology, but now with the
evolution of genetic DNA barcoding sequences, organisms can be differentiated
from the closely related species as well as phylogenetic relationships can be
discovered. The technique holds potential to resolve fundamental ecological,
evolutionary, biological, herbal authentication disputes, as well as answer to
unresolved forensic questions. In this chapter, the use of DNA barcoding in
wildlife forensics and its application in forensic science are discussed. Various
aspects of DNA barcoding technology are highlighted specifically with respect to
illegal trade of medicinal plants; identification and authentication of medicinal
plants with detailed protocols for extraction, and amplification and sequencing of
DNA barcoding are discussed.
Keywords
M. K. Thakar (*)
Department of Forensic Science, Punjabi University, Patiala, Punjab, India
T. Sharma
Department of Forensic Science and Toxicology, Chandigarh University, Mohali, Punjab, India
Medicinal plants are extracted from wild resources and have been smuggled across
the national and international borders to earn instantaneous profits (Douwma and
Hollow 2014). The global black market of illegally extracted wild medicinal plants
has been emphasized by the international organizations like CITES, UNCTAD,
TRAFFIC, and WWF (Fig. 21.1) and national legislation like Wildlife Protection
Act 1972 and others shown in Fig. 21.2, which also seeks help of scientific tools of
wildlife forensics to implement their regulations to prohibit such trade practices
(Wyatt et al. 2018; Dey n.d.; Wellsmith 2011; Haibin and Kunming 1999). The
volume of trade and frequency of illegal activities reported in herbal/pharmaceutical
industries increase continuously due to which certain plant species are becoming
extinct or reaching close to extinction (Butchart et al. 2004).
There are around 60,000 plant species in the world (45,000 from India), which are
used as traditional herbal medicine, and constituent of these phytomedicine are
useful in curing the serious ailments (Sen et al. 2011; Pan et al. 2014; Rajendran
and Basha 2010; Bordoloi and Dutta 2014). According to the global report of
Fig. 21.1 International conventions dedicated for the protection of plants: (a) Convention on
International Trade in Endangered Species of Wild Fauna and Flora, also known as the Washington
Convention, (b) Convention on Biological Diversity (CBD) Secretary-General of the United
Nations, (c) International Treaty on Plant Genetic Resources for Food and Agriculture (ITPGRFA)
Secretary-General of the United Nations, (d) Convention on the Conservation of European Wildlife
and Natural Habitats, also known as the Bern Convention (or Berne Convention), Council of
Europe, (e) The International Tropical Timber Agreement (ITTA, 1983), International Tropical
Timber Agreement, 1994 (ITTA, 1994 or ITTA2)
Fig. 21.2 Official agencies of Government of India regulating wildlife trade in India
21 The Utility of DNA Barcoding Technology in the Authentication of Medicinal. . . 407
Fig. 21.3 Classification of illegal trade practices of medicinal plants along with different modes of
execution
customs code HS 1211 (International Trade Center, United Nations, 2016 study), the
estimated trade turnover was around 3.4 billion USD (Lange 2006). The problem
becomes complicated when medicinal plants are extracted from the wild in excess
amounts beyond the regulations of CITES/Wildlife Protection Act 1972. Because of
this reason, many important medicinal plant species are now threatened (e.g.,
Trillium govanianum, Sacara asoca) (Vidyarthi et al. 2013; Dawson and Powell
1999). Because of the illegal smuggling of medicinal plants, CITES has now
protected around 30,000 plant species under its regulations within three appendices
(Warchol 2004). India being one of the signatory of CITES and needs to combat
such crime practices and implement CITES regulations actively to conserve the
national heritage of India (Reeve 2014).
The herbal sector growth is rapid, and according to data released by Confedera-
tion of Indian Industry (CII), gross market size of (end of 2018) Ayurvedic industry
has grown up to $4.4 billion (Subrat et al. 2002). Annually the herbal trade industry
of India is growing at the rate of 15% with a total turnover of around Rs. 2300 crore
per annum and has become the second most active country to export herbal medicine
across the globe after China (Wakdikar 2004). It is important to channelize such
trade practices by enforcing regulations. The broad classifications of Illegal Trade of
Medicinal plants is shown in Fig. 21.3.
It has become important for the enforcement agencies to channelize such trade
practices within the framework of legal regulations. To ensure this, identity of herbal
plants and their products is the primary requirement. The authentication of
confiscated plant material to check its relevance with regulatory legislation needs
to be undertaken by identifying the species of plants and their products. Taxonomist
has been using morphological features for the identification of plants, yet a number
of limitations exist, which need to be combated for proper enforcement of
regulations (Coghlan et al. 2012). The whole plant can be easily identified by
studying various morphological attributes, but plants are often traded in the form
408 M. K. Thakar and T. Sharma
of processed dried parts or in the form of products. In the processing, most of the
morphological attributes are sacrificed and become almost impossible to identify the
plants on the basis of their morphological and microscopic characteristics alone (Yao
et al. 2010).
The land plants worldwide encompass a colossal diversity in terms of form and
function. They consist of the seed plants (angiosperms and gymnosperms), along
with the bryophytes (mosses, hornworts, and liverworts), ferns, and fern allies.
Approximation of the entire species statistics varies to a great extent among authors,
but according to a recent estimation, there are approximately 380,000 species of land
plants, comprising 3 lakh species belonging to angiosperms, 13 hundred species
belonging to gymnosperms, and approximately 12 thousand species belonging to
each of bryophytes and ferns/fern allies (Fazekas et al. 2012). The identification has
been carried out solely on the basis of taxonomic characteristics. Then the idea of
using DNA barcodes for the identification of plants was first given by Kress et al.
(2015). After 2 years, the first paper related to the identification of plants with DNA
barcoding came in light.
The term “DNA barcoding” had first been coined by Paul Herbert. He mentioned
the utility of short DNA segments for the purpose of identification of animal species
in his publication entitled “Biological identifications through DNA barcodes.” This
paper was published in the Proceedings of the Royal Society of London, Series B:
Biological Sciences in 2003. This pioneer publication has become the base of the
giant project “Barcode of Life” which emphasizes onto the creation of genetic
database. The basic idea of the project was to accumulate genetic sequences,
which should include the sequences of candidate barcoding regions. The initial
work was progressing with the identification of the members of kingdom Animalia
only with COI (cytochrome oxidase I) barcoding region, but now the project has
expanded its branches to encompass other kingdoms (plants and others) as well.
Despite the kingdom, the common goal of BOL (Barcode of Life) project was to
generate a database of known species (Wong and Hanner 2008). The COI barcoding
region did not work for the plant tissues; the use of chloroplast and nuclear genome
was preferred in plant tissues (Hajibabaei et al. 2007). Probably the cytochrome
oxidase 1 (COI) gene in plants shows very slow rate of evolution than in animals
(Aubriot et al. 2013). Therefore, the use of mitochondrial genome in case of plant
DNA barcoding was not encouraged by various research groups (Hebert et al. 2003;
Newmaster et al. 2013). On the contrary, chloroplast genome was found to be
significant in identifying plant species with high rate of discriminating ability.
Four major plant DNA barcodes have been proposed, and their chronological
overview for the exploration of candidate barcoding region of plants has been
summarized in Fig. 21.4.
The DNA barcoding technologies have provided a new biological tool to taxono-
mist and forensic scientists to increase their understanding about the natural world
(Fazekas et al. 2012). The species level identification with the use of short segments
21 The Utility of DNA Barcoding Technology in the Authentication of Medicinal. . . 409
Fig. 21.4 Important milestones in the development of candidate barcoding regions for the identi-
fication of land plants
The correct identification and linkage of specimen with known standard form the
basis of forensic identification. DNA barcoding is a new informative technology
410 M. K. Thakar and T. Sharma
Table 21.1 List of important forensic research articles recommending DNA barcoding as tech-
nique to identify specimen in question
Recommended
candidate barcoding Year of
Title of the Study region publication
DNA barcodes for Mexican Cactaceae, plants under MatK ITS 2011
pressure from wild collecting
An authenticity survey of herbal medicines from ITS2 sequences 2016
markets in China using DNA barcoding
Potential use of DNA barcoding for the identification MatK + rbcL 2012
of tobacco seized from water pipes
Forensic botany II, DNA barcode for land plants: rbcL + matK 2014
Which markers after the international agreement?
DNA identification of Salvia divinorum samples rbcL + trnL 2012
Forensic timber identification: a case study of a CITES ITS2 + trnH-psba + trnL 2015
listed species, Gonystylus bancanus (Thymelaeaceae)
Forensic identification of Indian snakeroot (Rauvolfia rps16 intro 2013
serpentina Benth. Ex Kurz) using DNA barcoding
Forensic identification of CITES protected slimming psbA-trnhL, ITS 2013
cactus (Hoodia) using DNA barcoding
DNA barcoding for efficient identification of Ixiolirion ITS, trn intron 2015
species (Ixioliriaceae)
which can be used to resolve wildlife forensic cases. The technology can be used to
authenticate the confiscated material/s and link the questioned material with species
of origin. DNA barcodes in forensics can be utilized to ensure speedy court room
trials in illegal wildlife cases with respect to both plants and animals (Hajibabaei
et al. 2007). Many studies have been published in the international journals of repute.
These studies have recommended different candidate barcoding regions for the
identification of economical important medicinal plant species and are enumerated
in Table 21.1.
nutraceuticals. Even though high frequencies of illegal trade practices affect the
consumer health, yet very limited research studies are available (Vassou et al. 2015).
DNA barcodes hold the potential to authenticate the commercial available products
and can validate their genuineness and substitution if present. Different studies have
been conducted in this regard and are tabulated in Table 21.2.
Despite its proven potential, the technique is not fully utilized in solving wildlife
forensic cases. This may be because of lack of instrumental facility and most
importantly lack of DNA sequence database specifically medicinal plants in illegal
trade.
The technology can be used in forensic science laboratories to solve wildlife cases
related to smuggling of herbs, etc., but the only limitation it holds is the lack of
standardized database of local important medicinal plants (Hajibabaei et al. 2007;
Group et al. 2009). The availability of sequences of medicinal plants specifically
which are in trade has almost negligible data on portals like NCBI as shown in
Fig. 21.5. The lack of standard database restricts the wildlife forensic scientist to
authenticate the species in question. There is an urgent need for researchers to design
studies to develop DNA sequence database of the species having medicinal values
and involved in wildlife trade. The richness in sequence database will not only help
in the authentication of the specimen but also will be helpful in determining the
geographical origin of the plant species.
CITES organization has asked the forensic science community to answer the
following five questions related to wildlife crime:
The resolution of this becomes possible only when giant sample size is analyzed
with respect to all the above-mentioned factors. This is how the scientists can offer
answers to these questions. The DNA barcoding of plants can be a significant
milestone in the science of identification, as it can resolve criminal cases with respect
to various illegal trade attributes.
Forensic investigators could apply plant DNA barcodes to check smuggling of
endangered or restricted medicinal plants and monitor the commercial products (e.g.,
herbal medicines) for their claimed authenticity. The most imperative defying
wildlife forensics is lack of DNA sequence database with respect to medicinal plants
in trade. Around 90% of research associated with wildlife forensics is dedicated to
animal species and animal produce only. The illegal trade practices with respect to
medicinal plants/products or forest produce are not documented properly. As a
412 M. K. Thakar and T. Sharma
Table 21.2 Studies on DNA barcoding technology used to authenticate commercial herbs to
evaluate their purity or substitution
Part used
in herbal Medicinal
Plant specimen medicine properties Publication title Reference
Sida cordifolia Root, Antioxidant, anti- DNA barcoding for Vassou et al.
leaves inflammatory, species identification (2015)
antidiabetic from dried and
powdered plant parts:
a case study with
authentication of the
raw drug market
samples of Sida
cordifolia
Peucedanum Leaves, Expectorant Molecular Zhou et al.
praeruptorum roots authentication of the (2014)
traditional medicinal
plant Peucedanum
praeruptorum and its
substitutes and
adulterants by DNA
barcoding technique
Gingko biloba Leaves Parkinson’s Authentication of Little (2014)
disease and Ginkgo biloba herbal
Alzheimer’s dietary supplements
disease using DNA
barcoding
Phoenix Fruits Fruits are DNA barcoding Enan and
dactylifera antimutagenic based on plastid Ahamed (2014)
and antioxidants matK and RNA
polymerase for
assessing the genetic
identity of date
(Phoenix dactylifera
L.) cultivars
Piper nigrum Antimicrobial, DNA barcoding to Parvathy et al.
L. fruit antioxidant, anti- detect chili (2014)
inflammatory adulteration in traded
black pepper powder
Indirubin Leaves Treatment of Rapid identification Hu et al. (2015)
chronic and verification of
myelocytic indirubin-containing
leukemia medicinal plants
Lonicera Japonica Detoxifying and Stability and Hou et al.
leaves, anti- accuracy assessment (2013)
flowers inflammatory of identification of
effects traditional Chinese
materia medica using
DNA barcoding: a
case study
(continued)
21 The Utility of DNA Barcoding Technology in the Authentication of Medicinal. . . 413
result, only 10% of research studies present scientific validated tools to resolve
authentication problems of plants with the help of DNA technology. Very less
data with respect to Indian medicinal plants endemic to the India are available on
nucleotide databases like NCBI and BOLD systems. For example, Trillium
govanianum herb is majorly found at higher altitude regions of Himalayan region.
The herb contains chemical constituents like govanoside, steroidal saponins, and
compounds like borassoside and pennogenin, which have been known for
414 M. K. Thakar and T. Sharma
Fig. 21.5 Species sequence availability in terms of three barcoding regions, (a) sequences of
species available in NCBI gene bank for land plants in totality, (b) species in illegal trade and their
species richness in NCBI nucleotide bank. The data shown is representing global nucleotide
sequence database. *The authors have excluded their own sequences published in NCBI
antioxidant and anticancer activities. Due to surplus illegal extraction from wild
resources, the state government has presently banned the extraction of Trillium
govanianum plant and its products without the permission of regulatory authorities.
Till date almost negligible data related to the sequences of matK and rbcL and ITS
barcoding regions of Trillium govanianum species (i.e., 12 sequences for Trillium
govanianum, out of which only one sequence belongs to ITS gene with accession
number AB018813.1 from Japan), is available on nucleotide databases like NCBI,
Boldv3, DDBJ, and EMBL. The authors have submitted one sequence of ITS region
to the NCBI nucleotide database in 2017.
The Consortium for the Barcode of Life suggested the development of more DNA
barcode databases of medicinal plants in trade with specific candidate barcoding
regions, which is urgently required and the need of the hour. This type of databases
could provide a scientific tool to authenticate species in question as well as help in
the regulation of CITES and other national and international legislations (Aubriot
et al. 2013; Valentini et al. 2009).
• The first attribute is “universality,” i.e., it should be universally present among all
the population of species in question.
• The second attribute is “Amplification Success Rate,” i.e., the segment should be
amplifiable with standard universal/specific primers.
21 The Utility of DNA Barcoding Technology in the Authentication of Medicinal. . . 415
• Lastly, the third major attribute is conserved as well as variable regions which will
ultimately showcase intraspecific and interspecific variations, respectively
(Hebert et al. 2003).
Different validation studies conducted for the authentication and selection of candi-
date barcoding gene have shown chloroplast genome to be best suitable region to
identify land plants. Chloroplast genome further can be classified as protein coding
region which includes (matK, rbcL, rpoC1, and psbA-trnH) and noncoding (ITS,
psbA-trnH), which has been summarized by Chen et al. (2010). Although chloro-
plast genome exhibits higher amplification success, barcoding regions in chloroplast
genome exhibits very low substitution rate, which ultimately confines its boundaries
to be used as single super barcode. The species-lineage reconstructions in case of
hybridization and introgression events or linear sorting events shows higher error
rate. Specifically, the barcoding region of chloroplast rbcL has higher universality
but lacks discriminatory power in contrast to that matK shows higher discrimination
ability (Li et al. 2015; Gao et al. 2010; Newmaster et al. 2006).
fungal endophytes are prone to fungal contamination, thus making the sequencing
difficult to interpret. Due to ITS regions’ length, the chances of amplification success
are very less. So, Gonzalez et al. in their study concluded to use ITS2 region in spite
of using of ITS1–5.8S-ITS2. Due to its paralogy and enormous polymorphic sites,
the sequence quality must be thoroughly quantified to gain discriminatory ability
(Yao et al. 2010; Group et al. 2011; Techen et al. 2014).
trnH-psbA
The size of trnH-psbA varies from 100 to 1000 bp depending upon conifers and
monocots. The bryophytes on the other hand show less than 100 bp sequence length.
This region is the spacer region of plastid, which shows high level of discrimination
ability along with high amplification success rate. The spacer region is often paired
with matK or rbcL in terms of multilocus barcode approach to identify land plants. In
case of Ficus and Alnus genus, high rate of discrimination ability as well as
amplification success rate was observed. In case of genus Quercus and Salix,
enhanced resolution with species delineation property has been observed. The only
limitation of utilizing this region is the presence of microinversions, i.e., small-scale
genetic inversion. These regions can lead to overestimation of genetic differences
present between plant species, which should be detected, reoriented, or detached
from the data (Group et al. 2009).
The Second International Conference of Barcode of Life conducted by CBOL
Plant working group recognized other spacer genes for the purpose of identification.
These include spacers like atpF-atpH and psbK-psbI. The spacer region “psbK-psbI”
exhibits high discrimination ability, but low universality. Ki-Joong investigated
floral species of South Korea and claimed positive amplification and sequencing
results in case by both spacer genes (atpF-atpH and psbK-psbI) for the purpose of
identification (Group et al. 2009).
The intergenic spacer between trnL and trnF is trnL intron which is used for
species identification due to the presence of P6 loop, a small stem loop structure. The
major strength of this region is the flanking variable loop of 10–143 bp also
exhibiting conserved primary sites. This small-sized barcode can be useful to
study the DNA, which is highly degraded and can be utilized to study complex
samples like faces with the help of latest technology of next-generation sequencing
(Shokralla et al. 2012).
Considering the significance of the eccentricity of the bar coding region and the
performance of barcoding regions in different land plants, there will always remain
species which would be better resolved by some other barcoding region (Lahaye
et al. 2008). Due to this conclusive attribute, plant DNA barcoding community is still
searching for single locus barcoding region which would be applicable to all land
plants.
Lahaye et al. (2008) projected that matK individually can be the sole barcode to
identify land plants, but because of low amplification success rate, the proposal was
not accepted widely. Further validation of other chloroplast region combination of
418 M. K. Thakar and T. Sharma
seven markers showcased the potential applicability as barcoding region. These were
rpoC1, rpoB, trnH-psbA, rbcL, atpF-H, psbK-I, and matK (Krawczyk et al. 2014). A
variety of combinations of these markers were presented at the second IBOL
conference held in Taipei, but no agreement was reached. No single barcoding
region in plants was able to solve the ultimate goal of identification. So two
barcodes, instead of one, were utilized for the identification. Later, multilocus
barcodes in different combination were proposed for the accurate and precise
identification without nay ambiguity (Han et al. 2013). Recently, Han et al. have
proposed ITS2 in place of ITS as reliable barcoding region which can act as single
locus universal plant DNA barcode (Hollingsworth 2008). The claims were rejected
by various researchers because in 2008 a paper published in nature has claimed ycf5
as potential segment of DNA in plant to work as candidate barcode (Yao et al. 2009).
Several studies have observed that high discrimination rate persists for psbA-trnH
(Yao et al. 2009; Bruyns et al. 2006; Ma et al. 2010) or for matK (Fazekas et al.
2008).
In multilocus barcode approach, two or more loci in combination are used and are
preferred than using (single-DNA region) single-locus barcode (Fazekas et al. 2009).
Some of the loci exhibit low discrimination rate, this may be because of low rate of
nucleotide substitution, hybridization, polyploidy, speciation, and transitions. Fur-
thermore, species defined on very constricted taxon concepts may be one of the
explanation for showcasing such low levels of intraspecific gene flow for plastid
markers (Theodoridis et al. 2012).
Theodoridis et al. (2012) also recommended the use of matK and psbA-trnH
barcoding region for the identification of medicinal plants belonging to family
Labiatae (Lamiaceae). In contrast, Schori and Showalter (2011) observed that
identification parameters and choice of candidate barcoding region vary with each
and every species of plant tested. The success rate of one barcoding region may not
completely suitable for other medicinal plant species. Muellner et al. (2011)
analyzed family mahogany (Meliaceae) and recommended the use of ITS/ITS2
barcode for successful identification. Nithaniyal et al. (2014) demonstrated the low
discriminatory rate and limited opportunities to identify closely related species of
timber specimens of Andhra Pradesh and Tamil Nadu with standard barcoding
region (matK and rbcL). The observations were further recommended by Bolson
et al. (2015) which analyzed tree species of high economical value.
other barcoding region in the plant genome, more opportunities were presented than
the present combination (Burgess et al. 2011; Cuénoud et al. 2002; Saarela et al.
2013).
Fig. 21.6 Sample collection, preservation, and utilization of DNA barcoding for the authentication
of specimen confiscated by police officials
420 M. K. Thakar and T. Sharma
standardized all over the globe and has also been available on the official site of
CBOL/BOLD.
Table 21.3 Universal primers of candidate barcoding regions used for identification of species
Candidate
Sl. barcoding Direction
No. region type Primer sequences Reference
1. rbcL Forward ATGTCACCACAAACAGAGACTAAAGC Hasebe
a-f et al.
(1994)
a-r Reverse CTTCTGCTACAAATAAGAATCGATCTC Hasebe
et al.
(1994)
1F Forward ATGTCACCACAAACAGAAAC Lledo
et al.
(1998)
724R Reverse TCGCATGTACCTGCAGTAGC Lledo
et al.
(1998)
2. matK Forward CGATCTATTCATTCAATATTTC Yu et al.
390F (2011)
1326R Reverse TCTAGCACACGAAAGTCGAAGT Yu et al.
(2011)
matK_1F Forward GAACTCGTCGGATGGAGTG Gernandt
et al.
(2005)
matK_1R Reverse GAGAAATCTTTTTCATTACTACAGTG Gernandt
et al.
(2005)
matK_2F Forward CGTACTTTTATGTTTACAGGCTAA Gernandt
et al.
(2005)
matK_2R Reverse TAAACGATCCTCTCATTCACGA Gernandt
et al.
(2005)
3. ITS Forward GCTGCGTTCTTCATCGATGC Cheng
ITS2 et al.
(2016)
ITS3 Reverse GCATCGATGAAGAACGCAGC Cheng
et al.
(2016)
ITS5 Forward GGAAGTAAAAGTCGTAACAAGG Cheng
et al.
(2016)
ITS4 Reverse TCCTCCGCTTATTGATATGC Cheng
et al.
(2016)
4. accD 3 AGTATGGGATCCGTAGTAGG Lee et al.
accD 1 (2004)
accD 3 Reverse TTTAAAGGATTACGTGGTAC Lee et al.
(2004)
(continued)
422 M. K. Thakar and T. Sharma
The amplified products can be sequenced by using BigDye Terminator v3.1 Cycle
Sequencing Kit by following manufacturer’s protocol, and the results can be
matched with blast search available with NCBI or BOLD website to verify the
similarity of obtained sequences with known sequences (Yao et al. 2009; Bruyns
et al. 2006; Ma et al. 2010). The input query (sequences) generates a number of
similarity indices. In case of certain plant species, not even a single sequence data is
available on NCBI or BOLD website, which makes it quite difficult to interpret the
unknown species. Research groups all around the world is emphasizing to generate
the database of the economically important plant species, which can be included in
such database portals for easy access and comparison by various organizations.
DNA barcoding has started spreading its branches and making available the facilities
to evaluate evidences to authenticate wildlife trophies, medicinal plants, and botani-
cal evidences collected from scene of crimes. The DNA barcoding can also be
attempted to analyze the samples of diatoms and phytoplanktons received in cases
of drowning, postmortem interval analysis with entomological evidences, and even
the toxicological evidences with respect to poisonous plant samples. Moreover, on a
larger scale, it also helps the ecologists, conservationists, foresters, agriculturalists,
and customs and quarantine officers (Fig. 21.7).
In 2016, CITES organization has asked the forensic scientific community to
answer five questions related to wildlife crime, which includes
424 M. K. Thakar and T. Sharma
Fig. 21.7 Utilization of DNA barcoding technology for the identification of specimen as well as
sequence data freely available on gene bank data portals to be used by researchers and general
public
The major challenge related to plant DNA barcoding is still unanswered that is
“agreement on candidate barcoding region” which would be universally applicable
to plant species (Group et al. 2009). With the advent of time, the studies related to
DNA barcoding are increasing in number, consequently the number sequences
submitted to GenBank portals are also increasing. Yet due to limited availability
of regional DNA sequence database, scientific community is unable to find answer
related to geographical locations of plant specimens confiscated (Wasser et al. 2008).
The legal aspects are bound not only with species of origin but also with the
nature of their extraction. The question of their nature, i.e., whether the specimen is
being extracted from the wild resources or cultivated is still unanswered and needs
attention (Halward et al. 1991). Lastly, the foremost important challenge is the
extraction of DNA from dried specimens (Hajibabaei et al. 2006), mixture of
specimens (Mishra et al. 2016), and specimens with contaminants which requires
special emphasizes (Newmaster et al. 2013; Cowan and Fay 2012).
21 The Utility of DNA Barcoding Technology in the Authentication of Medicinal. . . 425
21.7 Conclusions
References
Al-Qurainy F, Khan S, Ali MA, Al-Hemaid FM, Tarroum M, Ashraf M (2011) Authentication of
Ruta graveolens and ITS adulterant using internal transcribed spacer (ITS) sequences of nuclear
ribosomal DNA. Pak J Bot 43(3):1613–1620
Aubriot X, Lowry PP, Cruaud C, Couloux A, Haevermans T (2013) DNA barcoding in a
biodiversity hot spot: potential value for the identification of Malagasy Euphorbia L. listed in
CITES Appendices I and II. Mol Ecol Resour 13(1):57–65
Bolson M, de Camargo Smidt E, Brotto ML, Silva-Pereira V (2015) ITS and trnH-psbA as efficient
DNA barcodes to identify threatened commercial woody angiosperms from southern Brazilian
Atlantic rainforests. PLoS One 10(12):e0143049
Bordoloi R, Dutta KN (2014) A review on herbs used in the treatment of diabetes mellitus. J Pharm
Chem Biol Sci 2:86–92
Bruyns PV, Mapaya RJ, Hedderson TJ (2006) A new subgeneric classification for Euphorbia
(Euphorbiaceae) in southern Africa based on ITS and psbA-trnH sequence data. Taxon 55
(2):397–420
Burgess KS, Fazekas AJ, Kesanakurti PR, Graham SW, Husband BC, Newmaster SG, Percy DM,
Hajibabaei M, Barrett SC (2011) Discriminating plant species in a local temperate flora using
the rbcL+ matK DNA barcode. Methods Ecol Evol 2(4):333–340
Butchart SH, Stattersfield AJ, Bennun LA, Shutes SM, Akçakaya HR, Baillie JE et al (2004)
Measuring global trends in the status of biodiversity: red list indices for birds. PLoS Biol 2(12):
e383
Carvalho DC, Palhares RM, Drummond MG, Frigo TB (2015) DNA barcoding identification of
commercialized seafood in South Brazil: a governmental regulatory forensic program. Food
Control 50:784–788
Chandramohan A, Divya SR, Dhanarajan MS (2013) MatK gene based molecular characterization
of medicinal plant—Croton bonplandianum Baill. Int J Biosci Res 2:1–7
426 M. K. Thakar and T. Sharma
Chen S, Yao H, Han J, Liu C, Song J, Shi L, Zhu Y, Ma X, Gao T, Pang X, Luo K (2010) Validation
of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS One 5
(1):e8613
Cheng T, Xu C, Lei L, Li C, Zhang Y, Zhou S (2016) Barcoding the kingdom Plantae: new PCR
primers for ITS regions of plants with improved universality and specificity. Mol Ecol Resour
16(1):138–149
Coghlan ML, Haile J, Houston J, Murray DC, White NE, Moolhuijzen P et al (2012) Deep
sequencing of plant and animal DNA contained within traditional Chinese medicines reveals
legality issues and health safety concerns. PLoS Genet 8(4):e1002657
Cooper JE, Cooper ME (2013) Wildlife forensic investigation: principles and practice. CRC Press,
Boca Raton
Cowan RS, Fay MF (2012) Challenges in the DNA barcoding of plant material. In: Plant DNA
fingerprinting and barcoding. Humana Press, Totowa, NJ, pp 23–33
Cuénoud P, Savolainen V, Chatrou LW, Powell M, Grayer RJ, Chase MW (2002) Molecular
phylogenetics of Caryophyllales based on nuclear 18S rDNA and plastid rbcL, atpB, and matK
DNA sequences. Am J Bot 89(1):132–144
Dawson IK, Powell W (1999) Genetic variation in the Afromontane tree Prunus africana, an
endangered medicinal species. Mol Ecol 8(1):151–156
Dey SC (n.d.) The convention on international trade in endangered species of wild fauna and flora
(CITES)
Douwma G, Hollow T (2014) TRAFFIC’s vision. TRAFFIC Bull 26(1)
Dunning LT, Savolainen V (2010) Broad-scale amplification of matK for DNA barcoding plants, a
technical note. Bot J Linn Soc 164(1):1–9
Enan MR, Ahamed A (2014) DNA barcoding based on plastid matK and RNA polymerase for
assessing the genetic identity of date (Phoenix dactylifera L.) cultivars. Genet Mol Res 13
(2):3527–3536
Fazekas AJ, Burgess KS, Kesanakurti PR, Graham SW, Newmaster SG, Husband BC, Percy DM,
Hajibabaei M, Barrett SC (2008) Multiple multilocus DNA barcodes from the plastid genome
discriminate plant species equally well. PLoS One 3(7):e2802
Fazekas AJ, Kesanakurti PR, Burgess KS, Percy DM, Graham SW, Barrett SC, Newmaster SG,
Hajibabaei M, Husband BC (2009) Are plant species inherently harder to discriminate than
animal species using DNA barcoding markers? Mol Ecol Resour 9:130–139
Fazekas AJ, Kuzmina ML, Newmaster SG, Hollingsworth PM (2012) DNA barcoding methods for
land plants. In: DNA barcodes. Humana Press, Totowa, NJ, pp 223–252
Ferri G, Corradini B, Ferrari F, Santunione AL, Palazzoli F, Alu M (2015) Forensic botany II, DNA
barcode for land plants: which markers after the international agreement? Forensic Sci Int Genet
15:131–136
Gao T, Yao H, Song J, Zhu Y, Liu C, Chen S (2010) Evaluating the feasibility of using candidate
DNA barcodes in discriminating species of the large Asteraceae family. BMC Evol Biol 10
(1):324
Gernandt DS, López GG, García SO, Liston A (2005) Phylogeny and classification of Pinus. Taxon
54(1):29–42
Group CPW, Hollingsworth PM, Forrest LL, Spouge JL, Hajibabaei M, Ratnasingham S, van der
Bank M, Chase MW, Cowan RS, Erickson DL, Fazekas AJ (2009) A DNA barcode for land
plants. Proc Natl Acad Sci U S A 106(31):12794–12797
Group CPB, Li DZ, Gao LM, Li HT, Wang H, Ge XJ, Liu JQ, Chen ZD, Zhou SL, Chen SL, Yang
JB (2011) Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS)
should be incorporated into the core barcode for seed plants. Proc Natl Acad Sci U S A 108
(49):19641–19646
Guo X, Wang X, Su W, Zhang G, Zhou R (2011) DNA barcodes for discriminating the medicinal
plant Scutellaria baicalensis (Lamiaceae) and its adulterants. Biol Pharm Bull 34(8):1198–1203
Haibin W, Kunming G (1999) Wildlife trade in Yunnan Province, China, at the border with
Vietnam. TRAFFIC Bull 18:21–30
21 The Utility of DNA Barcoding Technology in the Authentication of Medicinal. . . 427
Hajibabaei M, deWaard JR, Ivanova NV, Ratnasingham S, Dooh RT, Kirk SL, Mackie PM, Hebert
PD (2005) Critical factors for assembling a high volume of DNA barcodes. Philos Trans R Soc
B Biol Sci 360(1462):1959–1967
Hajibabaei M, Smith MA, Janzen DH, Rodriguez JJ, Whitfield JB, Hebert PD (2006) A minimalist
barcode can identify a specimen whose DNA is degraded. Mol Ecol Notes 6(4):959–964
Hajibabaei M, Singer GA, Hebert PD, Hickey DA (2007) DNA barcoding: how it complements
taxonomy, molecular phylogenetics and population genetics. Trends Genet 23(4):167–172
Halward TM, Stalker HT, Larue EA, Kochert G (1991) Genetic variation detectable with molecular
markers among unadapted germ-plasm resources of cultivated peanut and related wild species.
Genome 34(6):1013–1020
Han J, Zhu Y, Chen X, Liao B, Yao H, Song J, Chen S, Meng F (2013) The short ITS2 sequence
serves as an efficient taxonomic sequence tag in comparison with the full-length ITS. BioMed
Res Int 2013:741476
Hasebe M, Omori T, Nakazawa M, Sano T, Kato M, Iwatsuki K (1994) rbcL gene sequences
provide evidence for the evolutionary lineages of leptosporangiate ferns. Proc Natl Acad Sci U S
A 91(12):5730–5734
Hebert PD, Cywinska A, Ball SL, Dewaard JR (2003) Biological identifications through DNA
barcodes. Proc R Soc Lond Ser B Biol Sci 270(1512):313–321
Hollingsworth PM (2008) DNA barcoding plants in biodiversity hot spots: progress and outstand-
ing questions. Heredity (Edinb) 101(1):1–2
Hollingsworth PM, Graham SW, Little DP (2011) Choosing and using a plant DNA barcode. PLoS
One 6(5):e19254
Hou D, Song J, Shi L, Ma X, Xin T, Han J, Xiao W, Sun Z, Cheng R, Yao H (2013) Stability and
accuracy assessment of identification of traditional Chinese materia medica using DNA
barcoding: a case study on Flos Lonicerae Japonicae. BioMed Res Int 2013(1):549037
Hu Z, Tu Y, Xia Y, Cheng P, Sun W, Shi Y, Guo L, He H, Xiong C, Chen S, Zhang X (2015) Rapid
identification and verification of indirubin-containing medicinal plants. Evid Based Comple-
mentary Altern Med 2015:484670
Krawczyk K, Szczecińska M, Sawicki J (2014) Evaluation of 11 single-locus and seven multilocus
DNA barcodes in Lamium L. (Lamiaceae). Mol Ecol Resour 14(2):272–285
Kress WJ, Erickson DL (2007) A two-locus global DNA barcode for land plants: the coding rbcL
gene complements the non-coding trnH-psbA spacer region. PLoS One 2(6):e508
Kress WJ, García-Robledo C, Uriarte M, Erickson DL (2015) DNA barcodes for ecology, evolu-
tion, and conservation. Trends Ecol Evol 30(1):25–35
Lahaye R, Van der Bank M, Bogarin D, Warner J, Pupulin F, Gigot G, Maurin O, Duthoit S,
Barraclough TG, Savolainen V (2008) DNA barcoding the floras of biodiversity hotspots. Proc
Natl Acad Sci U S A 105(8):2923–2928
Lange DAGMAR (2006) International trade in medicinal and aromatic plants: actors, volumes and
commodities. Frontis:155–170
Lee SS, Jeong WJ, Bae JM, Bang JW, Liu JR, Harn CH (2004) Characterization of the plastid-
encoded carboxyltransferase subunit (accD) gene of potato. Mol Cells 17(3):422–429
Lee SC, Chiou SJ, Yen JH, Lin TY, Hsieh KT, Yang JC (2010) DNA barcoding Cinnamomum
osmophloeum Kaneh. Based on the partial non-coding ITS2 region of ribosomal genes. J Food
Drug Anal 18(2)
Li Y, Ruan J, Chen S, Song J, Luo K, Lu D, Yao H (2010) Authentication of Taxillus chinensis
using DNA barcoding technique. J Med Plants Res 4(24):2706–2709
Li FW, Kuo LY, Rothfels CJ, Ebihara A, Chiou WL, Windham MD, Pryer KM (2011) rbcL and
matK earn two thumbs up as the core DNA barcode for ferns. PLoS One 6(10):e26597
Li X, Yang Y, Henry RJ, Rossetto M, Wang Y, Chen S (2015) Plant DNA barcoding: from gene to
genome. Biol Rev 90(1):157–166
Linacre A, Tobe SS (2011) An overview to the investigative approach to species testing in wildlife
forensic science. Investig Genet 2(1):2
428 M. K. Thakar and T. Sharma
Little DP (2014) Authentication of Ginkgo biloba herbal dietary supplements using DNA
barcoding. Genome 57(9):513–516
Lledo MD, Crespo MB, Cameron KM, Fay MF, Chase MW (1998) Systematics of Plumbaginaceae
based upon cladistic analysis of rbcL sequence data. Syst Bot 23:21–29
Ma XY, Xie CX, Liu C, Song JY, Yao H, Luo K, Zhu YJ, Gao T, Pang XH, Qian J, Chen SL (2010)
Species identification of medicinal pteridophytes by a DNA barcode marker, the chloroplast
psbA-trnH intergenic region. Biol Pharm Bull 33(11):1919–1924
Mishra P, Kumar A, Nagireddy A, Mani DN, Shukla AK, Tiwari R, Sundaresan V (2016) DNA
barcoding: an efficient tool to overcome authentication challenges in the herbal market. Plant
Biotechnol J 14(1):8–21
Muellner AN, Schaefer H, Lahaye R (2011) Evaluation of candidate DNA barcoding loci for
economically important timber species of the mahogany family (Meliaceae). Mol Ecol Resour
11(3):450–460
Newmaster SG, Fazekas AJ, Ragupathy S (2006) DNA barcoding in land plants: evaluation of rbcL
in a multigene tiered approach. Botany 84(3):335–341
Newmaster SG, Grguric M, Shanmughanandhan D, Ramalingam S, Ragupathy S (2013) DNA
barcoding detects contamination and substitution in North American herbal products. BMC
Med 11(1):222
Nithaniyal S, Newmaster SG, Ragupathy S, Krishnamoorthy D, Vassou SL, Parani M (2014) DNA
barcode authentication of wood samples of threatened and commercial timber trees within the
tropical dry evergreen forest of India. PLoS One 9(9):e107669
Palhares RM, Drummond MG, Brasil BDSAF, Cosenza GP, Brandão MDGL, Oliveira G (2015)
Medicinal plants recommended by the world health organization: DNA barcode identification
associated with chemical analyses guarantees their quality. PLoS One 10(5):e0127866
Pan S-Y, Litscher G, Gao S-H, Zhou S-F, Yu Z-L, Chen H-Q, Zhang S-F, Tang M-K, Sun J-N, Ko
K-M (2014) Historical perspective of traditional indigenous medical practices: the current
renaissance and conservation of herbal resources. Evid Based Complement Alternat Med
2014:1
Pang X, Song J, Zhu Y, Xie C, Chen S (2010) Using DNA barcoding to identify species within
Euphorbiaceae. Planta Med 76(15):1784–1786
Parvathy VA, Swetha VP, Sheeja TE, Leela NK, Chempakam B, Sasikumar B (2014) DNA
barcoding to detect chilli adulteration in traded black pepper powder. Food Biotechnol 28
(1):25–40
Pawlowski J, Audic S, Adl S, Bass D, Belbahri L, Berney C, Bowser SS, Cepicka I, Decelle J,
Dunthorn M, Fiore-Donno AM (2012) CBOL protist working group: barcoding eukaryotic
richness beyond the animal, plant, and fungal kingdoms. PLoS Biol 10(11):e1001419
Rajendran R, Basha NS (2010) Antimicrobial activity of crude extracts and fractions of Premna
serratifolia Linn., root. Med Plants 2(1):1–6
Reeve R (2014) Policing international trade in endangered species: the CITES treaty and compli-
ance. Routledge, UK
Rogers SO, Bendich AJ (1989) Extraction of DNA from plant tissues. In: Plant molecular biology
manual. Springer, Dordrecht, pp 73–83
Saarela JM, Sokoloff PC, Gillespie LJ, Consaul LL, Bull RD (2013) DNA barcoding the Canadian
Arctic flora: core plastid barcodes (rbcL+ matK) for 490 vascular plant species. PLoS One 8
(10):e77982
Sass C, Little DP, Stevenson DW, Specht CD (2007) DNA barcoding in the cycadales: testing the
potential of proposed barcoding markers for species identification of cycads. PLoS One 2(11):
e1154
Schori M, Showalter AM (2011) DNA barcoding as a means for identifying medicinal plants of
Pakistan. Pak J Bot 43:1–4
Sen S, Chakraborty R, De B (2011) Challenges and opportunities in the advancement of herbal
medicine: India’s position and role in a global context. J Herb Med 1(3–4):67–75
21 The Utility of DNA Barcoding Technology in the Authentication of Medicinal. . . 429
Shokralla S, Spall JL, Gibson JF, Hajibabaei M (2012) Next-generation sequencing technologies
for environmental DNA research. Mol Ecol 21(8):1794–1805
Subrat N, Iyer M, Prasad R (2002) The ayurvedic medicine industry: current status and
sustainability. Ecotech Services, London, and International Institute for Environment and
Development, New Delhi
Techen N, Parveen I, Pan Z, Khan IA (2014) DNA barcoding of medicinal plant material for
identification. Curr Opin Biotechnol 25:103–110
Theodoridis S, Stefanaki A, Tezcan M, Aki C, Kokkini S, Vlachonasios KE (2012) DNA barcoding
in native plants of the Labiatae (Lamiaceae) family from Chios Island (Greece) and the adjacent
Çeşme-Karaburun Peninsula (Turkey). Mol Ecol Resour 12(4):620–633
Valentini A, Pompanon F, Taberlet P (2009) DNA barcoding for ecologists. Trends Ecol Evol 24
(2):110–117
Vassou SL, Kusuma G, Parani M (2015) DNA barcoding for species identification from dried and
powdered plant parts: a case study with authentication of the raw drug market samples of Sida
cordifolia. Gene 559(1):86–93
Vidyarthi S, Samant SS, Sharma P (2013) Dwindling status of Trillium govanianum Wall. ex
D. Don-A case study from Kullu district of Himachal Pradesh, India. J Med Plants Res 7
(8):392–397
Vijayan K, Tsou CH (2010) DNA barcoding in plants: taxonomy in a new perspective. Curr Sci
99:1530–1541
Wakdikar S (2004) Global health care challenge: Indian experiences and new prescriptions.
Electron J Biotechnol 7(3):02–03
Warchol GL (2004) The transnational illegal wildlife trade. Crim Justice Stud 17(1):57–73
Wasser SK, Joseph Clark WILLIAM, Drori O, Stephen Kisamo EMILY, Mailand C, Mutayoba B,
Stephens M (2008) Combating the illegal trade in African elephant ivory with DNA forensics.
Conserv Biol 22(4):1065–1071
Wellsmith M (2011) Wildlife crime: the problems of enforcement. Eur J Crim Policy Res 17
(2):125–148
Werle E, Schneider C, Renner M, Völker M, Fiehn W (1994) Convenient single-step, one tube
purification of PCR products for direct sequencing. Nucleic Acids Res 22(20):4354
Wong EHK, Hanner RH (2008) DNA barcoding detects market substitution in North American
seafood. Food Res Int 41(8):828–837
Wong KL, But PH, Shaw PC (2013) Evaluation of seven DNA barcodes for differentiating closely
related medicinal Gentiana species and their adulterants. Chin Med 8(1):16
Wyatt T, Johnson K, Hunter L, George R, Gunter R (2018) Corruption and wildlife trafficking:
three case studies involving Asia. Asian J Criminol 13(1):35–55
Yao H, Song JY, Ma XY, Liu C, Li Y, Xu HX, Han JP, Duan LS, Chen SL (2009) Identification of
Dendrobium species by a candidate DNA barcode sequence: the chloroplast psbA-trnH
intergenic region. Planta Med 75(06):667–669
Yao H, Song J, Liu C, Luo K, Han J, Li Y, Pang X, Xu H, Zhu Y, Xiao P, Chen S (2010) Use of
ITS2 region as the universal DNA barcode for plants and animals. PLoS One 5(10):e13102
Yu J, Xue JH, Zhou SL (2011) New universal matK primers for DNA barcoding angiosperms. J
Syst Evol 49(3):176–181
Zhou J, Wang W, Liu M, Liu Z (2014) Molecular authentication of the traditional medicinal plant
Peucedanum praeruptorum and its substitutes and adulterants by DNA-barcoding technique.
Pharmacogn Mag 10(40):385
DNA Barcoding in Forensic Mycology:
Concepts, Limitations, and Future 22
Prospects
Abstract
Keywords
22.1 Introduction
Mushrooms are ubiquitous and, therefore, are consumed worldwide for their
nutritional value. But, sometimes, they can be the cause of accidental poisoning
deaths due to misidentification of edible and inedible species while foraging wild
mushrooms. The incidences of mushroom poisonings have been reported in different
parts of the world since ancient times. About 5000 mushroom species have been
identified and recorded, and about 50–100 species of mushroom are known to cause
poisoning effects and deaths when consumed. The first report of mushroom poison-
ing dates back to 430 BC by Euripides, where the author mentioned about the fatal
poisoning case of his family (Berger and Guss 2005). Another case of Amanita
mushroom poisoning was reported in which a Gulf Coast family died of fulminant
hepatic failure after consumption of wild mushrooms (O’Brien and Khuu 1996).
Recently, a retrospective study on the meta-analysis of several mushroom poisoning
cases has been conducted worldwide, and a significant increase in the frequency of
mushroom poisoning cases was observed over the years (Diaz 2017). Erguven et al.
(2007) analyzed 39 pediatric patients from 1994 to 2004 of mushroom poisoning and
reported that 59% of patients were females and 41% were males. In Italy from 1996
to 2000, about 10,000 cases of mushroom poisoning were reported and about 2400
of these cases showed a long incubation, 22 cases resulted in the death of patients,
and nine required liver transplants due to severe hepatic insufficiency. Also, in
northern Italy from 2005 to 2008, 15% of poisoning cases have been caused by
Lepiota, Amanita, and Inocybe (Epis et al. 2010). Due to the lack of global data, it is
22 DNA Barcoding in Forensic Mycology: Concepts, Limitations, and Future Prospects 433
Generally, forensic mycology has four facets comprising (1) cause and manner of
death, (2) determination of postmortem interval, (3) location of the corpse, and
(4) biological warfare. However, to the best of author’s knowledge, no case of
biological warfare using fungi have been reported; therefore, this aspect will not
be discussed in detail in the present review. For more insights, readers are advised to
read an excellent review by Hawksworth and Wiltshire (2011). In this chapter, we
will be focusing on first three facets of forensic mycology.
Mushrooms are fungi with large fruiting bodies which are often consumed as
delicacies all over the world. However, many mushrooms can either prove to be
toxic or hallucinogenic if consumed mistakenly. In such cases, their identification
can help in ascertaining the cause and manner of death. Genus Amanita, Lepiota, and
Galerina are familiar to humans as certain species are well-known for causing
poisoning that often results in death. Among these members, genus Amanita is
responsible for around 90% of global deaths due to mushroom poisoning which is
primarily due to accidental consumption of misidentified wild mushrooms (Lima
et al. 2012; Garcia et al. 2015; Zhou et al. 2017). On the other hand, hallucinogenic
mushrooms are also confiscated in cases of illegal trade, mostly in the form of
434 S. Sharma et al.
14
Nunber of paper published
12
10
8
6
4
2
0
Poisonous Hallucinogenic Fungi As Trace
Mushrooms Mushrooms Evidence
Fig. 22.1 Distribution of the number of papers published on DNA-based identification of forensi-
cally important fungal species
436 S. Sharma et al.
The identification of fungal genera using taxonomic keys is often impossible in cases
of degraded samples and has traditionally been the specialized area of taxonomists,
providing a nomenclatural backbone and a key prerequisite for numerous biological
studies but has a limitation in analyzing degraded samples. The idea of a
22 DNA Barcoding in Forensic Mycology: Concepts, Limitations, and Future Prospects 437
Table 22.1 Summary of common markers used in DNA barcoding methods for forensically
important fungal species
Locus Primer sequence (50 –30 ) Orientation Reference
ITS 1 TCCGTAGGTGAACCTGCGG Forward White et al. (1990),
ITS 4 TCCTCCGCTTATTGATATGC Reverse Oda et al. (1999,
ITS 1 TCCGTAGGTGAACCTGCGG Forward 2004), Gonzalez et al.
(2002), Zhang et al.
ITS 2 GCTGCGTTCTTCATCGATGC Reverse
(2004, 2010), Cai et al.
ITS 3 GCATCGATGAAGAACGCAGC Forward (2014), Jansson et al.
ITS 4 TCCTCCGCTTATTGATATGC Reverse (2018), Nilsson et al.
ITS 5 GGAAGTAAAAGTCGTAACAAGG Forward (2012), Sugawara
ITS 4 TCCTCCGCTTATTGATATGC Reverse et al. (2016) Fu et al.
(2017), Weiß et al.
(1998)
nrLSU LROR—ACCCGCTGAACTTAAGC Forward Cai et al. (2014)
(nuclear LR5—ATCCTGAGGGAAACTTC Reverse Vilgalys and Hester
large (1990)
subunit)
rpb2 (RNA Am-6— Forward Zhang et al. (2004,
polymerase TGGGGSSTGGTRTGYCCTGC 2010), Cai et al.
II) Am-7— Reverse (2014)
CCCATKGCTTGTTTRCCCATGGC
ef 1-α 983— Forward Zhang et al. (2004,
(translation GCYCCYGGHCAYCGTGAYTTYAT 2010), Cai
elongation 1567— Reverse et al. (2014).
factor ACHGTRCCRATACCACCRAT
1-alpha)
β-Tubulin Am— Forward Zhang et al. (2004,
(Btub) AAGCGGAGCRGGTAACAAYTGG 2010), Cai et al.
Am— Reverse (2014)
ACRAGYTGGTGRACRGAGAGYG
many researchers have reported ITS as “universal primer pair” for the amplification
of fungal sequence. The details of the common markers used as DNA barcode for the
species identification of fungal evidence are given in Table 22.1.
The second basic requirement is DNA isolation and high-throughput sequencing
analysis to address the problem of misidentified sequences. The first database called
the Ribosomal Database Project (RPD) initially included nuclear small subunit
(SSU) rRNA gene sequence. Recent additions to RPD include a database for ITS
and large subunit (LSU) rRNA genes. To further enhance the sequence accuracy, a
number of other databases focused on specific marker sequences have been built.
The most common is UNITE (https://unite.ut.ee) database which is a web-based
database and sequence management environment developed for ITS sequences of
fungi. The UNITE database now acts as GenBank for all fungal ITS sequences from
environmental samples (Hibbett et al. 2016; Schoch et al. 2014). Various other
standard protocols have been developed that are also available in the form of
commercial kits such as QIAquick PCR purification kit (Qiagen) and sequencing
by BigDye Terminator sequencing reagents (Kowalczyk et al. 2015; Raja et al.
22 DNA Barcoding in Forensic Mycology: Concepts, Limitations, and Future Prospects 439
2017a). ITSx, a Perl-based software tool to extract ITS1, 5.8S gene, and ITS2, and
full-length ITS sequences have been introduced from both Sanger and high-
throughput sequencing (HTS) data sets. A number of ITSx pave the way for more
sensitive Basic Local Alignment Search Tool (BLAST) searches, sequence cluster-
ing operations, and are also useful for amplicon-based next-generation sequencing.
The third component is a database containing DNA sequences of the genetic
markers for the majority of species to be identified. The desired properties of DNA
barcodes are clearly defined: (1) the DNA fragment must be nearly identical in
specimens of the same species but different between individuals of different species,
(2) the section must be standardized (the same section should be used in different
taxonomic groups), and (3) the marker must be robust, with conservative primer
building sites that allow it to be readily amplified and sequenced.
For fungi, ITS regions work well, but sequence should be confirmed with
GenBank identifications. DNA taxonomy employing phylogenetic analysis is useful
for placing an unknown sequence into an existing classification in an evolutionary
framework. Researchers are still trying to find a single segment of DNA suitable for
the identification of all taxa. Despite several years of work in this area, such a region
has not been identified and a single universal DNA barcoding marker is unlikely to
exist. Figure 22.2 demonstrates the systematic approach to be followed for the fungal
species identification. If samples are encountered in a fresh and intact state, morpho-
logical features can be used; however, DNA extraction methods, PCR amplification,
and sequencing must be used for the absolute identification. When the samples are
highly degraded, direct PCR and real-time PCR analysis can be helpful in species
identification. In both the cases, ITS which is marked as universal primer pair in case
of fungal genera is to be employed.
information and geo-reference data (Blackwell 2011). This may either be due to
non-availability of authentic samples or due to availability of old or highly degraded
samples for DNA profiling.
One solution to the above-mentioned problem is to use epitype. An epitype is a
specimen or illustration selected to serve as an interpretative type when the holotype,
lectotype, or previously designated neotype, or all original material associated with a
validly published name, is demonstrably ambiguous and cannot be critically
identified for purposes of the precise application of the name of a taxon. It is
mandatory to cite the holotype, lectotype, or nectotype which is supported by
designated epitype (Hyde and Zhang 2008).
22.5 Conclusions
The use of forensic mycology in ascertaining the cause and time of death along with
the location of corpses has increased in the last decade; however, its full potential is
yet to be explored. Forensic mycology stands on the pillars of taxonomic identifica-
tion and DNA barcoding. With various limitations faced by the taxonomic identifi-
cation, it is imperative to use DNA barcoding for absolute identification. DNA
barcoding has the potential to identify fungal species encountered in various forms
(cooked and gastric aspirates) effectively and accurately. Many studies have
identified mixed-species using sequencing methods. However, less work has been
reported related to DNA-based identification in cases of fungi found as trace
evidence to determine time since death and location of the corpse. There is a need
to examine more related cases from different parts of the world having varying
climatic conditions, so that the pattern and rate of fungal growth can be determined
accurately. Also, due to the lack of proper database sequences, forensic mycology is
at a developing stage. Where morphological data is inconclusive, fungal evidence
can be analyzed through DNA barcoding for the species identification. DNA
barcoding is set to facilitate improvement in the existing identification methods,
and it will transform the field of forensic mycology.
References
Bellini E, Ambrosio E, Di Piazza S, Gabbrielli M, Zotti M (2015) microfungi on human corpse in
the skeletisation stage. In: Seventh European academy of forensic science congress, Prague,
6–11 Sept, Czech Republic
Berger KJ, Guss DA (2005) Mycotoxins revisited: Part I. J Emerg Med 28(1):53–62. https://doi.org/
10.1016/j.jemermed.2004.08.013
Blackwell M (2011) The fungi: 1,2,3. . . 5.1 million species? Am J Bot 98:426–438. https://doi.org/
10.3732/ajb.1000298
Bresinsky H, Besl A (1990) A colour atlas of poisonous fungi: a handbook for pharmacists, doctors,
and biologists. Wolf Publishing, London
Bridge P (2002) The history and application of molecular mycology. Mycologist 16:90–99. https://
doi.org/10.1017/S0269-915X(02)00201-X
Cai Q, Tulloss RE, Tang LP, Tolgor B, Zhang P, Chen ZH, Yang ZL (2014) Multi-locus phylogeny
of lethal amanitas: implications for species diversity and historical biogeography. BMC Evol
Biol 14:143. https://doi.org/10.1186/1471-2148-14-143
Cecilia TM, Noemi CM (2017) The mycology as forensics tool. Adv Tech Biol Med 05:10–11.
https://doi.org/10.4172/2379-1764.1000226
Chen Z, Zhang P, Zhang Z (2012) Investigation and analysis of 102 mushroom poisoning cases in
Southern China from 1994 to 2012. Fungal Divers 64:123–131. https://doi.org/10.1007/s13225-
013-0260-7
Dasmahapatra KK, Mallet J (2006) Taxonomy: DNA barcodes: recent successes and future
prospects. Heredity (Edinb) 97:254–255. https://doi.org/10.1038/sj.hdy.6800858
Dentinger BTM, Margaritescu S, Moncalvo JM (2010) Rapid and reliable high-throughput methods
of DNA extraction for use in barcoding and molecular systematics of mushrooms. Mol Ecol
Resour 10:628–633. https://doi.org/10.1111/j.1755-0998.2009.02825.x
Diaz JH (2017) Amatoxin-containing mushroom poisonings: species, toxidromes, treatments, and
outcomes. Wilderness Environ Med 29:111–118. https://doi.org/10.1016/j.wem.2017.10.002
Enjalbert F, Rapior S, Nouguier-Soule J, Guillon S, Amouroux N (2002) Treatment of amatoxin
poisoning: 20-year retrospective study. J Toxicol Clin Toxicol 40:715–757. https://doi.org/10.
1081/CLT-120014646
Epis S, Matinato C, Gentili G, Varotto F, Bandi C, Sassera D (2010) Molecular detection of
poisonous mushrooms in different matrices. Mycologia 102(3):747–754. https://doi.org/10.
3852/09-124
Erguven M, Yilmaz O, Deveci M, Aksu N, Dursun F, Pelit M, Cebeci N (2007) Mushroom
poisoning. Indian J Pediatr 74:847–852
Fišer Pečnikar Z, Buzan EV (2014) 20 years since the introduction of DNA barcoding: from theory
to application. J Appl Genet 55:43–52. https://doi.org/10.1007/s13353-013-0180-y
Frézal L, Leblois R (2008) Four years of DNA barcoding: current advances and prospects. Infect
Genet Evol 8:727–736. https://doi.org/10.1016/j.meegid.2008.05.005
Fu X, Fu B, He Z, Gong M, Li Z, Chen Z (2017) Acute renal failure caused by Amanita
oberwinklerana poisoning. Mycoscience 58:121–127. https://doi.org/10.1016/j.myc.2016.12.
004
Gambaro V, Roda G, Visconti GL, Arnoldi S, Casagni E, Dell’Acqua L, Farè F, Paladino E,
Rusconi C, Arioli S, Mora D (2016) DNA-based taxonomic identification of basidiospores in
hallucinogenic mushrooms cultivated in “grow-kits” seized by the police: LC-UV quali-quanti-
tative determination of psilocybin and psilocin. J Pharm Biomed Anal 125:427–432. https://doi.
org/10.1016/j.jpba.2016.03.043
Garcia J, Costa VM, Costa AE, Andrade S, Carneiro AC, Conceição F, Paiva JA, de Pinho PG,
Baptista P, de Lourdes Bastos M, Carvalho F (2015) Co-ingestion of amatoxins and isoxazoles-
containing mushrooms and successful treatment: a case report. Toxicon 103:55–59. https://doi.
org/10.1016/j.toxicon.2015.06.012
444 S. Sharma et al.
Khaund P, Joshi SR (2014) DNA barcoding of wild edible mushrooms consumed by the ethnic
tribes of India. Gene 550:123–130. https://doi.org/10.1016/j.gene.2014.08.027
Koljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AF, Bahram M, Bates ST, Bruns TD,
Bengtsson-Palme J, Callaghan TM, Dauglas B, Drenkhan T, Eberhardt U, Duenas M,
Grebenc T, Griffith GW, Hartmann M, Kirk M, Kohout P, Larsson E, Lindahl BD,
Lucking R, Martin MP, Matheny PB, Nguyen NH, Niskanen T, Oja J, Peay KG, Peintner U,
Peterson M, Poldmaa K, Saag L, Saar I, Schubler A, Scott JA, Senes C, Smith ME, Suija A,
Taylor DL, Telleria MT, Weiss M, Larsson KH (2014) Towards a unified paradigm for
sequence-based identification of fungi. Mol Ecol 22:5271–5277. https://doi.org/10.1111/mec.
12481
Kowalczyk M, Sekuła A, Mleczko P, Olszowy Z, Kujawa A, Zubek S, Kupiec T (2015) Practical
aspects of genetic identification of hallucinogenic and other poisonous mushrooms for clinical
and forensic purposes. Croat Med J 56:32–40. https://doi.org/10.3325/cmj.2015.56.32
Kress WJ, Erickson DL (2007) A two-locus global DNA barcode for land plants: the coding rbcL
gene complementa the non-coding trnH-psbA spacer region. PLoS One 2(6):e508. https://doi.
org/10.1371/journal.pone.0000508
Lee JCI, Cole M, Linacre A (2000) Identification of members of the genera Panaeolus and
Psilocybe by a DNA test: a preliminary test for hallucinogenic fungi. Forensic Sci Int
112:123–133. https://doi.org/10.1016/S0379-0738(00)00181-X
Li P, Deng W, Li T (2014) The molecular diversity of toxin gene families in lethal Amanita
mushrooms. Toxicon 83:59–68. https://doi.org/10.1016/j.toxicon.2014.02.020
Lima AD, Costa Fortes R, Carvalho Garbi Novaes MR, Percário S (2012) Poisonous mushrooms; a
review of the most common intoxications. Nutr Hosp 27(2):402–408. https://doi.org/10.3305/
nh.2012.27.2.5328
Linacre A, Cole M, Lee JC (2002) Identifying the presence of “magic mushrooms” by DNA
profiling. Sci Justice 42(1):50–54. https://doi.org/10.1016/S1355-0306(02)71797-8
Maeta K, Ochi T, Tokimoto K, Shimomura N, Maekawa N, Kawaguchi N, Nakaya M, Kitamoto Y,
Aimi T (2008) Rapid species identification of cooked poisonous mushrooms by using real-time
PCR. Appl Environ Microbiol 74(10):3306–3309. https://doi.org/10.1128/AEM.02082-07
Margarida A, Félix C, de Maria LB, Pinho PG, Carvalho M (2015) The hallucinogenic world of
tryptamines: an updated review. Arch Toxicol:1151–1173. https://doi.org/10.1007/s00204-015-
1513-x
Maruyama T, Kawahara N, Yokoyama K, Makino Y, Fukiharu T, Goda Y (2006) Phylogenetic
relationship of psychoactive fungi based on rRNA gene for a large subunit and their identifica-
tion using the TaqMan assay (II). Forensic Sci Int 163:51–58. https://doi.org/10.1016/j.forsciint.
2004.10.028
Matsushima Y, Eguchi F, Kikukawa T, Matsuda T (2009) Historical overview of psychoactive
mushrooms. Inflamm Regener 29(1):47–58. https://doi.org/10.2492/inflammregen.29.47
Mouhamadou B, Carriconde F, Gryta H, Jargeat P, Manzi S, Gardes M (2008) Molecular evolution
of mitochondrial ribosomal DNA in the fungal genus Tricholoma: barcoding implications.
Fungal Genet Biol 45:1219–1226. https://doi.org/10.1016/j.fgb.2008.06.006
Nagy J, Veress T (2016) HPLC analysis of hallucinogenic mushroom alkaloids (psilocin and
psilocybin) applying hydrophilic interaction chromatography (HILIC). J Forensic Res 7:356.
https://doi.org/10.4172/2157-7145.1000356
Nilsson RH, Tedersoo L, Abarenkov K, Ryberg M, Kristiansson E, Hartmann M, Schoch CL,
Nylander JAA, Bergsten J, Porter TM, Jumpponen A, Vaishampayan P, Ovaskainen O,
Hallenberg N, Bengtsson-Palme J, Eriksson KM, Larsson KH, Larsson E, Kõljalg U (2012)
Five simple guidelines for establishing basic authenticity and reliability of newly generated
fungal ITS sequences. MycoKeys 4:37–63. https://doi.org/10.3897/mycokeys.4.3606
Nugent NG, Saville BJ (2004) Forensic analysis of hallucinogenic fungi: a DNA-based approach.
Forensic Sci Int 140:147–157. https://doi.org/10.1016/j.forsciint.2003.11.022
O’Brien BL, Khuu L (1996) A fatal Sunday brunch: Amanita mushroom poisoning in a gulf coast
family. Am J Gastroentrol 91:581–583
446 S. Sharma et al.
Oda T, Tanaka C, Tsuda M (1999) Molecular phylogeny of Japanese Amanita species based on
nucleotide sequences of the internal transcribed spacer region of nuclear ribosomal DNA.
Mycoscience 40(1):57–64
Oda T, Tanaka C, Tsuda M (2004) Molecular phylogeny and biogeography of the widely
distributed Amanita species, A. muscaria and A. pantherina. Mycol Res 108:885–896. https://
doi.org/10.1017/S0953756204000620
Parnmen S, Sikaphan S, Leudang S, Boonpratuang T, Rangsiruji A, Naksuwankul K (2016)
Molecular identification of poisonous mushrooms using nuclear ITS region and peptide toxins:
a retrospective study on fatal cases in Thailand. J Toxicol Sci 41:65–76. https://doi.org/10.2131/
jts.41.65
Piazza SD, Zotti M, Barranco R, Cecchi G, Greco G, Ventura F (2018) Post-mortem fungal
colonization pattern during 6 weeks: two case studies. Forensic Sci Int 289:e18–e23. https://
doi.org/10.1016/j.forsciint.2018.05.037
Prakash PY, Irinyi L, Halliday C, Chen S (2017) Online databases for the taxonomy and identifica-
tion of pathogenic fungi and proposal for a cloud-based dynamic data network platform. J Clin
Microbiol 55:1011–1024. https://doi.org/10.1128/JCM.02084-16
Raja HA, Miller AN, Pearce CJ, Oberlies NH (2017a) Fungal identification using molecular tools: a
primer for the natural products research community. J Nat Prod 80(3):756–770. https://doi.org/
10.1021/acs.jnatprod.6b01085
Raja HA, Baker TR, Little JG, Oberlies NH (2017b) DNA barcoding for identification of consumer-
relevant mushrooms: a partial solution for product certification? Food Chem 214:383–392.
https://doi.org/10.1016/j.foodchem.2016.07.052
Ratnasingham S, Hebert PDN (2007) Barcoding, bold: the barcode of life data system. Mol Ecol
Notes 7:355–364. https://doi.org/10.1111/j.1471-8286.2006.01678.x. www.barcodinglife.org
Santi L, Maggioli C, Mastroroberto M, Tufoni M, Napoli L, Caraceni P (2012) Acute liver failure
caused by amanita phalloides poisoning. Int J Hepatol 2012:487480. https://doi.org/10.1155/
2012/487480
Sarwar M, Mcdonald JL (2003) A rapid extraction and GC/MS methodology for the identification
of psilocyn in mushroom/chocolate concoctions. Microgram J 1:177–183
Savolainen V, Cowan RS, Vogler AP, Roderick GK, Lane R (2005) Towards writing the encyclo-
pedia of life: an introduction to DNA barcoding. Philos Trans R Soc Lond Ser B Biol Sci
360:1805–1811. https://doi.org/10.1098/rstb.2005.1730
Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA (2012) Nuclear ribosomal
internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. PNAS
109(16):6241–6246. https://doi.org/10.1073/pnas.1117018109
Schoch CL, Robbertse B, Robert V, Vu D, Cardinali G, Irinyi L, Meyer W, Nilsson RH, Hughes K,
Miller AN, Kirk PM, Abarenkov K, Aime MC, Ariyawansa HA, Bidartondo M, Boekhout T,
Buyck B, Cai Q, Chen J, Crespo A, Crous PW, Damm U, De Beer ZW, Dentinger BTM,
Divakar PK, Dueñas M, Feau N, Fliegerova K, García MA, Ge ZW, Griffith GW, Groenewald
JZ, Groenewald M, Grube M, Gryzenhout M, Gueidan C, Guo L, Hambleton S, Hamelin R,
Hansen K, Hofstetter V, Hong SB, Houbraken J, Hyde KD, Inderbitzin P, Johnston PR,
Karunarathna SC, Kõljalg U, Kovács GM, Kraichak E, Krizsan K, Kurtzman CP, Larsson
KH, Leavitt S, Letcher PM, Liimatainen K, Liu JK, Lodge DJ, Luangsa-Ard JJ, Lumbsch HT,
Maharachchikumbura SSN, Manamgoda D, Martín MP, Minnis AM, Moncalvo JM, Mulè G,
Nakasone KK, Niskanen T, Olariaga I, Papp T, Petkovits T, Pino-Bodas R, Powell MJ, Raja
HA, Redecker D, Sarmiento-Ramirez JM, Seifert KA, Shrestha B, Stenroos S, Stielow B, Suh
SO, Tanaka K, Tedersoo L, Telleria MT, Udayanga D, Untereiner WA, Uribeondo JD,
Subbarao KV, Vágvölgyi C, Visagie C, Voigt K, Walker DM, Weir BS, Weiß M,
Wijayawardene NN, Wingfield MJ, Xu JP, Yang ZL, Zhang N, Zhuang WY, Federhen S
(2014) Finding needles in haystacks: linking scientific names, reference specimens and molec-
ular data for fungi. Database (Oxford) 2014:bau061. https://doi.org/10.1093/database/bau061
22 DNA Barcoding in Forensic Mycology: Concepts, Limitations, and Future Prospects 447
Zhou Q, Tang SS, He ZM, Luo T, Chen ZH, Zhang P (2017) Amatoxin and phallotoxin
concentrations in Amanita fuliginea: influence of tissues, developmental stages and collection
sites. Mycoscience 58:267–273. https://doi.org/10.1016/j.myc.2017.03.003
Zuber A, Kowalczyk M, Sekuła A, Mleczko P, Kupiec T (2011) Methods used in species identifi-
cation of hallucinogenic and other poisonous mushrooms in forensic investigations. Z
Zagadnien Nauk Sadowych 86:151–161
Part V
Advances in Forensic DNA Typing
Applications of Next-Generation
Sequencing in Forensic Field 23
María Saiz, Luis Javier Martínez-Gonzalez, Jose Antonio Lorente,
and Maria Jesus Alvarez-Cubero
Abstract
M. Saiz
Laboratory of Genetic Identification, Department of Legal Medicine, Toxicology and Physical
Anthropology, Faculty of Medicine, University of Granada, Granada, Spain
L. J. Martínez-Gonzalez
Centre for Genomics and Oncological Research, GENYO (University of Granada-Andalusian
Government—Pfizer), Granada, Spain
J. A. Lorente (*)
Laboratory of Genetic Identification, Department of Legal Medicine, Toxicology and Physical
Anthropology, Faculty of Medicine, University of Granada, Granada, Spain
Centre for Genomics and Oncological Research, GENYO (University of Granada-Andalusian
Government—Pfizer), Granada, Spain
e-mail: [email protected]
M. J. Alvarez-Cubero
Centre for Genomics and Oncological Research, GENYO (University of Granada-Andalusian
Government—Pfizer), Granada, Spain
Department of Biochemistry & Molecular Biology III, Faculty of Medicine, University of Granada,
Granada, Spain
Keywords
23.1 Introduction
Within the area of biomedicine, the techniques associated with molecular genetics,
highlighting DNA sequencing, have enormously advanced in the last two decades.
This big progress in molecular biology techniques led to next-generation sequencing
(NGS) development. New sequencing technologies are characterized by performing
the massive parallel sequencing (MPS), where thousands of reads are produced at the
same time, reads coming from DNA fragment (Williams 2012).
Main technologies of NGS equipment are principally massive parallel chemical
reactions, detection systems, and computational approaches to analyze sequences.
These groundbreaking scientific advances have drastically decreased sequencing
cost and reduced the time to a few days. Now, the amount of data derived from
NGS platform is facing another challenge associated with the problem of millions of
confusing results (Wong et al. 2013). Nevertheless, these know-hows have the
potential to endorse another revolution in sequencing and its use (directly sequenc-
ing single molecules like DNA, RNA or even protein) and the great challenge to the
substantially increase of data storage and processing (Han et al. 2014; van Dijk et al.
2014).
NGS technologies are principally applied in biomedical areas which have allowed
finding the bases of some rare syndromes. Even so, developments in prenatal
diagnosis are not comparable with the ones in genetics identification where there
is a great variability of samples and not enough NGS data for each evidence type.
Moreover, they also help to improve research in cancer diagnosis and genetically
heterogeneous disorders as well as common diseases. Also, NGS has been fre-
quently applied into the whole mitochondrial sequencing in forensic sciences.
Furthermore, when a low amount of DNA is available, NGS has also found great
achievements, such as in noninvasive prenatal diagnosis and in many forensic cases.
So, the advances that have occurred in prenatal diagnosis can be transferred to the
forensic field. Fetus DNA can be found in maternal blood, even though it is of low
quality, quantity, and its difficulty to be distinguished from maternal DNA. So, the
huge power of NGS seems striking for noninvasive prenatal testing. It is possible to
detect trisomies with noninvasive sample collection (Buermans and den Dunnen
2014). In the last decade, advanced research approaches to circulating cell-free fetal
DNA have made it possible to determine fetal rhesus D (RhD) genotype, fetal sex,
aneuploidies, detection, and microdeletions of inherited paternal monogenic
disorders. NGS will allow detection from hereditary mutations that cause genetic
diseases (Breveglieri et al. 2019).
23 Applications of Next-Generation Sequencing in Forensic Field 453
We should consider some ancient DNA (aDNA) reviews where the developments
of DNA isolation methods combined with and short sequences, generated by NGS,
have helped to increase its accessibility (Hofreiter et al. 2015). The elevated grade of
sample degradation and the limited amount of DNA are still the principal obstacle
for applying NGS systems in forensic fields. However, there are some studies that
have also considered enriching aDNA (ancient DNA) using custom project-specific
SNP panels or detecting specific genomic areas (Alvarez-Cubero et al. 2017).
23.1.2 Evolution
In 1977, Frederick Sanger announced a new method to study the DNA molecule
known as Sanger sequencing; this new sequencing method was based on a chain-
termination technique (Sanger et al. 1977). This was the primary technology of
sequencing or the “first generation” for research or diagnostic sequencing
applications (Collins et al. 2004; Liu et al. 2012). In 2003, the “Human Genome
Project” concludes all the human genome thanks to semiautomatic capillary electro-
phoresis sequencers and Sanger technology (Collins et al. 2004; International
Human Genome Sequencing Consortium 2004). The “Human Genome Project”
verified that whole-genome sequencing (WGS) could be performed, but not rou-
tinely, due to its high economic and time costs. NGS has accelerated the develop-
ment of WGS, decreasing the effort and high cost associated (Liu et al. 2012).
In 2005, the first NGS system appears as 454, it was carried out and launched by
454 and acquired by Roche in 2007, a year before Solexa developed a Genome
Analyzer which would be purchased by Illumina afterwards. The same year
Agencourt announced its new equipment, SOLiD (Sequencing by Oligo Ligation
Detection). In 2011, Life Technologies introduced a new system based on the
detection of hydrogen ions, the Ion Torrent Personal Genome Machine (PGM).
These were, and still are, the most extended NGS sequencers in all fields, with
Illumina instruments at the top. All of them share a satisfactory accuracy, a high
throughput and a lower cost compared to Sanger sequencing (Liu et al. 2012). All
these NGS platforms (categorized as Second Generation of sequencer, 2G) share the
basic idea to perform a ligation of DNA fragments with specific adapter sequences.
When DNA has adapters at both ends (libraries), they are linked to a surface (solid
surface or microsphere), then amplified and sequenced by diverse methods, resulting
in millions of reads.
Third-generation (3G) instruments are the evolution of NGS platforms. 3G
systems use single-molecule, DNA or RNA, templates without PCR, due to requir-
ing less starting material, and produce longer readings. 3G platforms include PacBio
(Pacific Biosciences) and HeliScope (Helicos Biosciences) (Ku and Roukos 2013).
An enzymatic template replication system is used to sequence individual clonal
molecules. Genomic DNA template is captured, and the incorporation of a new base
is controlled by breakup of fluorescent dye-linked pyrophosphate in the volume-
limited observation window (Gut 2013). 3G instruments had some sensitivity
problems, especially in some genome regions. PacBio had no sequencing problems
454 M. Saiz et al.
NGS instruments need hard protocols for samples analysis. Library preparation goes
from a multistep procedure starting with genomic template fragmentation, end
repair, purifications, and adapters ligation, but it can become a very complex process
like enrichment of targeted region of DNA or RNA. The common steps within the
workflow of the library construction, which are described in Fig. 23.1, include
(a) DNA/RNA fragmentation, (b) fragmented products end repairing and
A-tailing, (c) adapters ligation, (d) size selection, and (e) if necessary, amplification
and, generally, after fragmentation, RNA library will require a new reverse tran-
scription step.
Currently, there are a wide variability of NGS instruments, Ion Torrent (semicon-
ductor sequencing technology) platform: PGM; Proton; S5, S5 plus; and S5 prime
(managing 50Gb/day of sequences up to 600 bp). PacBio systems: RS II and Sequel
System, Advance genomics with single-molecule real-time (SMRT) sequencing
which is the longest read lengths available (average > 10,000 bp and some reads
>60,000 bp), but both systems and sequences are expensive (Sequel System—
PacBio n.d.). In recent years, DNBSEQ technology has broken into sequencers
system, MGI company offers to world trade instruments like DNBSEQ-G400,
DNBSEQ-G50, and DNBSEQ-T7. But after all, the highest percentage of sequenc-
ing data are produced by Illumina instruments: iSeq 100, MiniSeq, MiSeq Series,
Nexseq 550 Series, HiSeq 2000, and Novaseq 6000 (ordered by instrument cost and
generally, just the opposite, cost of sequencing). All of them produce short paired-
end sequences (2 150, except Miseq 2 300 pb) (Sequencing Platforms |
Compare NGS platforms (benchtop, production-scale) n.d.). Among Illumina
systems, we highlight the MiSeq FGx™, it is the first equipment fully validated
for forensic science which is able to address thousands of forensic markers in a single
test, through targeted sequencing of forensically relevant STRs and SNPs loci.
Illumina kits combined with MiSeq FGxTM allow forensic laboratories to obtain
genetic profiles from degraded, mixed, and limited DNA samples. This equipment
produces high-quality, efficient forensic DNA profiles which assure sharing these
profiles with others laboratories; moreover, this system performs mitochondrial
sequencing which is also very demanded in forensic community. Finally, there are
many other instruments but with an infrequent use, such as Oxford Nanopore
systems: PromethION, GridION X5, MinION, and SmidgION; Helicos
technologies; and seqll (tSMS technology, true single-molecule sequencing)
(Products n.d.).
New technologies of sequencing allow an accurate processing of huge number of
samples, including a sensitivity and specificity detection of differences on a popula-
tion level, the discovery of novel responsible variants, and the verification of benign
single/multiple-nucleotide polymorphisms. New studies such as human microbiome
analysis, small RNA, noncoding RNAs, methylome analysis, ChIP sequencing, or
methylated DNA immunoprecipitation force to realize new molecular designs to
produce libraries for small inserts, repeated sequences, complex elements, etc.
Thanks to this great development in NGS technologies and strategies, it will also
improve their applications into forensic sciences and human identification.
Another field of technological development with relevance in forensic field is the
single-cell sequencing studies. For NGS library preparation, it needs nanogram
amounts of DNA, but a cell just contains 6–7 pg of DNA (Sanchez-Cespedes et al.
456 M. Saiz et al.
The use of NGS methodologies in “de novo” analysis of whole genomes (like the
whole mitochondrial DNA sequence of Neophema chrysogaster) and in repeating
the sequencing of human genomes (Human Genome Project with 1092 genomes of
human samples from various populations, was developed by the use of a mixture of
exome sequencing and low-coverage whole-genome) has been extensively proven.
Hence, it is easy to visualize the possible uses of NGS in forensic sciences, avoiding
23 Applications of Next-Generation Sequencing in Forensic Field 457
DNA profile by using STR typing is the most common method for forensic analysis,
and DNA sequencing has usually been used to indicate the origin and relationship
between DNA samples in small quantity by the analysis of hypervariable section of
mitochondrial DNA (mtDNA) (Berglund et al. 2011).
STR study has become a very common methodology for human forensic cases
(Irwin et al. 2011a, b; Rockenbauer et al. 2014). STRs are normally studied by
multiplexed PCR continued by capillary electrophoresis (CE)-based separation
(Jobling and Gill 2004). Moreover, normal STR typing gives enough discrimination
power for many of the current applications, and it has been proven that just using
routine STRs can solve mistakes in relationship analysis (Li et al. 2012; Tsai et al.
2013). Furthermore, it is not capable to distinguish in the production stutter data
produced from mixtures (Butler et al. 2004; McNevin et al. 2005), and dye artifacts
are usually found (Zeng et al. 2015). The use of autosomal SNPs for human
classification in forensic identification also has several problems. Bi-allelic SNPs
are not as polymorphic as multi-allelic STRs. In DNA mixtures, analysis from
several individuals SNPs are not very informative, but the analysis of a incremented
number of SNPs as well as the use of multiple genotyping methodologies may
neutralize this event (Kayser and de Knijff 2011). Some SNP panels have been used
for individual identification; Fudan ID Panel covers 175 SNP markers and has been
improved and validated by Ion Torrent™ PGM (Li et al. 2017).
In recent times, MPS is very concerned for the forensic genetic community. It
offers the option to discover several hundred to thousand markers at the same time.
Using large-scale sequencing offers multiple enhancements to forensic science.
458 M. Saiz et al.
Lately, NGS has been applied to study nuclear microsatellite markers, where random
sequencing of a small fraction of the genome has been proven to produce high
density of potential microsatellite loci in a low cost and rapid process. The DNA
commission of the International Society for Forensic Genetics has just taken some
considerations for using typing, analysis, and naming MPS STRs for forensic uses
(Parson et al. 2016).
Furthermore, it will be possible to complement STR data with other informative
forensic markers obtained by large-scale sequencing (Berglund et al. 2011). New
sequencing technologies present a completely new paradigm for sequence data
generation, contributing the chance to sequence up to millions of individual DNA
fragment (like in DNA mixtures), and the elevated throughput sequencing when
compared with Sanger sequencing with a much lower cost. Using new instruments to
detect STR amplicons will make it much more discriminative for genetic identifica-
tion, and with a degraded DNA input of just 31 pg complete profiles could be
generated, also we could obtain partial informative profiles out of 5 pg of DNA
(Zeng et al. 2015; Elena et al. 2016).
SNPs and Indels could be found in the repeated unit of STRs or in the flanking
region, if nucleotide substitutions, deletions, or insertions are sequenced, but these
changes are not detectable by CE analysis (Rockenbauer et al. 2014). NGS identifies
the number of repetitions presented in the STRs, but also the sequence of the
polymorphisms presented in them (Novroski et al. 2016). Moreover, new
technologies allow to generate individual sequences of the different alleles present
in a STR amplicon mixture (Van Neste et al. 2012). More identifiable alleles lead to
more statistical power study and decrease the necessary number of STR loci that is
necessary to be analyzed to solve a case with a high probability of coincidence. In
criminal cases, it may also be easier to solve sample mixtures, when the same alleles
appear in CE analyses and may be latter identified with more information by NGS.
The possibility to discriminate between persons with identical allele lengths as far as
the characterization of variations could be crucial in forensic or affiliation analysis.
Statistical power will be increased using NGS technologies with a reduced number
of SNPs or STRs (Rockenbauer et al. 2014).
The STR Sequencing Project, known as STRSeq, was started to simplify the
characterization of sequence-based alleles at STR loci targeted in commercial kits
(Gettings et al. 2017). This tool entails a curated database of sequence diversity at
identification of STR loci, in addition to the nomenclature, essential elements, and
variations described in accordance with the current guidelines (Parson et al. 2016).
So, the power of new sequencing technologies can only be used by also including
complex STRs, analyzing both SNPs and STRs in parallel. NGS instrument provides
a possibility for creating an all-in-one multiplex with important identification
markers that include, e.g., STRs, SNPs, InDels, and mtDNA markers (Irwin et al.
2011a, b). In recent years, some biotech corporations are developing focused
NGS-Panel into the forensic area using the same genomics areas applied till now,
helping researchers to study their samples instead of customizing their own panels
and primers. Currently, Thermo Fisher has designed some kits focused on forensic
samples, Precision ID Panels, all of them based on Ion PGM System: Precision ID
23 Applications of Next-Generation Sequencing in Forensic Field 459
GlobalFiler™ NGS STR Panels and GlobalFiler™ PCR Amplification Kit, NGS and
STRs kits respectively, including the same 21 autosomal STRs and amelogenin sex
markers. However, this kit adds STR sequence motifs to the usual STR profile,
isometric heterozygotes, and known SNPs in flanking regions (Wang et al. 2017). In
addition, three other panels have been developed to investigate about the bio-
geographical origin of the samples and discriminate individuals based on SNP
analysis and mitochondrial DNA whole genome. The Illumina® ForenSeq™ DNA
Signature kit includes 200 genetic loci (autosomal STRs, Y-STRs and X-STRs,
ancestry informative SNPs, identity informative SNPs, and phenotypic informative
SNPs). As the size of the targeted amplicons range from 64 to 231 bp for SNPs and
61 to 430 bp for STRs, this kit has been postulated as a good choice in MPS analysis
of degraded human remains (Almohammed et al. 2017). Promega Corporation has
developed the PowerSeq™ Systems Prototype Auto/Y analyzing 22 autosomal STR
markers, amelogenin, and 23 Y-STR markers designed specifically for NGS on the
MiSeq FGx® System (Montano et al. 2018; Silva et al. 2018). Many evaluation
studies have been done in order to assess sensitivity, reproducibility, mixtures, and
concordance as well as the analysis of casework and ancient DNA samples (Fattorini
et al. 2017; Jäger et al. 2017; Just et al. 2017; Xavier and Parson 2017).
Thanks to the genome association studies, GWAs, it has been possible to identify
SNPs for the characterization of the phenotype, indicating their ethnic origin and
physical characteristics. These data are very useful in criminal cases because it can
help recognize an individual, which will later be confirmed compared with a
reference sample. Moreover, the capability to predict facial morphology and esti-
mate individual-specific appearance through DNA is a very important goal to
identify unknown persons (Irwin et al. 2011a, b; Rockenbauer et al. 2014). In
order to achieve this great precision, it is most likely that it cannot be done with a
few markers; on the contrary, a large set of genetic markers will be necessary. So,
NGS and high-density arrays are useful for genotyping large numbers of SNPs,
which can successfully deal with DNA degraded and in low quantity (Kayser and de
Knijff 2011). Currently, a good application of NGS is discovering forensic SNP
markers (Seo et al. 2013). TruSeqTM ChIP protocol has been modified and devel-
oped to detect 160 human identification, phenotypic SNPs, and ancestry; this new
method is called TruSeqTM Forensic Amplicon (Warshauer et al. 2015a). This
protocol is less labor-intensive than other techniques. In addition, low input DNA
(1 ng) is required for library preparation (Warshauer et al. 2015a, b). Additionally, a
genome-wide SNP array, containing 906,600 autosomal SNPs, Y-SNPs, and mito-
chondrial DNA has been developed by Affimetrix (Bridges et al. 2011).
The ability to produce a huge volume of data (in Novaseq more than 30 billion
short reads per run) is the key advance of NGS technologies, obtaining these genetics
data economically (Metzker 2009). Developing a software for the analysis of
forensic NGS data will be one of the main challenges in genetics identification; it
is needed because it is not possible to analyze the enormous amount of data
manually. The application tool must be consistent and validated before the software
can be applied in real case work. Forenseq Universal Analysis Software has been
developed by Illumina, specifically designed to support forensic genomics
460 M. Saiz et al.
applications. Recently, there has been developed a new web application, toaSTR. It
is a user-friendly tool for STR allele calling in massively parallel sequencing data
independent of the system and the forensic kit used (Ganschow et al. 2017). The
program differentiates automatically isoalleles from stutter and artefacts on a
sequence bases; it facilitates an automatic allele calling with minimal need for review
(Ganschow et al. 2017).
NGS has been used to discover systematically Y-STRs. 4500 Y-STRs have been
genotyped, and the mutation rates have been estimated for 702 of them (Willems
et al. 2016). Furthermore, sequence-based studies are beginning to reveal the full
extent of structural variants (CNVs and inversions) and the great acceptance for gene
loss on the Y chromosome compared with the autosomes (Massaia and Xue 2017) as
far as sequence microvariance among Y-STRs (Warshauer et al. 2015a, b; Kwon
et al. 2016; Iacovacci et al. 2017).
On the other hand, in Y-chromosome, the most interesting finding of NGS is the
discovery of new Y-SNPs. These previously unknown Y-SNPs are relevant for
Y-chromosomal phylogenies and haplogroup nomenclatures used for anthropologi-
cal research and forensic identification. This finding has direct influence over
phylogenies trees, appearing as new Y-chromosomal categories. Nevertheless, to
include new Y-SNPs and updating and having a global consensus in forensic and
anthropological sciences, a lot of work is still needed; most of the Y-chromosome
recent project use Y phylogeny and Y-SNPs defined by Karafet et al. (2008). Due to
the development of NGS analysis, new lineages have been described, and there is a
need in the updating of the Y-chromosomal tree (Larmuseau et al. 2015). A new
haplogroup has been described, A00, as the deepest-rooting known haplogroup in
the Y-chromosome tree that diverged 275 thousand years ago (Mendez et al. 2013).
Many populations have been sequenced for several Y-SNPs in order to include all
Y-haplogroups present and update the Y-Chromosome Consortium tree (Ochiai
et al. 2016; Choi et al. 2017; Gao et al. 2017; Larmuseau et al. 2017). All the
information derived from these studies has been accumulated, and the
Y-chromosomal phylogenetic tree has been updated for criminal purposes (Van
Geystelen et al. 2013).
mtDNA is present in higher number than nuclear DNA (nDNA), mitochondria
vary in number and also mtDNA copies vary in mitochondria. So the probability of
recovering useable DNA data is augmented in degraded samples that fail to yield
helpful nDNA typing results (Parson et al. 2013). mtDNA is also informative of
maternal biogeographic ancestry principally obtained by the HV1 and HV2 regions
(Kayser and de Knijff 2011).
The study of entire mtDNA control region offers a random match probability
(RMP) of 1 in 120 and has provided valuable evidence in many cases. The extension
to examine the complete mitochondrial genome is a logical consequence and
required goal to maximize the information content of mtDNA analyses (Irwin
23 Applications of Next-Generation Sequencing in Forensic Field 461
et al. 2011a). A study on Chinese Han population has determined that the RMP
probability decreases 4.12% when analyzing the mitochondrial Genome
(mtGenome) compared to control region analyses (Zhou et al. 2016).
New sequencing technologies have the potential to radically increase sample
throughput, workflow efficiency, and detection resolution, so helping to get reliable
and accurate entire mtGenome information (Yang et al. 2014; Zhou et al. 2016).
Analyzing the whole mitochondrial genome in individuals with the same control
region sequences will recognize different samples by the analysis of personal
polymorphisms in the coding region not studied yet by traditional methods (Holland
et al. 2011).
There is a substantial number of different variants on mtGenome, mainly due
because there are dozens of mtDNA copies in each mitochondrion and up to
hundreds of mitochondria in some tissues. Studying all mutations presented in
mtDNA in tissues could be slightly arduous. If we compare NGS data with those
analyzed by capillary electrophoresis, we could see the percentage of variables found
using each technique, and how many of these mutations are homoplasmic or
heteroplasmic. Several studies developed by NGS show us that this methodology
allowed detecting a high percentage of mutations. These mutations can also be
presented in homoplasmic or heteroplasmic states. Thanks to a study performed
with 20 cases, it was possible to recognize more than 400 individual nucleotide
substitutions that include four heteroplasmic variants confirmed by capillary electro-
phoresis with high equivalence (98%) (Zaragoza et al. 2010). While Sanger sequenc-
ing can detect heteroplasmy at a threshold of 10–20% but not resolve the variants,
MPS is able to both detect and conclude heteroplasmy at levels of 1–2% (Rathbun
et al. 2017; Gallimore et al. 2018); heteroplasmy can be detected accurately in 1 per
10,000 mtGenome copies with Illumina GAII (He et al. 2010). A recent study that
analyzed six pairs of adult monozygotic twins has observed point heteroplasmies in
five sets of twins, and a single nucleotide variant was detected in four sets. This
results give an evidence for the hypothesis that variants of the mtGenome could be a
biomarker to distinguish monozygotic twins from each other (Wang et al. 2015).
New sequencing methods are transforming data generation and have the potential
to generate whole mitochondrial genomes profiles from even highly degraded
specimens. It is quite simple and cost-effective. The study of mtDNA coding region
data will be included in many routine forensic caseworks, and its study will not be
dictated by the quantity or quality of the sample. This data allow accessibility to
population databases that can be used to determine uncommonness mitochondrial
haplotypes.
Recently, Precision ID mtDNA Whole Genome Panel kit has been tested to study
the mtGenome of three skeletons dated to about early eighteenth to mid-nineteenth
century. The three skeleton samples had the same whole mtDNA sequences with
38 mutations as compared to the rCRS, being assigned to haplogroup D4a1c. These
results suggested that the three skeletons might belong to the same maternal line
(Hashiyada et al. 2017). A recent study performed on chemically treated, degraded,
high-quality, and nonhuman samples showed NGS methods to be exceedingly
462 M. Saiz et al.
sensitive, capable of generating entire mtGenome data from samples that failed to
yield reliable sequences with standard PCR-based techniques (Marshall et al. 2017).
Many software packages have been developed for mtDNA profile generation.
Both mitoSAVE (King et al. 2014) and GeneMarker HTS (Holland et al. 2017)
generate haplotypes consistent with current forensic nomenclature guidelines and
apply used-defined thresholds for profile reporting from high-quality samples. On
the other hand, AQME automates mtDNA analysis from sequence data to forensic
profiles and offers mtDNA haplogroup assignment. It has shown to produce accurate
forensic profiles for high-quality, degraded, and chemically treated samples (Sturk-
Andreaggi et al. 2017). In addition, MitoSuite supports quality check of alignment
data, building consensus sequences, variant annotation, detection of heteroplasmic
sites and haplogroup classification, contamination, and base substitution patterns
(Ishiya and Ueda 2017).
23.3.3 Microbiome
16S rRNA and metagenomic data “The Microbiome Project” enlisted around
300 people at two places in the USA, and proof in 15–18 body positions that
characterizes skin, urogenital tract, gut, and oral cavity; studying them indicated
that the microbial variety on the human body site was more similar to the similar
human part on a different individual than to other body part on the same person
(Clarke et al. 2017).
The human microbiota consists of 10–100 trillion symbiotic microbial cells
harbored by each person and the genes these cells port. There are as many bacteria
in our body as human cells (Hampton-Marcell et al. 2017). Understanding these
genomes, we could understand the microbiome impacts on human health, but it is
also interesting as innovative tool of genetic identification (Ursell et al. 2012). Two
facts make microbiome as a relevant point for forensic identification: (a) the high
number of these bacterial cells in a human body; (b) the subspecies level of these
bacteria appears to be unique to each person. All of this offers an excellent chance to
find a new identifiable marker unique to each person (Hampton-Marcell et al. 2017).
There are unique methodologies that fit and classify some interesting taxa. In
forensic field, microbial analysis focuses on identifying precise bacterial strains
related to terrorism, illness, pollution, microbial postmortem variations, and trace
evidence signs. The current use of NGS of taxonomically and/or phylogenetically
useful genomic regions (i.e., 16S rRNA, 18S rRNA, and ITS) has optimized the
excellent potential use of microbiome to estimate the postmortem intervals, to
identify clandestine graves, and to unify people spaces or objects analyzing their
skin microbes. But postmortem intervals are one of the most improved forensic
investigations using metabolomics, by giving novel biomarkers linked to chrono-
logical variations after death, mainly to the high diversity and strength to unstable
conditions to microbes (Ursell et al. 2012).
Currently, there are different focuses on NGS, mass spectrometry, and computa-
tional methods for improving the ability to characterize the microbial diversity
23 Applications of Next-Generation Sequencing in Forensic Field 463
(microbiome); increasing the new applications of microbiome analysis such as, oral
microbiome. Such profile may be unique to each individual and thereby useful for
investigating genetics purposes. Microbiome will offer relevant data about each
person’s latest actions and about the place they live (Wong et al. 2013). Skin
microbiome is also very personal; it is recognized that two individual’s hands can
vary around a 80% by the types of microbe discovered there. They are also good
trace evidence, unique by person but can be easily transferred to objects associated
with a given person, such as a computer keyboard, computer mouse, and cell phone,
among others. Moreover, the structure of personalized skin microbial communities is
stable over time although variable by season; and highly specific of person’s gender
and lifestyle (Metcalf et al. 2017). Nowadays, there is a commercial kit that are based
on skin microbiome profiling for forensic human identification, such as hidSkinPlex,
comprising of 286 bacterial (and phage) family-, genus-, species-, and subspecies-
level markers (Schmedes et al. 2018).
Necrobiome or thanatomicrobiome (defined as the community of organisms
implicated in the decomposition events of a human body) is also a novel strategy
used in forensic caseworks, which improves the data of forensic entomology and the
obtained data from the physical description of corpses (Hyde et al. 2013; Pechal et al.
2014). NGS analysis of the necrobiome could establish the stage of decomposition,
its succession, as well as important bacteria taxa from these communities. Moreover,
they are also useful tools as postmortem interval estimator (Guo et al. 2016) and
details about paleoforensic allowing to deepen in the genomic development of DNA
microbes, pathogens as well as microbioma of putrefaction (Gorgé et al. 2016).
Recent data included Clostridium spp. prevailed at long postmortem intervals (up to
10 days) and that these Gram-positive, anaerobic extremophiles also prevailed at
shorter postmortem intervals (4 h) (Javan et al. 2017).
Lastly, details about geographical microbiome locations could also be of interest
in forensic field. It is known that soil samples from hundreds of sites in the area have
a specific profile, so any remains of soil sample in a scene of crime could be
informative (Hampton-Marcell et al. 2017).
There are many advances to date in NGS and microbiome analysis; however,
many things should be implemented in the near future and much work to be done
such as including microbiome in databases such as CODIS could prove an effective
method to lowering crime rates and clearing cases (Hampton-Marcell et al. 2017).
It was in 1942 when Waddington coined the term “epigenetics,” which he defined as
changes in phenotype without changes in genotype. Nowadays, we know that
epigenetics mechanisms interact with gene expression pathways and programs that
can canalize different cell-type identities, including details of histone modifications
and DNA methylation (Allis and Jenuwein 2016).
Many recent researches of epigenetic are focused on diseases such as cancer or
inflammation, because epigenomic events are relevant for cellular reprograming
464 M. Saiz et al.
(Allis and Jenuwein 2016). For example, an analysis demonstrated that KMT2D
epigenetically activates PI3K/Akt path and EMT by linking both LIFR and KLF4
serving as a supposed epigenetic-based target for treating prostate cancer (Lv et al.
2017). There are also details in non-cancer diseases such as the analysis of patterns
of DNA methylation and posttranslational histone modifications in chronic inflam-
matory diseases (Fogel et al. 2017).
In contrast, epigenetic has been explored slowly in forensic field. New researches
are focused in the “epigenomic fingerprint” using epigenomic prediction of lifestyle
and environmental exposures to improve DNA characterization in criminal cases
where problems in DNA profiles identification are, complementing its predictions
(Vidaki and Kayser 2017).
Many of the studies in epigenetic in forensic field are focused on markers for the
prediction of tissue-identification and monozygotic twin bias, by using DNA meth-
ylation methodologies (methylation-sensitive restriction endonuclease, bisulfite
modification, methylation-CpG linking protein, and third-generation sequencing
methods, among others) (Kader and Ghai 2015).
In relation to the use of epigenetic in the estimation of human age, there is a study
which analyses a total number of 27 CpG sites at three genetic loci (SCGN,
Secretagogin; KLF14, Kruppel-Like Factor 14; and DLX5, distal-less homeobox
5 gene) in relation to their methylation status with age (samples range from 5 to
73 years). Finally, it is discovered that specific CpGs in SCGN and KLF14 can be
used as potential epigenetic markers to estimate age using saliva and blood
specimens, data with relevant interest in forensic field. However, there are still
many challenges in finding universal DNA methylation markers using any body
fluid, because many studies reported that DNA methylation is tissue specific. By the
moment, just certain markers such as ELOVL2, which was describe as relatively
stable age predictors for some cell types (Alghanim et al. 2017).
There are also data reporting the use of epigenetic for the discrimination of
identical twins, demonstrating that there are twin-differentially methylated sites
that can be useful in the case of twin genetic identification, that nowadays is
currently impossible (Vidaki et al. 2017).
Many of the studies have been developed with great quantities of DNA, but
promising reports also exist with few quantities of initial DNA (100 pg), which is
relevant for forensic sciences (Yang et al. 2014). The application of epigenetic is in
the initial steps in the forensic field, but promise results are described according to
this data.
In 1993 Lee was the first to describe microRNAs (miRNAs). They are defined as
small RNA molecules encoded in the genome of plants and animals with highly
conserved regions; their main role is to regulate the expression of genes (Lee et al.
1993). There are many data about their role in cancer development and evolution.
Dr. Croce’s group was the first to highlight miRNAs role in B-cell chronic
23 Applications of Next-Generation Sequencing in Forensic Field 465
lymphocytic leukemia cells; describing for the first time miR-15a and miR-16-1 in
this cancer. Currently it is known that the role of miRNAs in cancer is wide, and they
can act in different ways depending on their target genes. miRNA could function as
either oncogene or tumor suppressor under certain circumstances. Recent researches
are focused in identifying miRNA profile in exosomes of cancer (Peng and Croce
2016).
miRNAs have also been recently introduced in forensic field. One of the principal
significant things is their little size (8–22 nucleotides in extent) which highlights
them as the most promising molecules for avoiding degradation and tissue-
specificity or very tissue-different expression. They are fitting for forensic detection,
body fluid classification, and postmortem interval (PMI) deduction analysis (Yang
et al. 2014).
There are data exposing a set of miRNAs as validated ones for human identifica-
tion in several body fluids (blood, saliva, semen, menstrual blood, and vaginal
secretions) and skin such as miR10b, miR203, miR374, miR451, and miR943 as
well as proper candidate housekeeping genes like miR26b, miR92, miR144, and
miR484 for normalizing miRNA gene expression data (Sirker et al. 2017). Recent
publications have also indicated that miR-451a and miR-142-3p were observed in
venous profiles and miR-205 absent; in menstrual blood samples, miR-451a,
miR-141-3p, and miR-205; miR-891a, miR-10b, miR-142-3p, and miR-205 were
observed in all semen samples; in saliva, miR-142-3p and miR-205 were observed
(Mayes et al. 2018).
There are also efforts in identifying miRNA organ-specific markers such as
hsa-miR-219a-5p, hsa-miR-122-5p, hsa-miR-205-5p, hsa-miR-208b-3p, and
hsa-miR-206 for the identification of brain, liver, skin, heart, and skeletal muscle,
respectively. Further, hsa-miR-9-5p and hsa-miR-124-3p as well as hsa-miR-499a-
5p, hsa-miR-1-3p, and hsa-miR-133a-3p were found to be promising markers for the
identification of brain and muscle in general, respectively (Sauer et al. 2017). As the
usefulness of miRNAs in the forensic field to determine the origin of the evidence is
more and more proven, there has been developed some strategies to multiplex the
analysis of miRNA for body fluid identification (Mayes et al. 2018). However, many
challenges are still open for its wide application in human identification and database
updating.
References
Alghanim H, Antunes J, Silva DSBS, Alho CS, Balamurugan K, McCord B (2017) Detection and
evaluation of DNA methylation markers found at SCGN and KLF14 loci to estimate human age.
Forensic Sci Int Genet 31:81–88. https://doi.org/10.1016/j.fsigen.2017.07.011
Allis CD, Jenuwein T (2016) The molecular hallmarks of epigenetic control. Nat Rev Genet 17:487.
https://doi.org/10.1038/nrg.2016.59
Almohammed E, Zgonjanin D, Iyengar A, Ballard D, Devesse L, Sibte H (2017) A study of
degraded skeletal samples using ForenSeq DNA Signature™ Kit. Forensic Sci Int Genet
Suppl Ser 6:e410–e412. https://doi.org/10.1016/j.fsigss.2017.09.158
466 M. Saiz et al.
Alvarez-Cubero MJ, Saiz M, Martínez-García B, Sayalero SM, Entrala C, Lorente JA, Martinez-
Gonzalez LJ (2017) Next generation sequencing: an application in forensic sciences? Ann Hum
Biol 44(7):581–592. https://doi.org/10.1080/03014460.2017.1375155
BD Rhapsody™ Single-Cell Analysis System—BD (n.d.). https://www.bd.com/en-us/offerings/
capabilities/genomics/bd-rhapsody-single-cell-analysis-system. Accessed 7 June 2018
Berglund EC, Kiialainen A, Syvänen AC (2011) Next-generation sequencing technologies and
applications for human genetic history and forensics. Investig Genet 2(1):23
Breveglieri G, D’Aversa E, Finotti A, Borgatti M (2019) Non-invasive prenatal testing using fetal
DNA. Mol Diagn Ther 23:291–299. https://doi.org/10.1007/s40291-019-00385-2
Bridges M, Heron EA, O’Dushlaine C, Segurado R, Morris D, Corvin A et al (2011) Genetic
classification of populations using supervised learning. PLoS One 6(5):e14802. Retrieved from
http://dx.doi.org/10.1371%2Fjournal.pone.0014802
Buermans HPJ, den Dunnen JT (2014) Next generation sequencing technology: advances and
applications. Biochim Biophys Acta 1842(10):1932–1941. https://doi.org/10.1016/j.bbadis.
2014.06.015
Butler JM, Buel E, Crivellente F, McCord BR (2004) Forensic DNA typing by capillary electro-
phoresis using the ABI Prism 310 and 3100 genetic analyzers for STR analysis. Electrophoresis
25(10–11):1397–1412. https://doi.org/10.1002/elps.200305822
Ku C-S, Roukos DH (2013) From next-generation sequencing to nanopore sequencing technology:
paving the way to personalized genomic medicine. Expert Rev Med Dev 10(1):1–6. https://doi.
org/10.1586/erd.12.63
Choi SS, Park KH, Nam DE, Kang TH, Chung KW (2017) Y-chromosome haplogrouping for
Asians using Y-SNP target sequencing. Forensic Sci Int Genet Suppl Ser 6:e235–e237. https://
doi.org/10.1016/J.FSIGSS.2017.09.100
Clarke TH, Gomez A, Singh H, Nelson KE, Brinkac LM (2017) Integrating the microbiome as a
resource in the forensics toolkit. Forensic Sci Int Genet 30:141–147. https://doi.org/10.1016/j.
fsigen.2017.06.008
Collins FS, Lander ES, Rogers J, Waterston RH, Conso I (2004) Finishing the euchromatic
sequence of the human genome. Nature 431:931–945
ddSEQ™ Single-Cell Isolator | Life Science Research | Bio-Rad (n.d.). http://www.bio-rad.com/es-
es/product/ddseq-single-cell-isolator?ID¼OKNWBSE8Z. Accessed 7 June 2018
van Dijk EL, Auger H, Jaszczyszyn Y, Thermes C (2014) Ten years of next-generation sequencing
technology. Trends Genet 30(9):418–426. https://doi.org/10.1016/j.tig.2014.07.001
Elena S, Alessandro A, Ignazio C, Sharon W, Luigi R, Andrea B (2016) Revealing the challenges of
low template DNA analysis with the prototype Ion AmpliSeq™ Identity panel v2.3 on the
PGM™ Sequencer. Forensic Sci Int Genet 22:25–36. https://doi.org/10.1016/j.fsigen.2015.07.
011
Fattorini P, Previderé C, Carboni I, Marrubini G, Sorçaburu-Cigliero S, Grignani P et al (2017)
Performance of the ForenSeq TM DNA Signature Prep kit on highly degraded samples.
Electrophoresis 38(8):1163–1174. https://doi.org/10.1002/elps.201600290
Fluidigm | Single-Cell Analysis (n.d.). https://www.fluidigm.com/applications/single-cell-analysis.
Accessed 7 June 2018
Fogel O, Richard-Miceli C, Tost J (2017) Epigenetic changes in chronic inflammatory diseases.
Adv Protein Chem Struct Biol 106:139–189. https://doi.org/10.1016/bs.apcsb.2016.09.003
Gallimore JM, McElhoe JA, Holland MM (2018) Assessing heteroplasmic variant drift in the
mtDNA control region of human hairs using an MPS approach. Forensic Sci Int Genet 32:7–17.
https://doi.org/10.1016/J.FSIGEN.2017.09.013
Ganschow S, Wiegand P, Tiemann C (2017) toaSTR: a web-based forensic tool for the analysis of
short tandem repeats in massively parallel sequencing data. Forensic Sci Int Genet Suppl Ser 6:
e119–e121. https://doi.org/10.1016/j.fsigss.2017.09.034
Gao T, Yun L, Zhou D, Lang M, Wang Z, Qian X et al (2017) Next-generation sequencing of
74 Y-SNPs to construct a concise consensus phylogeny tree for Chinese population. Forensic
Sci Int Genet Suppl Ser 6:e96–e98. https://doi.org/10.1016/j.fsigss.2017.09.043
23 Applications of Next-Generation Sequencing in Forensic Field 467
Gettings KB, Borsuk LA, Ballard D, Bodner M, Budowle B, Devesse L et al (2017) STRSeq: a
catalog of sequence diversity at human identification Short Tandem Repeat loci. Forensic Sci Int
Genet 31:111–117. https://doi.org/10.1016/J.FSIGEN.2017.08.017
Gorgé O, Bennett EA, Massilani D, Daligault J, Pruvost M, Geigl E-M, Grange T (2016) Analysis
of ancient DNA in microbial ecology. Methods Mol Biol 1399:289–315. https://doi.org/10.
1007/978-1-4939-3369-3_17
Guo J, Fu X, Liao H, Hu Z, Long L, Yan W et al (2016) Potential use of bacterial community
succession for estimating post-mortem interval as revealed by high-throughput sequencing. Sci
Rep 6(1):24197. https://doi.org/10.1038/srep24197
Gut IG (2013) New sequencing technologies. Clin Transl Oncol 15(11):879–881. https://doi.org/
10.1007/s12094-013-1073-6
Hampton-Marcell JT, Lopez JV, Gilbert JA (2017) The human microbiome: an emerging tool in
forensics. Microb Biotechnol 10(2):228–230. https://doi.org/10.1111/1751-7915.12699
Han J-P, Yang F, Xu C, Wei Y-L, Zhao X-C, Hu L et al (2014) A new strategy for sperm isolation
and STR typing from multi-donor sperm mixtures. Forensic Sci Int Genet 13:239–246. https://
doi.org/10.1016/j.fsigen.2014.08.012
Hashiyada M, Adachi N, Akane A, Matsumoto T, Yoshimura S (2017) The detailed examination of
the human ancient mitochondrial DNA using the Ion PGM™ System. Forensic Sci Int Genet
Suppl Ser 6:e156–e158. https://doi.org/10.1016/J.FSIGSS.2017.09.061
He Y, Wu J, Dressman DC, Iacobuzio-Donahue C, Markowitz SD, Velculescu VE et al (2010)
Heteroplasmic mitochondrial DNA mutations in normal and tumour cells. Nature 464:610–614.
https://doi.org/10.1038/nature08802
Hofreiter M, Paijmans JLA, Goodchild H, Speller CF, Barlow A, Fortes GG et al (2015) The future
of ancient DNA: technical advances and conceptual shifts. BioEssays 37(3):284–293. https://
doi.org/10.1002/bies.201400160
Holland MM, McQuillan MR, O’Hanlon KA (2011) Second generation sequencing allows for
mtDNA mixture deconvolution and high resolution detection of heteroplasmy. Croat Med J 52
(3):299–313. https://doi.org/10.3325/cmj.2011.52.299
Holland MM, Pack ED, McElhoe JA (2017) Evaluation of GeneMarker®HTS for improved
alignment of mtDNA MPS data, haplotype determination, and heteroplasmy assessment.
Forensic Sci Int Genet 28:90–98. https://doi.org/10.1016/j.fsigen.2017.01.016
Home—10 Genomics (n.d.). https://www.10xgenomics.com/. Accessed 7 June 2018
Hyde ER, Haarmann DP, Lynne AM, Bucheli SR, Petrosino JF (2013) The living dead: bacterial
community structure of a cadaver at the onset and end of the bloat stage of decomposition. PLoS
One 8(10):e77733. https://doi.org/10.1371/journal.pone.0077733
Iacovacci G, D’Atanasio E, Marini O, Coppa A, Sellitto D, Trombetta B et al (2017) Forensic data
and microvariant sequence characterization of 27 Y-STR loci analyzed in four Eastern African
countries. Forensic Sci Int Genet 27:123–131. https://doi.org/10.1016/J.FSIGEN.2016.12.015
International Human Genome Sequencing Consortium (2004) Finishing the euchromatic sequence
of the human genome. Nature 431(7011):931–945. https://doi.org/10.1038/nature03001
Irwin JA, Parson W, Coble MD, Just RS (2011a) mtGenome reference population databases and the
future of forensic mtDNA analysis. Forensic Sci Int Genet 5(3):222–225. Retrieved from http://
www.scopus.com/inward/record.url?eid¼2-s2.0-79953867044&partnerID¼40&
md5¼0c14688affdaf9198aad1f6d2a783bc6
Irwin J, Just R, Scheible M, Loreille O (2011b) Assessing the potential of next generation
sequencing technologies for missing persons identification efforts. Forensic Sci Int Genet
Suppl Ser 3(1):e447–e448
Ishiya K, Ueda S (2017) MitoSuite: a graphical tool for human mitochondrial genome profiling in
massive parallel sequencing. PeerJ 5(5):e3406. https://doi.org/10.7717/peerj.3406
Jäger AC, Alvarez ML, Davis CP, Guzmán E, Han Y, Way L et al (2017) Developmental validation
of the MiSeq FGx forensic genomics system for targeted next generation sequencing in forensic
DNA casework and database laboratories. Forensic Sci Int Genet 28:52–70. https://doi.org/10.
1016/j.fsigen.2017.01.011
468 M. Saiz et al.
Javan GT, Finley SJ, Smith T, Miller J, Wilkinson JE (2017) Cadaver thanatomicrobiome
signatures: the ubiquitous nature of Clostridium species in human decomposition. Front
Microbiol 8. https://doi.org/10.3389/fmicb.2017.02096
Jobling MA, Gill P (2004) Encoded evidence: DNA in forensic analysis. Nat Rev Genet 5
(10):739–751. Retrieved from http://www.scopus.com/inward/record.url?eid¼2-s2.0-
5044225199&partnerID¼40
Just RS, Moreno LI, Smerick JB, Irwin JA (2017) Performance and concordance of the ForenSeq™
system for autosomal and Y chromosome short tandem repeat sequencing of reference-type
specimens. Forensic Sci Int Genet 28:1–9. https://doi.org/10.1016/j.fsigen.2017.01.001
Kader F, Ghai M (2015) DNA methylation and application in forensic sciences. Forensic Sci Int
249:255. https://doi.org/10.1016/j.forsciint.2015.01.037
Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (2008) New
binary polymorphisms reshape and increase resolution of the human Y chromosomal
haplogroup tree. Genome Res 18(5):830–838. Retrieved from http://www.scopus.com/inward/
record.url?eid¼2-s2.0-43149087535&partnerID¼40&
md5¼1b7dc85ee8aeea4dbbc309c07ac69a5d
Kayser M, de Knijff P (2011) Improving human forensics through advances in genetics, genomics
and molecular biology. Nat Rev Genet 12(3):179–192
King JL, Sajantila A, Budowle B (2014) MitoSAVE: mitochondrial sequence analysis of variants in
excel. Forensic Sci Int Genet 12:122–125. https://doi.org/10.1016/j.fsigen.2014.05.013
Kwon SY, Lee HY, Kim EH, Lee EY, Shin K-J (2016) Investigation into the sequence structure of
23 Y chromosomal STR loci using massively parallel sequencing. Forensic Sci Int Genet
25:132–141. https://doi.org/10.1016/J.FSIGEN.2016.08.010
Larmuseau MHD, Van Geystelen A, Kayser M, van Oven M, Decorte R (2015) Towards a
consensus Y-chromosomal phylogeny and Y-SNP set in forensics in the next-generation
sequencing era. Forensic Sci Int Genet 15:39–42. https://doi.org/10.1016/j.fsigen.2014.11.012
Larmuseau MHD, Otten GPPL, Decorte R, Van Damme P, Moisse M (2017) Defining Y-SNP
variation among the Flemish population (Western Europe) by full genome sequencing. Forensic
Sci Int Genet 31:e12–e16. https://doi.org/10.1016/j.fsigen.2017.10.008
Lee RC, Feinbaum RL, Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small
RNAs with antisense complementarity to lin-14. Cell 75(5):843–854. Retrieved from http://
www.ncbi.nlm.nih.gov/pubmed/8252621
Li L, Ge J, Zhang S, Guo J, Zhao S, Li C et al (2012) Maternity exclusion with a very high
autosomal STRs kinship index. Int J Legal Med 126(4):645–648. https://doi.org/10.1007/
s00414-012-0668-8
Liu L, Li Y, Li S et al (2012) Comparison of next-generation sequencing systems. J Biomed
Biotechnol 2012:251364. https://doi.org/10.1155/2012/251364
Li L, Wang Y, Yang S, Xia M, Yang Y, Wang J et al (2017) Genome-wide screening for highly
discriminative SNPs for personal identification and their assessment in world populations.
Forensic Sci Int Genet 28:118–127. https://doi.org/10.1016/j.fsigen.2017.02.005
Loomis EW, Eid JS, Peluso P, Yin J, Hickey L, Rank D et al (2013) Sequencing the
unsequenceable: expanded CGG-repeat alleles of the fragile X gene. Genome Res 23
(1):121–128. https://doi.org/10.1101/gr.141705.112
Lv S, Ji L, Chen B, Liu S, Lei C, Liu X et al (2017) Histone methyltransferase KMT2D sustains
prostate carcinogenesis and metastasis via epigenetically activating LIFR and KLF4. Oncogene
37:1–15. https://doi.org/10.1038/s41388-017-0026-x
Marshall C, Sturk-Andreaggi K, Daniels-Higginbotham J, Oliver RS, Barritt-Ross S, McMahon TP
(2017) Performance evaluation of a mitogenome capture and Illumina sequencing protocol
using non-probative, case-type skeletal samples: implications for the use of a positive control in
a next-generation sequencing procedure. Forensic Sci Int Genet 31:198–206. https://doi.org/10.
1016/J.FSIGEN.2017.09.001
Massaia A, Xue Y (2017) Human Y chromosome copy number variation in the next generation
sequencing era and beyond. Hum Genet 136:591. https://doi.org/10.1007/s00439-017-1788-5
23 Applications of Next-Generation Sequencing in Forensic Field 469
Sauer E, Extra A, Cachée P, Courts C (2017) Identification of organ tissue types and skin from
forensic samples by microRNA expression analysis. Forensic Sci Int Genet 28:99–110. https://
doi.org/10.1016/j.fsigen.2017.02.002
Schmedes SE, Woerner AE, Novroski NMM, Wendt FR, King JL, Stephens KM, Budowle B
(2018) Targeted sequencing of clade-specific markers from skin microbiomes for forensic
human identification. Forensic Sci Int Genet 32:50–61. https://doi.org/10.1016/j.fsigen.2017.
10.004
Seo SB, King JL, Warshauer DH, Davis CP, Ge J, Budowle B (2013) Single nucleotide polymor-
phism typing with massively parallel sequencing for human identification. Int J Legal Med 127
(6):1079–1086. https://doi.org/10.1007/s00414-013-0879-7
Sequel System—PacBio (n.d.). https://www.pacb.com/products-and-services/pacbio-systems/
sequel. Accessed 7 June 2018
Sequencing Platforms | Compare NGS Platforms (Benchtop, Production-Scale) (n.d.). https://emea.
illumina.com/systems/sequencing-platforms.html. Accessed 7 June 2018
Silva DSBS, Sawitzki FR, Scheible MKR, Bailey SF, Alho CS, Faith SA (2018) Genetic analysis of
Southern Brazil subjects using the PowerSeq™ AUTO/Y system for short tandem repeat
sequencing. Forensic Sci Int Genet 33:129–135. https://doi.org/10.1016/j.fsigen.2017.12.008
Sirker M, Fimmers R, Schneider PM, Gomes I (2017) Evaluating the forensic application of
19 target microRNAs as biomarkers in body fluid and tissue identification. Forensic Sci Int
Genet 27:41–49. https://doi.org/10.1016/j.fsigen.2016.11.012
Sturk-Andreaggi K, Peck MA, Boysen C, Dekker P, McMahon TP, Marshall CK (2017) AQME: a
forensic mitochondrial DNA analysis tool for next-generation sequencing data. Forensic Sci Int
Genet 31:189–197. https://doi.org/10.1016/j.fsigen.2017.09.010
Tridico SR, Murray DC, Addison J, Kirkbride KP, Bunce M (2014) Metagenomic analyses of
bacteria on human hairs: a qualitative assessment for applications in forensic science. Investig
Genet 5(1):16. https://doi.org/10.1186/s13323-014-0016-5
Tsai CW, Yang CH, Chou SL, Cheng SG, Pai CY (2013) Non-CODIS DNA markers could be more
effective than CODIS-based STRs in problematic biological relationship cases. Rom J Leg Med
21(3):245–248. https://doi.org/10.4323/rjlm.2013.245
Ursell LK, Metcalf JL, Parfrey LW, Knight R (2012) Defining the human microbiome. Nutr Rev 70
(Suppl 1):S38. https://doi.org/10.1111/j.1753-4887.2012.00493.x
Van Geystelen A, Decorte R, Larmuseau MHD (2013) AMY-tree: an algorithm to use whole
genome SNP calling for Y chromosomal phylogenetic applications. BMC Genomics 14(1):101.
https://doi.org/10.1186/1471-2164-14-101
Van Neste C, Van Nieuwerburgh F, Van Hoofstat D, Deforce D (2012) Forensic STR analysis using
massive parallel sequencing. Forensic Sci Int Genet 6(6):810–818
Vidaki A, Kayser M (2017) From forensic epigenetics to forensic epigenomics: broadening DNA
investigative intelligence. Genome Biol 18(1):238. https://doi.org/10.1186/s13059-017-1373-1
Vidaki A, Díez López C, Carnero-Montoro E, Ralf A, Ward K, Spector T et al (2017) Epigenetic
discrimination of identical twins from blood under the forensic scenario. Forensic Sci Int Genet
31:67–80. https://doi.org/10.1016/j.fsigen.2017.07.014
Wang Z, Zhang S, Bian Y, Li C (2015) Differentiating between monozygotic twins in forensics
through next generation mtGenome sequencing. Forensic Sci Int Genet Suppl Ser 5:e58–e59.
https://doi.org/10.1016/J.FSIGSS.2015.09.023
Wang Z, Zhou D, Wang H, Jia Z, Liu J, Qian X et al (2017) Massively parallel sequencing of
32 forensic markers using the Precision ID GlobalFiler™ NGS STR Panel and the Ion PGM™
System. Forensic Sci Int Genet 31:126–134. https://doi.org/10.1016/J.FSIGEN.2017.09.004
Warshauer DH, Davis C, Holt C, Han Y, Walichiewicz P, Richardson T et al (2015a) Massively
parallel sequencing of forensically relevant single nucleotide polymorphisms using TruSeq™
forensic amplicon. Int J Legal Med 129(1):31–36. https://doi.org/10.1007/s00414-014-1108-8
Warshauer DH, Churchill JD, Novroski N, King JL, Budowle B (2015b) Novel Y-chromosome
short tandem repeat variants detected through the use of massively parallel sequencing. Geno-
mics Proteomics Bioinformatics 13(4):250–257. https://doi.org/10.1016/J.GPB.2015.08.001
23 Applications of Next-Generation Sequencing in Forensic Field 471
Williams GA (2012) Identification and resolution of capability gaps in forensic science. Doctoral
thesis, University of Huddersfield. (Deposit: http://eprints.hud.ac.uk/id/eprint/17500/)
Willems T, Gymrek M, Poznik GD, Tyler-Smith C, Erlich Y (2016) Population-scale sequencing
data enable precise estimates of Y-STR mutation rates. Am J Hum Genet 98(5):919–933. https://
doi.org/10.1016/j.ajhg.2016.04.001
Wong L-P, Ong RT-H, Poh W-T, Liu X, Chen P, Li R et al (2013) Deep whole-genome sequencing
of 100 Southeast Asian Malays. Am J Hum Genet 92(1):52–66. https://doi.org/10.1016/j.ajhg.
2012.12.005
Xavier C, Parson W (2017) Evaluation of the Illumina ForenSeq™ DNA Signature Prep Kit—MPS
forensic application for the MiSeq FGx™ benchtop sequencer. Forensic Sci Int Genet
28:188–194. https://doi.org/10.1016/j.fsigen.2017.02.018
Yang Y, Xie B, Yan J (2014) Application of next-generation sequencing technology in forensic
science. Genomics Proteomics Bioinformatics 12(5):190–197. https://doi.org/10.1016/j.gpb.
2014.09.001
Zaragoza MV, Fass J, Diegoli M, Lin D, Arbustini E (2010) Mitochondrial DNA variant discovery
and evaluation in human cardiomyopathies through next generation sequencing. PLoS One 5(8).
https://doi.org/10.1371/journal.pone.0012295
Zeng X, King JL, Stoljarova M, Warshauer DH, LaRue BL, Sajantila A et al (2015) High sensitivity
multiplex short tandem repeat loci analyses with massively parallel sequencing. Forensic Sci Int
Genet 16:38–47. https://doi.org/10.1016/j.fsigen.2014.11.022
Zhou Y, Guo F, Yu J, Liu F, Zhao J, Shen H et al (2016) Strategies for complete mitochondrial
genome sequencing on Ion Torrent PGM™ platform in forensic sciences. Forensic Sci Int Genet
22:11–21. https://doi.org/10.1016/J.FSIGEN.2016.01.004
Utility and Possibility of Next-Generation
Sequencing in Forensic DNA Typing 24
Vijay Nema
Abstract
The introduction of DNA typing itself was a game changer for forensic science as
it opened the window for knowing what was thought to be nonexisting. The traces
that were of no use suddenly became crucial evidence and were able to precisely
identify the individuals and their genetic information too. In DNA typing, the
biggest limitation came in for bigger DNA fragments or mixed samples, etc.,
which were tough to deal with. The solutions to this kind of problems along with
the introduction of high-throughput sequencing were introduced by next-
generation sequencing. With the improvement in technology not only the
throughput has increased but there has been a tremendous decrease in cost of
assays. This has increased precision along with affordability. This chapter has
tried to educate the users about the basics of next-generation sequencing and has
taken references from Sanger sequencing to make the reader understand better
and in context with what is available and what are the future avenues as shown by
new research evidence. A next-generation sequencing is a tool which can be
employed for various applications a glimpse of which has been provided in this
chapter; however, they are not and cannot be exhaustive as there is a potential for
newer and novel applications based on innovative approaches and need of the
field.
Keywords
Next-generation sequencing (NGS) · Forensics · DNA typing · Sequencing
platforms · Capillary electrophoresis (CE)
V. Nema (*)
ICMR-National AIDS Research Institute, Pune, India
24.1 Introduction
It is a fact that every criminal leave behind some clues. However, sometimes the
clues are so vague that finding them out with general observation or techniques
becomes impossible. Moreover, the specificity of the available evidence is always a
big concern so as to avoid punishment to an innocent person. Much work went into
an optimization to utilize the miniscule of the samples or evidence from the spot and
to improve upon sensitivity and specificity of detection. Biological samples are the
best to correlate specifically to individuals. Among biological samples, blood,
semen, skin, saliva, hairs, etc. are mostly available, and DNA from this sample is
used to specifically identify the individual from his biological leftover. The proce-
dure is basically a linking technique wherein biological samples of the individuals
are used to extract DNA which is then analyzed. When processed, the DNA of each
individual generates a pattern called “DNA profile.” This DNA profile remains
unique for each individual except in identical twins. This technique of DNA
profiling is commonly used in criminal investigations in different ways. Utilizing
this, an unidentified person may be identified, or in case of suspicion, the identity can
be confirmed. This comes as a handy solution when confirmation about a person’s
presence on a crime scene is a concern. The science of DNA typing is also an
evolving science wherein techniques of typing have improved a lot, and sensitivity
and specificity have gone up by many folds. In this chapter, a few such techniques
are introduced, and their details are discussed.
The first documented use of DNA fingerprinting in forensic science was recorded in
1986 when police in the United Kingdom requested Dr. Jeffreys, of University of
Leicester, for cross checking a person’s acceptance that he was responsible for two
rape-murders which were proven wrong. The first case of confirmation about the
person to be convicted utilizing this technique was Robert Melias in 1987 in the
same country (Anon 1996). The same year witnessed another case in the USA,
wherein the suspect in a rape case was convicted based on DNA evidence. However,
there were a few cases wherein the use of technology suffered lacunae and different
directives and guidelines were made regarding the right procedure of testing and
keeping of the results as obtained in the laboratory. The guidelines also explained
how the reports should be explained and how the errors were to be recorded.
Compliance with appropriate standards and controls was made mandatory through
regulatory agencies. After following all these, the technology was found to be full
proof and was being used as a routine technique. Based on these facts, the US
National Research Council’s (NRC) 1996 report (Anon 1996) on DNA evidence
stated, “The state of the profiling technology and the methods for estimating
frequencies and related statistics have progressed to the point where the admissibility
of properly collected and analyzed DNA data should not be in doubt” (Kaye 1995).
24 Utility and Possibility of Next-Generation Sequencing in Forensic DNA Typing 475
The human body is made up of basic units called cells. Every cell except red blood
cells is having a defined structure with various components including nucleus that
functions as its command center. This command center hosts the DNA or
deoxyribonucleic acid that codes for genetic information responsible for all cellular
processes. The DNA being a stable molecule with specific traits when compared
between individuals is the best biomolecule for forensic purposes. The nuclear DNA
is limited to one set (two copies) per cell, whereas the DNA found in mitochondrion
is available in multiple copies ranging up to 100,000 copies. Hence, both of these
DNAs are used for various purposes depending on the availability and quantity of
the samples recovered from crime scenes.
Human DNA is a large molecule with different regions having coding and
non-coding sequences of nucleotides. Coding sequences are responsible for cellular
processes as they code for proteins, enzymes, and various structural proteins.
However, noncoding regions that were earlier named as junk DNA are very impor-
tant with respect to regulation of cellular processes. These processes comprise of the
transcriptional and translational regulation of protein-coding sequences, regions for
the attachment of scaffold, a place for initiation of DNA replication, centromeres,
and telomeres along with some sequences which are repetitive. These functions are
very important for cellular and biological maintenance while repetitive sequences
have found their applications in the identification of individuals. Majority of the
noncoding DNA comprises repetitive sequences. The number of repeats and location
of these repeat sequences form the basis for their classification. At the same time, the
repeat could be of a single nucleotide to a full gene or a several thousand base pairs.
Repeats may be found scattered all through the genome or may be localized at a
particular site like telomeric regions. As they were initially found as small satellite
bands in density-gradient centrifugations, they are also referred as satellite DNA.
Mini- or microsatellites in these noncoding regions are the ones which are highly
polymorphic. The ones that are localized in a given human chromosome are single-
locus satellites, and those that are scattered throughout the genome are called as
multi-locus satellite elements or short tandem repeats (STRs). Repetitive DNA has
been classified based on characteristics which are not very stringent. However, for
convenience, they are divided into five classes: microsatellites and minisatellites,
satellites, retroposons, and proretroviral transposons. Further details show that these
repeats indicate a pattern of their repetition. Some are direct while others are indirect
repeats; a few are a complement, reverse complement, or palindrome in their
occurrences (Table 24.1).
Further, recent studies have tried to understand how much sequence variation
exists in these STR loci. A study found that three STRs, in particular, D21S11,
D2S1338, and D12S391, showed higher allelic diversity from sequencing the repeat
476 V. Nema
motifs in all four populations studied (African American, Caucasian, Hispanic, and
Chinese). Several loci, CSF1PO, D10S1248, TH01, and TPOX, showed little to no
diversity in length vs. sequence-based alleles (Novroski et al. 2016). Additionally,
single-nucleotide polymorphisms (SNPs) in the flanking regions of these STR repeat
motif are being studied to estimate their utility in resolving complex mixture and
kinship analyses. D5S818, D7S820, and D13S317 have multiple polymorphisms
within haplotypes, and this has resulted in new alleles, based on variation in these
flanking regions, and they are associated with multiple populations and allele sizes.
D16S539 shows an SNP which is also well represented in the most common allele
sizes and populations, making it useful for new allele determinations (Gettings et al.
2015a).
This variability of DNA is often the most useful tool for differentiation and identifi-
cation of an individual. There are various methods available for identifying
individuals in forensic science. STR analysis is one of the widely used ones.
These STRs are the repeats equal to or less than six bases and are also named
microsatellites. Conventional polymerase chain reaction (PCR) is being used for
STR typing wherein the amplicons obtained after the PCR are electrophoresed and
visualized for differences or similarities as compared to others or controls. There are
manual as well as kit-based automatic methods being used for STR analysis in
different setups. For STR characterization and analysis of size, about 10–13 STR
markers are in use as standards. All 13 STR regions are analyzed and compared to
establish profiles in criminal investigations with a chance of two people having the
exact same 13 regions reaching one in a billion. However, advanced methods are
employed for the exploration of STR sequence diversity wherein multiple chromo-
somal loci are analyzed. Commercial kits with up to 20 core loci are currently
24 Utility and Possibility of Next-Generation Sequencing in Forensic DNA Typing 477
Table 24.2 Other techniques available for genetic analysis in forensic science
Name of the
analysis Technique used Purpose
STR analysis PCR To measure the number of repeats
at specific loci
Fluorescent STR PCR with fluorescently labelled Detection of different STR loci
analysis primers
STR analysis for PCR Paternity testing
three loci to resolve
parentage dispute
Single-Nucleotide PCR-RFLP/PCR-Sequencing Information on physical
Polymorphism characteristics, e.g., eye, hair, or
(SNP) skin color
Point mutation PCR with probe Detection and quantification of the
detection age-related point mutation A189G
in the human mitochondrial DNA
Detection of rare diseases, etc.
Quantitative PCR Real-time PCR (with variants like Most important as a quantitation
probe-based RT-PCR, Taqman tool for DNA in available sample
Assays or Molecular Beacons) stain identification (blood/semen,
etc.)
Microarray-based Microarray SNP profiling (even in degraded
forensic DNA samples where STR analysis is not
analysis feasible)
Fluorescence in situ RNA-FISH Identification of body fluids
hybridization
(FISH)
available (Hares 2015). Table 24.2 highlights a few more techniques that are being
used for forensic analysis. These are mainly dependent on the instrumentation
available and the type of information required.
Fig. 24.1 Capillary electrophoresis instruments (Thermo) which can be used for capillary electro-
phoresis, (a, b) From outside, (c, d) inside view of 16 capillary instrument, (e, f) inside view of
96 capillary instrument
DNA analysis came as a precise and rapid method for obtaining test analysis results
in forensic science. This has become possible with the analysis of short tandem
repeat (STR) markers using PCR and capillary electrophoresis (CE). Analysis of
specific regions of mitochondrial DNA (mtDNA) has also become possible with
CE-based sequencing. In the current scenario, the load for analysis is growing
heavily, but CE-based testing has limited capacity. Hence, a revised interest in
developing and utilizing a better analysis method has come up with the demands
for the identification of missing persons, kinship testing, ancestry investigations, and
other human identification applications. Hence, there was a need for sequencing
method which could process samples in parallel and should be free from those
artifacts which Sanger sequencing or fragment analysis-based methodology had.
480 V. Nema
As stated earlier, the next-generation sequencing (NGS) is also based on the same
principle as like that of Sanger sequencing. The genomic strand serving as a template
is broken into pieces, and the nucleotides in each fragment are recognized by the
signals generated when the fragments are extended against a template strand
(Fig. 24.4). There are arrays which are used in NGS wherein each miniscule well
serves as one reaction center having Sanger sequencing ongoing in parallel to
millions of other reactions going in other wells of the same array. This increases
the throughput as well as reduces the cost to a significant scale. Various NGS
systems are available these days with varying throughput and run time. Still, the
basic principle in all sequencing technologies is to scan the successive addition of
nucleotides to a fixed DAN array. The chemistries used in different technologies are
different in generating the templates and the way they scan the sequence extension.
Hence, NGS is a technique that uses positional separation rather than using the size
separation to arrange the fluorescent molecules. To explain it further, fluorescent
technology can be taken as one of the examples. Herein, millions of different
template DNA strands sit tightly on segregated and fixed positions on a glass slide
or throughout the entire sequencing reaction. With the incorporation of each
482 V. Nema
modified base, a microscopic scanner records the position of each template on the
glass as well as its fluorescent color and intensity. The modified bases are then
cleaved to be the regular bases and are used to extend the reaction. After n number of
scanning cycles, the software assigns all signals to their respective base (i.e., A, T, C,
or G) (Muzzey et al. 2015). This is a nontechnical description of the whole process;
however, knowing and understanding the technical terms help in imbibing the
principle, instruments, and applications.
Read: It is the length of DNA that is actually read by the sequencers. It is to be
noted here that the original amplicon or the fragment supplied to the sequencer
would be larger than this segment which is read by the sequencer. For example, a
particular sequencer and chemistry may read only first 300 bases while the supplied
fragment could be in the range of 200–1000 bases. This reading may be
24 Utility and Possibility of Next-Generation Sequencing in Forensic DNA Typing 483
unidirectional (single read, SR) or may be read in a pair reading from both the ends
simultaneously (paired end (PE) read).
Read Length and Mean Read Length: The number of bases sequenced are called
“read length” which vary from reaction to reaction, and hence, an average of the total
length is termed as “mean read length.”
Sequencing Depth: The number of reads which align to the reference template in a
run is called coverage or the depth of the sequencing. Hence, “It is the average
number of times a single base is read during a sequencing run.” For example, if a
nucleotide or a gene fragment is sequenced 1000 times, the coverage would be called
as 1000. With the increase in coverage, reliability also increases as the errors
become minority.
File Formats: Every instrument uses its own software to scan the reads and
express them according to the fed algorithm. Hence, the output from the sequencer
depends on its software. However, all the output files need to be converted into once
common file format that may be read by other analysis software too. Some file
formats as originated from various sequencers are given below: “SRF, FASTA,
FASTQ, SFF, SCARF, AB1, EMBL” etc.
Q Score: This score indicates the possibility of a given base to be read incorrectly
by the sequencer or the analysis software, hence directly related to the quality of the
read. The score depends on various processing steps beginning from library prepa-
ration to the run and read.
With the success of Sanger sequencing, different innovative technologies were tried
and optimized for keeping the principle same while taking the number of reactions to
a million fold throughput and reducing the cost per reaction. Hence, a PCR tube with
single reaction has reached to millions of reactions in micro- or nano-sized wells of a
chip which itself measures a few millimeters. This was the next-generation sequenc-
ing. The best-used technologies in NGS instruments, sequencing-by-synthesis
(Ronaghi et al. 1998), sequencing-by-ligation (Shendure et al. 2005), and ion
semiconductor sequencing (Rothberg et al. 2011) are the prominent oneswherein
sequencing-by-synthesis are mostly used.
The instruments available in the market utilizes minor differences in the
technologies to handle the given application. Some instruments and technologies
are designed to execute lighter tasks with lowered cost which the others are robust in
throughput and are utilized for heavier sequencing like human genome project. They
require a heavy cost for their setup and execution. However, the information
generated is also significant. Here we discuss about a few commercial instruments,
but the list is not comprehensive to cover all the instruments and technologies.
Illumina: A company that is responsible for providing advanced instruments for
sequencing and microarray. Providing technologies for the analysis of genetic
variation and function is the key area along with all other dimensions of the genomic
research and molecular diagnostics. A wide variety of instruments are available for
484 V. Nema
NGS from this company. The instruments of NGS are based on the “sequencing by
synthesis” principle. The instruments from Illumina ranges from “NovaSeq™,
NextSeq®, HiSeq®, HiSeq X™, HiScanSQ™, MiSeq®, MiSeqDx™, MiniSeq™,
etc.” The MiSeq® and HiSeq® instruments are mostly used. Many of these
instruments are can read in single (single reads) as well as in both the directions
(paired-end reads), and the read length varies with instrument. NovaSeq™ 6000
(Fig. 24.5 as reproduce with the permission of Illumina Company) is the latest and
the most affordable instrument with all the desired applications on board wherein
NextSeq segment is the advanced series for very high load and coverage of all the
latest applications.
Ion (Thermo Fisher): The sequencers from ion range use optical signals in a few
instruments, whereas the release of H+ ions is captured in others. Ion torrent that
make use of optical signals is useful for amplicons, small genomes, or targeting of
small regions within a genome. Ion proton with the capacity of larger output captures
the release of hydrogen ion which is generated as a result of addition of a dNTP to a
DNA polymer. Non-dependency on optics make this technology a bit faster. Ion
GeneStudio series of the systems are the advanced ones which are used these days
for various applications.
SOLiD (Sequencing by Oligonucleotide Ligation and Detection) by Life
Technologies does the sequencing by ligation that takes place after emulsion PCR.
In this, the DNA templates are amplified on beads. The system on which the reaction
takes place is called the flow cell, and the beads are placed on the solid phase of this
24 Utility and Possibility of Next-Generation Sequencing in Forensic DNA Typing 485
flow cell. The system has a very high accuracy but has limitation of shorter read
length.
The conventional next-generation sequencing entails three basic steps. The reagents
and technologies differ from these steps in different companies and platforms. Step
one gets the sample ready by purifying it and removing all other impurities, and step
two links the primers with the small oligonucleotides which are used as identifying
bases in the later stages of data analysis. After attachment of the linkers, the
fragments are identifiable, and this step is called library preparation. The libraries
486 V. Nema
are enriched by polymerase chain reaction, and the step is called amplification. The
last step of reading or scanning these amplified molecules is to decipher the sequence
of nucleotides for which different instruments and technologies use different
chemistries as discussed earlier.
24.6.2 Amplification
In most of the cases, the library prepared for sequencing needs to be amplified so as
to get signals much above the background, and the threshold limits during the
detection by sequencer. The amplification is done using PCR which also have a
few limitations like “biasing” and “duplication.” Another problem is merging of the
two segments to become one segment having a region originating from a little part
from both of the two strands. This is called as Chimera, which mostly comes during
metagenomic sequencing and is a big concern. Although software takes care of these
chimeras in analysis part, these can be avoided during PCR only by using
high-fidelity enzymes (Nema 2012). Emulsion PCR and Bridge PCR are the
techniques used for amplifying the sequencing material. Emulsion PCR uses emul-
sion oil, beads, PCR mix, and the library DNA to form a mixture of all in emulsion
state wherein these miniscule droplets of emulsion serve as individual center of PCR.
Hence, number of reactions take place simultaneously in these micro-droplets. It is
believed that one droplet or a micro-well should contain one bead and one strand for
a successful reaction. To achieve the purpose of resolution, this is a very good
technique. However, having multiple steps like forming of emulsion followed by
amplification and enrichment and finally breaking of the same emulsion seems to be
a bit cumbersome and time consuming. This also has more chances of introducing
errors. If any step goes wrong, the whole setup has to be redone. In a few cases, this
may go well but you may just achieve a few good wells having one bead and one
strand in it. Another chemistry is bridge PCR wherein complementary
oligonucleotides to the primers which are attached to the DNA library fragments
are densely coated on flow cell (the glass or silica chip where the sequencing
chemistry occurs). The DNA is then allowed to attach to the surface of the cell at
random. When the reagents for extension are added, the free ends of the single
strands of DNA attach themselves to the surface of the cell via complementary
primers, creating bridged structures. This is followed by a normal PCR to form
double-stranded structures and is further used as templates for next reactions forming
clusters after a few cycles.
24.6.3 Sequencing
The wealth of big data generated by these high-throughput sequencing efforts can be
used only after analysis and useful interpretations. It is sometimes difficult for
normal laboratory workers to understand the complex algorithms used behind the
simplification and interpretation of the data as generated by these technologies.
Before matching the sequences with the available databases for deriving
conclusions, the first step is to ensure if the data generated is of optimum quality
or not. The interface between a user language and the machine language has to come
as the first step wherein the data generated is converted into a readable format. Also
this format has to be compatible with other analysis platforms. As different
instruments use different chemistries for reactions and different scanning methods
for reading the sequences, the first step is normally provided as embedded software
in the instrument itself. The parameters of initial importance are number of success-
ful reads, the read length, and quality of the reads (Q scores). In this step only, the
samples that were mixed for multiplexing need to be de-multiplexed by the software.
The adapters or the barcodes used to label the reactions initially are read by the
software to tease them into their independent identity and to segregate these reads in
separate files.
The outcome of the above step is a cleaned and quality data that is called as
primary data and is used in secondary analysis as per the user and application
requirements. This data is considered as clean with no background noise and errors
like chimera. The secondary analysis steps are normally the intensive ones in terms
of computational resources required and expertise of the analyst. Depending on the
required information, the obtained sequences are either aligned with the standard
genomes or the amplicons, and the step is called read mapping or alignment.
Different mapping tools are available with different algorithms developed by
workers from academics. These are listed in Table 24.3.
The mapping of the FASTQ file with the reference genome generated a sequence
alignment map (SAM) or the binary alignment files (BAM). As the name goes, BAM
files are the technical version of SAM files with binary codings. This saves space of
storage but are readable by machines only. These are the standard formats and are in
use universally. This data generated by these files is used in calibrating the quality
scores again depending on the purpose of the sequencing. Many open-ended or paid
software are available for in-depth analysis of data generated through various
platforms of next-generation technology. Moreover, a few platforms have integrated
software to take the analysis part also after generating FASTQ and SAM files.
However, the integrated ones are provided under commercial licenses and are costly.
Segregated tools from various platforms or free sites can also be employed in tandem
to get the overall analysis done.
24 Utility and Possibility of Next-Generation Sequencing in Forensic DNA Typing 489
This chapter was written with an intent of making the users understand the technol-
ogy and giving them an indication about its usage possibilities. However, no
technology is limited with the applications available in a given piece of time.
There is a good scope for innovation in this area. Technically speaking, next-
generation sequencing has many applications; a few of which are large whole-
genome sequencing of higher eukaryotes like plants, animals, and human, small
whole-genome sequencing of microbes, etc., exome and large panel sequencing,
amplicon-based or gene panel-based targeted gene sequencing, profiling of single-
cell-like scRNAseq, scDNA—Seq, oligo tagging assays, sequencing of
transcriptome comprising total RNA, mRNA or gene expression profiling, targeted
gene expression profiling, interaction analysis of DNA and protein, modification
analysis like methylation, etc., 16S metagenomics sequencing, shotgun
metagenomics and metatranscriptomics, cell free sequencing, liquid biopsy analysis,
etc. Furthermore, there are many field opening up with the use of NGS technology.
Forensic research is one such field that involve construction of DNA database,
ancestry and phenotypic inference, monozygotic twin studies, body fluid and species
identification, and forensic animal, plant, and microbiological analyses (Yang et al.
2014). It is up to the user and scope of the area of application that anyone or multiple
approaches may be employed to get desirable outcomes. A bottleneck in Sanger
sequencing for forensic STR analysis/CE typing is the ability to resolve alleles that
are identical by size, but different by sequence. NGS has this advantage over STR
analysis. At the same time, it has been proposed as a precise method for casework
and human identification utilizing applications such as intra-STR SNPs and
mtDNA SNPs.
490 V. Nema
Initial phase of NGS with shorter read length was considered non-suitable for STR
analysis. However, technological advancements not only made this possible but also
allow for the detection of newer STR locus. Other advantages being the discriminat-
ing capability of NGS for the resolution of alleles having similar length, differentia-
tion of mixed DNAs in the given samples, and to resolve complex paternity cases
(Irwin et al. 2011; Bornman et al. 2012; Warshauer et al. 2013; Van Neste et al.
2014).
When a new technology is found useful in the field of forensics, there come various
derivatives of the applications which may be used for different novel purposes. Here
are some of the examples wherein workers have exploited the immense potential of
NGS for harvesting newer information or digging out the information from hard to
reach samples. In a study by Xu and coworkers, it is proposed that prediction of age
using DNA methylation and “support vector regression model” is possible now.
Hence, they state that their strategy is highly useful in forensic practice as far as
estimating the individual age is concerned (Xu et al. 2015). Similarly, a study by
Vidaki and coworkers have attempted to create a similar age prediction test with
better sensitivity and accuracy using a method based on NGS. The methylation
24 Utility and Possibility of Next-Generation Sequencing in Forensic DNA Typing 491
status of the selected 16cCpG sites was assessed and quantified in the method using
the Illumina MiSeq® platform. A set of 46 blood samples were taken here to validate
the method and DNA standards of known methylation levels served as control. They
could achieve MAE ¼ 7.5 years and hope that future optimization of the method will
improve both the prediction accuracy and reproducibility (Vidaki et al. 2017).
NGS or massively parallel sequencing (MPS) is not only serving to study
complex samples but also coming handy in evaluating different existing
technologies for the analysis of complex study material. Similarly, a study to analyze
petrosal bone as a source of DNA was conducted and CE- and MPS-based analyses
were compared for forensic identification of challenging cranial bones. Cranial
bones and other skeletal materials were processed for doing STR typing, and the
results were verified using MPS. The outcomes of the analysis supported the
potential of MPS for studying degraded samples with an advantage and possibility
of getting additional and useful information (Kulstein et al. 2017). Studies are
coming up with next-generation sequencing for studying epigenetic markers like
analysis of tissue-specific DNA methylation. Workers have distinguished between
the epigenetic signals from 5000 pairs of monozygotic twins (Bell and Spector
2011). Identification of body fluid, tissue, and the age accurately and detection of
fabricated DNA evidence could be done using the epigenetic markers (Lee et al.
2012; Bocklandt et al. 2011). Along with epigenetic markers, microRNA and small
noncoding RNAs are also being used more and more for different forensic
applications and could be well studied using next-generation sequencing in a high-
throughput and time- and cost-effective manner. As microRNA (miRNA) are
smaller in size and are protected by proteins and other matrices, they are proven to
be more stable as compared to other RNA species. Forensically useful biological
fluids like blood, semen, vaginal fluid, menstrual blood, saliva, urine, feces, and
perspiration were used in a study to look for the usefulness of miRNA expression
which was read through NGS. A typical finding was that the small RNA from
bacterial origin in some fluids (vaginal fluid, saliva, and feces) interfered in the
yield of miRNA (Seashols-Williams et al. 2016). At the same time, some other
studies have also tried to harness the potential of miRNA and ncRNA (noncoding
RNA) sequencing in forensic investigations (Courts and Madea 2011; Wang et al.
2012; Tam et al. 2014; Ghildiyal and Zamore 2009; Courts and Madea 2010).
Identification of insects is an integral part of forensic entomology and is getting
great help with NGS. Identification of insects and arthropods has a potential to
support medico-criminal investigations like abuse cases, movement of corpse, and
the most useful one postmortem interval estimates. It may also help in the detection
of biological toxins, determination of the location of the incident, and in finding the
presence and time of the infliction of wounds. An interesting study in this area dealt
with the sampling of the insect population from the house of a women who died but
the cause of death was unknown. The technology could help not only in identifying
the insects but also the extraction and analysis of human DNA from the GI tract of
the insect. They could individuate the presence of human DNA in the samples and
determined the genetic profile (Pilli et al. 2016).
492 V. Nema
References
Anon A (1996) The evaluation off forensic evidence. Proc Natl Acad Sci 94(11):5498–5500
Bell JT, Spector TD (2011) A twin approach to unraveling epigenetics. Trends Genet 27
(3):116–125
Bocklandt S, Lin W, Sehl ME, Sanchez FJ, Sinsheimer JS, Horvath S, Vilain E (2011) Epigenetic
predictor of age. PLoS One 6(6):e14821
Bodner M, Bastisch I, Butler JM, Fimmers R, Gill P, Gusmao L, Morling N, Phillips C, Prinz M,
Schneider PM, Parson W (2016) Recommendations of the DNA Commission of the Interna-
tional Society for Forensic Genetics (ISFG) on quality control of autosomal Short Tandem
Repeat allele frequency databasing (STRidER). Forensic Sci Int Genet 24:97–102
Bornman DM, Hester ME, Schuetter JM, Kasoji MD, Minard-Smith A, Barden CA, Nelson SC,
Godbold GD, Baker CH, Yang B, Walther JE, Tornes IE, Yan PS, Rodriguez B, Bundschuh R,
Dickens ML, Young BA, Faith SA (2012) Short-read, high-throughput sequencing technology
for STR genotyping. Biotech Rapid Dispatches 2012:1–6
Borsting C, Morling N (2015) Next generation sequencing and its applications in forensic genetics.
Forensic Sci Int Genet 18:78–89
Braslavsky I, Hebert B, Kartalov E, Quake SR (2003) Sequence information can be obtained from
single DNA molecules. Proc Natl Acad Sci U S A 100(7):3960–3964
Courts C, Madea B (2010) Micro-RNA – a potential for forensic science? Forensic Sci Int 203
(1–3):106–111
Courts C, Madea B (2011) Specific micro-RNA signatures for the detection of saliva and blood in
forensic body-fluid identification. J Forensic Sci 56(6):1464–1470
Eduardoff M, Santos C, de la Puente M, Gross TE, Fondevila M, Strobl C, Sobrino B, Ballard D,
Schneider PM, Carracedo A, Lareu MV, Parson W, Phillips C (2015) Inter-laboratory evalua-
tion of SNP-based forensic identification by massively parallel sequencing using the ion PGM.
Forensic Sci Int Genet 17:110–121
Fierer N, Lauber CL, Zhou N, McDonald D, Costello EK, Knight R (2010) Forensic identification
using skin bacterial communities. Proc Natl Acad Sci U S A 107(14):6477–6481
Gettings KB, Aponte RA, Kiesler KM, Vallone PM (2015a) The next dimension in STR sequenc-
ing: Polymorphisms in flanking regions and their allelic associations. Forensic Sci Int Genet
Suppl Ser 5:e121–e123
494 V. Nema
Gettings KB, Aponte RA, Vallone PM, Butler JM (2015b) STR allele sequence variation: current
knowledge and future issues. Forensic Sci Int Genet 18:118–130
Gettings KB, Kiesler KM, Faith SA, Montano E, Baker CH, Young BA, Guerrieri RA, Vallone PM
(2016) Sequence variation of 22 autosomal STR loci detected by next generation sequencing.
Forensic Sci Int Genet 21:15–21
Ghildiyal M, Zamore PD (2009) Small silencing RNAs: an expanding universe. Nat Rev Genet 10
(2):94–108
Hares DR (2015) Selection and implementation of expanded CODIS core loci in the United States.
Forensic Sci Int Genet 17:33–34
Homer N, Merriman B, Nelson SF (2009) BFAST: an alignment tool for large scale genome
resequencing. PLoS One 4(11):e7767
Irwin J, Just R, Scheible M, Loreille O (2011) Assessing the potential of next generation sequencing
technologies for missing persons identification efforts. Forensic Sci Int Genet Suppl Ser
3:447–448
Kaye DH (1995) The forensic debut of the NRC’s DNA report: population structure, ceiling
frequencies and the need for numbers. Genetica 96(1–2):99–105
Kidd KK, Pakstis AJ, Speed WC, Grigorenko EL, Kajuna SL, Karoma NJ, Kungulilo S, Kim JJ, Lu
RB, Odunsi A, Okonofua F, Parnas J, Schulz LO, Zhukova OV, Kidd JR (2006) Developing a
SNP panel for forensic identification of individuals. Forensic Sci Int 164(1):20–32
Kidd KK, Speed WC, Pakstis AJ, Furtado MR, Fang R, Madbouly A, Maiers M, Middha M,
Friedlaender FR, Kidd JR (2014) Progress toward an efficient panel of SNPs for ancestry
inference. Forensic Sci Int Genet 10:23–32
Kim EH, Lee HY, Yang IS, Jung SE, Yang WI, Shin KJ (2016) Massively parallel sequencing of
17 commonly used forensic autosomal STRs and amelogenin with small amplicons. Forensic
Sci Int Genet 22:1–7
Kulstein G, Hadrys T, Wiegand P (2017) As solid as a rock-comparison of CE- and MPS-based
analyses of the petrosal bone as a source of DNA for forensic identification of challenging
cranial bones. Int J Legal Med 132(1):13–24
Lax S, Smith DP, Hampton-Marcell J, Owens SM, Handley KM, Scott NM, Gibbons SM, Larsen P,
Shogan BD, Weiss S, Metcalf JL, Ursell LK, Vazquez-Baeza Y, Van Treuren W, Hasan NA,
Gibson MK, Colwell R, Dantas G, Knight R, Gilbert JA (2014) Longitudinal analysis of
microbial interaction between humans and the indoor environment. Science 345
(6200):1048–1052
Lax S, Hampton-Marcell JT, Gibbons SM, Colares GB, Smith D, Eisen JA, Gilbert JA (2015)
Forensic analysis of the microbiome of phones and shoes. Microbiome 3:21
Lee HY, Park MJ, Choi A, An JH, Yang WI, Shin KJ (2012) Potential forensic application of DNA
methylation profiling to body fluid identification. Int J Legal Med 126(1):55–62
Lee WP, Stromberg MP, Ward A, Stewart C, Garrison EP, Marth GT (2014) MOSAIK: a hash-
based algorithm for accurate next-generation sequencing short-read mapping. PLoS One 9(3):
e90581
Levene MJ, Korlach J, Turner SW, Foquet M, Craighead HG, Webb WW (2003) Zero-mode
waveguides for single-molecule analysis at high concentrations. Science 299(5607):682–686
Metcalf JL, Wegener Parfrey L, Gonzalez A, Lauber CL, Knights D, Ackermann G, Humphrey GC,
Gebert MJ, Van Treuren W, Berg-Lyons D, Keepers K, Guo Y, Bullard J, Fierer N, Carter DO,
Knight R (2013) A microbial clock provides an accurate estimate of the postmortem interval in a
mouse model system. eLife 2:e01104
Munroe DJ, Harris TJ (2010) Third-generation sequencing fireworks at Marco Island. Nat
Biotechnol 28(5):426–428
Muzzey D, Evans EA, Lieber C (2015) Understanding the basics of NGS: from mechanism to
variant calling. Curr Genet Med Rep 3(4):158–165
Nature (2020). https://www.nature.com/subjects/next-generation-sequencing
Nema V (2012) Rectification of artificial molecular recombination with the use of high fidelity
enzyme in the amplification of 16S rDNA sequences from stool sample. All Res J Biol 3:6–9
24 Utility and Possibility of Next-Generation Sequencing in Forensic DNA Typing 495
Novroski NMM, King JL, Churchill JD, Seah LH, Budowle B (2016) Characterization of genetic
sequence variation of 58 STR loci in four major population groups. Forensic Sci Int Genet
25:214–226
Parson W, Strobl C, Huber G, Zimmermann B, Gomes SM, Souto L, Fendt L, Delport R, Langit R,
Wootton S, Lagace R, Irwin J (2013) Evaluation of next generation mtGenome sequencing
using the Ion Torrent Personal Genome Machine (PGM). Forensic Sci Int Genet 7(5):543–549
Parson W, Huber G, Moreno L, Madel MB, Brandhagen MD, Nagl S, Xavier C, Eduardoff M,
Callaghan TC, Irwin JA (2015) Massively parallel sequencing of complete mitochondrial
genomes from hair shaft samples. Forensic Sci Int Genet 15:8–15
Phillips C, Prieto L, Fondevila M, Salas A, Gomez-Tato A, Alvarez-Dios J, Alonso A, Blanco-
Verea A, Brion M, Montesino M, Carracedo A, Lareu MV (2009) Ancestry analysis in the 11-M
Madrid bomb attack investigation. PLoS One 4(8):e6583
Pilli E, Agostino A, Vergani D, Salata E, Ciuna I, Berti A, Caramelli D, Lambiase S (2016) Human
identification by lice: a next generation sequencing challenge. Forensic Sci Int 266:e71–e78
Ronaghi M, Uhlen M, Nyren P (1998) A sequencing method based on real-time pyrophosphate.
Science 281(5375):363–365
Rothberg JM, Hinz W, Rearick TM, Schultz J, Mileski W, Davey M, Leamon JH, Johnson K,
Milgrew MJ, Edwards M, Hoon J, Simons JF, Marran D, Myers JW, Davidson JF, Branting A,
Nobile JR, Puc BP, Light D, Clark TA, Huber M, Branciforte JT, Stoner IB, Cawley SE,
Lyons M, Fu Y, Homer N, Sedova M, Miao X, Reed B, Sabina J, Feierstein E, Schorn M,
Alanjary M, Dimalanta E, Dressman D, Kasinskas R, Sokolsky T, Fidanza JA, Namsaraev E,
McKernan KJ, Williams A, Roth GT, Bustillo J (2011) An integrated semiconductor device
enabling non-optical genome sequencing. Nature 475(7356):348–352
Sanchez JJ, Phillips C, Borsting C, Balogh K, Bogus M, Fondevila M, Harrison CD, Musgrave-
Brown E, Salas A, Syndercombe-Court D, Schneider PM, Carracedo A, Morling N (2006) A
multiplex assay with 52 single nucleotide polymorphisms for human identification. Electropho-
resis 27(9):1713–1724
Scheible M, Loreille O, Just R, Irwin J (2014) Short tandem repeat typing on the 454 platform:
strategies and considerations for targeted sequencing of common forensic markers. Forensic Sci
Int Genet 12:107–119
Seashols-Williams S, Lewis C, Calloway C, Peace N, Harrison A, Hayes-Nash C, Fleming S,
Wu Q, Zehner ZE (2016) High-throughput miRNA sequencing and identification of biomarkers
for forensically relevant biological fluids. Electrophoresis 37(21):2780–2788
Shendure J, Porreca GJ, Reppas NB, Lin X, McCutcheon JP, Rosenbaum AM, Wang MD,
Zhang K, Mitra RD, Church GM (2005) Accurate multiplex polony sequencing of an evolved
bacterial genome. Science 309(5741):1728–1732
Tam S, de Borja R, Tsao MS, McPherson JD (2014) Robust global microRNA expression profiling
using next-generation sequencing technologies. Lab Investig 94(3):350–358
Tang S, Wang J, Zhang VW, Li FY, Landsverk M, Cui H, Truong CK, Wang G, Chen LC,
Graham B, Scaglia F, Schmitt ES, Craigen WJ, Wong LJ (2013) Transition to next generation
analysis of the whole mitochondrial genome: a summary of molecular defects. Hum Mutat 34
(6):882–893
Taylor LH, Latham SM, Woolhouse ME (2001) Risk factors for human disease emergence. Philos
Trans R Soc Lond B Biol Sci 356(1411):983–989
Van Neste C, Vandewoestyne M, Van Criekinge W, Deforce D, Van Nieuwerburgh F (2014)
My-Forensic-Loci-queries (MyFLq) framework for analysis of forensic STR data generated by
massive parallel sequencing. Forensic Sci Int Genet 9:1–8
Vidaki A, Ballard D, Aliferi A, Miller TH, Barron LP, Syndercombe Court D (2017) DNA
methylation-based forensic age prediction using artificial neural networks and next generation
sequencing. Forensic Sci Int Genet 28:225–236
Walsh S, Liu F, Wollstein A, Kovatsi L, Ralf A, Kosiniak-Kamysz A, Branicki W, Kayser M
(2013) The HIrisPlex system for simultaneous prediction of hair and eye colour from DNA.
Forensic Sci Int Genet 7(1):98–115
496 V. Nema
Wang Z, Luo H, Pan X, Liao M, Hou Y (2012) A model for data analysis of microRNA expression
in forensic body fluid identification. Forensic Sci Int Genet 6(3):419–423
Warshauer DH, Lin D, Hari K, Jain R, Davis C, Larue B, King JL, Budowle B (2013) STRait
Razor: a length-based forensic STR allele-calling tool for use with second generation sequenc-
ing data. Forensic Sci Int Genet 7(4):409–417
Xu C, Qu H, Wang G, Xie B, Shi Y, Yang Y, Zhao Z, Hu L, Fang X, Yan J, Feng L (2015) A novel
strategy for forensic age prediction by DNA methylation and support vector regression model.
Sci Rep 5:17788
Yang Y, Xie B, Yan J (2014) Application of next-generation sequencing technology in forensic
science. Genomics Proteomics Bioinformatics 12(5):190–197
Zeng X, King JL, Stoljarova M, Warshauer DH, LaRue BL, Sajantila A, Patel J, Storts DR,
Budowle B (2015) High sensitivity multiplex short tandem repeat loci analyses with massively
parallel sequencing. Forensic Sci Int Genet 16:38–47
Zhou Y, Guo F, Yu J, Liu F, Zhao J, Shen H, Zhao B, Jia F, Sun Z, Song H, Jiang X (2016)
Strategies for complete mitochondrial genome sequencing on Ion Torrent PGM platform in
forensic sciences. Forensic Sci Int Genet 22:11–21
Oral Microbes: A Hidden Yet Powerful
Evidence for Futuristic Forensic 25
Investigation
Abstract
Keywords
Oral microbes · Forensic microbiology · Diversity · Bite mark · Body fluid · Post-
mortem interval (PMI) · Ethnicity · Human identification
B. C. Patel (*)
Laboratory of Forensic Biology and Biotechnology, School of Forensic Science, National Forensic
Sciences University, Gandhinagar, Gujarat, India
e-mail: [email protected]
M. G. Soni
Police Hospital, Rourkela, Odisha, India
25.1 Introduction
Since the earliest days of microbiology, it has been clear that all humans carry many
of the same microbial lineages. The microbes living in or on our bodies are now
known as the human microbiome (Turnbaugh et al. 2007). A collective international
effort, called the Human Microbiome Project (HMP) by the National Institutes of
Health (Peterson et al. 2009), is now broadly known as the International Human
Microbiome Consortium (IHMC). The consortium is aiming to characterize the
microbiome of various parts of human body.
Human body can support several bacterial ecosystems all over the body espe-
cially in hair (Tridico et al. 2014), skin, gut, mouth, and urogenital tracts (Giampaoli
et al. 2012; Juusola and Ballantyne 2005). Different studies for gut microflora
showed extensive diversity of the gut microbiome between healthy humans (Ley
et al. 2006a, b; Raman et al. 2010). Studies since past 5 years for skin bacterial
diversity showed that in addition to conserved organisms, there is massive diversity
in identities and richness (Costello et al. 2009; Grice et al. 2009; Fierer et al. 2008;
Gao et al. 2007; Blaser 2010). Among these, the oral cavity is a unique ecological
niche because it can provide hard, non-shedding surfaces that are teeth which are
durable and accessible for microbial colonization. Our oral cavity harbors a diverse
group of microorganisms that include bacteria, fungi, mycoplasma, protozoa, and
sometimes may be viruses (Costello et al. 2009; Ventura Spagnolo et al. 2019).
Altogether they are known as the oral microbiome. There are billions of bacteria in
the oral cavity that forms ecosystems in different sites in the oral cavity. These
ecosystems are dorsum of the tongue, buccal epithelium, the supragingival and
subgingival tooth surfaces, crevicular surfaces, and tonsils where microflora varies
from one site to another (Muhammad et al. 2012). These diverse ecosystems make
saliva a rich source of a diverse group of bacteria.
Our oral microflora constitutes more than 500 species of bacteria. The unique feature
of oral bacteria is that they vary from mouth to mouth, though the majority of them
are similar in most of the individuals and differences are created mainly by minority
members of the bacterial group (Takeshita et al. 2016). More precisely diversity can
be appreciated at species and subspecies level. A study by Bik et al. (2010) revealed
how each oral cavity harbors a distinct population of microbial groups, but that such
groups appear to be more identical when categorized at genus level. Previously
designed ecological methods for larger species, such as co-occurrence evaluation,
can significantly promote the study of diverse bacterial populations such as those
present in the human body and improve our perception of the role of microbiome in
human physiology.
25 Oral Microbes: A Hidden Yet Powerful Evidence for Futuristic Forensic. . . 499
Many factors contributing to the reason for this mixed microbial diversity
(Muhammad et al. 2012) described are as follows:
Oral
Microbiome
Fig. 25.1 Host secreted biomolecules that can affect oral microbiome heritability (Source: Daven-
port (2017))
for 485 twins aged 5–11 years. By comparing monozygotic (identical; MZ) and
dizygotic (fraternal; DZ) twin pair microbiomes, they estimated heritability (h2),
which is the difference in the association between MZ and DZ twin pairs, for the
comparative prevalence of bacterial taxa in at least half of their specimens. Of the
91 common bacteria investigated, nearly half show heritability at least 20%.
Among these, several taxa’s heritage estimates are relatively small, including
Prevotella pallens (h2 ¼ 0.65), a Veillonella genus (h2 ¼ 0.60), and Corynebac-
terium durum (h2 ¼ 0.54), clearly showing the importance of the host genomes to
oral occupancy by these microbes. As shown in Fig. 25.1, saliva and epithelial
tissues comprise many compounds of known genetic variation. Proline proteins
(PRPs) are significant component of saliva, causing bacterial adherence to tooth
surfaces. Mucins function as tethering and energy sources for different
microbiota. Immune molecules and other biomolecules (histatins, defensins,
etc.) control oral microbial composition and inhibit pathogen invasion. Taste
receptors make a contribution to food preferences, and certain enzymes catalyze
food, like amylase. All these molecular groups generate specific dietary content
for oral bacteria. Eventually, the salivary flow rate determines these molecule
concentration and electrolytes.
8. Other conditions: In certain oral health-related conditions like diabetes, hyper-
tension, smokers, dental caries, and periodontitis, phylogenetic diversity of oral
bacteria is more than in healthy individuals (Takeshita et al. 2016). HMP reported
that there were strong associations between whether individuals had been
25 Oral Microbes: A Hidden Yet Powerful Evidence for Futuristic Forensic. . . 503
breastfed as an infant, their gender, and their level of education with their
community types at several body sites (Anukam and Agbakoba 2017). Galvão-
Moreira et al. (2018) studied 46 female and 24 male patients, aged 18–40 years,
and counted both groups’ Streptococcus mutans. The study suggested that there
was a significant difference for S. mutans levels in both groups.
Given the range of surfaces required for the processing of samples and the abun-
dance of knowledge accessible to scientists and researchers from such tests, the
human microbiome is theoretically a very effective forensic analysis tool. Further
experiments have also shown that the makeup of the microbiota (taxonomical
structures) differ over time (Flores et al. 2014), and the microbial concentrations
of the gut and saliva are more stable.
Variety in human microbiome can be defined in many ways. The most
recommended practice is the analysis by targeted sequencing of the variable regions
of the 16S r RNA gene of the taxonomic distribution of samples. Several online and
offline bioinformatics tools/software/databases are available to assemble similar
sequences (traditionally 97% 16S rRNA sequence similarities) into groupings,
termed Operational Taxonomic Units or OTUs (Schloss et al. 2009; Caporaso
504 B. C. Patel and M. G. Soni
and the number of copies can vary between the species, and the hypervariable region
of rpoB can bring down the level of identification to species and subspecies level.
16srRNA and rpoB1 reveal that Streptococcus is the most commonly detected genus
in saliva, and according to rpoB2 gene analysis, Rothia is the most abundant genus.
Experiments using this technique demonstrate that samples from all the individuals
can be differentiated from each other and no two individuals had the same oral
microbial profiles (Rahimi et al. 2005; Leake et al. 2016). RFLP technique is the
most straightforward method to find out polymorphism in 16srRNA gene in bacteria
and compare bite mark DNA to suspect’s teeth DNA (Spradbery 2010). Multilocus
sequence typing (MLST) scheme which is used to isolate and differentiate strains of
microbial species by observing DNA sequence variations of housekeeping genes has
been developed for oral Streptococci (Do et al. 2010). High-throughput sequencing
technique is used to sequence 16srRNA, 16s–23s ITS (intergenic spacer), and rpoB
gene region of oral streptococcal DNA. Results obtained had proven that
Streptococci amplified from bite marks originated from teeth only. rpoB gene gave
the most satisfactory results, whereas the discriminatory power of 16srRNA and ITS
was less (Kennedy 2011).
A very crucial factor for forensic investigation is the temporal stability of the
reference sample which means if the sample is collected and subjected for
experiments, it should give the same results. Temporal stability of oral streptococcal
DNA has been assessed in various studies. AP PCR, as well as sequencing
techniques, revealed that although the oral streptococcal population is dynamic
with species number and proportions fluctuating over time, dominant strains are
retained for a longer period, and they were able to identify the suspect with the same
potential as earlier correctly (Rahimi et al. 2005; Kennedy 2011).
In infected human bites also Streptococcus species is the most abundant with
Streptococcus anginosus as dominant group followed by Staphylococcus aureus and
Eikenella corrodens as aerobic species and Prevotella, Fusobacterium, and
Veillonella as anaerobic species. Even in abscess bite mark wounds, Streptococcus
and Staphylococcus species are abundant (Talan et al. 2003).
Thus it is well proven that salivary microflora can be used as a potential tool for
identification as bacterial DNA resist degradation more efficiently and can differen-
tiate two individuals along with their lifestyle. Oral flora can even distinguish
between twins that means genetics do not have any influence on the oral
microbiome. Antibiotics do have a promising effect on the oral microbiome, but it
recovers back to pre-antibiotic diversity after a few days of treatment (Leake et al.
2016).
Biological evidence in a crime scene usually constitutes various body fluids that too
in trace amounts. It is very crucial to identify the type of body fluid to know the
nature of the crime. Various presumptive tests are still preferred to identify the body
fluids using specific enzymes that are particular for that fluid. The result is obtained
25 Oral Microbes: A Hidden Yet Powerful Evidence for Futuristic Forensic. . . 507
as a color change. However, this test may often give false-positive result due to the
presence of that enzyme in a small amount in other body fluids. An alpha-amylase
enzyme present in saliva is generally used to identify the saliva, but this enzyme is
generally present in small amount in other body fluids like urine and semen that can
falsely be recognized as saliva. RNA-based assay targeting saliva-specific gene
products have been recently introduced for the detection of saliva (Nakanishi et al.
2009).
An alternative method for the detection of body fluids is taxonomic profiling of
microbes. This can be possible for fluids rich in microbes such as saliva, vaginal
secretion, feces, and menstrual blood while sterile or nearly sterile body fluids such
as blood, semen, and tears are difficult to recognize. Sequencing of microbial
16srRNA gene can be done to discriminate saliva collected from the human body
or a crime scene (Hanssen et al. 2017). Oral Streptococci such as S. salivarius and
S. mutans are only found in saliva and not in semen, urine, skin, or vaginal fluid. In a
study, S. salivarius was obtained in all and S. mutans in most of the mock forensic
samples cigarette butt, cotton gauze wiped licked skin and aged saliva samples.
Neither S. salivarius nor S. mutans can be detected in the saliva of other animals.
Hence, oral streptococci are the new marker for detection of saliva (Nakanishi et al.
2009).
One of the most complex microbiomes in the human body is in the oral cavity. This
has been shown to be the second most complex microbiome of the body after the
gastrointestinal tract. The native microorganisms biodegrade the cadaver upon
death. Oral cavity and gastrointestinal tract microbiomes, thereby play a crucial
role in biological decomposition of the cadaver. Many studies are reported for the
application of different microbial succession for the PMI estimation (Damann et al.
2015; Burcham et al. 2016; Guo et al. 2015; Metcalf 2019; DeBruyn and Hauther
2017; Hyde et al. 2013). It has been well established that skin microbiome can be
used to calculate the postmortem interval of the dead body (Aaspõllu et al. 2011).
However, a study (Aaspõllu et al. 2011) reported that most variation over decompo-
sition occurred in mouth microbial populations, while group size and composition
were most consistent in the rectum. Recently, oral microbes are assessed to calculate
the time since death (Adserias-Garriga et al. 2017). Firmicutes and Actinobacteria
are the predominant phyla in the fresh stage of the cadaver. This phylum generally
includes Lactobacilli, Staphylococcus aureus, Carnobacteria, Veillonella, Strepto-
coccus, Campylobacteria, Micrococcus, Bifidobacteria, Actinomycetes, and Cory-
nebacterium. Tenericutes presence corresponds to bloat stage with
Peptostreptococcus and Bacteroides as dominant species in an early stage, and
Clostridiale in a later stage. Firmicutes is the predominant phyla in advanced
stage being that Firmicutes are different from that of the fresh stage. They are mainly
soil representatives. Dry remains mainly habitat by Bacillus and Clostridiale
508 B. C. Patel and M. G. Soni
(Adserias-Garriga et al. 2017). Thus, careful analysis of oral microflora can help in
estimating accurate time since death of the dead victim.
• Provide an evidence-based tool for the forensic and scientific community, thor-
oughly documenting the literature and sequences of microbial samples.
• Maintain a database of results, meta-data, and related analyzes managed by
quality.
• Build a website consisting of software that allow users to evaluate their individual
data, interpret and quantify the results, and compare the results with the existing
data for the public at large.
Machine learning has been used to determine the geographic position from where
the sample was collected, using the comparative richness of bacterial taxa in one
sample (Edgar 2013; Human and Project 2012). The more detailed and complex the
FMD data are, the more precise the forecasts are. Such forecasting could be used to
assess the location of a survivor of trafficking in human beings or as evidence in a
crime scene to limit a person’s investigation range.
Originally, this research involved the selection and management of samples of
human microbiome across five countries worldwide, namely Chile, Barbados, Hong
Kong, and two South African sites. Oral and stool samples from healthy women
aged 18–26 years have been obtained. Immediately frozen samples were sent to
J. Sequencing and subsequent research laboratory of Craig Venter Institute (JCVI).
This also gathers data from databases such as NCBI, EBI, and DDBJ. A quick
read (src), which stores raw sequencing for thousands of scientific studies
(Fig. 25.1), is held in NCBI (National Center for Biotechnology Information)
(Fig. 25.1). Scientists deposit their sequences with the SRA to make their
experiments reproductive and use them for new insights through other experiments.
In order to identify newly added studies to the database, the FMD regularly checks
the SRA. It is of concern to only a certain section of the samples contained in the
SRA. These are human-associated studies of the microbiome—sequence of readings
of bacterial 16s rRNA on a human body site with appropriate metadata. Using 16s
rRNA samples, the relative diversity of the population of microbes in that body site
can be determined. SRA samples comprise details on each sample—primarily how it
was processed and sequenced.
Within NCBI, the BioProject contains several samples of the same study in an
umbrella group. This BioProject explains the analysis and permits users to access all
SRA samples. To query databases in order to locate these studies, search words such
as “human microbiome 16S” are used. If a sample is found that fulfills the
25 Oral Microbes: A Hidden Yet Powerful Evidence for Futuristic Forensic. . . 509
specifications mentioned above, other conditions need to be met, since the intended
FMD feature must be further analyzed. Metadata linked with a report must at least
include the geographic location of the collection sample and the reported document
detailing the report (in the city level). Test inclusion does not allow other details such
as the age and gender of the human host to be useful and preserved in the database.
Most of the metadata is obtained from the website where the study has been
downloaded, but also from other sources such as the manuscripts released. Actually,
the public database and its associated research methods contain only safe human
samples, but unhealthy specimens are still collected for potential inclusion.
Samples of other sequence databases such as EBI and MG-RAST with a similar
organizational structure are obtained in addition to NCBI.
For more information about the 16S rRNA sequence data used in the FMD, one
can refer to the statistics page.
that better differentiate across different geographic locations. These two measures
are outlined in the manual tab available on the FMD website.
25.3.3.6 Why Does the FMD Pipeline Use UPARSE, and Not Mothur or
Qiime?
Various programs will predict a 16S sample taxonomic structure, like Mothur and
Qiime. Because UPARSE utilizes Mothur throughout the taxonomic assignment
phase, the software differ except during OTU construction. UPARSE was shown to
be faster during benchmarking with less OTUs (Edgar 2013). This is largely
attributed to the elimination of singletons by UPARSE (a singleton is a read with a
sequence existing entirely once, i.e., is specific among reads) before OTU clustering
(or OTU generation). Removing singletons eliminates sequencing errors. Moreover,
UPARSE is an agnostic sequencing tool, allowing it impartial to interpret sequence
datasets generated separately (i.e., 454 or Illumina). The manual on the website
includes a comprehensive explanation of the UPARSE system.
25.3.4.1 Identity
Recent large-scale human microbiome studies have shown considerable variation in
body-site-specific community composition and bacterial organism activity among
healthy individuals (Human and Project 2012; Qin et al. 2010; Cao et al. 2018).
Furthermore, it was shown that human microbiome characteristics may be optimally
correlated with individual people over significant phases of time (Schloissnig et al.
25 Oral Microbes: A Hidden Yet Powerful Evidence for Futuristic Forensic. . . 511
2012; Fierer et al. 2010; Poethig et al. 2013). Such findings indicate a special and
secure distinction within a population dependent on their native microbiota. There
has, however, been no systematic attempt to experimentally assess the viability of
microbiome-based detection. To do so, it involves proving (1) that an individual-
specific “metagenomic code” can be found in a population sample; (2) that perhaps
the code can be strongly redetected at a later stage; (3) that the code is impossible to
fit an unknown sample incorrectly; and (4) that such codes can be built for a
significant fraction of individuals. Such criteria stress the nature of human
microbiome identity with microbiome formation, composition, personalization,
and transient stability—foundational topics in microbiome science ecological
approaches (Franzosa et al. 2015).
In 2014, proof of concept was documented to distinguish two persons using oral
micrbiome (Sarah 2014). Tests from individual and combination studies revealed
that samples can be clustered from one individual and isolated from samples from a
second individual (Leake et al. 2016). It had shown that salivary microflora displays
substantial heterogeneity, and using a PCR-based metagenomic method using the
two gene targets, respectively, 16s rRNA gene and rpoB2, it was possible to
discriminate between two different individuals. In this analysis, a 58 genera central
microbiome was postulated by integrating three targets. This high number of genera
comprises about 95% of each individual population, suggesting that most variations
come from species/strain level. Results showed that with this type of testing, the
minimum number of sequences is 100,000 as this provided an excellent distinction
between individuals with all targets.
Recently Neckovic et al. (2020) defined how well a distinguishable microbiome
could be passed to another person and substrates, and vice versa. The findings of this
pilot study introduce a variety of potential challenges for the use of microbiome
sampling for forensic purposes; without the existence of comparison samples from
an individual(s) obtained from the correct body location, with a detailed history of all
individuals or artifacts closely touching the skin/body site within a currently unde-
fined timeline, it would be different.
25.3.4.2 Geolocation
This high heterogeneity in the human salivary microbiota is not geographically
organized. Although there is considerably more variation in bacterial genera relative
to different people than from the same population, variability between persons from
the same region is about the same as variation between individuals from different
places. Generally, the interpopulation portion of the variance in the distribution of
the bacterial genera is 13.5%, which means that each organism comprises on average
86.5% of the overall variance found when all organisms are collected. This is
strikingly proportionate to the amount of interpopulation variability usually found
among humans for neutral genetic markers (Romualdi et al. 2002; Li et al. 2007).
Thus, in this context, genera distribution of individuals acts as a neutral genetic
marker if one equates individual bacterial composition with the genetic composition
of human populations (Nasidze et al. 2009a, b).
512 B. C. Patel and M. G. Soni
25.3.4.3 Ethnicity
Mason et al. (2013) found that the subgingival microbial fingerprint can successfully
discriminate between the four ethnicities. To do this, a Random Forest machine-
learning classifier was trained to develop an educated classification algorithm using
subgingival microbial signatures, which was then applied to a test dataset to examine
the accuracy, sensitivity, and specificity of the prediction. The subgingival microbial
community was able to predict an individual’s ethnicity with a 62% accuracy, 58%
sensitivity, and 86% specificity.
The human microbiota contains fungi, bacteria, and viruses, which live in and
around the body. As evidence-based tool for the correlation or exclusion of people
of concern linked to illegal activity, microbiomes have intangible value in forensics.
Work has shown that the microbiome is isolated and specific signatures from
textures such as tablets, shoes, and textiles can be retrieved. In order to explore the
effectiveness and possible shortcomings of the micronutrient profiling, further
research is necessary before the human microbiome in general and salivary
microbiome in particular are used as a research tool. This involves the detection
range, risks involved with, or the application of microbial profiling for forensic
applications, of microbial transfers among humans or objects.
References
Aaspõllu A, Lillsaar T, Tummeleht L, Simm J, Metsis M (2011) Can microbes on skin help linking
persons and crimes? Forensic Sci Int Genet Suppl Ser 3:269–270. https://doi.org/10.1016/j.
fsigss.2011.08.131
Adams RI, Bateman AC, Bik HM, Meadow JF (2015) Microbiota of the indoor environment: a
meta-analysis. Microbiome 3:49. https://doi.org/10.1186/s40168-015-0108-3
Adler CJ, Dobney K, Weyrich LS, Kaidonis J, Walker AW, Haak W, Bradshaw CJA, Townsend G,
Sołtysiak A, Alt KW, Parkhill J, Cooper A (2013) Sequencing ancient calcified dental plaque
shows changes in oral microbiota with dietary shifts of the Neolithic and Industrial revolutions.
Nat Genet 45:450–455. https://doi.org/10.1038/ng.2536
Adserias-Garriga J, Quijada NM, Hernandez M, Rodríguez Lázaro D, Steadman D, Garcia-Gil LJ
(2017) Dynamics of the oral microbiota as a tool to estimate time since death. Mol Oral
Microbiol 32:511–516. https://doi.org/10.1111/omi.12191
An JY, Darveau R, Kaeberlein M (2018) Oral health in geroscience: animal models and the aging
oral cavity. Geroscience 40:1–10. https://doi.org/10.1007/s11357-017-0004-9
Anukam K, Agbakoba N (2017) A comparative study of the oral microbiome compositions of
healthy postmenopausal, premenopausal, and prepubertal Nigerian females, using 16s rrna
metagenomics methods. Niger J Clin Pract 20:1250–1258. https://doi.org/10.4103/njcp.njcp_
32_17
Arumugam M, Raes J, Pelletier E, Le Paslier D, Yamada T, Mende DR, Fernandes GR, Tap J,
Bruls T, Batto JM, Bertalan M, Borruel N, Casellas F, Fernandez L, Gautier L, Hansen T,
Hattori M, Hayashi T, Kleerebezem M, Kurokawa K, Leclerc M, Levenez F, Manichanh C,
Nielsen HB, Nielsen T, Pons N, Poulain J, Qin J, Sicheritz-Ponten T, Tims S, Torrents D,
25 Oral Microbes: A Hidden Yet Powerful Evidence for Futuristic Forensic. . . 513
Ugarte E, Zoetendal EG, Wang J, Guarner F, Pedersen O, De Vos WM, Brunak S, Doré J,
Weissenbach J, Ehrlich SD, Bork P (2011) Enterotypes of the human gut microbiome. Nature
473:174–180. https://doi.org/10.1038/nature09944
Bik EM, Long CD, Armitage GC, Loomer P, Emerson J, Mongodin EF, Nelson KE, Gill SR,
Fraser-Liggett CM, Relman DA (2010) Bacterial diversity in the oral cavity of 10 healthy
individuals. ISME J 4:962–974. https://doi.org/10.1038/ismej.2010.30
Blaser MJ (2010) Harnessing the power of the human microbiome. Proc Natl Acad Sci U S A
107:6125–6126. https://doi.org/10.1073/pnas.1002112107
Brito IL, Yilmaz S, Huang K, Xu L, Jupiter SD, Jenkins AP, Naisilisili W, Tamminen M, Smillie
CS, Wortman JR, Birren BW, Xavier RJ, Blainey PC, Singh AK, Gevers D, Alm EJ (2016)
Mobile genes in the human microbiome are structured from global to individual scales. Nature
535:435–439. https://doi.org/10.1038/nature18927
Brown LR, Fromme WJ, Handler SF, Wheatcroft MG, Johnston DA (1976) Effect of Skylab
missions on clinical and microbiologic aspects of oral health. J Am Dent Assoc 93:357–363.
https://doi.org/10.14219/jada.archive.1976.0502
Burcham ZM, Hood JA, Pechal JL, Krausz KL, Bose JL, Schmidt CJ, Benbow ME, Jordan HR
(2016) Fluorescently labeled bacteria provide insight on post-mortem microbial transmigration.
Forensic Sci Int 264:63–69. https://doi.org/10.1016/j.forsciint.2016.03.019
Butler JM (2011) Forensic DNA testing. Cold Spring Harb Protoc 6(12):1438–1450. https://doi.
org/10.1101/pdb.top066928
Cao S, Bai P, Zhu W, Chen D, Wang H, Jin B, Zhang L, Liang W (2018) Genetic portrait of
27 Y-STR loci in the Tibetan ethnic population of the Qinghai province of China. Forensic Sci
Int Genet 34:e18–e19. https://doi.org/10.1016/j.fsigen.2018.02.005
Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Peña
AG, Goodrich JK, Gordon JI, Huttley GA, Kelley ST, Knights D, Koenig JE, Ley RE,
Lozupone CA, Mcdonald D, Muegge BD, Pirrung M, Reeder J, Sevinsky JR, Turnbaugh PJ,
Walters WA, Widmann J, Yatsunenko T, Zaneveld J, Knight R (2010) QIIME allows analysis
of high- throughput community sequencing data. Intensity normalization improves color calling
in SOLiD sequencing. Nat Publ Gr 7:335–336. https://doi.org/10.1038/nmeth0510-335
Costello EK, Lauber CL, Hamady M, Fierer N, Gordon JI, Knight R (2009) Bacterial community
variation in human body habitats across space and time. Science 326:1694–1697. https://doi.
org/10.1126/science.1177486
Damann FE, Williams DE, Layton AC (2015) Potential use of bacterial community succession in
decaying human bone for estimating postmortem interval. J Forensic Sci 60:844–850. https://
doi.org/10.1111/1556-4029.12744
Davenport ER (2017) Tooth be told, genetics influences oral microbiome. Cell Host Microbe
22:251–253. https://doi.org/10.1016/j.chom.2017.08.018
DeBruyn JM, Hauther KA (2017) Postmortem succession of gut microbial communities in
deceased human subjects. PeerJ 2017:1–14. https://doi.org/10.7717/peerj.3437
Do T, Gilbert SC, Clark D, Ali F, Fatturi Parolo CC, Maltz M, Russell RR, Holbrook P, Wade WG,
Beighton D (2010) Generation of diversity in streptococcus mutans genes demonstrated by
MLST. PLoS One 5. https://doi.org/10.1371/journal.pone.0009073
Edgar RC (2013) UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat
Methods 10:996–998. https://doi.org/10.1038/nmeth.2604
Fierer N, Hamady M, Lauber CL, Knight R (2008) The influence of sex, handedness, and washing
on the diversity of hand surface bacteria. Proc Natl Acad Sci U S A 105:17994–17999. https://
doi.org/10.1073/pnas.0807920105
Fierer N, Lauber CL, Zhou N, McDonald D, Costello EK, Knight R (2010) Forensic identification
using skin bacterial communities. Proc Natl Acad Sci U S A 107:6477–6481. https://doi.org/10.
1073/pnas.1000162107
Flores GE, Caporaso JG, Henley JB, Rideout JR, Domogala D, Chase J, Leff JW, Vázquez-
Baeza Y, Gonzalez A, Knight R, Dunn RR, Fierer N (2014) Temporal variability is a
514 B. C. Patel and M. G. Soni
Leake SL, Pagni M, Falquet L, Taroni F, Greub G (2016) The salivary microbiome for
differentiating individuals: proof of principle. Microbes Infect 18:399–405. https://doi.org/10.
1016/j.micinf.2016.03.011
Ley RE, Turnbaugh PJ, Klein S, Gordon JI (2006a) Human gut microbes associated with obesity.
Nature 444:1021–1022. https://doi.org/10.1038/nature4441022a
Ley RE, Peterson DA, Gordon JI (2006b) Ecological and evolutionary forces shaping microbial
diversity in the human intestine. Cell 124:837–848. https://doi.org/10.1016/j.cell.2006.02.017
Li Y, Ismail AI, Ge Y, Tellez M, Sohn W (2007) Similarity of bacterial populations in saliva from
African-American mother-child dyads. J Clin Microbiol 45:3082–3085. https://doi.org/10.
1128/JCM.00771-07
Mason MR, Nagaraja HN, Camerlengo T, Joshi V, Kumar PS (2013) Deep sequencing identifies
ethnicity-specific bacterial signatures in the oral microbiome. PLoS One 8:1–7. https://doi.org/
10.1371/journal.pone.0077287
Metcalf JL (2019) Estimating the postmortem interval using microbes: knowledge gaps and a path
to technology adoption. Forensic Sci Int Genet 38:211–218. https://doi.org/10.1016/j.fsigen.
2018.11.004
Metcalf JL, Wegener Parfrey L, Gonzalez A, Lauber CL, Knights D, Ackermann G, Humphrey GC,
Gebert MJ, Van Treuren W, Berg-Lyons D, Keepers K, Guo Y, Bullard J, Fierer N, Carter DO,
Knight R (2013) A microbial clock provides an accurate estimate of the postmortem interval in a
mouse model system. elife 2:1–19. https://doi.org/10.7554/elife.01104
Muhammad S, Ali F, Tanwir F (2012) Oral microbial habitat a dynamic entity. J Oral Biol
Craniofacial Res 2:181–187. https://doi.org/10.1016/j.jobcr.2012.07.001
Nakanishi H, Kido A, Ohmori T, Takada A, Hara M, Adachi N, Saito K (2009) A novel method for
the identification of saliva by detecting oral streptococci using PCR. Forensic Sci Int 183:20–23.
https://doi.org/10.1016/j.forsciint.2008.10.003
Nasidze I, Quinque D, Li J, Li M, Tang K, Stoneking M (2009a) Comparative analysis of human
saliva microbiome diversity by barcoded pyrosequencing and cloning approaches. Anal
Biochem 391:64–68. https://doi.org/10.1016/j.ab.2009.04.034
Nasidze I, Li J, Quinque D, Tang K, Stoneking M (2009b) Global diversity in the human salivary
microbiome. Genome Res 19:636–643. https://doi.org/10.1101/gr.084616.108
Neckovic A, van Oorschot RAH, Szkuta B, Durdle A (2020) Investigation of direct and indirect
transfer of microbiomes between individuals. Forensic Sci Int Genet 45:102212. https://doi.org/
10.1016/j.fsigen.2019.102212
Ogawa T, Hirose Y, Honda-Ogawa M, Sugimoto M, Sasaki S, Kibi M, Kawabata S, Ikebe K,
Maeda Y (2018) Composition of salivary microbiota in elderly subjects. Sci Rep 8:1–8. https://
doi.org/10.1038/s41598-017-18677-0
Oliveira M, Amorim A (2018) Microbial forensics: new breakthroughs and future prospects. Appl
Microbiol Biotechnol 102:10377–10391. https://doi.org/10.1007/s00253-018-9414-6
Peterson J, Garges S, Giovanni M, McInnes P, Wang L, Schloss JA, Bonazzi V, McEwen JE,
Wetterstrand KA, Deal C, Baker CC, Di Francesco V, Howcroft TK, Karp RW, Lunsford RD,
Wellington CR, Belachew T, Wright M, Giblin C, David H, Mills M, Salomon R, Mullins C,
Akolkar B, Begg L, Davis C, Grandison L, Humble M, Khalsa J, Roger Little A, Peavy H,
Pontzer C, Portnoy M, Sayre MH, Starke-Reed P, Zakhari S, Read J, Watson B, Guyer M (2009)
The NIH human microbiome project. Genome Res 19:2317–2323. https://doi.org/10.1101/gr.
096651.109
Poethig RS, Faith JJ, Guruge JL, Charbonneau M, Subramanian S, Seedorf H, Goodman AL,
Clemente JC, Knight R, Andrew C, Leibel RL, Rosenbaum M, Gordon JI (2013) The long-term
stability of the human gut microbiota. Science 341:1–22. https://doi.org/10.1126/science.
1237439.The
Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C, Nielsen T, Pons N, Levenez F,
Yamada T, Mende DR, Li J, Xu J, Li S, Li D, Cao J, Wang B, Liang H, Zheng H, Xie Y, Tap J,
Lepage P, Bertalan M, Batto JM, Hansen T, Le Paslier D, Linneberg A, Nielsen HB, Pelletier E,
Renault P, Sicheritz-Ponten T, Turner K, Zhu H, Yu C, Li S, Jian M, Zhou Y, Li Y, Zhang X,
516 B. C. Patel and M. G. Soni
Zhernakova A, Kurilshikov A, Bonder MJ, Tigchelaar EF, Schirmer M, Vatanen T, Mujagic Z, Vila
AV, Falony G, Vieira-Silva S, Wang J, Imhann F, Brandsma E, Jankipersadsing SA,
Joossens M, Cenit MC, Deelen P, Swertz MA, Weersma RK, Feskens EJM, Netea MG,
Gevers D, Jonkers D, Franke L, Aulchenko YS, Huttenhower C, Raes J, Hofker MH, Xavier
RJ, Wijmenga C, Fu J (2016) Population-based metagenomics analysis reveals markers for gut
microbiome composition and diversity. Science 352:565–569. https://doi.org/10.1126/science.
aad3369
Zhou J, Jiang N, Wang Z, Li L, Zhang J, Ma R, Nie H, Li Z (2017) Influences of pH and iron
concentration on the salivary microbiome in individual humans with and without caries. Appl
Environ Microbiol 83:1–12. https://doi.org/10.1128/AEM.02412-16
MALDITOF the Fourth Generation
Techniques Still at Its Infancy to Identify 26
Forensically Important Insects
Abstract
V. Vinayak (*)
Diatom Nano Engineering and Metabolism (DNM) Lab., Department of Criminology and Forensic
Science, School of Applied Sciences, Dr. Harisingh Gour Central University, Sagar, Madhya
Pradesh, India
e-mail: [email protected]
A. Rai
DNA Division, State Forensic Science Laboratory, Madhuban, Haryana, India
Keywords
Abbreviations
26.1 Introduction
interval (PMImin); but also play a very important role in determining; cause of death,
geographical location of death, movement or storage of remains after death, time of
decapitation and dismemberment, submersion interval, specific site of injury on the
body, toxic drugs in body, etc. (Amendt et al. 2004). Soon after the death, decom-
position of the body starts which attracts various FII at the open wounds and natural
orifices. These sites serve as the spectacular breeding place for these necrophageous
insects (Amendt et al. 2011; Gennard 2012). Among FII, flies belonging to families
Calliphoridae (the blow flies) and Sarcophagidae (the flesh flies) are among the first
ones to arrive on a corpse within a few minutes (Payne 1965; Tullis and Goff 1987;
Anderson and VanLaerhoven 1996; Dadour et al. 2001; Wells et al. 2001; Greenberg
and Kunich 2002; Byrd and Castner 2009) and even few seconds (De Jong 1995).
These first cadaver colonizers are attracted by volatile organic chemicals (VOC)
released by the cadavers (Ashworth and Wall 1994; Morris et al. 1998; Wells and
LaMotte 2001; Hart and Whitaker 2006; Statheropoulos et al. 2007; Dekeirsschieter
et al. 2009).The arrival of necrophageous insects on the cadaver starts by laying of
their eggs and starting their reproductive life cycle. Since every insect has a life cycle
period during which it develops into a complete adult from the egg, taking few days
to weeks. The collection of insects at their different stages of development by
forensic scientist and knowing their life cycle helps in estimating the time since
death of a particular body. Identification of these insects on or around the cadaver is
therefore of paramount importance. Although recovery of these insects at their
various stages is helpful they show variation in their development which in turn is
highly dependent upon the environmental conditions (Berg and Benbow 2013). The
bodies found in water, plains, summers, winters, ice, soil, coffin, indoors, caskets,
closed vehicles, drugs, rural and urban areas have different impact on the coloniza-
tion of different insects and their stages (Campobasso et al. 2001; Pohjoismäki et al.
2010; Griffiths et al. 2020). Also if carrion is toxicated with some drugs like lead,
cocaine, heroin, morphine, paracetamol it effects not only the type of insect which
arrive but also show variation sin their developments (Carvalho et al. 2001; Aneyo
et al. 2020). Of the total ten cases studied by (Al-Khalifa et al. 2020), it was found
that Dermestes masculatus was identified on human cadavers which were in
advanced stage of decomposition (Al-Qahtni et al. 2020). Dermes frischii was
observed only in indoor skeletonised human cadaver. A study showed that blow
fly larvae develop much slowly in indoor cadavers as compared to outdoor ones.
This definitely results in approaching PMImin much earlier than the actual (Hofer
et al. 2017). However, the identification of some insect’s species, especially in their
immature stages may be complicated by many factors (Ingrisch 1995; Cywinska
et al. 2006; Rindi et al. 2008; Packer et al. 2009), even for experienced taxonomists
(Nekola and Barthel 2002; Gutiérrez-Gutiérrez et al. 2013). It is thus very necessary
to establish the identity of the particular species to determine post mortem interval.
Although every colonizer on a cadaver has a different morphological life cycle.
However, it’s difficult to distinguish members of closely related species. Figure 26.1
shows similarities in eggs of four different species of Calliphoridae (Lucilia sericata,
Phormia regina, Lucilia coeruleiviridis and Calliphora vicina) (Giffen et al. 2017).
The figure depict that although there is much difference in the morphological look of
522 V. Vinayak and A. Rai
Fig. 26.1 Images of eggs derived from four blow fly species from the Calliphoridae family, with
the inset in each case showing a picture of the adult fly species corresponding to the eggs displayed
in each panel. (a) Lucilia sericata eggs and adult fly; (b) Phormia regina eggs and adult fly; (c)
L. coeruleiviridis eggs and adult fly; (d) Calliphora vicina eggs and adult fly. The scale provided
refers to egg images only and does not reflect adult size. (Reproduced with permission from Giffen
et al. (2017))
adult flies their eggs look quite similar. Thus it becomes necessary to rear the eggs
back in lab and to be careful in transporting them in their live stage. This is also very
important for forensic laboratories to have an expertise, lab set up and conditions for
rearing and identifying insects. However, most of the times insects collected at
different stages by the scene of crime and police unit fix the stages with ethanol or
boiling water for their easy transport. This not only destroys their true morphology
but also alters their actual weight and size which creates hindrance to their identifi-
cation. Besides this the environmental and physical conditions of the corpse may
alter the morphological characters in the larvae or egg invading it. Even though with
the use of state of art microscopy like Scanning electron microscopy it becomes
simple to identify different stages but in cases of closely related species it becomes
challenging.
On the other hand, due to enormous number of species and diversity present in the
invertebrates DNA based methods are considered to be most accurate and authentic
(Hebert et al. 2003, 2004; Gupta and Setia 2004). The molecular barcoding to
identify insects targets on specific mitochondrial cytochrome c oxidase (COI-III),
26 MALDITOF the Fourth Generation Techniques Still at Its Infancy to Identify. . . 523
In other special case it is seen that in conditions like myiasis where insects larva
live in living or dead host tissue or body fluid or ingested food, the exact time of
arrival of insects in a carrion is a matter of concern (Anderson 2001). It is seen that in
cases of myiasis the morphological identification of insects is difficult (Anderson
2001; Noël et al. 2004). This is mainly due to the reason that the vectors are in their
immature, incomplete or destructive stage of their life cycle. Molecular sequencing
to identify the myiasis infested insect species is done targeting genes like 12SDNA
(Norris et al. 1996), 18SrDNA (Mangold et al. 1997) and 16S DNA (Norris et al.
1996). To add that DNA barcoding of the insects requires specific primers, intensive
labour, is time consuming and a huge database library is required (Wells and
Sperling 2001).
On the other hand protein profiling using the fourth generation matrix assisted
laser desorption/ionization time of flight mass spectrophotometery (MALDI-TOF-
MS) is an important tool for identification and establishing the phylogeny of a
species (Sauer et al. 2008; Freiwald and Sauer 2009; Seng et al. 2010). The
evaluation of MALDITOF MS analysed bacterial species showed that the results
were in consistent to that obtained when using 16S rRNA sequencing (Mellmann
et al. 2008). The technique serves as a species classification tool comparable to DNA
sequencing and has successfully tested to identify Eukarya, Archaea (Dridi et al.
2012) and some giant viruses (La Scola et al. 2010).
The current review however, emphasizes on adapting modern and economical
techniques like matrix assisted laser desorption/ionization time of flight mass
spectrophotometery (MALDI-TOF-MS) for correct identification of insect species
up to subspecies level at rapid and economical rates. Importantly to identify the
unknown species by MALDI TOF MS no taxon reference data is required since the
protein profile pattern need not to be established for unknown species (Singhal et al.
2015).
In fact when compared to PCR or other antibody based assays it does not require
genetic information of the species sample under study. However, it is necessary to
make database of such reference samples (Campbell 2005). The recent studies have
shown increase in number of reports where combination of MALDI time of flight
(TOF) MS has been widely used to identify the microorganism at genus, species and
subspecies level (Singhal et al. 2015).
26.2.1 Insects
26.2.1.1 Drosophila
Among insects the MALDI TOF MS technique was first used to identify Drosophila
species and is a advanced tool to identify inter-specific variations (Feltens et al.
2010). Campbell (2005) studied the MALDITOF MS spectra of three strains of
Drosophila melanogaster (Oregon R, Canton S and Harare) and its three species
viz; D. simulans, D. mauritiana and D. yakuba. He found that overall peaks of
Drosophila melanogaster and that for three species of Drosophila were similar
among the three species than between species as can be seen in Fig. 26.2a. To
prove it he took Drosophila strains from different localities but from same species of
Fig. 26.2 (a) Spectra from five male Drosophila flies, three for D. melanogaster strains and one
strain from D. simulans, D. mauritiana and D. yakuba. The vertical scale is expanded above m/z
5500 for clarity. (b) Identification of unknown species using reference spectra. The asterisks show
the common spectral peaks shared by individuals of unknown Drosophila species and D. simulans.
(Reproduced with permission from Campbell (2005))
26 MALDITOF the Fourth Generation Techniques Still at Its Infancy to Identify. . . 527
Fig. 26.3 (a) Dendrogram indicating the phylogeny of the different species is shown. Showing
clustered species. Percentages of bootstrapping replicates supporting the location of individual
nodes are indicated, Cluster analysis of 125 spectra from flies of 13 different species clustered using
Dice coefficients. (b) A heatmap representation of the pairwise similarity (Dice) coefficients in the
lower part of the map shows White Square outlining the cluster of D. mauritiana spectra.
(Copyright Feltens et al. (2010))
26.2.1.2 Aedes
The second major insect in which intensive protein profiling via MALDI TOF MS
has been employed is group Aedes. The advent of increased mosquito related
diseases has caused the technique like MALDI TOF to rapidly identify the mosquito
species. Even though mosquitoes are not colonizers on a cadaver, but in order to
understand and promote this technique in forensic science for species identification
26 MALDITOF the Fourth Generation Techniques Still at Its Infancy to Identify. . . 529
Fig. 26.4 MALDITOF MS from leg protein extraction of four An. gambiae form M specimens its
spectra by Flexi analysis using Flex analysis. (Copyright Yssouf et al. (2013))
2015). Similarly all morphologically identified Ph. barguesae showed genetic dif-
ference at barcode locus corresponding to their Gene Bank entries. The super
spectra, i.e. the identical biomarker mass spectra for fresh insects and 55/59 for
insects frozen in liquid nitrogen at 80 C for 25 years as seen in Fig. 26.5.
However, only 36/52 specimens stored in ethanol were identified stored at room
temperature or 20 C for few years. The overall sensitivity was 87% and specificity
of 100% for stored specimens compared to sensitivity for 312 specimens from 8 sand
fly species giving high quality spectra of 98.3% and specificity of 100%. Thus
specimens stored at different conditions and collected from different geographical
locations yield different spectral yield. This also validated that storage of sample and
not the period affected the mass spectrum data. It is clear from Fig. 26.5 that freezing
is superior for storing the insect samples than 70% ethanol. Further 70% is superior
to any higher concentrations of ethanol. To add high quality (98.9%) mass spectra
26 MALDITOF the Fourth Generation Techniques Still at Its Infancy to Identify. . . 531
Fig. 26.5 MALDITOF mass spectra of Phlebotomus perniciosus (a) Fresh specimen from colony
(b) field specimen stored in 70% ethanol, 20 C for 3 years. (c) Field specimen stored in liquid N2
for 80 C since 1991. (d) Field specimen stored in liquid N2 for 80 C since 1989. Scale: 10
magnification for mass range 10–20 kDa. (Copyright Mathis et al. (2015))
was obtained for 1200 Culicoides stored in 70% ethanol at 4 C for 1 year
(Kaufmann et al. 2012b).
Fig. 26.6 MALDI-TOF MS spectra from leg hemolymph protein extract of (a): non infected Rh.
Sanguineus, (b) Rh. sanguineus infected by R. c. conorii and (c) purified R. c. conorii strain.
(Reproduced with permission from Yssouf et al. (2015))
being same in each specimen of same species (Yssouf et al. 2015). Although the
study of Fotso et al. (2014) has shown that MALDI TOF MS of leg proteins has
helped in identification of tick species and tick borne pathogens in Borrelia fever
infecting Ornithodoros ticks. Among the challenges faced in tick identification using
proteomic study by obtaining their protein peaks by MALDI TOF MS, the technique
was applied to identify Rickettsia. c. conorii or Rickettsia slovaca pathogens in
Rhipicephalus sanguineus and Dermacentor marginatus using tick legs (Yssouf
et al. 2015). As the circulatory system of ticks contains circulating fluid known as
hemolymph, it is the residing place for many bacteria including Rickettsia
(Burgdorfer and Mavros 1970). The presence of pathogen in the haemolymph
altered the protein expression profiles of these ticks (Antunes et al. 2012). The
haemolymph MS profile from five such ticks were recorded in a database to identify
new tick species by blind tests. This was shown by work of Yssouf et al. (2015).
They showed that MS protein spectra of five tick species (Rhipicephalus sanguineus,
Rhipicephalus bursa, Dermacentor marginatus, Hyalomma marginatum rufipes and
Amblyomma variegatum) infected by Rickettsia africae.
The MALDITOF MS spectra of a protein mixture of a infected tick Rh.
sanguineus by R. c. conorii shows a change in the MS spectra from that of a non
infected according to the infection status as seen in Fig. 26.6. A total of
26 MALDITOF the Fourth Generation Techniques Still at Its Infancy to Identify. . . 533
Fig. 26.7 Results of DART-HRMS analyses of aqueous ethanol suspensions of six species of fly
eggs: (a) C. vicina, (b) L. coeruleiviridis, (c) L. sericata, (d) P. regina, (e) Phoridae spp., and (f)
Sarcophagidae spp. All analyses were performed in positive ion mode at 350 C. Each spectrum
represents an average of three analyses. The spectra generated for each species are unique and can
be used as fingerprints for the identification of individual species. (Reproduced with permission
from Giffen et al. (2017))
534 V. Vinayak and A. Rai
generated important DART HRMS data for species identification without involving
any pre treatment.
In addition to species identification gene expression studies help in knowing the age
of the insects and their stages which is very important to estimate PMImin. As an
organism develops, proteins are required for its development. The identification of
age of an insect at different developmental stages is essential in myiasis where actual
time of infestation of eggs/larva is not known. The most significant myriad flies
included those belonging to group Calliphoridae and Sarcophagidae which are
important forensic markers to determine time since death.
Taron and Foran profiled 11 genes in larva and pupa of L. sericata at different
time periods of the development. The expression results helped in predicting blow
fly age using generalized additive models (GAMs) (Tarone and Foran 2011). Among
a population of 958 individuals; 48 first instar larvae, 79 second instar larvae,
135 third instar larvae, 334 postfeeding third instar larvae had 362 genes which
were up and down regulated between feeding and post feeding stages. Four genes
were not regulated at some point, gene rop-I was off at earliest stage of development
and not included in the binary data. The expression of some genes (cs, ecr, hhsp60,
hsp90, rop-I and usp) was effected by temperature with hsp60 showing weak
whereas hsp90 and ace showing strong response. The nine genes evaluated in
L. sericata (ace, cs, eccr, hsp60, hsp90, rop-I, sll, usp and w) showed differential
regulation during developmental stages. Seven among them (cs, ecr, hsp60, hsp90,
rop-I, usp and w) helped to differentiate feeding and post feeding third instars.
Studies in Drosophila further shows that hormone ecdysone stimulates switching
of third instar from feeding to post feeding stage (Mirth et al. 2009). Therefore the
ecr and usp gene which encodes heterodimeric protein triggers ecdysone mediated
changes during the development. The current study of age estimation targeting nine
loci in blowfly resulted in 3–8% decrease in age overestimation and would improve
accurate PMImin estimate using entomological data. Gene Expression studies are
done to determine the amount of mRNA through RNA extraction, reverse transcrip-
tion into complementary DNA (cDNA) and quantitation of this cDNA using real
time polymerase chain reaction (real-time PCR) (Campobasso and Introna 2001;
Amendt et al. 2011). The microarray studies in Drosophila melanogaster have
shown expression of 2–9% genome changes with age. The transcriptional profiles
of D. melanogaster (Arbeitman et al. 2002) has shown gene expression changes in
adult female life stages (Cook et al. 2006). Evans and Wheeler used gene expression
studies for studying queen and worker specific gene expression in the development
of honeybee (Evans and Wheeler 1999). A clone sequence from gene Locus 1CB6 in
queen honeybee showed expression of proteins hexamerins and arylphorins which
are expressed more in queens than in workers as seen in Fig. 26.8. The clone
26 MALDITOF the Fourth Generation Techniques Still at Its Infancy to Identify. . . 535
expressed in queen shows alignment with 760–800 amino acids from larval storage
protein 1 of D. melanogaster. The workers on the other hand show expression at
locus 1CG5. The amino acid sequence for this locus showed similarity with protein
described from lens tissue in mammals. Another clone sequence 2QA4 was also
expressed at higher level in fourth instar Queen than in workers. The locus expressed
by 1CG5 was however expressed more in worker than in Queen. There were four
more additional clone sequences which were strongly expressed by the worker bees
than by the queens. The clone 1BH4 which is related to retinoic acid binding proteins
is widespread in vertebrates; the clone is aligned with 80% of fatty acid binding
proteins in tobacco hornworm Manduca sexta (Evans and Wheeler 1999). Another
worker expressed clone 52C8, encoded hexamerin storage protein. The 52A9 clone
sequence of worker bees on the other hand showed similarity over 200 amino acid
region of oxido-reductase enzyme family. There was great resemblance between
clone 52A11 and ELK-3 between amino acids 210 and 300 of ELK-3 locus (Evans
and Wheeler 1999). Tarone et al. (2007) investigated age of eggs of L. sericata by
gene expression studies profiled expression of three genes (bicoid, slalom, chitin
synthatase). Since gene expression studies are extremely important to investigate
age of the larva and pupa at different stages when morphological identification fails
specially in cases of myiasis.
However, the gene expression method to estimate age in metamorphosing flies is
dependent on the storage conditions (Bala and Sharma 2016). The quantification by
realtime-PCR is yields accurate on fresh samples. Even though FII needs to be
explored on the possibility of accuracy, extensive study has been done on Drosoph-
ila melangoster (Diptera) (Beckstead et al. 2005). On the other hand MALDI TOF
MS can be done for samples stored, frozen, fixatives, ethanol (Ellison and Hampton
536 V. Vinayak and A. Rai
1982). They are more accurate to determine chronological age of young insects of
both sexes and for any field material fresh or stored (Bala and Sharma 2016).
Takeuchi et al. (2003) combined MALDI TOF MS, gene expression and on line
capillary reverse-phase HPLC/quadrupole orthogonal acceleration time of flight
(Q-TOF) MS to estimate age of different stages of honey bee (Yasuda-Kamatani
and Yasuda 2000). They reported that a tachykinin related neuropeptide (TRPs)
content is regulated via varied expression of preproAmTRP gene in different sex and
at different stages of honey bee. The matrix is mixed with brain sample and mounted
on the metal plate towards the laser beam. The identified peptide was named as Apis
mellifera tachykinin-related peptide (AmTRP). After doing cloning of complemen-
tary DNA (cDNA) coding AmTRP gene Northern blotting was done to check the
expression of genes. It was found that AmTRP is related with female like behaviours
in honey bees. On the other hand the gene expression varied with age and showed a
intense band in forager bee RNA and less dense in nurse bee RNA (Takeuchi et al.
2003). This study demonstrated that AmTRP neuropeptides forms a molecular basis
for sexual behavior in honey bees.
Fig. 26.9 Gas chromatographic profile of cuticular hydrocarbons extracted from larvae of
Aldrichina graham at various stages of oviposition. (Reproduced with permission from Xu et al.
(2014))
genera had 40% of similar hydrocarbons, in both it was also noted that hydrocarbon
profile detected on day one of their growth was remarkably different from that found
on rest of the days. Further as the adult Cochliomyia macellaria matured the
hydrocarbon richness increased and reached the plateau on fifth day of post emer-
gence. However, Chrysomya rufifacies hydrocarbon profiles decreased as the flies
aged. This also proves the fact that adult flies have high molecular weight
hydrocarbons, since they have to tolerate unfavorable environmental conditions
which require impermeability on their cuticular surface (Toolson and Kuper-
Simbron 1989; Roux et al. 2008). This clearly demonstrates that CHC profile
generated by GC gives unique chemical fingerprints for native and invasive blow
flies which changed constantly with age until reaching a plateau at its adult stage as
seen in Fig. 26.10.
Li et al. (2017) for the first time used MALDI TOF MS based MALDI imaging mass
spectrometry (MALDI IMS) and principal component analysis (PCA) to estimate
PMImin from the rat muscle tissue. They visualized the proteins from the slice of a
538 V. Vinayak and A. Rai
Fig. 26.10 GC chromatograms on day 1, 5, 10, 20 and 30 post emergence in adult female of (a)
Cochliomyia macellaria and (b) Chrysomya rufifacies. Shaded bars within the chromatograms
illustrate distinctive changes over adult age indicating specific areas of interest. (Reproduced with
permissions from Pechal et al. (2014))
frozen rat muscle tissue. It was observed that the mass spectra value decreased with
the increase in PMImin. Their results were coherent with the histological sections of
rat muscle tissue at the respective PMI’s. Thus such non molecular techniques may
help forensic scientist to determine PMImin by not only estimating the age of the fly
but also its identification. This certainly will be of potential application if used in the
forensic laboratories which are still in their developing stage as far as entomology
and its importance in the court of law is concerned.
26 MALDITOF the Fourth Generation Techniques Still at Its Infancy to Identify. . . 539
26.5 Conclusion
DNA barcoding of forensically important insects does not require any taxonomist for
identification process but they do require reference nucleotide sequence available in
online molecular biology tools like NCBI and COBL. Though many researchers
have sequenced different FII taxas’s of different order at gene and species level a
more needs to be done from different geographical areas to create database. The
database of mitogenomic analysis is efficient but still a cost effective procedure. An
alternative technique which is fast and cheap is MALDI TOF-MS which is currently
utilized to identify insects which are non forensic in origin like Drosophila and Sand
flies. However, much progress is required to use this technique to generate profile
spectra of FII. The mass fingerprinting is altogether advantageous as it does not need
any reference spectra and expertise of taxonomy for species identification. Identifi-
cation of FII is very important since it gives reliable truth for determining PMImin
interval since there are certain limitations in identification of FII both morphologi-
cally and at molecular level in cases where insects have pre-infested the carrion. On
the other hand the larval and pupal stages show variation in their life cycle. Gene
expression studies though help in determination of different developmental stages of
insects altered by change in amino acid sequences and protein biomolecules at
different phases of growth. However, this too is applicable for fresh instar stages,
however cuticular hydrocarbon profile by MALDI TOF MS is more accurate to
determine chorological age of instars at different stages of metamorphosis. The
research data of experiment based study with animal carcass and as well as human
dead bodies must therefore be used for betterment of this sphere. We must be riveted
on the molecular recognition of insect and must prepare a database of a particular
habitat with international interactions. Medico legal entomology has reached an
exciting height in its evolution as testimony based on the interpretation if insect
evidence is now routinely provided in court of expert witness in some countries. The
increasing acceptance and recognition of medico legal entomology as a forensic
discipline coupled with the increased reliance of courts on biological evidence shall
continue to present increased opportunities for qualified forensic entomologist. The
application of MALDI-TOF MS studies for species identification at subspecies level
and their comparison with DNA sequences might therefore help to explain taxo-
nomic relationships at species and subspecies level and should be utilized to identify
FII by forensic entomologist and molecular biologist.
Not applicable.
References
Al-Khalifa MS, Mashaly AM et al (2020) Insect species colonized indoor and outdoor human
corpses in Riyadh, Saudi Arabia. J King Saud Univ Sci 32(3):1812–1817
Al-Qahtni AH, Al-Khalifa MS et al (2020) Two human cases associated with forensic insects in
Riyadh, Saudi Arabia. Saudi J Biol Sci 27(3):881–886
Amendt J, Krettek R et al (2004) Forensic entomology. Naturwissenschaften 91(2):51–65
Amendt J, Richards C et al (2011) Forensic entomology: applications and limitations. Forensic Sci
Med Pathol 7(4):379–392
Anderson GS (2001) Insect succession on carrion and its relationship to determining time of death.
In: Forensic entomology: the utility of arthropods in legal investigations. CRC Press, Boca
Raton, FL, pp 143–176
Anderson GS, VanLaerhoven SL (1996) Initial studies on insect succession on carrion in south-
western British Columbia. J Forensic Sci 41(4):617–625
Aneyo I, Alafia O et al (2020) Aerobic microbe community and necrophagous insects associated
with decomposition of pig carrion poisoned with lead. Legal Med 42:101638
Antunes S, Galindo RC et al (2012) Functional genomics studies of Rhipicephalus (Boophilus)
annulatus ticks in response to infection with the cattle protozoan parasite, Babesia bigemina. Int
J Parasitol 42(2):187–195
Arbeitman MN, Furlong EE et al (2002) Gene expression during the life cycle of Drosophila
melanogaster. Science 297(5590):2270–2275
Ashworth JR, Wall R (1994) Responses of the sheep blowflies Lucilia sericata and L. cuprina to
odour and the development of semiochemical baits. Med Vet Entomol 8(4):303–309
Audsley N, Weaver RJ (2003) Identification of neuropeptides from brains of larval Manduca sexta
and Lacanobia oleracea using MALDI-TOF mass spectrometry and post-source decay.
Peptides 24(10):1465–1474
Bala M, Sharma A (2016) Review of some recent techniques of age determination of blow flies
having forensic implications. Egypt J Forensic Sci 6(3):203–208
Ballard JWO, Chernoff B et al (2002) Divergence of mitochondrial DNA is not corroborated by
nuclear DNA, morphology, or behavior in Drosophila simulans. Evolution 56(3):527–545
Ballard JWO, Melvin RG et al (2007) Mitochondrial DNA variation is associated with measurable
differences in life-history traits and mitochondrial metabolism in Drosophila simulans. Evolu-
tion 61(7):1735–1747
Beckstead RB, Lam G et al (2005) The genomic response to 20-hydroxyecdysone at the onset of
Drosophila metamorphosis. Genome Biol 6(12):R99
Benecke M, Wells JD (2001) DNA techniques for forensic entomology. In: Forensic entomology:
the utility of arthropods in legal investigations. CRC Press, Boca Raton, FL, pp 341–352
Berg MC, Benbow ME (2013) Environmental factors associated with Phormia regina (Diptera:
Calliphoridae) oviposition. J Med Entomol 50(2):451–457
Boykin LM, Armstrong K et al (2012) DNA barcoding invasive insects: database roadblocks.
Invertebr Syst 26(6):506–514
Burgdorfer W, Mavros AJ (1970) Susceptibility of various species of rodents to the relapsing fever
spirochete, Borrelia hermsii. Infect Immun 2(3):256–259
Byrd JH, Castner JL (2009) Forensic entomology: the utility of arthropods in legal investigations.
CRC Press, Boca Raton, FL
Campbell PM (2005) Species differentiation of insects and other multicellular organisms using
matrix-assisted laser desorption/ionization time of flight mass spectrometry protein profiling.
Syst Entomol 30(2):186–190
Campobasso CP, Introna F (2001) The forensic entomologist in the context of the forensic
pathologist’s role. Forensic Sci Int 120(1–2):132–139
Campobasso CP, Di Vella G et al (2001) Factors affecting decomposition and Diptera colonization.
Forensic Sci Int 120(1–2):18–27
26 MALDITOF the Fourth Generation Techniques Still at Its Infancy to Identify. . . 541
Carvalho LM, Linhares ACX et al (2001) Determination of drug levels and the effect of diazepam
on the growth of necrophagous flies of forensic importance in southeastern Brazil. Forensic Sci
Int 120(1–2):140–144
Claydon MA, Davey SN et al (1996) The rapid identification of intact microorganisms using mass
spectrometry. Nat Biotechnol 14(11):1584–1586
Clynen E, Baggerman G et al (2003) Peptidomics of the locust corpora allata: identification of novel
pyrokinins (-FXPRLamides). Peptides 24(10):1493–1500
Cook PE, Hugo LE et al (2006) The use of transcriptional profiles to predict adult mosquito age
under field conditions. Proc Natl Acad Sci U S A 103(48):18060–18065
Cvačka J, Jiroš P et al (2006) Analysis of insect cuticular hydrocarbons using matrix-assisted laser
desorption/ionization mass spectrometry. J Chem Ecol 32(2):409–434
Cywinska A, Hunter F et al (2006) Identifying Canadian mosquito species through DNA barcodes.
Med Vet Entomol 20(4):413–424
Dadour IR, Cook DF et al (2001) Forensic entomology: application, education and research in
Western Australia. Forensic Sci Int 120(1):48–52
De Jong G (1995) Report of Chrysomya megacephala (Diptera: Calliphoridae) in northern New
Mexico. Entomol News 106(4):192
Dekeirsschieter J, Verheggen F et al (2009) Cadaveric volatile organic compounds released by
decaying pig carcasses (Sus domesticus L.) in different biotopes. Forensic Sci Int 189
(1–3):46–53
Dieme C, Yssouf A et al (2014) Accurate identification of Culicidae at aquatic developmental stages
by MALDI-TOF MS profiling. Parasit Vectors 7(1):544
Donaldson AE, Lamont IL (2014) Estimation of post-mortem interval using biochemical markers.
Aust J Forensic Sci 46(1):8–26
Dridi B, Raoult D et al (2012) Matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry identification of Archaea: towards the universal identification of living organisms.
APMIS 120(2):85–91
Dvorak V, Halada P et al (2014) Identification of phlebotomine sand flies (Diptera: Psychodidae) by
matrix-assisted laser desorption/ionization time of flight mass spectrometry. Parasit Vectors 7
(1):21
Ellison JR, Hampton EN (1982) Age determination using the apodeme structure in adult screw-
worm flies (Cochliomyia hominivorax). J Insect Physiol 28(9):731–736
Evans JD, Wheeler DE (1999) Differential gene expression between developing queens and
workers in the honey bee, Apis mellifera. Proc Natl Acad Sci U S A 96(10):5575–5580
Federhen S (2011) The NCBI taxonomy database. Nucleic Acids Res 40(D1):D136–D143
Feltens R, Görner R et al (2010) Discrimination of different species from the genus Drosophila by
intact protein profiling using matrix-assisted laser desorption ionization mass spectrometry.
BMC Evol Biol 10(1):95
Fotso AF, Mediannikov O et al (2014) MALDI-TOF mass spectrometry detection of pathogens in
vectors: the Borrelia crocidurae/Ornithodoros sonrai paradigm. PLoS Negl Trop Dis 8(7):
e2984
Freiwald A, Sauer S (2009) Phylogenetic classification and identification of bacteria by mass
spectrometry. Nat Protoc 4(5):732
Gennard D (2012) Forensic entomology: an introduction. John Wiley & Sons, Hoboken, NJ
Giffen JE, Rosati JY et al (2017) Species identification of necrophagous insect eggs based on amino
acid profile differences revealed by direct analysis in real time-high resolution mass spectrome-
try. Anal Chem 89(14):7719–7726
Goff M (1993) Estimation of postmortem interval using arthropod development and successional
patterns. Forensic Sci Rev 5:81–81
Greenberg B, Kunich JC (2002) Entomology and the law: flies as forensic indicators. Cambridge
University Press, Cambridge
542 V. Vinayak and A. Rai
Griffiths K, Krosch MN et al (2020) Variation in decomposition stages and carrion insect succes-
sion in a dry tropical climate and its effect on estimating postmortem interval. Forensic Sci
Res:1–9. https://doi.org/10.1080/20961790.2020.1733830
Gupta A, Setia P (2004) Forensic entomology—past, present and future. Anil Aggrawals Internet J
Forensic Med Toxicol 5(1):50–53
Gutiérrez-Gutiérrez C, Cantalapiedra-Navarrete C et al (2013) Molecular phylogeny of the nema-
tode genus Longidorus (Nematoda: Longidoridae) with description of three new species. Zool J
Linnean Soc 167(4):473–500
Hart AJ, Whitaker AP (2006) Forensic entomology: insect activity and its role in the decomposition
of human cadavers. Antenna 30(4):159–164
Hebert PD, Cywinska A et al (2003) Biological identifications through DNA barcodes. Proc R Soc
Lond B Biol Sci 270(1512):313–321
Hebert PD, Stoeckle MY et al (2004) Identification of birds through DNA barcodes. PLoS Biol 2
(10):e312
Hofer IM, Hart AJ et al (2017) Optimising crime scene temperature collection for forensic
entomology casework. Forensic Sci Int 270:129–138
Holland R, Wilkes J et al (1996) Rapid identification of intact whole bacteria based on spectral
patterns using matrix-assisted laser desorption/ionization with time-of-flight mass spectrometry.
Rapid Commun Mass Spectrom 10(10):1227–1232
Hoppenheit A, Murugaiyan J et al (2013) Identification of Tsetse (Glossina spp.) using matrix-
assisted laser desorption/ionisation time of flight mass spectrometry. PLoS Negl Trop Dis 7(7):
e2305
Ingrisch S (1995) Evolution of the Chorthippus biguttulus group (Orthoptera, Acriditae) in the
Alps, based on morphology and stridulation. Rev Suisse Zool 102(2):475–535
Inosaki A, Yasuda A et al (2010) Mass spectrometric analysis of peptides in brain neurosecretory
cells and neurohemal organs in the adult blowfly, Protophormia terraenovae. Comp Biochem
Physiol A Mol Integr Physiol 155(2):190–199
Jiggins FM (2002) The rate of recombination in Wolbachia bacteria. Mol Biol Evol 19
(9):1640–1643
Karger A, Kampen H et al (2012) Species determination and characterization of developmental
stages of ticks by whole-animal matrix-assisted laser desorption/ionization mass spectrometry.
Ticks Tick Borne Dis 3(2):78–89
Kaufmann C, Ziegler D et al (2011) Evaluation of matrix-assisted laser desorption/ionization time
of flight mass spectrometry for characterization of Culicoides nubeculosus biting midges. Med
Vet Entomol 25(1):32–38
Kaufmann C, Schaffner F et al (2012a) Identification of field-caught Culicoides biting midges using
matrix-assisted laser desorption/ionization time of flight mass spectrometry. Parasitology 139
(2):248–258
Kaufmann C, Steinmann IC et al (2012b) Spatio-temporal occurrence of Culicoides biting midges
in the climatic regions of Switzerland, along with large scale species identification by MALDI-
TOF mass spectrometry. Parasit Vectors 5(1):246
Krishnamurthy T, Rajamani U et al (1996) Detection of pathogenic and non-pathogenic bacteria by
matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Rapid Commun
Mass Spectrom 10(8):883–888
La Scola B, Campocasso A et al (2010) Tentative characterization of new environmental giant
viruses by MALDI-TOF mass spectrometry. Intervirology 53(5):344–353
Li C, Ma D et al (2017) Application of MALDI-TOF MS for estimating the postmortem interval in
rat muscle samples. J Forensic Sci 62(5):1345–1350
Macht M, Asperger A et al (2004) Comparison of laser-induced dissociation and high-energy
collision-induced dissociation using matrix-assisted laser desorption/ionization tandem time-of-
flight (MALDI-TOF/TOF) for peptide and protein identification. Rapid Commun Mass
Spectrom 18(18):2093–2105
26 MALDITOF the Fourth Generation Techniques Still at Its Infancy to Identify. . . 543
Mangold A, Bargues M et al (1997) 18S rRNA gene sequences and phylogenetic relationships of
European hard-tick species (Acari: Ixodidae). Parasitol Res 84(1):31–37
Mathis A, Depaquit J et al (2015) Identification of phlebotomine sand flies using one MALDI-TOF
MS reference database and two mass spectrometer systems. Parasit Vectors 8(1):266
Medzihradszky KF, Campbell JM et al (2000) The characteristics of peptide collision-induced
dissociation using a high-performance MALDI-TOF/TOF tandem mass spectrometer. Anal
Chem 72(3):552–558
Mellmann A, Cloud J et al (2008) Evaluation of matrix-assisted laser desorption ionization-time-of-
flight mass spectrometry in comparison to 16S rRNA gene sequencing for species identification
of nonfermenting bacteria. J Clin Microbiol 46(6):1946–1954
Metcalf JL, Parfrey LW et al (2013) A microbial clock provides an accurate estimate of the
postmortem interval in a mouse model system. Elife 2:e01104
Mirth CK, Truman JW et al (2009) The ecdysone receptor controls the post-critical weight switch to
nutrition-independent differentiation in Drosophila wing imaginal discs. Development 136
(14):2345–2353
Mizrachi I (2007) GenBank: the nucleotide sequence database. The NCBI Handbook [Internet],
updated 22
Morris M, Woolhouse A et al (1998) Orientation stimulants from substances attractive to Lucilia
cuprina (Diptera, Calliphoridae). Aust J Exp Agric 38(5):461–468
Nachman RJ, Russell WK et al (2005) Mass spectrometric assignment of Leu/Ile in neuropeptides
from single neurohemal organ preparations of insects. Peptides 26(11):2151–2156
Narita S, Nomura M et al (2006) Genetic structure of sibling butterfly species affected by
Wolbachia infection sweep: evolutionary and biogeographical implications. Mol Ecol 15
(4):1095–1108
Nekola JC, Barthel M (2002) Morphometric analysis of the genus Carychium in the Great Lakes
region of North America. J Conchol 37(5):515–532
Noël S, Tessier N et al (2004) Molecular identification of two species of myiasis-causing Cuterebra
by multiplex PCR and RFLP. Med Vet Entomol 18(2):161–166
Norris DE, Klompen J et al (1996) Population genetics of Ixodes scapularis (Acari: Ixodidae) based
on mitochondrial 16S and 12S genes. J Med Entomol 33(1):78–89
Packer L, Gibbs J et al (2009) DNA barcoding and the mediocrity of morphology. Mol Ecol Resour
9:42–50
Payne JA (1965) A summer carrion study of the baby pig Sus scrofa Linnaeus. Ecology 46
(5):592–602
Pechal JL, Moore H et al (2014) Hydrocarbon profiles throughout adult Calliphoridae aging: a
promising tool for forensic entomology. Forensic Sci Int 245:65–71
Perera MR, Vargas RDF et al (2005) Identification of aphid species using protein profiling and
matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Entomol Exp Appl
117(3):243–247
Pohjoismäki JL, Karhunen PJ et al (2010) Indoors forensic entomology: colonization of human
remains in closed environments by specific species of sarcosaprophagous flies. Forensic Sci Int
199(1–3):38–42
Powell JR, DeSalle R (1995) Drosophila molecular phylogenies and their uses. In: Evolutionary
biology. Springer, New York, pp 87–138
Predel R, Wegener C et al (2004) Peptidomics of CNS-associated neurohemal systems of adult
Drosophila melanogaster: a mass spectrometric survey of peptides from individual flies. J
Comp Neurol 474(3):379–392
Predel R, Roth S et al (2005) New insect order Mantophasmatodea: species differentiation by mass
fingerprints of peptide hormones? J Zool Syst Evol Res 43(2):149–156
Rahman MM, Neupert S et al (2013) Neuropeptidomics of the Australian sheep blowfly Lucilia
cuprina (Wiedemann) and related Diptera. Peptides 41:31–37
Ratnasingham S, Hebert PD (2007) BOLD: the barcode of life data system. Mol Ecol Notes 7
(3):355–364. http://www.barcodinglife.org
544 V. Vinayak and A. Rai
Wells JD, Pape T et al (2001) DNA-based identification and molecular systematics of forensically
important Sarcophagidae (Diptera). J Forensic Sci 46(5):1098–1102
Whitworth T, Dawson R et al (2007) DNA barcoding cannot reliably identify species of the blowfly
genus Protocalliphora (Diptera: Calliphoridae). Proc R Soc B Biol Sci 274(1619):1731–1739
Xinghua W, Jifeng C et al (2010) The availability of 16SrDNA gene for identifying forensically
important blowflies in China. Rom J Leg Med 1:43–50
Xu H, Ye G-Y et al (2014) Age-dependent changes in cuticular hydrocarbons of larvae in
Aldrichina grahami (Aldrich) (Diptera: Calliphoridae). Forensic Sci Int 242:236–241
Yasuda-Kamatani Y, Yasuda A (2000) Identification of orcokinin gene-related peptides in the brain
of the crayfish Procambarus clarkii by the combination of MALDI-TOF and on-line capillary
HPLC/Q-TOF mass spectrometries and molecular cloning. Gen Comp Endocrinol 118
(1):161–172
Yssouf A, Socolovschi C et al (2013) Matrix-assisted laser desorption ionization-time of flight mass
spectrometry: an emerging tool for the rapid identification of mosquito vectors. PLoS One 8(8):
e72380
Yssouf A, Parola P et al (2014) Identification of European mosquito species by MALDI-TOF
MS. Parasitol Res 113(6):2375–2378
Yssouf A, Almeras L et al (2015) Identification of tick species and disseminate pathogen using
hemolymph by MALDI-TOF MS. Ticks Tick Borne Dis 6(5):579–586
Zhu GH, Xu XH et al (2007) Puparial case hydrocarbons of Chrysomya megacephala as an
indicator of the postmortem interval. Forensic Sci Int 169(1):1–5
Forensic DNA Phenotyping
27
Dolly Mahna, Meenu Dutt, Sanjeev Puri, Tanzeer Kaur,
and Shweta Sharma
Abstract
Keywords
27.1 Introduction
police investigations and thus avoid becoming a known suspect. So the current
approach to this problem is getting its shape by collecting database which is screened
by investigators, in routine. Sometimes cases may take a long time due to lack of
evidence and/or DNA database for the investigation in unknown forensic sample
donors (Kayser and de Knijff 2011).
Mutation, gene flow, genetic drift and natural selection provide the overview of
genetic diversity development and maintenance with the growth of human popula-
tion. Unlike most animals, individual gene frequencies have been shaped by human
migration from one environment to another in an extremely wide range of environ-
mental ecosystems, genetic adaptation and genetic drift (Morjan and Rieseberg
2004).
Skin tone; darker skin is a trait of communities lately residing in equatorial areas,
e.g. South Indians, Sub Saharan Africans, natives of the Australian continent
because melanin absorbs damaging ultraviolet radiation before it can make way to
the epidermis nuclei and harm DNA. Whereas, Caucasian population exposed to
low-UV environment acquires lighter skin tone (Kowalczyk et al. 2018; Norton et al.
2005).
In determining patterns of overt genetic variation various factors such as natural
selection, natural variation or genetic drift, recombination, mutation and gene
conversion, sexual selection come into the scenario playing a significant part.
These factors are known to interact with statistical sampling which is induced by
the influence of the founders, isolation, migration and demographic bottlenecks,
certainly establishing phenotype diversity which even holds a substantial existence
in the human family tree in modern times (Phillips et al. 2018). A few apparent
phenotypic distinctions among the different population of the world include:
The anthropometric characteristic is the content of skin melanin and the Body
Mass Index (BMI). BMI differs significantly with ancestry through the rule of
Bergmann asserting that BMI improves with respect to distance from the equator
because of the cold climatic conditions of northern parts and association of volume-
to-surface ratio with heat exchange effectiveness. Bergmann’s principle is also able
to explain the difference in the bodily appearances of the populations belonging to a
certain environment e.g. population native to tropical environments (e.g. Kenyans,
Ethiopians, etc.) is big whereas locals residing in Arctic are thin. It also justifies the
550 D. Mahna et al.
EVCs can be changed artificially through many cosmetic procedures or surgery, for
example, dyed hair colour, coloured contact lenses, artificial hair extensions, facial
plastic surgery, hair transplantation etc. (Walsh 2005). The perpetrators may fake
their appearances to avoid any tracing by police investigation which may occur
during or after the criminal act. So, the criminals are required to register their feigned
appearance in police documentations which is quite difficult (Hernando et al. 2018).
In addition to this, passports, driving licences have portrait images along with a
record of other physical characteristics of an individual e.g. eye colour, height record
which can further assist in the identification of a suspect along with DNA predicted
appearance from evidence (Vidaki et al. 2013).
Keeping in mind these complexities, it is necessary to implement the phenotyping
techniques with a fair deal of planning to avoid FDP-guided investigations via
feigned appearances (Zaorska et al. 2019). However, the criminals often fail to
even practice the simplest act of wearing gloves which makes the method of
human identification from fingerprints effective and valid even after more than
100 years of its utility (Jing et al. 2019). Even though altered appearance theoreti-
cally seems to be a burden on FDP (Forensic DNA Phenotyping) but it is unlikely to
challenge FDP directed identification.
There are certain ethical issues attached with the use of FDP raised on the basis of
privacy associated with EVCs (Sero et al. 2019). Practically, the right-not-to-know
does not apply when appearance traits are concerned because they are already well
known to the people who have ever seen the person and all the identity cards
including driver-licences, passports, voter cards have portrait photographs (Kastelic
et al. 2013). Therefore, EVCs are not eligible to be considered as personal data.
On the other hand, the right-not-to-know can be applied on genetic ancestry
testing and disease-linked appearance. Utilization of the disease information of an
individual for forensic purpose is not ethically suitable to be used. Such reasoning is
not universally accepted as the forensic DNA legislation of US state of Texas has
permitted the use of information based on genetic diseases for FDP (Kayser 2015).
Problems may arise for EVCs where the same gene is associated with the normal as
well as diseased character. For example, SNPs related to the cleft-lips disease is also
associated with the normal facial width so in such cases it becomes extremely
difficult to ignore such an informative SNP (Kayser and de Knijff 2011). In such
case, extensive future research is required for the identification of genetic factors
responsible for the appearance of cleft thus allowing the differentiation between
diseased and normal forms of facial width thus isolating the utilization of disease
linked information (Pospiech et al. 2018).
27 Forensic DNA Phenotyping 553
In addition to the scientific research based burdens, there are various legal issues
associated with practical FDP. Basically, the country specific legal legislations and
implications on the regulation of the utilization of human DNA for DNA fingerprint-
ing or DNA profiling do not cover FDP (Walsh et al. 2011). Although, some
countries like Netherlands have modified their forensic DNA regulations to permit
the application of DNA based appearance prediction in forensic cases. Some
countries, such as UK, do not even have particular legislations for the utilization
of FDP rather allow its utilization for forensic identification (Mengel-From et al.
2009).
Apart from all the other factors imposing challenge to FDP, the significant burden is
that of the dearth of immense knowledge on the genetic basis of human appearance
(Aulchenko et al. 2009). Along with the restricted scientific knowledge of concerned
field, insufficient research funding by government agencies is quite a major factor in
not letting FDP flourish as an established technique in forensic identification
(Weinberg et al. 2008). Furthermore, the literature present on the topic is quite
limited with not a very large number of publications. Provided the novelty and
significance of the newly built phenomenon, large number of research studies are
required (Slabbert and Heathfield 2018).
Another serious burden for FDP is the unavailability of multiplex genotyping
technologies for incorporating in-parallel analysis of a large number of SNPs
appropriate for low quality and quantity DNA available on the crime scenes (Salvoro
et al. 2019). Continuous efforts are being made to overcome this limitation by
implementing massive parallel sequencing technologies viz. next generation
sequencing (NGS) or second generation sequencing (SGS) technologies which
have the ability to analyse quite a number of SNPs required for a detailed appearance
prediction (Bradbury et al. 2019).
Acknowledgements The authors are thankful to DST, Govt. of India, for providing financial
support to IFSC and Centre for SCTE through the PURSE grant.
References
Ackerman JP, Bartos DC, Kapplinger JD, Tester DJ, Delisle BP, Ackerman MJ (2016) The promise
and peril of precision medicine: phenotyping still matters most. Mayo Clin Proc 91:1606.
https://doi.org/10.1016/j.mayocp.2016.08.008
556 D. Mahna et al.
Aulchenko YS, Struchalin MV, Belonogova NM, Axenovich TI, Weedon MN, Hofman A,
Uitterlinden AG, Kayser M, Oostra BA, van Duijn CM, Janssens ACJW, Borodin PM (2009)
Predicting human height by Victorian and genomic methods. Eur J Hum Genet 17:1070. https://
doi.org/10.1038/ejhg.2009.5
Bradbury C, Kottgen A, Staubach F (2019) Off-target phenotypes in forensic DNA phenotyping
and biogeographic ancestry inference: a resource. Forensic Sci Int Genet 38:93–104. https://doi.
org/10.1016/j.fsigen.2018.10.010
Branicki W, Brudnik U, Kupiec T, Wolanska-Nowak P, Wojas-Pelc A (2007) Determination of
phenotype associated SNPs in the MC1R gene. J Forensic Sci 52:349–354. https://doi.org/10.
1111/j.1556-4029.2006.00361.x
Brewer N, Wells GL (2011) Eyewitness identification. Curr Dir Psychol Sci 20:24–27. https://doi.
org/10.1177/0963721410389169
Buchanan N, Staubach F, Wienroth M, Pfaffelhuber P, Surdu M, Lipphardt A, Kottgen A,
Syndercombe-Court D, Lipphardt V (2018) Forensic DNA phenotyping legislation cannot be
based on “Ideal FDP”—a response to Caliebe, Krawczak and Kayser (2017). Forensic Sci Int
Genet 34:e13–e14. https://doi.org/10.1016/j.fsigen.2018.01.009
Budowle B, Bieber FR, Eisenberg AJ (2005) Forensic aspects of mass disasters: strategic
considerations for DNA-based human identification. Leg Med (Tokyo) 7:230–243. https://doi.
org/10.1016/j.legalmed.2005.01.001
Caliebe A, Krawczak M, Kayser M (2018) Predictive values in Forensic DNA Phenotyping are not
necessarily prevalence-dependent. Forensic Sci Int Genet 33:e7–e8. https://doi.org/10.1016/j.
fsigen.2017.11.006
Chaitanya L, Pajnic IZ, Walsh S, Balazic J, Zupanc T, Kayser M (2017) Bringing colour back after
70 years: predicting eye and hair colour from skeletal remains of World War II victims using the
HIrisPlex system. Forensic Sci Int Genet 26:48–57. https://doi.org/10.1016/j.fsigen.2016.10.
004
Chaitanya L, Breslin K, Zuniga S, Wirken L, Pospiech E, Kukla-Bartoszek M, Sijen T, de Knijff P,
Liu F, Branicki W, Kayser M, Walsh S (2018) The HIrisPlex-S system for eye, hair and skin
colour prediction from DNA: introduction and forensic developmental validation. Forensic Sci
Int Genet 35:123–135. https://doi.org/10.1016/j.fsigen.2018.04.004
Claes P, Roosenboom J, White JD, Swigut T, Sero D, Li J, Lee MK, Zaidi A, Mattern BC,
Liebowitz C, Pearson L, González T, Leslie EJ, Carlson JC, Orlova E, Suetens P,
Vandermeulen D, Feingold E, Marazita ML, Shaffer JR, Wysocka J, Shriver MD, Weinberg
SM (2018) Genome-wide mapping of global-to-local genetic effects on human facial shape. Nat
Genet 50:414–423. https://doi.org/10.1038/s41588-018-0057-4
Daniel R, Santos C, Phillips C, Fondevila M, van Oorschot RAH, Carracedo A, Lareu MV,
McNevin D (2015) A SNaPshot of next generation sequencing for forensic SNP analysis.
Forensic Sci Int Genet 14:50–60. https://doi.org/10.1016/j.fsigen.2014.08.013
Feng L, Peng F, Li S, Jiang L, Sun H, Ji A, Zeng C, Li C, Liu F (2018) Systematic feature selection
improves accuracy of methylation-based forensic age estimation in Han Chinese males. Foren-
sic Sci Int Genet 35:38–45. https://doi.org/10.1016/j.fsigen.2018.03.009
Hernando B, Ibanez MV, Deserio-Cuesta JA, Soria-Navarro R, Vilar-Sastre I, Martinez-Cadenas C
(2018) Genetic determinants of freckle occurrence in the Spanish population: towards ephelides
prediction from human DNA samples. Forensic Sci Int Genet 33:38–47. https://doi.org/10.
1016/j.fsigen.2017.11.013
Hill WG (2010) Understanding and using quantitative genetic variation. Philos Trans R Soc Lond
Ser B Biol Sci 365:73–85. https://doi.org/10.1098/rstb.2009.0203
Hussing C, Huber C, Bytyci R, Mogensen HS, Morling N, Borsting C (2018) Sequencing of
231 forensic genetic markers using the MiSeq FGx forensic genomics system—an evaluation of
the assay and software. Forensic Sci Res 3:111–123. https://doi.org/10.1080/20961790.2018.
1446672
27 Forensic DNA Phenotyping 557
Jing X, Sun Y, Zhao W, Gao X, Ma M, Liu F, Li C (2019) Predicting adult height from DNA
variants in a European-Asian admixed population. Int J Legal Med. https://doi.org/10.1007/
s00414-019-02039-8
Kastelic V, Pospiech E, Draus-Barini J, Branicki W, Drobnic K (2013) Prediction of eye color in the
Slovenian population using the IrisPlex SNPs. Croat Med J 54:381–386. https://doi.org/10.
3325/cmj.2013.54.381
Kayser M (2015) Forensic DNA phenotyping: predicting human appearance from crime scene
material for investigative purposes. Forensic Sci Int Genet 18:33–48. https://doi.org/10.1016/j.
fsigen.2015.02.003
Kayser M, de Knijff P (2011) Improving human forensics through advances in genetics, genomics
and molecular biology. Nat Rev Genet 12:179. https://doi.org/10.1038/nrg2952
Kowalczyk M, Zawadzka E, Szewczuk D, Gryzinska M, Jakubczak A (2018) Molecular markers
used in forensic genetics. Med Sci Law 58:201–209. https://doi.org/10.1177/
0025802418803852
Kukla-Bartoszek M, Pospiech E, Spolnicka M, Karlowska-Pik J, Strapagiel D, Zadzinska E,
Rosset I, Sobalska-Kwapis M, Slomka M, Walsh S, Kayser M, Sitek A, Branicki W (2018)
Investigating the impact of age-depended hair colour darkening during childhood on
DNA-based hair colour prediction with the HIrisPlex system. Forensic Sci Int Genet
36:26–33. https://doi.org/10.1016/j.fsigen.2018.06.007
Lima FA, Goncalves FT, Fridman C (2015) SLC24A5 and ASIP as phenotypic predictors in
Brazilian population for forensic purposes. Leg Med (Tokyo) 17:261–266. https://doi.org/10.
1016/j.legalmed.2015.03.001
Liu F, Zhong K, Jing X, Uitterlinden AG, Hendriks AEJ, Drop SLS, Kayser M (2019) Update on
the predictability of tall stature from DNA markers in Europeans. Forensic Sci Int Genet
42:8–13. https://doi.org/10.1016/j.fsigen.2019.05.006
Machado H, Silva S (2019) What influences public views on forensic DNA testing in the criminal
field? A scoping review of quantitative evidence. Hum Genomics 13:23. https://doi.org/10.
1186/s40246-019-0207-5
MacLean CE, Lamparello A (2014) Forensic DNA phenotyping in criminal investigations and
criminal courts: assessing and mitigating the dilemmas inherent in the science. Recent Adv
DNA Gene Seq 8:104–112
Mengel-From J, Wong TH, Morling N, Rees JL, Jackson IJ (2009) Genetic determinants of hair and
eye colours in the Scottish and Danish populations. BMC Genet 10:88. https://doi.org/10.1186/
1471-2156-10-88
Morjan CL, Rieseberg LH (2004) How species evolve collectively: implications of gene flow and
selection for the spread of advantageous alleles. Mol Ecol 13:1341–1356. https://doi.org/10.
1111/j.1365-294X.2004.02164.x
Norton HL, Kittles RA, Parra E, Mckeigue P, Mao X, Cheng K, Canfield VA, Bradley DG,
Mcevoy B, Shriver MD (2005) Genetic evidence for the convergent evolution of light skin in
Europeans and East Asians, vol 24, p 710. https://doi.org/10.1093/molbev/msl203
Parson W (2018) Age estimation with DNA: from forensic DNA fingerprinting to forensic (epi)-
genomics: a mini-review. Gerontology 64:326–332. https://doi.org/10.1159/000486239
Phillips C, Devesse L, Ballard D, van Weert L, de la Puente M, Melis S, Alvarez Iglesias V, Freire-
Aradas A, Oldroyd N, Holt C, Syndercombe Court D, Carracedo A, Lareu MV (2018) Global
patterns of STR sequence variation: sequencing the CEPH human genome diversity panel for
58 forensic STRs using the Illumina ForenSeq DNA Signature Prep Kit. Electrophoresis
39:2708–2724. https://doi.org/10.1002/elps.201800117
Pospiech E, Karlowska-Pik J, Ziemkiewicz B, Kukla M, Skowron M, Wojas-Pelc A, Branicki W
(2016) Further evidence for population specific differences in the effect of DNA markers and
gender on eye colour prediction in forensics. Int J Legal Med 130:923–934. https://doi.org/10.
1007/s00414-016-1388-2
Pospiech E, Chen Y, Kukla-Bartoszek M, Breslin K, Aliferi A, Andersen JD, Ballard D,
Chaitanya L, Freire-Aradas A, van der Gaag KJ, Giron-Santamaria L, Gross TE, Gysi M,
558 D. Mahna et al.
White D, Rabago-Smith M (2011) Genotype-phenotype associations and human eye color. J Hum
Genet 56:5–7. https://doi.org/10.1038/jhg.2010.126
Williams R, Wienroth M (2017) Social and ethical aspects of forensic genetics: a critical review.
Forensic Sci Rev 29:145–169
Wolinsky H (2015) CSI on steroids: DNA-based phenotyping is helping police derive visual
information from crime scene samples to aid in the hunt for suspects. EMBO Rep
16:782–786. https://doi.org/10.15252/embr.201540714
Wray NR, Yang J, Hayes BJ, Price AL, Goddard ME, Visscher PM (2013) Pitfalls of predicting
complex traits from SNPs. Nat Rev Genet 14:507. https://doi.org/10.1038/nrg3457
Zaorska K, Zawierucha P, Nowicki M (2019) Prediction of skin color, tanning and freckling from
DNA in Polish population: linear regression, random forest and neural network approaches.
Hum Genet 138:635–647. https://doi.org/10.1007/s00439-019-02012-w
Zbiec-Piekarska R, Spolnicka M, Kupiec T, Parys-Proszek A, Makowska Z, Paleczka A,
Kucharczyk K, Ploski R, Branicki W (2015) Development of a forensically useful age predic-
tion method based on DNA methylation analysis. Forensic Sci Int Genet 17:173–179. https://
doi.org/10.1016/j.fsigen.2015.05.001
Rapid DNA Typing
28
Pankaj Shrivastava, Aditi Mishra, Anand Kumar,
Sumit K. Chaudhary, Sonia Kakkar, and R. K. Kumawat
Abstract
P. Shrivastava (*)
DNA Fingerprinting Unit, State Forensic Science Laboratory, Department of Home (Police),
Government of Madhya Pradesh, Sagar, Madhya Pradesh, India
A. Mishra
DNA Fingerprinting Unit, State Forensic Science Laboratory, Department of Home (Police),
Government of Madhya Pradesh, Sagar, Madhya Pradesh, India
Raksha Shakti University, Gandhinagar, Gujarat, India
A. Kumar · S. Kakkar
Department of Forensic Medicine, Post Graduate Institute of Medical Education and Research
(PGIMER), Chandigarh, India
S. K. Chaudhary
Raksha Shakti University, Gandhinagar, Gujarat, India
R. K. Kumawat
DNA Division, State Forensic Science Laboratory, Jaipur, Rajasthan, India
Keywords
Fig. 28.2 Current practice in Forensic DNA analysis vs Rapid DNA technology
reports from the target samples (Lee 2017). In order to meet the expectations of law
and enforcement, fully automated DNA technology is being demanded by many
forensic laboratories. This technology is the need of the hour when there is a huge
backlog in forensic laboratories across the world. This demand resulted in to the
development of instruments which can do all the analysis and provide result in
minimum time. The commercialization of an automated system that brings the
extraction, amplification, separation and analysis steps together in one platform
has been unrealized until recently. Instruments and kits that support the automated
DNA process are now available to the few forensic laboratories.
Rapid DNA technology is a fully automated (hands free) process of generating
STR profile from buccal swab reference samples. The “swab in—profile out”
method (portable) is integrated with the automated DNA extraction, STR amplifica-
tion, Amplicon separation, detection and allele calling without human involvement
which minimizes the analysis time and also cross-contamination of samples
(Fig. 28.2) (Gold 2013).
In December 2010, Rapid DNA Program Office was set up by the Federal Bureau
of Investigation (FBI) to adopt the rapid DNA technology by law enforcement and
other government agencies (https://www.fbi.gov/). Further, many amendments have
been considered to the DNA Identification Act of 1994 to utilize the rapid DNA
technology in forensic fields (Lee 2017). The Rapid DNA Act of 2017 was signed on
August 18, 2017, which amends the DNA Identification Act of 1994. This law gives
permission to use fully automated rapid DNA technology or instruments to the
various laboratories (Gold 2013). The development of rapid DNA as an advanced
technology has many advantages such as:
The advanced rapid DNA technology works with computer based software and
comes with the pre-filled cartridges. These pre-filled cartridges contain all the
chemical reagents required for the further processing such as DNA extraction,
amplification, separation and genotyping. These cartridges also contain sample
input slots in which forensic samples are loaded. After the sample loading into the
instrument, analysis proceeds automatically. The analysis operation is self-
calibrating which allows semi-skilled person to handle this equipment with an
hour of training. Besides this, the machine allows identifying the criminal
(s) within 75–90 min and this helps in exonerate the suspect(s) in very limited
time (Roewer 2013).
The developments that helped to advance rapid DNA technology to the prevailing
situation are various; but incorporation of advanced micro fluidic principle into rapid
DNA system makes it more attractive. The micro-fluidic technology uses fewer
amounts of chemicals to minimize the cost, instrument size, reaction time and also
size of the cartridges containing chemical. The complete DNA processing steps like
extraction, amplification (also commonly called as PCR; Polymerase Chain Reac-
tion), separation (also known as capillary electrophoresis), and interpretation can be
achieved with one micro-fluidic chip (Gold 2013). The rapid DNA systems comprise
three integral parts:
• Swab
• A chip
• The instrument
The swab is needed for the input of desired quantity of forensic samples to the
system for analyses. The chip bears all the materials, regents and waste containments
required for the process in order to generate STR profile i.e. reagents for DNA
extraction, PCR to capillary electrophoresis. There is no direct contact between the
instrument and the sample swab. The sample injection is by pneumatic pressure to
avoid any chance for contamination. The steps in processing of samples for genera-
tion of DNA profile are shown in Fig. 28.3.
The STR profiles generated from the rapid DNA are compatible to the new
CODIS loci, Expanded European Standard Set, National DNA profile databank
(United Kingdom), National Criminal Investigation DNA database (Australia),
National DNA Data Bank (Canada), National DNA Database (China), Data-
Analyse-Datei (Germany), and National DNA profile databank (New Zealand)
(Carney 2019).
Rapid DNA analysis can be useful in identification of criminals where they can
only be kept for not more than 2 h as it provides faster results. In future, the use or
28 Rapid DNA Typing 565
The innovation of Rapid DNA technology has been extremely beneficial to the law
enforcement agencies and forensic laboratories. As discussed above, it has shown
many benefits to the numerous cases. Above all the benefits of the rapid DNA
technology, it has some limitations too such as:
• It supports very few sample types. All variety of forensic samples especially
tough samples like bone and teeth cannot be processed using this technology.
• It requires pre-processing for many forensic samples.
• It does not give 100% yield rate on all the tested samples.
• In comparison to traditional methods, it is still not affordable for many
investigating agencies.
• It still requires proper standardization and validation for the wide variety of
forensic samples.
• In many forensic cases the samples are degraded either due to their recovery from
adverse environments or due to their late processing for one or the other reason.
566 P. Shrivastava et al.
With the advancement in this technology various instruments have been designed
by different manufacturer (Table 28.1).
two sample cartridges for analysis and both of them can be run subsequently. After
the cartridges are loaded into instrument and the run has been initiated, the
RapidHIT™ 200 uses the DNA IQ™ System from the Promega Corporation to
isolate DNA from the buccal swabs. The RapidHIT™ 200 instrument does not
require quantification of the samples as the DNA IQ™ method restrict the amount
of extracted DNA sent to the PCR chamber (4–20 ng) of input DNA template
(Shackleton 2019).
28.3 RapidHIT® ID
used by RapidHIT® ID. However, a second sample cartridge has recently designed
by IntegenX for the RapidHIT® ID system to process the extracted DNA samples
encountered at crime scene (Buscaino 2018). The complete DNA processing steps
like extraction, amplification (also commonly called as PCR; Polymerase Chain
Reaction), separation (also known as capillary electrophoresis), and interpretation
can be done with RapidHIT® ID system.
was specially designed for the detection of six fluorescent dyes (6C) and validated
for FlexPlex27 Chemistry. FlexPlex 27 STR Multi-Plexkit has 23 autosomal loci,
3 Y STR loci and Amelogenin loci (Grover 2017). This advanced version of the
instrument is referred to as ANDE6C. The additional loci in the FlexPlex27
Multiplexed STR kit having expended set of the CODIS core 20 loci increase the
power of discrimination to upgrade the efficacy of kinship analysis and identification
matches. Output files shall be encrypted and can be decrypted and exported by using
a multi-function user privilege software package known as FAIRS™ (ANDE
Corporation).
Recently, new method of DNA extraction methods has been manufactured by LGC
known as Para DNA® instruments to analyze the samples within 75 min. The
ParaDNA® instruments can be deployed in a lab or at a crime scene by forensic
experts or properly trained non-expert person (e.g. crime scene investigators). The
ParaDNA® is quick and robust instrument which generates reliable profile informa-
tion with high success rate. ParaDNA® instruments also specify whether samples
collected at the crime scene contain human DNA and which of them can generate
reliable STR profiles for investigations. It consists of two sections; DNA amplifica
tion and fluorescent detection software and a consumable kit (sample collector and
reaction plate containing required biochemistry for amplification). The ParaDNA®
570 P. Shrivastava et al.
References
Blackman S, Dawnay N, Ball G, Stafford-Allen B, Tribble N, Rendell P, Wells S (2015) Develop-
mental validation of the ParaDNA® Intelligence System—a novel approach to DNA profiling.
Forensic Sci Int Genet 17:137–148
Buscaino J (2018) Evaluation of a Rapid DNA process with the RapidHIT® ID system using a
specialized cartridge for extracted and quantified human DNA. Forensic Sci Int Genet
34:116–127
Carney C (2019) Developemental validation of the ANDETM Rapid DNA system with
FlexPlexTM Assay for arrestee and reference buccal swab processing and database searching.
Forensic Sci Int Genet 40:120–130
Date-Chong M (2016) Evaluation of RapidHIT™ 200 and RapidHITGlobelFiler® express kit for
fully automated STR genotyping. Forensic Sci Int Genet 23:1–8. https://doi.org/10.1016/j.
fsigen.2016.03.001
Gold S (2013) Rapid DNA: a game changer in the law enforcement identification stakes. Biometric
Technol Today 2013(1):7–10
Grover R (2017) Flexplex27-highly multiplexed rapid DNA identification for law enforcement,
kinship and military applications. Int J Legal Med 131:1489–1501
Hennessy LK et al (2014) Developmental validation of the GlobalFiler® express kit, a 24-marker
STR assay, on the RapidHIT® System. Forensic Sci Int Genet 13:247–258
Lee J (2017) The emergence of rapid DNA technology. International Biometrics + Identity Associ-
ation (IBIA), Washington, DC, pp 1–8
Moreno LI (2017) Internal validation of the DNAscan/ANDE™ Rapid DNAAnalysis™ platform
and its associated PowerPlex® 16 high content DNA biochip cassette for use as an expert system
with reference buccal swabs. Forensic Sci Int Genet 29:100–108
Roewer L (2013) DNA fingerprinting in forensics: past, present, future. Investig Genet 4(1):22
Salceda S (2017) Validation of a Rapid DNA process with the Rapid HIT® ID system using
GlobalFiler® express chemistry, a platform optimized for decentralized testing environments.
Forensic Sci Int Genet 28:21–24
Shackleton D (2019) Development of enhanced sensitivity protocol on the RapidHIT™ 200 with a
view to processing case work material. Sci Justice 59:411–417
Thong Z et al (2015) Evaluation of the RapidHITTM 200 System: a comparative study of its
performance with Maxwell® DNA IQTM/Identifiler® Plus/ABI 3500xL workflow. Forensic Sci
Int Genet 19:22–27
Turingan RS et al (2016) Rapid DNA analysis for automates processing and interpretation of low
DNA content samples. Investig Genet 7:2
Part VI
Guideline, Quality Control, Legal Aspects and
DNA Database in Forensic DNA Typing
Guidelines for Collection and Preservation
of Samples for Forensic DNA Testing 29
Pankaj Shrivastava, Shivani Dixit, and Hirak Ranjan Dash
Abstract
Forensic DNA typing is the gold standard in a criminal investigation that has
overpowered all other forensic techniques. The materials which are examined in
forensic DNA are of biological origin, which is amenable to degradation. Hence,
proper preservation and transportation are to be ensured. With the increasing
reliance on the DNA technique, it is required that the exhibits being sent for DNA
testings should be properly preserved and sent as per the proper guidelines. Also,
the chain of custody from collection to transport of material to the DNA labora-
tory should be ensured. The laboratories practicing forensic DNA have their
guidelines that need to be followed for sending the sample to any particular
laboratory. But for the benefit of readers, some general guidelines are presented in
this chapter.
Keywords
Forensic DNA · Guidelines · Collection · Preservation
Forensic DNA examination has now almost changed the global scenario of Investi-
gation not only for establishing conviction but also to avoid wrongful conviction of
innocents (Johnson and Williams 2004). Courts are now waiting for the DNA reports
in the cases. On the basis of our experience as forensic DNA experts since last
15 years we have seen dramatic change towards the importance of DNA reports in
criminal cases specially. The peculiar features of DNA have made them the hero in
the process of criminal investigation (Fig. 29.1).
Another very important point is the fact that no two individuals have the same
DNA profile (except for the identical twins). Due to this fact, any evidence collected
from the crime scene can be linked with the suspect or it can be used to eliminate a
suspect from any doubt. Similarly in cases of sexual assault the source of body fluid
transferred from suspect to victim’s body or vice versa is ascertained by using DNA
typing (Collins 1998). In case of paternity establishment or identification of
mutilated remains, the paternity of concerned is ascertained. The beauty of this
technique is the fact that it works with a wide variety of exhibits (Fig. 29.2).
The DNA profile gathered from the evidence sample or from the sample which
was lifted and preserved from scene of crime is compared with the reference sample.
Also in United States and few other countries having database, this DNA profile can
be used to generate hit in to the database like FBI’s Combined DNA Index System
(CODIS) (Panneerchelvam and Norazmi 2003). For making the effective use of the
technology the evidence require proper attention so as to reach the laboratory in a
proper way. All the laboratories working on forensic DNA typing work have issued
guidelines for proper sampling, preservation and transportation of biological
exhibits. Few noticeable guidelines can be accessed from the web-links given in
Table 29.1.
The samples in consideration for the DNA analysis can be classified broadly in
two categories, i.e. (1) Reference samples; (2) Forensic samples.
29 Guidelines for Collection and Preservation of Samples for Forensic DNA Testing 575
Fig. 29.2 Wide varieties of exhibits received in the laboratory for forensic DNA examination
Table 29.1 Guidelines issued by some reputed laboratories for collection and preservation of
DNA evidences
Organization Link
Federal Bureau of Investigation (FBI) Handbook of Forensic Services—FBI.gov
www.fbi.gov/file-repository/handbook-of-
forensic-services-pdf
National Institute of Standards and Technology https://www.nist.gov/topics/forensic-science/
(NIST) evidence-management/biological-evidence-
guidance
Central Forensic Science Laboratory (CFSL), http://dfs.nic.in/pdfs/Pamphlet%20.pdf
Chandigarh, India
Centre for DNA Fingerprinting and Diagnostics http://www.cdfd.org.in/images/dna/
(CDFD), Hyderabad, India newinfo28308.pdf
Nepal Police https://www.nepalpolice.gov.np/images/
documents/updates/Dna_Guidelines.pdf
Produced 2014 by the Forensic Working Group https://www.tracenetwork.org/wp-content/
(FWG), part of the Partnership for Action uploads/2012/08/Wildlife_DNA_Sampling_
against Wildlife Crime (PAW) Guide_web.pdf
576 P. Shrivastava et al.
In most of the cases the blood is considered to be the ideal referral sample which is
collected from victim as well as from the suspect. Liquid blood is drawn by the
medical practitioner after pre-informed written consent as per the DNA examination
guidelines (Weedn et al. 1998). In the consent form genetic abnormality (if any) and
information about any specific medical condition like blood/organ transplant must
be stated and sent to the laboratory along with the sample. 2–5 ml1 liquid blood
samples (standard as per many standard protocols) is collected in pre-sterile EDTA
vial. Ethylenediaminetetraacetic acid (EDTA) is a polyprotic acid that chelate
Calcium and other ions, thus irreversibly preventing coagulation of blood in the
tube (Banfi et al. 2007). 0.5 ml blood should be collected in case of infant/child
(in case of paternity establishment). After collection and keeping the blood in EDTA
vial, the second important point is to prove the identity of vial. The entire informa-
tion essential for identification of subject and case viz. name, father’s name, case
number, name and signature of collector with date should be there in the form of a
label as illustrated in Fig. 29.3.
The ideal way is to cover the information by a transparent tape before sealing and
preserving the sample for sending to the laboratory. As liquid blood is a biological
sample and to avoid any further degradation it is advisable to refrigerate (not frozen)
and the sample is transported to the laboratory under ice. Devoid of which, the
quality of DNA is decreased due to lysis of WBC (Huang et al. 2017). A suggested
method for transport of the referral blood samples is shown in Fig. 29.4. Blood
sample can also be collected from dead bodies till 24 h of the last heartbeat by
puncturing heart or from the major blood vessel. Postmortem blood should also be
1
Though with the increased sensitivity of kits and available automations in DNA extraction the
requirement of blood samples is less than 100 μl for extracting amplifiable quantity of DNA.
29 Guidelines for Collection and Preservation of Samples for Forensic DNA Testing 577
Fig. 29.4 After marking the tube and covering the marking with the transparent tape, the process
of keeping sample for transportation
collected in EDTA vial. Some of the DNA laboratories also accept the blood samples
in pre-sterile blood gauge which authors does not recommend as:
• It is not expected that all the samples in the laboratory can never be processed
immediately
• Wet swabs facilitate degradation of sample
• Drying of swab is not possible in controlled sterile atmosphere every time
Alternatively blood sample can also be sent on FTA card (Initially launched by
Whatman but now being marketed by Qiagen). For this <125 μl blood sample is
transferred on the provided place on the card (Fig. 29.5) (Ahmed et al. 2011). Over-
crowding the sample should be provided and the card should be kept for 3–5 min for
drying. Each card should be packed separately and the sample on the FTA card can
578 P. Shrivastava et al.
If wet blood stains found on any clothing, weapon, small objects or any movable
objects which can be moved easily from the crime scene. Then it is recommended to
air dry before packaging and then it can be transported to the laboratory. To avoid
cross contamination attempt should be made to avoid the overlap of one spot to the
other. This can simply be done by separating different stains by keeping paper on
different air dried stains. After air drying the item, it should be packaged in paper
bag, marked, labeled sealed and then should be transported to the laboratory.
Multiple items should be packaged separately to avoid cross contamination
(Magalhães et al. 2015).
Wet blood stains from large or immovable objects like wood, surface, wallpaper
should be collected by soak up blood through sterilized cotton swab. Swab should be
air dried before packaging. Swabs from multiple stained areas should be collected
separately to avoid contamination. If wet blood stains are present on large objects
29 Guidelines for Collection and Preservation of Samples for Forensic DNA Testing 579
which are difficult to move then it’s recommended to take swab or else the object can
be cut leaving at least 6 in. space from the periphery of the stain. The stain should be
covered with a paper; the paper should be fixed with the use of adhesive tape to avoid
the sample loss. The stained area should be allowed to air dry before covering it with
paper and cutting it before packaging.
If dried blood stains found on clothing, weapon, small objects or any movable
objects then it is recommended to preserve whole item directly. The collected item
should be marked and labeled with the requisite information. Dried blood stains from
large or immovable objects can be scraped on a clean paper. If object cannot be
scraped then it is recommended to take the swab of the suspected area. Allow to air
dry swab before packaging. If the stain is on large object the suspected area can be
cut and sent for examination. Blood spatters can be collected through tape lifting
from possible areas. Blood samples can also be found in many other possible areas
like snow, water etc. if blood stains found on snow then a bigger scoop of snow
should be taken and transferred in pre-sterile container. Container should be freeze
after taking the sample. If blood stains found in swimming pool, pond or anywhere
in still water then collect sample by using sterilized syringe. Transfer sample in a
container and then it is recommended to freeze.
specialized swabs can also be used for this purpose. Victims clothing can also be
preserved and sent for the examination as per requirement in the case. It should be
insisted to get medical examination of victim done at earliest to avoid the possible
loss of evidence due to change atmospheric pH, enzyme activity, washing and
natural cleaning due to urination in the victim’s body.
It is difficult to send these samples in dried state, hence if these samples are found on
scene of crime then should be picked by sterile forceps or spatula and preserved
separately in pre-sterile container in normal saline. To prevent microbial decay it
is also suggested to use antibiotics (0.1 mg/ml gentamicin solution). If the sample is
being preserved from a postmortem body with varied state of decomposition, it is
advisable to collect deep muscle tissues (preferable from more than one organ) by
the same procedure. Depending upon the state of degradation of body thigh muscles,
heart and brain have been the samples of preference for forensic DNA examination
purpose. If it is not possible to send these samples for forensic DNA examinations
then its recommended to keep samples under refrigerated condition. If uterus and
fetus are to be preserved for establishment of paternity then is highly recommended
to preserve both separately to avoid any chance of contamination during possible
decay. Tissue or organ samples are never preserved in formal in as it causes DNA
damage as well as its known PCR inhibiting capability (Zimmermann et al. 2008).
These evidences are already preserved due to their calcified structure (Westen et al.
2008). These samples do not need any preservative and hence can be transported in
paper packing at room temperature. Proper information about source and place from
where it is collected including the date should be mentioned on the label. For
matching of DNA profile of these items, referral samples are also required to be
sent as per the guidelines to establish relationship.
29.2.7 Hair
Hairs found in the feast of deceased, on the scene of crime, attached with the clothes
of deceased can provide a good link of suspect with the crime. With the advancement
in the technology DNA profile can be generated even with a single rooted hair. These
samples also do not need any preservative and hence can be transported in paper
packing at room temperature. Proper information about source and place from where
it is collected including the date should be mentioned on the label. Cut hairs are not
normally suitable for DNA examination as they lack nuclear DNA however mtDNA
can be extracted from these hairs (Lebedeva et al. 2000) (Table 29.2).
29 Guidelines for Collection and Preservation of Samples for Forensic DNA Testing 581
Table 29.2 Quick reference for collection, preservation and transportation of biological samples
for forensic DNA examination
Sample preservation guideline at a glance
How to send/
Type of sample How to preserve transport
Blood sample In EDTA vial Under ice within
48 h of collection
Blood sample Whatman filter paper no. 3/FTA Room
temperature
Buccal swabs Pre-sterile individually packed. Wrapped in a dry Room
paper temperature
Teeth Wrapped in a dry paper or cloth Room
Preferably molars (without any clinical filling) temperature
Hair with root Wrapped in a dry paper Room
temperature
Nails Wrapped in a dry paper Room
temperature
Bones (intact) Preferably femur wrapped in a dry paper or cloth Room
In case where the bone is in pieces then the largest temperature
piece should be sent, however, yield of good
quality DNA from the pieces of bone is uncertain
owing to the microbial contamination
Completely burnt bones and ash are not useful for
DNA analysis
Vaginal/anal swabs Pre-sterile individually packed Room
Or dry cotton swab should be placed in a sterile temperature
dry glass vial/bottle
Vaginal/anal smear Should be air dried and sent unstained. Swab used Room
slide to make slide should also be sent in a separate temperature
container
Breast swab/finger Should be air dried and sent unstained Room
swab or any other temperature
swab
Penile swab Use pre-sterile individually packed Room
or temperature
Dry cotton swab should be air dried and sent
Condoms dry In normal paper packing Room
temperature
Condoms wet Should be tied and sent as soon as possible Under ice within
48 h of collection
Muscle tissues Should be sent in a clean glass bottle/plastic Should be
(about 100 g)/fetus container with 0.9% DNS (normal saline sold in transported under
medical shops) on ice or in a crystal salt (sodium ice
chloride) as a preservative
Tissue/foetus samples should never be preserved
in formalin
Bloodstains In normal paper packing Room
temperature
Weapons In normal paper packing Room
temperature
(continued)
582 P. Shrivastava et al.
Dont’s
• Completely charred bones and/or ash are not suitable for DNA examination.
• Cut hairs are normally not suitable for DNA examination.
• Contact of soil with any material may be problematic during forensic DNA
analysis.
References
Ahmed HA, MacLeod ET, Hide G, Welburn SC, Picozzi K (2011) The best practice for preparation
of samples from FTA®cards for diagnosis of blood borne infections using African trypanosomes
as a model system. Parasit Vectors 4:68
Banfi G, Salvagno GL, Lippi G (2007) The role of ethylenediaminetetraacetic acid (EDTA) as
in vitro anticoagulant for diagnostic purposes. Clin Chem Lab Med 45:565–576
Bever RA, DeGuglielmo MA (1994) Development and validation of buccal swab collection method
for DNA testing for paternity testing. In: Bär W, Fiori A, Rossi U (eds) Advances in forensic
haemogenetics, Advances in forensic haemogenetics, vol 5. Springer, Berlin, Heidelberg
Collins KA (1998) The laboratory’s role in detecting sexual assault. Lab Med 29:381–385
Huang LH, Lin PH, Tsai KW, Wang LJ, Huang YH, Kuo HC, Li SC (2017) The effects of storage
temperature and duration of blood samples on DNA and RNA qualities. PLoS One 12:e0184692
Johnson P, Williams R (2004) Post-conviction DNA testing: the UK’s first ‘exoneration’ case? Sci
Justice 44:77–82
Kleypas DA, Gossman WG (2019) Evidence collection. In: StatPearls [Internet]. StatPearls Pub-
lishing, Treasure Island, FL. Available from: https://www.ncbi.nlm.nih.gov/books/
NBK441852/
Lebedeva IA, Kulikov EE, Ivanova NV, Poltaraus AB (2000) Mitochondrial DNA sequencing of
human hair shafts stored for long time. Sud Med Ekspert 43:9–14
Magalhães T, Dinis-Oliveira RJ, Silva B, Corte-Real F, Vieira DN (2015) Biological evidence
management for DNA analysis in cases of sexual assault. Sci World J 2015:1. https://doi.org/10.
1155/2015/365674
29 Guidelines for Collection and Preservation of Samples for Forensic DNA Testing 583
Panneerchelvam S, Norazmi MN (2003) Forensic DNA profiling and database. Malays J Med Sci
10:20–26
Weedn VW, Rogers GS, Henry BE (1998) DNA testing in the forensic laboratory. Lab Med
29:484–489
Westen AA, Gerretsen RRR, Maat GJR (2008) Femur, rib, and tooth sample collection for DNA
analysis in disaster victim identification (DVI). Forensic Sci Med Pathol 4:15–21
Zimmermann J, Hajibabaei M, Blackburn DC, Hanken J, Cantin E, Posfai J, Evans TC Jr (2008)
DNA damage in preserved specimens and tissue samples: a molecular assessment. Front Zool
5:18
Quality Control in Forensic DNA Typing
30
Ashish Badiye, Neeti Kapoor, Prachi Kathane, and Ritesh K. Shukla
Abstract
Keywords
Quality control · Chain of custody · Accreditation · Proficiency testing
30.1 Introduction
In criminal and civil trials, DNA is one of the most potential and prime evidence that
plays a vital role in the framing of judgement. Personal identification, determination
of maternity and paternity, and knowing the involvement of personnel, among others
are possible with the invention DNA typing technique. Compared to various others,
the DNA technique in some ways is more authentic. It is also considered as ‘new
gold standard’ of scientific evidence and at times even circumvent other established
evidence such as fingerprints. During the middle 1980s, the DNA technique was
introduced by Sir Alec Jeffreys and his team of the University of Leicester, UK
(Lynch 2003; Ansell 2013).
Forensic DNA analysis may be defined as the process of identification and
individualisation of biological evidence for legal proceedings using DNA technol-
ogy. It is used in both criminal and civil cases. Criminal cases mostly involve
aggravated assault, murder, rape, arson, grievous hurt, robbery, etc. In contrast,
civil cases may include paternity disputes, proof of kinship, custodial disputes, etc.
which may involve DNA typing. It helps establish a link between the suspect, victim
and the crime scene (National Research Council (US) Committee 1992). In every
case, evidence should be handled on a priority basis. It is imperative for every
individual coming in contact with the exhibits to maintain the integrity and authen-
ticity of the evidence. Maintaining the high and uniform standards of quality is
imperious.
Due to dissimilarity in every crime scene and unpredictability of the type of DNA
samples collected from the crime scene, the analysis in Forensic Science
Laboratories is a tough job for the DNA analyst/expert. The quality control
(QC) and quality assurance (QA) processes play a significant role by providing
consistency in results, upgradation of the procedure and tools used for DNA
analysis, enhancement of expert skills and maintenance of instruments employed
for DNA examination. The need and broad scope of quality control in DNA
forensics is illustrated in Fig. 30.1.
‘Quality control’ is the term associated with maintaining the quality of every
small entity that proves its adherence to the said set of programs. The ISO 9000
defines quality control as ‘a part of quality management focused on fulfilling quality
requirements (requirements related to quality)’ (ASQ n.d.). So, it applies to every
section of testing where quality is the prime motto. Whereas, ‘quality assurance’ is
referred to as ‘the systematic and premeditated approach to build confidence among
the service and product, which is required for giving quality result’.
In DNA testing laboratories, quality control is critical because of the vulnerability
to produce false (positive/negative) results. Forensic DNA analysis begins with the
collection of biological evidences and continues until the report is finally admitted in
the court proceedings and has withstood the scrutiny of the defence and the court.
When considering the legal purview, the evidence is never treated directly or sent for
DNA testing. It has to go through the pipeline before reaching the DNA testing
laboratory. In many cases, it first passes through preliminary examination and then
after several procedures, at last, is sent for DNA testing. Hence, the quality control in
30
Quality Control in Forensic DNA Typing
Fig. 30.1 The need and scope of ‘quality control’ in DNA forensics
587
588 A. Badiye et al.
DNA testing is not limited to the quality of the testing laboratory but has to be taken
into consideration during every step of the investigation. Lacking quality control can
lead to the conviction of an innocent and exoneration of the guilty (Balažic and
Zupanič 1999). The defence counsel raises not only the question on the DNA typing
technique but also the procedure and methods used for DNA collection, preserva-
tion, documentation, chain of custody, reporting and even the proficiency of the
analyst/expert (to name a few).
The ‘quality control’ (QC) is the check on routine operational technique followed
by an expert for conducting the DNA analysis. While ‘quality assurance’ (QA) is
referred to as the systematic and premeditated approach to build confidence in the
testing to provide a consistent quality result. Each DNA testing laboratory has a set
of pretested protocols that needs time to time progression/updating and regular
validation of methods and instruments for reliable results. For consistency and
transparencies in result, every DNA lab should undergo a regular audit, proficiency
test, expert and routine training programs for DNA experts, and along with the
accreditation of DNA laboratories (Butler 2005). ‘Validation’ is described as the
procedure followed by the personnel in a laboratory is capable of producing a
vigorous, trustworthy and reproducible results (Butler 2005).
The ‘proficiency test’ is an assessment of a laboratory’s performance in
conducting DNA analysis procedures. These tests may be conducted periodically,
or on a semi-annual basis, for each DNA examiner in the testing laboratory. The
‘ISO/IEC 17043:2010 Conformity Assessment—General Requirements for Profi-
ciency Testing’ standard is used by internationally recognised accreditation bodies to
accredit proficiency test providers. This standard also provides the purpose of
proficiency testing. As per the guidelines of DNA Advisory Board Standard 13.1,
this proficiency test can be performed by two ways, i.e., internal proficiency test and
external proficiency test. In internal proficiency test, the DNA analyst has to undergo
a performance test conducted by some other DNA expert within the lab/organisation/
company. In external proficiency test, the proficiency of the analyst examined by
some other experts belonging to a different organisation. The most effective way of
external proficiency test is when it is performed without the knowledge of DNA
analyst being examined. This type of proficiency test is termed as a ‘blind external
proficiency test’. According to the guidelines, every examiner/analyst handling
DNA examination should undergo a proficiency test within 180 days of service.
The German DNA profiling group (GEDNAP) has built up a productive and
successful blind proficiency-testing program (DNA Box 16.2) (Butler 2005). Fur-
ther, the analyst engaged in DNA analysis must endure a proficiency test based on
new Laboratory Validation Error 393 in typing. This Laboratory Validation Error
393 in typing was proposed by DNA Advisory Board Standards, which was then
recognised as the National Standard in the United States (Butler 2005). In India,
NABL provides the guidelines for the ‘Proficiency Testing Providers’ in accordance
with ISO/IEC standards.
The ‘laboratory audit’ is one of the crucial aspects. It is a systematic examination/
audit that may be performed by the laboratory management (internally) or may be
conducted by calling experts from another independent organisation/laboratory. It is
30 Quality Control in Forensic DNA Typing 589
a substantial and obligatory requirement for the DNA laboratory to keep the audit
record and the course of action undertaken to resolve the points/problems raised by
the audit committee.
The ‘laboratory accreditation’ is the third-party verification related to the
predetermined protocols, instrument performance, personal proficiency and regular
audits of a DNA laboratory. Accreditation of a laboratory is the resulting outcome
from the successful inspection by a recognised body of a country. It is essential to
maintain good lab practices. The ‘accreditation process’ generally involves several
steps such as a ‘laboratory self-evaluation, filing the application and supporting
documents to initiate the accreditation process, on-site inspection by a team of
trained auditors, an inspection report, and an annual accreditation review report’.
The inspection evaluates the facilities and equipment, the training of the technical
staff, the written operating and technical procedures and the casework reports and
supporting documentation of the applicant laboratory (Butler 2005).
Quality control of the samples starts from the crime scene itself. The samples for
DNA testing may be collected from crime scenes, victims, suspects and hospitals.
When collecting the samples, one should follow the proper method, as making
mistakes at this point will cause the failure of the entire procedure.
DNA evidence is collected as blood, hair, bone, teeth, seminal stains, other body
fluids, etc. [7]. The type of material used for collecting this evidence also plays a role
in quality control. The material used for the collection process should be completely
free from any foreign or extraneous substance. The material should be completely
sterile, and its quality should be checked before using it to avoid contamination of
the sample. This can be achieved by manufacturing the material, especially for
collecting DNA evidence under proper guidance. The cotton swab, filter paper,
FTA paper modified cellulose, foam, nylon, polyester and rayon-tipped swabs
used for collecting the evidence should be kept separately and labelled thoroughly
(Eugene 2011). Every sample should be handled carefully to avoid contamination of
original evidence with biological and non-biological samples. Contamination of
evidence with non-biological origin sample may cause failure in results, whereas
contamination with biological origin sample will change the result completely. It
will result in a mixed genotype which will further cause problems in the interpreta-
tion of the result. This can be avoided only by handling the evidence with
precautions, wearing gloves and avoiding mixing of the evidence by keeping them
separate from the time of collection itself (Balažic and Zupanič 1999). Care should
be taken to avoid contamination as well as cross-contamination.
The investigating officer while collecting evidence from the crime scene should
follow some practices like, when the wet sample is collected from the crime scene, it
should be air-dried at room temperature only, and the dried sample should be placed
in the sterile containers. The wet sample must not be ‘blown-upon’ in an attempt to
hasten the drying process, as it might result in the contamination of the swab by the
590 A. Badiye et al.
saliva coming out from the mouth. The control sample, collected from the victims or
suspects, should be stored in the tubes containing anticoagulant EDTA
(ethylenediaminetetraacetic acid), which inhibits the sample degradation (Li 2015).
The syringe used for the collection of samples should be sterile and new. Every
possible effort should be made to avoid contamination of the sample during its
collection, preservation and handling until it reaches the lab. A chain of custody of
evidence log should be maintained. It is necessary that the chain of custody docu-
ment has the record of every transfer made from one person to another person, from
the moment the evidence is collected. This helps in establishing beyond doubt that
nobody else could have accessed the evidence without authorisation. It also serves as
a log of possession or chain of evidence (Badiye et al. 2020) (Fig. 30.2).
30 Quality Control in Forensic DNA Typing 591
Every DNA testing laboratory should follow Quality Assurance Standards for
Forensic DNA Testing Laboratories. The laboratories that perform DNA testing
should always work according to the established standards while considering all the
ways to maintain the quality of the results produced.
30.3.1 Personnel
The laboratory must have qualified DNA analysts who have experience in examina-
tion and testimony. It should have personnel with technical skills and other manage-
rial staff with all required qualifications to complete the assigned work. At the time
of hiring laboratory personnel, they must pass the competency test (to confirm
his/her knowledge about the field). They must then be trained irrespective of their
experience(s), with the updated testing procedures of the laboratory. Based on the
expertise and the accuracy required, individuals may be assigned separate tasks.
The laboratory must have the manuals or SOP (standard operating procedures
booklets) soliciting all the analytical procedures performed during testing for
maintaining the consistency of testing procedures, and the result produced through
it. The laboratory should always follow well established, tested and validated
methodologies for DNA testing. The manual should be regularly maintained and
updated from time to time, considering the accurate testing and innovations in the
field. Along with manual methods, automated or robotic methods should also be
validated. Care should always be taken to evaluate the updated procedure for
maintaining consistency in the result. Every single modification or update to the
software will require a routine check to maintain the integrity of results. Validation
of the procedures adopted should be performed by the laboratory (Butler 2001).
There should be safety manuals for the laboratory personnel. When dealing with
‘unique’ samples, the method may be modified as per the existing literature and/or
experience of the senior analyst. However, the process should be documented and
must be with appropriate justification.
30.3.3 Requirements
Fully equipped lab is the prime requirement for each testing laboratory, including
reagents, apparatus, equipment, personal safety wears, etc. The laboratory should
always use calibrated equipment. All equipment should be sterilised after every use.
The use of reagents should always be according to the written protocol given in the
laboratory manual/SOPs. The reagents that are prepared in the laboratory should also
592 A. Badiye et al.
Each laboratory should have a secure and governed area for evidence storage and
testing materials (FBI n.d.). The samples, when received at the laboratory, should be
appropriately marked using the common standards. The laboratory should also
maintain the chain of custody of every piece of evidence, so that when the report
is presented in the court, it should stand admissible. The evidence at the laboratory
should be accessed by the dedicated personnel only.
Every time only a single sample should be analysed to avoid sample switching. It
should be a common practice to try and avoid analysing the reference and suspected
sample parallelly.
The result obtained should be uniform throughout the testing procedure. Regular
inspection and professional assessments are also the critical factors in maintaining
the testing laboratories. Professional assessments will involve internal and external
testing. Internal testing will comprise of testing within the laboratory, i.e., the same
sample will be tested by multiple personnel to check the consistency of the results.
Whereas in external testing, the samples will be tested by authorised external bodies
to check the consistency and/or variability of the results (Balažic and Zupanič 1999).
The laboratory should always be cleaned before and after the testing procedures.
Care should be taken for not exposing the testing area to direct environment. Primary
as well as secondary transfers must be prevented. The appropriate environmental and
health safety guidelines and norms must be followed while disposing of the
chemicals and waste.
30.3.5 Accreditation
Table 30.1 List of organisations providing accreditation to the forensic DNA testing laboratories
Sr.
No. Name of the body Abbreviation Link Country
1 ANSI National Accreditation Board ANAB https://anab. United
ansi.org/ States of
America
2 American Society of Crime Laboratory ASCLDLAB https:// United
Directors Laboratory Accreditation www.ascld. States of
Board org/ America
3 National Accreditation of Testing NATA https:// Australia
Authority www.nata.
com.au/
4 National Accreditation Board for NABL https://nabl- India
Testing and Calibration Laboratories india.org
5 The American Association for A2LA https:// United
Laboratory Accreditation www.a2la. States of
org/ America
6 United Kingdom Accreditation Service UKAS https:// United
www.ukas. Kingdom
com/
7 New York State Department of Health NYSDOH https:// United
www. States of
health.ny. America
gov/
8 The South African National SANAS https:// South Africa
Accreditation System www.sanas.
co.za/
9 Polish Centre for Accreditation PCA https:// Poland
www.pca.
gov.pl/
10 National Accreditation Authority NAH https:// Hungary
Hungary www.nah.
gov.hu/
11 Czech Accreditation Institute CAI https:// Czech
www.cai.cz/ Republic
12 Standards Council of Canada SCC https:// Canada
www.scc.
ca/
13 Finland Accreditation Service FINAS https:// Finland
www.finas.
fi/
14 Deutsche Akkreditierungsstelle DAkkS https:// Germany
www.dakks.
de/
15 The Spanish Association for AENOR https:// Spain
Standardization and Certification www.en.
aenor.com/
16 Swedish Board for Accreditation and SWEDAC https:// Sweden
Conformity Assessment www.
swedac.se/
(continued)
594 A. Badiye et al.
procedure of quality control. Table 30.1 shows the list of organisations providing
accreditation to the Forensic DNA Testing Laboratories.
Table 30.2 List of global institutions/organisations conducting proficiency tests for the DNA examiners
Sr.
No. Proficiency testing agency Website Proficiency test scheme Country
1 Forensic Foundations https://www.forensicfoundations.com. Forensic Biological Examination and DNA-1. Australia
au/proficiency-testing/2020- 2020-1
proficiency-tests/ Forensic Biological Examination and
DNA-22020-10
Forensic Biological Examination, BPA and
DNA. 2020-7
2 Bode Technology www.bodetechnology.com IQAS Proficiency Test United States
of America
3 Forensic Assurance https://forensicassurance.com/ Forensic Biology United States
of America
4 Collaborative Testing Services http://www.ctsforensics.com/ CTS Forensics Program: DNA Interpretation United States
Quality Control in Forensic DNA Typing
(continued)
Table 30.2 (continued)
596
Sr.
No. Proficiency testing agency Website Proficiency test scheme Country
10 Federal Bureau of Investigation https://www.fbi.gov/ – United States
of America
11 The Scientific Working Group on https://www.swgdam.org/ – United States
DNA Analysis Methods (SWGDAM) of America
12 Serological Research Institute http://www.serological.com/ – United States
of America
13 Central Police Forensic Laboratory http://clkp.policja.pl/ – Poland
14 The GEDNAP (German DNA https://www.gednap.org/ – Germany
profiling group) proficiency testing
system
15 Hungarian Institute for Forensic http://www.nszkk.gov.hu/ – Hungary
Sciences
16 Forenzni DNA Servis http://www.dna.com.cz/ – Czech
17 Central Forensic Science Laboratory, http://cfslhyd.gov.in/ – India
Hyderabad
18 ESR https://www.esr.cri.nz/ – New Zealand
19 Bureau Veritas https://www.bvlabs.com/ – Canada
20 Forensic Proficiency Testing Service https://www.forensic-proficiency.co.uk/ – United
Kingdom
21 Easy DNA https://www.easydna.co.uk/ – United
Kingdom
22 University of Granada—GITAD www.ugr.es DNA polymorphisms in bloodstains and other Spain
biological samples (autosomal, X- and
Y-chromosome, mtDNA); statistical
calculations; mixed stains interpretation
A. Badiye et al.
30 Quality Control in Forensic DNA Typing 597
eliminations as actual evidence. It mainly contains the DNA profile, which has
shown failure and not reported by the laboratory. If the laboratory fails to maintain
the EDB, the wrong profile can be used in the legal proceedings and will adversely
affect the case in hand. These should be evaluated yearly to compare the growth of
the laboratory (Ansell 2013). Figure 30.3 depicts the important points that must be
remembered during the quality control cycle.
The reports generated by the testing laboratories are admissible in the court unless
the questions are raised on its authenticity. The laboratory should maintain every-
thing in writing to support the conclusions drawn through it. The data should be
maintained in hardcopy as well as in softcopy. It should be maintained in a defined
format so that everyone could get it when going through it. It should contain all the
details of the case and the process. The report will contain information including case
identifier/serial number, detailed description of the evidence analysed, description of
the procedures and techniques performed, result or conclusion, interpretation of the
statements made, date issued, disposition of the evidence and lastly the signature of
the expert/authorised person who performed the primary operations in the case. The
laboratory should follow the rules for maintaining the privacy of the evidence and
information related to it. The final report should be verified by more than one person
before dispatch. The reports should never be biased. The laboratory should always
hand over the reports to the concerned authorised person. There should not be any
leakage of the information from the laboratory. The chain of custody should be
maintained throughout the procedure (FBI n.d.).
598 A. Badiye et al.
30.5 Conclusion
In forensic DNA typing setups, ‘Quality control’ is one of the critical components in
ensuring high quality and standards. The path of the evidence from the crime scene
to the courtroom is quite lengthy and intricate. The characteristic unpredictability of
every crime and the biological evidence thus recovered and analysed adds to the
complexity. Different QCs along the whole process shall assist in providing justice
by eliminating the chances of errors and thus being admissible in the court of law.
Maintenance of the chain of custody as well as ensuring quality control measures at
each and every step during the whole investigation shall be given utmost priority and
importance.
Supplementary Materials
Table 30.3 Compilation of some of the validation studies conducted using commercial STR kits,
in-house assays, instrumentation, and software in human identity testing applications
S. No. Kit, Assay, or Instrument Reference
1. 19-locus Y-STR system Daniels et al. (2004)
2. 21-SNP multiplex Dixon et al. (2005)
3. ABI 310 Lazaruk et al. (1998), Isenberg et al. (1998), Moretti
et al. (2001a, b)
4. ABI 3100 Sgueglia et al. (2003), Koumi et al. (2004)
5. ABI 3700 Gill et al. (2001), Koumi et al. (2004)
6. ABI 377 Frazier et al. (1996), Fregeau et al. (1999)
7. Amelogenin LaFountain et al. (1998)
8. AmpFlSTR Blue Wallin et al. (1998)
9. AmpFlSTR Green I Holt et al. (2002)
10. Biomek 2000 with DNA Greenspoon et al. (2004a)
IQ
11. BodeQuant Fox et al. (2003)
12. COfiler LaFountain et al. (2001), Tomsey et al. (2001), Moretti
et al. (2001a, b), Holt et al. (2002), Buse et al. (2003),
Wallin et al. (2002)
13. CompareCalls software Ryan et al. (2004)
14. CTT Budowle et al. (1997)
15. D12S391 Junge and Madea (1999)
16. D3S1358, D8S1179, Potter (2003)
D18S51
(continued)
30 Quality Control in Forensic DNA Typing 599
Table 30.4 Summary of articles published on rapid DNA instruments since 2016
S. No. Instrument STR Primer Set Reference
1. ANDE 6C FlexPlex (6-dye, 27plex Carney et al. (2019)
STR assay)
2. DNAscan/ PowerPlex 16 Turingan et al. (2016), Della Manna
ANDE 4C et al. (2016), Moreno et al. (2017)
3. RapidHIT GlobalFiler Express Date-Chong et al. (2016)
200
4. RapidHIT NGM SElect Express Boiso et al. (2017a, b), Shackleton et al.
200 (2019a, b)
5. RapidHIT GlobalFiler Express Wiley et al. (2017), Salceda et al.
ID (2017), Amick and Swiger (2019)
6. RapidHIT GlobalFiler Express and Buscaino et al. (2018)
ID NGM SElect Express
Adapted from: https://doi.org/10.1016/j.fsisyn.2019.12.002
References
Amick GD, Swiger RR (2019) Internal validation of RapidHIT® ID ACE sample cartridge and
assessment of the EXT sample cartridge. J Forensic Sci 64(3):857–868
Andersen JF, Greenhalgh MJ, Butler HR, Kilpatrick SR, Piercy RC, Way KA, Myhill HS, Wright
JC, Hallett R, Parkin BH (1996) Further validation of a multiplex STR system for use in routine
forensic identity testing. Forensic Sci Int 78:47–64
Ansell R (2013) Internal quality control in forensic DNA analysis. Accred Qual Assur 18:279–289.
https://doi.org/10.1007/s00769-013-0968-9
Applied Biosystems (2003) Quantifiler human DNA quantification kit user’s manual. Applied
Biosystems, Foster City, CA
ASQ (n.d.). https://asq.org/quality-resources/iso-9000
Badiye A, Kapoor N, Menezes RG (2020) Chain of custody (chain of evidence). In: StatPearls.
StatPearls Publishing LLC, Treasure Island, FL. http://www.ncbi.nlm.nih.gov/pubmed/
31869141
Balažic J, Zupanič I (1999) Quality control and quality assurance in DNA laboratories: legal, civil
and ethical aspects. Forensic Sci Int 103:S1–S5. https://doi.org/10.1016/S0379-0738(99)00064-
X
Boiso S, Dalin E, Seidlitz H, Trygg E, Hedman J, Ansell R (2017a) Experiences from operating the
RapidHIT® System and identified issues processing crime scene samples. February 2017 report
from the Swedish National Forensic Centre. Available from: https://nfc.polisen.se/siteassets/
dokument/informationsmaterial/rapporter/nfc-rapport-2017-02_experiences-fromoperating-
the-rapidhit-system.pdf
Boiso S, Dalin E, Seidlitz H, Sidstedt M, Trygg E, Hedman J, Ansell R (2017b) RapidHIT for the
purpose of stain analyses e an interrupted implementation. Forensic Sci Int Genet Suppl Ser 6:
e589–e590
Budowle B, Moretti TR, Keys KM, Koons BW, Smerick JB (1997) Validation studies of the CTT
STR multiplex system. J Forensic Sci 42(4):701–707
Buscaino J, Barican A, Farrales L, Goldman B, Klevenberg J, Kuhn M et al (2018) Evaluation of a
rapid DNA process with the RapidHIT® ID system using a specialized cartridge for extracted
and quantified human DNA. Forensic Sci Int Genet 34:116–127
30 Quality Control in Forensic DNA Typing 601
Buse EL, Putinier JC, Hong MM, Yap AE, Hartmann JM (2003) Performance evaluation of two
multiplexes used in fluorescent short tandem repeat DNA analysis. J Forensic Sci 48
(2):348–357
Butler JM (2005) Forensic DNA typing: biology, technology, and genetics of STR markers, 2nd
edn. Academic Press, London. https://www.elsevier.com/books/forensic-dna-typing/butler/
978-0-08-047061-0
Butler JM (2001) Forensic DNA Typing: Biology and Technology behind STR markers. Elsevier
Academic Press, San Diego
Carney C, Whitney S, Vaidyanathan J, Persick R, Noel F, Vallone PM et al (2019) Developmental
validation of the ANDE rapid DNA system with FlexPlex assay for arrestee and reference
buccal swab processing and database searching. Forensic Sci Int Genet 40:120–130
Clayton TM, Whitaker JP, Fisher DL, Lee DA, Holland MM, Weedn VW, Maguire CN, DiZinno
JA, Kimpton CP, Gill P (1995) Further validation of a quadruplex STR DNA typing system: a
collaborative effort to identify victims of a mass disaster. Forensic Sci Int 76:17–25
Collins PJ, Hennessy LK, Leibelt CS, Roby RK, Reeder DJ, Foxall PA (2004) Developmental
validation of a single-tube amplification of the 13 CODIS STR loci, D2S1338, D19S433, and
amelogenin: the AmpFlSTRIdentifiler PCR amplification kit. J Forensic Sci 49(6):1265–1277
Coticone SR, Oldroyd N, Philips H, Foxall P (2004) Development of the AmpFISTRSEfiler PCR
amplification kit: a new multiplex containing the highly discriminating ACTBP2 (SE33) locus.
Int J Legal Med 118(4):224–234
Cotton EA, Allsop RF, Guest JL, Frazier RR, Koumi P, Callow IP, Seager A, Sparkes RL (2000)
Validation of the AMPFlSTR((R)) SGM plus system for use in forensic casework. Forensic Sci
Int 112(2-3):151–161
Crouse C, Schumm JW (1995) Investigation of species specificity using nine PCR-based human
STR systems. J Forensic Sci 40(6):952–956
Daniels DL, Hall AM, Ballantyne J (2004) SWGDAM developmental validation of a 19-locus
Y-STR system for forensic casework. J Forensic Sci 49(4):668–683
Date-Chong M, Hudlow WR, Buoncristiani MR (2016) Evaluation of the RapidHIT 200 and
RapidHITGlobalFiler® express kit for fully automated STR genotyping. Forensic Sci Int
Genet 23:1–8
Della Manna A, Nye JV, Carney C, Hammons JS, Mann M, Al Shamali F et al (2016) Develop-
mental validation of the DNAscan Rapid DNA Analysis instrument and expert system for
reference sample processing. Forensic Sci Int Genet 25:145–156
Dequeker E, Ramsden S, Grody W et al (2001) Quality control in molecular genetic testing. Nat
Rev Genet 2:717–723. https://doi.org/10.1038/35088588
Dixon LA, Murray CM, Archer EJ, Dobbins AE, Koumi P, Gill P (2005) Validation of a 21-locus
autosomal SNP multiplex for forensic identification purposes. Forensic Sci Int 154:62–77
Eugene T (2011) Sample collection system for DNA analysis of forensic evidence: towards
practical, fully-integrated str analysis. https://www.ncjrs.gov/pdffiles1/nij/grants/236826.pdf
FBI (n.d.). https://www.fbi.gov/file-repository/quality-assurance-standards-for-forensic-dna-test
ing-laboratories.pdf/view. Accessed 30 Mar 2020
Fox JC, Cave CA, Schumm JW (2003) Development, characterization, and validation of a sensitive
primate-specific quantification assay for forensic analysis. Biotechniques 34(2):314–318.
320, 322
Frank WE, Llewellyn BE, Fish PA, Riech AK, Marcacci TL, Gandor DW, Parker D, Carter RR,
Thibault SM (2001) Validation of the AmpFlSTR Profiler Plus PCR amplification kit for use in
forensic casework. J Forensic Sci 46(3):642–646
Frazier RR, Millican ES, Watson SK, Oldroyd NJ, Sparkes RL, Taylor KM, Panchal S, Bark L,
Kimpton CP, Gill PD (1996) Validation of the Applied BiosystemsPrism™ 377 automated
sequencer for forensic short tandem repeat analysis. Electrophoresis 17(10):1550–1552
Fregeau CJ, Bowen KL, Fourney RM (1999) Validation of highly polymorphic fluorescent
multiplex short tandem repeat systems using two generations of DNA sequencers. J Forensic
Sci 44(1):133–166
602 A. Badiye et al.
Fregeau CJ, Bowen KL, Leclair B, Trudel I, Bishop L, Fourney RM (2003) AmpFlSTR Profiler
Plus short tandem repeat DNA analysis of casework samples, mixture samples, and nonhuman
DNA samples amplified under reduced PCR volume conditions (25 microL). J Forensic Sci 48
(5):1014–1034
Gaines ML, Wojtkiewicz PW, Valentine JA, Brown CL (2002) Reduced volume PCR amplification
reactions using the AmpFlSTR Profiler Plus kit. J Forensic Sci 47(6):1224–1237
Gill P, Koumi P, Allen H (2001) Sizing short tandem repeat alleles in capillary array gel electro-
phoresis instruments. Electrophoresis 22:2670–2678
Greenspoon SA, Lytle PJ, Turek SA, Rolands JM, Scarpetta MA, Carr CD (2000) Validation of the
PowerPlex 1.1 loci for use in human identification. J Forensic Sci 45(3):677–683
Greenspoon SA, Ban JD, Sykes K, Ballard EJ, Edler SS, Baisden M, Covington BL (2004a)
Application of the BioMek 2000 Laboratory Automation Workstation and the DNA IQ System
to the extraction of forensic casework samples. J Forensic Sci 49(1):29–39
Greenspoon SA, Ban JD, Pablo L, Crouse CA, Kist FG, Tomsey CS, Glessner AL, Mihalacki LR,
Long TM, Heidebrecht BJ, Braunstein CA, Freeman DA, Soberalski C, Nathan B, Amin AS,
Douglas EK, Schumm JW (2004b) Validation and implementation of the PowerPlex 16 BIO
System STR multiplex for forensic casework. J Forensic Sci 49(1):71–80
Holland MM, Parsons TJ (1999) Mitochondrial DNA sequence analysis - validation and use for
forensic casework. Forensic Sci Rev 11(1):22–50
Holt CL, Buoncristiani M, Wallin JM, Nguyen T, Lazaruk KD, Walsh PS (2002) TWGDAM
validation of AmpFlSTR PCR amplification kits for forensic DNA casework. J Forensic Sci 47
(1):66–96
Isenberg AR, Allen RO, Keys KM, Smerick JB, Budowle B, McCord BR (1998) Analysis of two
multiplexed short tandem repeat systems using capillary electrophoresis with multiwavelength
florescence detection. Electrophoresis 19:94–100
Johnson CL, Warren JH, Giles RC, Staub RW (2003) Validation and uses of a Y-chromosome STR
10-plex for forensic and paternity laboratories. J Forensic Sci 48(6):1260–1268
Junge A, Madea B (1999) Validation studies and characterization of variant alleles at the short
tandem repeat locus D12S391. Int J Legal Med 112(1):67–69
Junge A, Lederer T, Braunschweiger G, Madea B (2003) Validation of the multiplex kit
genRESMPX-2 for forensic casework analysis. Int J Legal Med 117(6):317–325
Juniper I (1999) Quality issues in proficiency testing. Accred Qual Assur 4:336–341. https://doi.
org/10.1007/s007690050377
Kadash K, Kozlowski BE, Biega LA, Duceman BW (2004) Validation study of the TrueAllele
automated data review system. J Forensic Sci 49(4):660–667
Kimpton CP, Oldroyd NJ, Watson SK, Frazier RR, Johnson PE, Millican ES, Urquhart A, Sparkes
BL, Gill P (1996) Validation of highly discriminating multiplex short tandem repeat amplifica-
tion systems for individual identification. Electrophoresis 17(8):1283–1293
Koumi P, Green HE, Hartley S, Jordan D, Lahec S, Livett RJ, Tsang KW, Ward DM (2004)
Evaluation and validation of the ABI 3700, ABI 3100, and the MegaBACE 1000 capillary array
electrophoresis instruments for use with short tandem repeat microsatellite typing in a forensic
environment. Electrophoresis 25(14):2227–2241
Krenke BE, Tereba A, Anderson SJ, Buel E, Culhane S, Finis CJ, Tomsey CS, Zachetti JM,
Masibay A, Rabbach DR, Amiott EA, Sprecher CJ (2002) Validation of a 16-locus fluorescent
multiplex system. J Forensic Sci 47(4):773–785
Krenke BE, Viculis L, Richard ML, Prinz M, Milne SC, Ladd C, Gross AM, Gornall T, Frappier
JRH, Eisenberg AJ, Barna C, Aranda XG, Adamowicz BB (2005) Validation of a male-specific,
12-locus fluorescent short tandem repeat (STR) multiplex. Forensic Sci Int 148:1–14
LaFountain M, Schwartz M, Cormier J, Buel E (1998) Validation of capillary electrophoresis for
analysis of the X-Y homologous amelogenin gene. J Forensic Sci 43(6):1188–1194
LaFountain MJ, Schwartz MB, Svete PA, Walkinshaw MA, Buel E (2001) TWGDAM validation
of the AmpFlSTR Profiler Plus and AmpFlSTRCOfiler STR multiplex systems using capillary
electrophoresis. J Forensic Sci 46(5):1191–1198
30 Quality Control in Forensic DNA Typing 603
Lazaruk K, Walsh PS, Oaks F, Gilbert D, Rosenblum BB, Menchen S, Scheibler D, Wenz HM,
Holt C, Wallin J (1998) Genotyping of forensic short tandem repeat (STR) systems based on
sizing precision in a capillary electrophoresis instrument. Electrophoresis 19(1):86–93
Leibelt C, Budowle B, Collins P, Daoudi Y, Moretti T, Nunn G, Reeder D, Roby R (2003)
Identification of a D8S1179 primer binding site mutation and the validation of a primer designed
to recover null alleles. Forensic Sci Int 133(3):220–227
Levedakou EN, Freeman DA, Budzynski MJ, Early BE, Damaso RC, Pollard AM, Townley AJ,
Gombos JL, Lewis JL, Kist FG, Hockensmith ME, Terwilliger ML, Amiott E, McElfresh KC,
Schumm JW, Ulery SR, Konotop F, Sessa TL, Sailus JS, Crouse CA, Tomsey CS, Ban JD,
Nelson MS (2002) Characterization and validation studies of powerPlex 2.1, a nine-locus short
tandem repeat (STR) multiplex system and penta D monoplex. J Forensic Sci 47(4):757–772
Li R (2015) Forensic biology, 2nd edn. CRC Press, Taylor & Francis Group, Boca Raton
Lygo JE, Johnson PE, Holdaway DJ, Woodroffe S, Whitaker JP, Clayton TM, Kimpton CP, Gill P
(1994) The validation of short tandem repeat (STR) loci for use in forensic casework. Int J Legal
Med 107(2):77–89
Lynch M (2003) God’s signature: DNA profiling, the new gold standard in forensic science.
Endeavour 27:93–97. https://doi.org/10.1016/S0160-9327(03)00068-1
Mandrekar MN, Erickson AM, Kopp K, Krenke BE, Mandrekar PV, Nelson R, Peterson K,
Shultz J, Tereba A, Westphal N (2001) Development of a human DNA quantitation system.
Croat Med J 42(3):336–339
Micka KA, Sprecher CJ, Lins AM, Comey CT, Koons BW, Crouse C, Endean D, Pirelli K, Lee SB,
Duda N, Ma M, Schumm JW (1996) Validation of multiplex polymorphic STR amplification
sets developed for personal identification applications. J Forensic Sci 41(4):582–590
Micka KA, Amiott EA, Hockenberry TL, Sprecher CJ, Lins AM, Rabbach DR, Taylor JA, Bacher
JW, Glidewell DE, Gibson SD, Crouse CA, Schumm JW (1999) TWGDAM validation of a
nine-locus and a four-locus fluorescent STR multiplex system. J Forensic Sci 44(6):1243–1257
Moreno LI, Brown AL, Callaghan TF (2017) Internal validation of the DNAscan/ANDE Rapid
DNA Analysis platform and its associated PowerPlex® 16 high content DNA biochip cassette
for use as an expert system with reference buccal swabs. Forensic Sci Int Genet 29:100–108
Moretti TR, Baumstark AL, Defenbaugh DA, Keys KM, Brown AL, Budowle B (2001a) Valida-
tion of STR typing by capillary electrophoresis. J Forensic Sci 46(3):661–676
Moretti TR, Baumstark AL, Defenbaugh DA, Keys KM, Smerick JB, Budowle B (2001b) Valida-
tion of short tandem repeats (STRs) for forensic usage: performance testing of fluorescent
multiplex STR systems and analysis of authentic and simulated forensic samples. J Forensic
Sci 46(3):647–660
Morley JM, Bark JE, Evans CE, Perry JG, Hewitt CA, Tully G (1999) Validation of mitochondrial
DNA minisequencing for forensic casework. Int J Legal Med 112(4):241–248
National Research Council (US) Committee on DNA Technology in Forensic Science (1992) DNA
technology in forensic science. National Academies Press (US), Washington, DC. 6. Use of
DNA information in the legal system. Available from: https://www.ncbi.nlm.nih.gov/books/
NBK234535/
Nelson MS, Levedakou EN, Matthews JR, Early BE, Freeman DA, Kuhn CA, Sprecher CJ, Amin
AS, McElfresh KC, Schumm JW (2002) Detection of a primer-binding site polymorphism for
the STR locus D16S539 using the Powerplex 1.1 system and validation of a degenerate primer
to correct for the polymorphism. J Forensic Sci 47(2):345–349
Nicklas JA, Buel E (2003) Development of an Alu-based, real-time PCR method for quantitation of
human DNA in forensic samples. J Forensic Sci 48(5):936–944
van Oorschot RA, Gutowski SJ, Robinson SL, Hedley JA, Andrew IR (1996) HUMTH01 valida-
tion studies: effect of substrate, environment, and mixtures. J Forensic Sci 41(1):142–145
Pawlowski R, Maciejewska A (2000) Forensic validation of a multiplex containing nine STRs--
population genetics in northern Poland. Int J Legal Med 114(1–2):45–49
604 A. Badiye et al.
Pestoni C, Lareu MV, Rodriguez MS, Munoz I, Barros F, Carracedo A (1995) The use of the STRs
HUMTH01, HUMVWA31/A, HUMF13A1, HUMFES/FPS, HUMLPL in forensic application:
validation studies and population data for Galicia (NW Spain). Int J Legal Med 107(6):283–290
Potter T (2003) Co-amplification of ENFSI-loci D3S1358, D8S1179 and D18S51: validation of
new primer sequences and allelic distribution among 2874 individuals. Forensic Sci Int 138
(1–3):104–110
Prinz M, Ishii A, Coleman A, Baum HJ, Shaler RC (2001) Validation and casework application of a
Y chromosome specific STR multiplex. Forensic Sci Int 120(3):177–188
Richard ML, Frappier RH, Newman JC (2003) Developmental validation of a real-time quantitative
PCR assay for automated quantification of human DNA. J Forensic Sci 48(5):1041–1046
Ryan JH, Barrus JK, Budowle B, Shannon CM, Thompson VW, Ward BE (2004) The application
of an automated allele concordance analysis system (CompareCalls) to ensure the accuracy of
single-source STR DNA profiles. J Forensic Sci 49(3):492–499
Salceda S, Barican A, Buscaino J, Goldman B, Klevenberg J, Kuhn M et al (2017) Validation of a
rapid DNA process with the RapidHIT® ID system using GlobalFiler® Express chemistry, a
platform optimized for decentralized testing environments. Forensic Sci Int Genet 28:21–34
Sgueglia JB, Geiger S, Davis J (2003) Precision studies using the ABI prism 3100 genetic analyzer
for forensic DNA analysis. Anal Bioanal Chem 376(8):1247–1254
Shackleton D, Gray N, Ives L, Malsom S, Vanhinsbergh D (2019a) Development of RapidHIT® ID
using NGM SElect™ Express chemistry for the processing of reference samples within the UK
criminal justice system. Forensic Sci Int 295:179–188
Shackleton D, Pagram J, Andrews N, Malsom S, Ives L, Vanhinsbergh D (2019b) Development of
enhanced sensitivity protocols on the RapidHIT™ 200 with a view to processing casework
material. Sci Justice 59:411–417
Shewale JG, Nasir H, Schneida E, Gross AM, Budowle B, Sinha SK (2004) Y-chromosome STR
system, Y-PLEX 12, for forensic casework: development and validation. J Forensic Sci 49
(6):1278–1290
Sinha SK, Budowle B, Arcot SS, Richey SL, Chakrabor R, Jones MD, Wojtkiewicz PW,
Schoenbauer DA, Gross AM, Sinha SK, Shewale JG (2003a) Development and validation of
a multiplexed Y-chromosome STR genotyping system, Y-PLEX 6, for forensic casework. J
Forensic Sci 48(1):93–103
Sinha SK, Nasir H, Gross AM, Budowle B, Shewale JG (2003b) Development and validation of the
Y-PLEX 5, a Y-chromosome STR genotyping system, for forensic casework. J Forensic Sci 48
(5):985–1000
Sparkes R, Kimpton C, Gilbard S, Carne P, Andersen J, Oldroyd N, Thomas D, Urquhart A, Gill P
(1996a) The validation of a 7-locus multiplex STR test for use in forensic casework. (II),
Artefacts, casework studies and success rates. Int J Legal Med 109(4):195–204
Sparkes R, Kimpton CP, Watson S, Oldroyd NJ, Clayton TM, Barnett L, Arnold J, Thompson C,
Hale R, Chapman J, Urquhart A, Gill P (1996b) The validation of a 7-locus multiplex STR test
for use in forensic casework: I. Mixtures, ageing, degradation and species studies. Int J Legal
Med 109(4):186–194
Tomsey CS, Kurtz M, Kist F, Hockensmith M, Call P (2001) Comparison of PowerPlex
16, PowerPlex1.1/2.1, and ABI AmpFISTR Profiler Plus/COfiler for forensic use. Croat Med
J 42(3):239–243
Turingan RS, Vasantgadkar S, Palombo L, Hogan C, Jiang H, Tan E, Selden RF (2016) Rapid DNA
analysis for automated processing and interpretation of low DNA content samples. Invest Genet
7:2
Wallin JM, Buoncristiani MR, Lazaruk KD, Fildes N, Holt CL, Walsh PS (1998) TWGDAM
validation of the AmpFISTR Blue PCR amplification kit for forensic casework analysis. J
Forensic Sci 43(4):854–870
Wallin JM, Holt CL, Lazaruk KD, Nguyen TH, Walsh PS (2002) Constructing universal multiplex
PCR systems for comparative genotyping. J Forensic Sci 47(1):52–65
30 Quality Control in Forensic DNA Typing 605
Wiegand P, Budowle B, Rand S, Brinkmann B (1993) Forensic validation of the STR systems SE
33 and TC 11. Int J Legal Med 105(6):315–320
Wiley R, Sage K, LaRue B, Budowle B (2017) Internal validation of the RapidHIT® ID system.
Forensic Sci Int Genet 31:180–188
Wilson MR, DiZinno JA, Polanskey D, Replogle J, Budowle B (1995) Validation of mitochondrial
DNA sequencing for forensic casework analysis. Int J Legal Med 108(2):68–74
Legal Aspects of Forensic DNA Typing
31
Ankit Srivastava, Abhimanyu Harshey, and Pankaj Shrivastava
Abstract
Keywords
Forensics · Criminal justice system · DNA profiling · DNA databank · Legal
perspective · The DNA Technology (Use and Application) bill 2019
31.1 Introduction
The beginning of human civilization and its evolution, from the stone-age to the
modern era, is one of the significant areas of interest in social sciences. Since humans
are the social element, therefore, the civilized society has its value-based rules and
regulations to ensure one’s activities and to protect the rights. In socio-legal terms,
the breach of these rules and regulations is anti-social and is often referred to as a
crime. Although in the legal context, the definition of crime also depends upon the
law of the land. To ensure justice against crime is essential to maintain law and order.
Scientific and technological advancements have greatly influenced the lifestyle of a
common man. It is worthy to note that now technological advances are being used as
a tool of crime. That is the reason, with progressive changes and advances in science
and technology, new trends of crime are also being emerging. The potential of
science in the administration of justice has been well recognized. The information
extracted from the scientific analysis is of the crucial evidential significance. Contri-
bution of the science in a criminal investigation is referred to as forensic science that
is an integral entity of the criminal justice system (CJS) that provides strong
corroborative evidence. Forensics not only provides scientific evidence but has
also helped to exonerate the innocent and thus strengthens the path of fair justice
(Jayewardene 1988; Brown 1998; Sedley 2005).
Adoption of the scientific discoveries and inventions to both life of a common
man and CJS put several considerations to the policymakers. Laws and regulations
that govern the society ensure some fundamental human rights such as the Right to
Privacy and Right to Self-Incrimination. Before the adoption of new scientific
advent, it must be ensured that conventional rules, regulations, and human rights
are intact and are not getting affected. It is of utmost importance to create balance
among the newly developed technique and traditional and constitutional rights, e.g.,
Right of Privacy and Right of Self-Incrimination (Kirby 2001; Walsh 2005).
Sometimes, it is impossible to optimally utilize the scientific advances without the
breach of human rights; therefore, any other legislation or modification to the
existing regime is required. At the end of policymakers, it is essential to reduce
the possibilities of misuses of technology and new rules and regulation against the
public interest.
Research and development echelon of forensic genetics raised several new
possibilities with the discovery of the deoxyribonucleic acid (DNA). DNA technol-
ogy has efficaciously contributed as strong corroborating evidence in the court of
law (Kirby 2001; Adhikary 2007; Kumar et al. 2016).
The discovery of DNA, in 1950, tagged DNA as the universal genetic material that
inherits from one generation to another. With time, the technique of DNA profiling
has been revolutionized with the introduction of several technological
31 Legal Aspects of Forensic DNA Typing 609
developments. Many developments are going onwards, but it is notable that from
restriction fragment length polymorphism (RFLP) to the short tandem repeat (STR)
and next-generation sequencing (NGS), fundamental principle, i.e., DNA is a unique
genetic code that can demonstrate the genealogy, remains the same (Butler 2015a).
The advent and result oriented increasing use of DNA fingerprinting has broadly
influenced the criminal justice system. In 1985, it was an immigration dispute (a civil
dispute) in which DNA technology was applied for the first time. However, in 1986,
the case of Colin Pitchfork was the first criminal case that was decided on the
grounds of DNA evidence. Endeavors of Prof. Alec Jeffrey of Leicester University,
UK, resulted in the identification of the culprit (Colin Pitchfork Case, 1986) in
England. In this case, DNA also served as an evidential tool corroborating the
acquittal of an innocent (Jeffreys et al. 1985; Jobling and Gill 2004).
Development of polymerase chain reaction (PCR) and STR-based DNA analysis
significantly contributed to a forensic DNA analysis. Since, many times the
biological sample (source of DNA) undergoes several adverse conditions (such as
exposure to the high temperature, humidity) followed by degradation as well as the
sample may present in minimal quantity. These techniques enabled the generation of
DNA profiles from the degraded samples, thus countered the problem. DNA
phenotyping is an emerging trend in forensic genetics, attracting experts and
scientists across the globe (Edwards et al. 1992; Butler 2015a; Shrivastava et al.
2016).
The ‘establishment of event or linkage to crime’ is referred to as the body of crime
for what the term corpus delicti is often used in forensics and legal proceedings. It
requires the establishment of personal identity. Several methods such as fingerprints,
anthropometry and poroscopy are well-recognized and -accepted practices for per-
sonal identification. Identification from skeletal remains, body fluids, and mutilated
bodies presents limitations to the techniques described above. DNA typing has the
potential to counter these limitations with a high level of accuracy. Enormous aid of
DNA to the criminal investigation has designated it as a “new gold standard” in
forensic science (Lynch 2003; The Royel Society and The Royel Society of
Edinburgh 2017; Wrobel et al. 2018).
DNA analysis has provided scientific evidence beyond reasonable doubt and
played a vital role in the administrations of justice in various criminal and civil
cases. The DNA report has produced the grounds indicating the innocence of a
suspect or a person who has wrongfully convicted. Project Innocence is the demon-
stration that DNA cogent gateway to the fair justice (Shrivastava et al. 2016;
Steinback 2007; Goswami and Goswami 2018).
Human trafficking, child abuse, illegal adoption, etc. are some significant
concerns to law enforcement agencies. DNA has found to be a useful tool for
identification and rehabilitation. DNA PROKID is a project initiated by the Univer-
sity of Granada Genetic Information Laboratory, Spain, with the support of the
Government of Spain, in 2006, with the prime objective of the identification and
rehabilitation of the potential victims of human trafficking, i.e., children and women.
Questioned and reference databases are being generated with the help of DNA
PROKID Kit under this project. DNA PROKID kit offers a simple collection of
610 A. Srivastava et al.
Science, National Research Council of USA 1992; Kunkel 2018). This chapter looks
toward the painstaking attempts of the judiciary members and policymakers to keep
the balance between the rights and the technology. Indian legislative perspective of
the DNA evidence becomes significant as the government of India is in the process
of enacting the bill.
The court evaluates the admissibility of the scientific information before including
it. In the USA, the assessment of the reliability of the evidence initiated in 1923 when
the court, in United States v Frye,1 denied to relay upon the lie detector evidence and
stated that the relevant scientific community had not accepted the technology. The
court emphasized that the technique, procedure, or scientific principle deducing the
expert testimony must be sufficiently established in the particular field. To keep
adverse scientific evidence out of the trial, prosecution and defense pleaded in the
light of Frye standard. In brief, the Frye standard identifies the particular field into
which the discovery or scientific principle may be categorized and acceptance of the
principle, invention, or experimental procedures within the concerned scientific
community (Committee on DNA Technology in Forensic Science, USA Board of
Biology, Commission on Life Science, National Research Council of USA 1992).
It is notable that theoretically, the role of the court is limited to the assessment for
the acceptance of scientific technique underlying the evidence in the concerned
regime and reliability of scientific technology for the intended purpose. When
selecting the expert from forensic genetics, due to its complexities, the role of the
court becomes essential and critical. While dealing with the DNA evidence, admis-
sibility is judged on the validity of assumption, i.e., DNA is a unique genetic code
(except for the identical twins), the used procedure allows the profiling of the DNA
samples, and available databank and statistical methods enable the assessment of the
match probability. Acceptance of these assumptions is followed by the evaluation of
the procedure performed in the particular case in compliance with the available
standards. Frye standard delineates rejection of the DNA evidence extracted from the
improper and substandard practice even if DNA profiling is well established and
accepted in the scientific domain.
Despite the reliability of DNA typing, its admissibility was successfully
challenged in the court of law. In 1976, People v Kelly,2 held in California court,
was a landmark decision concluding that correct scientific procedures were exercised
must be demonstrated by the proponent of the evidence. People v Castro3 is another
flagship case which did not accept the DNA evidence due to the flawed practice of
1
293 F 1013 (DC Cir 1923).
2
144 Misc2d 955 NVS 22 d 985 (Sup Ct 1989).
3
545 N.Y.S.2d 985 (Sup. Ct.1989).
612 A. Srivastava et al.
the technique. People v Castro also emphasized that the admissibility not only
requires the correct procedures to be used but also the assurance that the correct
procedure was performed correctly. DNA evidence was rejected by the appellate
court for the first time in 1989 when the Supreme Court of Minnesota deduced that
compliance of the laboratory with available proper standard and testing data is the
foundation on which admissibility of the evidence rests. The quality of the
procedures followed hereby decides the probative force of the evidence. California
Court of Appeals made a significant remark that admissibility of the evidence, as per
Frye standard, requires technique used to be supported by a clear majority of the
experts of concerned filed rather than unanimity of views on support (Adhikary
2007).
4
113 S Ct 2786 (1993).
31 Legal Aspects of Forensic DNA Typing 613
account. Though, the comparison of scientific evidence with other evidence should
be made to assess the justifiability of differential treatment of scientific evidence
(Adhikary 2007).
‘Convicted by Juries, Exonerated by Science’ project unmarked the error in
28 cases by exonerating the previously convict of rape or murder by means of
DNA testing. In most cases, DNA evidence served as evidence discovered after
the trial. DNA tests were conducted independently, and in some cases, results from
DNA tests were sent to another laboratory for cross-validation. Authorities asked for
the preservation of the evidence for further testing since the previous examination
destroyed the sample or proof. Furthermore, in some cases, in compliance with the
chain of custody was observed to be broken, and thus, the integrity of the investiga-
tion was put into the peril. This project also emphasized the establishment of the
criteria for the inclusion and reliability of the eyewitness. The literature recommends
that the reliability of eyewitness testimony (pros and cons) should be tested with the
use of expert testimony (National Department of Justice (NIJ) Research Report, US
Department of Justice 1996).
Accreditation and quality control are two points that have been asked by the
judiciary. The National Research Council found that the adequacy of laboratory
procedures and its compliance with standards and competence of experts are always
questionable. Consequently, the National Research Council has emphasized the
need for external accreditation. In 1988, the Technical Working Group on DNA
Analysis Methods (TWGDAM), consisting of forensic DNA experts of government
and private sector from the USA and Canada, was established under the sponsorship
of FBI laboratory division. TWGDAM issued guidelines from time to time (in 1989,
1991, and 1995) for the quality assurance of DNA analysis. In 1991, joint House and
Senate Congressional hearings recommended the federal legislation by recognizing
the application of DNA technology for criminal identification and the need for
procedural and quality control standards for the DNA test (Adhikary 2007).
Enactment of DNA Identification Act 1994, led the establishment and improve-
ment of the Forensic DNA testing laboratories through the provided grants. In 1995,
the DNA Advisory Board (DAB) was established and funded to formulate DNA
testing standards under the provisions of this act. This bill also emphasized the
national DNA profile indexing of convicted offenders. During the tenure of Nobel
Laureate Dr. Joshua Lederberg, in 1998, DAB published Quality Assurance
standards for Forensic Testing Laboratories. Under the chairmanship of Dr. Arthur
Eisenberg, DAB finalized and produced Quality Assurance Standards for Convicted
Offender DNA Databasing Laboratories. The director approved both the measures of
the FBI. This act is the legal framework of DNA testing and database in the USA,
and these standards ensure high-quality testing (Committee on DNA Technology in
Forensic Science, USA Board of Biology, Commission on Life Science, National
Research Council of USA 1992).
614 A. Srivastava et al.
“What our committee found is that, although there are many dedicated and skilled forensic
professionals, the quality of practice in the forensic disciplines varies widely, and the
conclusions reached by forensic practitioners are not always reliable. From my vantage
point, the response to the Report has been very positive, and I have seen a groundswell of
support in favor of major reforms to correct the ills of the forensic science community. If
courts blindly follow the precedent that rests on unfounded scientific premises, this will lead
to unjust results. When scientific methodologies once considered sacrosanct are modified or
discredited, the judicial system must accommodate the changed scientific landscape.”
(Edwards 2010)
DNA profiling was first applied in England in 1986 for the investigation of a criminal
case. It not only apprehended the culprit but also saved the innocent. The legal
foundation in the UK classifies blood as an intimate sample, and therefore, consent is
needed for sample collection (certain conditions are an exception where sample
616 A. Srivastava et al.
could be collected against the consent, e.g., testing for diseases such as HIV) and
thus protects the privacy. On the other hand, the law designates buccal scrapes and
hair roots as a non-intimate sample; therefore, sample could be collected by force if
necessary. As per the recommendations of the Royal Commission on Criminal
Justice 1993, police should be allowed to collect non-intimate samples from
suspects. Forensic Science Service contributed efficaciously to the feasible estab-
lishment of the National DNA Database (NDNAD).
In 1994, with enacting the Criminal Justice and Public Order Act, the legal
foundation for the National DNA database was established. This act authorized the
police to collect the samples from any person charged with any recordable offense
and search for matching the profiles that can be performed. This bill enabled the
collection of DNA samples of arrested individuals and thus makes the investigation
process rapid. It also created a complete record of the active criminal population,
thereby eliminating the innocent as a suspect first. Retention or recording of physical
samples has been subject of debate. The UK is credited as the first country that
established a national DNA database for criminal investigation and detection in
1995. The Criminal Justice and Public Order Act 1994, Criminal Procedure
(Scotland) Act 1995, and Police (Amendment) (Northern Ireland) Order 1995
made provision authorizing the retention of the information even if the subject is
not guilty in England (in Wales also), Scotland, and Northern Ireland, respectively.
Earlier, in 2001, White Paper on CJS suggested that in Scotland, there should be
legislative grounds for the retention of voluntarily given fingerprints and DNA
samples. As per the Paper, samples, derived from an individual who has progressed
through the CJS and found to be not guilty, cannot be retained. This reflects the
contrast to the Criminal Justice and Police Act 2000 (UK) that allows the retention of
samples regardless of the aforesaid conditions. White Paper recommended that
sample collection by non-intrusive means does not require any consent. All of
these recommendations were included in the Criminal Justice (Scotland) Bill 2002.
The use of the information derived from the samples or database has been
challenged in the court of law. Earlier, the House of Lords Select committee on
science and technology suggested the formation of an independent body to supervise
the functioning of the database. R v Willoughby is one of the landmark cases in which
the application of the database was pleaded as a contravention of the Criminal Justice
and Police Order Act 1994. As per the provisions of this act, samples should be
destroyed after used, and this information cannot be used for the investigation
purpose. Attempts to calculate statistical probabilities are out of the investigation
sphere (Adhikary 2007; Amankwaa 2019; Christopher and Asplen 2001).
In another case, R (on the application of S) v Chief Constable of South Yorkshire,
the court of appeal distinguished among the “taking,” “retention,” and “use” of
samples, i.e., fingerprints or DNA. The amendment to the Police and Criminal
Evidence Act 1984 as the insertion of section 64(1A) provided the statutory basis
for the retention of the samples. It was pleaded that these amendments are not in
compliance with the provision of protection of privacy that is provided in articles
8 and 14 of the Human Rights Act. The Court of Appeal upheld the legislation
directing the preservation of the samples. Saunders v United Kingdom demonstrates
31 Legal Aspects of Forensic DNA Typing 617
In India, DNA technology was first applied in the case of a paternity dispute. In
1989, the Center for Cellular and Molecular Biology (CCMB) was the first institute
that conducted the DNA test for forensic purposes. Later, in 1998, a specialized
center named as Center for DNA Fingerprinting and Diagnostics (CDFD) was
established to conduct DNA testing for legal purposes. All the Central Forensic
Science Laboratories (CFSLs) and State Forensic Science Laboratories (SFSLs) are
well equipped to perform DNA profiling. Recently, the Government of India has
provided funds to strengthen the DNA facilities in the laboratories. Under this step,
the laboratories are getting strengthened with the all modern sophisticated and
updated instrument. In India, there are two institutions severing DNA testing for
the wildlife forensic purpose that are Wildlife Institute of India (WII) and Laboratory
for the Conservation of Endangered Species (LaCONES) situated at Dehradun and
Hyderabad, respectively. As far as the area of the research is concerned, STR
marker-based studies of the diverse Indian population and studies establishing the
genealogy are current trends (Verma and Goswami 2014; Shrivastava et al. 2019;
Srivastava et al. 2019a, b, 2020; Gupta et al. 2016).
Some existing laws regulate the practice of DNA. The Indian judiciary has
appreciated DNA evidence. DNA has revolutionized the criminal justice system
and played a crucial role in resolving several criminal as well as civil cases. Since the
Indian laws do not anticipate modern technology, contradictions and challenges
arose due to the absence of specific legislation that puts forth a need for it.
The Constitution of India (COI) protects the rights of the citizens. Right to Privacy
and Right against Self Incrimination is defined as fundamental rights under Article
21 and Article 20 (3) of COI (Patel et al. 2013). Maintaining a balance between
618 A. Srivastava et al.
Table 31.1 Legal provision in different countries: at a glance (Law Commission of India,
Department of legal affairs, Govt. of India 2017)
Sr. Subjects of sample Policies over sample Concerning legal
No. Country collection retention foundations
1 Austria Convicted persons, Convicted persons State Police Law
suspects charged of a ‟samples must be (SPG)
serious offences and destroyed when
all crime scene stains individual reaches age
80, suspects samples
are retained despite
suspects” acquittal
[a written request for
destruction must be
submitted]
2 Belgium Persons convicted of a Convicted persons Law of March
“serious offence” and “samples must be 22, 1999
crime scene stains destroyed once DNA Royal Decree of
when ordered by a profile is created, February 4, 2002
prosecutor suspects” profiles
must be destroyed
once the prosecutor
has determined that a
suspects” request for
independent DNA
analysis will not be
granted or when the
result of such request
has been
communicated to the
suspect
3 China Persons convicted of Convicted persons’ The Dangerous
(Hong any “serious samples must be Drugs, Independent
Kong) arrestable offence” destroyed as soon as Commission Against
and all crime scene they are practicable Corruption and Police
stains from such time as Force Ordinance
there is no other Independent
charge against the Commission Against
person in relation to Corruption Ordinance
an offence which Police Force
renders the retention Ordinance
of the sample
necessary and all
proceedings
(including any appeal)
arising out of the
conviction have been
concluded; suspects’
samples must be
destroyed as soon as
they are practicable
12 months after the
sample is taken if they
(continued)
31 Legal Aspects of Forensic DNA Typing 619
technology and constitutional rights is a painstaking task to the judiciary. Selvi v. the
State of Karnataka5 is one of the flagship cases in the history of the Indian judiciary
in which it was decided that the court does not possess an inherent power to direct the
sample collection of an Individual. Further, the court observed that consent becomes
essential if the technique in invasive. Court has more right to order a DNA test in the
criminal case rather than a civil trial. Furthermore, the court finds that if a person
refuses to submit the sample, it cannot be a ground to take an adverse inference. At
the same time, section 114 of the Indian Evidence In 1872 (IEA) directs to draw an
adverse conclusion if a person denies producing a piece of evidence under his
possession (Goswami and Goswami 2018).
The supreme court of India found that, in State of Bombay v. KathiKaluOghad,6
submission of a specimen of finger or foot does, handwriting or signature prints of
palms cannot be considered a breach of the Right to Privacy, and therefore, consent
is not essential. While in the case of BhabaniPrasadJena v. Convener, Secretary,
Orissa State Commission for Women,7 the apex court observed that the court should
decide the important need of the DNA test in search of the truth, on its discretion,
after balancing the rights. The insertion of sections 53-A and 164-A in the Code of
Criminal Procedure (CrPC) by CrPC (Amendment) Act 2005 provisions direct
investigator and the registered medical examination practitioner to conduct the
medical test of a rape victim as well to collect the sample of the accused or culprit
regardless of his consent (Gupta et al. 2016).
In this consonance, few more judgments are there that demonstrate the views of
the Indian judiciary on the Right to Privacy and Right against Self-incrimination.
Neither CrPC nor IEA has provisions directing the sample collection of a minor or
his mother in connection with maternity dispute.8 As per the Court’s observation in
SubayyaGounder v. BhoopalaSubramaniam,9 against the will of the subject, the
court cannot order to give the blood sample. Collection of blood from the veins
cannot be regarded as the breach of Right to Privacy as held by Rajasthan High
5
51. 2010 7 SCC 263.
6
AIR 2014 SC 932).
7
AIR 2010 SC 2851.
8
Venkateshwarlu vs. Saubbayya (AIR 1951 MAD 910).
9
(1959 Cr LJ 1087 MAD).
31 Legal Aspects of Forensic DNA Typing 623
Court.10 A positive view of the court toward the DNA testing in matrimonial cases
may be observed in Sharda vs. Dharmpal11 (Adhikary 2007; Goswami and
Goswami 2018; Law Commission of India, Department of legal affairs, Govt. of
India 2017).
The introduction of DNA technology in Indian courts was initiated with the paternity
dispute. Indian legislation gives a special status to the legitimacy.12 If the husband
fails to prove no access to the wife, the child shall be considered as born from their
legal wedlock as per the provisions of Section 112 of IEA. Actually, in paternity
disputes, special care and discretion are needed to satisfy the rights of the child as
well as the father. DNA reveals the biological truth of the child and may put the right
of a child in peril. Therefore, legitimacy has referred to as conclusive presumption
(with the exception of a particular condition), and the court observed that although
DNA technique is well established and as well as accurate, nonetheless, it is not only
enough to escape from Section 112 of IEA.13 GoutamKundu v State of Bengal14 is a
very famous paternity dispute in India. In this case, the apex court formulated a few
guidelines to conduct the DNA test in complaints with the legal provisions. In brief,
the instructions may be extracted as the DNA test is not a matter of the routine. The
husband must prove no access to the wife as a strong prima facie. The court may
order DNA on its discretion only after deciding that it does not threaten the rights of
children and women. The subject cannot be forced to give a sample, and his refusal
to provide a sample is watched over by Article 20(3) and 21 of COI. But it appears
that the court itself took the way out of these guidelines in N.D. Tiwari v
RohitShekhar.15 These guidelines have supposed to create obstacles in the criminal
investigation. The case studies reveal that with time the court has relied on the
DNAtest. To solicit the scientific advances on legal grounds, Malimath Committee16
has suggested some revision to be incorporated in the Section 112 of IEA (Goswami
and Goswami 2018; Verma and Goswami 2014).
10
SwatiLodha vs. state of Rajasthan (1959 Cr LJ 1087 MAD).
11
2003 4 SCC 493.
12
Yasu vs. Santh (1975, Ker Lt 533).
13
Smt. KaomtiDevi v. Poshiram(2001) 5 SCC 311.
14
1993 (2) Scale 994. O. 6/95.
15
FAO(OS) No. 547/2011.
16
Ministry of Home Affairs, Govt. of India Report, Reforms of Criminal Justice System (2003)
vol 1.
624 A. Srivastava et al.
Several ethical challenges are associated with the practice of DNA. It is of utmost
care to reduce the chances of misuse against the public interest. Specific legislation
provides the statutory grounds for the practice of DNA tests. Standards of examina-
tion, accreditation of the laboratory, qualification of the expert, etc. are some
significant issues that directly influence the reliability of the evidence. With the
emerging technological advances, some concepts such as fabrication and theft of
DNA have arisen (Verma and Goswami 2014; Harshey and Srivastava 2018). The
UK has categorized DNA theft as an offense (Laurie 2003). A DNA profile cannot
distinguish between the genuine and falsely planted samples. In the recent past, a
study demonstrating in vitro synthesis of specific DNA, particularly with any
biological sample, has been reported. A strict guideline for DNA practice is a must
to avoid the misuse of it as well to safeguard to the privacy since DNA databank is
supposed to be a threat to privacy. Care should be there, as it may lead to the
miscarriage of justice (Bolden 2011; Frumkin et al. 2010; Kunkel 2018; Tang et al.
2020). The advent of the assisted reproductive technique (ART) and bone marrow
transplantation (BMT) has posed a need to take special care while conducting the
DNA test (Batch et al. 1968; Gatti et al. 1968; Pope and Chapman 2006; Motluk
2011; Goswami 2015, 2016; Dauber et al. 2004). The need and benefits of the
establishment of a DNA databank along with its ethical concerns have been well
discussed. Databank also bears some ethical issues along with it (Amankwaa 2019;
Guillén et al. 2000; Yadav 2017; Joy et al. 2018; Wallace et al. 2014; Cordner 2001;
García et al. 2017; Machado and Silva 2019; Jakovski et al. 2017).
DNA Profiling Bill 2019 also directs the provisions for the establishment of the
databank. Indian Government machinery is exercising to draft a bill for the DNA
practice since 2003. For several times, the draft framework was criticized as privacy
issues were not properly addressed. In 2019 lower house of Indian Parliament, i.e.,
Lok Sabha, has approved the DNA Technology (Use and Application) Regulation
Bill 2019, and now it is pending in Rajya Sabha that is Upper house. This bill will
provide the statutory basis for the identification of the victim, culprit, missing
person, and unknown dead bodies utilizing DNA profiling. This bill constitutes ten
chapters directing provisions of the DNA Regulatory Board, funding for smooth
operation, the establishment of DNA databank, accreditation procedures, and orga-
nization of a DNA laboratory. This bill also describes the mechanism to secure the
genetic information of the subjects and penalties for the disclosure or misuse of the
data. This bill will strengthen the future pathway of DNA profiling in India on legal
grounds (The DNA Technology 2019).
31.7 Conclusion
Since the development of DNA technology, it has been appreciated and well
believed in the criminal justice system. It reveals that the accuracy of DNA profiling
does not mean that it is infallible. Distinguished care is needed while admitting the
31 Legal Aspects of Forensic DNA Typing 625
DNA as evidence. A number of ethical issues are associated with DNA technology,
posing serious challenges. For the optimal anticipation of the DNA in the criminal
justice system, a need for public awareness has felt. Balancing the rights with
technology is of utmost importance. On reviewing the legal frameworks of different
nations, it is evident that all the countries have erected the law intending to deliver
justice by guarding the fundamental rights and eliminating the chances of miscar-
riage of justice. Legal provision has emphasized the standard procedures to ensure
the reliability of the DNA evidence. Accreditation and the qualification of the expert
are crucial factors while assessing the authenticity of the evidence. In the current
scenario, to strengthen the future perspective, a need for publicly available informa-
tion about the forensic potential of DNA is needed since it will lead to increase
public awareness, followed by increasing the impact of DNA. Along with this, there
are several burning questions, such as whether police should be granted access or not
that are needed to be answered. Legal frameworks anticipating the future perspective
of DNA technology and avoiding substantial threats of criminal justice will increase
its impact in the CJS, and it is likely to be a significant contribution toward humanity.
References
Adhikary J (2007) DNA technology in administration of justice. LexisNexis Butterworths
(a division of Reed Elsevier India Pvt Ltd), New Delhi, India
Alvarez-Cubero MJ, Saiz M, Martinez-Gonzalez LJ, Alvarez JC, Lorente JA (2018) Application of
DNA fingerprinting: DNA and human trafficking. In: Dash HR et al (eds) DNA fingerprinting:
advancements and future endeavors. Springer, Singapore. https://doi.org/10.1007/978-981-13-
1583-1_11
Amankwaa AO (2019) Trends in forensic DNA database: transnational exchange of DNA data.
Forensic Sci Res 5:8. https://doi.org/10.1080/20961790.2019.1565651
Batch FH, Albertini RJ, Joo P, Anderson JL, Bortin MM (1968) Bone marrow transplantation in a
patient with the Wiskott-Aldrich syndrome. Lancet 2:1364–1366
Bolden K (2011) DNA fabrication, a wake up call: the need to reevaluate the admissibility and
reliability of DNA evidence. Georgia State Univ Law Rev 227:1–34
Brown A (1998) DNA as an investigative technique. Sci Justice 38(4):263–265
Bureau of Justice Statistics (1991) Forensic DNA analysis: issues. U.S. Department of Justice,
Bureau of Justice Statistics, Washington, DC, p 4. note 8
Butler JM (2006) Genetics and genomics of core short tandem repeat loci used in human identity
testing. J Forensic Sci 51:253–265
Butler JM (2015a) The future of forensic DNA analysis. Philos Trans R Soc B 370:20140252.
https://doi.org/10.1098/rstb.2014.0252
Butler JM (2015b) U.S. initiatives to strengthen forensic science and international standards in
forensic DNA. Forensic Sci Int Genet 18:4–20. https://doi.org/10.1016/j.fsigen.2015.06.008
Charter of the Subcommittee on Forensic Science, Committee on Science National Science and
Technology Council (2015). Available from: https://www.whitehouse.gov/sites/default/files/
microsites/ostp/forensic-science-subcommittee-charter.pdf
Christopher H, Asplen JD (2001) The application of DNA technology. U.S. Department of Justice.
https://www.ncjrs.gov/pdffiles1/nij/grants/203971.pdf
Committee on DNA Technology in Forensic Science, USA Board of Biology, Commission on Life
Science, National Research Council of USA (1992) DNA technology in forensic science
Cordner S (2001) Ethics of forensic applications and databanks. In: Encyclopedia of forensic and
legal medicine 2. Elsevier Ltd, Amsterdam
626 A. Srivastava et al.
Dauber EM, Dorner G, Mitterbauer M, Wenda S, Fae I, Glock B, Mayr WR (2004) Discrepant
results of sample taken from different tissues of a single individual. Prog Forensic Genet
10:48–49
Dodd V, Laville S (2012) Stephen Lawrence verdict: Dobson and Norris guilty of racist murder.
The Guardian, 03 Jan 2012
Edwards HT (2010) The National Academy of Sciences Report on Forensic Sciences: what it means
for the bench and the bar. Presentation at the Superior Court of the District of Columbia
conference on the role of the courts in an age of developing science & technology, held in
Washington, DC, 6 May 2010. Available from: http://www.law.yale.edu/documents/pdf/
alumni_affairs/stith_edwards_nas_report_forensic_science.pdf
Edwards A, Hammond HA, Jin L, Caskey CT, Chakraborty R (1992) Genetic variation at five
trimeric and tetrameric tandem repeat locus in four human population groups. Genomics 12
(2):241–253
Frumkin D, Wasserstrom A, Davidson A, Grafit A (2010) Authentication of forensic DNA samples.
Forensic Sci Int Genet 4(2):95–103
García O, Crespillob M, Yurrebasoa I (2017) Suspects identification through “familial searching” in
DNA databases of criminal interest. Social, ethical and scientific implications. Rev Esp Med
Legal 43(1):26–34. https://doi.org/10.1016/j.reml.2016.07.003
Gatti RA, Meuwissen HJ, Allen HD, Hong R, Good RA (1968) Immunological reconstitution of
sex linked lymphopenic immunological deficiency. Lancet 2:1366–1369
Goswami GK (2015) The genetic truth of surrogate parentage. Med Leg J 83(4):188–193
Goswami GK (2016) Assisted reproduction and conflicts in rights. Satyam Law International, New
Delhi
Goswami GK, Goswami S (2018) Three decades of DNA evidence: judicial perspective and future
challenges in India. In: Dash HR et al (eds) DNA fingerprinting: advancements and future
endeavors. Springer, Singapore. https://doi.org/10.1007/978-981-13-1583-1_11
GrubbA (1993) Legal aspect of DNA profiling. JFSS 33(4):228–233
Guillén M, Lareu MV, Pestoni C et al (2000) Ethical-legal problems of DNA databases in criminal
investigation. J Med Ethics 26:266–271
Gupta R, Gupta S, Gupta M (2016) Journey of DNA evidence in legal arena: An insight on its legal
perspective worldwide and highlights on admissibility in India. J Forensic Sci Med 2
(2):102–106. https://doi.org/10.4103/2349-5014.184196
Harshey A, Srivastava A (2018) DNA theft, DNA fabrication: serious challenges in ethical practice
of DNA. J Forensic Sci Crim Investig 8(5)
INTERPOL (2009) INTERPOL handbook on DNA data exchange and practice, 2nd edn.
INTERPOL, Lyon
Jakovski Z, Ajanovska RJ, Stankov A, Popska V, Bitoljanu N, Belakaposka V (2017) The power of
forensic DNA database in solving crime cases. Forensic Sci Int Genet Suppl Ser 6:e275–e276
Jayewardene CHS (1988) Forensic science and the law. Forensic Sci Int 36:41–45
Jeffreys AJ, Wilson V, Thein SL (1985) Hyper variable minisatellite regions in human DNA.
Nature 314:67–73
Jobling MA, Gill P (2004) Encoded evidence: DNA in forensic analysis. Nat Rev 5(10):739–751
Joy S, Bastian TS, Selvamani M, Abraham S (2018) Indian-national DNA offender database as tool
for criminal surveillance: need for public debate!!! J Med Radiol Pathol Surg 5:11–14
Kirby M (2001) DNA evidence: Proceed with care. Aust J Forensic Sci 33:9–13
Kumar S, Verma AK, Singh P, Singh R (2016) Current scenario of forensic DNA database in or
outside India and their relative risk. Egypt J Forensic Sci 6:1–5
Kunkel DR (2018) A moratorium on the presentation of DNA evidence. Int Soc Sci Rev 94(3):2
Laurie G (2003) DNA theft: new crime in the UK. Nat Rev Genet 4(8):584
Law Commission of India, Department of legal affairs, Govt. of India (2017) Human DNA
profiling—A draft bill for the use and regulation of DNA-based technology. http://
lawcommissionofindia.nic.in/reports/Report271.pdf
31 Legal Aspects of Forensic DNA Typing 627
Lynch M (2003) Gods signature: DNA profiling, the new gold standard in forensic science.
Endeavor 27(2):93–97
Lynch M, McNally R (2003) “Science,” “common sense,” and DNA evidence: a legal controversy
about the public understanding of science. Public Understand Sci 12:83–103
Machado H, Silva S (2019) What influences public views on forensic DNA testing in the criminal
field? A scoping review of quantitative evidence. Hum Genomics 13:23. https://doi.org/10.
1186/s40246-019-0207-5
Motluk A (2011) Canadian court bans anonymous sperm and egg donation. Nature. https://doi.org/
10.1038/news.2011.329
Murphy E (2017) Forensic DNA typing. Annu Rev Criminol 1:13.1–13.19. https://doi.org/10.1146/
annurev-criminol-032317-092127
National Academy of Sciences (2009) Strengthening forensic science in the United States: a path
forward. National Academies Press, Washington, DC
National Department of Justice (NIJ) Research Report, US Department of Justice (1996) Convicted
by juries, exonerated by science: case studies in the DNA evidence series
Patel N, Gautaman VK, Jangir SS (2013) The role of DNA in criminal investigation – admissibility
in Indian legal system and future perspectives. Int J Humanit Soc Sci Invent 2(7):15–21
Pope S, Chapman H (2006) The effect of bone marrow transplantation on DNA profiles: a case
example. Sci Justice 46(4):231–237
Renewed Charter of the Subcommittee on Forensic Science (2015). Available from: https://www.
whitehouse.gov/sites/default/files/sofs_charter_2012_signed.pdf
Sedley S (2005) Science & justice—DNA and the courts. Sci Justice 45(2):59–60
Shrivastava P, Jain T, Trivedi VB (2016) DNA fingerprinting: a substantial and imperative aid to
forensic investigation. Eur J Forensic Sci 3(3):1–8. https://doi.org/10.5455/ejfs.204929
Shrivastava P, Kaitholiya K, Kumawat RK, Dixit S, Dash HR, Srivastava A, Baroniya Y, Mishra A,
Kushwaha K, Rana M, Dixit A, Sarawgi T, Bhatt A, Sharma H, Sinha M, Chaubey G (2019)
Forensic effectiveness and genetic distribution of 23 autosomal STRs included in
VerifilerPlusTM multiplex in a population sample from Madhya Pradesh, India. Int J Legal
Med 134:1327. https://doi.org/10.1007/s00414-019-02172-4
Srivastava A, Kumawat R, Dixit S, Kaitholia K, Shrivastava D, Yadav VK, Nigam K, Sharma H,
Trivedi VB, Chaubey G, Shrivastava P (2019a) Genetic data for Power Plex 21™ autosomal
and Power Plex 23 Y-STR™ loci from population of the state of Uttar Pradesh, India. Int J Legal
Med 133(5):1381–1383
Srivastava A, Yadav VK, Nigam K, Dixit S, Kumawat RK, Shrivastava D, Shrivastava P (2019b)
Genomic portrait of population of Uttar Pradesh, India drawn with autosomal STRs and
Y-STRs. Forensic Sci Int Genet Suppl Ser 7(1):800–801. https://doi.org/10.1016/j.fsigss.
2019.10.182
Srivastava A, Singh PP, Bandopadhyay A, Singh P, Das D, Tamang R, Chaubey AK, Shrivastava P,
Driem GV, Chaubey G (2020) Genetic and linguistic noncorrespondence suggests evidence for
collective social climbing in the Kol tribe of South Asia. Sci Rep 10:5593. https://doi.org/10.
1038/s41598-020-61941-z
Steinback R (2007) The fight for post-conviction DNA testing is not yet over: an analysis of the
eight remaining holdout states and suggestions for strategies to bring vital relief to the wrong-
fully convicted. J Crim Law Criminol 98(1):8
Tang J, Ostrander J, Wickenheiser R, Hall A (2020) Touch DNA in forensic science: the use of
laboratory created eccrine fingerprints to quantify DNA loss. Forensic Sci Int Synergy 2:1–16.
https://doi.org/10.1016/j.fsisyn.2019.10.004
The DNA Technology (use and application) regulation bill (2019). Retrieved from: http://164.100.
47.4/billstexts/lsbilltexts/PassedLokSabha/142C_%202018_LS_Eng.pdfhttps://pib.gov.in/
Pressreleaseshare.aspx?PRID¼1559099
The Royel Society & The Royel Society of Edinburgh (2017) Forensic DNA analysis: a primer for
the court. ISBN: 978-1-78252-301-7. https://royalsociety.org/about-us/programmes/science-
and-law
628 A. Srivastava et al.
Verma SK, Goswami GK (2014) DNA evidence: current perspective and future challenges in India.
Foensic Sci Int 241:183–189
Virkler K, Lendev IK (2009) Analysis of body fluids for forensic purposes: from laboratory testing
to non-destructive rapid confirmatory identification at a crime scene. Forensic Sci Int 188:1–17
Wallace HM, Jackson AR, Gruber J, Thibedeau AD (2014) Forensic DNA databases ethical and
legal standards: a global review. Egypt J Forensic Sci 4:57–63
Walsh SJ (2005) Legal perceptions of forensic DNA profiling: Part I. A review of the legal
literature. Forensic Sci Int 155:51–60
Wrobel K, Doroz R, Porwik P, Bernas M (2018) Personal identification utilizing lip print furrow
base pattern. A new approach. Pattern Recognit 81:585–800. https://doi.org/10.1016/j.patcog.
2018.04.030
Yadav PK (2017) Ethical issues across the different field of forensic science. Egypt J Forensic Sci 7
(1):10
DNA Databases
32
Anna Barbaro
Abstract
Keywords
Database · DNA · YHRD · X-STR · STRbase · EMPOP
32.1 Introduction
A. Barbaro (*)
Department of Forensic Genetics, Studio Indagini Mediche E Forensi (SIMEF), Reggio Calabria,
Italy
Worldwide Association of Women Forensic Experts (WAWFE), Reggio Calabria, Italy
e-mail: [email protected]
Since years, STR analysis is routinely used for human identity testing: new loci and
new systems are continuously studied and validated by forensic scientists. In July
1997, the Applied Genetics Group of the National Institute of Standards and
Technology created the STRBase (available at www.cstl.nist.gov/biotech/strbase)
that became an important resource for the forensic community because it contains
updated information about commonly used STRs (Butler and Reeder 1997; Ruitberg
et al. 2001; Butler 2008) (Fig. 32.1).
It also includes several sections with information about commercial multiplex,
PCR primers sequences, observed alleles or “off-ladder” alleles, new microvariant,
and mutation rates. In addition, data about available typing technologies, population
studies, quality assurance, and validation procedures are provided. A list of STR
references with relevant web links and addresses of forensic experts is also reported.
Additional sections include information about non-traditional DNA markers (SNPs
and mt-DNA) and non-human DNA resources.
The database represents now the result of international collaborative efforts to collect
population data: by October 2017, Y-HRD contains more than 197,100 of 9-loci
minimal haplotypes, 39,414 23-locus haplotypes, and 22,832 Y-SNP profiles, from
Asia, Europe, Latin America, North America, Africa, and Oceania/Australia. In
addition, the database provides advanced tools for the calculation of likelihood
ratio (LR) of patrilineal relationships and for Y-STR mixture calculations.
The analysis of X-chromosome (ChrX) markers may support autosomal and Y-STR
typing especially in complex kinship cases. While ChrY markers do not recombine
during meiosis, for ChrX markers, the localization is relevant because all loci are
placed on the same chromosome within an area of 240 cM. Physical and genetic
localization of chromosome X loci are related, but not linearly; this implies that
working with X-STRs requires an exact knowledge about their genetic localization
because the possibility of a crossing-over is directly related to the genetic distance
between markers. Hence, loci are often linked and exhibit linkage disequilibrium.
Thus, X-STR markers are clustered into linkage groups, and each set may be
considered as a haplotype (Hering et al. 2006; Szibor 2007; Szibor et al. 2003).
Haplotype frequencies are estimated by the number of observations in a popula-
tion sample: if two or more STRs loci are analyzed, the count of haplotypes may
include up to thousand possible haplotypes. A X-chromosome 2.0 database (ChrX-
STR.org) freely accessible online (http://www.chrx-str.org/) was launched in 2006
by the Forensic ChrX Research Group in order to provide a reference database for
ChrX STR haplotypes (Fig. 32.3). It includes published population data from several
countries and information about the most commonly used X-STRs multiplexes and
commercial software packages (Szibor et al. 2006).
Since years, mitochondrial DNA (mt-DNA) is used to study several genetic diseases,
to map out ancestry and migration during years, but also to analyze variations
between human and other species in order to find any relationships between them.
Mt-DNA is also useful, in forensics, for the analysis of scarce or high degraded
samples, because it is available in several copies per cell, while nuclear DNA has
only two copies per cell. In addition, while nuclear DNA is inherited from father and
mother to the offspring, mitochondrial DNA is passed through maternal lineage, so it
can be used when a direct comparison with a person is not possible because any other
individual from the maternal line may give a reference sample. Obviously, this
means that the analysis of mt-DNA is not enough for identification purposes.
A common problem with mt-DNA is the heteroplasmy that consists in the
co-existence in an individual of different mitochondrial DNA types, generally
differing at only one base (Butler 2009). This must be accurately evaluated during
data interpretation in order to avoid wrong exclusions. Many collaborative studies
showed that several errors may occur during mt-DNA analysis or data interpretation
(i.e., nomenclature inconsistencies, sample mix-up), so the European DNA Profiling
Group (EDNAP) on October 16, 2006, launched online a EDNAP forensic mt-DNA
population database (EMPOP) with the aim to develop the standards for data
generation, analysis, and quality control (Parson and Bandelt 2007; Parson et al.
2014; Parson and Dür 2007).
The database is maintained and updated by the Institute of Legal Medicine of
Innsbruck (Austria), and it is freely accessible online at www.empop.org (Parson
and Dür 2007; Prieto et al. 2011; Roewer and Parson 2015) (Fig. 32.4). Mitochon-
drial DNA databases are the basis for frequency estimations of mt-DNA haplotypes,
and hence, they are useful for calculating the probability of a match by determining
the frequency of a given haplotype in a population. The EMPOP database now
comprises 5173 mt-DNA sequences from worldwide populations sent by
laboratories participating in some collaborative exercises: among them, 4527
sequences are forensic data (high quality sequences), and 646 sequences are from
published papers. The majority of the sequences in the database are from Western
Eurasian populations, less data are from East Asian, South East Asian, and
Sub-Sahara African populations, but data are continuously increasing. The database
includes also a section that provides some software packages for mt-DNA analysis,
data interpretation, and quality control.
634 A. Barbaro
All data generated by the SNPforID consortium are freely available online on the
SNPforID browser (http://spsmart.cesga.es/snpforid.php) that is a public accessible
database launched in 2005 and maintained by the Institute of Legal Medicine from
the University of Santiago de Compostela (Spain) (Amigo et al. 2008) (Fig. 32.5).
The database allows to search and review SNP allele frequencies from several
populations, and in addition, it permits the combination of populations in groupings,
the comparison between populations individually or among groupings or with
equivalent HapMap data.
During years national DNA databases have become very efficient tools during
criminal investigations for providing information about unknown individuals with
the aim to identify the author of a crime. Originally developed for sexual assault
caseworks, DNA databases have been extended to all criminals, because it was
observed a majority of crimes are committed by repeat offenders.
The utility of a DNA database consists of the possibility to link crimes or
criminals who are not directly related to a specific case and to prevent further crimes
committed by the same persons. The first governmental database was established in
the United Kingdom in April 1995, the second one in the same year in New Zealand,
and the third one in France in 1998 (Schneider and Martin 2001, Linacre 2003). In
USA, the DNA Identification Act of 1994 authorized the creation of the USA
National DNA database (CODIS) that was launched in 1997 by FBI. CODIS
software allows comparisons of DNA profiles at different levels (national, statal
and local) in accordance with actual laws.
636 A. Barbaro
For the inclusion in CODIS, DNA profiles must be analyzed following the FBI
Director’s Quality Assurance Standards and the guidelines of the Scientific Working
Group on DNA Analysis Methods (SWGDAM). In Europe, the DNA working group
of the European Network of Forensic Sciences Institutes (ENFSI) has developed
recommendations for DNA databases management, describing all criteria required
for including or deleting DNA profiles (ENFSI 2009/2010). Many countries have
implemented their DNA analysis programs for database generation, according to
guidelines of coordinating bodies or DNA working groups.
Generally, a national database includes a section with DNA profiles of several
categories of persons such as convicted persons, suspects, arrestees, and sometimes
also volunteers. In another section of the database, DNA profiles of the evidences
recovered at the crime scene are stored. Obviously, this may change in different
countries according to their law. Database access is obviously exclusive for police
purposes, and there are strong penalties for anyone different from the law enforce-
ment, using information or samples for other purposes. To assure respect of privacy
and security of the information, the database does not contain any information about
samples donor or about the criminal case.
The software is able to perform multiples comparisons so as to determine if an
evidence profile matches with any known donor. In case of a match, a new DNA
sample from the suspect is required for performing a confirmation test. After a match
confirmation, evidence test laboratory is notified and may exchange additional
information and case details with the central laboratory. If there is not any match
between the evidence profile and the reference profiles, then the evidence profile is
compared with DNA profiles of samples coming from other unsolved crimes, to
verify if the same person (even if unknown) is the author of different crimes.
In USA, 13 loci (D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539,
D18S51, D21S11, CSF1PO, FGA, TH01, TPOX, and vWA) were initially required
for inclusion of a reference profile in CODIS. In 1999, the ENFSI (European
Network of Forensic Science Institutes) DNA Working proposed a European Stan-
dard Set (ESS) of seven loci (TH01, vWA, FGA, D21S11, D3S1358, D8S1179, and
D18S51) as a minimum number of markers required to allow comparison of DNA
profiles between different European countries. This proposal was accepted and
confirmed by the EU-Council resolution no. 2001/C 187/01.
In 2009, following to the Treaty of Prüm, that enabled all 27 EU countries to
exchange DNA profiles, ENFSI recommended the extension of the European Stan-
dard Set of Loci (ESS) including five additional loci, with the aim to reduce false
matches in case of massive data exchange. This proposal was accepted and con-
firmed by the resolution of the European Council no. 2009/C 296/01. In order to
favorite the amplification of degraded/low DNA samples, it was established to
include between the five new core loci, also three new miniSTR loci (D10S1248,
D2S441, D22S1045).
In 2012, in USA, FBI also proposed the expansion of the original CODIS core
loci from 13 to 20 loci with the aim to increase international compatibility and the
discrimination power. In particular, in 2015 it was decided to include the five ESS
loci (D1S1656, D2S441, D10S1248, D12S391, and D22S1045) plus D2S1338 and
32 DNA Databases 637
References
Amigo J, Phillips C, Lareu M, Carracedo A (2008) The SNPforID browser: an online tool for query
and display of frequency data from the SNPforID project. Int J Legal Med 122(5):435–440
Budowle B, van Daal A (2008) Forensically relevant SNP classes. BioTechniques 44:603–610
Butler JM, Reeder DJ (1997) STRBase: a short tandem repeat DNA database for the DNA typing
community. Profiles in DNA, Promega Corporation, Volume 1, No. 2, p. 10
Butler JM (2008) New resources for the forensic genetics community available on the NIST
STRBase website. Forensic Science International: Genetics Supplement Series (Progress in
Forensic Genetics 12) 1(1):97–99
Butler JM (2009) Fundamentals of Forensic DNA Typing. Academic Press, Elsevier, London
Butler JM, Coble MD, Vallone PM (2007) STRs vs. SNPs: thoughts on the future of forensic DNA
testing. Forensic Sci Med Pathol 3:200–205
DNA-Database Management Review and Recommendation ENFSI DNA Working Group—April
(2009/2010)
Gill P, Werrett DJ, Budowle B, Guerrieri R (2004) An assessment of whether SNPs will replace
STRs in national DNA database: joint considerations of the DNA working group of the
European Network of Forensic Science Institutes (ENFSI) and the Scientific Working Group
on DNA Analysis Methods (SWGDAM). Sci Justice 44:51–53
Hering S, Augustin C, Edelmann J, Heidel M, Dressler J, Rodig H, Kuhlisch E, Szibor R (2006)
DXS10079, DXS10074 and DXS 10075 are STRs located within a 280-kb region of Xq12 and
provide stable haplotypes useful for complex kinship cases. Int J Legal Med 120:337–345
Linacre A (2003) The UK national DNA database. Lancet 361:1842
Parson W, Bandelt HJ (2007) Extended guidelines for mtDNA typing of population data in forensic
science. Forensic Sci Int Genet 1(1):13–19
Parson W, Gusmao L, Hares DR, Irwin JA, Mayr WR, Morling N, Pokorak E, Prinz M, Salas A,
Schneider PM, Parsons TJ (2014) DNA Commission of the International Society for Forensic
Genetics: revised and extended guidelines for mitochondrial DNA typing. Forensic Sci Int
Genet 1(1):13–19
Parson W, Dür A (2007) EMPOP-a forensic mtDNA database. Forensic Sci Int Genet 1(2):88–92
Prieto L, Zimmermann B, Goios A, Rodriguez-Monge A, Paneto GG, Alves C, Alonso A,
Fridman C, Cardoso S, Lima G, Anjos MJ, Whittle MR, Montesino M, Cicarelli RM, Rocha
AM, Albarran C, de Pancorbo MM, Pinheiro MF, Carvalho M, Sumita DR, Parson W (2011)
The GHEP-EMPOP collaboration on mtDNA population data—a new resource for forensic
casework. Forensic Sci Int Genet 5(2):146–151
Roewer L, Parson W (2015) Internet accessible population databases: YHRD and EMPOP.
Forensic Biol 311
Roewer L, Krawczak M, Willuweit S, Nagy M, Alves C, Amorim A, Anslinger K, Augustin C,
Betz A, Bosch E, Caglia A, Carracedo KM et al (2001) Online reference database of European
Y-chromosomal short tandem repeat (STR) haplotypes. Forensic Sci Int 118:106–113
Ruitberg CM, Reeder DJ, Butler JM (2001) STRBase: a short tandem repeat DNA database for the
human identity testing community. Nucleic Acids Res 29(1):320–322
Sanchez JJ, Phillips C, Børsting C, Balogh K, Bogus M, Fondevila M, Harrison CD, Musgrave-
Brown E, Salas A, Syndercombe-Court D, Schneider PM, Carracedo A, Morling N (2006) A
638 A. Barbaro
multiplex assay with 52 single nucleotide polymorphisms for human identification. Electropho-
resis 27(9):1713–1724
Schneider PM, Martin PD (2001) Criminal DNA database: the Europe situation. Forensic Sci Int
119(2):232–238
Sherry ST, Ward MH, Kholodov M, Baker J, Phan L, Smigielski EM, Sirotkin K (2001) dbSNP: the
NCBI database of genetic variation. Nucleic Acids Res 29:308–331
Sobrino B, Carracedo A (2005) SNP typing in forensic genetics. In: Carracedo A (ed) Forensic
DNA typing protocols, Methods in molecular biology, vol 297. Humana Press, Totowa, NJ, pp
1064–3745
Szibor R (2007) X-chromosomal markers: past, present and future. Forensic Sci Int Genet 1
(2):93–99
Szibor R, Krawczak M, Hering S, Edelmann J, Kuhlisch E, Krause D (2003) Use of X-linked
markers for forensic purposes. Int J Legal Med 117:67–74
Szibor R, Hering S, Edelmann J (2006) A new web site compiling forensic chromosome X research
is now online. Int J Legal Med 120:252
Willuweit S, Roewer L (2007) Y chromosome haplotype reference database (YHRD): update.
Forensic Sci Int Genet 1(2):83–87
Building of the World’s Largest DNA
Database: The China Case 33
Ausma Bernotaite
Abstract
Started only in 2005, China has already entered 68 million profiles into its
National DNA Database (NDNAD), according to the data presented by
NDNAD governing agency—the Chinese Institute of Forensic Science, Ministry
of Public Security, at the Asian Forensic Sciences Network in September 2018,
Beijing, China. Following the data presented by the same government agency at
the International Society for Forensic Genetics in 2017, Seoul, Korea, the data-
base grew to the said number from a reported 55 million profiles in less than
1 year. This number implies that by the number of profiles entered, the Chinese
NDNAD is by far the largest in the world, followed by 17,530,781 profiles in the
National DNA Index of the United States of America in 2018 and 6,024,032
profiles in the NDNAD of the United Kingdom in 2017. Additionally, National
Missing Children DNA Database was created in 2009 to include genetic data
from parents and their children. While large in the mere count of profiles
included, it currently covers a relatively low percentage of approximately 4.5%
of the Chinese population and has not provided globally comparable match, or
hit, rates for criminal case inquiries. Despite its rapid expansion and swift
adoption of emerging genetic technologies, little effort has been made to share
the developmental details of the database. This chapter serves as a short summary
to trace the development timeline, goals, technological applications, main actors,
as well as the biggest achievements and future plans of the Chinese NDNAD. It is
concluded with the emphasis for the need to ground national databases in strong
socio-legal considerations.
A. Bernotaite (*)
School of Criminology and Criminal Justice, Griffith University, Mount Gravatt, QLD, Australia
e-mail: [email protected]
Keywords
33.1 Introduction
The DNA database has become the most important technological tool in the field of criminal
technology in China. (Zhao et al. 2017)
1
In this chapter, we refer to “China” as the region of Mainland China without the areas of Hong
Kong or Macao, as these areas have independent criminal justice governance mechanisms.
33 Building of the World’s Largest DNA Database: The China Case 641
Technology and big data are becoming increasingly intertwined with our everyday
lives, and this also applies to criminal justice. Digitalized forms of fingerprints,
DNA, facial scans, and criminal records—all of these examples of digitalized
personal data used for policing—are increasingly becoming the standard for efficient
implementation of criminal justice. Following the dramatic drop in cost of the
genetic analysis technologies, forensic DNA databases have boomed in popularity.
A well-managed DNA fingerprinting database is a powerful and cost-effective tool
for untangling crime cases and has been proven to deter crime and reduce crime rates
(Doleac 2017). The most recent global report on the use of DNA profiling published
by Interpol in 2008 reported that 54 countries have national DNA databases and
120 countries use DNA profiling as evidence in criminal investigations (Interpol
Global DNA Profiling Survey 2008). There have been many more databases created,
but there has not been a more recent global summary publication since then. A strong
effort to collect comprehensive information, not only about the presence and size of
DNA databases, but also on the local public discussions around them, has been made
by the Forensic Genetics Policy Initiative—a collaboration of three charity
organizations, namely GeneWatch UK, Privacy International, and the Council for
Responsible Genetics. The organization estimates that there currently are
60 countries with operational and at least 34 with planned DNA databases globally
(The Forensic Genetics Policy Initiative 2018). The same source reports that there
have been proposals of whole-population database creation. Tracy and Morgan
(1999) called this type of DNA database expansion plans “DNA fever” and reasoned
that whole-population databases are a financial burden on the government that does
not provide statistically valuable outcomes. Instead it creates a Big Brother state,
while potentially violating constitutional rights to personal privacy. Following the
growth of forensic database adoption around the world, the scope of public and
academic discussions on this multifaceted topic has also grown.
Just like any complex method of policing, DNA databases require to find the right
balance between ensuring the implementation of justice and individual privacy
protection. While the safety and security of the people in the country is the obvious
goal of all forensic DNA databases, governing authorities must take into account a
variety of intersecting factors of database operation ethics. To explain this in depth,
642 A. Bernotaite
we can revert to the history of the two other DNA databases that are currently second
and third in size after China’s NDNAD. As mentioned in the introduction, the USA
and the UK have the two largest databases in the Americas and Europe, respectively,
not only by their size but also by the percentage of the population covered.
According to the Federal Bureau of Investigation website, the USA, the National
DNA Index had a total of 17,785,074 profiles in October 2018, which is approxi-
mately 5% of the total population (CODIS—NDIS Statistics 2018). The National
DNA Database of the United Kingdom held an estimate of 5,258,600 DNA profile
records in March 2017, the number accounting for an approximate 8% population
coverage; the match rate, or “the chance that a crime scene profile, once loaded onto
NDNAD, matched against a subject profile stored on NDNAD” (National DNA
2018), of the database is high at 66% for the reporting year of 2016/2017 (National
DNA 2018). The National DNA Database in the UK is also the oldest one, and one
that has undergone detailed scrutiny by the public. The UK’s database had allowed
for overly loose profile inclusion regulations, which are now partially addressed by
the state: the Criminal Justice and Police Act 2001 decreased the levels of authority
requirements for taking of DNA samples without consent and eliminated the need to
remove the DNA data and samples collected from the database after the end of
investigation (McCartney 2004). There has been a strong public backlash against the
new regulations, which culminated in the case of S. and Marper v. the UK in the
European Court—the first of its kind. In 2008, the Grand Chamber of the European
Court of Human Rights passed a judgment rule that the law in England and Wales
breached the European Convention on Human Rights. Following the judgment, the
UK removed a total of 7,753,000 DNA profiles (including over 1.7 million DNA
profiles taken from innocent people and from children) from its database without an
observance of reduced crime detection rates (NDNAD 2013). The match rate of the
NDNAD has seen stable increase despite the removal of a large number of profiles
(National DNA 2018). Following the UK NDNAD’s privacy dispute, “a growing
global consensus on the need for legislative provisions for the destruction of
biological samples and deletion of innocent people’s DNA profiles” was gaining
speed (Wallace et al. 2014). A second question brought to the public eye in the recent
years is the issue of racialized inequalities of DNA data inclusion and consecutive
criminalization disproportionately increasing the policing of black men observed but
not resolved (Skinner 2013). Randerson estimated that a staggering number of 77%
of black men between the ages of 15 and 34 years had a profile on the DNA database,
and up to 37% of the total DNA database constituted profiles of black men as
compared to 13% of Asian and 9% of white men (Randerson 2006). Skinner
(2013) raised concerns over potential evidence of racism in DNA profile inclusion
resulting in ethnic monitoring by the police.
In the USA, DNA evidence became increasingly used in the 1980s, but it was not
until 1994 that the Federal Bureau of Investigations formalized the Combined DNA
Index System (CODIS) database, which serves as a joint platform for DNA profile
sharing between states (Deray 2011). In terms of racial inequalities, the USA
database has witnessed criticisms of similar nature as to those of the UK NDNAD:
Cole (1999) traced archival knowledge of black policing in the USA and expressed
33 Building of the World’s Largest DNA Database: The China Case 643
concern over the racial discrimination in the database reproduced by historical racist
biases. A further criticism of the CODIS pointed at the expansive policies of
databasing and referred back to the Marper case against the United Kingdom and
the consecutive ruling of the European Court of Human Rights:
As federal and state legislation in the United States become increasingly expansive,
legislators and law enforcement need to be reminded that just because they have the
technology to do something does not mean they should do it. (Cole 1999)
Despite the public criticisms, the two databases have proven success in assisting
the solving of crimes. In the annual UK NDNAD report (2018), the National DNA
Database Strategy Board provided the following statistics: “In 2016/17 the NDNAD
provided 31,743 routine matches, including to 514 homicides and 612 rapes, and
493 urgent matches, including to 122 homicides and 141 rapes. This is an increase in
the number of matches reported in the previous year, demonstrating the continued
effectiveness of the NDNAD. The percentage of crime-scene profiles which matched
a subject profile on load to the NDNAD (referred to as the match rate) was 66%”
(National DNA 2018). In the USA, the official FBI website provides wider statistics:
“As of October 2018, CODIS has produced over 440,346 hits assisting in more than
428,808 investigations” (CODIS—NDIS Statistics 2018). The joint historical and
modern experiences of the two largest DNA databases, following the Chinese one,
suggest that DNA evidence can serve as an important tool in procedural justice by
enabling the police to bring serious offenders to justice faster as well as ability to
prove suspects innocent. While acknowledging the benefits of DNA databases, it is
also important to recognize the fact that the use of technology does not happen in a
socio-political vacuum. In light of multifaceted considerations of DNA database
ethics, it is of crucial importance that ongoing and transparent efforts are made to
ensure that the genetic databases are managed ethically. To borrow the words from
the Forensic Genetics Policy Initiative mission statement: “An appropriate middle
ground between the legitimate needs of law enforcement and a respect for individual
rights is achievable” (The Forensic Genetics Policy Initiative 2018).
The Chinese DNA databases have grown immensely with the advancement and
scaling of genetic technologies. In the recent years, we have seen more publications
talking about the history of this—now grandiose—public security project. The
process of setting up the database has been top to bottom: led by a small group of
experts from the Ministry of Public Security and then passed down to provincial
public security branches. The initial small DNA database was created to protect
children from going missing—still a serious issue in modern-day China. Ge, Liu,
and Peng (2017) suggest that there have been four main stages of DNA database
development: technological observation, active search of suitable technical DNA
database implementation strategies, promoting its creation, and the stage of rapid
644 A. Bernotaite
development. The authors shared a few landmark events on the road to NDNAD
establishment: the idea to create a “DNA Fingerprinting Database” was first
introduced in a meeting co-organized by the Chinese Ministry of Public Security
and the Ministry of Science and Technology, the second time at “The First Academic
Conference on Forensic Material Evidence,” and was finally decidedly approved for
government use for the Ninth Five-Year Plan, for the years 1996–2000. An IFS
publication echoes the dates and adds commentary on what was exactly achieved in
each year:
With reference to the advanced experience of developed countries, the Physical Evidence
Identification Center, the Ministry of Public Security, first proposed the establishment of an
experimental DNA database in China in 1996. ‘Forensic DNA Quality Control Technology
and DNA Database’ was a complex project that combined quality control and database
technologies. It set the ground for the standardization of forensic DNA testing through
systematic and pioneering research. In terms of quality control, the project completed a
standard named ‘Forensic DNA Laboratory Quality Assurance System’ as well as
6 standards for forensic DNA testing and DNA database. (Hu et al. 2003)
Over a seemingly short period of time, China has adopted a wide range of social
surveillance technology measures. While it is the current owner of the largest DNA
database in the world, the personal data collected in China is not limited to that.
Currently available databases include: facial recognition, fingerprint, STR (direct
and familial searches), and Y-STR profile (direct or mass screening) databases. The
databases can then be connected together for various purposes of policing and public
33 Building of the World’s Largest DNA Database: The China Case 645
Picture 33.1 A police station at a crossroads at an Eastern city of Ningbo using a facial recogni-
tion and traffic control robot connected to the digital database and an LED screen displaying the
faces and surnames of people crossing the street on red light
Cases solved
200,000
150,000
100,000
50,000
0
2011 2012 2013 2014 2015 2016
Table 33.1 Percentile population coverage in different provinces and regions of China
Province/ Number Province/region Province/ Number Province/region
region of profiles coverage percent region of profiles coverage percent
Beijing 217,390 1.11% Hubei 1,946,219 3.40%
Tianjin 213,068 1.65% Hunan 2,181,102 3.32%
Hebei 1,352,379 1.88% Guangdong 1,707,206 1.64%
Shanxi 919,004 2.57% Guangxi 1,593,857 3.46%
Inner 354,541 1.44% Hainan 199,495 2.30%
Mongolia
Liaoning 930,050 2.13% Chongqing 1,504,827 5.22%
Jilin 1,003,642 3.65% Sichuan 2,746,677 3.42%
Heilongjiang 1,855,512 4.84% Guizhou 1,553,093 4.47%
Shanghai 58,968 0.26% Yunnan 879,757 1.91%
Jiangsu 2,997,317 3.81% Tibet 2625 0.09%
Zhejiang 1,236,539 2.27% Shaanxi 1,332,932 3.57%
Anhui 2,096,514 3.52% Gansu 981,509 3.84%
Fujian 1,119,043 3.03% Qinghai 224,768 3.99%
Jiangxi 1,596,364 3.58% Ningxia 129,897 2.06%
Shandong 2,392,837 2.50% Xinjiang 2,851,289 13.07%
Henan 4,232,469 4.50%
Picture 33.2 Polymerase chain reaction machines processing thousands of reference samples at
the Center for Applied Forensic Sciences and Technologies in Beijing, China
built (Human Rights Watch 2018). The province of Xinjiang, or the Xinjiang
Uyghur Autonomous Region, is one of the most politically sensitive regions in
China. The region has a large population of Uyghur Muslims, and tensions between
Han and Uyghur ethnicities in the region are common; reported surveillance and
control, peaking in the recent Chinese government recognition of “re-education
camp” establishment for “thought reform” of hundreds of thousands Uyghurs, are
justified by terrorism threats and the need to ensure the safety of the people (Human
Rights Watch 2018). This can be related back to the large percentile coverage of the
Xinjiang overall percentile population coverage (Picture 33.2).
According to the September 2017 presentation of IFS at the International Society
for Forensic Genetics, 23.6% of crime scene samples match a person or another
crime sample when entered into the database for the first time. For the China’s
NDNAD, a clear goal outlined by the government on multiple occasions is to
increase the database match rate between crime case profiles (match rate of
evidence-individual) and profiles in the database by continuously increasing popu-
lation coverage (Bing 2015). Liu Yao, who is a representative of Institute of Forensic
Science, has noted that China is lagging behind the percentile match rates of the UK
and including more DNA profiles into the database would be a strong priority at IFS
(Bing 2015). The author does not explain whether or not these profiles would be
taken from offenders. While talking about the larger structures of running the DNA
648 A. Bernotaite
database, “the assessment of the state of public order has relied on two indicators: the
number of files places on police files (li’an) and the police clear-up rate (po’anlu)”
(Sapio et al. 2017). This partially explains the reasons of assigning high priority to
increasing NDNAD match rate. Besides ethics and financial viability, the ability to
quickly match a crime scene DNA profile to a known person in DNA database would
dramatically cut down on the work of the police, thus raising the statistical value of
police work quality.
Y-STR database was officially announced in September 2012, as a response to
the need for further DNA evidence to solve crime and the statistical conclusion that
most violent crime is being committed by men. Ge et al. (2014) argue that since it is a
well-established fact that men commit the overwhelming majority of violent crimes,
male-specific Y-STR data can be used to rapidly and efficiently identify the
perpetrators of crimes. Y-STR database in China has over seven million entries.
Four main uses of the Y-STR database have been outlined: determining connections
between surnames and Y-STR heritage in regions with little migration, familial
searching using autosomal and Y-STRs to determine the identity of criminals,
determining the inference of source population, analyzing of mixed samples (espe-
cially rape samples with small trace of any present male DNA), and the searching of
missing persons or the relatives of missing persons (Ge et al. 2013). Determining
statistically significant connections between Y-STR data and surnames, as well as
being able to determine the inference of source population still need a lot published
research from different areas in China. Currently, Y-STR database is identified as
particularly important because genetic familial linkage information can assist the
police in tracing close male relatives of a criminal in case an instant match is not
available upon crime case profile search in the database. High discriminatory power
and the advantage of being able to trace paternal lineage mean that while sometimes
a database search might not provide a match, the related results would suggest a male
family member of a crime perpetrator. In areas of China that have not seen much
migration, genetic heritage is strongly connected and familial linkages can be
quickly uncovered through data derived from Y-STRs, while maintaining sufficient
discrimination power for direct comparisons of single-source samples as well. IFS
confirms that, although increasing the number of crime scene and reference sample
profiles in the database remains a continuous goal, familial searching, indeed, is
being considered as a potential means of maximizing the efficiency of the database.
In 2012, the work of building the Y-STR database was started in nine laboratories in
six provinces, with the goal of further expanding and uniting this database. This type
of database is not common in other places of the world, where most of the databases
focus on non-gendered autosomal STR loci. China has taken a bold step to build a
large national Y-STR database, starting with provincial crime laboratories. Since the
Chinese judicial system is focused on being able to “break the case,” match rates are
strongly emphasized as prime indicators of database success. They note that the
gender distribution of crime statistics should be an important driving factor in
Y-STR database creation (Ge et al. 2017).
The third type of the DNA database created in China is the National Missing
Children DNA Database. Issues of missing children were the reason why the work of
33 Building of the World’s Largest DNA Database: The China Case 649
genetics was started in China is the late 1990s—NMCDD was the starting point of
all of the databases. The issue of missing children has started in the 1970s, and
around 200,000 missing children are reported each year, only 0.1% of them are
found (Ge et al. 2013). If thinking chronologically, the database for missing children
was the first one to be established; however, it took a long time for the project to be
approved as a stand-alone database. In 2009, the Ministry of Public Security gave the
go-ahead for the project.
(...) the Fifth Bureau of the Ministry of Public Security will re-develop and construct the
“National Public Security Organization DNA Database Information System for Search of
Trafficked/Missing Children” and the “National Public Security Organization DNA Data-
base Information System for Search of Trafficked/Missing Children”, which will be handed
over to the Ministry of Public Security for evidence management and management. (...) Up
to now, the library has accumulatively recorded 557,000 DNA data of abducted/missing
children and their relatives. There are 4420 trafficked/missing children that have been
found, and the longest time that a child has been lost is 36 years. (Ge et al. 2017: 4–5)
In their doctoral thesis Chen Zeyu (2013) notes that in the years of database
running, it has faced many issues ranging from ethical issues of DNA sample
collection and management to the technical questions around the running of the
database and suggests that two main advancements—resolving ethical privacy issues
as well as increasing the efficiency of the database—should be resolved for a more
efficient running of the database.
China’s NDNAD, Y-STR database, and the NMCDD are the three main DNA
databases in China. NDNAD has seen rapid growth aligned with the Party-state
goals of achieving “harmonious society” and “peaceful development” of the country,
further talked about in the next chapter. For the government to be able to maximize
the benefits of the databases, data sharing and integration have been promoted.
During the Fifth Plenary Session of the 18th CPC Central Committee in 2015, the
largest and most important strategic governmental session in China, a slogan to
“Implement the national big data strategy, promote open sharing of data resources”
was created to signal the larger direction of database development.
the People’s Republic of China that ensures law enforcement and is also the
governing body of all of the Public Security Bureaus across the country.
Since the establishment of the DNA database in 2009, it was run by the Ministry
of Public Security. After the official establishment of the NDNAD in 2005 and
National Missing Children DNA Database in 2009, the governance of these two
databases was transferred to the Institute of Forensic Science in 2009. The institute,
which is located in the capital city of Beijing, is part of the Ministry of Public
Security and is the governing body directly responsible for the operation of DNA
databases in the country as well as the independent advancement of proprietary
Chinese DNA technologies. The responsibilities that the institute officially assumes
are: (1) strategic management of the database, (2) setting of Statement of
Requirements for the National DNA Database, (3) monitoring of Forensic Science
laboratories, (4) delivering DNA database services to police forces, (5) ensuring
integrity in the management and the DNA data held, (6) development of database
software, (7) providing management information, such as standards and guidance,
and (8) delivering training. For these responsibilities, the IFS reports directly to the
Ministry of Public Security.
China is also of the few countries that adjoined a research center to develop own
STR typing reagents as well as a genetic analyzer. The First Research Institute of the
Ministry of Public Security is the largest and the highest unit of forensic science
research in the public security system. Founded in 1960, the First Research Institute
is also one of the oldest scientific research institutions in China. It is the research and
development base of modern police technology and has long been responsible for
the research and development of police science and technology. It plays a strategic
role in China forensic science field as it pushes for China’s technological indepen-
dence. Accommodated within the First Research Institute umbrella, the Center for
Applied Forensic Sciences and Technologies (as shown in Picture 33.3) develops
and utilizes own technologies for reference sample inclusion in the NDNAD.
Located on the outskirts of Beijing, the center has three functions: it is a research
center, an STR kit manufacturing facility as well as a reference sample processing
police DNA laboratory. During the fifteenth period, the Institute of Forensic Science
of the Ministry of Public Security successfully developed domestic forensic DNA
detection reagents, breaking the monopoly of foreign DNA technology products.
During the 11th Five-Year Plan period, under the advocacy and care of the Ministry
of Public Security, the First Institute of the Ministry of Public Security jointly
developed the GA119-16A Genetic Analyzer and related analysis software and
consumables with independent intellectual property rights, realized the complete
supporting of domestic DNA testing reagents, domestic instruments, and
consumables. While not well known internationally, the analyzer is a groundbreak-
ing invention as prior to that Thermo Fisher Scientific had been the only supplier of
this laboratory equipment in the world. The genetic analyzer was developed to
ensure the government’s self-sufficiency, shortened investigative time, and cost
reduction.
Acquiring a software that would be able to assist the management of the DNA
database has also been important to China. To be able to efficiently store, manage,
33 Building of the World’s Largest DNA Database: The China Case 651
Picture 33.3 A government representative outside of the Center for Applied Forensic Sciences
and Technologies in Beijing, China
and share DNA data across the country, the Ministry of Public Security invested in
different types of data management software, which have undergone several devel-
opmental stages. Representatives from the Ministry of Public Security Material
Identification Center have summarized the developmental pathway and main
technologies used:
Security held a DNA Database Upgrade and Reconstruction Project meeting in Beijing,
which officially launched the nation-wide construction and application of the second-
generation national DNA database. The timeline for the replacement of the first-generation
database is set as the end of this year. The second-generation ‘National DNA Database’ will
better support rapid DNA query, classification and other applications of massive data
quantities. (Ge et al. 2017: 6)
The DNA databases are governed by a set of regulations named “Criteria for
Forensic DNA Databases”(法庭科学DNA数据库建设规范). The set of regulations
are fairly simple and even somewhat loose: while they do set the basic understanding
of what elements constitute a DNA database, the document maintains ample space
for the government to include, preserve, and use DNA data as deemed necessary.
While the size of the DNA database is growing exponentially, it is not entirely clear
what standards the government is upkeeping. There are two widely internationally
accepted loci set standards: the expanded Combined DNA Index System (CODIS)
loci standard is the United States set by the Federal Bureau of Investigation (Hares
2015) and the European Standard Set (ESS) loci decided on by the DNA working
group of the European Network of Forensic Science Institutes (ENFSI). In China the
situation has been different, and it has become a source of criticism both nationally
and internationally. Since the beginning of DNA database construction, the loci
standards were not set. The difficulties arose in the very beginning of the DNA
database building as researchers discovered that due to genetic differences, some loci
were close to obsolete in Chinese populations, such as loci typical in Caucasian and
Black populations (Wang et al. 2003). As a result, different local and international
manufacturers of the DNA technologies have followed own chosen standards, often
the CODIS standard applied in the USA. Scientist Bing Liu (2015) outlined that due
to lack of regulations, various DNA technology providers have come up with own
versions of STR analysis kits causing a fair sense of havoc and advised that despite
the rapid growth of the database, too little thought was put into setting standards for
the industry. In 2015, the Chinese NDNAD was undergoing a major technological
upgrade, and grasping that opportunity, Bing urged the government to put further
thought into learning from the experience of foreign scientists and considering
various factors that would make a major difference in the application of the DNA
database (Bing 2015). Currently, a new standard of 20 loci is being applied, although
it has not been officially published.
The “outsourcing” of governance responsibilities concerning DNA databases to
one dedicated agency has proved to have increased the efficiency standardization.
The IFS has put efforts to increase the efficiency of the DNA database in terms of
pushing for the development of DNA analysis technologies locally, upgrading the
DNA analysis software across the country, and is aiming to unify the loci standards
used by different laboratories. Further efforts should be invested toward the trans-
parency of DNA collection rules and regulations as the current standards are loose.
33 Building of the World’s Largest DNA Database: The China Case 653
The Chinese DNA database has exhibited extreme growth and has shown voracious
adoption rates of new technologies and heavy allocation of resources for innovative
DNA research. The country has already implemented three types of DNA databases
(NDNAD, NMCDD, and Y database), fingerprint database, face image database,
and has already planned for an SNP database, according to the announcement made
during the tenth AFSN Annual Meeting in Beijing, China (Wang 2018).
Next-generation sequencing (NGS), also referred to as second-generation
sequencing and massive parallel sequencing (MPS), has risen in popularity in the
Chinese forensic circles. During international presentations as well as published
articles, IFS has indeed signaled that they would be ready to consider NGS
technologies in the future: “Currently, MPS appears sufficiently robust to type
reference samples for uploading DNA profiles into databases. With the technology
evolving, it is likely that in the near term MPS will be able to offer the sensitivity of
detection to analyze low quantity and quality DNA samples, and will be capable of
analysis of forensic casework evidence” (Ge et al. 2014: 13). Furthermore, during
2017 ISFG meeting, IFS representatives noted that the capacity of the Chinese
database is ready to hold a large increase of data that using MPS technologies
would require. In the 2018 AFSN event, SNP profile database was confirmed as
planned for implementation.
The SNP database will be running on NGS equipment: a new type of genetic
analysis equipment, also referred to as second-generation sequencers, which is able
to analyze large amounts of different types of genetic data at the same time. Once
implemented, it will be one of the most technologically advanced databases used
around the world. In a recent publication by the IFS, the clear vision of how NGS
would be used with the existing NDNAD and the biggest challenges were discussed.
NGS would be incorporated into the existing NDNAD instead of replacing it, and
the critical challenge was to resolve compatibility issues between NGS-generated
data and the currently used STR data (Zhao et al. 2017). The article comments:
“From the perspective of its developmental history, the applications of forensic DNA
databases have closely followed the development of DNA technologies applied in
the field of biology. Thus, following the development of second-generation sequenc-
ing technologies and platforms as well as the development of many emerging
biological genetic technologies such as SNP, mRNA, and whole genome sequenc-
ing, the next step in the development of DNA databases should be gradually
combining the new and the currently used technologies to support better data use
and retrieval” (Zhao et al. 2017: 257). One of the main considerations prompting the
adoption of NGS is the desire to make the most use of the currently existing data
through increasing its efficiency. NGS could be a potential answer: as previously
mentioned, it can analyze different types of data in the same reaction, thus increasing
the accuracy of the profiles. It is recognized that the costs of running NGS tests as
well as the need for the technology to mature and be fully compatible with the
existing NDNAD as two main challenges to be solved before a large-scale adoption
is undertaken (Zhao et al. 2017). The Beijing Institute of Genomics, Chinese
654 A. Bernotaite
Academy of Sciences, has taken an active role in NGS research in China, and they
have identified and called for resolution of the following issues: low-template library
preparation, error rate, type estimations, as well as existing problems with NGS data
processing and mining (Yang et al. 2014). Despite the existing issues and the high
costs, it can be foreseen that the government will adopt the technology once all the
issues are resolved.
China has successfully applied various emerging technologies to ensure the wider
societal goals to ensure the stable growth and development of the country. With the
NDNAD, Y-STR, and NMCDD to manage and an articulated need to obtain China-
specific DNA markers with high discrimination, MPS technologies do have the
potential to unify all of the present needs of the police on one platform. This is
one single large development, which is known to be under serious consideration by
the highest governing units in China.
China has made a strong push to ensure that forensic DNA technologies are an
integral part of public safety and social stability. Managing around 600 laboratories
across the country—their staff, buildings, technical and governance standards—is
not an easy task. It is not surprising that the DNA databases have not been without
issues. In a recent publication, the Physical Evidence Identification Center, the
Ministry of Public Security, identified six main issues that the NDNAD is currently
encountering, the main one being the lack of adequate management skills as well as
the infrastructure and quality management capabilities. The database has been
ordered to be created so quickly that personnel training has lagged behind and
hard skills of DNA laboratory management have not followed (Ge et al. 2017).
The authors also comment on the serious lack of both personnel and laboratory
issues: “Some of the newly built, some of the rebuilt and some of the modernized and
expanded DNA laboratories still have a low level of modernization and
standardization. Some have just started work, and there is an obvious lack of
functionality, laboratory room partition confusion, observed high risk for lab pro-
cesses. National DNA database information quality monitoring can find
contaminated data every month. Problems such as the failure of the quality manage-
ment system to meet standards have seriously reduced the standardization, credibil-
ity and authority of inspection and appraisal. Among the 387 provincial and
prefecture DNA laboratories participating in the 2016 Ministry of Public Security’s
proficiency assessment, 15 failed the results (2 provincial), and the rate of failed
qualification assessment reached 3.87%.” (Ge et al. 2017: 10). The second observed
issue refers to the ability to collect physical evidence and handle samples. Ge et al.
(2017: 10) comment, “In some places, especially in areas where DNA laboratories
33 Building of the World’s Largest DNA Database: The China Case 655
have only recently been built, there is a significant lack of expertise, evidence
handling awareness, technical preparation and operational skills in DNA technology.
The on-site bio-material evidence extraction rate is far below the national average.
Some provinces have more prominent problems, and the rate of on-site bio-materials
extraction is less than 5%. In some provinces, the effective collection rate and
sample size of DNA samples of eight key personnel such as crimes are very low,
and repeated collections are at a high level for a long time. In some places, the
problems of long-term backlog, failure to inspect samples or not inspecting samples
in time are more prominent.” Further, issues with ensuring adequate numbers of
qualified specialists are pertinent. To comment in numbers, there were only 112 pro-
fessional DNA technicians who qualified in 2006 national DNA laboratory assess-
ment, and the number of full-time DNA database administrators and DNA
intelligence analysts who have mastered DNA testing techniques and surveyed
onsite, familiar investigative work, and proficient in computer technology is
extremely scarce (Ge et al. 2017). With only the recent update of the DNA database
management software, system security and risk management capabilities have been
an issue. Although the DNA database operates on the public security network, there
are still many risks in security management: in May 2017, after the outbreak of the
“Eternal Blue” blackmail-born virus, DNA database server virus was found in
19 provinces and cities nationwide, causing system paralysis; the most serious
consequence of DNA database virus was information loss that occurred in several
individual cities (Ge et al. 2017). Failure to upgrade the DNA software system in
time was the primary reason for that, which could have been prevented with stricter
management of DNA laboratories. Such large-scale database server virus infection is
a serious red flag as it poses a serious security threat. The final issue has to do with
the staff skills to handle incoming information and their ability to successfully use
the information at hand while solving cases.
All six of the technical issues mentioned here are serious problems. It can be seen
that only half of the laboratories that are being run employ staff who is fully capable
to work in a forensic genetics laboratory. Consequentially, without strong support in
a genetic laboratory, new staff without prior experience in the field would find the
work very challenging. In 2017, the Ministry of Public Security launched “Three
Strikes and One Remediation” campaign to resolve some of the most crucial of these
issues; the results of this campaign are yet to be measured and evaluated.
Technical issues of the database is only one side of the coin. Ethical issues have
also been pertinent to the DNA database: the steps that the country has taken around
the building of its DNA database could be called somewhat radical. The country has
taken big steps toward large-scale monitoring of its population without putting much
effort toward transparency. Some of the measures taken to build the forensic DNA
database are implemented against well-researched experience from other countries.
For example, in the UK, the number of subject, or reference, profiles loaded to the
DNA database has been decreasing from year to year, but the efficiency measures by
the match rate have increased. The percentile ratio of match rates as compared to the
overall size of the Chinese DNA databases have not seen stable annual increases—in
the year 2015, they had even decreased. Therefore, a possibility that the goal of
656 A. Bernotaite
The Ministry of Public Security has pushed the NDNAD to grow and become the
world’s largest DNA database in just over 10 years. Additionally, China’s Y-STR
database is now also the world’s largest database of such kind. To achieve this goal,
the Chinese government has taken some radical decisions in terms of fueling the
expansion of DNA laboratories without a set supply of specialists to work in them,
lagging creation and implementation of standards and not publicly disclosing com-
prehensive uses of DNA databases. In some cases, work was started first and the
relevant regulations followed later, creating concern around ethics of the sample
collection, storage, and use of the DNA profiles. Since there is a lack of transpar-
ency, it can be argued that an authoritarian country with so much power over its
people would not necessarily only use all the data collected for the purpose of
solving crime. The implications of owning and managing this size of a database
are varied and extending. China must pay close attention to maintaining a balance
between the legitimate goal of maintaining a safe and stable society, identified as one
of the major building blocks of the present political system, smart use of government
funds, as well as the ethics of forensics in the country.
In the future, the size of the NDNAD will grow not only in size but also in
complexity with the use of next-generation sequencing technologies, as well as the
addition of the Y-STR database. With the rise of facial recognition technologies, it
can be speculated that at some point in the near future, a crime could be solved by
CCTV recognizing an offender and any DNA evidence conclusively confirming a
crime. Overall, China is preparing to meet yet another Five-Year Plan in 2020 with
its forensic technologies, laboratories, staff, and standards mature for another chal-
lenge to come. In a way, much of the rushed growth can be explained with the goals
of planned governance and central management. We are yet to fully understand how
such planning would work out in the context of forensic DNA.
References
Bing L (2015) A preliminary evaluation of DNA evidence in criminal investigations based on
National DNA database. Foren Sci Technol 40(3):199–203. [Chinese Mandarin]
Chen Z (2013) Application and perfection of DNA database in the fight against child trafficking
crime. PhD Dissertation, Southwest University of Political Science and Law. [Chinese
Mandarin]
33 Building of the World’s Largest DNA Database: The China Case 657
Wang W, Jia H, Wang Q, Cai Z, Wei L, Wang D, Bittles AH (2003) STR polymorphisms of
“forensic loci” in the northern Han Chinese population. J Hum Genet 48(7):337–341
Wrong D (1994) Problem of order. Simon and Schuster, New York
Yang Y, Xie B, Yan J (2014) Application of next-generation sequencing technology in forensic
science. Genomics Proteomics Bioinformatics 12(5):190–197
Zhao Z et al (2017) The application of next generation sequencing in forensic DNA database. Sci
Discov 5(4):257–261. [Chinese Mandarin]
DNA Databases: Risks, Benefits, Privacy,
and Human Rights 34
Sachil Kumar
Abstract
Keywords
DNA database · CODIS · DNA profiles · STRs · Criminal investigation · Risks ·
Bio-surveillance · Benefits · Privacy · Familial searching · Human rights
S. Kumar (*)
Department of Forensic Sciences, College of Criminal Justice, Naif Arab University for Security
Sciences, Riyadh, Saudi Arabia
e-mail: [email protected]
34.1 Introduction
The UK became the first nation to proceed on the so-called forensic DNA revolution
(Jeffreys et al. 1985a; Gill et al. 1985), with the DNA fingerprinting test being first
applied for the resolution of the immigration dispute as a result of disputed family
relationships in early 1985 (Jeffreys et al. 1985b; Aronson 2005). Soon afterwards,
DNA evidence in a paternity dispute was submitted to a civil court in the UK. In
October 1986, DNA typing in criminal investigations started with Enderby’s murder
trial, an investigation that contributed to the release of a key suspect following
subsequent DNA testing proved his innocence. In 1987, DNA typing tests had
34 DNA Databases: Risks, Benefits, Privacy, and Human Rights 661
been submitted as proof in criminal courts in the United Kingdom and the United
States, and then in 1988, the United Kingdom Home Office and the Foreign and
Commonwealth Office had granted approval for the usage of DNA typing to resolve
immigration issues linked to the contested family relationships (Home Office 1989).
It was soon realized that this method was theoretically far more commonly used
in the justice system. As a consequence, the application of DNA in the area of law
enforcement has expanded, enabled by rapid technological developments, followed
by incremental legal reforms, enabling the acquisition and the usage of DNA profiles
to become an integral part of the criminal justice cycle. Enthusiast use of the modern
methodology has fueled by both political and media hyperboles regarding the
effectiveness of DNA profiling in identifying, stopping, and regulating crime.
DNA profiling has been celebrated as an uncomplicated success tale, with the
National DNA Database set up without any explicit laws, thus evading any focused
political or public debate (Wallace 2006).
The UK’s National DNA Database (NDNAD) was established in 1995 utilizing
the SGM (second-generation multiplex) profiling method. Since 1998, the SGMPlus
methodology are used for DNA profiling comprising of eight CODIS loci (TH01,
D8S1179, FGA, D16S539, D3S1358, D18S51, VWA, or D21S11), together with
two additional markers, D19S433 and D2S1338, and also the AMELX locus (Butler
2006). However, as of July 24, 2014, samples are profiled using the DNA-17
profiling technique [kits of 17 STR loci (along with gender identifier)]. Only patterns
of STRs are stored in NDNAD instead of an individual’s entire genomic sequence.
All information kept on the NDNAD is regulated by a Tripartite Board involving
the Home Office, the Association of Police Authorities, and the Association of Chief
Police Officers.
More than a year after its launch, the NDNAD has expanded to include DNA
samples from 2.7 million people—around 5.2% of the people of the UK—several of
whom have never been charged with or convicted of any offence. It is the world’s
foremost and largest forensic DNA database of its kind. Under existing legislation, it
could be extended to 25% of male population and nearly 7% of female population
(Williams and Johnson 2005). It had 3.1 million profiles in 2005, 5.77 million by
2015 and 5.86 million by 2016 (National DNA Database Statistics 2015). The
number of DNA profile records kept in NDNAD rose by more than 172,000 in the
year up to March 2018, the highest annual rise since more than one million records
were removed from the database after the “Protection of Freedoms Act” came into
effect. As of March 2018, the NDNAD held 6,196,278 DNA profile, a rise of 2.86%
on the total for March 2017. This follows a rise of 2.79% between March 2016 and
March 2017 and a rise of 1.63% (to March 2016) and 0.88% (to March 2015) over
the preceding 2 years (Statewatch n.d.).
662 S. Kumar
New Zealand was the second nation across the globe to set up the DNA Profile Data
Bank (DPD) in 1995 and this constructive approach to crime culminated in a high
rate of success in providing useful information for unsolved offences (Harbison et al.
2001). In New Zealand, “the Criminal Investigations (Blood Samples) Act 1995”
(“CI (BS) Act”) authorizes the setup of a DNA data bank. In addition to the sex test,
15 STR loci are used in New Zealand to create DNA profiles (Institute of Environ-
mental Science and Research Website 2013). This included the compilation of DNA
profiles of registered criminals and volunteers in a national database, which is
managed on behalf of the police by the ESR (Environmental Science and Research).
Project DPD includes two repositories: the National DNA Database (individual’s
profiles) and the Crime Sample Database (profiles from unresolved crimes). By
making comparisons, potential perpetrators can be classified and offences linked.
There is also a stand-alone temporary database (“TD”), comprising DNA profiles
from individuals who have been detained by the police or expect to be prosecuted. If
such an individual is thereafter convicted, their profile would be passed from the TD
to the DPD for permanent retention.
DPD utilizing the SGM DNA profiling system until July 2009 (Sparkes et al.
1996). Since that time, the AmpFlSTR® SGM Plus® system (the six core SGM loci,
amelogenin, and four additional loci) has been used (Cotton et al. 2000).
The DPD currently maintains some 189,000 individual DNA profiles and more
than 40,000 crime sample DNA profiles. New Zealand dominates the world in DNA
matching with almost 70% of all unresolved offences loaded to the crime sample
data banks effectively connecting to offenders and 30% to another incident.
French created the national DNA database named FNAEG (Fichier National
Automatisé des Empreintes Génétiques) in 1998, which was used by the local
gendarmerie and national police. The Guigou Legislation on the Prevention of
Sexually Oriented Offences, enacted by the Plural Left Lionel Jospin Administra-
tion, established a forensic DNA data bank in 1998. The deployment, initially
scheduled for 1999, was eventually accomplished in 2001, with the repository itself
housed at Écully, controlled by a sub-directorate of the French police’s technological
and scientific divisions.
After the 9/11 attacks, the government of France extended the context of the
repository to incorporate DNA linked to other indictable offenses. Yet another “law
for interior safety” adopted on March 18, 2003 broadened the spectrum even more to
include nearly all acts of abuse, but not traffic violations or crimes perpetrated
overseas. Samples are taken from convicted persons as well as simple suspects.
The law does not specify a minimum age (Le Monde 2007).
34 DNA Databases: Risks, Benefits, Privacy, and Human Rights 663
The CODIS (Combined DNA Index System) is a system of DNA profile indexes
established by the FBI (Federal Bureau of Investigation). The CODIS combines
DNA and computer technologies into a powerful tool for linking crimes. This allows
local and state forensic laboratories to digitally share and match profiles, linking
violent crimes with each other and with known perpetrators. CODIS consists of three
tiers (or levels); National DNA Index System (NDIS) enables states to compare
DNA information with each other; State DNA Index Systems (SDIS) allows labs
between states to exchange information; and the Local DNA Index Systems (LDIS)
where DNA profiles originate.
In 1989, TWGDAM (Technical Working Group on DNA Analysis Methods) first
announced the creation of a national DNA database (Budowle et al. 1998). FBI
initiated a pilot DNA databased program involving 14 local and state laboratories in
1990 (Combined DNA Index System (CODIS) 2018). Congress enacted the DNA
Identification Act in the year 1994 (42 U.S.C. § 14132) requiring the FBI to set up a
nationwide DNA repository for incarcerated criminals and also specific repositories
for missing people and forensic samples retrieved from crimes (42 U.S.C. § 14132 n.
d.). The National DNA Index System or the NDIS become functional in 1998.
Presently, all 50 states, the Federal Police, the Army Laboratories, Puerto Rico,
and the District of Columbia are involved in NDIS (Federal Bureau of Investigation
2017).
The CODIS contains a number of specific indices for storing DNA profile
information. There are three indexes for assisting in criminal investigations: the
offender index, which comprises DNA profiles of people accused of violent
offences; the arrestee index, which includes profiles of those arrested of crimes
pursuit to the laws of the particular state; and the forensic index, which includes
profiles collected from crime scene evidence (Data and Communication Flow in
CODIS 2017). Other indexes, like the biological relatives of missing people’s index,
the missing persons index, and the unidentified human remains index, are used to
help identify missing individuals (Procedure for CODIS 2017).
CODIS-based identifications rely on STRs that are distributed in the human
genome and on statistics that are used to measure the prevalence of that particular
profile in the population (The Biology Project 2000; Forensics 2017). Similarly,
CODIS requires data on mitochondrial DNA (mtDNA) to be added to missing
person related indexes. Because mtDNA passes from a mother to all of her children,
this concept can be used to link people over decades.
664 S. Kumar
CODIS core is mentioned below; the most recent loci with asterisks have been
introduced to the CODIS core in year 2017 (FBI CODIS Core STR Loci 2015;
Butler 2006).
Although the US database is not explicitly connected to any other nation, many
organizations across the globe use the underlying CODIS program. As of 2016,
90 foreign laboratories in 50 countries have been using CODIS software (Forensics
2017).
A person covering his face using nylon stocking and carrying a knife leap out from
underneath the bushes and sexually harassed a female walking around. Semen
retrieved from the sufferer’s clothing and saliva was tested using DNA technology.
The resultant profile was looked up against Minnesota’s CODIS repository. The hunt
revealed the offender “Terry Lee Anderson,” who admitted and now is behind bars.
34.7 Australia
34.8 Canada
The National DNA Data Bank of Canada (NDDB) was founded in 1998 but started
operations in the year 2000 (Milot et al. 2003). Federal courts have concluded that
the legislation enacted by Parliament to control the usage of this technology in the
justice system is mindful of the constitutional and privacy rights of offenders,
particularly of individuals alleged to be convicted of serious crimes (National
DNA Data Bank 2013).
After the UK’s launch of its data bank (NDNAD) in year 1995, the acquittal of
two false convicts (Milgaard case, 1969 and Morin case, 1985) and the adoption of
the C-104 bill (to amend the Criminal Code and the Young Offenders Act) acknowl-
edged the need for such a specific data bank in Canada and prompted the establish-
ment of the NDDB via the Identification Act (Law C-37 of December 10, 1998)
(Curran 1997). The Government of Canada adopted the DNA Identification Act on
December 11, 1999. This would allow the creation and modification of a Canadian
DNA data bank for the purposes of the Criminal Code. This law became legal on
June 29, 2000. On the basis of 13 CODIS core loci, profiles are managed and
compared using CODIS (Bank, Government of Canada 2001; Police 2012).
NDDB comprised DNA profiles in two separated indexes: Convicted Offender
Index (COI), biological samples resulting in DNA profiles can only be collected
from perpetrators against whom post-conviction DNA data bank orders have been
made; and Crime Scene Index (CSI), DNA profiles derived from crime scene
investigations.
As of July 15, 2013, the COI had over 237,000 DNA profiles and the CSI had
over 87,000 DNA profiles (Milot et al. 2013). Moreover, there were 21,563 matches
between crime scene and convicted offender DNA profiles and 2741 “forensic
matches” per crime scene.
666 S. Kumar
34.9 Dubai
In 2006, the United Arab Emirates declared that it would create a DNA database for
its whole populace. The UK Forensic Science Service (FSS) officially signed
contracts to build a database, but the FSS has since shut down due to recession.
In the year 2017, Dubai unveiled an initiative named Dubai 10X, designed to
generate “disruptive innovation” in the region (Sutton 2017). DNA database was one
of the programs in this initiative that would gather genomes from all three million
nationals over a 10-year span. This was expected to use the database to determine the
hereditary origins of diseases and to create customized medical therapies (Treviño
2018).
34.10 Germany
Germany established its DNA data bank for the Federal Criminal Police (in German:
Bundeskriminalamt, abbreviated BKA) in 1998 (GeneWatch UK 2016; Germany’s
DNA Database 2016; National DNA Intelligence Databases in Europe 2016;
Peerenboom 1998). At the end of 2010, the database held more than 700,000
DNA profiles, and 1,162,304 DNA profiles in 2017 (Käppner 2016).
In the year 2011, “Stop the DNA Collection Frenzy!” movement and numerous
human rights and data security groups submitted a public letter (Ope Letter Stop
2016) to the Minister of Justice of Germany urging her to take steps to avoid the
“preventive expansion of DNA data-collection” and the “preemptive use of mere
suspicions and of the state apparatus against individuals” and the cancelation of
foreign DNA data sharing initiatives at European and transatlantic stage (Schultz
2016).
34.11 Israel
Israel Police DNA Index System (IPDIS) is the Israeli national DNA data bank
(Zamir et al. 2012) which was created in the year 2007 and has a database of more
than 135,000 DNA profiles and more than 2000 confirmed hits reported. The IPDIS
contains DNA profiles of accused, suspect, and convicted criminals.
In order to manage the high-throughput processing and DNA analysis with FTA
cards, IPDIS has built a semi-automatic LIMS system that enables a limited number
of police officers to complete the collection of a vast number of samples in a fairly
short time period and are also liable for the future follow-up of assays.
34 DNA Databases: Risks, Benefits, Privacy, and Human Rights 667
34.12 Kuwait
Kuwait created its DNA database in 2002 without any relevant legislation on DNA
databases. There were renewed calls in 2012 for expansion. In 2015, the Kuwaiti
government passed a law (Act No. 78/2015) requiring not only of citizens living in
the Persian Gulf state but also of other residents and even country visitors to have
their DNA onto a national repository (Visser 2015; Ley 78/2015 de Kuwait 2016).
Such a database would have been the first of its kind in the world.
The explanation for this legislation was safety issues following the ISIS suicide
bomb attack (Imam Sadiq Mosque), which killed 27 people and wounded several
more (ISIL 2015). They planned to finish collecting the DNA from approximately
4.2 million people in a security crackdown to help officers detain suspects by
September 2016, which outside analysts felt was unrealistic (Field 2015).
The Ministry of the Interior has allocated $400 million to the project, that is likely
to be criticized by human rights defenders for violating the person’s right to privacy.
Many that fail to give samples could face a penalty of up to $33,000 or $29, EUR
700, and a 1-year prison term, and those found supplying false samples will be
imprisoned for 7 years.
Nevertheless, as the legislation is now scheduled to be implemented soon, several
researchers and advocacy groups have voiced their doubts and pleaded with the
Government of Kuwait to reconsider its plans. In the New Scientist, geneticist Olaf
Riess claimed that the legislation was a “huge attack on genetic confidentiality”
which severely jeopardized Kuwait’s global image. The Kuwait Constitutional
Court, in 2017, ruled against the statute that there was a breach of personal privacy
and that the program had been terminated (Coghlan 2017).
34.13 Brazil
The Forensic DNA Research Institute of Federal District Civil Police in 1998 set up
a DNA data bank designed to help resolve serious offences (Ferreira et al. 2015). In
2012, Brazil approved a national legislation creating DNA repositories at national
and state levels for the DNA typing of people with criminal convictions (Ferreira
et al. 2015).
In 2013, the Brazilian National DNA Database (BNPG) was created. In the first
half of 2019, the number of genetic profiles that entered BNPG increased by 70%. In
addition to this rise, the number of matches in the same time have risen by 46%.
Following the 2013 declaration of the President of the Republic of Brazil, which
governs the 2012 Act, Brazil has started utilizing CODIS as well the DNA database
of sexual assault evidence to resolve abuse cases in Brazil (Ferreira et al. 2015).
668 S. Kumar
The Netherlands is the biggest gatherer of its people’s DNA profiles compared to
other European countries. The DNA database, containing DNA profiles, was
established at the National Forensic Institute (NFI) in 1997. The concept “database”
in Dutch law involves the collection of autosomal STR profiles that are held in this
repository (Beekman et al. 2004). Right now, the DNA repository at the Netherlands
Forensic Institute holds DNA profiles of more than 316,000 Dutch people
(Veiligheid 2013). In comparison with the situation in most other European nations,
the Dutch authorities have wide-ranging rights to collect and preserve DNA samples
if an individual is guilty of a recordable crime, except when the conviction only
involves paying a penalty.
Throughout Sweden, only the profiles of offenders who have served more than
2 years in jail are kept. In Norway, court orders are necessary. Austria introduced
their own DNA database in 1997, which is run by the Ministry of Interior (Hindmash
and Prainsack 2010), and Italy also set up a criminal DNA database in 2016 (Negri
2016; Jamaica Observer 2016). Switzerland launched a provisional criminal DNA
registry in 2000 and passed the law in 2005 (Haas et al. 2006).
The Government of Portugal suggested the development of a DNA data bank for
the whole populace of Portugal in the year 2005 (Newropeans Magazine n.d.). But,
after an informed debate, including the view of the Portuguese Ethics Council
(CNECV—ConselhoNacional de Éticapara as Ciências da Vida n.d.), only the
criminal’s DNA profile were kept in the database (Skinner 2010).
GMI (Genomics Medicine Ireland), a life sciences company, is establishing a
genetic registry that will include information from almost 10% of the Irish populace,
involving patients with different disorders and normal individuals (Genomics Medi-
cine n.d.; Irish Times n.d.-a). The likelihood of a private company retaining public
DNA data posed questions. At present, it appears that Ireland has adopted a fully
commercial approach to genomics. This policy jeopardizes the unrestricted access of
genomic data for scientific researches which could aid the patient (Irish Times n.d.-
b).
The National Forensic DNA Database (NFDD) is the South Africa national DNA
data bank used by law enforcement agencies. Sexual abuse was a major burden on
the nation, and the country was reported with the maximum rape rate, with a female
sexually assaulted every 17 seconds posing massive challenge to the nation and
highlighting the severity of the issue. Thus, in 2014, President Zuma approved the
legislation “DNA Act” to protect the innocent (The Evolution of Forensic DNA
Database Policy 2017; Global Offender Data Base 2014).
34 DNA Databases: Risks, Benefits, Privacy, and Human Rights 669
34.16 China
In 2004, China set up its DNA database to track abducted and missing children.
Since 2001, Hong Kong within China has had a separate database, utilizing the
United States CODIS, the FBI’s forensic DNA database system (DNA Policy
Initiative n.d.-c).
The 2011 Interpol survey reported that China’s DNA data bank has expanded to
461,513 crime scene DNA profiles, 7,701,745 individual’s profiles, 22,718 missing
person’s profiles, 65,115 unidentified human remain profiles and 279,999 other
profiles (total: 8,531,099 DNA profiles). Chinese data bank is projected to have
20 million profiles by 2013 and 40 million by 2016, rendering this the biggest in the
globe (DNA Policy Initiative n.d.-c).
The Chinese authorities intend to increase their current DNA archive to 100 mil-
lion records by 2020, according to the Wall Street Journal examination of reports
from police departments throughout China (WSJ n.d.). There has been criticism that
China can use DNA repositories not only to solve offence but also to monitor
dissidents, particularly Uyghurs (The New York Times n.d.).
In India, also, this type of DNA profile database is needed which may help Indian
law enforcement agencies. DNA fingerprinting has been a useful tool for law
enforcement, as it works both ways to secure correct convictions and also to
exonerate the innocent. India’s latest compilation of crime statistics for 2016 from
the National Crime Records Bureau (NCRB) indicates that the rate of conviction for
rape is 25%. The 2016 NCRB statistics documented more than 300,000 crimes that
directly affect people or property, but the conviction rate remains at around 30%.
Only a small proportion of these criminal offences are currently being investigated
through DNA testing (Kumar et al. 2016).
The Union Government is focusing on a revised draft of the legislation which
aimed at creating a national DNA database for offenders. The proposal to draft a bill
authorizing the usage of DNA profiles for crime-related purposes started in 2003
when the Department of Biotechnology (DBT) set up a council named the DNA
Profiling Advisory Committee to make guidelines for the drafting of the “2006 DNA
Profiling Bill” that ultimately became the “2007 Human DNA Profiling Law”
(International Forensic Sciences n.d.; Maguire et al. 2013; Jeffreys 2005; Machado
and Silva 2014). The proposed “Human DNA Profiling Bill” was disclosed in 2007,
but never presented in Parliament.
There are 17 sites or locations along the DNA strand that we used to identify an
individual. However, neither of these sites ever disclosed nothing about an
individual’s medical records. They are almost as neutral as fingerprints (Livemint
n.d.). Rights activists criticized the law as a potential infringement of the rights of
residents and questioned it on legal and technical grounds. Dr. Helen Wallace from
GeneWatch, a UK-based not-for-profit organization that advocates against DNA
670 S. Kumar
data banks, believes that India needs to learn from foreign experience, especially
from the United Kingdom, which in 1995 became the first nation to create a data
bank that also prompted retention of DNA records of innocents (The Hindu 2020).
The United Kingdom in 2011 adopted the “Protection of Freedoms Act” which
would delete an additional one million records from the DNA database. Jeremy
Gruber, Executive Director, Council for Responsible Genetics, said that the Indian
data bank was troublesome as it would be a Big Brother surveillance tool rather than
a crime-solving platform (Livemint n.d.).
The revised 2012 Profiling Bill proposes just incremental changes to its counter-
part, the 2007 Draft “Human DNA Profiling Bill.” In a contentious move in 2012 to
increase state intervention in the lives of common citizens, the UPA government
introduced the DNA Profiling Bill at the Parliament’s Winter Session. If it becomes
law, the bill would give the right to obtain vast amounts of confidential DNA
information from people even if they are “suspects” in a criminal trial. The informa-
tion will be retained until the person has been cleared by the tribunal (Sanhati n.d.).
The bill advocates the creation of a National DNA Data Bank to be supervised by
an officer who is of the rank of Joint Secretary to the Government of India. For
protestors, this will help the government to play the role of an alarming Big Brother
gathering a vast amount of sensitive data of citizens. The proposed amendment to the
bill states that “DNA analysis offers sensitive information which, if misused, can
cause harm to a person or society.” It is not obvious under what conditions
“volunteers” will disclose their personal details with the government.
The data, according to the bill, will also be used for the “creation and mainte-
nance” of population statistics and can be used for identification, research, protocols
development or quality control. Surprisingly enough, the punishment for “misusing”
the DNA profiles is a jail sentence of a few months or a fee of a paltry, Rupees
50,000. In reality, law enforcement organizations like the CBI have lobbied the
government to enact the bill early. They referenced the outcomes of a British
parliamentary report published by the Department of Science and Technology in
February 2006 claiming that prosecutions in crime trials rose significantly after the
government decided to retain the details on DNA profiling in future years.
In the meantime, senior civil servants who are associated with the bill and have
made detailed briefings to the DoB are unhappy that the bill calls for the deletion of
DNA profile data after an individual has been discharged by the courts. They believe
that preserving and growing data gradually and progressively would go a fair way in
the detection and settlement of offences. Though this is a valid point, the absence of
a strict privacy legislation poses questions regarding the obtrusive existence of the
proposed DNA Profiling Bill. The proposal has been questioned for not resolving
privacy issues. The Citizens Forum for Civil Liberties criticized the bill on privacy
and in 2012 submitted a petition to the National Human Rights Commission (The
Hindu 2012).
The Bill was further developed by an advisory committee because of concerns
about privacy and lack of safeguards. Nonetheless, a new draft bill was presented to
Parliament in the summer of 2015 but was opposed by a number of committee
members who said their concerns had not been fully addressed. A public
34 DNA Databases: Risks, Benefits, Privacy, and Human Rights 671
consultation was then announced (deadline August 20, 2015). An expert committee
was set up by the DoB to address these issues.
A revised version of the bill was sent to the Indian Parliament in August 2018, but
it was not implemented before the end of the parliamentary session. As a result, after
the 2019 Lok Sabha General Election, the bill was reintroduced again. The Act was
approved in the Lok Sabha in January but lapsed because it could not be passed in
the Rajya Sabha owing to lack of support from the opposition parties. Soon, after the
Cabinet’s approval, a new bill would be presented in Parliament, sources aware of
the developments stated.
The Act needs informed consent from individuals to obtain DNA samples from
them. Permission shall not be needed for crimes punished by more than 7 years in jail
or by a death penalty. The genomic details of 10,000 Indians will be collected in the
first stage of “Genome India.” The proposed National DNA Database, or the Indian
Database as it would be named, would merge profiles from multiple state-level
repositories and retain at no less than six indices: an offenders index, suspects
index, missing people’s index, a crime scene index, unknown deceased person’s
index, and a volunteer’s index. Those guilty of an offense would have their profiles
retained in the data bank. Missing persons eventually identified or accused who have
been acquitted in an incident should be removed from the database when a court
directs the DNA database bank manager to do so (Livemint n.d.).
Expansion of forensic DNA data bank poses concerns about the criterion for
inclusion and retention and doubts about the effectiveness, affordability, and privacy
infringement of such large collections of personal data. Unlike in the past, not just
violent crimes but all offences are subject to DNA analysis creating thousands and
thousands of DNA profiles, all of which are stored and continually searched in
national DNA repositories. As always when big datasets are gathered, new mining
procedures based on correlation became feasible. For example, “Familial Searching
in which a profile from crime site is intentionally run through the criminal database
in the hopes of getting a list of profiles that are genetically identical to the DNA
evidence and using this knowledge as an investigation leads to questioning families
of the partial matches profiles”.
Finally, the very first familial searching was carried out effectively in the United
Kingdom in 2004, which led to the prosecution of Craig Harman for assassination.
Craig Harman from Frimley, Surrey, was prosecuted and imprisoned for 6 years on
the grounds of a familial DNA search that connected him to the murder scene via a
near relative’s DNA profile. Another family search that hit the headlines in the UK
was the case of Lynette Deborah White, who was killed on Valentine’s Day in
Cardiff, Wales, in 1988. Three locals were falsely jailed for life in 1990 and declared
innocent and released after appeal in 1992. In 2009, 13 police officers involved in the
case were charged with a plot to pervert the course of justice by jailing three
innocents.
672 S. Kumar
In 2000, a DNA profile of the alleged murderer was retrieved, but no match was
made in the NDNAD. A family search was undertaken in 2003 and a close
resemblance to a 14-year-old child with an identical genetic profile was revealed
in the database. Since the child was not yet born when the offense was done, the law
enforcement officials searched to his nearest associates or immediate family. This
guided the investigators to Jeffrey Gafoor, a 38-year-old paternal uncle of the boy.
Gafoor has admitted to White’s assassination and has been sentenced to life in
prison. Subsequently, the technique has been adopted in some US states, but it is
not enforced at country level.
German police were often also active with Family Search strategies. In Northern
Germany, the cops detained a man convicted of raping a woman after they had
examined the DNA of his two brothers who had taken part in the dragnet. Owing to
partial matches between the DNA profiles of the crime scene and these brothers, the
perpetrator was confirmed. In contrast to other jurisdictions, the Federal Constitu-
tional Court of Germany ruled against the potential usage of this sort of evidence by
the court in December 2012.
Familial searches are certainly a useful tool in police investigations that can help
to solve previously unsolved crimes. The biggest criticism is about how minorities
are going to be affected. Ms. Simoncelli claimed that the usage of familial searches
would harm a specific group of people—minorities. Simoncelli claimed that African
Americans and Latinos should be increasingly targeted by law enforcement; that
family members would be put under “genetic surveillance” for offenses they did not
undertake and that family members would become “genetic informants”. Simoncelli
also stated that if familial searches were carried out on a regular basis, hundreds of
thousands of innocent citizens who happen to be relatives of persons in the DNA
database will be exposed to lifetime monitoring. Defense Attorney Stephen Mercer
claimed that the risk is in the usage of the DNA database to decide if individuals who
perform violent actions have genes that tend to lead them to abuse or other disruptive
behavior (DNA Forensics n.d.).
Earlier, Alec Jeffreys questioned how the DNA profiles collected by UK police
held not only individuals who were wrongfully convicted of crimes but also people
arrested without prosecution, suspects acquitted in the inquiry, or also innocent
citizens who had never been charged with an unlawful act. He also questioned the
fact that large national DNA repositories, such as the NDNAD in the UK, are likely
to be socioeconomically biased. It has been reported that most matches are for petty
offences; as per GeneWatch in Germany, 63% of the data bank matches are for
robbery, and fewer than 3% are for murder and rape. The amendments to the UK
database came in 2012s “Protection of Freedoms Act,” after a significant setback at
the European Court of Human Rights in 2008. Since 2013, 1.1 million profiles
(of about seven million) have been deleted to eradicate profiles of innocents from the
data bank.
Despite the risks that such a universal system poses to people’s freedoms, the
government may not seem overly worried. A new survey of public opinion on issues
related to DNA databases has found that a more censorious approach against wider
national data banks is connected to the age and schooling of participants. There is a
34 DNA Databases: Risks, Benefits, Privacy, and Human Rights 673
need to raise awareness of the risks and benefits of very large-scale DNA collections
and to follow specific ethical and privacy principles for the creation and regulation of
DNA repositories where citizens’ views are taken into account.
The usage of DNA to locate individuals accused of perpetrating an offence has been
a big move forward in the world of policing. If profiling is used cautiously, it can
serve to prosecute people who have committed atrocious crimes or to absolve others
those who are innocence. Nevertheless, issues occur if individual’s tissue samples,
computerized DNA profiles, and personal records are retained permanently in a
DNA database. It is worried that this knowledge may be used in ways that jeopardize
the privacy and rights of individuals and their families. The retention of an
individual’s DNA profiles and other information on a computer database thus allows
a form of “bio-surveillance” or biological tagging, which can be applied to ascertain
where they have been. This assures that DNA repositories may be used to identify
people who have not perpetrated a crime or whose “crime” is a nonviolent protest or
confrontation. For instance, in a nation where freedom of speech and democratic
freedoms are limited, the government or intelligence services might attempt to
collect DNA samples from a civil gathering to ascertain whether or not certain
people have been involved. DNA repositories link searchable computer records of
personal demographics, with the potential to biotag an entity and monitor their
position using their DNA profile. Family members of an individual can often be
identified through a partial matching of their DNA. There is concern that the Chinese
government are using Genetic tests to censor the country’s overwhelmingly Muslim
Uyghur population. Human rights organizations claim that China has set up a
massive DNA list of Uighurs residing in Xinjiang province, gathering samples
without approval from approximately 36 million people as part of a free medical
check-up scheme. Chinese scientists in 2014 released a report explaining how to
separate Uighurs from other ethnic groups by utilizing DNA testing (Independent n.
d.-a). DNA databases therefore dramatically change the balance-of-power from
individual to state.
“Bio-surveillance” concerns stretch outside the state to anybody who may breach
the system and gain access to the person’s DNA profile. That may involve organized
criminal or terrorist organizations, or someone trying to locate a person. People on
witness protection schemes, for example, can have their image changed but cannot
modify their DNA. When someone is aware of them and gathers their DNA, their
identification may be disclosed by comparing it to the DNA profile contained in the
database, whether it is available and connected to their old identity. Their families
may also be identified through “familial searching” (seeking partial matches with
other people’s DNA profiles in the database).
These issues do not apply exclusively to the collection, retention, access, and
usage of DNA samples that form the basis of the DNA profile, but rather to other
information that may be stored. For example, as DNA is collected on arrest and
674 S. Kumar
34.20 Conclusion
DNA databases are well established in several nations across the globe. These
databases have proven to be a valuable resource in the battle against offence (fast
and equal conviction of crimes, exoneration of accused individuals, and diminishing
ethnic differences in law enforcement), which, from the perspective of public
protection and criminal justice, make such a database extremely appealing. A
number of people have a strong, adverse response to the concept of a DNA reposi-
tory. Their main fear is that having a DNA database would massively intrude on their
privacy and human rights. Safeguards are necessary because:
Maintaining national DNA databases ought to pay heed over the adequacy of
safeguards to secure privacy rights and prevent adverse social impacts.
34 DNA Databases: Risks, Benefits, Privacy, and Human Rights 675
References
42 U.S.C. § 14132 (n.d.) Index to facilitate law enforcement exchange of DNA identification
information
Albujja MH, Bin Dukhyil AA, Chaudhary AR, Kassab AC, Refaat AM, Babu SR, Kumar S (2018)
Evaluation of skin surface as an alternative source of reference DNA samples: a pilot study. J
Forensic Sci 63(1):227–233
Aronson JD (2005) DNA fingerprinting on trial: the dramatic early history of a new forensic
technique. Endeavour 29:126e131. https://doi.org/10.1016/j.endeavour.2005.04.006
Bank, Government of Canada, Royal Canadian Mounted Police, National DNA Data (22 Apr 2001)
National DNA Data Bank
Beekman M, Posthuma D, Heijmans BT, Lakenberg N, Suchiman HED, Snieder H, de Knijff P et al
(2004) Combined association and linkage analysis applied to the APOE locus. Genet Epidemiol
26(4):328–337. https://doi.org/10.1002/gepi.10318
Budowle B, Moretti TR, Niezgoda SJ, Brown BL (1998) CODIS and PCR-based short tandem
repeat loci: law enforcement tools. In: Second European symposium on human identification,
vol 7388. Promega Corporation, Madison, WI
Butler JM (2006) Genetics and genomics of core short tandem repeat loci used in human identity
testing. J Forensic Sci 51:253–265
Butler J (2012) Advanced topics in forensic DNA typing: methodology. Elsevier, London
CNECV—ConselhoNacional de Éticapara as Ciências da Vida (n.d.)
CODIS—combined DNA index system (n.d.). http://www.fbi.gov/hq/lab/codis/index1.html
Coghlan A (9 Oct 2017) Kuwait’s plans for mandatory DNA database have been cancelled. New
Scientist, Accessed 2 Mar 2018
Combined DNA Index System (CODIS) (2018) Federal Bureau of Investigation. Accessed 8 May
2018
Commission, Australian Criminal Intelligence (18 July 2018) National Criminal Investigation DNA
Database
Cotton EA, Allsop RF, Guest JL, Frazier RRE, Koumi P, Callow IP et al (2000) Validation of the
AMPFlSTR® SGM Plus™ system for use in forensic casework. Forensic Sci Int 112
(2–3):151–161
CrimTrac (2014) Annual report. Commonwealth of Australia, Canberra. http://www.crimtrac.gov.
au/about_us/CorporateDocuments.html
Curran T (1997) Forensic DNA analysis: technology and applications. In: Background paper
BP-443E. edBibliothèque du parlement (Ottawa, ON: Parliamentary Research Branch, Library
of Parliament), 43. Available from: http://www.parl.gc.ca/Content/LOP/researchpublications/
bp443-e.htm
Curtis C, Hereward J (29 Aug 2017) From the crime scene to the courtroom: the journey of a DNA
sample. The Conversation. Accessed 14 Oct 2017
Data and Communication Flow in CODIS (PDF) (2017) Sexual assault kit initiative. Accessed
9 Apr 2017
DNA Forensics (n.d.). http://www.dnaforensics.com/familialsearches.aspx
DNA Policy Initiative (n.d.-a). http://dnapolicyinitiative.org/wiki/index.php?title¼Global_
summary
DNA Policy Initiative (n.d.-b) France. http://dnapolicyinitiative.org/wiki/index.php?title¼France.
Accessed 26 Apr 2020
DNA Policy Initiative (n.d.-c). http://dnapolicyinitiative.org/wiki/index.php?title¼China
FBI CODIS Core STR Loci (2015) National Institute of Standards and Technology, 26 Aug 2015.
Accessed 29 Dec 2017
Federal Bureau of Investigation (2017) Frequently asked questions on CODIS and NDIS. Federal
Bureau of Investigation. Accessed 6 Mar 2017
Ferreira ST, Paula KA, Maia FA, Svidizinski AE, Amaral MR, Diniz SA, Siqueira ME, Moraes AV
(2015) The use of DNA database of biological evidence from sexual assaults in criminal
676 S. Kumar
investigations: a successful experience in Brasília, Brazil. Forensic Sci Int Genet Suppl Ser 5:
e595–e597. https://doi.org/10.1016/j.fsigss.2015.09.235
Field, D (3 Sept 2015) Kuwait’s war on ISIS and DNA. Oxford University Press Blog. Accessed
10 Oct 2015
Forensics: Fingering Criminals Using DNA (2017) For dummies. Accessed 6 Mar 2017
GeneWatch UK—Germany (2016). genewatch.org. Accessed 29 Dec 2016
Genomics Medicine (n.d.). https://genomicsmed.ie/genomics-medicine-ireland-raises-40-million-
series-funding/
Germany’s DNA Database (2016) Accessed 29 Dec 2016
Gill P, Jeffreys AJ, Werrett DJ (1985) Forensic application of DNA ‘fingerprints’. Nature
318:577e579. https://doi.org/10.1038/318577a0
Global Offender Data Base (2014) Tim Schellberg Gordon Thomas Honeywell Government Affairs
Tbilisi, Georgia. Available from: http://www.slideplayer.com/slide/6660048/. Last cited 10 Oct
2017
Haas C, Voegeli P, Hess M, Kratzer A, Bär W (1 Apr 2006). A new legal basis and communication
platform for the Swiss DNA database. In: International congress series. Progress in forensic
genetics 11 proceedings of the 21st international ISFG congress held in Ponta Delgada, The
Azores, Portugal between 13 and 16 Sept 2005, vol 1288, pp 734–736. https://doi.org/10.1016/j.
ics.2005.11.040
Harbison SA, Hamilton JF, Walsh SJ (2001) The New Zealand DNA databank: its development and
significance as a crime solving tool. Sci Justice 41(1):33–37. https://doi.org/10.1016/S1355-
0306(01)71846-1
Hayhurst C (2016) Melanie road murder: how a remarkable 32-year-old murder cold case was
solved. The Independent, 10 May 2016. Available from: http://www.independent.co.uk/news/
uk/crime/melanie-road-murder-how-dna-collected-in-1984-solved-the-32-year-old-case-with-
christopher-hampton-a7022056.html. Cited 20 June 2018
Hindmash R, Prainsack B (eds) (2010) Genetic suspects: global governance of forensic DNA
profiling and databasing. Cambridge University Press, Cambridge, p 154. ISBN:
978-0521519434
Home Office (1989) DNA profiling in immigration casework. Report of a pilot trial by the Home
Office and Foreign and Commonwealth Office. Home Office, London
Independent (n.d.-a). https://www.independent.co.uk/news/world/asia/china-expands-dna-testing-
xinjiang-muslims-security-crackdown-human-rights-watch-a7739791.html
Independent (n.d.-b). https://www.independent.co.uk/news/world/africa/rwanda-dna-database-
human-rights-privacy-a8832051.html
Institute of Environmental Science and Research Website (2013). www.esr.cri.nz
International Forensic Sciences (n.d.) DNA Labs India (DLI), Truth Labs and Bio-Axis DNA
Research Centre (P) Limited
Interpol. Global DNA Profiling Survey Results (2016). https://www.interpol.int/INTERPOL-exper
tise/Forensics/DNA/Media-library/INTERPOL-Global-DNASurvey-Results-2016. Accessed
22 Feb 2019
Irish Times (n.d.-a). https://www.irishtimes.com/special-reports/r-d-ireland/genomics-exploring-
new-horizons-1.3985051
Irish Times (n.d.-b). https://www.irishtimes.com/opinion/ireland-putting-profit-before-people-
with-genomic-medicine-strategy-1.3944438
ISIL claims responsibility for Kuwait Shia mosque blast (2015) Al Jazeera, 27 June 2015. Accessed
10 Oct 2015
Jamaica Observer (2016) Italy creates national DNA database to enhance anti-terror fight. Jamaica
Observer, 26 Mar 2016. Accessed 11 May 2017
Jeffreys A (2005) Genetic fingerprinting. Nat Med 11:1035–1039. https://doi.org/10.1038/nm1005-
1035
Jeffreys AJ, Wilson V, Thein SL (1985a) Individual-specific “fingerprints” of human DNA. Nature
316:76e79. https://doi.org/10.1038/316076a0
34 DNA Databases: Risks, Benefits, Privacy, and Human Rights 677
Jeffreys AJ, Brookfield JFY, Semeonoff R (1985b) Positive identification of an immigration test-
case using human DNA fingerprints. Nature 317:818e819. https://doi.org/10.1038/317818a0
Kumar S, Verma AK, Singh P, Singh R (2016). Current scenario of forensic DNA databases in or
outside India and their relative risk. Egyptian J Forensic Sci 6(1):1–5.
Käppner J (2016) Justiz: VerräterischeProben (in German). SüddeutscheZeitung. Accessed 29 Dec
2016
Le Canard enchaîné (2009) “L’ADN fiche la trouille”, article of Dominique Simonnot, mercredi
16 septembre 2009, p 4 (in French)
Le Monde (2007) A 8 et 11 ans, ilssontmenacés de fichagegénétique pour vol de jouetsdans Le
Monde daté du 05 mai 2007 (in French)
Ley 78/2015 de Kuwait (consulted 5 Dec 2016). Available from: http://kuwaitalyawm.media.gov.
kw/content/%D9%82%D8%A7%D9%86%D9%88%D9%86-78
Livemint (n.d.). https://www.livemint.com/Politics/hFVRzai11wlgloIlr6zuZP/Proposed-DNA-data
base-greatly-expands-scope-of-surveillance.html
Machado H, Silva S (2014) Would you accept having your DNA profile inserted in the National
Forensic DNA database? Why? Results of a questionnaire applied in Portugal. Forensic Sci Int
Genet 8:132–136. https://doi.org/10.1016/j.fsigen.2013.08.014
Maguire CN, McCallum LA, Storey C, Whitaker JP (2013) Familial searching: a specialist forensic
DNA profiling service utilising the National DNA Database Òto identify unknown offenders via
their relatives—the UK experience. Forensic Sci Int Genet 8:1–9. https://doi.org/10.1016/j.
fsigen.2013.07.004
McCartney C (2006) The DNA expansion programme and criminal investigation. Br J Criminol
46:175e192. https://doi.org/10.1093/bjc/azi094
Milot E, Lecomte MM, Germain H, Crispino (2003) The National DNA Data Bank of Canada: a
Quebecer perspective. Front Genet 4:249
Milot E, Marie L, Hugo G, Frank C (2013) The national DNA data bank of Canada: a Quebecer
perspective. Front Genet 4:249
Minister for Justice Michael Keenan (5 Nov 2015) New super agency to tackle emerging threats
(Press release). Accessed 9 Dec 2016
Mobbs JD (2001) Crimtrac-technology and detection. In: Fourth national outlook symposium on
crime in Australia, New crimes or new responses, Canberra
National DNA Data Bank (2013) Archived 2013-06-25 at the Wayback Machine
National DNA Database Statistics, Q1 2015 to 2016 (2015) National DNA Database statistics. UK
Government Home Office. Accessed 11 Oct 2015
National DNA Intelligence Databases in Europe (2016) Report on the current situation (PDF).
Accessed 29 Dec 2016
Negri G (26 Mar 2016) Italy approves DNA database to fight crime. Il Sole 24 Ore, English edition.
Accessed 11 May 2017
Newropeans Magazine (n.d.) The European perspective. Preparing for the world of tomorrow
Ope Letter Stop the police’s DNA collection frenzy! (PDF) (2016) Accessed 29 Dec 2016
Ouvrez la bouche (2009) vousêtesfiché, article in Le Monde, of 18 Sept 2009
Peerenboom E (1998) Central criminal DNA database created in Germany. Nat Biotechnol
16:510–511. https://doi.org/10.1038/nbt0698-510
Police RCM (2012) The national DNA data bank of Canada. In: Annual Report (ed) Forensic
science and identification services. Royal Canadian Mounted Police, Ottawa, ON, pp 1–30
Procedure for CODIS (2017) 10. North Carolina Department of Justice, 28 Dec 2015. Accessed
13 May 2017
Sanhati (n.d.). http://sanhati.com/excerpted/5753/
Schneider P (1998) Datenbankenmitgenetischen Merkmalen von Straftätern. Werdendurch die
forensische DNA-Analyse persönlichkeitsrelevante Merkmale aufgedeckt, pp 330–333
Schultz S (2016) Stop the DNA collection frenzy!: expansion of Germany’s DNA database.
Forensic Genetics Policy Initiative. Accessed 29 Dec 2016
Skinner D (14 July 2010) Sociology 52: 13: Machado and Silva: Forensic DNA in Portugal
678 S. Kumar