Original Article

Page 1 of 24

Functional differences and similarities in activated

peripheral blood mononuclear cells by lipopolysaccharide or
phytohemagglutinin stimulation between human and cynomolgus
monkeys
Zhi Lin#, Ying Huang#, Hua Jiang, Di Zhang, Yanwei Yang, Xingchao Geng, Bo Li

National Institute for Food and Drug Control, National Center for Safety Evaluation of Drugs, Beijing Key Lab for Preclinical Safety Evaluation of
Drugs, Beijing, China
Contributions: (I) Conception and design: Z Lin, Y Huang; (II) Administrative support: B Li, X Geng; (III) Provision of study materials or patients:
X Geng, B Li; (IV) Collection and assembly of data: Z Lin, H Jiang; Y Yang, D Zhang; (V) Data analysis and interpretation: Z Lin, Y Huang; (VI)
Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.
#
These authors contributed equally to this work.
Correspondence to: Dr. Xingchao Geng. National Institute for Food and Drug Control; National Center for Safety Evaluation of Drugs, The Beijing
Key Lab for Pre-clinical Safety Evaluation of Drugs, Beijing 100176, China. Email: [email protected]. Dr. Bo Li. National Institute for Food and
Drug Control, National Center for Safety Evaluation of Drugs; Beijing Key Lab for Preclinical Safety Evaluation of Drugs, Beijing 100176, China.
Email: [email protected].

Background: The monkey is a primary species used in toxicological research. However, the failures of
preclinical studies to predict a life-threatening “cytokine storm”, which, for instance, rapidly occurred in six
healthy volunteers with the CD28 superagonist monoclonal antibody (mAb) TGN1412 in the first-in-human
phase I clinical trial, have emphasized a need to clarify the differences between human and monkey immune
systems.
Methods: In the present study, we analyzed and compared the lymphocyte proliferation, cytokine secretion,
and gene expression profiles after phytohemagglutinin (PHA) and lipopolysaccharide (LPS) stimulation of
peripheral blood mononuclear cells (PBMCs) from three healthy humans and cynomolgus monkeys (Macaca
fascicularis).
Results: The results derived from comparison with the corresponding control groups showed that PHA in
humans induced a stronger proliferation and wider range of cytokine secretion, along with a greater number
of differently expressed genes (DEGs), than when PHA was applied in cynomolgus monkeys. The significant
upregulation of genes involved in the mitotic cell cycle, including cyclin B2, TOP2A, TYMS, and CEP55, was
observed in human PBMCs with PHA stimulation, while only infrequent or slight upregulation occurred in
cynomolgus monkey PBMCs, which may be one of the reasons for a stronger response to PHA in humans.
In contrast to PHA, LPS in both species induced a similar proliferation ratio, cytokine profile, and DEG
count, suggesting that human and cynomolgus monkeys have a similar response intensity for innate immune
responses. Furthermore, 38 and 20 overlapped genes under PHA and LPS stimulation, respectively, were
found in both species. These overlapped DEGs were associated with the same biological functions, including
DNA replication, mitosis, immune response, chemotaxis, and inflammatory response. Thus, these results
might reflect the highly conserved signatures of immune responses to PHA/LPS stimulation across the
primates. Moreover, there were some differences in antigen processing and presentation, and the interferon
gamma (INF-γ)–mediated signaling pathway in these species detected by gene expression profile study.
Conclusions: In conclusion, this is the first study to compare data on the responses of PBMCs to PHA and
LPS in humans versus cynomolgus monkeys, and these findings may provide crucial insights into translating
non-human primate (NHP) studies into human trials.

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 2 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

Keywords: Non-human primates (NHPs); immunotoxicity; toxicogenomics; lipopolysaccharide (LPS);

phytohemagglutinin (PHA)

Submitted Jun 07, 2020. Accepted for publication Oct 30, 2020.
doi: 10.21037/atm-20-4548
View this article at: http://dx.doi.org/10.21037/atm-20-4548

Introduction lower than that in baboon/macaques (7). However, this

study was limited to the steady-state gene expression in
Toxicological research requires animal models that are
the resting state of immune cells, while the functions of
physiologically closely related to one another. There is
stimulated immune cells, including cell proliferation,
good evidence that non-human primates (NHPs), including
cytokine secretion, pathogen clearance, and others, can
rhesus and cynomolgus monkeys (Macaca fascicularis),
better reflect the body’s response to exogenous substances.
closely meet these requirements at both the molecular and
As an alternative, ex vivo/in vitro approaches of immune
developmental levels (1). However, the recently failed first-
cell function trials using PBMCs can be used to assess
in-human clinical trial of TGN1412 (theralizumab) raises
immunotoxicity of a given agent. Furthermore, the
concerns about whether the immune system of NHPs can
information obtained from human and NHPs can facilitate
be used to predict how TGN1412 affects in humans. In
the comparative study of different species under the
that trial, six healthy volunteers suffered severe adverse same treatment conditions (8,9). In addition to classical
events soon after TGN1412 antibody administration, immune cells function trials, microarrays can be a valuable
while preclinical safety testing in cynomolgus monkeys tool for translating data from animals to humans (10-13).
had suggested that TGN1412 could be tolerated without Comparing differences between the expression profiles of
toxicity (2,3). It has been suggested that the immune genes associated with toxicity among various animal and
response to exogenous substances differs between these human tissues to identify the significant key genes expressed
two species. Therefore, comparative studies of the immune in each type of host would provide a better translation of
system, especially the functional differences of immune animal toxicity data to human scenarios (14,15).
cells, in humans and NHPs, could provide valuable Thus, our aim was to compare the differences in
information for better extrapolating animal toxicity data in cell proliferation, cytokine secretion, and gene profiles
preclinical drug safety studies using NHPs. of human and cynomolgus monkey PBMCs under
The immune system is highly complex and capable various stimulations in vitro, to provide new specific
of lifelong renewal. The normal physiological range of primate data for comparative immunology. We chose
variation in the immune system is affected by age, sex, two different stimulations, lipopolysaccharide (LPS) and
environment, and other factors; this diversity presents a phytohemagglutinin (PHA), to induce an innate immune
major challenge in assessing drug-induced immunotoxicity response (LPS stimulation) or lymphocyte proliferation
(4,5). However, research on the anatomical and functional (PHA stimulation) respectively. LPS is a part of the
differences between the immune systems of monkeys and outermost layer of Gram-negative bacteria, and is used to
humans has been limited. Currently, the morphological study the innate immune response after bacterial infection
characteristics and development of the cynomolgus monkey in vitro by pathogen-associated molecular pattern (PAMP).
immune system, including the spleen, lymph nodes, and PHA can activate small lymphocytes to transform into
Peyer’s patches have been reported on (6). Additionally, lymphoblasts, then divide and proliferate, release cytokines,
differences have been found in gene expression of Th1/ and improve the phagocytic ability of macrophages. PHA
Th2 cytokines and their receptors in the peripheral blood binds to specific cell surface carbohydrates on T-cells and
mononuclear cells (PBMCs) of primates. For example, one is often used in immunology studies as a T-lymphocyte
study demonstrated a higher gene expression of interleukin proliferation inducer. Both stimulations were chosen as
4 (IL-4) in humans and chimpanzees compared with that they are typically used to induce distinct types of immune
of baboon/macaques, whereas the expression of interferon responses for further characterization. We observed the
gamma (IFN-γ) and IL-12 genes in humans was shown to distinct features of cell proliferation, cytokine secretion, and

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 3 of 24

gene expression changes in response to both stimulations Sigma) were used to induce lymphocyte proliferation among
with concentration, and here report the molecular cultured PBMCs. In brief, PBMCs obtained from three
mechanisms of the two species in different immune cynomolgus monkeys and three human donors were used.
responses based on the information of gene expression For this, 106 cells/well/host were placed into dedicated wells
microarrays. To our knowledge, this is the first study to of 96-well plates and then received medium containing PHA
report the differences and similarities between the immune (2, 5, or 10 μg/mL final concentration in well) or LPS (2, 5,
responses of PBMCs to LPS and PHA stimulation in or 10 μg/mL final concentration in well) and then incubated
humans versus cynomolgus monkeys. for 3 days at 37 ℃. Cells that received medium only served
We present the following article in accordance with as controls. Lymphocyte proliferation responses were then
the Animal Research: Reporting of In Vivo Experiments measured using a Cell Counting Kit-8 (CCK-8) assay
(ARRIVE) reporting checklist (available at http://dx.doi. (Dojindo, Tokyo, Japan) according to the manufacturer’s
org/10.21037/atm-20-4548). instructions. In brief, 10 μL of CCK-8 solution was added to
each well and the plates were incubated for 4 hours at 37 ℃.
Then, absorbance at 450 nm in each well was measured
Methods
using a SpectraMax Plus microplate reader (Molecular
Isolation of cynomolgus and human PBMCs Devices, Sunnyvale, CA, USA). The proliferation ratio of
PBMCs (%) was the ratio of optical density (OD) value
Blood from three healthy adult male volunteers who had of test well to that of the control well. All samples at each
donated blood to the National Institutes for Food and Drug stimulant dose were evaluated in triplicate.
Control (NIFDC) and who had provided written informed
consent, was obtained. Cynomolgus monkey blood was
obtained from three apparently healthy 2.5-year-old Cytokine expression after exposures to PHA and LPS
male cynomolgus monkeys. All procedures in the animal To detect and compare the expression of cytokines (IFN-γ,
experimental studies were performed under a project license tumor necrosis factor alpha [TNF-α, IL-2, IL-4, IL-5, IL-6,
(IACUC-2013-041) granted by the ethics board of the IL-8, IL-10, IL-12p70, IL-17A, and IL-23) in human and
National Center for Safety Evaluation of Drugs (NCSED), monkey PBMCs after exposure to PHA/LPS, a multiplex
in compliance with the Guide for the Care and Use of Luminex-based assay (eBioscience Inc., San Diego, CA,
Laboratory Animals of the NCSED (China). USA) was used. In brief, similar to in the proliferation study
In all cases, whole blood PBMCs were isolated from noted above, the supernatants from cultures after PHA/
the heparinized samples by Ficoll-Hypaque density LPS treatments (2, 5, or 10 μg/mL) were collected and
centrifugation (Histopaque: ρ=1.119 or 1.077; Sigma, immediately stored at −80 ℃ until analyzed. Quantification
St. Louis, MO, USA) at 2,000 rpm for 30 min. Isolated of each cytokine was performed according to manufacturer
PBMCs had >90% purity based on flow cytometric analyses protocols using a Luminex 200 system (Luminex Corp.,
using CD3, CD20, and CD14 staining (BD Biosciences, Austin, TX, USA). Minimum detectable concentrations of
San Diego, CA, USA). The major PBMC cell types isolated IFN-γ, TNF-α, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-
were T-lymphocytes, B-lymphocytes, and monocytes. The 12p70, IL-17A, and IL-23 were, respectively, 12.2, 8.5, 4.9,
isolated cells were washed twice in Hank’s Balanced Salt 12.2, 7.3, 9.8, 2.4, 2.4, 6.8, 2.4, and 14.6 pg/mL for human
Solution (HBSS) and re-suspended to a final concentration cytokines and 1.0, 16.6, 0.5, 8.8, 10.35, 4.03, 3.2, 0.8, 1.5,
of 106 cells/mL in Roswell Park Memorial Institute (RPMI) 7.0, and 6.7 pg/mL for NHP cytokines. All samples at each
1640 medium supplemented with 10% heat-inactivated stimulant dose were evaluated in triplicate.
fetal calf serum (Gibco, Grand Island, NY, USA). All
experiments using cultured cells were performed in
PBMC gene expression profiles after exposures to PHA and
triplicate.
LPS

To compare gene expression profiles of human and

PBMC lymphocyte proliferation induced by PHA and LPS
cynomolgus monkey PBMCs in response to PHA and LPS,
The PHA (phytohemagglutinin, Sigma) and LPS the PBMCs (106 cells/mL) obtained from cynomolgus or
(lipopolysaccharide, Type O127:B8 from Escherichia coli, human donors were placed in 6-well plates (106 cells/well),

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 4 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

treated with PHA (2 or 10 μg/mL) or LPS (2 or 10 μg/mL), (Table 1). Glyceraldehyde 3-phosphate dehydrogenase
and incubated at 37 ℃ for 72 hours. Cells cultured under (GAPDH) was used as a housekeeping control and to
similar conditions without stimulation served as controls. normalize data.
Total RNA was extracted from PBMCs using Trizol
reagent (Invitrogen, Waltham, MA, USA) according to
Statistical analysis
the manufacturer’s instructions. The RNA purity in each
sample was assessed using a NanoDrop system (NanoDrop For the lymphocyte proliferation, F-tests of two regression
Technologies, Wilmington, NC, USA); RNA integrity line equations were used to compare increasing trends for
was assessed using standard agarose gel electrophoresis. A the lymphocytes in the human and cynomolgus monkey
total of three RNA samples for each group were selected groups. For the Luminex data, a Bartlett test for variance
for subsequent microarray analyses. Purified total RNA homogeneity was performed first; if a result showed no
was amplified and labeled using Agilent Low Input Quick significance (i.e., P>0.05), a one-way analysis of variance
Amp Labeling Kit (Agilent, Santa Clara, CA, USA). Then, (ANOVA) was used. If a result was significant, a Dunnett’s
fluorescence dye-labeled complement RNA (cRNA) test (parameter method) for multiple comparisons was
was hybridized to Agilent 4×44K Human and 4×44K performed. A P value <0.05 was considered significant in the
Monkey Whole Genome GeneChips (Agilent, Palo Alto, ANOVA/Dunnett’s evaluations. For GeneChip microarray
CA, USA). Hybridization, scanning, and washing were data, SAM software and R language package software were
performed on Agilent’s Microarray Platform according to used to identify the DEG and relevant GO terms. All
their standard protocols, and the array data were analyzed results, except for the gene expression data, are expressed as
using Agilent Feature Extraction software (version 10.7). mean ± SD.
After normalization of the raw data, probes with intensities
<400 were removed from the subsequent analysis using Results
significance analysis of microarray (SAM) software.
Differentially expressed genes (DEGs) were identified PBMC lymphocyte proliferation induced by PHA and LPS
as those having an adjusted q-value <0.05 and an average Proliferation responses of PBMC lymphocytes were
fold-change (FC) difference of >1.5. Gene Ontology (GO) measured after 72 hours of stimulation with PHA or LPS
analysis was performed using hypergeometric distribution at 2, 5, and 10 μg/mL. The results showed that with the
in the R-language package software (R Foundation for increasing PHA levels, the proliferation ratio of human and
Statistical Computing, Vienna, Austria). cynomolgus monkey PBMCs increased in a dose-dependent
manner. At a high dose, the mean proliferation ratio of
Validation of the gene expression data using real-time human and cynomolgus monkey PBMCs was 441.3% and
quantitative polymerase chain reaction (qRT-PCR) 187% respectively, and the proliferation of human PBMCs
was significantly higher than that of cynomolgus monkeys
A total of 10 genes that exhibited significant differential (Figure 1). The proliferation trend significantly differed
expression profiles based on the microarray analysis between human and monkey cells, which suggested that the
were chosen for validation by qRT-PCR. Here, 1 µg of proliferation ability of human PBMCs induced by PHA was
DNase-treated total RNA (the same RNA as was used in stronger than that of cynomolgus monkeys (F-test of two
microarrays) was reverse transcribed using an oligo-dT regression line equations; P<0.05).
primer and Moloney murine leukemia virus (M-MLV) After LPS stimulation, compared with negative control
reverse transcriptase (Life Technologies, San Diego, CA, groups, the PBMCs of human and cynomolgus monkeys
USA). Real-time PCR amplification was then performed were increased. At a high LPS level, the mean proliferation
using FastStart Universal SYBR Green Master and a ratio of human and cynomolgus monkey PBMCs were
LightCycler 480 system (Roche Diagnostics, Shanghai, 149.3% and 122%, respectively, and the proliferation curves
China). Running conditions were 3 min at 95 ℃, followed of human and cynomolgus monkey PBMCs were similar
by 45 cycles of 30 sec at 94 ℃ (denaturation), 30 sec at (P>0.05). Therefore, the differential analysis in these two
57 ℃ (annealing), and 30 sec at 72 ℃ (extension). Relative species showed that the lymphocyte proliferation of PBMCs
mRNA expression levels were analyzed using the 2-ΔΔCt varied considerably after PHA treatment in comparison to
method. A total of 18 primers were used in this study the LPS treatment.

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 5 of 24

Table 1 Primer sequences for real-time PCR

Target gene Forward Primer (5'---3') Reverse Primer (3'---5')

Human IL-8 ACATACTCCAAACCTTTCCACC TCAAAAACTTCTCCACAACCC

Human PCNA TTGAAGCACCAAACCAGGA AGAAGGCATCTTTACTACACAGC

Human MCM6 TCAGAGCAGCGATGGAGAAAT CCCGACACAGGTAAGGGTAAA

Human PLK1 AATGACGAGTTCTTTACTTCTGGC TGAGGACTGTGAGGGGCTTC

Human CDKN2C CAGGGGGGACCTAGAGCAA ATGAATGACAGCGAAACCAGTT

Human CCL2 TCAATGCCCCAGTCACCT CCACAATGGTCTTGAAGATCA

Human CD74 GCTGACCCCCTGAAGGTGTA CAAGGAGTGCCTGCTCATTTC

Human IL1A AAGAAGACAGTTCCTCCATTGA GCTTGGATGTTTTAGAGGTTTC

Human CCL3 AGCCCGGTGTCATCTTCCT CACACGCATGTTCCCAAGG

Monkey IL8 CAAGAGCCAGGAACAAACCA GCAAAACTGCACCTTCACACA

Monkey PCNA TCGATAAAGAGGAGGAAGCTG ACCGTTGAAGAGAGTGGAGTG

Monkey MCM6 CATTGGTTGTGAGTTTTGTGG GTCTGGTAGGCAGGTCTTGG

Monkey PLK1 AGGAAGAAGACCCTGTGCG GCAAGAAGTCTCAAAAGGTGGT

Monkey CDKN2C GACCCTAAAGAATGGCCGA GGGATTTCCAAGTTTCATAACC

Monkey CCL2 TGGTGATTCTTCTATAGCTCGCC GGTGATTCTTCTATAGCTCGCC

Monkey CD74 CACATCCTGCCCCTCAAAA AACCCCTGGCTCACCTCTT

Monkey IL1A AATGACACCCTCAATCAAACTA TCATCTTGGGCACTCACATA

Monkey CCL3 ACTGCTGCCCTTGCTGTCCT TGGCTGTTGGTCTCAAAGTAGTCA

A PHA B LPS
500 200
Human * Human
450 180
Monkey Monkey
Proliferation ratio of PBMCs (%)

Proliferation ratio of PBMCs (%)

400 160
350 140
300 120
250 100
200 80
150 60
100 40
50 20
0 0
Control 2 μg/mL 5 μg/mL 10 μg/mL Control 2 μg/mL 5 μg/mL 10 μg/mL

Figure 1 Lymphocyte proliferation in response to PHA or LPS. Proliferation by human and cynomolgus PBMCs were measured via CCK-8
assay. An F-test of two regression line equations was used to compare trends for proliferation rates between human and monkey cells. Lines
in red and blue indicate trend curves for proliferation of the human and monkey PBMCs, respectively. (A) The trend for the proliferation of
PBMC was significantly different between humans and cynomolgus monkeys after PHA stimulation (*, P<0.05). (B) No significant difference
in trends for proliferation was noted between human and cynomolgus monkey cells after LPS stimulation. PHA, phytohemagglutinin; LPS,
lipopolysaccharide; PBMC, peripheral blood mononuclear cells; CCK-8, Cell Counting Kit-8.

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 6 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

Cytokine formation by human and cynomolgus PBMC in humans and 10,273 probes in monkeys. According to
induced by PHA and LPS the ratio value of “treatment/control, the DEGs were
identified by SAM (two-class unpaired analysis) software.
Production of INF-γ, TNF-α, and IL-2, -4, -5, -6, -8, -10,
The number of DEGs obtained after PHA/LPS treatments
-12p70, -17A, and -23 induced by PHA and LPS in isolated
are listed in Figure 4. Compared with the control group,
human and cynomolgus PBMCs are shown in Figures 2,3
after 2 or 10 μg/mL of PHA stimulation, the number of
(summarized in Table 2).
DEGs in human PBMCs were 115 (41 upregulated genes,
Compared with the control group, 10 µg/mL PHA
74 downregulated genes) and 1,510 (610 upregulated genes,
could induce a significant increase in the secretion of all
900 downregulated genes), respectively; under the same
cytokines in human PBMCs, and the secretion of INF-γ,
conditions, DEGs in cynomolgus monkey PBMCs were 21
TNFα, IL-2, -8, -10, -12p70, -17A, and -23 in cynomolgus
(5 upregulated genes, 16 downregulated genes) and 166 (91
monkey PBMCs was significantly increased. Interestingly,
upregulated genes, 75 downregulated genes), respectively
at 10 µg/mL PHA, the secretion of INFγ, TNFα, and IL-5,
(Figure 4A). The results showed that the number of DEGs
-6, and -10 in human PBMCs were approximately 10–200 increased with the increase in dose in both species. Notably,
times higher than those in cynomolgus monkey PBMCs, the number of DEGs in human PBMCs was approximately
with the contents close to 600–5,000 pg/mL, indicating that nine times higher than that in cynomolgus monkeys at
human PBMCs secreted a much higher level of cytokines 10 μg/mL PHA.
than cynomolgus monkeys under the same conditions of With regard to LPS (Figure 4B), the total DEGs in
PHA treatment. However, unlike other cytokines, IL-8 and relation to monkey cells in human cells stimulated with
IL-23 secreted by human and cynomolgus monkey PBMCs 2 and 10 μg LPS/mL was 341 and 810, and 588 and 562,
showed a similarly elevated level after PHA stimulation, respectively. In contrast with PHA treatment, there was no
with no significant difference between them. apparent difference in the number of DEGs between human
Overall, the secretion of cytokines by human and and cynomolgus monkey PBMCs after LPS stimulation.
cynomolgus monkey PBMCs after LPS stimulation, The striking differences in the number of DEGs between
regardless of the types of cytokines or secretion levels, human and cynomolgus monkeys after PHA treatment
were lower than that of PHA treatment in both species. might explain the considerable diversities of lymphocyte
After 10 µg/mL of LPS stimulation, compared with the proliferation results across these two species. For the reader,
control group, the secretion of INF-γ, IL-2, -6, -8, and -10 the raw microarray data have been deposited in the Gene
cytokines in human PBMCs increased significantly, and the Expression Omnibus (GEO) database under accession
secretion of IL-2, -6, -8, and -10 cytokines in cynomolgus number GSE90723.
monkey PBMCs increased significantly. Except for INF-γ,
the secretion levels of cytokines were similar between the
two species. Among them, IL-6 and IL-8 secreted by human Comparing functional groups of DEGs by GO enrichment
and cynomolgus monkey PBMCs were significantly increased analysis after PHA stimulus
under three different doses of LPS, and their secretion GO enrichment analysis was performed to identify
contents were close to 3000–10,000 pg/mL, which were much significant functional groups of genes that reflected changes
higher than those of the other cytokines. These results in human and monkey PBMCs after mitogen stimulation.
suggested that LPS induces similar cytokine secretion The significant GO terms describing major biological
responses in human and cynomolgus monkey PBMCs processes (BPs) impacted by PHA/LPS are noted in Table 3.
and that IL-6 and IL-8 are relatively more pronounced Venn diagrams of the DEGs were generated to compare
cytokines. However, most notably, IL-5 was not detected gene expression profiles between human and monkey
(value below standard curve limits) in monkey cultures that PBMCs stimulated with PHA or LPS (Figure 5).
received either PHA or LPS. The results of the GO analysis indicated that the DEGs in
human PBMCs under the PHA stimulation were significantly
enriched in BPs, which included immune response, mitotic
Comparing numbers of DEGs in human and cynomolgus
cell cycle, and cytokine-mediated signaling pathway
PBMCs after PHA/LPS stimulation
(P value =−2.22×10-16, 3.33×10-16, 3.33×10-16, respectively),
The resulting microarray platform included 11,914 probes in addition to other biological groups related to DNA

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 7 of 24

pg/mL IFN-γ pg/mL TNF-α pg/mL IL-2

2500 3000
Human ** Human * 50
Human
Monkey 2500 Monkey
2000 * *
40
2000
1500 30
1500
1000 20
1000
500 10
500
**
* **
0 0 0
Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL) Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL) Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL)

pg/mL IL-4 pg/mL IL-5 pg/mL II-6

25 8000
Human 1200 Human
Human
*
Monkey 7000 Monkey
20 * 1000 Monkey *
6000
15 800 5000
600 4000
10 3000
400
5 2000
200
1000
0 0 0
Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL) Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL) Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL)

IL-8 II-10 IL-12

pg/mL pg/mL pg/mL
4000 1000
Human ** ** Human 35
3500 * Monkey
* Human
Monkey * 800 30 **
3000
Monkey **
25
2500 600
20
2000
400 15
1500
1000 10
200
500 5 *
0 0 ** 0
Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL) Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL) Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL)

pg/mL pg/mL
IL-17 IL-23
500 ** 50
Human Human
**
Monkey Monkey
400 40 ** *
*
300 ** 30

200 20

100 10
**
0 0
Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL) Control PHA (2 μg/mL) PHA (5 μg/mL) PHA (10 μg/mL)

Figure 2 Cytokine profiles of human and monkey PBMCs treated with PHA or control (n=3). Data are presented as the mean ± SD.
Statistically significant differences compared with values of the control group are highlighted by asterisks (*, P<0.05, **, P<0.01). PBMC,
peripheral blood mononuclear cells; PHA, phytohemagglutinin; SD standard deviation.

replication, cell division, etc. (see Table 3). With the increase Under the PHA stimulation, the biological function
of PHA concentration, the number of genes involved in groups involved by most DEGs in cynomolgus monkey
the top 10 biological function groups, including immune PBMCs were related to DNA-dependent DNA replication
response and mitotic cell cycle, increased significantly, at a initiation, ommune response, DNA replication (P value
much higher rate than that of monkeys. =3.30×10-8, 6.29×10-7, and 3.02×10-5, respectively), anti-

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 8 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

pg/mL IFN-γ pg/mL TNF-α pg/mL IL-2

200 700 30
Human Human Human *
Monkey 600 Monkey
25 Monkey
*
150 500
20
400
100 15
300
200 10
50 ** ** **
100 5

0 0 0
Control LPS (2 μg/mL) LPS (5 μg/mL) LPS (10 μg/mL) Control Control
LPS (2 μg/mL)
LPS (2 μg/mL)
LPS (5 μg/mL)
LPS (5 μg/mL)
LPS (10LPS
μg/mL)
(10 μg/mL) Control LPS (2 μg/mL) LPS (5 μg/mL) LPS (10 μg/mL)

pg/mL IL-4 pg/mL IL-5 pg/mL II-6

40 Human
12 10000
Human 35 Monkey Human
10 Monkey
30 8000 Monkey ** **
**
8 25 **
6000
6 20
15 4000 **
4 **
10
2000
2 5
0 0 0
Control LPS (2 μg/mL) LPS (5 μg/mL) LPS (10 μg/mL) Control LPS (2 μg/mL) LPS (5 μg/mL) LPS (10 μg/mL) Control LPS (2 μg/mL) LPS (5 μg/mL) LPS (10 μg/mL)

IL-8 II-10 IL-12

pg/mL pg/mL pg/mL
12000
Human 350 *
**
Human 160
10000 Monkey
300 Monkey
140 Human

250 Monkey
8000 120
* 200 100
6000
150 80
4000 * * 60
* * 100
40
2000 50 ** **
** 20
0 0 0
Control LPS (2 μg/mL) LPS (5 μg/mL) LPS (10 μg/mL) Control LPS (2 μg/mL) LPS (5 μg/mL) LPS (10 μg/mL) Control LPS (2 μg/mL) LPS (5 μg/mL) LPS (10 μg/mL)

pg/mL IL-17 pg/mL IL-23

80 70
Human Human
70
Monkey 60 Monkey
60
50
50
40
40
30 30
20 20
10 10
0 0
Control LPS (2 μg/mL) LPS (5 μg/mL) LPS (10 μg/mL) Control LPS (2 μg/mL) LPS (5 μg/mL) LPS (10 μg/mL)

Figure 3 Cytokine profiles of human and monkey PBMCs treated with LPS or control (n=3). Data are presented as the mean ± SD.
Statistically significant differences compared with values of control group are highlighted by asterisks (*, P<0.05, **, P<0.01). PBMC,
peripheral blood mononuclear cells; LPS, lipopolysaccharide; SD, standard deviation.

apoptosis, and other BPs such as chemotaxis and antigen highest number of genes involved in cynomolgus monkey
processing and presentation. Similarly, in addition to PBMCs, but this included only 9 DEGs, which was far from
antigen processing and presentation, there was an increase the 71 DEGs for this biological function group in human
in PHA concentration in the number of DEGs, but the PBMCs. Through a comparison of the top 10 GO terms
magnitude of increase was much lower. For example, in humans versus monkeys, it was found that the similar
immune response was the biological function with the biological function groups in the two species were mostly

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 9 of 24

Table 2 Cytokines induced by PHA and LPS in human and monkey of 5.8 at 10 μg/mL PHA (see Table 5). The GO enrichment
PHA LPS analysis showed that the RGS8 gene was mainly involved
Cytokines in termination of G-protein coupled receptor signaling
Human Monkey Human Monkey
pathway (GO:0038032). The RGS8 gene can inhibit
IFN-γ X X X O
signaling by increasing the guanosine triphosphate (GTP)
TNF-α X X O O ase activity of G protein α-subunit, which then transforms
IL-2 X X X X into an inactive guanosine diphosphate (GDP) —bound
form. In addition, the top 20 genes, such as MCM4, MCM6,
IL-4 X O O O
and MCM7 acting as MCM complexes, were found to
IL-5 X O O O be upregulated (FC =2.5–3.5). The MCM complex is the
IL-6 X O X X putative replicative helicase essential for once-per-cell-cycle
IL-8 X X X X DNA replication initiation and elongation in eukaryotic
cells, so it participates in DNA replication and promotes
IL-10 X X X X
cell proliferation. The downregulated gene in cynomolgus
IL-12 X X O O monkey PBMCs, CCL2 [chemokine (C-C motif) ligand
IL-17 X X O O 2, FC =0.2], is also a CC chemokine family member, and
IL-23 X X O O
is involved in inflammatory response, immune response,
chemotaxis, cytokine activity, and cytokine-mediated
With PHA/LPS stimulation, statistically significant differences
comparing with values of control group are present as “X”. No
signaling pathway, as confirmed by GO enrichment analysis.
significant differences comparing with values of control group In order to establish bridging biomarkers shared by
are present as “O”. Value significantly different from control human and monkey PBMCs, 21 upregulated genes and
group at P<0.05 or P<0.01. 17 downregulated genes were obtained by comparing the
same DEGs in PBMCs of different species after PHA
treatment (see Figure 5). By correlating the same genes in
associated with immune response, DNA replication, and the overlapped biological functional groups of human and
chemotaxis, suggesting that these three major biological cynomolgus monkeys (see Table 6), it was found that the
functions may be the most basic and critical biological genes related to immune response were C1QC, IL8, and
responses induced by PHA. XCL1, and the genes related to inflammatory response
The cyclin B2 (CCNB2) gene was by far the most and chemotaxis were CCL2 and IL8. In addition, the genes
upregulated gene with a positive Fc of 16.7 at 10 μg/mL PHA related to DNA replication and DNA-dependent DNA
in humans (see Table 4); it was found to be an important replication initiation were MCM6, MCM3, MCM7, MCM4,
regulator of the G2–M phase. The GO enrichment analysis and PCNA, while those related to mitosis and cell division
also showed that CCNB2 participated in 18 GO function were polo-like kinase 1 (PLK1) and CDC20, respectively.
groups, mainly involving G2/M transition of mitotic cell The PLK1 variation was most obvious among these
cycle, mitotic cell cycle, cell division, and other functions. overlapping genes, with a positive FC of 6.9 in humans and
The other top 10 genes, such as TOP2A, TYMS, CEP55, 2.5 in monkeys. One of the members of the polo kinase
CENPF, and KIF23 (FC =16.5–11.3) are also involved in family (PLKs), PLK1, is a cell cycle regulatory factor, which
mitosis, mitotic cell cycle, G1/S phase of mitotic cell cycle, plays important roles in mitosis such as spindle assembly,
regulation of G2/M transition of mitotic cell cycle, and centrosome maturation, chromosome separation, and
DNA replication, among others. The CCL3 [chemokine cytokinesis. It can promote cell mitosis and accelerate cell
(C-C motif) ligand 13, FC =0.01] had the most significantly proliferation in the mitotic M phase.
downregulated expression in human PBMCs. Also known as
monocyte chemoattractant protein 4, CCL3 is a member of
the CC chemokine family and is considered to promote the Comparing biological functions of DEGs by GO
recruitment of monocytes and lymphocytes and participate enrichment analysis after LPS stimulus
in the inflammatory response. Under LPS stimulation, biological function groups involved
For monkeys, the regulator of G-protein signaling 8 by most DEGs in human PBMCs referred to antigen
(RGS8) gene was the most obvious DEG with a positive FC processing and presentation of peptide or polysaccharide

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 10 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

A PHA B LPS
1600
900
Up-regulated Up-regulated
1400 Down-regulated 800 Down-regulated

1200 610 700

Number of DEGs

Number of DEGs
1000 600 419
500
800
400
600
300 568 532
900 176
400 200 391
200 100
41 91 165
5
0 74 16 75 0 20 30
2 μg/mL 10 μg/mL 2 μg/mL 10 μg/mL 2 μg/mL 10 μg/mL 2 μg/mL 10 μg/mL

Human Monkey Human Monkey

Figure 4 Up- and down-regulated genes in human and cynomolgus PBMCs treated with PHA (2 or 10 μg/mL) or LPS (2 or 10 μg/mL)
compared to control. Bar charts in gray and dark represent the number of up- and downregulated genes, respectively. PBMC, peripheral
blood mononuclear cells; PHA, phytohemagglutinin; LPS, lipopolysaccharide.

antigen via major histocompatibility complex (MHC) class detoxification of heavy metals, elimination of free radicals,
II, IFN-γ mediated signaling pathway, ‘immune response stress response, DNA replication and transcription,
(P=0, 1.11×10-16, 3.33×10-16, respectively), and other BPs affecting protein and energy metabolism, and promoting
related to innate immune response, T cell costimulation, cell proliferation. Among the top 10 upregulated genes,
and others (see Table 7). In contrast to PHA, the results the expressions of IL-1β and IL-8 genes were significantly
showed that the number of genes involved in the top 10 upregulated (FC value =15.6 and 6.4, respectively). Also
functional groups increased slightly with the increase of known as lymphocyte stimulating factor, IL-1 is mainly
LPS concentration. produced by activated monocyte macrophages, which can
For monkeys under LPS stimulation, there was a synergistically stimulate the activation of antigen-presenting
significant enrichment of DEGs associated with biological cells (APC) and T cells, promote the proliferation of B cells,
functions related to immune response processes such as secrete antibodies, and contribute to immune regulation.
antigen processing and presentation of peptide antigen Many different cell types can produce IL-8, including
via MHC class I, antigen processing and presentation, macrophages, neutrophils, and epithelial cells, and its main
and immune response (P=−2.22×10 -16 , 0, 8.88×10 -16 , biological activity is to induce and activate neutrophil
respectively). By comparing the top 10 GO biological effector functions, including the release of reactive oxygen
functional groups of humans and cynomolgus monkeys after species (ROS), proteinases, and protective antimicrobial
10 μg/mL LPS treatment, we found that antigen processing peptides. In addition, members of the CXC chemokine
and presentation of peptide or polysaccharide antigen via family, CXCL1, CXCL5, and CXCL2, were also upregulated.
the MHC II and immune response were the same functional In the top 10 downregulated genes, the change of CXCL1
groups in the two species. However, it was interesting that was also obvious.
although antigen processing and presentation via MHC For monkeys after 10 μg/mL LPS stimulation, the most
II are common to both human and cynomolgus monkeys, obvious upregulated DEGs were MHC family members (see
antigen processing and presentation via MHC I (P value Table 9), such as MAMU-A (MHC class I, A), MAMU-B18
=−2.22×10-16) only occur in cynomolgus monkeys. (MHC class I, B), MAMU-I (MHC class I, I), MAMU-E
In the 10 μg/mL LPS treatment group, the most obvious (MHC class I, E), and MAMU-F (MHC class I, F), with a
upregulated gene in human PBMCs was metallothionein FC value of 11.3–8.4. Indeed, this also confirmed that not
1H (MT1H), with a positive FC of 28.6 (see Table 8). The only were more DEGs involved in antigen processing and
MT1H gene is one of the metallothionein function genes, presentation via MCH I in cynomolgus monkey PBMCs,
and is mainly involved in the metabolism of trace metals, but the increase of these DEGs expression was very marked.

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 11 of 24

Table 3 Top-ten biological functions identified by significant enrichment GO analysis in monkey and human PBMCs after PHA stimulation
GO term (biological process) P value# DEGs* (2 μg/mL PHA) DEGs (10 μg/mL PHA)

Human

Immune responseф −2.22×10–16 12 71

–16
Mitotic cell cycle 3.33×10 11 70
–16
Cytokine-mediated signaling pathway 3.33×10 2 43
–16
DNA strand elongation involved in DNA replication 5.55×10 1 21
–15
Interferon-gamma-mediated signaling pathway 2.00×10 0 26
ф –14
DNA replication 3.79×10 4 37
–14
Cell division 4.07×10 10 52
–14
Inflammatory response 5.35×10 11 46

Antigen processing and presentation of peptide or polysaccharide 1.57×10–13 0 12

antigen via MHC class II

M phase of mitotic cell cycle 4.08×10–13 6 28

△
Phosphatidylinositol-mediated signaling 4.74×10–5 6 14
△ ф △ –6
Chemotaxis 1.53×10 7 25
△ △ –6
Mitosis 4.75×10 8 31
△ △ –5
Negative regulation of caspase activity 7.21×10 4 9

Monkey

DNA-dependent DNA replication initiation 3.30×10–8 0 4

ф –7
Immune response 6.29×10 6 9
ф –5
DNA replication 3.02×10 0 5

Anti-apoptosis 7.39×10–5 2 5

Chromosome organization 0.00016 0 3

Regulation of cell shape 0.00017 1 4

Astrocyte cell migration 0.00019 1 2

Positive regulation of cholesterol efflux 0.00032 1 2

ф
Chemotaxis 0.00070 1 3

Apoptotic cell clearance 0.00087 1 2

△ △ –13
Antigen processing and presentation of peptide antigen via MHC 3.47×10 5 1
class I
△ △
Antigen processing and presentation 4.07×10–10 5 1
*, DEGs: number of differently expression genes identified by microarray in 2 or 10 μg/mL PHA groups; , P value for enrichment; △, that
#

means these top-ten GO terms are identified in 2 μg/mL PHA group; ф, the same GO terms used in both human and monkey groups.

Similarly, we gathered 10 upregulated genes and 10 same DEGs involved in immune response were C1QC,
downregulated genes common to both humans and CCL3, CD74, CXCL3, IL-1A, and IL-8; those involved in
monkeys after LPS stimulation (see Figure 5). By correlating cytokine-mediated signaling pathway were CD74 and IL-
the same genes in the overlapped GO functional groups 1A; those involved in chemotaxis were CCL3 and IL-8; and
of humans and cynomolgus monkeys, we found that the those involved in inflammatory response were CCL3, IL-

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 12 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

PHA Stimulation LPS Stimulation

UP Down UP Down

579 893 409 381

Human
21 17 10 10 Monkey

58 522 20
70

Figure 5 Venn diagrams of DEGs in human and monkey PBMCs after PHA or LPS stimulation (10 μg/mL). The number of genes that
showed expression changes at a two-fold level are shown. DEGs, differentially expressed genes; PBMC, peripheral blood mononuclear cell;
PHA, phytohemagglutinin; LPS, lipopolysaccharide.

Table 4 Top-ten 10 DE genes in human PBMCs after PHA stimulation

Gene symbol Gene name FC Q-value

Up-regulation

CCNB2 Cyclin B2 16.9 0

TOP2A DNA topoisomerase II alpha 16.6 0

TYMS Thymidylate synthetase 13.6 0

CEP55 Centrosomal protein 55 13.5 0

KIAA0101 PCNA Clamp Associated Factor 12.8 0

KIF14 Kinesin family member 14 12.2 0

CENPF Centromere protein F 11.6 0

KIF23 Kinesin family member 23 11.3 0

HMMR Hyaluronan-mediated motility receptor 11.3 0

STAG3 Stromal antigen 3 10.9 0

Down-regulation

CCL13 C-C motif chemokine ligand 13 0.01 2.840

CLC Charcot-Leyden crystal galectin 0.02 2.840

FCER1A Fc fragment of IgE receptor Ia 0.02 2.840

MS4A6A Membrane spanning 4-domains A 6A 0.03 2.840

CPVL Carboxypeptidase vitellogenic-like 0.03 2.840

FUCA1 Alpha-L-fucosidase 1 0.03 2.840

STAB1 Stabilin 1 0.04 2.840

ALDH1A1 Aldehyde dehydrogenase 1 family member A1" 0.05 2.840

GPNMB Glycoprotein nmb 0.05 2.840

FC, fold change.

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 13 of 24

Table 5 Top-ten 10 DE genes in monkey PBMCs after PHA stimulation

Gene symbol Gene name FC Q-value

Up-regulation

RGS8 Regulator of G-protein signaling 8 5.8 0

XCL1 Chemokine (C motif) ligand 1 4.9 0

TOP2A DNA topoisomerase II alpha 4.7 1.962

CDC20 Cell division cycle 20 4.2 0

CENPW Centromere protein W 4.1 0

MCM4 Minichromosome maintenance complex component 4 3.5 0

PTTG1 PTTG1 regulator of sister chromatid separation, securin 3.4 0

CENPM Centromere protein M 3.3 0

LOC701198 Cytochrome c oxidase assembly factor 1 homology 3.1 0

LOC712754 regulator of G protein signaling 1 3.1 0

Down-regulation

MS4A4A Membrane spanning 4-domains A4A 0.1 0

C1QA Complement C1q A chain 0.1 0

CCL2 C-C motif chemokine ligand 2 0.2 0

HMOX1 Heme oxygenase 1 0.2 0

CTSL Cathepsin L 0.2 0

SLC40A1 Solute carrier family 40 member 1 0.3 0

LOC715159 Cathepsin L-1 pseudogene 0.3 0

SELENOP Selenoprotein P 0.3 0

SLCO2B1 Solute carrier organic anion transporter family member 2B1 0.3 0
FC, fold change.

1A, and IL-8 (see Table 10). Among these genes, IL-8 gene which MCM2-7, PCNA, RFC2-5, CDK2, and RPA were
expression was most the upregulated, with a FC of 6.4 in significantly upregulated; meanwhile, there were 6 DEGs in
humans and 2.0 in monkeys. cynomolgus monkey PBMCs, with MCM2-7, PCNA, and
RPA being similarly upregulated. The overlapped cell cycle
pathway contained 27 DEGs in human PBMCs, but only 10
Comparing KEGG pathways of DEGs by enrichment
DEGs were present in cynomolgus monkey PBMCs after
analysis after PHA/LPS stimulus
PHA stimulation. The results showed that the numbers
We analyzed the pathway function enrichment of the of upregulated human genes were higher than those of
selected differential genes, and listed the top 10 pathway cynomolgus monkeys despite these species having the same
names according to P value (see Tables S1,S2). pathways.
In the PHA treatment groups, the two most important In the LPS treatment groups, only graft-versus-host
pathways in both human and cynomolgus monkey PBMCs disease [P value: 0.00215 (human), 4.44×10-16 (monkey)] was
were DNA replication [P value =1.11×10 -16 (human), the same signaling pathway in the two species. Interestingly,
7.57×10 -7 (monkey)] and cell cycle [P value =1.44×10 -15 there were 16 genes involved in cynomolgus monkey
(human), 1.39×10 -7 (monkey)]. In the DNA replication PBMCs, and only 4 involved in human PBMCs. The
pathway, there were 18 DEGs in human PBMCs, among obvious upregulated genes in cynomolgus monkey PBMCs

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 14 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

Table 6 Overlap DE genes in human and monkey PBMCs after PHA stimulation
GO term (P value) Overlap DEGs (FC: h/m) UniqH DEGs UniqM DEGs

Immune response: C1QC (0.1/0.4); 1Mar; C3; C5AR1; CBLB; CCL13; CCL8; CCR1; CCR2; CD274; CCL11; CCL18;
(Ph =−2.22×10–16); IL8 (0.4/0.5); CD28; CD7; CD74; CD8A; CD8B; CFP; CIITA; CMKLR1; CTLA4; CCL2; CD40LG;
(Pm =6.29×10–7) XCL1 (2.9/4.9) CTSC; CTSS; CXCL1; CXCL10; CXCL2; CXCL3; ENPP2; FCGR2B; LOC714964;
FCGR2C; FCGR3A; FCGRT; FTH1; HLA-DMA; HLA-DMB; HLA- SERPINB9
DPA1; HLA-DPB1; HLA-DQA1; HLA-DQA2; HLA-DQB1; HLA-DRA;
HLA-DRB1; HLA-DRB3; HLA-DRB4; HLA-DRB5; ICOS; IGF1R; IGJ;
IGLL1; IGSF6; IL10; IL1A; IL1RAP; IL2RA; IL6; IL7R; LILRB2; LST1;
LTB; NCF4; PDCD1LG2; PPBP; PTAFR; RGS1; SAMHD1; SECTM1;
TGFBR3; TLR1; TLR2; TLR4; TNFRSF4

Inflammatory CCL2 (0.2/0.2); AIF1; AOAH; APOL3; C3; C3AR1; CCL13; CCL8; CCR1; CCR2; CCL11; CD40LG
response: IL8 (0.4/0.5) CCR3; CD14; CD163; CLEC7A; CXCL1; CXCL10; CXCL2; CXCL3;
(Ph =5.35×10–14); CYBA; CYBB; GGT5; IL10; IL1A; IL1RAP; IL6; LY86; LY96; MGLL;
(Pm =0.00095) MMP25; MS4A2; NFAM1; NLRP3; OLR1; PTAFR; RXRA; S100A12;
S100A8; S100A9; SERPINA1; SIGLEC1; STAB1; TLR1; TLR8;
TNFAIP6

Chemotaxis: CCL2 (0.2/0.2); C3AR1; C5AR1; CCL13; CCL8; CCR1; CCR2; CCR3; CMKLR1; CCL11
(Ph =1.64×10–8); IL8 (0.4/0.5) CX3CR1; CXCL1; CXCL10; CXCL2; CXCL3; CXCR3; ENPP2; FPR1;
(Pm =0.00070) FPR3; PLAU; PPBP; PTAFR; S100A8; S100A9

DNA replication: MCM6 (4.6/2.9); BLM; BRCA1; CDK2; CENPF; CHAF1A; DBF4; DUT; GINS2; GINS3;
(Ph =3.79×10–14); MCM3 (2.8/3.0); GINS4; LIG1; MCM2; MCM5; MCM8; NASP; POLA1; POLA2;
(Pm =3.02×10–5) MCM7 (3.1/2.5); POLD1; PRIM1; PRIM2; RBBP7; RFC2; RFC3; RFC4; RFC5; RMI1;
MCM4 (4.0/3.5); RPA3; RRM1; RRM2; TK1; TOP2A
PCNA (4.4/2.8)

DNA–dependent DNA MCM6 (4.6/2.9); CCNE1; MCM2; MCM5; POLA1; POLA2; PRIM1
replication initiation: MCM3 (2.8/3.0);
(Ph =1.25×10–8); MCM7 (3.1/2.5);
(Pm =3.30×10–8) MCM4 (4.0/3.5)

Cell division: CDC20 (3.4/4.2) 10Sep; ANXA11; AURKA; BIRC5; C13orf34; CCDC99; CCNA2;
(Ph =4.07×10–14); CCNB1; CCNB2; CCNE1; CCNE2; CDCA8; CDK1; CDK2; CDK6;
(Pm =0.13773) CENPF; CENPH; CEP55; CKS1B; CKS2; DSN1; FBXO5; HAUS1;
HAUS4; HAUS8; KIF11; KIF20B; KNTC1; LATS2; LIG1; MAD2L1;
MASTL; MIS18BP1; NCAPD2; NCAPD3; NCAPG2; NUP37;
NUSAP1; OIP5; PTTG1; SKA2; SMC4; TIMELESS; TIPIN; TPX2;
TUBA1B; TUBB; UBE2C; UBE2S; ZWILCH

Mitosis: PLK1 (6.9/2.5) AURKA; BIRC5; CCNA2; CCNB2; CDK1; CDK2; CEP55; HAUS1;
(Ph =1.13×10–7); HAUS4; HAUS8; KIF11; KIF22; KIF23; LATS2; MAD2L1; MASTL;
(Pm =0.10771) MIS18BP1; NCAPD2; NCAPD3; NCAPG2; OIP5; PKMYT1; PTTG1;
SKA2; TIMELESS; TIPIN; TPX2; TUBB; UBE2C
FC, fold change; Ph, P value of human; Pm, P value of monkey; h/m, human/monkey.

were mainly MAMU family members, which participate such as trypanosomiasis, amoebiasis, malaria, and
in antigen processing and presentation, and this was leishmaniasis.
consistent with the results of GO analysis. In contrast,
IFNγ, IL-1α, IL-1β, and IL-6 were the upregulated genes
Validation of DEGs by qRT-PCR
in the human PBMC pathway. These genes were also
involved in the cytokine-cytokine receptor interaction A set of 10 genes was selected for microarray data validation
signaling pathway and other parasitic infectious diseases by qRT-PCR. The genes were chosen according to their

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 15 of 24

Table 7 Top-ten biological functions identified by significant enrichment GO analysis in monkey and human PBMCs after LPS stimulation

GO term (biological process) P value# DEGs* (2 μg/mL LPS) DEGs (10 μg/mL LPS)

Human

Antigen processing and presentation of peptide or 0 11 13

polysaccharide antigen via MHC class IIф

Interferon-gamma-mediated signaling pathway 1.11×10–16 14 23

ф –16
Immune response 3.33×10 32 53
–16
Cytokine-mediated signaling pathway 1.11×10 19 33
–11
Chemotaxis 1.11×10 13 21
–11
T cell co-stimulation 5.18×10 11 16
–10
Inflammatory response 1.58×10 17 27
–9
T cell receptor signaling pathway 2.89×10 11 15
–8
Innate immune response 9.11×10 13 23

Platelet degranulation 3.13×10–7 6 13

△ △ –6
Phagocytosis, recognition 2.60×10 3 3
△ △ –5
Positive regulation vascular endothelial growth factor 1.08×10 4 5
production

Monkey

Antigen processing and presentation of peptide antigen via −2.22×10–16 13 13

MHC Class I

Antigen processing and presentation 0 22 23

ф –16
Immune response 8.88×10 30 33
–9
Antigen processing and presentation of peptide or 2.83×10 6 6
polysaccharide antigen via MHC class IIф

Chaperone-mediated protein folding requiring cofactor 0.00015 3 3

Sarcomere organization 0.00028 3 3

Positive chemotaxis 0.00061 2 3

Cellular iron ion homeostasis 0.00092 0 3

Aerobic respiration 0.00148 1 2

Antigen processing and presentation of exogenous peptide 0.00148 2 2

antigen via MHC Class II
△ △
Electron transport chain 0.00017 4 3
△ △
Translation 0.00125 9 8
△ △
ATP synthesis coupled electron transport 0.00150 2 2
*, DEGs: number of differently expression genes identified by microarray in 2 or 10 μg/mL LPS groups; #, P value for enrichment; △, that
means these top-ten GO terms are identified in 2 μg/mL LPS group; ф, the same GO terms used in both human and monkey groups.

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 16 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

Table 8 Top-ten 10 DE genes in human PBMCs after LPS stimulation

Gene symbol Gene name FC Q-value

Up-regulation

MT1H Metallothionein 1H 28.6 0

CXCL1 C-X-C motif chemokine ligand 1 24.2 0

MT1G Metallothionein 1G 19.3 0

CXCL1 C-X-C motif chemokine ligand 1 16.8 0

IL1B Interleukin 1 beta 15.6 0

IL8 Interleukin 8 6.4 0

CXCL5 C-X-C motif chemokine ligand 5 14.0 0

CXCL2 C-X-C motif chemokine ligand 2 8.1 0

RETN Resistin 7.8 11.047

MT1M Metallothionein 1M 7.6 0

Down-regulation

LTF Lactotransferrin 0.04 100

ALDH1A1 Aldehyde dehydrogenase 1 family member A1 0.05 100

MS4A6A Membrane spanning 4-domains A6A 0.05 100

C1QA Complement C1q A chain 0.05 100

IFI27 Interferon alpha inducible protein 27 0.07 100

CXCL9 C-X-C motif chemokine ligand 9 0.09 100

APOBEC3B Apolipoprotein B mRNA editing enzyme catalytic subunit 3B 0.09 100

APOC1 Apolipoprotein C1 0.1 100

C1QC Complement C1q C chain 0.1 100

FC, fold change.

similar biological functions in both human and monkey present in a relatively intact environment (16,17). Also,
PBMCs, and included CCL2, IL8, PCNA, MCM6, PLK1, such information from humans can be likewise compared
and CDKN2C after PHA stimulation, and CD74, IL1A, with animals (8). In general, primary immunotoxicologic
IL8, and CCL3 after LPS stimulation (see Figure 6). The functional observations can be monitored in vitro by a
direction of change in the two methods showed a good proliferative response and cytokine releases of lymphocytes
correlation in spite of there being small discrepancies in the provoked with different stimulations (18). Therefore, in
magnitude of change. the current study, the different stimulations expected to
induce either T cell-specific proliferation (PHA) or classic
innate immune response (LPS) were used for the first
Discussion
time to evaluate the similarities and differences in immune
Comparative studies of the physiological or pathological responses of PBMCs of humans and cynomolgus monkeys,
status of the immune system in monkeys and humans can including the aspects of lymphocyte proliferation, cytokine
give us invaluable information for performing immune- secretions, and gene expression profile, which provided
related biomedical studies using NHPs. In vitro approaches primate-specific data for comparative immunology, and
can evaluate immunotoxicity using human PBMSs to also provided valuable information for extrapolating animal
accommodate its complexity, with several cell components data to human in biomedical research using cynomolgus

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 17 of 24

Table 9 Top-ten 10 DE genes in monkey PBMCs after LPS stimulation

Gene symbol Gene name FC Q-value

Up-regulation

MAMU-A Major histocompatibility complex, class I, A 11.3 0

MAMU-B18 Major histocompatibility complex, class I, B 11.3 0

MAMU-A Major histocompatibility complex, class I, A 11.3 0

MAMU-B18 Major histocompatibility complex, class I, B 10.7 0

MAMU-I Major histocompatibility complex, class I, I 10.2 0

MAMU-E Major histocompatibility complex, class I, E 10.2 0

LOC714964 HLA class I histocompatibility antigen, B-67 alpha chain-like 9.6 0

MAMU-E Major histocompatibility complex, class I, E 9.2 0

MAMU-F Major histocompatibility complex, class I, F 8.4 0

ACTB actin beta 7.7 19.539

There were 562 DEG in 10 μg/mL LPS groups after LPS stimulation, but only 30 of them were down regulate with Q-value (%) of 103.376
and FC of 0.269 to 0.499. Because of the lack of significance, they were not listed in the table. FC, fold change.

Table 10 Overlap DE genes in human and monkey PBMCs after LPS stimulation

GO term (P value) Overlap DEGs (FC: h/m) UniqH DEGs UniqM DEGs

Immune response: C1QC (0.1/0.4); CCL3 AQP9, C3, CCL13, CCL3L3, CCR2, B2M, CCL18, CCL4L1, CCL5,
(Ph =3.33×10–16); (2.5/2.2); CD74 (0.4/5.2); CD276, CIITA, CMKLR1, CTSC, CTSS, LOC100424348, LOC100427798,
(Pm =8.88×10–7) CXCL3 (7.0/2.7); IL1A CTSW, CXCL1, CXCL10, CXCL2, CXCL5, LOC694372, LOC714964,
(5.4/2.5); IL8 (6.4/2.0) CXCL9, ENPP2, FCAR, FCGRT, HLA- LOC720309, LOC720330,
DMA, HLA-DMB, HLA-DOA, HLA-DPA1, LOC720365, LOC722711,
HLA-DPB1, HLA-DQA1, HLA-DQA2, MAMU-A, MAMU-AG, MAMU-B,
HLA-DQB1, HLA-DRA, HLA-DRB1, HLA- MAMU-B18, MAMU-DPA,
DRB3, HLA-DRB4, HLA-DRB5, IFI6, MAMU-DPB, MAMU-DQA1,
IGSF6, IL18, IL1B, IL6, LST1, NCF4, MAMU-DQB1, MAMU-DRA,
OAS1, OAS3, P2RY14, PDCD1LG2, MAMU-E, MAMU-F, MAMU-I,
PGLYRP1, PPBP, SECTM1, TLR4 MAMU_DMA

Cytokine–mediated signaling CD74 (0.4/5.2); IL1A CCL2, CCR2, CEBPA, CIITA, HLA-DMA, IL2RG, JAK1
pathway: (Ph =1.11×10–11); (5.4/2.5) HLA-DMB, HLA-DOA, HLA-DPA1, HLA-
(Pm =0.003845) DPB1, HLA-DQA1, HLA-DQA2, HLA-
DQB1, HLA-DRA, HLA-DRB1, HLA-
DRB3, HLA-DRB4, HLA-DRB5, IFI27,
IFI30, IFI6, IFNG, IL1B, IL6, IRF5, JAK2,
MT2A, MX1, OAS1, OAS3, SOCS3

Chemotaxis: CCL3 (2.5/2.2); IL8 C3AR1; CCL13; CCL2; CCL3L3; CCR2; LOC721048
(Ph =1.11×10–11); (6.4/2.0) CMKLR1; CXCL1; CXCL10; CXCL16;
(Pm =0.00647) CXCL2; CXCL3; CXCL5; CXCL9; ENPP2;
FPR2; FPR3; PLAU; PLAUR

Inflammatory response: CCL3 (2.5/2.2); IL1A C3, C3AR1, CCL13, CCL2, CCL3L3, CCL5
(Ph =1.58×10–10); (5.4/2.5); IL8 (6.4/2.0) CCR2, CD163, CLEC7A, CXCL1, CXCL10,
(Pm =0.002622) CXCL2, CXCL3, CXCL9, FPR2, GGT5,
IL1B, IL6, IRAK2, MMP25, NFKBIZ,
SIGLEC1, SPP1, STAB1, TNFAIP6
FC, fold change; Ph, P value of human; Pm, P value of monkey; h/m, human/monkey.

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 18 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

A 4.00 qRT-PCR B 6.00

qRT-PCR
2.00 Microarray 4.50
Microarray

Fold Change

Fold Change
0.00 3.00
–2.00 1.50
–4.00 0.00
–6.00 –1.50
–8.00 –3.00
K1 CNA M6 IL8 N2C CL2 IL8 A 74 L3
PL P MC K C IL1 CD CC
CD
Monkey---PHA Monkey---LPS

C 10.00
7.50 qRT-PCR D 10.00
qRT-PCR
8.00
5.00 Microarray Microarray
Fold Change

Fold Change
6.00
2.50
4.00
0.00
–2.50 2.00
–5.00 0.00
–7.50 –2.00
–10.00 –4.00
K1 NA CM6 IL8 N2C CL2 IL8 A 74 L3
PL PC M K C IL1 CD CC
CD
Human---PHA Human---LPS

Figure 6 Effects of PHA and LPS on select gene expression in PBMCs. Impact of 10 µg/mL of PHA on the expression of PLK1, PCNA,
MCM6, IL8, CDKN2C, and CCL2, and that of 10 µg/mL of LPS on IL-8, IL-1A, CD74, and CCL3, were validated by qRT-PCR. Fold-
changes in expression levels between the PHA group and control are indicated in A (monkey) and B (human). Fold-changes in the expression
levels between the LPS and control groups are indicated in C (monkey) and D (human). The qRT-PCR data are presented as means ± SD of
three independent samples. Array data were calculated using SAM software. PHA, phytohemagglutinin; LPS, lipopolysaccharide; qRT-PCR,
quantitative reverse transcription polymerase chain reaction; SD, standard deviation; SAM, significance analysis of microarray.

monkeys. secreted by PHA-stimulated human PBMCs were more

PBMC proliferation induced by PHA/LPS pronounced than those of cynomolgus monkeys; in
particular, the secretion level of INFγ and IL-10 were
Here, the proliferation ratio of PHA-stimulated PBMCs
almost 30 and 50 times that of the cynomolgus monkeys.
of human and cynomolgus monkeys was significantly
With consideration to previous proliferation assay, the
increased with an increase in concentration. In particular,
increased secretion of INFγ might have been due to the
human PBMCs showed a higher proliferative capacity, for
increased number of activated T lymphocytes by PHA
which the proliferation ratio was ~2.5 fold higher compared
with cynomolgus monkey PBMCs to 10 μg/mL PHA. This in humans. There was additional evidence in our gene
result was also consistent with the gene expression profile, expression profile study showing that an enrichment of
in which the number of DEGs in human PBMCs after DEGs in PHA-stimulated human PBMCs was principally
PHA stimulation was found to be almost nine times higher related to IFNγ-mediated signaling pathway (GO:0060333,
than that of cynomolgus monkeys. In contrast to PHA, no P value =2.00×10-15). Of note, the significant functional
significant difference in the proliferation of PBMCs was group of genes under both PHA and LPS stimulation
detected between human and cynomolgus monkey PBMCs were also mostly associated with IFNγ-mediated signaling
stimulated with LPS. These results showed a distinct pathway (GO:0060333, P value: 1.11×10 -11) in human
difference of immune responses to the various activators in PBMCs, which is consistent with the significant secretion
primates, suggesting humans were more susceptible to T of IFN-γ in human PBMCs by LPS stimulation. Therefore,
cell-specifical mitogen PHA than cynomolgus monkeys. the pronounced secretion and upregulated genes associated
with IFN-γ in human PBMCs may reflect a functional
difference between the two species after PHA or LPS
Cytokine profile induced by PHA/LPS
stimulation.
In the cytokine profiles study, the levels of most cytokines IFN-γ, one of the most important cytokines in innate

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 19 of 24

and adaptive immune responses, is mainly secreted by T IL-8 in different species after LPS stimulation suggested
cells and natural killer (NK) cells. It plays an important that IL-8 could be a bridge biomarker to reflect the
role in eliminating pathogens, increasing macrophage activation state of innate immune response in mammals.
function, promoting the expression of MHC molecules Most notably, in the cytokine profile study, IL-5 was
and antigen presenting molecules, and preventing not detected (value below standard curve limits) in monkey
allergic inflammation (19). Although previous studies have cultures that received either PHA or LPS. It has been
confirmed that PHA can induce human PBMCs to secrete reported that Th2-type cytokines like IL-5 (also IL-4 and
a large amount of IFN-γ (20,21), we found for the first IL-13) were associated with promotion of immunoglobulin
time that the secretion level in humans was much higher E (IgE) and eosinophilic responses (32). Recently, it was
than that in cynomolgus monkeys. Unequal cytokine found that IL-5 was produced by memory CD4+ TH2 cell
formation by dendritic cell (DC)/other cell types was also subsets that play an important role in allergic inflammation
shown by Gujer et al. (22), in which human plasmacytoid in humans and mice (33). Although we have no direct
(p)DC displayed rapid IFN-γ secretion after TLR7/8-L evidence to account for these differences in IL-5 secretion
activation, and that secretion was more pronounced in between humans and cynomolgus monkeys, it has been
humans than in rhesus cells after CpG C stimulation. previously reported that a marked difference in memory
Similar research results also exist in comparative studies CD4+ TH2 cells was found between the two species
of some zoonotic diseases [e.g., human immunodeficiency (24,34). Previous studies have shown that human memory
virus (HIV) or yellow fever (YF)-17D]; for example, YF- T cells can be divided into central T cells (CD28+CCR7+)
17D stimulation of sooty mangabey (SM) PBMCs resulted and effector T cells (CD28+CCR7-), while cynomolgus
in a significantly reduced IFNα production compared monkey memory T cells can be divided into central T cells
with the PBMCs of rhesus macaques and humans, which (CD28+CCR7+), transitional T cells (CD28+CCR7+),
could possibly be explained by the diminished NKs and and effector T cells (CD28-CCR7-) (35,36). Thus, one
effector CD8+T cells in the SMs (23). The extent of early cannot rule out that the lack of cell surface marker CD28 in
CD8+T cell proliferation has been found to vary between effector T cells of monkeys reflects a functional difference
different animals with various stimulations (24,25). Another between humans and monkeys. Eastwood et al. found
explanation may be the genetic variation across primates. that the failure of the monoclonal antibody TGN1412
Obvious sequence differences in the promoter or the trial was due to species differences in CD28 expression
proximal region of cytokine genes (e.g., IL-4, IL-10, IL- on CD4+ effector memory T cells (34). In addition, age-
12β, TNF-α, and IFN-γ) among human, mangabey, and related phenotypic and functional changes were reported
macaque monkeys, which affect regulation of cytokine in cynomolgus monkey T cells; for example, only adult
synthesis have been reported (26). Although the IFN data monkey T cells could be activated and induced to released
here are just general examples, these could potentially high concentrations of IFN-γ after stimulation with anti-
reflect strikingly different mechanisms in the innate and CD28 and/or anti-CD3 antibodies, while young monkey T
adaptive immune responses across the primates. cells showed very low responses to these stimulations (37).
The current study also examined the cytokine changes by Therefore, the differences in memory T cells in humans
LPS stimulation in human and cynomolgus monkeys. The and cynomolgus monkeys, especially in juvenile monkeys,
results showed that the significantly increased secretion of might have contributed to the differential secretion of IL-5
IL-2, IL-6, IL-8, and IL-10 was observed in both species. in PBMCs stimulated with PHA or LPS in this study, and
The levels of IL-6 and IL-8 in the supernatant of PBMCs further experiments will be required to specifically address
with LPS were much higher than those other cytokines this question.
in the two species. Indeed, IL-8 is a chemokine known
to act as one of the major mediators of inflammatory
Biologic functional features of DEGs in human and
response and has been reported to be upregulated after
monkey PBMCs with PHA stimulation
LPS stimulation in many mammals including cattle, mice,
and pigs (27-30). Recent studies have shown that bacterial Comparative study of gene expression profiles can be used
and host interactions can affect the histone acetylation, to better understand the mechanisms of similar and different
phosphorylation, and methylation status of the TLR4 and immune responses to PHA or LPS between the two
IL-8 promoters in host cells (31). The similar changes in species. Therefore, the GO enrichment analysis of DEGs

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 20 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

was performed to identify significant functional groups of in active lymphocytes during late G1, increased until the
genes in PHA/LPS-stimulated PBMCs. According to the beginning of S phase, and reached its peak 72 hours later
results from GO analysis, the DEGs in human PBMCs (38,39). In our study, the PLK1 gene, a highly conserved
with PHA treatment were significantly enriched in BPs, serine/threonine kinase widely found in eukaryotes, was
including immune response, mitotic cell cycle, cytokine- the most significant upregulated gene shared by humans
mediated signaling pathway, DNA replication, and and cynomolgus monkeys under PHA stimulation. Indeed,
inflammatory response. Although the DEGs in cynomolgus PLK1 performs several important functions throughout
monkey PBMCs were also mainly involved in the same the M phase of the cell cycle, such as the regulation of
biological functions, including immune response and DNA centrosome maturation and spindle assembly, the removal of
replication, the number of DEGs in the same BP was far cohesin from chromosome arms, the regulation of mitotic
fewer than that of humans. The most upregulated gene in exit, and cytokinesis (40). Thus, our results are in agreement
human PBMCs after 10 μg/mL PHA stimulation was cyclin with these studies, suggesting that these overlapped DEGs
B2 (FC =16.7), an important regulator of the G2/M phase associated with DNA replication and cell cycle reflect the
of the cell cycle that initiates the G2/M phase transition highly conserved signatures of immune responses to PHA
by activation of CDK1 kinase in the cell cycle. Moreover, stimulation across the primates.
several of top 10 DEGs, including TOP2A, TYMS, CEP55,
CENPE, and KIF23, also participated in the BPs of mitosis,
Biologic functional features of DEGs in human and
mitotic cell cycle, and the G1/S phase of mitotic cell cycle,
monkey PBMCs with LPS stimulation
with upregulated expression >10-fold in PHA-stimulated
human PBMCs compared to control PBMCs. A large Our results have confirmed a wide range of genes
number of upregulated genes related to mitosis seemed which were affected by LPS stimulation in human and
to suggest that a stronger response to PHA in humans cynomolgus PBMCs. For human PBMCs, the DEGs
may be implicated in rapidly increased mitosis, leading to with LPS treatment were significantly enriched in antigen
proliferation of PBMCs, which may be one of the important processing and presentation of peptide or polysaccharide
molecular mechanisms responsible for the difference in antigen via MHC class II, interferon-gamma-mediated
immune responses to PHA between the two species in signaling pathway, immune response, cytokine-mediated
question. signaling pathway, chemotaxis, T cell costimulation, and
By comparing the top 10 gene functional groups inflammatory response. Also, the DEGs in cynomolgus
between humans and cynomolgus monkeys, we found monkey PBMCs were mainly involved in the same
similar characteristics in the gene expression profiles of biological functions, including antigen processing and
the two species after PHA treatment, including in immune presentation of peptide antigen via MHC Class II, antigen
response, DNA replication, and chemotaxis. Also, the Kyoto processing and presentation, and immune response. In
Encyclopedia of Genes and Genomes (KEGG) pathway contrast to PHA, the count of DEGs in the same BP
analysis results revealed that the DEGs were involved in was similar in the two species under LPS stimulation,
DNA replication and the cell cycle in both species. For suggesting humans and cynomolgus monkeys have similar
identification of conserved signatures of immune responses characteristics in immune pathways and response intensity
to PHA in human and cynomolgus monkey PBMCs, we in the innate immune response to LPS.
found an overlap of 21 upregulated and 17 downregulated In human PBMCs, the genes MT1H, CXCL1, MT1G,
genes between human and monkey DEG lists, notably the IL1B, and IL-8 were the top five genes found over-expressed
MCM complexes (MCM3, MCM4, MCM6, and MCM7) with 10 μg/mL LPS treatment. IL-1β is a key cytokine
and proliferating cell nuclear antigen (PCNA) involved that modulates the expression of other secondary cytokines
in DNA replication pathway. The MCM complex, listed including IL-8 and TNFAIP6 (41). IL-8 is a chemokine
in the top 20 upregulated genes in cynomolgus monkeys, known to act as one of the major mediators of inflammatory
is a hexameric protein complex required for the initiation response for mobilization and activation of neutrophils (42).
and regulation of DNA replication. PCNA is an auxiliary We also observed increased IL-8 cytokine expression after
protein of DNA polymerase delta and is involved in LPS stimulation in both human and monkey PBMCs by
DNA replication/repair. Previous studies have shown that Luminex-based analysis. In addition, upregulation of a
PCNA was necessary for entering S phase, and appeared wider range of inflammatory cytokines, including IL-6,

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 21 of 24

IL-1A, IL-1B, and TNF, was also observed in other elicited T-cell responses are variable in currently utilized
species after LPS stimulation (43). In the 10 μg/mL LPS nonhuman primate populations, owing to the heterogeneity
groups, we found an overlap of the 10 upregulated and top in MHC class I genetics (46). The genetic difference in the
10 downregulated genes across the human and monkey two species might by accounted for by the distinct findings
DEG lists; notably, IL-8 was the most upregulated gene in in the gene expression profile after LPS stimulation. As the
humans and cynomolgus monkeys. These data indicated MHC class I and II regions influence the ability to mount
that IL-8 was highly conserved among the primates and an immune response against infectious pathogens and
might play an important role in the innate immune response vaccines, the genetic and functional differences between
to LPS. humans and monkeys should be considered in experimental
In monkey PBMCs, the genes MAMU-A, MAMU-B18, medicine in macaques.
MAMU-I, MAMU-E, and LOC714964 were the top five
genes found to be strongly upregulated with 10 μg/mL LPS
Conclusions
treatment. It could be seen that, unlike the overexpression
of cytokines and chemokines genes in the top genes In the present study, we have characterized the cytokine
lists in humans, the most upregulated genes in monkeys secretion and gene expression profiles of human and
belonged to the MHC I antigen. These results, confirmed cynomolgus monkey PBMCs upon in vitro stimulation by
by the GO analysis, suggest that the upregulated DEGs in either PHA or LPS, and thus have identified the similarities
monkeys were primarily associated with antigen processing and differences of immune responses between these species.
and presentation of peptide antigen via MHC class I These differences suggest the species-specific nature
(P value =−2.22×10-16). Also, we found that the DEGs were implicated in the T cell–specific mitogen or innate immune
enriched in graft-versus-host disease during the KEGG responses, including lymphocyte proliferation, cytokine
enrichment analysis in both humans and monkeys by LPS secretion (e.g., IFN-γ and IL-5), antigen processing and
stimulation. Although they shared the same pathway, the 16 presentation via MHC I, and so on, which should be carefully
genes involved in this pathway are MAMU family members considered in biomedical research using NHPs. Additionally,
in monkeys, while the 4 genes in humans were IFNG, IL- the evaluation of genes conserved between the species under
1A, IL1-B, and IL-6, which suggests that antigen processing the same stimulation conditions could provide a new way to
and presentation is the most characteristic response to LPS discern biomarkers and to transfer animal data to humans.
in cynomolgus monkeys. Accordingly, future studies exploring the effects of other
Interestingly, the antigen processing and presentation stimulations on human and monkey immune cells are needed.
was found mainly via MHC class II rather than MHC
class I in humans after LPS stimulation. Molecules of
Acknowledgments
MHC class I are found on almost every nucleated cell
of the body and generally interact with CD8+ T cells. Funding: This work was supported by Project of the 13th
Benefiting from the development of molecular genetics, National Five-Year Plan for Significant New Drug Creation
the study of Mafa MHC polymorphism demonstrated ‘Key Technologies for Nonclinical Safety Evaluation of
that the MHC of cynomolgus macaques (Mafa MHC) Innovative Drugs’ (Project No. 2018ZX09201-017).
was organized in the same way as that of humans, but it
differed from the human type by its high degree of classical
Footnote
class I gene duplication (44). In other words, the MHC-I
locus in macaques was astoundingly complex, with each Reporting Checklist: The authors have completed the
individual haplotype expressing multiple A alleles and ARRIVE reporting checklist. Available at http://dx.doi.
potentially >10 B alleles, while a single A, B, and C allele org/10.21037/atm-20-4548
were expressed on a haplotype in human MHC-I locus.
Several published studies are in agreement with regards to Data Sharing Statement: Available at http://dx.doi.
the important role that the MHC class IB region plays in org/10.21037/atm-20-4548
the mechanism of controlling simian immunodeficiency
virus (SIV) infection in a Mauritian macaque model (45). Peer Review File: Available at http://dx.doi.org/10.21037/
Additionally, the magnitude and specificity of vaccine- atm-20-4548

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 22 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

Conflicts of Interest: All authors have completed the ICMJE 2008;37:290-6.

uniform disclosure form (available at http://dx.doi. 8. Galbiati V, Mitjans M, Corsini E. Present and future
org/10.21037/atm-20-4548). The authors have no conflicts of in vitro immunotoxicology in drug development. J
of interest to declare. Immunotoxicol 2010;7:255-67.
9. Grote-Wessels S, Frings W, Smith C, et al.
Ethical Statement: The authors are accountable for all Immunotoxicity testing in non-human primates. Methods
aspects of the work in ensuring that questions related Mol Biol 2010;598:341-59.
to the accuracy or integrity of any part of the work are 10. Luebke RW, Holsapple MP, Ladics GS, et al.
appropriately investigated and resolved. All procedures of Immunotoxicogenomics: Potential of genomics technology
animal experimental studies were performed under a project in immuno-toxicity risk assessment process. Toxicol Sci
license (No. IACUC-2013-041) granted by the ethics 2006;94:22-7.
board of National Center for Safety Evaluation of Drugs 11. Mei N, Fuscoe J, Lobenhofer E, et al. Application of
(NCSED), in compliance with the Guide for the Care and microarray-based analysis of gene expression in the field of
Use of Laboratory Animals of the NCSED [China]. toxicogenomics. Methods Mol Biol 2010;597:227-41.
12. Currie RA. Toxicogenomics: Challenges and opportunities
Open Access Statement: This is an Open Access article to identify biomarkers, signa-tures, and thresholds to
distributed in accordance with the Creative Commons support mode-of-action. Mutat Res 2012;746:97-103.
Attribution-NonCommercial-NoDerivs 4.0 International 13. Wilson VS, Keshava N, Hester S, et al. Utilizing
License (CC BY-NC-ND 4.0), which permits the non- toxicogenomic data to understand chemical mechanism
commercial replication and distribution of the article with of action in risk assessment. Toxicol Appl Pharmacol
the strict proviso that no changes or edits are made and the 2013;271:299-308.
original work is properly cited (including links to both the 14. Bartosiewicz M, Trounstine M, Barker D, et al.
formal publication through the relevant DOI and the license). Development of a toxicological gene array and quantitative
See: https://creativecommons.org/licenses/by-nc-nd/4.0/. assessment of this technology. Arch Biochem Biophys
2000;376:66-73.
15. Bender AT, Wu Y, Cao Q, et al. Assessment of the
References
translational value of mouse lupus models using clinically-
1. Buse E. Development of the immune system in the relevant biomarkers. Transl Res 2014;163:515-32.
cynomolgus monkey: Appropriate model in human 16. Fu K, Cheng Q, Liu Z, et al. Immunotoxicity assessment
targeted toxicology? J Immunotoxicol 2005;2:211-6. of rice-derived recombinant human serum albumin using
2. Suntharalingam G, Perry M, Ward S, et al. Cytokine human peripheral blood mononuclear cells. PLoS One
storm in a Phase 1 trial of the anti-CD28 monoclonal 2014;9:e104426.
antibody TGN1412. N Engl J Med 2006;355:1018-28. 17. Rosas LE, Elgamal OA, Mo X, et al. In vitro
3. Wadman M. London's disastrous drug trial has serious immunotoxicity assessment of culture-derived extracellular
side effects for research. Nature 2006;440:388-9. vesicles in human monocytes. J Immunotoxicol
4. Wanda M. Haschek, Colin G, Rousseaux T. Handbook 2016;13:652-65.
of Toxicologic Pathology, Second Edition. New York: 18. House RV. An overview of in vitro/ex vivo assays for
Academic Press. 2002; pp.585-646. preclinical evaluation of immunomodulation. Hum Exp
5. Elmore SA. Enhanced histopathology of the Toxicol 2000;19:246-50.
immune system: A review and update. Toxicol Pathol 19. Carneiro MW, Fukutani KF, Andrade BB, et al. Gene
2012;40:148-56. expression profile of high IFN-γ producers stimulated
6. Moriyama A, Fujishima J, Furukawa T, et al. Quantitative with Leishmania braziliensis identifies genes associated
analyses of lymphoid tissue in spleen, lymph nodes, and with Cutaneous Leishmaniasis. PLoS Negl Trop Dis
Peyer's patches in cynomolgus monkeys. J Vet Med Sci 2016;10:e0005116.
2011;73:1459-64. 20. Yang H, Sun J, Li Y, et al. Human umbilical cord-derived
7. Jeong AR, Nakamura S, Mitsunaga F. Gene expression mesenchymal stem cells suppress proliferation of PHA-
profile of Th1 and Th2 cytokines and their receptors activated lymphocytes in vitro by inducing CD4(+)
in human and nonhuman primates. J Med Primatol CD25(high)CD45RA(+) regulatory T cell production

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Annals of Translational Medicine, Vol 9, No 3 February 2021 Page 23 of 24

and modulating cytokine secretion. Cell Immunol development, and allergen sensitiza-tion in infants at high
2016;302:26-31. risk of asthma. Lancet 2000;355:1680-3.
21. Mohammadi AM, Javadi A, Firooz A, et al. Comparison 33. Shinoda K, Hirahara K, Nakayama T. Maintenance of
of cytokine profile of IFN-γ, IL-5 and IL-10 in cutaneous pathogenic TH2 cells in allergic disorders. Allergol Int
leishmaniasis using PBMC vs. whole blood. Iran J 2017;66:369-76.
Microbiol 2019;11:431-9. 34. Eastwood D, Findlay L, Poole S, et al. Monoclonal
22. Gujer C, Sundling C, Seder R, et al. Human and rhesus antibody TGN1412 trial failure explained by species
plasmacytoid dendritic cell and B-cell responses to Toll- differences in CD28 expression on CD4+ effector memory
like receptor stimulation. Immunology 2011;134:257-69. T-cells. Br J Pharmacol 2010;161:512-26.
23. Mandl JN, Akondy R, Lawson B, et al. Distinctive TLR7 35. Nam KH, Illés Z, Terao K, et al. Characterization of
signaling, type I IFN production, and attenuated innate expanded T-cell clones in healthy macaques: Ontogeny,
and adaptive immune responses to yellow fever virus in a distribution, and stability. Dev Comp Immunol
primate reservoir host. J Immunol 2011;186:6406-16. 2000;24:703-15.
24. Medina M, Couturier J, Feske M, et al. Granzyme B- 36. Lee WW, Nam KH, Terao K, et al. Age-related increase
and Fas ligand-mediated cytotoxic function induced by of peripheral CD4+ CD8+ double-positive T lymphocytes
mitogenic CD28 stimulation of human memory CD4+ in cynomolgus monkeys: longitudinal study in relation to
T-cells. J Leukocyte Biol 2012;91:759-71. thymic involution. Immunology 2003;109:217-25.
25. Kolumam GA, Thomas S, Thompson LJ, et al. Type I 37. Terao K. Essentials for starting a pediatric clinical study (3):
interferons act directly on CD8 T cells to allow clonal Dynamic changes in early development of immune system
expansion and memory formation in response to viral in macaque monkeys‐‐the significance from standpoint
infection. J Exp Med 2005;202:637-50. of preclinical toxicity test using nonhuman primates. J
26. Bostik P, Watkins M, Villinger F, et al. Ansari AA: Genetic Toxicol Sci 2009;34 Suppl 2:P321-5.
analysis of cytokine promoters in nonhuman primates: 38. Ohta S, Shiomi Y, Sugimoto K, et al. A proteomics
implications for Th1/Th2 profile characteristics and SIV approach to identify proliferating cell nuclear antigen
disease pathogenesis. Clin Dev Immunol 2004;11:35-44. (PCNA)-binding proteins in human cell lysates. J Biol
27. Doherty R, O'Farrelly C, Meade KG. Epigenetic Chem 2002;277:40362-7.
regulation of the innate immune response to LPS in 39. Giacomelli L, Nicolini C. Gene expression of human
bovine peripheral blood mononuclear cells (PBMC). Vet T-lymphocyte cell cycle: Experimental and bioinformatic
Immunol Immunopathol 2013;154:102-10. analysis. J Cell Biochem 2006;99:1326-33.
28. Gao Y, Flori L, Lecardonnel J, et al. Transcriptome 40. Kothe M, Kohls D, Low S, et al. Structure of the catalytic
analysis of porcine PBMCs after in vitro stimulation domain of human polo-like kinase 1. Biochemistry
by LPS or PMA-ionomycin using an expression array 2007;46:5960-71.
targeting the pig immune response. BMC Genomics 41. Brochu C, Cabrita MA, Melanson BD, et al. NF-κB-
2010;11:292. dependent role for cold-inducible RNA binding protein in
29. Uddin MJ, Nuro-Gyina PK, Islam MA, et al. Expression regulating interleukin 1β. PLoS One 2013;8:e57426.
dynamics of Toll-like receptors mRNA and cytokines in 42. Caswell JL, Middleton DM, Gordon JR. Production and
porcine peripheral blood mononuclear cells stimulated by functional characterization of recombi-nant bovine IL-8
bacterial lipopolysaccharide. Vet Immunol Immunopathol as a specific neutrophil activator and chemoattractant. Vet
2012;147:211-22. Immunol Immunopathol 1999;67:327-40.
30. Ding Q, Liu G, Zeng Y, et al. Glycogen synthase kinase 3β 43. Jacquier V, Estellé J, Schmaltz-Panneau B, et al. Genome-
inhibitor reduces LPS induced acute lung injury in mice. wide immunity studies in the rabbit: transcriptome
Mol Med Rep 2017;16:6715-21. variations in peripheral blood mononuclear cells after
31. Raymond B, Batsche E, Boutillon F, et al. Anthrax lethal in vitro stimulation by LPS or PMA-Ionomycin. BMC
toxin impairs IL-8 expression in epithelial cells through Genomics 2015;16:26.
inhibition of histone H3 modification. PLoS Pathog 44. Shiina T, Blancher A. The Cynomolgus Macaque
2009;5:e1000359. MHC Polymorphism in Experimental Medicine. Cells
32. Gereda JE, Leung DY, Thatayatikom A, et al. Relation 2019;8:978.
between house-dust endotoxin exposure, Type 1 T-cell 45. Antony JM, MacDonald KS. A critical analysis of the

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
Page 24 of 24 Lin et al. Differences/similarities of immune function between NHPs and humans

cynomolgus macaque, Macaca fascicularis, as a model to haplotypes on susceptibility/resistance to SHIV(89.6P)

test HIV-1/SIV vaccine efficacy. Vaccine 2015;33:3073-83. infection. Vaccine 2008;26:3312-21.
46. Florese RH, Wiseman RW, Venzon D, et al. Comparative
study of Tat vaccine regimens in Mauritian cynomolgus (English Language Editors: J. Jones and J. Gray)
and Indian rhesus macaques: influence of Mauritian MHC

Cite this article as: Lin Z, Huang Y, Jiang H, Zhang D,

Ya n g Y, G e n g X , L i B . F u n c t i o n a l d i f f e r e n c e s a n d
similarities in activated peripheral blood mononuclear cells
by lipopolysaccharide or phytohemagglutinin stimulation
between human and cynomolgus monkeys. Ann Transl Med
2021;9(3):257. doi: 10.21037/atm-20-4548

© Annals of Translational Medicine. All rights reserved. Ann Transl Med 2021;9(3):257 | http://dx.doi.org/10.21037/atm-20-4548
 Supplementary

Table 1 Pathway in human and monkey PBMCs after treatment with 10 μg PHA/ml by KEGG pathway analysis of DEGs
Pathway name P-value for enrichment Count (DEGs)
Human *DNA replication 1.11 × 10–16 18
–15
*Cell cycle 1.44 × 10 27
Mismatch repair 6.34 × 10–10 10
–7
Pyrimidine metabolism 3.80 × 10 15
Oocyte meiosis 2.43 × 10–6 15
p53 signaling pathway 8.72 × 10–6 11
–5
Nucleotide excision repair 5.77 × 10 8
*Systemic lupus erythematosus 0.001320315 12
One carbon pool by folate 0.002098523 4
Monkey *Cell cycle 1.39×10–7 10
*DNA replication 7.57×10–7 6
*Systemic lupus erythematosus 0.000252866 7
Malaria 0.000789218 4
Staphylococcus aureus infection 0.000855251 4
Lysosome 0.003184947 5
Chemokine signaling pathway 0.006346366 6
Other glycan degradation 0.007767431 2
Chagas disease (American trypanosomiasis) 0.011799898 4
NOD-like receptor signaling pathway 0.012418785 3
*Same pathway found in both human and monkey groups.

Table 2 Pathway in human and monkey PBMCs after treatment with 10 μg LPS/ml by KEGG pathway analysis of DEGs
Pathway name P-value for enrichment Count (DEGs)
Human Cytokine-cytokine receptor interaction 3.74×10–9 18
Chagas disease (American trypanosomiasis) 6.84×10–7 10
–6
Chemokine signaling pathway 4.27×10 12
NOD-like receptor signaling pathway 0.000130695 6
Amoebiasis 0.000393937 7
Malaria 0.000462262 5
Osteoclast differentiation 0.001219195 7
Toll-like receptor signaling pathway 0.001905942 6
*Graft-versus-host disease 0.002155832 4
Leishmaniasis 0.002372092 5
Monkey Type I diabetes mellitusI –2.22×10–16 16
Allograft rejection 2.22×10–16 15
Antigen processing and presentation 2.22×10–16 19
*Graft-versus-host disease 4.44×10–16 16
–14
Autoimmune thyroid disease 1.34×10 15
Viral myocarditis 2.02×10–14 17
–11
Phagosome 1.30×10 19
Cell adhesion molecules (CAMs) 2.97×10–10 16
Staphylococcus aureus infection 3.73×10–9 10
–7
Rheumatoid arthritis 2.02×10 11
*Same pathway found in both human and monkey groups.

© Annals of Translational Medicine. All rights reserved. http://dx.doi.org/10.21037/atm-20-4548