Mol Breeding (2011) 27:129–135

DOI 10.1007/s11032-010-9538-6

SHORT COMMUNICATION

Development and validation of functional marker targeting

an InDel in the major rice blast disease resistance
gene Pi54 (Pikh)
G. Ramkumar • K. Srinivasarao • K. Madhan Mohan • I. Sudarshan •
A. K. P. Sivaranjani • K. Gopalakrishna • C. N. Neeraja • S. M. Balachandran •

R. M. Sundaram • M. S. Prasad • N. Shobha Rani • A. M. Rama Prasad •

B. C. Viraktamath • M. S. Madhav

Received: 13 August 2010 / Accepted: 24 November 2010 / Published online: 4 December 2010
Ó Springer Science+Business Media B.V. 2010

Abstract Rice blast is one of the most devastating with blast resistance in a mapping population with no
diseases affecting the rice crop throughout the world. recombinants. Validation of this marker in 105
In molecular breeding for host plant resistance, genotypes which are either susceptible or resistant
functional markers are very useful for enhancing to rice blast disease showed that the marker is
the precision and accuracy in marker-assisted selec- polymorphic in most of the resistant–susceptible
tion (MAS) of target gene(s) with minimum effort, genotype combinations and is more accurate than
time and cost. Pi54 (which was earlier known as the earlier reported markers for Pi54. Hence this
Pikh) is one of the major blast resistance genes and functional, co-dominant marker is suggested for
has been observed to show resistance against many routine deployment in MAS of Pi54 in breeding
isolates of the blast pathogen in India. The gene has programs.
been cloned through map-based strategy and encodes
a nucleotide-binding site–leucine-rich repeat (NBS– Keywords Rice blast  Pi54  InDel 
LRR) domain-containing protein. In the present Functional marker  Magnaporthe oryzae
study, we carried out allele mining for this gene
and identified a 144-bp insertion/deletion (InDel)
polymorphism in the exonic region of the gene.
A PCR-based co-dominant molecular marker target- Rice (Oryza sativa L.) is a staple food for more than
ing this InDel, named Pi54 MAS, was developed. half of the world’s population. Rice blast disease,
Pi54 MAS was observed to perfectly co-segregate caused by the filamentous ascomycete fungus Magna-
porthe oryzae (anamorph Pyricularia oryzae), is one of
the major threats to rice production and leads to
Electronic supplementary material The online version of significant yield losses (Manandhar et al. 1992; Khush
this article (doi:10.1007/s11032-010-9538-6) contains and Jena 2009). Deployment of host plant resistance is
supplementary material, which is available to authorized users. considered to be the best option for managing the
disease (Hulbert et al. 2001) and to date more than 50
G. Ramkumar  K. Srinivasarao  K. M. Mohan 
I. Sudarshan  A. K. P. Sivaranjani  K. Gopalakrishna  blast resistance genes have been characterized in rice.
C. N. Neeraja  S. M. Balachandran  The causal organism, M. oryzae, is highly variable, and
R. M. Sundaram  M. S. Prasad  N. S. Rani  therefore combining 2–3 effective resistance genes
A. M. R. Prasad  B. C. Viraktamath  M. S. Madhav (&)
through gene pyramiding can be helpful in developing
Crop Improvement Section, Directorate of Rice Research,
Rajendranagar, Hyderabad 500030, India durable, broad-spectrum blast-resistant varieties.
e-mail: [email protected]; [email protected] Gene/allele-specific markers play an important role

123
130 Mol Breeding (2011) 27:129–135

in gene pyramiding and marker-assisted selection analysis revealed that Tetep was resistant to all the
(MAS) programs for accurate selection of target plants pathogen isolates tested and the isolate named NLR-
with minimum effort, time and cost. 1, collected from Nellore, Andhra Pradesh, India,
Identification of natural variants for any effective showed the differential reaction of Tetep (Pi54) with
gene (i.e., allele mining) can lead to identification of most of the other resistance gene sources except for
the nucleotide variations responsible for the target Pita, Pib and Pi-2. Plant materials used in this study
trait phenotype, and aids the development of molec- included 27 landraces collected from the north-
ular markers specific to the functional allele (Spooner eastern part of India for identification of nucleotide
et al. 2005; Ramkumar et al. 2010a) of the target sequence level allelic variation in Pi54. The land-
genes. Many functional markers have been developed races were screened for blast resistance with a
by using the strategy of allele mining (Shi et al. 2008; virulent isolate of the pathogen NLR-1, by the spray
Costanzo and Jia 2010). Allele mining is being method and by punch inoculation. Genomic DNA
employed for discovering the variant alleles of major was extracted by a modified potassium acetate
rice biotic resistance genes. Among the blast resis- method (Dellaporta et al. 1983). Linked markers,
tance genes, Pikh, which has been recently renamed viz., RM 206, TRS 26 and TRS 33, for Pi54 (Sharma
Pi54 (Sharma et al. 2010), exhibited resistance to et al. 2005) were also used to screen the materials to
predominant races of the pathogen in India (Sharma confirm the presence of the resistance allele of Pi54
et al. 2002). Pi54 gene was originally identified from in the selected landraces. Using available gene
Tetep, a rice variety, and mapped on chromosome sequence information of Pi54 (which has been
11L with two tightly linked simple sequence repeat identified to encode a nucleotide-binding site–leu-
(SSR) markers TRS26 and TRS33, and has been cine-rich repeat (NBS–LRR) domain-containing pro-
cloned (Sharma et al. 2005). Genotyping using the tein; Sharma et al. 2005) at Genbank (Accession no.
linked markers requires analysis through polyacryl- AY914077), primer pairs were designed using
amide gel electrophoresis (PAGE), which is cumber- the online tool, Primer 3 (http://frodo.wi.mit.
some and time-consuming. Hence, marker-assisted edu/cgi-bin/primer3/primer3_www.cgi), to amplify
introgression of Pi54 into susceptible rice varieties is the entire allelic region of Pi54 gene in such a way
being achieved through another linked SSR marker, that the forward primer targets the upstream region
RM206, which can be resolved through agarose gel (*500 bp before transcription start site) and the
electrophoresis (Srinivasarao et al. 2008, 2009; Hari reverse primer targets the 30 UTR region. These
et al. 2008). However, the marker is not very close to primers (Table 1) were optimized for PCR and the
the gene and this might result in some recombinants Pi54 genomic region was amplified from the selected
in MAS. In order to deploy the gene in marker- rice landraces (Supplementary Table 2) using a high
assisted breeding programs, it was desirable to fidelity Taq DNA polymerase (Fermentas, USA).
develop a functional marker for Pi54, which has not PCR was performed using the protocol described in
done until now. In the present study, we have Ramkumar et al. (2010b). The amplicons were cloned
developed a functional marker for Pi54 through using the ZeBaTA cloning vector (Chen et al. 2009).
allele mining and demonstrated its robustness and Four clones per amplicon were sequenced at Bio-
utility in MAS for the gene. Serve Biotechnologies Pvt. Ltd., Hyderabad, India.
In order to confirm the broad-spectrum resistance The high-quality sequences (Phred score [ 20 per
of Pi54, 12 different blast pathogen isolates, collected base) were compared with each of the identified Pi54
from various hot-spot regions of India (Electronic alleles and with the originally reported gene sequence
Supplementary Material Table 1) were tested for of the candidate gene (Sharma et al. 2005) using the
their pathogenicity against Tetep (possessing Pi54) online sequence alignment tool ClustalW (www.ebi.
and other monogenic lines containing different Pi ac.uk/Tools/clustralw/). Primers were developed tar-
genes at the Directorate of Rice Research, Hydera- geting a 144-bp insertion/deletion (InDel) polymor-
bad, India, by the spray method (Peng and Shishiy- phism which was observed between the resistant and
ama 1988) and by punch inoculation (Dillon et al. susceptible allelic sequences. The primers (Table 1)
1997). Screenings were repeated twice with three were standardized for PCR through gradient anneal-
replications in kharif (July–October), 2009. This ing temperatures in an Applied Biosystems (USA)

123
Mol Breeding (2011) 27:129–135 131

Table 1 List of primers used for allele mining study and for Pi54 MAS marker
Primer Sequence Purpose Expected PCR product (bp)
Forward/reverse

Pi54 AM 1 ctattcctctcttctaaccacatcc/catgagaacatatgtaagcttgtgc Allele mining 1,873

Pi54 AM 2 gtcagaggcattttgttacacagg/gccacttacattaagtaccacactcc Allele mining 2,230
Pi54 MAS caatctccaaagttttcagg/gcttcaatcactgctagacc Allele-specific marker 216 for R/359 for S
AM Allele mining, R resistance, S susceptible
IR68897B
50 bp

Tetep

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27

359bp
216bp

rr RR RR Rr Rr Rr Rr RR rr rr Rr rr RR rr Rr Rr RR RR RR rr Rr RR rr Rr rr Rr Rr rr Rr
IR68897B
50 bp

Tetep

28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

359bp
216bp

rr RRRR RR Rr RR Rr Rr RR Rr Rr Rr Rr RR rr rr Rr RR RR RR RR Rr Rr Rr Rr Rr Rr Rr RR

Fig. 1 Pi54 MAS marker was validated in BC1F2 population; susceptible alleles co-segregated with 216 and 359 bp,
BC1F2 mapping population was derived from a cross between respectively. No recombination was found while comparing
Tetep (possessing Pi54) and IR68897B (susceptible to blast the marker genotypic data and plant phenotypic data. 1–54
disease). Tetep and IR68897B parents were used as resistant BC1F2 mapping population; RR homozygous resistant, rr
and susceptible controls for genotyping. The resistance and homozygous susceptible

thermal cycler. PCR was performed using 1 U of Taq the above, genetic analysis of the marker was con-
DNA polymerase and 19 PCR buffer (Genei, India) ducted by assessing the type I error [i.e., probability
in 15-ll reaction volume with a thermal profile of that the test rejects H0 (no linkage) although H0 is
94°C for 4 min (initial denaturation), followed by 35 true] and type II error (i.e., probability that the test
cycles of denaturation at 94°C for 30 s, annealing at fails to reject H0 although H0 is false) as indicated for
55°C for 30 s, extension at 72°C for 1 min and a final the co-dominant molecular marker-assisted linkage
extension of 7 min at 72°C. PCR products were detection for monogenic qualitative trait and the
electrophoretically separated in 1% agarose gels. power of tests for linkage of the marker with the trait
Validation of the marker was done in a BC1F2 as demonstrated by Huhn and Piepho (2003). The
population, derived from the cross between Tetep sensitivity (which is the probability that the test will
(possessing Pi54) and IR68897B, which is suscepti- be positive if a line has the disease) and specificity
ble to blast disease (Fig. 1). In addition to the pop- (which is the probability that the test will be negative
ulation, a total of 105 diverse rice varieties if a line does not have the disease) of this marker also
(Supplementary Table 3) were screened to check the were calculated.
utility of the newly developed marker (Fig. 2). To Based on phenotyping data, two each of highly
check the reliability of the binding positions of the resistant and susceptible landraces were selected to
designed primers, PCR amplicons of two each sus- analyze the Pi54 allelic variation. Using the opti-
ceptible and resistant genotypes were cloned by using mized primers, the Pi54 allelic regions were ampli-
ZeBaTA cloning vector (Chen et al. 2009) and four fied, cloned and sequenced from these genotypes and
clones per amplicon were sequenced. In addition to the sequence information has been submitted to

123
132 Mol Breeding (2011) 27:129–135

100bp
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25

359 bp

216 bp

RR RR RR RR RR RR RR RR RR RR RR RR RR rr rr rr rr rr rr rr RR RR rr RR rr

Fig. 2 Pi54 MAS amplification pattern in 23 of 105 diverse susceptible and heterozygote allele. Tetep and IR68897B
important rice varieties; 105 diverse important rice varieties parents were used as resistant and susceptible controls for
were used for the validation of the newly developed Pi54 MAS genotyping. 1–23 represent 1–23 rice varieties in Supplemen-
marker. The amplified alleles were scored as resistance, tary Table 3; 24 Tetep; 25 IR68897B

GenBank (Supplementary Table 2). Sequence com- respect to the functional marker, and the marker
parison at nucleotide level of the Pi54 alleles of the genotype was observed to be perfectly correlated with
genotypes revealed the presence of 45 single nucle- the phenotypic data, indicating the reliability of the
otide polymorphisms (SNPs) and four InDels as newly developed marker Pi54 MAS (Fig. 2). Inter-
common polymorphisms between the resistant and estingly, we observed that genotyping with the
susceptible genotypes. Among these, a large 144-bp functional marker is more accurate than RM206.
InDel was conspicuous (Supplementary Fig. 1). For instance, the susceptible genotypes, Pud-
Primers (Pi54 MAS) were designed targeting the uraiponni, FR13A, CST7-1, Narendra user-2 and
InDel region, in such a way that the resistant and Bate Aus, showed a susceptible allelic pattern and the
susceptible genotypes would produce 216- and 359- resistant genotypes, Suraksha, Phalguna, Triguna and
bp amplicons respectively and the amplicons could Haryana basmati and CH988, showed a resistance
be resolved in low-percentage agarose gels within a allelic pattern with Pi54 MAS, which matched
short time span. To validate the linkage of the marker perfectly with the phenotypic score, while in all
with the trait phenotype, it was screened in the these cases RM206 showed contradictory genotypes
BC1F2 mapping population consisting of 200 indi- (Supplementary Table 3). This indicates that the
viduals derived from the cross Tetep 9 IR68897B. marker Pi54 MAS gives more accurate genotyping
When the phenotype data of the mapping population than the earlier reported SSR markers since the newly
was correlated with the marker genotype data, all the developed functional marker is designed from the
54 homozygous resistant BC1F2 plants amplified the exonic region of the gene itself. The rice varieties
216-bp fragment, while all the 98 heterozygous IR64, IR36 and Palamdhan 957 showed the resistance
resistant plants displayed a heterozygous amplifica- reaction whereas Pi54 MAS showed a susceptible-
tion pattern and all the 48 homozygous susceptible specific allelic pattern. This can be explained by the
plants displayed amplification of the 359-bp frag- fact that the two IR cultivars are known to possess
ment. The plants were observed to segregate in a Pita and Pib genes (Ebron et al. 2004) and Palamd-
typical Mendelian ratio of 1 homozygous resistant: 2 han 957 possesses the Pi2 gene (based on marker
heterozygous resistant: 1 homozygous susceptible analysis carried out in our laboratory). To check the
(v2 = 0.14, P = 0.49) with respect to marker geno- reliability of the primer binding positions of Pi54
type. No recombinants were observed between Pi54 MAS, the PCR amplicons derived with this marker
MAS marker genotype and the trait phenotype, while were cloned and sequenced from two resistant
two recombinants were observed with respect to the genotypes (Suraksha and Swarnamukhi) and two
linked marker RM206 (Sharma et al. 2005). susceptible genotypes (Swarna and Samba Mahsuri).
The functional marker, Pi54 MAS, was also tested The sequencing results confirm the presence of a 144-
in 105 diverse rice varieties (Supplementary Table 3) bp insertion in the susceptible and deletion of 144 bp
and the results were compared with the linked in the resistant cultivars. Interestingly, Nipponbare,
marker RM206. Among the 105 varieties, 38 and which is also susceptible to blast, showed the
65 genotypes displayed amplification of homozygous presence of a 144-bp insertion (Fig. 3). Statistical
resistant and susceptible alleles, respectively, with analysis of genotyping results of Pi54 MAS in 105

123
Mol Breeding (2011) 27:129–135 133

Fig. 3 Sequence alignment showing the 144-bp InDel in the genotypes (Swarna and Samba Mahsuri). The sequencing
Pi54 alleles. To check the reliability of the primer binding results confirm the presence of a 144-bp insertion in the
positions of Pi54 MAS, the PCR amplicons derived with this susceptible and deletion of 144 bp in the resistant Pi54 alleles.
marker were cloned and sequenced from two resistant Reported Pi54 and Nipponbare sequences were also used for
genotypes (Suraksha and Swarnamukhi) and two susceptible comparison

diverse rice cultivars also revealed the very low showed a resistant-specific amplification pattern
occurrence of type I errors (a) and type II errors (b) (216 bp), but they were observed to be phenotypi-
compared to those of RM206. This shows that Pi54 cally susceptible. This susceptibility may be due to
MAS is more sensitive, more specific and has a other mutations in the Pi54 gene. Sharma et al.
higher power (93.0) for accurate genotyping com- (2005) reported the presence of a SNP in the
pared to RM206 (Table 2). Fuentes et al. (2008) promoter region in the Pi54 allele of HP2216, which
demonstrated this statistical method for selecting a is responsible for low expression of the gene and
better marker for Pi-1(t) from a set of markers therefore susceptibility of that cultivar. Molecular
developed for the gene. markers developed for that reported SNP could not
Although the Pi54 MAS marker can accurately differentiate diverse susceptible rice varieties from
genotype most of the resistant/susceptible cultivars/ Tetep except for HP2216 and Kalinga III (unpub-
genotypes, we found two exceptions; HP2216 and lished data from our previous study), which reveals
Kalinga III were genotyped as resistant since they that the reported SNP is not a common feature among
the susceptible rice varieties. However, we observed
Table 2 Statistical comparison of Pi54 MAS and RM206 that the 144-bp InDel marker predicts the genotype
using the Huhn and Piepho (2003) system
accurately in 98% of the screened rice varieties,
Probability qualifications (%) Pi54 MAS RM206 which includes most of the commonly used rice
False linkage (a) 3.3 8.8
varieties in the national and international breeding
False no linkage (b) 7.0 19.6
programs (Supplementary Table 3).
In summary, Pi54 is one of the important genes
Power (1 - b) 93.0 80.4
being used in rice breeding programs. Although
Sensitivity 96.7 91.2
functional markers are used in molecular breeding for
Specificity 93.0 80.4
blast resistance genes such as Pita (Jia et al. 2002), a
Predictive value positive (PVP) 95.0 88.1
functional marker for Pi54 has not yet been reported
Predictive value negative (PVN) 95.2 85.2
until now. The development of a functional marker

123
134 Mol Breeding (2011) 27:129–135

for this gene through the present study will be Ebron LA, Fukuta Y, Imbe T, Kato H, Yanoria JMT, Tsu-
immensely helpful for enhancing the precision of nematsu H, Khush GS, Yakoo M (2004) Estimation of
genes in blast resistance in elite indica type rice (Orysa
selection in breeding programs. The allele mining sativa L.) varieties bred at the International Rice Research
strategy is being widely used to develop many Institute. Breed Sci 54:381–387
functional/tightly linked molecular markers. Cost- Fuentes JL, Victoria FJC, Escobar F, Prado G, Aricapa G,
anzo and Jia (2010) also developed an InDel-based Duque MC, Tohme J (2008) Identification of microsatel-
lite markers linked to the blast resistance gene Pi-1(t) in
marker for the blast resistance gene Pikm using the rice. Euphytica 160:295–304
allele mining strategy; Hayashi et al. (2006) devel- Hari Y, Srinivasarao K, Ramesha MS, Viraktamath BC, laha
oped PCR-based InDel markers for nine blast resis- GS, Balachandran SM, Prasad MS, Reddy CS, Prasad
tance genes by using already reported sequence ASH, Natarajkumar P, Sujatha K, Sundaram RM (2008)
Improvement of maintainer line (IR58025B) for bacterial
information on the candidate genes. Hence, we also blight (BB) and blast resistance through marker assisted
applied the allele mining strategy to find the varia- selection. National symposium on new biology in
tions in the Pi54 alleles. The functional marker agriculture, Punjab University, Chandigarh, p 80, 7–8
developed for Pi54 in this study is based on the 144- November 2008
Hayashi K, Yoshida H, Ashikawa I (2006) Development of
bp InDel mutation in the exonic region of the Pi54 PCR-based allele-specific and InDel marker sets for nine
gene, which may alter the protein structure and hence rice blast resistance genes. Theor Appl Genet 113:251–
its function. Interestingly, this InDel mutation may 260
not affect NBS-LRR domains of the gene (Sharma Huhn M, Piepho HP (2003) Determining the sample size for
co-dominant molecular marker-assisted linkage detection
et al. 2005) and we assume that it occurred much for a monogenic qualitative trait by controlling the type-I
earlier in the evolution of the Pi54 locus, since the and type-II errors in a segregating F2 population. Theor
InDel is present in most of the rice varieties. While Appl Genet 106:840–845
many of the reported blast resistance functional Hulbert SH, Webb CA, Smith SM, Sun Q (2001) Resistance
gene complexes: evolution and utilization. Annu Rev
markers are dominant (Hayashi et al. 2006; Jia Phytopathol 39:285–312
et al. 2002), this newly developed Pi54 MAS marker Jia Y, Wang Z, Singh P (2002) Development of dominant rice
is co-dominant in nature and hence will have more blast Pi-ta resistance gene markers. Crop Sci 42:2145–
practical applications in MAS. The marker can be 2149
Khush GS, Jena KK (2009) Current status and future prospects
used for accurate genotyping in segregating popula- for research on blast resistance in rice (Oryza sativa L.).
tions and predicts the allelic status efficiently in many In: Wang GL, Valent B (eds) Advances in genetics,
rice cultivars. Hence, the newly developed exonic genomics and control of rice blast disease. Springer, New
InDel-based simple functional marker will be highly York, pp 1–10
Manandhar HK, Shrestha K, Amatya P (1992) Seed-borne
useful in marker-assisted breeding programs aimed at diseases. In: Mathur SB, Amatya P, Shrestha K, Manan-
improvement of blast resistance in elite rice cultivars. dhar HK (eds) Plant diseases, seed production and seed
health testing in Nepal. DGISP, Denmark, pp 59–74
Acknowledgments The Authors thank the Department of Peng YL, Shishiyama J (1988) Temporal sequence of cyto-
Biotechnology, Government of India for providing funds for logical events in rice leaves infected with Pyricularia
carrying out the research work. Ramkumar is grateful to CSIR orvzae. Can J Bot 66:730–735
for the award of a senior research fellowship. Ramkumar G, Sakthivel K, Sundaram RM, Neeraja CN, Bal-
achandran SM, Rani NS, Viraktamath BC, Madhav MS
(2010a) Allele mining in crops: prospects and potentials.
Biotechnol Adv 28:451–461
References Ramkumar G, Biswal AK, Mohan KM, Sakthivel K, Sivaran-
jani AKP, Neeraja CN, Ram T, Balachandran SM, Sun-
Chen S, Songkumarn P, Liu J, Wang GL (2009) A versatile daram RM, Prasad MS, Rani NS, Viraktamath BC,
zero background T-vector system for gene cloning and Madhav MS (2010b) Identification of novel alleles of rice
functional genomics. Plant Physiol 150:1111–1121 blast resistance genes Pikh and Pita through allele mining.
Costanzo S, Jia Y (2010) Sequence variation at the rice blast Int Rice Res Notes 35:1–6
resistance gene Pi-km locus: implications for the devel- Sharma TR, Chauhan RS, Singh BM, Paul R, Sagar V, Rathore
opment of allele specific markers. Plant Sci 178:523–530 R (2002) RAPD and pathotype analysis of Magnaporthe
Dellaporta SL, Wood J, Hick JB (1983) A plant DNA mini- grisea population from North-western Himalayan region
preparation: version II. Plant Mol Biol Rep 1:19–21 of India. J Phytopathol 150:649–656
Dillon VM, Overton J, Grayer RJ, Harbornet JB (1997) Dif- Sharma TR, Madhav MS, Singh BK, Shanker P, Jana TK,
ferences in phytoalexin response among rice cultivars of Dalal V, Pandit A, Singh A, Gaikwad K, Upreti HC,
different resistance to blast. Phytochemistry 44:599–603 Singh NK (2005) High-resolution mapping, cloning and

123
Mol Breeding (2011) 27:129–135 135

molecular characterization of the Pi-kh gene of rice, Prasad ASH, Natarajkumar P, Sujatha K, Sundaram RM
which confers resistance to Magnaporthe grisea. Mol (2008) Improvement of Hybrid rice parental lines for
Genet Genomics 274:569–578 bacterial leaf blight (BLB) and blast resistance through
Sharma TR, Rai AK, Gupta GK, Singh NK (2010) Broad spec- marker assisted selection. 1st AP science congress 2008—
trum blast resistance gene Pikh cloned from the rice line emerging trends in science and technology, Hyderabad,
tetep designated as Pi54. J Plant Biochem Biotechnol 19:1 p 115, 14–16 Nov 2008
Shi W, Yang Y, Chen S, Xu M (2008) Discovery of a new Srinivasarao K, Hari Y, Laha GS, Virakthamath BC, Mishra B,
fragrance allele and the development of functional Hariprasad AS, Natarajkumar P, Mohan KM, Prasad MS,
markers for the breeding of fragrant rice varieties. Mol Sundaram RM (2009) Marker assisted introgression of
Breed 22:185–192 bacterial blight and rice blast resistance genes into hybrid
Spooner D, van Treuren R, de Vicente MC (2005) Molecular rice parental lines. Proceedings of 6th international rice
markers for genebank management. Technical bulletin no. genetics symposium, IRRI, Philippines, pp 3–56, 16–19
10, International Plant Genetic Resources Institute, Italy Nov 2009
Srinivasarao K, Hari Y, Ramesha MS, Mishra B, Viraktamath
BC, Laha GS, Balachandran SM, Prasad MS, Reddy CS,

123