Online Submissions: http://www.journaltcm.

com J Tradit Chin Med 2021 December 15; 41(6): 927-934

[email protected] ISSN 0255-2922
© 2021 JTCM. All rights reserved.

RESEARCH ARTICLE
TOPIC

Zuogui Wan (左归丸) improves trabecular bone microarchitecture in

ovariectomy-induced osteoporosis rats by regulating orexin-A and
orexin receptors

LIU Feixiang, TAN Feng, FAN Qiaoling, TONG Weiwei, TENG Zhanli, YE Sumin, LI Xing, ZHANG Mingyue, CHAI Yi,
MAI Chongying
aa
LIU Feixiang, TAN Feng, FAN Qiaoling, TONG Weiwei, trate-resistant acid phosphatase (TRACP-5b) and
TENG Zhanli, YE Sumin, LI Xing, ZHANG Mingyue, CHAI bone alkaline phosphatase (BALP) were measured
Yi, MAI Chongying, School of Chinese Medicine, School of by enzyme-linked immunosorbent assay. Hematox-
Integrated Chinese and Western Medicine, Nanjing Universi-
ylin-eosin staining was used to detect the changes
ty of Traditional Medicine, Nanjing 210023, China
Supported by Traditional Chinese and Western Medicine
in the morphological structure in bones. Microcom-
Clinical Medicine Brand Construction Project of Jiangsu puted tomography was used to evaluate the bone
Higher Education Institutions (Phase Ⅱ) and National Natu- mineral density and microarchitecture of the distal
ral Science Foundation of China (No. 81573874 and femur. The gene or protein expression of orexin-A,
81873229) orexin receptor 1 (OX1R), orexin receptor 2 (OX2R),
Correspondence to: Prof. TAN Feng, and Prof. FAN Qiaol- osteoprotegerin (OPG) and receptor activator of nu-
ing, School of Chinese Medicine, School of Integrated Chi- clear factor-κ B ligand (RANKL) were assayed by ei-
nese and Western Medicine, Nanjing University of Tradition-
ther quantitative polymerase chain reaction or
al Medicine, Nanjing 210023, China. [email protected];
[email protected].
Western blot analysis.
Telephone: +86-25-85811929
DOI: 10.19852/j.cnki.jtcm.20210903.001
RESULTS: Compared with the OVX group, ZGW
Accepted: November 12, 2020 could reduce the serum level of TRACP-5b and in-
creased the serum levels of BALP and17β-E2 (P <
0.01). Meanwhile, ZGW could prevent bone loss
and improved bone trabecular microarchitecture
Abstract by increasing the trabeculae structure thickness
and trabecular number, and arranging the trabecu-
OBJECTIVE: To investigate the protective effects of
lae structure properly. Compared with the OVX
Zuogui Wan ( 左 归 丸, ZGW) on bone loss induced
group, it was upregulated for the orexin-A and
by ovariectomy (OVX) and its mechanism via orex-
OX2R mRNA or protein expression from the hypo-
in-A and orexin receptors in the osteoporosis rat
thalamus and tibiae, and OPG in the tibiae of ZGW
model.
groups (P < 0.01, < 0.05), while downregulated for
METHODS: Fifty Sprague-Dawley female rats were the OX1R mRNA and protein expression in the tibi-
randomly divided into sham-operated (sham) ae and hypothalamus and RANKL from the tibiae
group and four OVX subgroups. Rats subjected to (P < 0.01).
sham and OVX were treated with the vehicle
(OVX, 1 mL/100 g weight, n = 10), 17β-estradiol CONCLUSION: ZGW exhibited a protective effect
(E2, 50 μg·kg － 1·d － 1), and ZGW at the doses of 2.3 for PMOP that may be mediated via orexin-A and
(ZGW-L) and 4.6 (ZGW-H) g/kg/day lyophilized pow- orexin receptors regulation.
der daily for 3 months, respectively. The serum bio-
chemical parameters of 17β-estrogen (17β-E2), tar- © 2021 JTCM. All rights reserved.

JTCM | www. journaltcm. com 927 December 15, 2021 | Volume 41 | Issue 6 |
 LIU FX et al. / Research Article

Keywords: osteoporosis, postmenopausal; orexin ae Oppositae) 120 g, Shanzhuyu (Fructus Macrocarpii)

receptors; orexins; Zuogui Wan 120 g, Gouqizi (Fructus Lycii) 120 g, Niuxi (Radix
Achyranthis Bidentatae) 90 g, Tusizi (Semen Cuscutae)
120 g, Guijiajiao (Colla Carapacis et Plastri) 120 g, and
INTRODUCTION Lujiaojiao (Colla Cornus Cervi) 120 g were supplied by
Postmenopausal osteoporosis (PMOP), is a generalized the affiliated hospital of Nanjing University of Chinese
Medicine. The method of preparing ZGW lyophilized
bone disease caused by estrogen deficiency and charac-
powder was adopted from Liu et al.8 In brief, all drugs
terized by the alterations in the bone trabecular micro-
except Guijiajiao (Colla Carapacis et Plastri) and Lujiao-
architecture, decrease in bone mass, and increase in
jiao (Colla Cornus Cervi) were mixed, dried, crushed to
bone fragility.1 According to a research issued by the
80 mesh, and boiled 2 times in 10.5 L of water for 1 h
French statutory health insurance system for salary
each. The two gelatins were melted and added to the
workers in 2013, approximately 135 000 female pa-
decoction. The concentrated liquid was rapidly frozen
tients aged over 50 years old that are admitted in the
and dried in a flask with liquid nitrogen and then ly-
hospitals in France sustain fractures, which caused sub-
ophilized under −50 ℃ by freeze dryers with a product
stantia economic losses of more than €770 million.2
yield of 51.2%.
The agents of stimulating bone formation or inhibiting
bone resorption, such as estrogen, bisphosphonates, flu- Animals
oride, teriparatide, and calcitriol, are commonly ap-
These 4-month-old female Sprague-Dawley rats [(313
plied for PMOP treatment and play essential roles in
± 20) g] were purchased from the Animal Breeding
clinical settings.3,4 However, the side effects of these
Center of Qinglong mountain, Jiangning district, Ji-
agents, including atypical femoral fractures, endome-
angsu, China with the certification No. SCXK (SU)
trorrhagia, stroke, et al., affect the quality of the life of
2017-0001 (n = 50). The Institutional Animal Care
patients.5 Therefore, necessary precautions should be
and Use Committee of Nanjing University of Chinese
taken to reduce the cost and risk of future fractures.
Medicine approved the experimental animal facility
Zuogui Wan ( 左 归 丸, ZGW), which was formulated
and research protocols (Agreement No. 201803A002).
by Zhang Jingyue, a famous physician in Ming Dynas-
ty and first recorded in Jingyue Quanshu, could be Modeling and grouping
used to strengthen bone.6 Our previous study also indi- Rats were subjected to OVX or sham and left untreat-
cated that ZGW exhibits an osteoprotective effect by ed for 4 weeks to develop significant osteopenia. The
correcting bone metabolism imbalance via RANKL/ specific operation methods referred to the literature de-
OPG regulation mediated by β2AR in ovariectomized scribed by Yuan et al.12 These OVX rats were randomly
(OVX) rats.7 However, there is lacking information on divided into 4 separate groups by random number ta-
the precise mechanism underlying tonifying kidney to ble method as follows (n = 10 per group): OVX with
increase BMD. 17β-estradiol (17β-E2) dissolved in absolute ethyl alco-
Orexin-A and -B are neuropeptides, produced laterally hol and then diluted with water (OVX-E2, 50 μg·kg －
in the hypothalamus, which are associated with sleep, ·d－1), OVX model group with water as vehicle (OVX,
1

food intake, and bone metabolism regulation.8 The ac- 1 mL water /100 g per day), OVX with high-dose
tion is regulated by two G-protein-coupled receptors, ZGW lyophilized powder dissolved in water (ZGW-H,
namely, orexin receptors 1 (OX1R) and 2 (OX2R).9 4.6 g·kg－1·d－1), and OVX with low-dose ZGW lyoph-
The lack of orexins in humans and rats can cause nar- ilized powder dissolved in water (ZGW-L, 2.3 g·kg －1·
colepsy, anorexia, and obesity, which are also impor- d － 1) once a day for 12 weeks. Sham group rats were
tant risk factors for the increased incidence of low bone treated with water (n = 10). The intake dose for ani-
mass and osteoporotic fractures in PMOP.10 Orexins mals was derived from the clinical human dose. After 3
regulate bone remodeling bidirectionally through months of administration, animals were anaesthetized
OX1R and OX2R in brain and bone marrow tissues with 3% pentobarbital solution for blood collection
and maintain bone mass balance through their interac- and then sacrificed via bloodletting. Tibiae, bilateral
tion, respectively.11 femora, and hypothalamus were extracted and pre-
In this study, we hypothesized that orexin system regu- served for further experiments.
lation may be attributed to the mechanism and effect
of ZGW in improving bone microstructure and cor- Drugs and reagents
recting bone metabolism imbalance. Enzyme-linked immunosorbent assay (ELISA) kits of
rat 17β-E2, bone alkaline phosphatase (BALP) and tar-
trate-resistant acid phosphatase 5b (TRAP-5b) were
MATERIALS AND METHODS provided by Enzyme-linked Biotechnology Co., Ltd.
ZGW lyophilized powder preparation (Shanghai, China). 17β-E2 was purchased from Sigma
Eight Chinese medicines in ZGW, including Dihuang Co., Ltd. (St. Louis, MO, USA). The Tissue/cell RNA
(Radix Rehmanniae) 240 g, Shanyao (Rhizoma Dioscore- rapid extraction kit was supplied by Yi Fei Xue Biotech-

JTCM | www. journaltcm. com 928 December 15, 2021 | Volume 41 | Issue 6 |
 LIU FX et al. / Research Article

nology Co., Ltd. (Nanjing, China). HifairTMII 1 trabecular separation (Tb. Sp), and bone surface/vol-
Strand cDNA Synthesis SuperMix for quantitative ume ratio (BS/BV), were calculated and analyzed as de-
polymerase chain reaction (qPCR), HieffTM qPCR scribed by Stephens et al.13
SYBR GREEN Master Mix, Cy3-AffiniPure goat an- Quantitative real-time PCR assay
ti-mouse IgG (H + L) and Cy3-AffiniPure goat an-
Total RNA was extracted from the right tibiae plateau
ti-rabbit IgG (H + L) were purchased from Yi Sheng and hypothalamus in accordance with the commercial
Biotechnology Co., Ltd. (Shanghai, China). Rabbit an-
instructions of the tissue/cell RNA rapid extraction kit.
ti-OPG, mouse monoclonal actin and anti-RANKL
cDNA was synthesized in accordance with the commer-
were provided by Abcam, Co., Ltd. (Cambridge, UK).
cial protocol of HifairTM Ⅱ 1 Strand cDNA Synthe-
Rabbit anti-OX1R and rabbit anti-OX2R antibodies
sis SuperMix for qPCR. qPCR was analyzed on the cD-
were purchased from Bioss Biotechnology Co., Ltd.
NA samples via real-time PCR (ABI 7500, Applied
(Beijing, China).
Biosystems Inc., Waltham, MA, USA) in accordance
with the commercial instructions of HieffTM qPCR
Serum biochemical parameters
SYBR GREEN Master Mix, with the amplification
The serum17β-E2, BALP and TRACP-5b concentra-
procedure of 1 cycle for 95 ℃ for 5 min, followed by
tions were measured according to the commercial in-
40 cycles of 10 s of denaturation at 95 ℃, 20 s of an-
structions in ELISA kits. The serum biochemical pa-
rameters were analyzed by the enzyme-linked immune nealing at 60 ℃, 20 s of extension at 72 ℃, and then
followed 1 cycle, with the three stages of dissolution
detector (EnSpire, Perkin Elmer Instrument Co., Ltd.,
curve for 15 s at 95 ℃ , 60 s at 60 ℃ , and 15 s at
Waltham, MA, USA).
95 ℃. The primer sequences are listed in Table 1. GAP-
Histological examination of distal femurs DH was used as the internal control. All primers
The right distal femurs were immobilized with 10% were purchased from Shenggong Co., Ltd. (China).
formalin and decalcified by ethylenediamine tetraacetic Data were analyzed and calculated by the 2 － ΔΔCt tech-
acid solution for 4 weeks. Then, all samples were em- nique.
bedded in paraffin and sectioned into 4 μm thick speci-
Western blot
mens for routine hematoxylin-eosin (HE) staining.
The total protein from the tibiae plateau and hypothal-
The pathological changes in the stained femurs were
amus were extracted by using protein extraction buffer.
photographed and viewed under × 100 magnification
Approximately 20 μg of each protein samples were sep-
by using fluorescence-inverted microscope camera sys-
arated by 10% SDS-PAGE. Afterward, the samples
tem (DMI3000B, Leica, Weztlar, Germany).
were transferred into 0.45 μm polyvinylidene fl uoride
BMD and micro-computed tomography (µCT) membranes. After 1 h of blocking with 3% BSA solu-
The computed tomography images of the bone miner- tion, bands were incubated with the first antibodies, in-
al density and trabecular bone microarchitecture of the cluding mouse monoclonal actin (1∶1000), rabbit an-
left distal femur were acquired and measured using ti-OX1R (1∶1000), rabbit anti-RANKL (1∶1000), rab-
Bruker μCT (SkyScan 1176, Bruker, Co., Ltd., Karl- bit anti-OX2R (1∶1000), and rabbit anti-OPG (1∶
sruhe, Germany). The detailed scan method and pa- 1000). Then bands were incubated with secondary an-
rameter set-up in SkyScan 1176 were obtained in our tibodies, as follows: Cy3-AffiniPure goat anti-mouse
previous study.7 Those methods of the BMD measured IgG (H + L) (1∶2000) or Cy3-AffiniPure goat anti-rab-
via μCT by using Bruker μCT, the volume investigated bit IgG (H + L) (1:2000). Membranes were visualized
by 3D models for structure thickness and separation with the Enhanced ECL Chemiluminescent Substrate
distribution in CTVox and analyzed the bone via μCT Kit and then exposed to X-film by gel documentation
general information were performed from Yuan et al.12 system (Imagequant LAS 4000, GE Co., Ltd., Boston,
The following direct trabecular metric parameters, in- MA, USA). Image J software (National Institutes of
cluding trabecular number (Tb. N), bone volume/tis- Health, Bethesda, MD, USA) was used to detect and
sue volume (BV/TV), trabecular thickness (Tb. Th), analyze the sum density of membranes.

Table 1 Primer sequences for RT-PCR analysis

Gene Gene bank number Forward premier Reverse premier bp
OREXIN-A NM_013179.2 TCCTGCCGTCTCTACGAACT GGTTACCGTTGGCCTGAAG 133
OX1R NM_013064.1 GACCCTCAGAGCAACTGGAA GCATCTTGGCAGTCTTCCTC 120
OX2R NM_013074.1 CATCGTTGTCATCTGGATCG GCGTTCATCGCAGACTGTAA 124
OPG NM_012870.2 CACAGAGCAGCTCCGCATCTTG AAGTGCTTGAGTGCGTACATCAGG 183
RANKL NM_057149.1 ATATCGTTGGATCACAGCACATCAGAG TGTCGGTGGCATTAATAGTGAGATGAG 126
GAPDH NM_017008.4 AGTTCAACGGCACAGTCAAGG ACATACTCAGCACCAGCATCAC 121
Notes: RT-PCR: reverse transcription-polymerase chain reaction; OX1R: orexin receptors 1; OX2R: orexin receptors 2; OPG: osteoprote-
gerin; RANKL: receptor activator of nuclear factor-κB ligand.

JTCM | www. journaltcm. com 929 December 15, 2021 | Volume 41 | Issue 6 |
 LIU FX et al. / Research Article

Statistical analyses Histopathological analysis

All data were expressed as means ± standard deviation In the OVX group, the HE staining of the distal femur
( xˉ ± s). One-way analysis of variance followed by post showed irregular trabecular arrangement, thinned and
hoc analysis using Student-Newman-Keuls test (more incomplete trabecular structure, a considerable amount
than two groups), and Student's t-test (two-group com- of empty bone lacunae, disorganized distribution, and
parison) were used to calculate and analyze all results. widened intertrabecular spaces compared with the
Statistical analysis was performed with the SPSS 19.0 sham group (Figure 1). After 12 weeks treatment with
software (IBM SPSS, Armonk, NY, USA). P < 0.05 was ZGW, the bone histomorphology improved compared
considered to indicate statistically significant difference. with that in the OVX group and showed slightly or-
dered arrangement of the trabeculae, increased bone
trabecula in terms of number and width, slight thin-
RESULTS ning of the trabeculae, and decreased empty bone lacu-
nae (Figure 1).
Biochemical assay
In the OVX group, the serum BALP and 17β-E2 levels µCT evaluation
were lower (P < 0.01) and the serum TRACP-5b level The local BMD of the distal femur was lower in the
was higher (P < 0.01) than those of the sham group OVX group (P < 0.01) than that in the sham group.
(Table 2). After 12 weeks of treatment with ZGW or After 3 months of treatment with either ZGW or E2,
E2, the serum BALP and 17β-E2 levels were higher (P < the local BMD levels were significantly higher (P <
0.01) and the serum TRACP-5b concentration was low- 0.05, P < 0.01) than those in the OVX group (Table 3).
er (P < 0.01) than those of the OVX group (Table 2). The μCT analysis of left distal femur trabecular indicat-

Table 2 Effect of ZGW on biochemical parameters in serum17β-E2, BALP and TRACP-5b ( xˉ ± s)

Group n BALP（ng/mL） TRAP-5b（mU/mL） 17β-E2 (pmol/L)
Sham 6 348.21±28.66 133.55±34.10 55.99±4.09
OVX 6 227.62±13.38 a
303.07±23.79 a
34.57±9.79a
OVX-E2 6 339.39±36.10 b
178.81±42.03 b
50.44±2.84b
OVX-ZGW(L) 6 305.55±30.05b 237.39±18.32b 45.01±3.37b
OVX-ZGW(H) 6 332.74±27.73b 204.37±38.85b 55.49±6.56b
Notes: sham group was treated with water. OVX group (OVX, 1 mL water /100 g per day), OVX-E2 group (OVX-E2, 50 μg·kg －1·d －1),
OVX-ZGW(H) group (ZGW-H, 4.6 g·kg －1·d －1), and OVX-ZGW(L) group (ZGW-L, 2.3 g·kg －1·d －1) were treated once a day for 12
weeks. ZGW: Zuogui Wan; 17β-E2: 17β-estradiol; BALP: bone alkaline phosphatase; TRAP-5b: tartrate-resistant acid phosphatase 5b;
OVX: ovariectomy; OVX-E2: ovariectomy-17β-E2; OVX-ZGW(H): ovariectomy with high-dose ZGW lyophilized powder; OVX-ZGW
(L): ovariectomy with low-dose ZGW lyophilized powder. Groups of sham and OVX were treated with water (1 mL water/100 g per day);
OVX-E2 was treated with 17β-E2 (50 μg·kg －1·d －1); Groups of OVX-ZGW(L) and OVX-ZGW(L) were treated with ZGW lyophilized
powder (2.3, 4.6 g·kg－1·d－1) for 12 weeks. aP < 0.01, compared to sham; bP < 0.01, compared to OVX.

Figure 1 Histopathological changes in different groups

A: sham group; B: ovariectomy group; C: ovariectomy-17β-estradiol group; D: variectomy with low-dose Zuogui Wan (ZGW) lyoph-
ilized powder; E: ovariectomy with high-dose ZGW lyophilized powder. Representative pictures (×100) of the right distal femur
staining in different groups (n = 4). ↑ indicates a considerable amount of empty bone lacunae; ▼ indicates a decreased empty
bone lacunae.
Table 3 Selective µCT parameters of the left distal femoral trabecular ( xˉ ± s)
Group n BMD (g/cm2) Tb. Th (mm) BV/TV (%) Tb. N (1 mm) BS/BV (1/mm) Tb. Sp (mm)
Sham 5 0.23±0.05 0.41±0.13 98.01±1.12 8.49±2.31 5.38±1.80 0.01±0.00
OVX 5 0.08±0.01a 0.09±0.02a 84.45±1.76a 2.63±0.85a 18.59±4.49a 0.03±0.00a
OVX-E2 5 0.12±0.01b 0.22±0.01b 95.32±3.14c 5.82±0.73b 11.04±1.66c 0.01±0.01c
OVX-ZGW(L) 5 0.12±0.02 b
0.21±0.04 b
96.61±1.37 c
5.41±0.76 c
11.31±2.33 c
0.01±0.00c
OVX-ZGW(H) 5 0.12±0.01b 0.22±0.04b 96.75±0.89c 5.73±0.64c 9.29±1.77c 0.01±0.00c
Notes: BMD: bone mineral density; Tb. Th: trabecular thickness; BV/TV: bone volume/tissue volume; Tb. N: trabecular number; BS/BV:
bone surface/volume ratio; Tb. Sp: trabecular separation; OVX: ovariectomy OVX-E2: ovariectomy-17β-E2; OVX-ZGW(H): ovariectomy
with high-dose ZGW lyophilized powder; OVX-ZGW(L): ovariectomy with low-dose ZGW lyophilized powder; ZGW: Zuogui Wan. aP <
0.01, compared to sham; bP < 0.05, cP < 0.01, compared to OVX.

JTCM | www. journaltcm. com 930 December 15, 2021 | Volume 41 | Issue 6 |
 LIU FX et al. / Research Article

ed that the rat trabecular bone microarchitecture was pared with the sham group (P < 0.05, < 0.01) (Figure
decreased after OVX. After 12 weeks of ZGW adminis- 3). After 12 weeks of administration with either ZGW
tration, both trabecular volume and structure thickness or E2, the OPG and OX2R protein expression levels in
were improved, as shown in the 3D models compared the rat tibiae or hypothalamus were significantly upreg-
with the OVX group (Figure 2). The analysis of the ulated (P < 0.05, < 0.01), and those of OX1R and
representative sample data illustrated that Tb. Th, Tb. RANKL were significantly downregulated compared
N, and BV/TV levels were decreased in the OVX with the OVX group (P < 0.01) (Figure 3).
group (P < 0.01), and BS/BV and Tb. Sp levels were
significantly increased (P < 0.01) compared with those
in the sham group (Table 3). In the ZGW groups, Tb. DISCUSSION
N, BV/TV, and Tb. Th levels were increased (P <
ZGW, with the function of tonifying kidney and es-
0.01), and BV/TV and Tb. Sp levels were decreased
sence, benefiting marrow, and strengthening bone, is
(P < 0.01) compared with the control vehicle-treated
commonly used in the treatment of PMOP and the im-
rats (Table 3).
provement of the PMOP-induced symptoms.14 Com-
qPCR analysis bining our results with those of the previous researches,
Compared with the sham group, it was decreased for we proposed that ZGW may play an important role in
the orexin-A and OX2R mRNA expression levels in bone formation by the central regulation of orexin-A
the rat tibiae and hypothalamus and OPG in the tibiae and its receptors.
of the OVX group (P < 0.01), but increased for the As a steroid hormone, estrogen primarily modulates os-
OX1R and RANKL mRNA expression levels (P < teoclast proliferation and development. The treatment
0.01) (Table 4). After 12 weeks of treatment with with estrogen can improve the symptoms of bone loss,
ZGW, the orexin-A and OX2R mRNA expression lev- dyssomnia, and depression, which are caused by the de-
els of the rat tibiae and hypothalamus and OPG in the ficiency of estrogen in postmenopausal women.15 Os-
tibiae were upregulated (P < 0.05, < 0.01), and OX1R teoclasts and osteoblasts play critical roles in regulating
and RANKL mRNA expression levels were significant- bone remodeling and maintaining the balance of bone
ly downregulated compared with the OVX group (P < resorption and bone formation. With the abnormal
0.01) (Table 4). fluctuation and decreasing of estrogen, the rate of bone
formation and bone resorption are highly increased in
Protein analysis perimenopausal women.16 BALP is a specific osteoblast
The OX1R protein expression level in the rat tibiae activity marker, while TRAP5b is the osteoclast activity
and hypothalamus and RANKL in the tibiae of the marker.17-18 The current research indicated that the ther-
OVX group were highly upregulated (P < 0.01), and apeutic effect of ZGW not only inhibits bone resorp-
those of OPG and OX2R were downregulated com- tion but also promotes bone formation.

Figure 2 Micro-CT generated 3D models of the left distal femur trabecular in different groups
A: sham group; B: ovariectomy group; C: ovariectomy-17β-estradiol group; D: variectomy with low-dose ZGW lyophilized powder;
E: ovariectomy with high-dose ZGW lyophilized powder. Representative Micro-CT generated 3D models of the left distal femur
staining in different groups (n = 4). ↑ indicates a decreased trabecular bone microarchitecture; ▼ indicates improved trabecular
volume and structure thickness.
Table 4 Effects of ZGW on orexin-A, OX1R, OPG, RANKL and OX2R signaling in the rat hypothalamus and tibiae ( xˉ ± s)
Hypothalamus Tbiae
Group n
Orexin-A OX1R OX2R Orexin-A OX1R OX2R OPG RANKL
Sham 5 2.97±0.75 0.48±0.09 2.85±0.74 2.10±0.74 0.50±0.04 2.56±0.25 2.45±0.59 0.47±0.16
OVX 5 1a
1a
1 a
1a
1 a
1 a
1 a
1a
OVX-E2 5 2.92±1.08 c
0.44±0.04c
1.90±0.16 b
2.19±0.57 c
0.19±0.01c
2.34±0.15 c
1.76±0.15c
0.30±0.09c
OVX-ZGW
5 2.65±0.97b 0.41±0.17c 1.77±0.12b 1.89±0.32b 0.22±0.03c 2.42±0.25c 1.52±0.09 0.41±0.09c
(L)
OVX-ZGW
5 3.88±0.58c 0.46±0.07c 2.44±0.44c 2.50±0.20c 0.12±0.03c 1.95±0.15c 1.90±0.24c 0.61±0.06c
(H)
Notes: OVX: ovariectomy OVX-E2: ovariectomy-17β-E2; OVX-ZGW(H): ovariectomy with high-dose ZGW lyophilized powder;
OVX-ZGW(L): ovariectomy with low-dose ZGW lyophilized powder; ZGW: Zuogui Wan; OX1R: orexin receptors 1, OX2R: orexin re-
ceptors 2, OPG: steoprotegerin, RANKL: receptor activator of nuclear factor-κ B ligand. aP < 0.01, compared to sham; bP < 0.05, cP <
0.01, compared to OVX.

JTCM | www. journaltcm. com 931 December 15, 2021 | Volume 41 | Issue 6 |
 LIU FX et al. / Research Article

g·kg-1·d-1

g·kg-1·d-1

g·kg-1·d-1 g·kg-1·d-1 g·kg-1·d-1

g·kg-1·d-1 g·kg-1·d-1 g·kg-1·d-1

Groups Groups Groups

Figure 3 Production of proteins in the rathypothalamus and tibiae with Western blot
A, B: protein display image of rathypothalamus, tibiae; C, D: relative protein expression of orexin receptor 1 (OX1R), orexin recep-
tor 2 (OX2R) in the rathypothalamus with Western blot; E, F, G, H: relative protein expression of protein OX1R, OX2R, osteoprote-
gerin (OPG), receptor activator of nuclear factor-κ B ligand (RANKL), in the tibiae with Western blot. Results were expressed as
mean ± standard deviation. aP < 0.05, dP < 0.01, compared to sham; bP < 0.05, cP < 0.01, compared to OVX.

According to the World Health Organization, PMOP groups was statistically insignificant.
diagnosis and fracture risk assessment should be based Orexins produced in the lateral hypothalamus plays a
on BMD measurement.19 However, increasing evidence crucial role for people's health. Studies showed that
has demonstrated that BMD cannot predict and esti- orexin, as an important rheostat of skeletal homeostasis
mate the fracture risk perfectly and is comprehensively but previously unrecognized regulator, exerted a
unrelated to bone strength.20 Given its characteristics of Yin-Yang dual regulation for bone metabolism by dif-
sensibility and visualization for the quantitative analy- ferentially utilizing OX1R and OX2R.23 Orexin-A
sis of skeletal structures, μCT can clearly observe the could accelerate the differentiation and matrix mineral-
pathological changes in the trabecular bone microarchi- ization of osteoblast, while orexin B could inhibit the
tecture.21 Dual-energy X-ray absorptiometry combined proliferation cultured rat calvarial osteoblast-like cells.24
with μCT can provide highly diagnostic information Orexin can enhance bone formation via the central ac-
about skeletal structures and bone quality.22 The pres- tivation of OX2R by lowering the circulating leptin lev-
ent study showed that 12 weeks of administration with el and also suppress bone formation via the peripheral
either ZGW or E2 exerted significantly positive effects activation of OX1R by decreasing the osseous ghrelin
on bone morphological structures and trabecular bone expression.23 Leptin could suppress bone formation by
microarchitecture. However, the difference in the mor- increasing the expression of RANKL.25 The activity of
phological characteristics of apoptosis and the changes RANKL/RANK signaling pathway could be inhibited
in the μCT parameters of BMD, Tb. Th, Tb. N, BV/ when OPG binds RANKL by competing with RANK
TV, BS/BV, and Tb. Sp between the ZGW and E2 on the surface of bone-degrading osteoclasts.26 Both

JTCM | www. journaltcm. com 932 December 15, 2021 | Volume 41 | Issue 6 |
 LIU FX et al. / Research Article

orexin-A and OX1R are present in the brain and hav Neurosci 2017; 33: 17-50.
bone.27 OX2R is expressed in brain, but whether it is 10 Kaushik MK, Aritake K, Imanishi A, et al. Continuous
present in bone remains unknown.27 The dysfunction intrathecal orexin delivery inhibits cataplexy in a murine
of the hypothalamic-pituitary-gonadal axis in patients model of narcolepsy. Proc Natl Acad Sci USA 2018; 115
with kidney deficiency can lead to unbalanced bone (23): 6046-6051.
formation and absorption and damage the bone micro- 11 Ziolkowska A, Rucinski M, Tyczewska M, et al. Orexin B
structure. Therefore, to explore whether the central inhibits proliferation and stimulates specialized function
control dominating over the peripheral regulation is in- of cultured rat calvarial osteoblast-like cells. Int J Mol Med
2008; 22(6): 749-755.
volved in the underlying mechanism of ZGW in treat-
12 Yuan H, Xiao L, Min W, et al. Bu-Shen-Tong-Luo decoc-
ing PMOP, we examined the mRNA or protein expres-
tion prevents bone loss via inhibition of bone resorption
sion of OX1R, orexin-A, OX2R, OPG and RANKL in
and enhancement of angiogenesis in ovariectomy-induced
the rat hypothalamus and tibiae. Our study showed
osteoporosis of rats. J Ethnopharmacol 2018; 220:
that OX2R was expressed in the tibiae of OVX rats.
228-238.
ZGW could improve bone mass by significantly in- 13 Stephens NB, Kivell TL, Pahr DH, et al. Trabecular bone
creasing the orexin-A, OX2R and OPG protein or patterning across the human hand. J Hum Evol 2018;
mRNA expression levels and significantly downregulat- 123: 1-23.
ing the OX1R and RANKL protein and mRNA expres- 14 Wei S. Clinical study on Zuogui pills combined with alen-
sion levels in the hypothalamus or tibiae. dronate sodium in treatment of postmenopausal osteopo-
However, certain insufficiencies still existed in this rosis. Drugs & Clinic 2017; 32(6): 1048-1051.
study. The ZGW mechanism underlying the occur- 15 Johnston CB, Dagar M. Osteoporosis in older adults.
rence of PMOP was illustrated through the regulation Med Clin North Am 2020; 104(5): 873-884.
of orexin-A and orexin receptors, which was only an as- 16 Prior JC. Progesterone for the prevention and treatment
pect. The comprehensive evaluation of the effect and of osteoporosis in women. Climacteric 2018; 21(4):
mechanism of ZGW against osteoporosis requires an 366-374.
in-depth study. 17 Whyte MP, Ma NS, Mumm S, et al. Persistent idiopathic
In conclusion, the results of this study illustrated that hyperphosphatasemia from bone alkaline phosphatase in a
the regulation of orexin-A and orexin receptors played healthy boy. Bone 2020; 138: 115459.
a role and contributed to the mechanism of ZGW un- 18 Lausch E, Janecke A, Bros M, et al. Genetic deficiency of
derlying the increase in the bone mass in the OVX rat tartrate-resistant acid phosphatase associated with skeletal
model. ZGW may be a potential herbal alternative for dysplasia, cerebral calcifications and autoimmunity. Nat
PMOP treatment. Genet 2011; 43(2): 132-137.
19 Compston J, Cooper A, Cooper C, et al. UK clinical
guideline for the prevention and treatment of osteoporo-
REFERENCES sis. Arch Osteoporos 2017;12(1): 43.
1 Black DM, Delmas PD, Eastell R, et al. Once-yearly zole- 20 Alvarenga JC, Boyd SK, Pereira RMR. The relation-
dronic acid for treatment of postmenopausal osteoporosis. ship between estimated bone strength by finite element
N Engl J Med 2007; 356(18): 1809-1822. analysis at the peripheral skeleton to areal BMD and
2 Briot K, Roux C, Thomas T, et al. 2018 update of French trabecular bone score at lumbar spine. Bone 2018;
recommendations on the management of postmenopausal 117: 47-53.
osteoporosis. Joint Bone Spine 2018; 85(5): 519-530. 21 Arnold EL, Clement J, Rogers KD, et al. The use of μCT
3 Wu J, Zhang Q, Yan G, Jin X. Denosumab compared to and fractal dimension for fracture prediction in osteoporot-
bisphosphonates to treat postmenopausal osteoporosis: a ic individuals. J Mech Behav Biomed Mater 2020; 103:
Meta-analysis. J Orthop Surg Res 2018; 13(1): 194. 103585.
4 Cosman F. Long-term treatment strategies for postmeno- 22 Klotz MC, Beckmann NA, Bitsch RG, et al. Bone quality
pausal osteoporosis. Curr Opin Rheumatol 2018; 30(4): assessment for total hip arthroplasty with intraoperative
420-426. trabecular torque measurements. J Orthop Surg Res 2014;
5 Reid IR. Efficacy, effectiveness and side effects of medica- 9: 109.
tions used to prevent fractures. J Intern Med 2015; 277 23 Wei W, Motoike T, Krzeszinski JY, et al. Orexin regulates
(6): 690-706. bone remodeling via a dominant positive central action
6 Zhang JY. Jingyue Quanshu. Beijing: China Medical Sci- and a subordinate negative peripheral action. Cell Metab
ence Press, 2011: 1283-1284. 2014; 19(6): 927-940.
7 Liu FX, Tan F, Tong WW, et al. Effect of Zuogui Wan on 24 Han X, Zhou J, Peng W.Orexins facilitates osteogenic dif-
osteoporosis in ovariectomized rats through RANKL/ ferentiation of MC3T3-E1 cells. IUBMB Life 2018; 70
OPG pathway mediated by β2AR. Biomed Pharmacother (7): 633-641.
2018; 103: 1052-1060. 25 Liu GY, Liang QH, Cui RR, et al. Leptin promotes the os-
8 Sakurai T. The neural circuit of orexin (hypocretin): main- teoblastic differentiation of vascular smooth muscle cells
taining sleep and wakefulness. Nat Rev Neurosci 2007; 8 from female mice by increasing RANKL expression. Endo-
(3): 171-181. crinology 2014; 155(2): 558-567.
9 Kukkonen JP. Orexin/hypocretin signaling. Curr Top Be- 26 Shafiey SI, Mohamed WR, Abo-Saif AA. Paroxetine and

JTCM | www. journaltcm. com 933 December 15, 2021 | Volume 41 | Issue 6 |
 LIU FX et al. / Research Article

rivastigmine mitigates adjuvant-induced rheumatoid ar- in-1 and orexin-2 receptors in the CA1 region of hippo-
thritis in rats: impact on oxidative stress, apoptosis and campus in the forced swim stress- and food deprivation-in-
RANKL/OPG signals. Life Sci 2018; 212: 109-118. duced reinstatement of morphine seeking behaviors in
27 Edalat P, Kavianpour M, Zarrabian S, et al. Role of orex- rats. Brain Res Bull 2018; 142: 25-32.

JTCM | www. journaltcm. com 934 December 15, 2021 | Volume 41 | Issue 6 |