Infection, Genetics and Evolution 11 (2011) 1183–1187

Contents lists available at ScienceDirect

Infection, Genetics and Evolution

journal homepage: www.elsevier.com/locate/meegid

Short communication

The origin of dengue viruses caused the DF outbreak in Guangdong province,

China, in 2006
Shuiping Chen *
State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, PR China

A R T I C L E I N F O A B S T R A C T

Article history: Phylogenetic analysis suggested that the DENV1 strains isolated in the DF outbreak in Guangdong
Received 26 January 2011 province in 2006 were likely to be imported from Southeast Asian. Specifically, viruses isolated from
Received in revised form 22 March 2011 Shantou and Chaozhou were imported from Singapore; viruses isolated from Guangzhou, Yangjiang, and
Accepted 28 March 2011
Foshan were imported from Thailand/Vietnam. Therefore, importation of DENV1 from Southeast Asia
Available online 5 April 2011
was an important contributory factor of the 2006 DF outbreak in Guangdong province.
ß 2011 Elsevier B.V. All rights reserved.
Keywords:
Dengue virus
Epidemiology
Phylogenetic analysis

1. Introduction 2007). Therefore, we attempted to address the origin of DENV1

caused this DF outbreak.
Dengue viruses (DENVs) belong to the family Flaviviridae and
genus Flavivirus. Four closely related but antigenically distinct 2. Materials and methods
serotypes (DENV1, DENV2, DENV3, and DENV4) have been
described. They are distributed worldwide and infection in 2.1. Virus strains
humans results in a variety of clinical manifestation, ranging
from mild, flu-like dengue fever (DF) to life-threatening dengue Eight DENV1 strains were isolated from the sera of 38 acute-
hemorrhagic fever (DHF)/dengue shock syndrome (DSS). In the last phase dengue patients admitted to Guangzhou No. 8 hospital,
decades, DF and DHF/DSS have emerged as one of the most Guangdong province, China, during the DF epidemic that broke out
important public health problems in the tropical and subtropical in 2006. The viruses were recovered in C6/36 cells and identified
regions. It’s estimated that 50–100 million infections occur using serological assays, RT-PCR (Lanciotti et al., 1992), and
annually worldwide, and more than 2.5 billion people are at risk sequences analysis. All virus strains used in this study were listed
(Gubler, 2002, 2004). in Table 1.
DF re-emerged in China in 1978 after disappeared for more than
30 years. And Guangdong province was the most severe epidemic 2.2. RNA extraction, RT-PCR and sequencing
region, with 66 190 infected cases from 1978 to 1989 (He et al.,
2002). But cases in this province dropped dramatically since 1990, Viral RNA was extracted from the supernatant of the virus-
with 374, 371, 2, 359, 4, 6812, 0, 632, 488, 304, 401, 344, 1348, 42, infected C6/36 cell culture by using the Qiagen RNeasy mini kit. To
47, 6, and 1010 cases from 1990 to 2006, respectively (He et al., amplify E/NS1 fragments, RT-PCR was performed by using primers
2002; Liang et al., 2007). Strikingly, infected cases were mainly ES1 and ES2 (Table 2). To determine the full-length genomic
caused by DENV1 since 1990, such as in 1995, 1997, 2000, 2002, sequences, 9 overlapping PCR fragments spanning the whole
2003, 2004, and 2006. The 3rd largest DF outbreak in Guangdong genome were amplified using a combination of primers (A1 and
province in 2006 only occurred in Guangzhou, Yangjiang, Foshan, A2, B1 and B2, C1 and C2, D1 and D2, E1 and E2, F1 and F2, G1 and
Chaozhou and Shantou city, and most cases were distributed in G2, H1 and H2, I1 and I2, Table 2). We performed 50 and 30 rapid
Guangzhou (765/1010) and Shantou (177/1010) (Wang et al., amplification of cDNA ends (RACE) by using the SMARTTM RACE
2009; Yao et al., 2007; Luo et al., 2007; Fan et al., 2007; Liu et al., cDNA amplification kit and gene specific primers (GSP1 and GSP2,
Table 2). The PCR products were purified from agarose gels and
sequenced. To ensure accuracy of the sequenced fragments, each
* Tel.: +1 915 274 3306. nucleotide was sequenced in at least 3 independent sequencing
E-mail address: [email protected]. reactions to avoid sequencing errors.

1567-1348/$ – see front matter ß 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.meegid.2011.03.025
1184 S. Chen / Infection, Genetics and Evolution 11 (2011) 1183–1187

Table 1
DENV1 strains used in this study.

No. Virus strain Year of isolation Country of origin Sequence GenBank accession number

1 DEN1/GZ/OY (in this study) 2006 Guangdong, China Genome FJ176779

2 DEN1/GZ/XNC (in this study) 2006 Guangdong, China Genome FJ176780
3 GZ061707 2006 Guangdong, China Envelope EF508203
4 GZ16/2006 2006 Guangdong, China Envelope EF113152
5 GZ17/2006 2006 Guangdong, China Envelope EF113153
6 D060117 2006 Guangdong, China Envelope EF508207
7 D06098 2006 Guangdong, China Envelope EF508206
8 D06068 2006 Guangdong, China Envelope EF508205
9 D06045 2006 Guangdong, China Envelope EF508204
10 A04137 2004 Guangdong, China Envelope EF508202
11 D02031 2002 Guangdong, China Envelope EF508201
12 GZ01/02 2002 Guangdong, China Envelope DQ855296
13 71/02GZ 2002 Guangdong, China Genome EF025110
14 GZ/218/2002 2002 Guangdong, China Envelope EF079826
15 D01048 2001 Guangdong, China Envelope EF508200
16 D99020 1999 Guangdong, China Envelope EF508199
17 GD05/99 1999 Guangdong, China Genome AY376738
18 D98039 1998 Guangdong, China Envelope EF508198
19 GD14/97 1997 Guangdong, China Genome AY376737
20 GZ01/95 1995 Guangdong, China Envelope DQ855297
21 GD23/95 1995 Guangdong, China Genome AY373427
22 GZ02/03 1993 Guangdong, China Envelope DQ211349
23 DENV-1/VN/BID-V4036/2008 2008 Vietnam Genome GU131793
24 DENV-1/VN/BID-V3895/2008 2008 Vietnam Genome HM181964
25 DENV-1/VN/BID-V3864/2008 2008 Vietnam Genome GU131699
26 DENV-1/VN/BID-V957/2007 2007 Vietnam Genome EU482502
27 DENV-1/VN/BID-V2805/2007 2007 Vietnam Genome FJ882554
28 DENV-1/VN/BID-V2824/2007 2007 Vietnam Genome GQ199829
29 DENV-1/VN/BID-V1324/2006 2006 Vietnam Genome EU660394
30 DENV-1/VN/BID-V807/2006 2006 Vietnam Genome EU482801
31 DENV-1/VN/BID-V2687/2006 2006 Vietnam Genome GQ199771
32 DENV-1/VN/BID-V817/2006 2006 Vietnam Genome EU482811
33 SG(EHI)DED149408 2008 Singapore Envelope GQ357686
34 SG(EHI)DED80208 2008 Singapore Envelope GQ357682
35 D1/SG/06K2236DK1/2006 2006 Singapore Genome EU081280
36 D1/SG/05K4142DK1/2005 2005 Singapore Genome EU081257
37 S418/05 2005 Singapore Envelope EU069594
38 D1/SG/05K2916DK1/2005 2005 Singapore Genome EU081234
39 T3196/04 2004 Singapore Envelope EU069624
40 T3179/04 2004 Singapore Envelope EU069619
41 SG(EHI)D1209Y03 2003 Singapore Genome FJ469907
42 S159/03 2003 Singapore Envelope EU069598
43 S144/02 2002 Singapore Envelope EU069600
44 D1/Thailand/0707aTw 2007 Thailand Envelope EU448394
45 DenKor-05 2005 Thailand Envelope EF654108
46 D1/Thailand/03-135 2003 Thailand Envelope HM134239
47 D1/Thailand/0310aTw 2003 Thailand Envelope EU448393
48 ThD1_0075_02 2002 Thailand Envelope AY732398
49 ThD1_0102_01 2001 Thailand Genome AY732479
50 ThD1_0049_01 2001 Thailand Genome AY732482
51 DENV-1/TH/BID-V2273/2001 2001 Thailand Genome FJ850068
52 01A00082 2001 Thailand Envelope EU117312

Table 2
Oligonucleotide primers used in this study.

Upstream primers Downstream primers

Name Position Sequences (50 –30 ) Name Position Sequences (50 –30 )

1 ES1 2183–2206 ctttggttctataggaggagtgtt ES2 2625–2648 ttcaagtaagatgtgattcagttc

2 A1 298–321 agaagaatggagcgatcaaagtgc A2 1646–1623 tgtcttaaatgtcaccagcaaatc
3 B1 1448–1469 cgactacggagctcttacattg B2 2692–2670 atcccagcaacatctcctacaac
4 C1 2547–2567 aaggcatgggaggagggtgtg C2 3805–3782 tccacagatgccactagactcaat
5 D1 3657–3677 gacaggatggggatgggaacg D2 4890–4867 ctagggcaatggctccaacttcac
6 E1 4678–4701 tcatgtatcaagggaagagactgg E2 5987–5965 catttttgcttccgtccagtgag
7 F1 5760–5779 cgggccgacagggtgataga F2 7180–7201 gcttttgcttgcagtccaggtc
8 G1 6917–6940 agcttcagcctggaccctctatgc G2 8183–8161 tgggtttcgcactagcattcctc
9 H1 8027–8047 agaggaaggaagaacgctacg H2 9383–9363 taagccataagttccgacctg
10 I1 9169–9192 gggatacaaggataacagaggatg I2 10497–10476 agtctgctaccccatcgctaca
11 GSP2 10337–10311 gtcaggccggattaagccatagtacgg GSP1 580–606 ctggttccgcctcagtgattcgagggc

Positions were given relative to the published sequence of the strain Cambodia (AF309641).
 S. Chen / Infection, Genetics and Evolution 11 (2011) 1183–1187 1185

2.3. Sequence analysis GZ061707 (Guangzhou) and DEN1/GZ/XNC (Guangzhou) were

grouped into clade A formed by strains isolated between 2006 and
Nucleotide and amino homology analysis was performed by 2008 from Vietnam. D06098 (Shantou) and D060117 (Chaozhou)
using MEGA4 (Tamura et al., 2007). The ML tree, based on the full- were grouped into clade B formed by strains isolated between 2002
length envelope gene, was inferred by using TREE-PUZZLE program and 2006 from Singapore. D06045 (Yangjiang), DEN1/GZ/OY
(Schmidt et al., 2002). (Guangzhou), GZ16/2006 (Guangzhou), GZ17/2006 (Guangzhou),
and D06068 (Foshan) were grouped into clade C formed by strains
3. Results isolated between 2001 and 2007 from Thailand/Vietnam.

3.1. Full-length viral genome sequences 4. Discussion

Pairwise comparisons of 8 DENV1 strains recovered in this Because there were not enough complete DENV1 viral genomes
study showed nucleotide homology of 100% between 7 strains in available, especially for strains isolated in Guangdong province in
the E/NS1 region, except 1 strain which had nucleotide divergence 2006, the ML tree constructed in this study was solely based on the
of 2.6% with above 7 strains. Therefore, full-length genomic envelope gene sequence. Thus phylogenetic inference from this
sequences of strain DEN1/GZ/XNC (the most divergent strain) and tree might have missed intraserotype recombination events that
DEN1/GZ/OY (1 of the mentioned 7 strains) were determined. Both would have been revealed by using complete genome sequences.
viral genomes had 10 735 nucleotides with no insertions and According to results described previously (Zheng et al., 2009),
deletions. The genome sequences of DEN1/GZ/OY and DEN1/GZ/ D06098, D060117, D06045, D06068, and GZ061707 were circulat-
XNC had been submitted to GenBank and assigned the accession ing strains, and strain GZ061707 was imported from Cambodia. But
numbers FJ176779 and FJ176780. in our opinion, the DF outbreak in Guangdong province in 2006
was unlikely caused by local strains. As shown in Fig. 1, the viruses
3.2. Phylogenetic analysis isolated from Shantou and Chaozhou (D06098 and D060117) were
similar to those from Singapore. Also, 2 strains from Guangzhou
The ML tree (Fig. 1) showed that all DENV1 strains isolated in (GZ061707 and DEN1/GZ/XNC) were similar to those from
Guangdong province in the past 17 years were grouped into 2 Vietnam; 3 strains from Guangzhou (DEN1/GZ/OY, GZ16/2006,
genotypes (I and IV). But all 9 strains (GZ061707, DEN1/GZ/XNC, and GZ17/2006), 1 strain from Foshan (D06068), and 1 strain from
D06098, D060117, D06045, DEN1/GZ/OY, GZ16/2006, GZ17/2006, Yangjiang (D06045) were similar to those from Thailand/Vietnam.
and D06068) isolated in this province in 2006 were classified as In addition, nucleotide and amino acid homology were very high in
genotype I. To determine the origin of DENV strains caused the DF the envelope or the whole coding region between the strains in
outbreak in Guangdong province in 2006, blast analysis in Guangdong province in 2006 and epidemic strains in Southeast
GenBank based on the complete envelope genes was performed Asian in corresponding clades (Table 3). Therefore, we concluded
and the 9 strains were confirmed to be highly homologous to those that DF outbreak in Guangdong province in 2006 were likely
strains circulated around 2006 in Southeast Asian. Strikingly, the 9 caused by imported cases, i.e., viruses isolated from Shantou and
strains in 2006 were classified as 3 different clades (A, B, and C). Chaozhou were imported from Singapore; viruses isolated from

Fig. 1. The maximum likelihood (ML) phylogenetic tree based on the full-length envelope gene. Taxon names corresponded to ‘‘strain name + origin + year of isolation’’. Main
bootstrap values were shown on the key nodes of the tree. The tree was rooted by strain 43 of DENV2 (AF204178). Strains isolated from Guangdong province were shown as
bold fonts.
1186 S. Chen / Infection, Genetics and Evolution 11 (2011) 1183–1187

Table 3
Nucleotide and amino acid homology analysis.

Strain pairs Sequences Nucleotide homology (%) Amino acid homology (%)

DEN1/GZ/XNC DENV-1/VN/BID-V2687/2006 Envelope 99.1 100

Coding region 99.2 99.8
DEN1/GZ/OY DENV-1/VN/BID-V817/2006 Envelope 99.2 99.8
Coding region 98.8 99.4
D06098a D1/SG/06K2236DK1/2006 Envelope 99.1 99.8
Coding region ND ND
a
The genome sequence was not available. ND: not done.

Guangzhou, Yangjiang, and Foshan were imported from Thailand/ et al., 2009). In addition, envelope nucleotides diversities were
Vietnam (Fig. 2). To strain D01048 isolated in Guangdong province more than 4.7% between strains isolated in 1995 and strains
in 2001, it was imported from Thailand. But to strain A04137 isolated in 1993 and 2002. Therefore, the DF outbreak in
isolated in Guangdong province in 2004, it was previously deemed Guangdong province in 2006 was unlikely to be caused by local
that it was introduced from Micronesia (Zheng et al., 2009). But we strains, and importation of DENV1 from Southeast Asia was an
deduced that it was more likely introduced from Singapore. important contributory factor.
Meanwhile, Fig. 1 showed that strains (genotype I), which were
isolated in 1998, 1999, 2001, 2004, 2006, were imported from
Thailand, Vietnam, and Singapore. However, other strains, which Acknowledgements
were isolated in 1993, 1995, 2002, fell into genotype IV. And strains
isolated in 2002 were likely introduced from Indonesia (Zheng We thank Liqun Fang for drawing maps.

Fig. 2. The origin of DENV1 strains isolated in Guangdong province in 2006. The map in the box showed Southeast Asian, and the grey region in Southeast China was
Guangdong province. The right map was an enlargement of Guangdong province. ‘‘*’’ denoted DENV1 strains isolated in Shantou (D06098) and Chaozhou (D060117), which
were introduced from Singapore. ‘‘&’’ denoted DENV1 strains isolated in Guangzhou (GZ061707 and DEN1/GZ/XNC), which were introduced from Vietnam. ‘‘^’’ denoted
DENV1 strains isolated in Guangzhou (DEN1/GZ/OY, GZ16/2006, GZ17/2006), Foshan (D06068), and Yangjiang (D06045), which were introduced from Thailand/Vietnam.
 S. Chen / Infection, Genetics and Evolution 11 (2011) 1183–1187 1187

References Liu, S.Q., Yang, S.K., Xu, Y.T., Wang, X.Y., 2007. Epidemiological analysis of dengue
fever in Chaozhou city in 2006 (in Chinese). South China J. Prev. Med. 33, 36–37.
Fan, Z.F., Li, W.J., Yang, L.M., Li, N.M., 2007. Study on the epidemiological charac- Luo, L., Yang, Z.C., Wang, Y.L., Liu, Y.F., Qin, P.Z., Dong, Z.Q., 2007. Analysis on
teristic and factor of dengue fever outbreaks in Yang Jiang city in 2001–2006 characteristics of dengue fever epidemic in Guangzhou, 2006 (in Chinese).
years (in Chinese). China Trop. Med. 7, 352–353 p. 398. South China J. Prev. Med. 33, 11–14.
Gubler, D.J., 2002. Epidemic dengue/dengue hemorrhagic fever as a public health, Schmidt, H.A., Strimmer, K., Vingron, M., von Haeseler, A., 2002. TREE-PUZZLE:
social and economic problem in the 21st century. Trends Microbiol. 10, 100– maximum likelihood phylogenetic analysis using quartets and parallel com-
103. puting. Bioinformatics 18, 502–504.
Gubler, D.J., 2004. The changing epidemiology of yellow fever and dengue, 1900– Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary
2003: full circle? Comparative immunology. Comp. Immunol. Microbiol. Infect. Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599.
Dis. 27, 319–330. Wang, Q., Yin, W.W., Dou, F.M., Xu, Z., Liu, B., Sun, H., Zhang, D., Wang, X.F., Guo, Y.H.,
He, J.F., Zheng, K., Li, L.H., Jiang, L.M., 2002. Analysis on the epidemiologic features of Meng, F.X., 2009. Dengue fever surveillance in China, 2006 (in Chinese). Dis.
dengue fever in Guangdong province, 1990–2000 (in Chinese). Chin. J. Epide- Surveill. 24, 22–24.
miol. 23, 427–430. Yao, L.J., Huang, J.Y., She, H.Z., Zhang, X.S., Xu, L., Liao, C.H., 2007. The prevalent
Lanciotti, R.S., Calisher, C.H., Gubler, D.J., Chang, G.J., Vorndam, A.V., 1992. Rapid situation of dengue fever and control measures in Shantou city in 2006 (in
detection and typing of dengue viruses from clinical samples by using reverse Chinese). China Trop. Med. 7, 895–896 p. 911.
transcriptase-polymerase chain reaction. J. Clin. Microbiol. 30, 545–551. Zheng, K., Zhou, H.Q., Yan, J., Ke, C.W., Maeda, A., Maeda, J., Takashima, I., Kurane, I.,
Liang, W.J., He, J.F., Luo, H.M., Zhou, H.Q., Yang, F., Zhen, K., 2007. Epidemiological Ma, H., Xie, X., 2009. Molecular characterization of the E gene of dengue virus
analysis of dengue fever in Guangdong province, 2001–2006 (in Chinese). South type 1 isolated in Guangdong province, China, in 2006. Epidemiol. Infect. 137,
China J. Prev. Med. 33, 4–7. 73–78.