Chapter 9

Plant-associated Fungi: Methods for Taxonomy, Diversity,

and Bioactive Secondary Metabolite Bioprospecting
Mariana Costa Ferreira, Camila Rodrigues de Carvalho, Marina Bahia,
Débora Luiza Costa Barreto, Rafaela Nogueira Azevedo,
Betania Barros Cota, Carlos Leomar Zani, Ana Raquel de Oliveira Santos,
Carlos Augusto Rosa, and Luiz Henrique Rosa

Abstract
Plants harbor a large reservoir of fungal diversity, encompassing endophytic, epiphytic, phytopathogenic,
and rhizosphere-associated fungi. Despite this diversity, relatively few fungal species have been character-
ized as sources of bioactive secondary metabolites. The role of secondary metabolites is still not fully
understood; however, it is suggested that these metabolites play important roles in defense mechanisms and
fungal interactions with other organisms. Hence, fungal secondary metabolites have potential biotechno-
logical applications as prototype molecules for the development of therapeutic drugs. In this chapter, we
describe the main methods used for routine fungi isolation, production of crude fungal extracts, and
chemical characterization of bioactive compounds. In addition, explicative notes about the steps described
are provided to explore the diversity of the endophytic, phytopathogenic, epiphytic, and rhizosphere fungi
and to evaluate the biotechnological potential of each group.

Key words Endophytic fungi, Epiphytic fungi, Phytopathogenic fungi, Rhizosphere fungi, Isolation,
Identification, Crude extracts, Chemical characterization

1 Introduction

Plants represent a promising reservoir of microbial diversity, which

includes endophytic, epiphytic, phytopathogenic, and rhizosphere-
associated fungi. Plant microbiomes represent a great challenge to
modern microbiology, due to the multitude of species already
known and/or estimated to exist [1–3]. Among these, endophytes
may be the most frequently studied over the last few years and can
be defined as microorganisms that at any point in their life cycle can
live in internal tissues of plants without causing signs of disease
[4]. They may colonize in the intercellular portion (apoplast) as
well as in the intracellular portion (symplast).

Lilia C. Carvalhais and Paul G. Dennis (eds.), The Plant Microbiome: Methods and Protocols, Methods in Molecular Biology,
vol. 2232, https://doi.org/10.1007/978-1-0716-1040-4_9, © Springer Science+Business Media, LLC, part of Springer Nature 2021

85
86 Mariana Costa Ferreira et al.

In contrast, some fungi, known as epiphytes, can also colonize

the plant surface and inhabit the aerial part of healthy plants with-
out causing disease. In addition, there are casual epiphytes that are
present on the leaves, but do not multiply [5, 6]. Some studies have
reported the coexistence between the endophytic and epiphytic
fungi and their importance in the phyllosphere [7]. Among the
epiphytic fungal community, there are epiphytic yeasts, which can
act as biocontrol agents against postharvest diseases, especially fruit
rot. They have the potential to help to reduce the amount of
agrichemical residues in food crops [8]. Yeast cells can penetrate
the plant interior through hydathodes, stomata, or microdamage
present on the plant tissue. Furthermore, some species possess
lipolytic and pectinolytic activities, which enable them to penetrate
through damaged regions in the plant cuticle [9]. However, com-
pared to filamentous fungi, there is little research regarding the
biodiversity of endophytic yeasts. Despite the large number of yeast
species found on the plant surface, only a few have been recovered
from the plant interior [9]. These microorganisms occupy highly
differentiated niches and play a very important role in plant protec-
tion [8, 9].
The rhizosphere is the soil region where roots, the microorgan-
isms, and the soil itself interact [10]. Fungi in the rhizosphere can
have positive and negative effects on different organisms. They can
establish mutualistic associations with plants by producing metabo-
lites, which stimulate plant growth. In return, fungi benefit from
carbon-containing compounds that plants produce. Alternatively,
there may be an imbalance in this ecosystem and the fungi may
become pathogenic. The diversity of these microorganisms in the
soil will depend on factors such as pH, temperature, water, oxygen
supply, soil type, soil age, among others [11].
Additionally, phytopathogenic fungi are part of the plant
microbiome and can cause diseases in plants. Symptoms can be
caused by the release of secondary metabolites (phytotoxins),
which kill the host cells. These fungal pathogens can be necro-
trophs, which feed on organic compounds from dead plant tissues,
or biotrophs, which feed on the contents of living cells [12].
Despite the great diversity expected for the various global
environments, relatively few of these microorganisms have been
characterized, representing an untapped source of bioactive sec-
ondary metabolites [13]. According to Bhardwaj and Agrawal
[3], the role of secondary metabolites is still poorly understood.
It has been suggested that these metabolites play an important role
in defense mechanisms and fungal relationships. Compounds pro-
duced by fungal secondary metabolism have potential biotechno-
logical applications as prototype molecules for the development of
therapeutic drugs [3, 13, 14].
In the present chapter, we describe the main methods used to
explore the diversity of the endophytic, epiphytic, rhizosphere, and
 Fungi Taxonomy and Bioprospecting 87

phytopathogenic fungi, as well as to evaluate the biotechnological

potential of these microorganisms (Fig. 1).

2 Materials

2.1 Isolation Autoclave or use purchased presterilized materials for the experi-
of Endophytic Fungi ment. Fungal isolations should be carried out in a laminar flow
hood.
1. Sodium hypochlorite with 2% active chlorine.
2. Ethanol 70% v/v.
3. Distilled water.
4. Scissors.
5. Tweezers.
6. Conical plastic tubes.
7. Potato Dextrose Agar (PDA) medium (see Note 1).
8. Biochemical Oxygen Demand (BOD) incubator (see Note 2).

2.2 Isolation Autoclave or use purchased presterilized materials for the experi-
of Epiphytic Fungi ment. Fungal isolations should be carried out in a laminar flow
hood.
1. Petri dishes containing culture medium (see Notes 1 and 3).
2. Saline solution (0.85%): dilute 0.85 g of NaCl in 100 mL of
sterilized distilled water.
3. Scalpel.
4. Tweezers.
5. Tips and micropipettes.
6. BOD incubator (see Note 2).

2.3 Isolation Autoclave or use purchased presterilized materials for the experi-
of Rhizosphere Fungi ment. Ideally, fungal isolations should be carried out in a laminar
flow hood.
1. Petri dishes containing culture medium (see Notes 1 and 3).
2. Saline solution (0.85%): dilute 0.85 g of NaCl in 100 mL of
sterilized distilled water.
3. Tips and micropipettes.
4. BOD incubator (see Note 2).

2.4 Isolation Autoclave or use purchased presterilized materials for the experi-
of Phytopathogenic ment. Ideally, fungal isolations should be performed in a laminar
Fungi flow hood.
88 Mariana Costa Ferreira et al.

Fig. 1 Flowchart of the main methods used to explore the diversity of the endophytic, phytopathogenic,
epiphytic, and rhizosphere fungi, as well as those used to evaluate the biotechnological potential of these
microorganisms
 Fungi Taxonomy and Bioprospecting 89

1. Petri dishes containing culture medium (see Notes 1 and 3).

2. Distilled water.
3. Sodium hypochlorite: 0.5% of active chlorine is diluted in
sterilized distilled water.
4. Scalpel.
5. Filter paper.
6. Conical plastic tubes.
7. Tweezers.
8. Tips and micropipettes.
9. BOD incubator (see Note 2).

2.5 Molecular 1. Lysis buffer: 0.05 M Tris-HCl (tris-hydroxymethyl amino-

Identification methane. pH 7.5–8.8), 0.005 M EDTA (ethylenediaminete-
traacetic acid), 0.1 M NaCl, and 5% SDS (sodium dodecyl
2.5.1 DNA Extraction
sulphate).
from Filamentous Fungi
2. CTAB buffer: 2 M Tris, 8.2% NaCl, 2 M EDTA and
0.2% CTAB.
3. Tris-EDTA: 0.01 M Tris-HCl, and 0.001 M EDTA.
4. Chloroform/isoamyl alcohol mixture (24: 1).
5. 3 M Sodium Acetate solution (pH 5.2).
6. Ethanol 70% v/v.
7. Isopropanol.
8. Tissue grinder equipment.

2.5.2 DNA Extraction 1. Lysis buffer: 0.05 M Tris-HCl (tris-hydroxymethyl amino-

from Yeasts methane, pH 7.5–8.8), 0.005 M EDTA (ethylenediaminete-
traacetic acid), 0.1 M NaCl, and 5% SDS (sodium dodecyl
sulphate).
2. Tris-EDTA: 0.01 M Tris-HCl, pH 7.5–8.8 and
0.001 M EDTA.
3. Chloroform/isoamyl alcohol mixture (24:1).

2.5.3 Amplification Using 1. PCR mix for (GTG)5: 2 μL of 10 pmol primer (GTG)5, 2.5 μL
the Primer (GTG)5 of 5
PCR buffer, 1.5 μL of 25 mM MgCl2, 1 μL of 10 mM
dNTP, 2 μL of 5 M betaine (optional), 2 μL of dimethyl
sulfoxide (optional), 0.2 μL of Taq DNA polymerase (some
Taq buffers already come with MgCl2 and dNTP or have
different concentrations, and therefore, the concentration of
the reagents should follow the manufacturer’s recommenda-
tions), and the final volume filled with sterile ultrapure water to
24 μL.
2. TBE 0.5
: dissolve 54 g of Tris base, 27.5 g of boric acid, and
20 mL of 0.5 M EDTA, pH 8.0.
90 Mariana Costa Ferreira et al.

2.5.4 PCR Amplification DNA amplification for sequencing and subsequent fungal identifi-
cation can be carried out using different primers, as shown in
Table 1.
1. PCR Mix for ITS: 1 μL of each 10 pmol primer (according to
Table 1), 5 μL of 5
PCR buffer, 2 μL of 25 mM MgCl2, 2 μL
of 10 mM dNTP, 2 μL of 5 M betaine (optional), 2 μL of
dimethyl sulfoxide (optional), 0.2 μL of Taq DNA polymerase
and the final volume filled with 49 μL of deionized sterilized
water.
2. PCR Mix for D1/D2 domains: 1 μL of each 10 pmol primer
(according to Table 1), 5 μL of 5
PCR buffer, 3 μL of 25 mM
MgCl2, 2 μL of 10 mM dNTP, 0.2 μL of Taq DNA polymerase
and the final volume filled with 49 μL of deionized sterilized
water.
3. TBE 0.5
: dissolve 54 g of Tris base and 27.5 g of boric acid in
20 mL of 0.5 M EDTA, pH 8.0.

2.5.5 Purification Amplicons generated by the PCR reaction can be purified using the
of Amplicons following reagents:
1. EDTA (ethylenediaminetetraacetic acid) 125 mM.
2. Absolute ethanol.
3. Ethanol 70% v/v.
4. Sterile deionized water.

2.5.6 Sequencing Sequencing can be performed using the BigDye Terminator

sequencing kit in combination with the ABI 3730xl automated
sequencing system.
1. BigDye Terminator sequencing kit (Applied Biosystems
Thermo Fisher Scientific).
2. ABI 3730xl automated sequencing system.
3. Absolute ethanol.
4. Ethanol 70% v/v.
5. 3 M Sodium Acetate solution (pH 5.2).

2.5.7 Computational 1. Computer with Internet access.

Analysis of Sequences 2. Mega Molecular Evolutionary Genetics Analysis across Com-
puting Platforms (MEGA) software (https://www.
megasoftware.net/).
3. Sequences in FASTA format.
4. Internet access to the GenBank (https://blast.ncbi.nlm.nih.
gov/Blast.cgi or https://www.ncbi.nlm.nih.gov/genbank/).
 Fungi Taxonomy and Bioprospecting 91

Table 1
Primers and cycling conditions used to amplify the different DNA regions for sequencing and
subsequent fungal identification. Denaturation and extension temperatures and the duration of each
cycle may vary according to the polymerase type, and so, it is advised to follow the conditions
recommended by the polymerase manufacturer

DNA region Primer Cycling conditions

Amplification of the ITS ITS1: TCCGTAGGTGAACCTGCGG Denaturation at 94  C for 5 min
region (see Note 18) ITS4: TCCTCCGCTTATTGATATGC followed by 35 cycles of 1 min
of denaturation at 94  C,
1 min of annealing at 55  C,
1 min of extension at 72  C,
and a final extension of 5 min
at 72  C.
Amplification of the NL1: Denaturation at 95  C for 2 min
D1/D2 domains of GCATATCAATAAGCGGAGGAAAAG followed by 35 cycles of 15 s
the large subunit NL4: GGTCCGTGTTTCAAGACGG of denaturation at 95  C, 25 s
rRNA (see Note 19) of annealing at 54  C, 20 s of
extension at 72  C, and a final
extension of 10 min at 72  C
Partial amplification of BT2a: Denaturation at 94  C for 5 min,
the β-tubulin gene GGTAACCAAATCGGTGCTGCTTTC followed by 35 cycles of 1 min
(see Note 20) BT2b: of denaturation at 94  C,
ACCCTCAGTGTAGTGACCCTTGGC 1 min of annealing at 59  C,
90 s of extension at 72  C, and
a final extension for 7 min at
72  C
Partial amplification of EF1-728F: Denaturation at 96  C for 3 min,
the elongation factor CATCGAGAAGTTCGAGAAGG followed by 40 cycles of 30 s
1α gene (see Note 21) EF1-986R: of denaturation at 95  C, 45 s
TACTTGAAGGAACCCTTACC of annealing at 54  C, 45 s of
extension at 72  C, and a final
extension for 7 min at 72  C
Partial amplification of RPB2 5F: Denaturation at 94  C for 3 min,
RNA Polymerase II GATGACCGTGGACCACTTCGG followed by 35 cycles of 20 s
(see Note 22) RPB2 7R: of denaturation at 94  C, 30 s
CCCATGGCTTGTTTGCCCAT of annealing at 55  C, 60 s of
extension at 72  C, and a final
extension for 10 min at 72  C

2.6 Micro- Prepare all solutions using deionized water and analytical grade
morphological reagents. Prepare and store all reagents at room temperature
Identification (Ridell (unless indicated otherwise). Diligently follow all waste disposal
Technique) regulations when disposing waste materials.
1. Blue lactophenol-cotton solution: dissolve 20 g of lactic acid,
20 g of phenol crystals, 20 g of glycerin, and 0.05 g of blue
cotton (see Note 4) in a final volume of 20 mL of distilled water
in a vial. Homogenize for 5 min using a magnetic stirrer inside
92 Mariana Costa Ferreira et al.

a gas exhaust hood. The phenol crystals should be previously

melted in a water bath and then added to the vial containing
the other reagents. Filter the solution after incubation for 24 h
at room temperature and store in a glass bottle for future use.
2. PDA medium (potato dextrose agar).

2.7 Yeast 1. Petri dishes containing culture medium:

Physiological (a) Growth in different carbon sources: yeasts nitrogen base
Identification (Replica medium with different carbon sources (cellobiose, citrate,
Plate) D-arabinose, D-glucitol, D-gluconate, D-glucosamine, D-
mannitol, D-ribose, D-xylose, DL-lactate, erythritol, etha-
nol, galactitol, galactose, gluconolactone, glucose, glyc-
erol, hexadecane, inulin, sucrose, L-arabinose, L-
rhamnose, L-sorbose, lactose, maltose, melezitose, meli-
biose, methanol, myo-inositol, n-acetyl-d-glucosamine,
raffinose, ribitol, salicin, soluble starch, succinate, treha-
lose and xylitol).
(b) Carbon source media preparation: the medium volume is
calculated according to the number of yeasts to be tested.
Consider 20 mL of media for a Petri dish with 9 cm in
diameter. Basal medium: dissolve 6.7 g/L of Bacto Yeast
Nitrogen Base and 20 g/L of agar in demineralized water
into tubes or bottles. Sterilize at 121  C for 15 min.
Prepare a set of tubes each one containing a tenfold solu-
tion of the different carbon sources in distilled water and
sterilize at 121  C for 15 min (50 g/L for all, except for
raffinose, which will be 100 g/L). Mix 19 mL of melted
basal medium with 1 mL of each carbon solution and pour
it into a Petri dish. The final concentration of each carbon
source will be 5 g/L, except for raffinose, which will be
10 g/L. Also, prepare Petri dishes with only basal medium
(without any carbon source) to be used as controls.
(c) Growth in different nitrogen sources: yeast carbon base
medium with the required amount of nitrogen from dif-
ferent sources (potassium nitrate, sodium nitrite and L-
lysine). Dissolve 11.7 g/L of Bacto yeast carbon base and
20 g/L in demineralized water into tubes or bottles and
sterilize at 121  C for 15 min. Prepare a tenfold solution
of the required amount of nitrogen (0.78 g/L potassium
nitrate, 0.26 g/L sodium nitrite, and 0.56 g/L L-lysine)
and store in glass tubes. Mix 19 mL of melted basal
medium with 1 mL of each nitrogen solution and pour
it into a Petri dish. A Petri dish with only basal medium
(without any nitrogen source) is used as control.
 Fungi Taxonomy and Bioprospecting 93

(d) Growth in amino acid-free medium: Dissolve 6.7 g/L of

Yeast Nitrogen Base medium w/o amino acids and 20 g/
L of agar in distilled water. Sterilize at 121  C for 15 min.
Mix 19 mL of melted basal medium with 1 mL of a
ten-fold solution of glucose (50 g/L) and pour onto a
Petri dish. The glucose final concentration is 5 g/L.
(e) Growth in media of high osmotic pressure: agar media
containing 50% (w/w) glucose; agar media with 10%
sodium chloride plus 5% glucose. Dissolve 50% (w/w)
glucose, 1% yeast extract, and 1.5% agar in distilled
water. Sterilize at 110  C for 10 min and pour onto Petri
dishes. Dissolve 50 g/L glucose, 100 g/L NaCl, 10 g/L
peptone, 5 g/L yeast extract, and 20 g/L agar into dis-
tilled water. Sterilize at 121  C for 15 min and pour onto
Petri dishes.
(f) Growth at 37 and 40  C: Petri dishes containing Sabour-
aud agar medium. Dissolve 2 g/L glucose, 1 g/L pep-
tone, 0.5 g/L yeast extract, and 2 g/L agar into distilled
water. Sterilize at 121  C for 15 min and pour onto Petri
dishes.
(g) Acid production from glucose: Petri dishes with medium
containing calcium carbonate (0.5%). Dissolve 50 g/L
glucose, 5 g/L calcium carbonate (CaCO3), 5 g/L yeast
extract, and 20 g/L agar in distilled water. Sterilize at
121  C for 15 min and agitate the medium gently to
resuspend the precipitate before pouring onto Petri
dishes.
(h) Formation of extracellular amyloid: Lugol’s iodine solu-
tion. Dissolve 10 g of KI in about 20–30 mL of distilled
water. Add 5 g of iodine crystals and heat gently with
constant mixing until iodine is dissolved. Make up to
100 mL with distilled water. Store in amber glass-
stoppered bottle in the dark.
(i) Tolerance to 1% of acetic acid: Petri dishes with medium
containing acetic acid (1%). Dissolve 100 g/L glucose,
10 g/L peptone, 10 g/L yeast extract, and 20 g/L agar in
distilled water and autoclave at 121  C for 15 min. Add 1%
of glacial acetic acid after the medium cools down to
about 50  C. Mix vigorously and distribute onto Petri
dishes.
(j) Cycloheximide resistance: Petri dishes with medium con-
taining cycloheximide (1.000 μg/mL). Dissolve 6.7 g/L
of yeast nitrogen base medium, 5 g/L glucose, and 20 g/
L of agar in distilled water. Sterilize at 121  C for 15 min.
94 Mariana Costa Ferreira et al.

Fig. 2 Glass tubes with 3 mL of fermentation basal medium with a small inverted
tube. If the sugar is fermented, the small tube is fulfilled with gas

Add 0.01% of cycloheximide after cooling down the

medium to about 50  C. Mix and distribute onto Petri
dishes.
2. Glass tubes with 2 mL of distilled water.
3. Glass tubes with 3 mL of fermentation basal medium: Dissolve
20 g/L of glucose, 4.5 g/L of yeast extract, and 7.5 g/L of
peptone in distilled water. Distribute aliquots of 3 mL into
10 or 15 mL tubes along with a small inverted tube (Fig. 2).
Sterilize at 121  C for 15 min. During autoclaving, the inverted
tubes will be filled with the liquid medium.
4. Multipoint inoculator.
5. Tips and micropipettes.

2.8 Production Prepare all solutions using ultrapure water and analytical grade
of Crude Extracts reagents. Follow all waste disposal regulations when disposing
waste materials.

2.8.1 Solid State 1. Culture medium: potato dextrose agar (PDA) (see Note 5).
Fermentation Using Apolar 2. Solvent: dichloromethane PA (see Note 6).
Solvent
3. Lyophilizer (freeze drying equipment).

2.8.2 Solid State 1. Culture medium: potato dextrose agar (PDA) (see Note 5).
Fermentation Using Polar 2. Solvent: ethanol PA (see Note 6).
Solvent
3. Vacuum centrifuge.

2.8.3 Liquid State 1. Culture medium: potato dextrose broth (see Note 5).
Fermentation Using Apolar 2. Orbital shaker (see Note 7).
Solvent
3. Centrifuge (see Note 8).
 Fungi Taxonomy and Bioprospecting 95

4. Solvent: ethyl acetate PA (see Note 6).

5. Separation funnel.
6. Rotary evaporator (see Note 9).

2.9 Chemical 1. Separation funnel and Erlenmeyer flasks.

Characterization 2. Rotary evaporator.
2.9.1 Liquid-Liquid 3. Ultrasonic bath.
Partition 4. Vacuum centrifuge.

2.9.2 Effluent Collection 1. Reverse phase analytical column (RP-18, 5 μm, 4.6
250 mm,
in a 96-Well Plate i.d.).
2. Solvent: acetonitrile grade HPLC and Milli-Q water.
3. Liquid chromatographic equipment for analytical scale.
4. Automatic fraction collector.
5. Vacuum centrifuge.

2.9.3 Preparation 1. Microplate shaker.

of Fractions 2. Ultra performance liquid chromatography—tandem mass
and Identification of Active spectrometer equipment.
Fractions by UHPLC-MS/
MS

2.9.4 Chromatographic 1. Semi-preparative columns.

Fractionation by 2. Liquid chromatographic equipment for semi-preparative scale.
Semi-preparative Scale
3. Automatic fraction collector.
(HPLC)

2.9.5 Getting Spectra 1. Ultra performance liquid chromatography—tandem mass

Data of the Active spectrometer equipment.
Compound 2. Polarimeter equipment.
3. Ultraviolet-visible spectrophotometer.
4. Infrared equipment.
5. Nuclear Magnetic resonance equipment.

3 Methods

3.1 Isolation The plant organs (leaves, stems, flowers, fruits, or roots) from
of Endophytic Fungi which the fungi are isolated should be healthy and processed within
24 h of collection. Before disinfestation, the collected plant tissues
are cleaned with neutral detergent and rinsed thoroughly with
sterilized distilled water. Subsequent steps are carried out under a
laminar flow hood.
96 Mariana Costa Ferreira et al.

1. Cut the fragments of the plant tissue of interest using scissors

and tweezers previously sterilized.
2. Surface-disinfest fragments of approximately 0.5 cm in diame-
ter with 70% alcohol for 1 min, sodium hypochlorite with 2%
active chlorine for 3 min, and rinse with sterilized distilled
water for 2 min (see Note 10) [15, 16].
3. Plate five fragments on Petri dishes containing potato dextrose
agar (PDA) (see Notes 11 and 12) supplemented with chlor-
amphenicol at 100 mg/L to inhibit the growth of contaminat-
ing epiphytic bacteria. Incubate the plates up to 60 days at
10–15  C for fungal isolates from plants of polar environments
and 28  C for fungal isolates from plants of tropical environ-
ments. Transfer filamentous fungal colonies to PDA and yeast
colonies to YM agar for purification.
4. Preserve mycelial pieces (5 mm) in cryotubes in sterile 15%
glycerol at 80  C for long-term storage.
5. Preserve yeasts 80  C in cryotubes with sterile 20% glycerol.

3.2 Isolation Methods for isolation of epiphytic fungi are described here as
of Epiphytic Fungi previously reported in mainly two ways. Spores can be directly
transferred into the culture medium [17]:
1. Cut five 5
5 mm fragments of the tissue with a sterile scalpel
and place the adaxial part of the leaf in contact with the growth
medium for 1 h.
2. Remove the leaf fragments.
3. Incubate plates in the BOD until colonies appear (approxi-
mately 7 days) at 10–15  C for fungal isolates from plants of
polar environments and 28  C for fungal isolates from plants of
tropical environments.
4. Use a circular fragment (0.5 cm) from each grown colony to
inoculate another plate and incubate in BOD to obtain a pure
culture.
5. Streak out on YM agar plates a loopful of each yeast colony and
incubate in BOD for culture purification.
Or indirectly, by plating out spores in the culture medium after
being mechanically released by shaking the plant tissue in a liquid
solution, it will be plated [18, 19]:
1. Add 1 g of the sample (leaves, stems, flowers, or fruits) in
100 mL of saline solution.
2. Place the suspension in a shaker (2
g) for 60 min at room
temperature to release the fungal spores present on the sample
surface.
 Fungi Taxonomy and Bioprospecting 97

3. Make a serial dilution (101, 102, and 103) from the washing
suspension and plate 100 μL of each dilution in triplicate.
4. Incubate the plates in BOD until colonies appear (approxi-
mately 7 days) at 10–15  C for fungi isolates of plants from
polar environments and 28  C for fungi isolates of plants from
tropical environments.
5. Use a circular fragment (0.5 cm) from each colony to inoculate
another plate and incubate in BOD to obtain a pure culture.
6. Streak out a loopful of each yeast colony on YM agar plates and
incubate in BOD for culture purification.

3.3 Isolation The isolation steps described below follow the procedures
of Rhizosphere Fungi described in [20].
1. Collect at five different points with a distance of 10 cm between
them, soil samples with 0–10 cm deep (see Note 13).
2. Add 1 g of the rhizosphere sample in 9 mL of 0.85% NaCl.
3. Plate 100 μL of a 101 dilution in culture medium (see Note 3).
4. Incubate the plates in BOD until colonies appear (approxi-
mately 7 days) at 10–15  C for fungi isolates of plants from
polar environment and 28  C for fungi isolates of plants from
tropical environment.
5. Use a circular fragment (0.5 cm) from each grown colony to
inoculate another plate and incubate in BOD to obtain a pure
culture.
6. Streak out a loopful of each yeast colony on YM agar plates and
incubate in BOD for culture purification.

3.4 Isolation Collect plants with symptoms of fungal infection. Conduct isola-
of Phytopathogenic tions of phytopathogenic fungi from a section of symptomatic
Fungi tissue, which is selected after surface disinfestation [17].
1. Wash the plants under running water to eliminate sediments.
2. Cut five 5
5 mm fragments of the selected diseased part of
the plant with scalpel, surface sterilized in 0.5% (v/v) sodium
hypochlorite, and wash in sterile distilled water twice.
3. Plate the fragments in Petri dishes containing the suitable
culture medium for fungal growth (see Note 3).
4. Incubate the plates in BOD until colonies appear (approxi-
mately 7 days) at 10–15  C for fungi isolates of plants from
polar environments and 28  C for fungi isolates of plants from
tropical environments.
5. Use a circular fragment (0.5 cm) from each grown colony to
inoculate another plate and incubate in BOD to obtain a pure
culture.
98 Mariana Costa Ferreira et al.

3.5 Molecular Carry out all procedures at room temperature unless otherwise
Identification specified.
3.5.1 DNA Extraction 1. Add enough mycelium fragments to fill half of the 2.0 mL tube
from Filamentous Fungi and add 400 μL of lysis buffer.
2. Add three stainless steel beads (3 mm in diameter approxi-
mately) in each tube and further grind in the tissue grinder
equipment.
3. Add 162 μL of CTAB to tubes, homogenize in a vortex, and
incubate for 30 min at 65  C (see Note 14).
4. Subsequently, add 570 μL of the chloroform/isoamyl alcohol
mixture (24:1). Homogenize the tubes in vortex and then
incubate for 50 min on ice (see Note 15).
5. Centrifuge the content at 12,470
g for 10 min, transfer
supernatant to a new sterile 1.5 mL tube, and add 1/10
volume 3 M sodium acetate.
6. Homogenize the tube by inversion, incubate at 0  C for
30 min, and subsequently centrifuge at 12,856
g for 10 min.
7. Transfer the supernatant to a new tube, add 1/2 volume iso-
propanol, gently homogenize the suspension, and incubate at
room temperature for 30 min.
8. Centrifuge the sample at 12,856
g for 5 min and discard the
supernatant by inversion.
9. Add 200 μL of 70% ice-cold ethanol and homogenize by
inversion. Subsequently centrifuge for 5 min at 12,856
g
and discard the supernatant. Repeat the procedure.
10. Samples can be dried in a heat block at 65  C for approximately
1 h or left overnight at room temperature.
11. To hydrate the extracted DNA, add 50 μL of Tris-EDTA (see
Note 16) and incubate at 65  C for 60 min. The sample can be
stored in a freezer at 20  C.

3.5.2 DNA Extraction 1. Transfer a loopful of a yeast culture grown for 20–24 h at 25  C
from Yeasts in YMA to a 0.6 mL microtube with 100 μL of lysis buffer and
vortex to homogenize.
2. Heat the samples at 65  C for 30 min using a heat block or a
water bath.
3. Add 200 μL of the chloroform/isoamyl alcohol mixture (24:1)
and homogenize the samples by tube inversion or gentle
vortexing.
4. Centrifuge at 16,162
g for 15 min and transfer the upper
aqueous phase to a new 0.6 mL microtube. Add (v/v) of
isopropanol volume and incubate at room temperature for
15 min.
 Fungi Taxonomy and Bioprospecting 99

5. Centrifuge at 16,162
g for 10 min and discard the superna-

tant by inversion.
6. Wash the pellets with 100 μL 70% ethanol, spin down as
described in previous step, and remove the supernatant by
tube inversion.
7. Allow the samples to air-dry at room temperature for at least
2 h or overnight.
8. Resuspend the pellets in 50 μL of Tris-EDTA (see Note 16),
incubate at 37  C for 30 min, and then store at 20  C.

3.5.3 Amplification Using The primer (GTG)5 is used for the amplification of microsatellite
the Primer (GTG)5 regions, as described in [21]. This PCR is used to group fungi that
have similar morphotypes, while considering coloration, border
shape, filament type, and texture.
1. In a 200 μL micro tube, add 24 μL of the PCR mix solution
and 1 μL of DNA (see Note 17).
2. Perform PCR reactions using a thermal cycler as follows: initial
denaturation at 94  C for 5 min, followed by 40 cycles of 15 s
of denaturation at 94  C, 45 s of annealing at 55  C, 90 s of
extension at 72  C, and a final extension for 6 min at 72  C
(Cycling conditions may vary according to the manufacturer of
the polymerase, follow their recommendations).
3. Run 3 μL of the PCR product in a 1.5% agarose gel electro-
phoresis in 0.5
TBE buffer running for approximately 1.5 h
at 80 V.
4. Stain bands with any DNA dye (e.g., Gel Red using 2 μL for
3 μL of sample).
5. Visualize the gel on ultraviolet light (or any other light with the
suitable wavelength to observe the chosen dye) and photo-
graph using a gel photodocumentation system.

3.5.4 PCR Amplification Fungi with the same band pattern in the gel can be considered to be
closely related taxonomically, and only one of them should be used
in the next PCR amplification step. The amplification of an addi-
tional DNA region, for sequencing and subsequent fungal identifi-
cation, can be carried out using different primer sets.
1. Add 49 μL of the PCR mix solution and 1 μL of DNA (see Note
17) to a 200 μL microtube and incubate in the thermal cycler
using the cycling conditions described in Table 1.
2. Run 3 μL of the PCR product in a 1.0% agarose gel electro-
phoresis in 0.5
TBE buffer eluted for approximately 30 min
at 120 V.
3. Stain bands with any DNA dye (e.g., Gel Red using 2 μL for
3 μL of sample).
100 Mariana Costa Ferreira et al.

4. Visualize the gel on ultraviolet light (or any other light with the
suitable wavelength to observe the chosen dye) and photo-
graph using a gel photo-documentation system.

3.5.5 Purification 1. Add to final PCR product (47 μL) 11.75 μL of 125 mM EDTA
of Amplicons and 141 μL of absolute ethanol.
2. Centrifuge the solution with a rotation of 12,470
g for
25 min. Discard the supernatant and wash the precipitate by
adding 120 μL of 70% ethanol, homogenized by inversion.
3. Centrifuge at 12,470
g 10 min, discard the supernatant
again, and the remainder of the ethanol will be dried for
20 min at 37  C.
4. Resuspend the DNA in 10 μL of sterile deionized water. Mea-
sure the products on spectrophotometry or fluorescence-based
equipment (e.g., Nanodrop or Qubit) for sequencing.

3.5.6 Sequencing 1. For the sequencing reactions, use 5–20 ng of the purified
DNA. For PCR reaction, add 4 μL of the premix (present in
the sequencing kit), 2 μL of the kit sequencing buffer, and 1 μL
of the primer (5 pmol) and adjust final volume to 10 μL with
sterile deionized water.
2. The cycling conditions consist of an initial denaturation at
96  C for 1 min, followed by 25 cycles of denaturation at
96  C for 10 s, annealing at 50  C for 5 s, and extension at
60  C for 4 min.
3. Add the sodium acetate 3 M solution into the sidewall of the
wells and the plate lightly tapped on the bench for mixing.
4. Add 28 μL of absolute ethanol. Seal and vortex the plate and
incubate for 20 min at room temperature, protected from the
light.
5. After incubation period, centrifuge the plate for 45 min at
5376
g.
6. Discard the supernatant by turning the plate over absorbent
paper.
7. Add 150 μL of 70% ethanol. Centrifuge the plate for 15 min at
5376
g and discard the supernatant.
8. To remove excess ethanol, invert the plate on absorbent paper,
subjected to a centrifugal pulse at 272
g for 1 s.
9. Incubate the plate at room temperature keeping it protected
from the light for 20–40 min for evaporation of the residual
ethanol.
10. Resuspend the precipitated DNA from each well in 10 μL in
“run buffer” (present in the sequencing kit).
 Fungi Taxonomy and Bioprospecting 101

11. Vortex the plate for 2 min, then centrifuge for 1 s at 272
g,
and store at 4  C protected from light until samples are injected
into the automated ABI 3730x1 system.

3.5.7 Computational 1. Compare the DNA sequence obtained with the sequences
Analysis of Sequences deposited by GenBank using the BLASTn (Basic Local Align-
ment Search Tool—version 2.215 of BLAST 2.0) software
available on the NCBI portal (http://www.ncbi.nlm.nih.gov/
blast/). Preferably, compare the sequences of target fungi with
sequences of ex-type species deposited in the GenBank.
2. The isolates that present sequence with identity 99% in rela-
tion to the ex-type sequences of fungi deposited in GenBank
are considered as belonging to the same species.
3. For sequences with an identity equal to 98%, the genus and
species are accepted. However, the term ‘cf.’ (Latin for confer)
is used to indicate that there are small differences in the
sequence compared to the reference species.
4. For those sequences with identity <95%, the isolates are iden-
tified as belonging to a unknown species or identified just at
family, class, and order taxonomic levels [22].
5. Yeasts species, in both Ascomycota and Basidiomycota, possess
not more than 1% difference when comparing sequences of the
D1/D2 LSU or ITS regions. However, in some cases, it is
necessary to analyze genes such as RNA polymerase II—sub-
unit 1, actin, translation elongation factor-1α, or cytochrome
oxidase II and even perform multigenic phylogenetic analyses,
using a combination of these genes.
6. Conduct phylogenetic analysis using Mega Molecular Evolu-
tionary Genetics Analysis (MEGA) software. Consider the taxa
with sequences less than 300 bp as unidentified.
7. Perform the bootstrap analysis with 1000 replicates using the
software included in MEGA. Add sequences of reference spe-
cies deposited in GenBank to the phylogenetic analyses. Use
MycoBank (http://www.mycobank.org/) and Index Fun-
gorum (http://www.Índexfungorum.org/) for information
on hierarchical levels used in fungal taxonomy.

3.6 Micro- All procedures should be carried out at room temperature, unless
morphological otherwise specified. The first step for identification involves the
Identification (Riddell preparation of Petri dishes by adding a blade supported by glass,
Technique) another blade, or two matches.
1. Use a plate containing nutrient agar (see Note 23), with this
medium having a thickness of approximately 2 mm. With the
aid of a sterilized scalpel blade, remove approximately 1 cm2
rectangular medium blocks. Arrange the blocks aseptically on
102 Mariana Costa Ferreira et al.

the blade in the petri dish. Then, the colony to be analyzed is

peeled on the four sides of the rectangle of agar, which are
covered later with a sterile coverslip.
2. To prevent desiccation of the culture medium during fungal
growth, add 1–2 mL of sterile distilled water to the bottom of
the plate or soak a small piece of sterile cotton.
3. Incubate the plates at 10–15  C for fungi isolated from plants
occurring in polar environments and 28–30  C for fungi
isolated from plants occurring in tropical environments for up
to 15 days.
4. Remove the coverslip gently and stain the fungus with lacto-
phenol to facilitate the visualization of the structures under the
microscope.

3.7 Physiological Yeast species have been traditionally identified by a series of physio-
Identification of Yeast logical and biochemical tests that included assays assessing utiliza-
Species [23] tion of different carbon and nitrogen sources, fermentation of
different sugars, growth at different temperatures, resistance to
antifungal (cycloheximide), acid production, and others. Currently,
species identification is carried out by sequencing and the physio-
logical tests are only used for characterization of new yeast species.
1. Inoculation of media: Prepare a cell suspension of fresh yeast
cultures (20–24 h growth) in glass tubes with 2 mL of distilled
water (MacFarland standard # 2). Fulfill the multipoint inocu-
lator wells with the cell suspension. Add 50 μL of cell suspen-
sion to the glucose fermentation test tube. Using the
multipoint inoculator, inoculate the set of plates for each
assay. Assays include assessment of utilization of different car-
bon and nitrogen sources in basal agar medium, acid produc-
tion, resistance to the antifungal cycloheximide, acid acetic
production, temperature, and high osmotic pressure tests.
Incubate at 25  C. Incubate the temperature test plates
(Sabouraud agar) at 37  C and 40  C.
2. Read the results 7, 14, and 21 days after inoculation. For the
substrate utilization tests, inspect the fungal growth and com-
pare with the colonies of the negative control (plates contain-
ing the basal medium without a carbon source).
3. Read the glucose fermentation test 2, 3, 5, 7, 10, and 14 days
after inoculation. Inspect the accumulation of carbon dioxide
in the inverted small tubes. They are filled with carbon dioxide
when the yeast is able to ferment glucose.
4. Make a record of the formation of extracellular amyloid com-
pounds in a plate containing 2 to 3 week-old yeast colonies
grown in YNB plus glucose medium. Flood the colonies with
diluted Lugol’s iodine. Inspect the colonies for the develop-
ment of a blue to green color, which indicates a positive result.
 Fungi Taxonomy and Bioprospecting 103

3.8 Production The extraction process relies on the separation of compounds from
of Crude Extracts a matrix by using a solvent that extracts soluble solids [24, 25]. The
solubility of a solute depends on its interaction with the solvent,
which is determined by the polarity and selectivity of the solvent
with the solute the compound. Knowing the polarity of com-
pounds of interest is important for the choice of solvent for the
extraction [26]. In addition, factors such as extraction method,
toxicity, instability of the compounds to be extracted, availability,
and cost should also be considered [27]. Different methods have
been applied during the extraction process including solid state
fermentation (SSF) and liquid state fermentation (LSF). SSF uses
insoluble substrates with a low percentage of water in its composi-
tion. LSF has, as its main feature, the use of a liquid fermentation
medium with soluble nutrients [28, 29]. To make a decision on the
most suitable method, the microorganisms that are used should be
considered. For example, the ability of the fungus to produce
metabolites in liquid or solid cultures and the types of solvents
that are used in the extraction stage should be assessed. Fermenta-
tion methodologies may vary according to the choice of solvent,
because of its polarity and that of the target extract [30]. Several
solvents can be applied in the extraction process. When the interest
is to obtain polar compounds, methanol and ethanol are the most
commonly used solvents, and for nonpolar compounds, dichloro-
methane and ethyl acetate are used, because of their ability to bind
with less polar molecules and the possibility of phase dissociation
[31]. The extraction method using organic solvents offers advan-
tages such as the simplicity and practicality associated with their use,
high performance, low cost, and relatively simple required instru-
mentation [32–34]. However, drawbacks to be considered include
toxicity, high solvent consumption, and potential for environmen-
tal pollution [32–34]. All procedures should be carried out at room
temperature, unless otherwise specified.

3.8.1 Extract Preparation 1. Grow the fungal isolate under static conditions at 10–15  C for
by SSF Using fungi isolates from plants of polar environments and 28  C for
Dichloromethane PA fungi isolates from plants of tropical environments for 15 days
in Petri dishes (90
15 mm) containing 20 mL of potato
dextrose agar medium (see Note 24).
2. Cut the culture medium with mycelial growth in pieces of
approximately (1
1 mm), transfer to a 125 mL Erlenmeyer,
cover the top of the flask with a paper towel, tie with a rubber
band, close with paper towel, and freeze at 20  C for at least
24 h (see Note 25).
3. Lyophilize the samples for 5 days (see Note 26).
4. After complete sample dehydration, add absolute dichloro-
methane until the mycelium is covered, seal the flask with
aluminum foil, and maintain the material for 48 h at room
temperature (see Notes 27 and 28).
104 Mariana Costa Ferreira et al.

5. Filter the supernatant (dichloromethanic phase) through a

qualitative filter paper (80 g/m2 with 3 μm porosity) into a
new flask previously cleaned with acetone and keep it covered
with a paper towel in an exhaust hood until dry (see Note 27).
6. Add absolute dichloromethane into the Erlenmeyer until the
fungal fragments are fully covered, seal the flask with aluminum
foil, and incubate the flask for another 48 h at room tempera-
ture (see Note 27).
7. Filter the supernatant (dichloromethanic phase) through a
qualitative filter paper (80 g/m2 with 3 μm porosity) into the
same flask containing the dry extract and keep it covered with a
paper towel in the exhaust hood until dry (see Note 27).
8. Use the same procedure using sterile PDA medium to obtain
an extract that will be used as control in the screening
procedure.

3.8.2 Extract Preparation 1. Grow the fungus under static conditions at 10–15  C for fungi
by SSF Using Absolute isolates from plants of polar environments and 28  C for fungi
Ethanol isolates from plants of tropical environments for 15 days in
Petri dishes (90
15 mm) containing 20 mL of PDA medium
(see Note 24).
2. Cut the culture medium with mycelial growth into pieces of
approximately (1
1 mm), transfer to a 50 mL Falcon tube,
add 30 mL of absolute ethanol, and store at 4  C for 48 h (see
Note 29).
3. Filter the supernatant through a qualitative filter paper (80 g/
m2 with 3 μm of porosity) in a new conical flask previously
cleaned with acetone and seal it.
4. Dry the extracts in a vacuum centrifuge at 40  C (see Note 30).
5. Use the same procedure to obtain an extract from the sterile
PDA medium that will be used as control in the screening
procedure.

3.8.3 Extract Preparation 1. Grow the fungus under static conditions at 10–15  C for
by LSF Using Absolute Ethyl fungal isolates of plants from polar environments and 28  C
Acetate for fungal isolates of plants from tropical environments for
7 days in Petri dishes (90
15 mm) containing PDA medium
(see Note 31).
2. Inoculate 5-mm diameter disks of fungal mycelium into potato
dextrose broth in an Erlenmeyer flask and incubate for 9 days at
25  C in an orbital shaker at 160 rpm (see Notes 32 and 33).
3. Centrifuge the fungal liquid culture at 1275
g rev for 10 min
to separate the broth from the mycelium.
 Fungi Taxonomy and Bioprospecting 105

4. Pour the supernatant in a separating funnel, add the same

volume of absolute ethyl acetate, shake the funnel, and leave
it still until the total separation of the phases.
5. Remove the water, then collect the organic phase (containing
extracts dissolved in ethyl acetate), which will be at the bottom
of the funnel, and use a rotary evaporator at 40  C to remove
the solvent and obtain the dry extract (see Note 32).
6. Use the same procedure to obtain an extract from the sterile
PDA medium that will be used as control in the screening
procedure.

3.9 Chemical The following describes a generic protocol for drug discovery from
Characterization natural products, using a bioassay-guided approach (Fig. 3). The
preliminary fractionation of the original extract is performed using
reverse phase columns in ultra-high-performance liquid chroma-
tography tandem mass spectrometry (UHPLC-MS/MS) or by
high-performance liquid chromatography (HPLC) on the analyti-
cal scale and testing the fractions using a suitable biological assay.
The nature of the original extract and of the target compound,
present in the crude extract, will determine the right procedure to
perform the semi-preparative fractionation by HPLC. The main
advantage of fractionation on the analytical scale is to obtain infor-
mation about the active compound through the comparison of its
mass spectra with scientific literature or in-house data based on
standard compounds. Obtaining information from previous studies
on target compounds not only helps in the choice of the most
suitable method for isolation but also gives an indication of poten-
tial biological activities already described for a given metabolite.
1. Inject an aliquot of the crude organic extract (50–100 μg) into
a reverse-phase analytical column (RP-18, 5 μm,
4.6
250 mm, i.d.) to perform the chromatographic separa-
tion. Use a linear gradient from 10 to 100% CH3CN in 30 min
and 100% CH3CN in H2O during 10 min at a flow rate of
1 mL/min. Record the ultraviolet chromatograms at wave-
lengths of 210 and 254 nm (see Note 34).
2. Collect the effluent from the chromatographic run in a 96-well
plate (300 μL per well, 80 wells) using an automatic fraction
collector (30 s/well). Eighty wells should be collected. Moni-
tor the effluent of the chromatographic separation using a UV
detector (210 and 254 nm). Evaporate the solvent from the
plates (obtained in triplicate) in a vacuum centrifuge at 45  C
and then subject the fractions to bioassays to identify the ones
containing active metabolites (see Note 35).
3. Add an aliquot of 50 μL of 90% v/v DMSO-H2O in each well
of a 96-well plate and mix them for 1 min on a microplate
shaker (it is considered that each well of the plate contains a
106 Mariana Costa Ferreira et al.

Fig. 3 Flowchart of general procedure for bioguided fractionation of organic extracts from endophytic fungi.
This bioguided fractionation can be performed (1a) by direct chromatographic fractionation of crude organic
extract using the reverse-phase HPLC analytical (solid arrows) or by using an additional step (1b) that involves
a liquid-liquid partition of the crude extract on a large scale with solvents of increasing polarity (red dashed
arrow), followed by the same steps, (2) collection of the effluent on a 96-well plate, (3) evaluation of all the
fractions in the biological assay to identify the active fraction, (4) injection of the active fraction in UHPLC-
qTOF-MS to identify the natural product using MS/MS data and databases, (5) chromatographic fractionation
of the crude extract/fraction by semi-prep-HPLC (100–300 mg), (6) evaluation of all the fractions in the
biological assay to confirm the active fraction, followed by (7a) confirmation of identity of the active fraction by
UHPL-qTOF, (7b) obtainment of the spectral data (UV, IR, MS, NMR, and optical activity) of the active
compound to perform the structural elucidation and obtainment of the biological data (IC50 and SI determina-
tions; in vivo assays) of active compound (DCM dichloromethane, EtOAc ethyl acetate, HPLC high-performance
liquid chromatography, UHPLC ultra-high-performance liquid chromatography, qTOF-MS quadrupole time of
flight mass spectrometry, semi-prep-HPLC semi-preparative high-performance liquid chromatography, IC50
half maximal inhibitory concentration, SI selectivity index, UV ultraviolet spectrum, IR infrared spectrum, MS
mass spectrometry data, semi-prep-HPLC semi-preparative high-performance liquid chromatography, and
NMR nuclear magnetic resonance data)

mass that will provide a final concentration of 20 μg/mL in the

biological assay). Transfer, in duplicate, a volume of 20 μL of
the suspension to another two sterile 96-well plates to conduct
the biological assays. Ensure that the first and last columns of
96-well plates are not filled with any effluent to receive the
positive and negative controls and the organic crude extract.
 Fungi Taxonomy and Bioprospecting 107

4. Resuspend the content of the wells of the bioactive fraction

(s) in 50 μL of methanol (from the third 96-well plate). After
the results of the biological assays, inject 20 μL of the active
fractions to be analyzed by (UHPLC-MS [tandem MS
(MS/MS)]. Use a linear gradient from 5% B of 0.1% formic
acid in CAN (B) for 0.5 min, then a linear gradient to 100% B
over 12.5 min, and a final hold for 1 min of 100% B and a
column (2.2 μm, 2.2
200 mm) at 40  C and a flow rate of
200 μL/min. Record the ultraviolet chromatograms at wave-
lengths of 210 and 254 nm. Acquire the mass spectra in posi-
tive mode at a spectra rate of 2 Hz. Ion-source parameters are
set to an end plate offset of 500 V, a capillary voltage of 4500 V,
a nebulizer pressure of 2.0 bar, and a dry gas flow and a
temperature of 8.0 L/min and 200  C, respectively. Obtain
data dependent on precursor fragmentation at collision ener-
gies of 40 eV. Optimize ion cooler settings within an m/z range
of 40–1000 using a solution of 10 mM sodium formate in 50%
2-propanol for calibration. Mass calibration is achieved by an
initial ion-source infusion of 20 μL of calibration solution and
postacquisition recalibration of the raw data. Perform the com-
pound detection by chromatographic peak analysis with
subsequent formula determination according to the exact
mass and isotope pattern (MS1) and database comparison of
compound fragment spectra (MS2). Use an in-house database
of standard compounds and the public spectra database Mass-
Bank (https://massbank.eu/MassBank/Search; Copyright
© since 2017 MassBank Consortium) as sources of reference
ESI fragment spectra.
5. Perform liquid-liquid partition as an alternative to the initial
fractionation of crude extract on an analytical scale. Solubilize
approx. 0.5–2.0 g of crude extract in 120 mL of methanol/
water (1:1) mixture with the aid of an ultrasonic bath. Transfer
the suspension to a separating funnel and extract it successively
(3 times using 120 mL) with immiscible solvents, hexane and
dichloromethane. Reduce the methanol/water (1:1) soluble
phase in rotary evaporator at temperatures below 45  C and
extract the residual aqueous phase with ethyl acetate (3 times
using 120 mL). Eliminate the residual solvent in a vacuum
centrifuge at 45  C. Test all fractions in the biological assays
and repeat all procedures described (steps 1–4) (see Note 36).
6. Perform a semi-preparative chromatographic fractionation of
the crude extract (100–300 mg) in a reverse-phase column
(5 μm, 20
250 mm, i.d.), using a linear gradient from
10 to 100% CH3CN for 60 min and 100% CH3CN in H2O
during 20 min at a flow rate of 10 mL/min. Record the
ultraviolet chromatograms at wavelengths of 210 and
254 nm. Collect the fractions by time intervals or by peak
108 Mariana Costa Ferreira et al.

using an automatic fraction collector. Eliminate the residual

solvent in a vacuum centrifuge at 45  C to obtain dry extract
of each fraction.
7. Prepare stock solutions of the fractions at a concentration of
20 mg/L in dimethyl sulfoxide (90% v/v DMSO-H2O). Test
all fractions using relevant biological assays to identify the
fractions containing active metabolites.
8. Confirm the putative active compound by running the active
fractions through the UHPLC-MS and compare the results
with active fractions from the 96-well plate.
9. Confirm the purity of the active fractions by TLC, HPLC,
and/or UHPLC.
10. Obtain the biological data of active compounds (CI50, SI, etc.)
(see Note 37).
11. Test the solubility of the compound to obtain the spectral data.
12. Obtain the optical activity and ultraviolet spectra of the active
compounds before obtaining the RMN spectra (1H and 13C,
DEPT-135, DEPT-90, COSY, HSQC, HMBC, and NOESY).
Obtain the infrared and mass spectra (see Note 38).
13. Perform the structural elucidation of the active compound.

4 Notes

1. The media should be supplemented with 100 μg/mL chloram-

phenicol to prevent bacterial growth.
2. The incubation temperature of the plates may vary according to
the location of the plant collection. For fungi isolated from
tropical environments, incubate in BOD at 25–28  C; for iso-
lates from cold environments, incubate in BOD at 10–15  C.
3. The culture medium used for the isolation may vary for fungal
growth according to its original substrate. Medium examples:
potato dextrose agar, Sabouraud dextrose agar, malt extract,
and yeast extract, among others. Yeasts grow better in medium
with malt extract (YMA, for example).
4. The blue cotton can be replaced with methylene blue.
5. Use the appropriate culture medium for each fungus.
6. The choice of the solvent is determined according to the char-
acteristics of the molecule of interest.
7. Use proper aeration for growth of each fungus.
8. A filtration step can be conducted to separate the fungal broth
from the mycelium.
9. Change the drying method if the compounds of interest are
not thermotolerant and can volatilize at high temperatures.
 Fungi Taxonomy and Bioprospecting 109

10. Aliquots of the sterilized distilled water used in the disinfesta-

tion process should also be inoculated into the medium as a
control to ensure that only endophytic fungi were isolated.
11. Other culture media may also be used according to the grow-
ing conditions for each fungus.
12. The isolation of endophytes by grinding follows all sections
(Subheading 3.1, Subheading 3.2, and part of topic on Sub-
heading 3.3). Instead of directly placing the fragments in the
middle of the plate, add a 1 mg fragment in a 2.5 mL tube with
1 mL of saline solution and three stainless steel beads. Subse-
quently, the tube is placed in a tissue grinder instrument for
trituration. Plate 100 μL of the solution with the aid of glass
beads.
13. The amount, depth, and distance between collection points
can be determined according to each study. A superficial or
deeper analysis of each soil can be done.
14. The time of contact with CTAB can be increased if the fungus
has strong pigmentation (e.g., dark fungus).
15. At this stage, tubes can be stored overnight at 20  C and the
procedure can be continued in the following day.
16. The amount of Tris-EDTA required may vary according to the
amount of DNA extracted. The standard is 50 μL; however, if a
low DNA concentration is found, a volume of 20 μL can
be used.
17. 1–5 μL of DNA varying according to sample concentration,
which should be between 50 and 500 ng/μL.
18. The ITS primers anneal to conserved regions of the 18S, 5.8S,
and 28S rRNA genes to amplify noncoding regions between
them (intergenic spacer regions) [35].
19. The primers NL1 and NL4 are used to amplify the D1/D2
domain of large-subunit (LSU) ribosomal DNA [36].
20. The primers BT2a and BT2b are used for partial amplification
of the β-tubulin gene as well as for the rapid identification of
fungal species by PCR [37].
21. The sequences of the elongation factor 1α have been used for
phylogenetic analysis. These regions are a potentially rich
source of characteristics for population and speciation studies
in filamentous ascomycetes [38].
22. The RNA polymerase II gene (RPB2), which encodes the
second largest protein subunit, is conserved and suggested to
be a single-copy gene in fungi [39]. For this reason, this gene is
an important target for amplification and subsequent sequenc-
ing to identify fungi.
23. The solid culture medium may vary according to the growth
requirements of the fungus.
110 Mariana Costa Ferreira et al.

24. Use the appropriate time and temperature for each fungus to
ensure growth and production of the metabolite of interest.
25. Wash each Erlenmeyer with acetone and seal the flask with
paper towel. Perform this procedure a few days before sam-
pling the fungal sample, so that all acetone evaporates and does
not contaminate the extract. Use scalpels disinfected with 70%
alcohol to cut the fungus. Use the appropriate temperature for
each fungus.
26. Ensure that the sample is completely frozen. Choose the nec-
essary time to lyophilize the entire sample.
27. Wear a mask while handling the solvent. This procedure should
be performed in an exhaust hood.
28. To reduce solvent waste, the sample can be immersed in
dichloromethane for a longer period, between 4 and 7 days,
where only one filtration is necessary.
29. Use sterile Falcon tubes. Use sanitized scalpels with 70% alco-
hol to cut the fungus.
30. Use the optimal growth temperature depending on the metab-
olite of interest.
31. Use the optimal growth temperature for each fungus.
32. Use a suitable revolution frequency depending on the aeration
need of each fungus.
33. Use a suitable temperature that avoids volatilization of the
compounds of interest.
34. The chromatographic fractionation can be performed either by
HPLC or by UHPLC-MS/MS. On the analytical scale of the
chromatographic fractionation, the extract can be solubilized
even in non-polar solvents such as dichloromethane. Choose
the best HPLC grade solvent to ensure that all compounds will
be injected into the column. The volume to be injected will
depend on the size of the loop, the automatic injector config-
urations, and column dimensions. MeOH–H2O can be used
instead of CH3CN-H2O in the gradient elution. A previous
analytical run can determine which mixture of solvents is more
appropriate. The general gradient elution followed by an iso-
cratic elution with 100% of a more strong solvent can ensure
that all compounds will be eluted.
35. The collection time will depend on flow rate of the
chromatographic run.
36. If the hexane soluble fraction from liquid-liquid partition is
active, perform the chromatographic fractionation by HPLC
using normal phase columns. In addition, the attempt of the
identification of bioactive metabolites could be performed
through a CG-MS analysis.
 Fungi Taxonomy and Bioprospecting 111

37. When planning to perform multiple analyses such as optical

activity and ultraviolet and NMR spectra, ensure that an ali-
quot of the sample is kept before for the NMR analysis since
some compounds can be degraded when exposed to deuter-
ated solvents.
38. Adjust the flow rate when scaling up from analytical to prepar-
ative mode. The general formula that converts flow rate from
any given column dimension to another is F2 ¼ F1
(L2/
L1)
(r2/r1)2, where L ¼ length of the column (in mm);
r ¼ radius of the column (in mm); F ¼ flow rate (in mL/min);
1 ¼ the first column, and 2 ¼ the second column.

References
1. Gamboa MA, Laureano S, Bayman P (2002) 12. Horbach R, Navarro-Quesada AR, Knogge W
Measuring diversity of endophytic fungi in leaf et al (2011) When and how to kill a plant cell:
fragments: does size matter? Mycopathologia infection strategies of plant pathogenic fungi. J
156:41–45 Plant Physiol 168(1):51–62
2. Aly AH, Debbab A, Proksch P (2011) Fungal 13. Doty SL (2013) Endophytic yeasts: biology
endophytes: unique plant inhabitants with and applications. In: Aroca R (ed) Symbiotic
great promises. Appl Microbiol Biotechnol endophytes, Soil biology, vol 37. Springer,
90:1829–1845 Berlin
3. Bhardwaj A, Agrawal P (2014) A review fungal 14. Smith SA, Tank DC, Boulanger L-A et al
endophytes: as a store house of bioactive com- (2008) Bioactive endophytes warrant intensi-
pound. J Pharm Pharm Sci 3:228–237 fied exploration and conservation. PLoS One 3
4. Petrini O (1991) Fungal endophytes of tree (8):3052
leaves. In: Microbial ecology of leaves. 15. Collado J, Platas G, Peláez F (1996) Fungal
Springer, New York, NY, pp 179–197 endophytes in leaves, twigs and bark of Quercus
5. Leben CURT (1965) Epiphytic microorgan- ilex from Central Spain. Nova Hedwigia 63
isms in relation to plant disease. Annu Rev (3):347–360
Phytopathol 3(1):209–230 16. Carvalho CR, Gonçalves VN, Pereira CB et al
6. Osono T (2008) Endophytic and epiphytic (2012) The diversity, antimicrobial and anti-
phyllosphere fungi of Camellia japonica: sea- cancer activity of endophytic fungi associated
sonal and leaf age-dependent variations. Myco- with the medicinal plant Stryphnodendron
logia 100(3):387–391 adstringens (Mart.) Coville (Fabaceae) from
7. Kharwar RN, Gond SK, Kumar A et al (2010) the Brazilian savannah. Symbiosis 57
A comparative study of endophytic and epi- (2):95–107
phytic fungal association with leaf of Eucalyptus 17. Santamarı́a J, Bayman P (2005) Fungal epi-
citriodora Hook., and their antimicrobial activ- phytes and endophytes of coffee leaves (Coffea
ity. J Microbiol Biotechnol 26(11):1941–1948 arabica). Microb Ecol 50(1):1–8
8. Bleve G, Grieco F, Cozzi G et al (2006) Isola- 18. Salazar-Cerezo S, Martinez-Montiel N, Cruz-
tion of epiphytic yeasts with potential for bio- Lopez MDC et al (2018) Fungal diversity and
control of Aspergillus carbonarius and A. niger community composition of culturable fungi in
on grape. Int J Food Microbiol 108 Stanhopea trigrina Cast Gibberellin producers.
(2):204–209 Front Microbiol 9:612
9. Isaeva OV, Glushakova AM, Garbuz AS et al 19. Gomes T, Pereira JA, Benhadi J et al (2018)
(2010) Endophytic yeast fungi in plant storage Endophytic and epiphytic phyllosphere fungal
tissues. Biol Bull 37(1):26–34 communities are shaped by different environ-
10. Campbell R, Greaves MP (1990) Anatomy and mental factors in a Mediterranean ecosystem.
community structure of the rhizosphere. The Microb Ecol 76(3):668–679
Rhizosphere. pp 11–34 20. Gomes EC, Godinho VM, Silva DA et al
11. Lynch JM, de Leij et al (2012) Rhizosphere. (2018) Cultivable fungi present in Antarctic
In: eLS. Wiley, Chichester soils: taxonomy, phylogeny, diversity, and
112 Mariana Costa Ferreira et al.

bioprospecting of antiparasitic and herbicidal ativos a partir de plantas medicinais. Conceito

metabolites. Extremophiles 22(3):381–393 sobre modificação estrutural para otimização
21. Lieckfeldt E, Meyer W, Börner T (1993) Rapid da atividade. Quimica Nova 21
identification and differentiation of yeasts by 32. Aspé E, Fernández K (2011) The effect of
DNA and PCR fingerprinting. J Basic Micro- different extraction techniques on extraction
bial 33(6):413–425 yield, total phenolic, and anti-radical capacity
22. Gonçalves VN, Vaz AB, Rosa CA et al (2012) of extracts from Pinus rodiata Bark. Ind Crop
Diversity and distribution of fungal commu- Prod 34:838–844
nities in lakes of Antarctica. FEMS Microbiol 33. Garcia-Salas P, Morales-Soto A, Segura-
Ecol 82(2):459–471 Carretero A et al (2010) Phenolic-compound-
23. Kurtzman CP, Fell JW, Boekhout T et al extraction systems for fruit and vegetable sam-
(2011) Methods for isolation, phenotypic char- ples. Molecules 15:8813–8826
acterization and maintenance of yeasts. In: The 34. Santos DT, Veggi PC, Meireles MAA (2010)
yeasts. Elsevier, Amstradam, pp 87–110 Extraction of antioxidant compounds from
24. Clarke NA (1985) Surface memory effects in jabuticaba (Myrciaria cauliflora) skinsμ yield,
liquid crystals: Influence of surface composi- composition and economical evaluation. J
tion. Phys Rev Lett 55:292–295 Food Eng 101:23–31
25. Handa SS, Khanuja SPS, Longo G et al (2008) 35. White TJ, Bruns T, Lee SJWT et al (1990)
Extraction technologies for medicinal and aro- Amplification and direct sequencing of fungal
matic plants. International Centre for Science ribosomal RNA genes for phylogenetics. PCR
and High Technology 1–65 Protoc 18(1):315–322
26. Pandey A, Tripathi S (2014) Concept of stan- 36. Kurtzman CP, Robnett CJ (1998) Identifica-
dardization, extraction and pre phytochemical tion and phylogeny of ascomycetous yeasts
screening strategies for herbal drug. J Pharma- from analysis of nuclear large subunit (26S)
cogn Phytochem 2(5):115–119 ribosomal DNA partial sequences. Antonie
27. Dai J, Mumper RJ (2010) Plant phenolics: Van Leeuwenhoek 73(4):331–371
extraction, analysis and their antioxidant and 37. Glass NL, Donaldson GC (1995) Develop-
anticancer properties. Molecules ment of primer sets designed for use with the
15:7313–7352 PCR to amplify conserved genes from filamen-
28. Pandey A (1992) Recent process developments tous ascomycetes. Appl Environ Microbiol 61
in solid-state fermentation. Process Biochem (4):1323–1330
27:109–117 38. Carbone I, Kohn LM (1999) A method for
29. Pandey A (2003) Solid-state fermentation. designing primer sets for speciation studies in
Biochem Eng J 13:81–84 filamentous ascomycetes. Mycologia:553–556
30. Cowan MM (1999) Plant products as antimi- 39. Malkus A, Chang PFL, Zuzga SM et al (2006)
crobial agents. Clin Microbiol Rev 2 RNA polymerase II gene (RPB2) encoding the
(4):564–582 second largest protein subunit in Phaeosphaeria
nodorum and P. avenaria. Mycol Res 110
31. Cechinel V, Yunes RA (1998) Estratégias para a (10):1152–1164
obtenção de compostos farmacologicamente