See discussions, stats, and author profiles for this publication at: [Link]

net/publication/282649320

The Adaptor Protein Myd88 Is a Key Signaling Molecule in the Pathogenesis of

Irinotecan-Induced Intestinal Mucositis

Article  in  PLoS ONE · October 2015

DOI: 10.1371/[Link].0139985

CITATIONS READS

40 394

15 authors, including:

Deysi Wong Roberto Lima

Universidade Federal do Ceará Universidade Federal do Ceará
35 PUBLICATIONS   810 CITATIONS    51 PUBLICATIONS   1,722 CITATIONS   

SEE PROFILE SEE PROFILE

Caio Leite Maraiza Alves

Beneficência Portuguesa de São Paulo Amedeo Avogadro University of Eastern Piedmont
23 PUBLICATIONS   1,062 CITATIONS    6 PUBLICATIONS   80 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

IL-33 and sepsis-induced immunosuppression View project

Wound healing by natural products View project

All content following this page was uploaded by Rangel Leal Silva on 09 October 2015.

The user has requested enhancement of the downloaded file.

 RESEARCH ARTICLE

The Adaptor Protein Myd88 Is a Key

Signaling Molecule in the Pathogenesis of
Irinotecan-Induced Intestinal Mucositis
Deysi V. T. Wong1,2, Roberto C. P. Lima-Júnior1, Cibele B. M. Carvalho3, Vanessa
F. Borges4, Carlos W. S. Wanderley1, Amanda X. C. Bem1, Caio A. V. G. Leite1, Maraiza
A. Teixeira1, Gabriela L. P. Batista1, Rangel L. Silva4, Thiago M. Cunha4, Gerly A. C. Brito5,
Paulo R. C. Almeida3, Fernando Q. Cunha4, Ronaldo A. Ribeiro1,6*
1 Nucleus for the Study of Toxicities of the Cancer Treatment, Department of Physiology and Pharmacology,
Faculty of Medicine–Federal University of Ceará, Fortaleza, Brazil, 2 Laboratory of Molecular Biology,
Department of Pathology, Cancer Institute of Ceará, Fortaleza, Brazil, 3 Department of Pathology and
Forensic Medicine, Faculty of Medicine–Federal University of Ceará, Fortaleza, Brazil, 4 Department of
Pharmacology, School of Medicine of Ribeirão Preto, University of São Paulo, São Paulo, Brazil,
5 Department of Morphology, Faculty of Medicine–Federal University of Ceará, Fortaleza, Brazil,
6 Department of Clinical Oncology, Cancer Institute of Ceará, Fortaleza, Brazil

* ribeiror21@[Link]; devite06@[Link]
OPEN ACCESS

Citation: Wong DVT, Lima-Júnior RCP, Carvalho

CBM, Borges VF, Wanderley CWS, Bem AXC, et al.
(2015) The Adaptor Protein Myd88 Is a Key Signaling
Abstract
Molecule in the Pathogenesis of Irinotecan-Induced
Intestinal mucositis is a common side effect of irinotecan-based anticancer regimens.
Intestinal Mucositis. PLoS ONE 10(10): e0139985.
doi:10.1371/[Link].0139985 Mucositis causes cell damage, bacterial/endotoxin translocation and production of cyto-
kines including IL–1 and IL–18. These molecules and toll-like receptors (TLRs) activate a
Editor: Lena Alexopoulou, Centre d'Immunologie de
Marseille-Luminy, CNRS-Inserm, FRANCE common signaling pathway that involves the Myeloid Differentiation adaptor protein,
MyD88, whose role in intestinal mucositis is unknown. Then, we evaluated the involvement
Received: March 12, 2015
of TLRs and MyD88 in the pathogenesis of irinotecan-induced intestinal mucositis. MyD88-,
Accepted: September 21, 2015
TLR2- or TLR9-knockout mice and C57BL/6 (WT) mice were given either saline or irinote-
Published: October 6, 2015 can (75 mg/kg, i.p. for 4 days). On day 7, animal survival, diarrhea and bacteremia were
Copyright: © 2015 Wong et al. This is an open assessed, and following euthanasia, samples of the ileum were obtained for morphometric
access article distributed under the terms of the analysis, myeloperoxidase (MPO) assay and measurement of pro-inflammatory markers.
Creative Commons Attribution License, which permits
Irinotecan reduced the animal survival (50%) and induced a pronounced diarrhea,
unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are increased bacteremia, neutrophil accumulation in the intestinal tissue, intestinal damage
credited. and more than twofold increased expression of MyD88 (200%), TLR9 (400%), TRAF6
Data Availability Statement: All relevant data are (236%), IL–1β (405%), IL–18 (365%), COX–2 (2,777%) and NF-κB (245%) in the WT ani-
within the paper. mals when compared with saline-injected group (P<0.05). Genetic deletion of MyD88,
Funding: Grants received by RAR: 308879/2009-0, TLR2 or TLR9 effectively controlled the signs of intestinal injury when compared with irinote-
Conselho Nacional de Desenvolvimento Científico e can-administered WT controls (P<0.05). In contrast to the MyD88-/- and TLR2-/- mice, the iri-
Tecnológico, Website: [Link]; 23038.007544- notecan-injected TLR9-/- mice showed a reduced survival, a marked diarrhea and an
201131, Fundação Coordenação de Aperfeiçoamento
enhanced expression of IL–18 versus irinotecan-injected WT controls. Additionally, the
de Pessoal de Nível Superior, website: [Link].
[Link]; 11.01.00/08, Fundação Cearense de Apoio ao expression of MyD88 was reduced in the TLR2-/- or TLR9-/- mice. This study shows a critical
Desenvolvimento Científico, website: [Link]. role of the MyD88-mediated TLR2 and TLR9 signaling in the pathogenesis of irinotecan-
[Link]. The above mentioned funders had no role in induced intestinal mucositis.
study design, data collection and analysis, decision to
publish, or preparation of the manuscript.

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 1 / 21

 MyD88, Toll-Like Receptors and Mucositis

Competing Interests: The authors have declared Introduction

that no competing interests exist.
Many anti-tumor agents used to treat cancer also affect rapidly dividing normal cells, including
the epithelial cells of the gut, leading to various degrees of mucositis in the gastrointestinal tract
[1]. Of particular importance in the clinical setting is the life-threatening intestinal mucositis
associated with diarrhea [1]. The use of chemotherapeutic protocols that include irinotecan
may cause diarrhea in as many as 80% of patients and in 5–47% of them, a severe form of diar-
rhea (National Cancer Institute–Common Toxicity Criteria grades 3 or 4) is reported [1–3].
The clinical consequences of chemotherapy-induced diarrhea include dose-reduction (45%),
delays in therapy (71%) and discontinuation of therapy (3%) [1].
Irinotecan, a topoisomerase I inhibitor, is clinically active against lung, gastric, cervical and
ovarian cancers and is used as first- and second line-therapy for colorectal cancer [4]. Irinote-
can-related diarrhea occurs in two forms, an early-onset type, which is dependent on the acti-
vation of cholinergic signaling and is controlled with atropine, and a late-onset diarrhea, whose
mechanism has not been completely elucidated. However, loperamide, a μ2-opioid agonist
agent used as a first-line treatment, and octreotide, whose mechanism is unclear and is used as
a second-line treatment, are somewhat effective [1]. Recently, we demonstrated that in spite of
regulating the diarrheic events, the inflammatory response associated with the mucositis
induced by irinotecan is not attenuated by loperamide [5], which might explain its incomplete
response in clinical setting. Other and less effective prophylactic approaches that have been
suggested to manage chemotherapy-induced diarrhea include octreotide, glutamine, celecoxib,
activated charcoal, absorbents, and racecadotril [6]. However, an improved knowledge con-
cerning the pathogenesis of mucositis would open substantial perspectives on the adequate
management of this condition.
The intestinal microbiota is believed to influence all phases of the pathogenesis of mucositis
[7]. Activation of the innate immune response in the intestine is triggered by pathogen-recog-
nition receptors including toll-like receptors (TLRs), which function as sensors of pathogen-
associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs)
[8].
TLRs are transmembrane proteins that maintain intestinal homeostasis [9] or contribute to
inflammatory diseases [10]. TLRs initiate the innate immune response and the production of
pro-inflammatory mediators including interleukin–1β (IL–1β) [11], nitric oxide [12] and
interleukin–18 [13], whose role in intestinal mucositis has been previously described by our
group [5,14,15]. Several TLRs and the IL–1 family of cytokines are known to signal through a
complex intracellular network that involves MyD88-dependent or Myd88-independent path-
ways [16] that regulate the mucosal immune response [17,18]. Interestingly, Frank and col-
leagues [19] showed that TLR2 knockout mice injected with methotrexate present an
exacerbated mucositis. In addition, Sukhotnik et al [20] suggested that MyD88-dependent
TLR4 signaling is protective against methotrexate-induced intestinal damage. In contrast,
Kaczmarek and co-workers [21] demonstrated that TLR2 and TLR9 signaling pathways play a
central role in the development of doxorubicin-induced intestinal mucositis. However, in con-
trast to irinotecan, protocols that include doxorubicin are mainly described to induce severe
oral mucositis (up to 13.40% of patients) rather than intestinal damage and severe diarrhea
(2.78% of patients) [22]. Such findings might suggest that the pathogenesis of mucositis seems
to be strongly dependent on the chemotherapeutic agent used
Then, we aimed to study the involvement of TLR2, TLR9 and the downstream adaptor mol-
ecule, MyD88, in the pathogenesis of irinotecan-induced intestinal.

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 2 / 21

 MyD88, Toll-Like Receptors and Mucositis

Materials and Methods

Animals
The experiments were performed on male C57BL/6 mice (background mouse strain, wild type,
WT, 20–24 g) and MyD88 (MyD88-/-)-, Toll-like receptor 2 (TLR2-/-)- and 9 (TLR9-/-)-defi-
cient mice. The mice were housed in the animal care facility of the School of Medicine of Ribei-
rão Preto and were divided in experimental groups of 6–9 animals. The animals were kept in a
temperature-controlled room under a dark-light cycle, and food and water were available ad
libitum. The original breeding pairs of mice with the targeted disruptions of the TLRs and
MyD88 gene were obtained from The Jackson Laboratories (Bar Harbor, Maine, USA). The
genotype of these mice was confirmed by DNA PCR.

Ethics statement
This study was carried out in strict accordance with the recommendations in the Guide for the
Care and Use of Laboratory Animals of the National Institutes of Health and the ARRIVE
Guidelines (Animals in Research: Reporting In Vivo Experiments) [23]. All efforts were made
in order to minimize animal suffering. In the survival study, the animals were monitored twice
daily for ten days following the first injection of irinotecan. During the experiment, fifty per-
cent of the animals succumb due to the treatment and its consequences, including diarrhea.
Those animals that showed signs of imminent death, including piloerection, reduced locomo-
tion, inability to maintain upright position, ataxia, tremor and altered breath frequency were
euthanized by ketamine/xylazine overdose (>100/10 mg/kg, s.c., União Química, São Paulo,
Brazil) followed by cervical dislocation. Pain relievers or anesthesia were not used in our exper-
iments since those agents directly interfere with the production of inflammatory mediators
and/or alter the gastrointestinal transit and mask the diarrheic events in this animal model. At
the end of the survival experiment, live animals were euthanized by ketamine/xylazine over-
dose (>100/10 mg/kg, s.c., União Química, São Paulo, Brazil) followed by cervical dislocation.
The experimental protocol, including the mortality aspects of the protocol, was reviewed and
approved by the Committee on the Ethics of Animal Experiments of the Federal University of
Ceará (Permit Number: 99/10).

Drugs
Irinotecan hydrochloride (irinotecan, Evoterin1, Evolabis, São Paulo, Brazil, 100 mg ampoule)
and sterile saline were used.

Induction of experimental intestinal mucositis

The induction of experimental intestinal mucositis in mice was based on a model previously
described by Ikuno et al. [24], and modified for our experimental conditions. Briefly, C57BL/6
wild type, MyD88-/-, TLR2-/- and TLR9-/- mice were given either saline (3.5 mL/kg, i.p.) or iri-
notecan (75 mg/kg, i.p.) once daily for 4 days. On day seven after the first dose of irinotecan
diarrhea, and blood leukocyte and bacterial counts were assessed. The animals were anesthe-
tized with an overdose of ketamine/xylazine (>100/10 mg/kg, s.c.) followed by cervical disloca-
tion for the collection of samples of the ileum for morphometric analysis, myeloperoxidase
assay, NF-κB immunohistochemistry, Interleukin–1 levels and COX–2 and IL–18 mRNA
expression. For the study of animal survival, the mice were observed as described previously up
to day ten following the first injection of irinotecan.

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 3 / 21

 MyD88, Toll-Like Receptors and Mucositis

Diarrhea assessment
Diarrhea observed on the seventh day after the first dose of irinotecan was considered to be
delayed-onset diarrhea. The severity of the diarrhea was scored as described by Kurita et al.
[25] as follows: 0 (normal), normal stool or absent; 1 (slight), slightly wet and soft stool; 2
(moderate), wet and unformed stool with moderate perianal staining of the coat; and 3
(severe): watery stool with severe perianal staining of the coat.

Blood leukocyte and bacterial counts

The mice were lightly anaesthetized with tribromoethanol 2.5% solution (10 [Link]−1, i.p.), and
a sample of blood was collected from the retro-orbital plexus. The blood leukocyte count was
performed using a Coulter ACT series cell counter and expressed as cells x 103.μL−1 of blood. A
bacterial count in whole blood was conducted as previously described by Godshall et al. [26].
Briefly, blood samples were collected under sterile conditions, plated in Muller-Hinton agar
dishes (Difco Laboratories), and aerobically incubated at 37°C. Colony-forming units (CFU)
were recorded after 48 h of culture. The results were expressed as the log of [Link]−1 of
blood.

Morphometric analysis
The specimens were fixed in 10% neutral buffered formalin, dehydrated, and embedded in par-
affin. Sections of 5 μm thickness were obtained for hematoxylin-eosin staining (H&E) and sub-
sequent examination by light microscopy (x100). For the morphometric analysis, the length of
the intestinal villi was measured using Software ImageJ 1.4 (NIH–National Institute of Health,
Bethesda, MD, USA). Between 5 and 10 villi were measured per slice [5]. Mucosal injury was
also assessed using a modification of the histopathological score system described by Macpher-
son & Pfeiffer [27] and was graded as follows: Score 0, normal histological findings; Score 1,
mucosa: villus blunting, loss of crypt architecture, sparse inflammatory cell infiltration, vacuo-
lization and oedema. Muscle layer: normal. Score 2, mucosa: villus blunting with fattened and
vacuolated cells, crypt necrosis, intense inflammatory cell infiltration, vacuolization and
oedema. Muscle layer: normal. Score 3, mucosa: villus blunting with fattened and vacuolated
cells, crypt necrosis, intense inflammatory cell infiltration, vacuolization and oedema. Muscle
layer: oedema, vacuolization and neutrophilic infiltration.

Determination of ileum tissue myeloperoxidase activity (MPO)

MPO is an abundant enzyme found in the azurophilic granules of neutrophils, and the mea-
surement of myeloperoxidase is commonly used as a neutrophil marker in inflamed tissue as
previously described [28]. Briefly, a sample of the ileum (40–60 mg) was harvested and homog-
enized in 0.02 M NaPO4 buffer (pH 4.7) containing 0.1 M NaCl and 0.015 M Na2 EDTA then
centrifuged at 800 g for 15 min at 4°C. The pellet was then subjected to hypotonic lysis (0.2%
NaCl solution, followed 30 s later by the addition of an equal volume of a solution). After a fur-
ther centrifugation step, the pellet was resuspended in 300 μL of 0.05 M NaPO4 buffer, pH 5.4,
containing 0.5% hexadecyltrimethyl-ammonium bromide (HTAB, Sigma). The MPO activity
was developed with the color reagent tetramethylbenzidine (1.6 mM) and H2O2 (0.5 mM). The
reaction was stopped with a 2 M H2SO4 solution and the absorbance at 450 nm was determined
using a spectrophotometer. The readings were compared with those of a standard curve of
mouse peritoneal neutrophils processed in the same way, and the data obtained were expressed
as MPO activity (neutrophils/mg of tissue).

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 4 / 21

 MyD88, Toll-Like Receptors and Mucositis

NF-κB immunohistochemistry
Immunohistochemistry for the NF-κB p50 nuclear localization sequence (NLS) was performed
using the streptavidin-biotin-peroxidase method [29]. Ileal cross-sections were processed and
incubated overnight (4°C) with primary rabbit anti-NF-κB antibody (Santa Cruz Biotechnol-
ogy, sc–114) diluted 1:400 in PBS with bovine serum albumin (PBS-BSA). The slides were then
incubated with biotinylated goat anti-rabbit antibody (Santa Cruz Biotechnology) diluted
1:800 in PBS/BSA. After washing, the slides were incubated with the avidin-biotin-horseradish
1
peroxidase conjugate (Strep ABC complex by Vectastain ABC Reagent and peroxidase sub-
strate solution) for 30 min, according to the Vectastain protocol. NF-κB was visualized with
the chromogen 3,3’-diaminobenzidine (DAB). The negative control sections were processed
simultaneously as described above except that the first antibody was replaced with PBS-BSA
5%. Qualitative immunohistochemistry was performed as described by [30]. The staining was
observed using light microscopy. NF-κB expression was evaluated by counting the immunos-
tained nuclei in the Lieberkühn crypts and expressed as the percentage of positive stained
nuclei.

Quantification of nuclear p65 subunit as a parameter of NF-κB activation

by western blotting
Ileum samples of WT or Myd88-/- mice were lysed, homogenized and immediately transferred
to tubes and vortexed for 1 min. The resulting extract was centrifuged at 10,000 g for 5 min
and the supernatant was collected as a cytoplasmic extract. The pellet was washed and follow-
ing centrifugation the supernatant was discarded. The resulting pellet was lysed, maintained in
ice and homogenized by vortexing for 30 min. The resulting extract was centrifuged at 10,000 g
for 5 min. The resulting supernatant was taken as nuclear extract. The proteins in each extract
were separated by electrophoresis on 12% polyacrylamide gel (SDS-PAGE) followed by trans-
fer to nitrocellulose membrane. The membrane containing the nuclear proteins was incubated
with 1:300 rabbit anti-p65 (sc–372, Santa Cruz Biotechnology, Dallas, TX, USA), washed and
incubated with a secondary antibody conjugated with peroxidase (anti-rabbit IgG, Sigma,
St. Louis, MO, USA). For measurement, the chemiluminescence system was visualized using
the ChemiDocTM XRS+ System (BioRad, Life Technologies, Carlsbad, CA, USA). To assess the
quality of the separation of the extracts, the same membranes were stained with the anti-mouse
antibody nucleophosmin (Sigma, St. Louis, MO, USA). Then, the membranes were incubated
with respective secondary antibodies conjugated with peroxidase following the same protocol
described above. The bands shown are representative of the groups. The quantification was
performed by normalization with control group (medium) [31].

IL–1β enzyme-linked immunosorbent assay (ELISA)

Intestinal samples of MyD88-/-, TLR2-/- and TLR9-/- mice were removed and processed as
described by Safieh-Garabedian et al. [32] to determine the concentration of interleukin (IL)-
1β using an enzyme-linked immunosorbent assay (ELISA) [33]. Briefly, microtiter plates were
coated overnight at 4°C with an antibody against mouse IL–1β (4 μg/mL, DuoSet ELISA Devel-
opment kit R&D Systems). After blocking the plates, the sample and standard were added and
incubated at 4°C for 2 h. After washing the plates, biotinylated goat anti-mouse (diluted 1:1000
with assay buffer 1% BSA, R&D System, USA) was added to the wells at room temperature for
2 h and incubated with 100 μl of Streptavidin-HRP diluted 1:200. The substrate solution
(100 μL of a 1:1 mixture of H2O2 and tetramethylbenzidine; R&D System, USA) was then
added to the plate, and incubated in the dark at room temperature for 20 min. The enzyme

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 5 / 21

 MyD88, Toll-Like Receptors and Mucositis

reaction was stopped with H2SO4 (2N) and absorbance was measured at 450 nm. The results
are expressed as pg/mg of tissue and reported as the means ± S.E.M.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Ileum samples from the WT mice were removed to determine the expression of MyD88, Tlr2,
Tlr9, Myd88 and Traf6. In addition, intestinal samples of MyD88-/-, TLR2-/- and TLR9-/- mice
were removed to quantify the expression of cyclooxygenase–2 (Cox–2) and IL–18. Total RNA
isolation was performed using the AurumTM Total RNA Fatty and Fibrous Tissue Kit (Bio-Rad,
CA, USA). The yield and quality of total RNA were determined spectrophotometrically using
260 nm and a 260/280-nm ratio, respectively. One microgram of total RNA from the intestinal
samples in a final volume of 20 μl were reverse-transcribed into cDNA in the C1000 TouchTM
Termal Cycler system with the iScriptTM cDNA synthesis kit from Bio-Rad. Real-time quanti-
tative PCR analysis of the mRNA was performed in an CFX96 TouchTM real-time PCR detec-
tion system instrument from Bio-Rad using the iQTM SYBR1 Green Supermix (Bio-Rad, CA,
USA) as indicated by the manufacturer. All samples were run in duplicate, and the relative
mRNA expression level was determined after normalizing all values to those of β-actin. All
samples were evaluated for the dissociation characteristics of the double-stranded DNA during
heating (melting curve analysis). The relative gene expression was determined using the 2-ΔΔCt
method [34] with β-actin as the housekeeping gene. The primer pairs used in this study are
shown in Table 1.

Statistical analysis
The parametric data are expressed as the means ± standard error of the mean (S.E.M.), except
for the diarrhea assessment and histopathologic scores (non-parametric data), which are
reported as the median values (minimum-maximum). The data were analyzed using one-way
or two-way ANOVA followed by Bonferroni’s test (parametric data) or by Kruskal-Wallis fol-
lowed by Dunn’s test (non-parametric data). The Mantel-Cox log rank test was used to deter-
mine differences between survival curves. Statistical significance was accepted when P<0.05.

Table 1. Primers used in this study.

Primers Sequence
Myd88 Forward 5'- GCCTTTACAGGTGGCCAGAG–3'
Reverse 5´- CGGATCATCTCCTGCACAAA–3'
Tlr2 Forward 5'-CAAACGCTGTTCTGCTCAGG–3'
Reverse 5´- CACCATGGCCAATGTAGGTG–3’
Tlr9 Forward 5’- TCCATCACCTGAGCCATCTG–3’
Reverse 5’- TAGGTCCAGCACCGAGAGGT–3’
Traf6 Forward 5’-AGCGCTGCAGTGAAAGATGA–3’
Reverse 5’-CTGCTTCCCGTAAAGCCATC–3’
Cox–2 Forward 5'-GTGGAAAAACCTCGTCCAGA–3'
Reverse 5´-GCTCGGCTTCCAGTAFFGAG–3'
Il–18 Forward 5'-CAGGCCTGACATCTTCTGCAA–3’
Reverse 5´- TCTGACATGGCAGCCATTGT–3’
β-actin Forward 50 -GACATGGAGAAGATCTGGCA–30
Reverse 50 -GGTCTTTACGGATGTCAACG–30
doi:10.1371/[Link].0139985.t001

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 6 / 21

 MyD88, Toll-Like Receptors and Mucositis

Fig 1. TLR9, MyD88 and TRAF6 are markedly expressed during irinotecan-induced intestinal mucositis. The mice (n = 6–9) were injected for 4 days
with saline (3 mL/kg) or irinotecan (75 mg/kg, i.p.) and were killed on the seventh day after the first dose. Ileal samples were collected and processed for
quantitative PCR. The expression of MyD88 (panel A), TLR9 (panel C) and TRAF6 (panel D), but not of TLR2 (panel B), was markedly increased in
irinotecan-injected WT mice when compared with saline-injected animals. The values are expressed as the means ± SEM.
doi:10.1371/[Link].0139985.g001

Results
TLR and downstream molecules are expressed during intestinal
mucositis
As shown in Fig 1, mRNA expression of MyD88 (twofold increase, panel A), TLR9 (fourfold
increase, panel C) and TRAF6 (twofold increase, panel D), but not of TLR2 (panel B), are sig-
nificantly increased in WT mice that received irinotecan in comparison with saline-injected
group (P<0.05).

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 7 / 21

 MyD88, Toll-Like Receptors and Mucositis

MyD88-, TLR2- or TLR9- knockout mice show a preserved intestinal

architecture during intestinal mucositis
Microscopic damage was observed in the ileal samples of the irinotecan-treated WT mice (Fig
2A–2D and Table 2). These samples showed shortened villi with flattened and vacuolated
cells, massive loss of crypt architecture, a complete disarrangement of the epithelial cell layer,
and marked infiltration with inflammatory cells (Fig 2A). The length of the villi was decreased
(Fig 2A–2D) compared with the intact structures observed in the saline-treated WT mice.
However, irinotecan-injected MyD88- (Fig 2A and 2B), TLR2- (Fig 2A and 2C) and TLR9-
(Fig 2A and 2D) knockout mice showed a partial and significant preservation of the height of
the villi, conserved epithelial cell surfaces and less inflammatory infiltrates compared to the
WT group treated with irinotecan (P<0.05). In addition, a semi-quantitative analysis of gut
injury showed that irinotecan-injected WT mice presented a significant intestinal damage
when compared to saline-administered animals, which was prevented in MyD88-, TLR2- and
TLR9- knockout mice (Table 2).

Deletion of the MyD88, TLR2 or TLR9 genes prevent bacteria

translocation
Irinotecan injection in the WT mice caused a reduced animal survival (50%) and increased
bacteremia on the 7th day after the first dose of irinotecan compared to saline-treated WT con-
trol group (P<0.05) (Fig 3A–3F). Additionally, animal survival was improved and bacteremia
was attenuated in the MyD88-/- (100%, Fig 3A and 3B) and TLR2-/- (100%, Fig 3C and 3D)
mice in comparison with the irinotecan-injected WT mice (P<0.05). However, deletion of the
TLR9 gene prevented only the bacteremia (P<0.05), but not animal survival (P = 0.107), com-
pared with the irinotecan-injected WT mice (Fig 3E and 3F).

Irinotecan-induced diarrhea is effectively controlled in the MyD88 or

TLR2 but not in the TLR9 knockout mice
As shown in Table 3, diarrhea was found to be statistically increased in the irinotecan-injected
WT mice compared to the saline-injected WT group (P<0.05). In addition, the diarrheal scores
of the irinotecan-injected MyD88-/- and TLR2-/- mice were markedly reduced (P<0.05) com-
pared with the severe diarrheic events in the irinotecan-injected WT group. On the other hand,
compared to their respective saline group, the irinotecan-injected TLR9-/- animals showed
moderate to severe diarrhea (P<0.05), similar to irinotecan-injected WT mice (P>0.05).
Table 3 also shows the significant leukopenia (P<0.05) in the WT and knockout animals that
received irinotecan versus their respective saline-treated control groups (P<0.05).

TLR signaling is dependent on MyD88, which induces NF-κB expression

The expression of both MyD88 (Fig 4A) and NF-κB (Fig 4B, 4C and 4D) was significantly
increased in the irinotecan-injected WT mice versus the saline group (P<0.05). In addition,
NF-κB expression is markedly increased both in cytoplasmic and nuclear (a two-fold increase)
regions in irinotecan-injected WT animals (Fig 4C and 4D). In contrast, the expression of
MyD88 (Fig 4A) and NF-κB (Fig 4B, 4C and 4D) was absent or drastically reduced in the
MyD88 knockout mice. Furthermore, the expression of the adaptor protein MyD88 in TLR2-/-
and TLR9-/- animals that received irinotecan remained similar to the basal levels in the saline-
treated knockout mice (P>0.05, Fig 4A).

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 8 / 21

 MyD88, Toll-Like Receptors and Mucositis

Fig 2. Irinotecan-induced intestinal injury is attenuated in MyD88-/-, TLR2-/- and TLR9-/- mice. The mice (n = 6–9) were injected for 4 days with saline (3
mL/kg) or irinotecan (75 mg/kg, i.p.) and were killed on the seventh day after the first dose. Ileal samples were collected and processed for histopathological
and morphometric analysis. The irinotecan-treated WT animals showed a pronounced intestinal injury and inflammatory infiltration (A) and shorter villi

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 9 / 21

 MyD88, Toll-Like Receptors and Mucositis

lengths (B-D) versus the saline-treated WT group (A-D). The MyD88-, TLR2- and TLR9- knockout mice demonstrated a more intact gut architecture (A) and
increased villi height (B, C and D, respectively). H&E staining. The scale bar represents 200 μm (magnification 100x) or 50 μm (magnification 400x). The
values are expressed as the means ± SEM.
doi:10.1371/[Link].0139985.g002

MyD88, TLR2 and TLR9 activate a local inflammatory reaction during

intestinal mucositis
The protective role of MyD88 and TLR2 and TLR9 in irinotecan-induced mucositis was associ-
ated with a pronounced reduction of the local inflammatory reaction, as detected by the mea-
surement of myeloperoxidase activity (Fig 5A, 5C and 5E) and COX–2 (Fig 5B, 5D and 5F)
and IL–1β production (Fig 6A, 6C and 6E). All these inflammatory markers were significantly
increased in irinotecan-administered WT animals (Figs 5 and 6, Panels A-F). Of note, the
expression of IL–18 induced by irinotecan (Fig 6C and 6D) was reduced in the TLR-2-/- and
MyD88-/-, but not in the TLR9-/-, mice (Fig 6F), in which the expression was markedly
enhanced compared with irinotecan-injected WT mice.
Hypothesis model of the inflammatory cascade activated during the pathogenesis of irinote-
can-induced intestinal mucositis is shown in Fig 7. Pathogen and damage associated molecular
patterns (PAMPs and DAMPs) trigger the synthesis of pro-inflammatory cytokines (e.g. IL–1β
and IL–18) and enzymes (COX–2, for instance) through the activation of TLR2 and TLR9 sig-
naling pathway. These receptors signal through the MyD88 adaptor molecule and TNF recep-
tor-associated factor 6 (TRAF6) to activate NF-κB transcription function. The recruitment of
inflammatory cells, such as neutrophils, leads to the amplification of intestinal injury and the
development of mucositis.

Discussion
In the present study, we showed that the adaptor protein MyD88 has a major detrimental con-
tribution to the pathogenesis of intestinal mucositis and is possibly activated by toll-like recep-
tors. The genetic deletion of MyD88, TLR2 or TLR9 prevented the progression of the
irinotecan-related intestinal mucositis as detected by the attenuation of several parameters
including tissue damage, neutrophil infiltration and expression of inflammatory mediators. As

Table 2. Semi-quantitative analysis of histopathological damage.

Group Mucosal damage

Scores
WT + saline 0(0–0)
WT + Irinotecan 2(1–3)a
MyD88-/- + saline 0(0–0)
MyD88-/- + Irinotecan 1(0–2)b
TLR2-/- + saline 0(0–0)
TLR2-/- + Irinotecan 0(0–3)b
TLR9-/- + saline 0(0–1)
TLR9-/- + Irinotecan 1(0–2)b

Data were analyzed using Kruskal-Wallis/Dunn’s test. The values are expressed as the median (minimum-
maximum).
a
P<0.05 vs wild type control group injected with saline.
b
P<0.05 vs the wild type group injected with irinotecan. No statistical difference was found between the
knockout groups that were injected either saline or irinotecan.

doi:10.1371/[Link].0139985.t002

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 10 / 21

 MyD88, Toll-Like Receptors and Mucositis

Fig 3. Irinotecan reduces animal survival and increases bacteremia, which were prevented in the MyD88-/- and TLR2-/- mice. The mice (n = 6–9) were
injected for 4 days with saline (3 mL/kg) or irinotecan (75 mg/kg, i.p.) and survival was monitored during the whole experimental period. A blood sample was
collected on day 7 to measure the bacterial load. The WT mice that were injected with irinotecan showed a significantly reduced survival (A, C and E) and

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 11 / 21

 MyD88, Toll-Like Receptors and Mucositis

increased bacteremia (B, D and F) versus the saline-injected group. MyD88- and TLR2-, but not TLR9-, knockout mice showed an improved survival (A, C
and E, respectively). The blood bacterial load was reduced in all knockout mice (B, D and F). *P<0.05 vs the WT saline group; #P <0.05 knockout groups vs
the WT group injected with irinotecan.
doi:10.1371/[Link].0139985.g003

a consequence of the reduced mucositis, the blood bacterial load and an improvement in the
survival of the animals were observed.
Interestingly, we found that the expression of TLR9, MyD88 and TRAF6 were significantly
increased following irinotecan injection in wild type mice. However, TLR2 expression did not
change. One possibility that could explain such apparent conflicting result in regard to TLR2 is
that the mRNA translation into protein in WT mice might be highly activated in irinotecan
group, but not in saline-injected animals. In spite of the basal expression of TLR2, genetic dele-
tion to this receptor broadly prevented the development of intestinal mucositis, suggesting the
important role of TLR2 in the pathogenesis of intestinal mucositis.
Irinotecan-induced intestinal damage is a well-described phenomenon in the literature
[5,14,15,24,35]. Those studies showed that irinotecan induces a marked loss of the epithelial
cell lining, shortening of the villi, expression of inflammatory mediators and infiltration of leu-
kocytes into the lamina propria in a manner similar to that found in the present research. In
addition, Nakao and colleagues [36] suggested that irinotecan damages claudin–1 and occlu-
din, leading to disorders in the intestinal epithelial barrier. This damage allows bacterial trans-
location, which may contribute to an enhancement of the mucositis. Bacterial translocation
can be stratified to three levels: a) local- level I- (mesenteric lymph nodes), b) regional- level II
(portal blood and /or liver), and c) systemic- level III (peripheral blood, spleen). In the present
study, we observed a systemic level III bacterial translocation in the irinotecan-injected WT
mice, an effect that correlated with the severity of the mucositis and was not observed in TLR2
and TLR9 knockout mice. We also observed a significant regional level II bacterial transloca-
tion to the liver in irinotecan-injected wild type mice when compared with saline-treated
group. However, no statistical difference (P>0.05) was observed between wild type mice and
knockout animals that were injected with irinotecan (data not shown). These results might
indicate that the systemic bacterial translocation is delayed in the lack of TLRs signaling, which

Table 3. Diarrhea assessment and blood leukocyte counts in irinotecan-injected mice.

Group Diarrhea assessment Blood leukocyte count

Scores cells x 103/μL
WT + saline 0(0–0) 3.950 ± 0.28
WT + Irinotecan 2(1–3)a 1.906 ± 0.2a
-/-
MyD88 + saline 0(0–0) 3.625 ± 0.24
MyD88-/- + Irinotecan 0(0–1)c 2.557 ± 0.37b
TLR2-/- + saline 0(0–0) 3.320 ± 0.34
TLR2-/- + Irinotecan 0(0–1)c 2.400 ± 0.17b
TLR9-/- + saline 0(0–1) 2.580 ± 0.51
TLR9-/- + Irinotecan 2(0–3)c 1.280 ± 0.09b

Parametric and non-parametric data were analyzed using ANOVA/Bonferroni’s test or Kruskal-Wallis/
Dunn’s test, respectively. The values are expressed as the means ± S.E.M (parametric data) or median
(minimum-maximum) for non-parametric data.
a
P<0.05 vs wild type control group injected with saline.
b
P<0.05 vs its respective knockout control group injected with saline.
c
P<0.05 vs the wild type group injected with irinotecan.

doi:10.1371/[Link].0139985.t003

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 12 / 21

 MyD88, Toll-Like Receptors and Mucositis

Fig 4. Intestinal mucositis is dependent on MyD88 and NF-κB expression. The mice (n = 6–9) were
injected for 4 days with saline (3 mL/kg, open bars) or irinotecan (75 mg/kg, i.p., black bars) and were killed

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 13 / 21

 MyD88, Toll-Like Receptors and Mucositis

on the seventh day after the first dose. Ileal samples were collected and processed for MyD88 and NF-κB
expression. Irinotecan injection increased MyD88 (A) and NF-κB (B, C and D) expression as detected by
qPCR (A and C), immunohistochemistry (B) or western blot (D) versus the saline-treated WT mice. The basal
expression of MyD88 was found in the irinotecan-injected MyD88-/-, TLR2-/- or TLR9-/- mice when compared
to their respective saline-injected knockout controls (A). Deletion of the MyD88 gene also prevented the
expression of NF-κB (B, C and D). The values are expressed as the means ± SEM.
doi:10.1371/[Link].0139985.g004

reinforces the deleterious role of bacterial translocation as a crucial event in the development
of irinotecan-associated mucositis.
The central roles of TLR2 and TLR9 in the development of intestinal mucositis induced by
another anticancer agent, doxorubicin, have also been described in a previous study [21]. Fur-
thermore, the literature describes the involvement of TLRs in other gastrointestinal inflamma-
tory diseases. In clinical inflammatory bowel diseases, for instance, activation of TLRs appears
to have a role in the development of damage to the large and small intestines of patients
because these receptors are found to be markedly expressed in the intestinal epithelium of
those patients [37,38]. Furthermore, TLRs have been suggested to play a critical role in sponta-
neous, commensal-dependent experimental colitis [9]. In contrast do the detrimental role of
TLRs during doxorubicin-induced mucositis, the activation of these receptors seems to be pro-
tective in the mucositis induced by another anticancer agent, methotrexate [19, 20]. These
findings clearly indicate that the signaling pathways involved in intestinal damage during
mucositis vary according to the drug, which might suggest the use of specific therapeutic
approaches to prevent these toxicities.
Since we have previously shown the deleterious role of IL–18 in the pathogenesis of irinote-
can-induced intestinal mucositis [15] and considering that MyD88 is the key signaling mole-
cule downstream of several TLRs and members of the interleukin–1 receptor superfamily [39],
we investigated whether this adaptor protein is involved in the pathogenesis of mucositis. In
fact, the expression of MyD88 was markedly increased in the irinotecan-injected wild-type
mice, but not in the TLR2- or TLR9-knockout animals. In addition, similar to the TLR2-/- and
TLR9-/- mice, the mice with a genetic deletion of MyD88 were markedly protected from the
development of mucositis, as indicated by a reduced production of inflammatory markers and
intestinal damage. Consequently, they also demonstrated a reduced bacteremia. These results
might suggest that the TLRs, and possibly IL1-family of cytokines, signal through MyD88 caus-
ing the irinotecan-related intestinal damage.
It is well known that the TLR/MyD88 signaling pathway induces nuclear factor kappa B
(NF-κB) activation [40]. Moreover, there is evidence that the expression of NF-κB is increased
during mucositis [41]. Here, we determined that the MyD88 knockout mice exhibited a
reduced NF-κB activation, as well as the expression of pro-inflammatory mediator in the intes-
tinal samples. These results clearly suggest that the transcription of this factor with consequent
transcription of inflammatory mediators is downstream of TLR/MyD88 pathway. Similarly, it
was recently shown that TLR2 activation in BV–2 microglia cells leads to the induction of the
MyD88/PI3-kinase/AKT/NF-κB signaling pathway, which mediates the expression of several
cytokines as well as COX–2 and iNOS [42]. Possibly the striking protective response shown in
regard to the MyD88 protein reflects not only the modulation of signaling by the toll-like
receptors, but also the broader modulation of members of the IL–1 family. In a previous study
by our group, we found that irinotecan-induced intestinal damage might be inhibited by the
administration of pentoxifylline, which inhibits the production of IL–1 as well as other cyto-
kines [14].
The data discussed above indicate that the inflammatory parameters and signs of intestinal
damage were prevented in the TLR2-, TLR9- and MyD88-knockout animals. However, with

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 14 / 21

 MyD88, Toll-Like Receptors and Mucositis

Fig 5. Inflammatory enzyme markers are reduced in MyD88-/-, TLR2-/- and TLR9-/- mice during intestinal mucositis. The mice (n = 6–9) were injected
for 4 days with saline (3 mL/kg) or irinotecan (75 mg/kg, i.p.) and were killed on the seventh day after the first dose. Ileal samples were collected and
processed for MPO activity and qPCR for COX–2. The irinotecan injection in the WT mice increased the MPO activity (A, C and E) and COX–2 expression
(B, D and F) compared with the normal WT control animals. The MyD88-/-, TLR2-/- and TLR9-/- mice showed a significant reduction in these inflammatory
enzymes compared to the irinotecan-injected WT animals. The values are expressed as the means ± SEM.
doi:10.1371/[Link].0139985.g005

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 15 / 21

 MyD88, Toll-Like Receptors and Mucositis

Fig 6. IL–1β levels and IL–18 expression are markedly decreased in the MyD88-/- and TLR2-/- mice. The mice (n = 6–9) were injected for 4 days with
saline (3 mL/kg) or irinotecan (75 mg/kg, i.p.) and were killed on the seventh day after the first dose. Ileal samples were collected and processed for IL–1β
levels (ELISA) and qPCR for IL–18. The irinotecan injection in the WT mice increased the IL–1β levels (A, C and E) and IL–18 expression (B, D and F)
compared with the normal WT control animals. The MyD88-/- or TLR2-/- mice that received irinotecan showed a significant reduction in these inflammatory
markers compared to the irinotecan-injected WT animals (A-D). The irinotecan-treated TLR9-/- animals showed reduced levels of IL–1β, but increased
expression of IL–18 (E and F). The values are expressed as the means ± SEM.
doi:10.1371/[Link].0139985.g006

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 16 / 21

 MyD88, Toll-Like Receptors and Mucositis

Fig 7. Hypothesis for the development of intestinal mucositis. Irinotecan (CPT–11) is metabolized in the liver into the active compound SN–38, which in
turn is inactivated through glucuronidation to SN-38G. SN-38G is eliminated through the common bile duct into the intestinal tract where it is re-activated by
Gram-negative bacteria containing beta-glucuronidase enzymes. In the intestinal lumen, the active SN–38 leads to epithelial damage, allowing the enteric

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 17 / 21

 MyD88, Toll-Like Receptors and Mucositis

bacteria to translocate. Pathogen-associated molecular patterns (PAMPs) and Damage-associated molecular patterns (DAMPs) are recognized by the toll-
like receptors, which signal through the MyD88 adaptor protein and TNF receptor-associated factor 6 (TRAF6) to activate NF-κB and cytokine synthesis. This
process contributes to neutrophil recruitment to the site of infection, amplifying the damage.
doi:10.1371/[Link].0139985.g007

respect to the diarrhea and survival rate parameters, the TLR2-/- or MyD88-/- mice showed
diminished diarrheic events and improved survival in comparison with the WT mice, whereas
the TLR9-knockout mice were not protected. The late diarrhea due to irinotecan is known to
be mediated by eicosanoids [43,44] and IL–18 [15]. In our study, genetic deletion of TLR9 or
MyD88 led to a lower expression of COX–2, which argues against the participation of eicosa-
noids in the diarrhea that remained in the irinotecan-injected TLR9-/- mice. On the other
hand, the expression of IL–18 remained significantly high in those mice. The literature reports
that, although IL–1β and IL–18 belong to the same cytokine family, they have different process-
ing mechanisms [45]. The transcription of pro-IL–1β is mediated by the activation of the NF-
κB, whereas pro-IL–18 is constitutively expressed in the majority of cell types. However, the
production of both cytokines is dependent on the same mechanism, i.e., activation of caspase–
1 and 11 [45]. Since irinotecan is known to activate the NLRP3 inflammasome in a reactive
oxygen species-dependent manner [46], IL–18 processing might occur even in the TLR9-/-
mice. In contrast, similar to the results for TLR2 or MyD88, the lack of TLR9 signaling would
reduce MyD88/NF-κB-dependent expression of pro-IL–1β with the consequence that IL–1
production would be reduced. Due to the persistent diarrhea and IL–18 production in the
TLR9-/- animals, their survival was reduced.
It is worth mentioning that the deletion of the TLR2, TLR9 or MyD88 genes did not seem to
affect the irinotecan-induced cytotoxic effects because the leukopenia was still observed [5].
Furthermore, the protective effect against the development of the inflammatory reactions and
diarrhea observed in the MyD88 and TLR2 knockout animals contributed to a significantly
better clinical condition and an improved animal survival. Therefore, the stimulation of the
immune response by the intestinal microbiota via TLR/MyD88 and the activation of IL–1 fam-
ily of cytokines, which also signal through MyD88 adaptor protein, seem to be relevant in the
context of the mucositis associated with this anticancer treatment. This pathway orchestrates
the activation of NF-κB with the consequent production of cytokines and other inflammatory
mediators (Fig 7). To the best of our knowledge, this is the first time that the TLR/MyD88/NF-
κB pathway has been implicated in the mechanisms of damage involved in irinotecan-related
intestinal mucositis. The pharmacological modulation of these target receptors might have a
clinically relevant therapeutic impact.

Acknowledgments
We are grateful to Maria Silvandira Freire, Giuliana Bertozi, Diva Amabile, Ana Katia dos San-
tos, Sergio Roberto Rosa, Ieda Regina dos Santos, Socorro França and José Olavo Morais for
technical assistance.

Author Contributions
Conceived and designed the experiments: DVTW RCPLJ CBMC GACB TMC PRCA FQC
RAR. Performed the experiments: DVTW VFB CWSW AXCB CAVGL MAT RLS GLPB. Ana-
lyzed the data: DVTW RCPLJ CBMC GACB TMC PRCA FQC RAR. Contributed reagents/
materials/analysis tools: DVTW RCPLJ CBMC GACB TMC PRCA FQC RAR. Wrote the
paper: DVTW RCPLJ CBMC GACB PRCA FQC RAR.

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 18 / 21

 MyD88, Toll-Like Receptors and Mucositis

References
1. Andreyev J, Ross P, Donnellan C, Lennan E, Leonard P, Waters C, et al. Guidance on the manage-
ment of diarrhoea during cancer chemotherapy. Lancet Oncol. 2014; 15: e447–60. doi: 10.1016/
S1470-2045(14)70006-3 PMID: 25186048
2. Arnold RJ, Gabrail N, Raut M, Kim R, Sung JC, Zhou Y. Clinical implications of chemotherapy-induced
diarrhea in patients with cancer. J Support Oncol. 2005; 3: 227–32. PMID: 15915825
3. Richardson G, Dobish R. Chemotherapy induced diarrhea. J Oncol Pharm Pract. 2007; 13: 181–98.
PMID: 18045778
4. Ramesh M, Ahlawat P, Srinivas NR. Irinotecan and its active metabolite, SN–38: review of bioanalytical
methods and recent update from clinical pharmacology perspectives. Biomed Chromatogr. 2010; 24:
104–23. doi: 10.1002/bmc.1345 PMID: 19852077
5. Lima-Júnior RC, Figueiredo AA, Freitas HC, Melo ML, Wong DV, Leite CA, et al. Involvement of nitric
oxide on the pathogenesis of irinotecan-induced intestinal mucositis: role of cytokines on inducible nitric
oxide synthase activation. Cancer Chemother Pharmacol. 2012; 69: 931–42. doi: 10.1007/s00280-
011-1780-z PMID: 22101361
6. Gibson RJ, Keefe DM, Lalla RV, Bateman E, Blijlevens N, Fijlstra M, et al. Systematic review of agents
for the management of gastrointestinal mucositis in cancer patients. Support Care Cancer. 2013; 21:
313–26. doi: 10.1007/s00520-012-1644-z PMID: 23142924
7. van Vliet MJ, Harmsen HJ, de Bont ES, Tissing WJ. The role of intestinal microbiota in the development
and severity of chemotherapy-induced mucositis. PLoS Pathog. 2010; 6: e1000879. doi: 10.1371/
[Link].1000879 PMID: 20523891
8. Santaolalla R, Abreu MT. Innate immunity in the small intestine. Curr Opin Gastroenterol. 2012; 28:
124–9. doi: 10.1097/MOG.0b013e3283506559 PMID: 22241076
9. Rakoff-Nahoum S, Paglino J, Eslami-Varzaneh F, Edberg S, Medzhitov R. Recognition of commensal
microflora by toll-like receptors is required for intestinal homeostasis. Cell. 2004; 118: 229–41. PMID:
15260992
10. Fukata M, Vamadevan AS, Abreu MT. Toll-like receptors (TLRs) and Nod-like receptors (NLRs) in
inflammatory disorders. Semin Immunol, 2009; 21: 242–53. doi: 10.1016/[Link].2009.06.005 PMID:
19748439
11. Carvalho FA, Aitken JD, Vijay-Kumar M, Gewirtz AT. Toll-like receptor-gut microbiota interactions: per-
turb at your own risk! Annu Rev Physiol. 2012; 74: 177–98. doi: 10.1146/annurev-physiol-020911-
153330 PMID: 22035346
12. Shi D, Das J, Das G. Inflammatory bowel disease requires the interplay between innate and adaptive
immune signals. Cell Res. 2006; 16: 70–4. PMID: 16467877
13. Fernandes-Alnemri T, Kang S, Anderson C, Sagara J, Fitzgerald KA, Alnemri ES. Cutting edge: TLR
signaling licenses IRAK1 for rapid activation of the NLRP3 inflammasome. J Immunol. 2013; 191:
3995–9. doi: 10.4049/jimmunol.1301681 PMID: 24043892
14. Melo ML, Brito GA, Soares RC, Carvalho SB, Silva JV, Soares PM et al. Role of cytokines (TNF-alpha,
IL-1beta and KC) in the pathogenesis of CPT-11-induced intestinal mucositis in mice: effect of pentoxi-
fylline and thalidomide. Cancer Chemother Pharmacol. 2008; 61: 775–84. PMID: 17624531
15. Lima-Júnior RC, Freitas HC, Wong DV, Wanderley CW, Nunes LG, Leite LL, et al. Targeted inhibition
of IL–18 attenuates irinotecan-induced intestinal mucositis in mice. Br J Pharmacol. 2014; 171: 2335–
50. doi: 10.1111/bph.12584 PMID: 24428790
16. Cohen P. The TLR and IL–1 signalling network at a glance. J Cell Sci. 2014; 127(Pt 11): 2383–90.
17. Hausmann M, Kiessling S, Mestermann S, Webb G, Spöttl T, Andus T et al. Toll-like receptors 2 and 4
are up-regulated during intestinal inflammation. Gastroenterology. 2002; 122: 1987–2000. PMID:
12055604
18. Reuter BK, Pizarro TT. Commentary: the role of the IL–18 system and other members of the IL-1R/TLR
superfamily in innate mucosal immunity and the pathogenesis of inflammatory bowel disease: friend or
foe? Eur J Immunol. 2004; 34: 2347–55. PMID: 15307167
19. Frank M, Hennenberg EM, Eyking A, Rünzi M, Gerken G, Scott P, et al. TLR signaling modulates side
effects of anticancer therapy in the small intestine. J Immunol. 2015; 194(4):1983–95. doi: 10.4049/
jimmunol.1402481 PMID: 25589072
20. Sukhotnik I, Pollak Y, Coran AG, Pilatov J, Bejar J, Mogilner JG, et al. Glutamine attenuates the inhibi-
tory effect of methotrexate on TLR signaling during intestinal chemotherapy-induced mucositis in a rat.
Nutr Metab (Lond). 2014; 11:17.

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 19 / 21

 MyD88, Toll-Like Receptors and Mucositis

21. Kaczmarek A, Brinkman BM, Heyndrickx L, Vandenabeele P, Krysko DV. Severity of doxorubicin-
induced small intestinal mucositis is regulated by the TLR–2 and TLR–9 pathways. J Pathol. 2012; 226:
598–608. doi: 10.1002/path.3009 PMID: 21960132
22. Keefe DM, Schubert MM, Elting LS, Sonis ST, Epstein JB, Raber-Durlacher JE, et al. Updated clinical
practice guidelines for the prevention and treatment of mucositis. Cancer. 2007; 109: 820–31. PMID:
17236223
23. McGrath JC, Drummond GB, McLachlan EM, Kilkenny C, Wainwright CL. Guidelines for reporting
experiments involving animals: the ARRIVE guidelines. Br J Pharmacol. 2010; 160: 1573–6. doi: 10.
1111/j.1476-5381.2010.00873.x PMID: 20649560
24. Ikuno N, Soda H, Watanabe M and Oka M. Irinotecan (CPT–11) and characteristic mucosal changes in
the mouse ileum and caecum. J Natl Cancer Inst. 1995; 87: 1876–1883. PMID: 7494232
25. Kurita A, Kado S, Kaneda N, Onoue M, Hashimoto S and Yokokura T. Modified irinotecan hydrochlolor-
ide (CPT–11) administration schedule improves induction of delayed-onset diarrhea in rats. Cancer
Chemother Pharmacol. 2000; 46: 211–220. PMID: 11021738
26. Godshall CJ, Scott MJ, Peyton JC, Gardner SA, Cheadle WG. Genetic background determines suscep-
tibility during murine septic peritonitis. J Surg Res. 2002; 102: 45–49. PMID: 11792151
27. MacPherson BR, Pfeiffer CJ. Experimental production of diffuse colitis in rats. Digestion. 1978; 17
(2):135–50. PMID: 627326
28. Alves-filho JC, de Freitas A, Russo M, Cunha FQ. Toll-like receptor 4 signaling leads to neutrophil
migration impairment in polymicrobial sepsis. Crit Care Med. 2006; 34: 461–470. PMID: 16424729
29. Hsu SM and Raine L. Protein A, avidin, and biotin in immunohistochemistry. J Histochem Cytochem.
1981; 29: 1349–1353. PMID: 6172466
30. Yeoh AS, Bowen JM, Gibson RJ and Keefe DM. Nuclear factor kappaB (NFkappaB) and cyclooxygen-
ase–2 (Cox–2) expression in the irradiated colorectum is associated with subsequent histopathological
changes. Int J Radiat Oncol Biol Phys. 2005; 63: 1295–1303. PMID: 16099597
31. Souza GR, Cunha TM, Silva RL, Lotufo CM, Verri WA Jr, Funez MI, et al. Involvement of nuclear factor
kappa B in the maintenance of persistent inflammatory hypernociception. Pharmacol Biochem Behav.
2015 Jul; 134:49–56. doi: 10.1016/[Link].2015.04.005 PMID: 25902407
32. Safieh-Garabedian B, Poole S, Allchorne A, Winter J, Woolf CJ. Contribution of interleukin–1 beta to
the inflammation-induced increase in nerve growth factor levels and inflammatory hyperalgesia. Br J
Pharmacol. 1995; 115: 1265–75. PMID: 7582555
33. Cunha FQ, Assreuy J, Moss DW, Rees D, Leal LM, Moncada S, et al. Differential induction of nitric
oxide synthase in various organs of the mouse during endotoxaemia: role of TNF-alpha and IL-1-beta.
Immunology. 1994; 81: 211–215. PMID: 7512527
34. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR
and the 2(-Delta Delta C(T)) Method. Methods. 2001; 25: 402–8. PMID: 11846609
35. Gibson RJ, Keefe DM. Cancer chemotherapy-induced diarrhoea and constipation: mechanisms of
damage and prevention strategies. Support Care Cancer. 2006; 14: 890–900. PMID: 16604351
36. Nakao T, Kurita N, Komatsu M, Yoshikawa K, Iwata T, Utusnomiya T, Shimada M. Irinotecan injures
tight junction and causes bacterial translocation in rat. J Surg Res. 2012; 173: 341–7. doi: 10.1016/[Link].
2010.10.003 PMID: 21176921
37. Cario E, Podolsky DK. Differential alteration in intestinal epithelial cell expression of toll-like receptor 3
(TLR3) and TLR4 in inflammatory bowel disease. Infect Immun, 2000; 68: 7010–7. PMID: 11083826
38. Frolova L, Drastich P, Rossmann P, Klimesova K, Tlaskalova-Hogenova H. Expression of Toll-like
receptor 2 (TLR2), TLR4, and CD14 in biopsy samples of patients with inflammatory bowel diseases:
upregulated expression of TLR2 in terminal ileum of patients with ulcerative colitis. J Histochem Cyto-
chem. 2008; 56: 267–74. PMID: 18040078
39. Loiarro M, Ruggiero V, Sette C. Targeting TLR/IL-1R signalling in human diseases. Mediators Inflamm.
2010; 2010: 674363. doi: 10.1155/2010/674363 PMID: 20396389
40. Kawai T, Akira S. TLR signaling. Cell Death Differ. 2006; 13: 816–25. PMID: 16410796
41. Chang CT, Ho TY, Lin H, Liang JA, Huang HC, Li CC, et al. 5-Fluorouracil induced intestinal mucositis
via nuclear factor-κB activation by transcriptomic analysis and in vivo bioluminescence imaging. PLoS
One. 2012; 7: e31808. doi: 10.1371/[Link].0031808 PMID: 22412841
42. Lin HY, Tang CH, Chen YH, Wei IH, Chen JH, Lai CH, Lu DY. Peptidoglycan enhances proinflamma-
tory cytokine expression through the TLR2 receptor, MyD88, phosphatidylinositol 3-kinase/AKT and
NF-kappaB pathways in BV–2 microglia. Int Immunopharmacol. 2010; 10: 883–91. doi: 10.1016/j.
intimp.2010.04.026 PMID: 20451669

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 20 / 21

 MyD88, Toll-Like Receptors and Mucositis

43. Sakai H, Diener M, Gartmann V, Takeguchi N. Eicosanoid-mediated Cl- secretion induced by the anti-
tumor drug, irinotecan (CPT–11), in the rat colon. Naunyn Schmiedebergs Arch Pharmacol. 1995; 351:
309–14. PMID: 7609786
44. Kase Y, Hayakawa T, Togashi Y, Kamataki T. Relevance of irinotecan hydrochloride-induced diarrhea
to the level of prostaglandin E2 and water absorption of large intestine in rats. Jpn J Pharmacol. 1997;
75: 399–405. PMID: 9469646
45. Latz E, Xiao TS, Stutz A. Activation and regulation of the inflammasomes. Nat Rev Immunol. 2013; 13:
397–411. doi: 10.1038/nri3452 PMID: 23702978
46. Arifa RD, Madeira MF, de Paula TP, Lima RL, Tavares LD, Menezes-Garcia Z, et al. Inflammasome
activation is reactive oxygen species dependent and mediates irinotecan-induced mucositis through
IL–1β and IL–18 in mice. Am J Pathol. 2014; 184: 2023–34. doi: 10.1016/[Link].2014.03.012 PMID:
24952429

PLOS ONE | DOI:10.1371/[Link].0139985 October 6, 2015 21 / 21

View publication stats