Republic of the Philippines
Department of Education
Region V-Bicol
SCHOOLS DIVISION OFFICE OF TABACO CITY
LEARNING ACTIVITY SHEET IN SCIENCE 9
QUARTER 1, WEEK 4-MODULE 6
Name of Student: ______________________________________________________________________________
Learning Area-Grade Level: _____________________________________________________________________
Date: _________________________________________________________________________________________
I. Introductory Concept:
All living things are composed of cells. These cells are governed by the central processing unit we call the
nucleus. Inside the nucleus are threadlike structures called chromosomes containing DNA genetic materials.
Inheritance of traits depends on their behavior during sexual reproduction. Just like any structure,
chromosomes are made up of units organized together.
II. Learning Skills from the MELCs:
Explain the different patterns of non-Mendelian inheritance.
Learning Objectives:
• Describe the structure of the DNA molecule;
• Infer that a particular gene has a specific location in the chromosomes;
• Appreciate the role of genes in storing genetic information.
III. Learning Tasks
A. Read the information below to deepen your understanding.
The genetic materials in the nucleus of our cells like any other structures are so
organized and also made up of building units.
The largest structures visible under the microscope during cell division are called
the chromosomes.
These chromosomes are composed of super packed coiled threadlike structures
called chromatin which in turn are composed of nucleosomes grouped together.
These nucleosomes are the DNA strands that wound themselves around a histone
protein.
What do you think is the purpose of packing the DNA strands into a super-packed chromosome?
The Hierarchical Structure of DNA through to the Chromosome
A long segment of chromatin in the chromosome that
codes for a certain trait is called the gene. Genes are the
ones that are shuffled in different combinations, as they
are passed on from parents to offspring during sexual
reproduction. They carry the hereditary traits that are
inherited by children from their parents.
The illustration at the right shows the parts of the
chromosome. Several genes may be found in this
chromosome.
DNA is composed of chains of nucleotides built on a sugar and phosphate backbone
and wrapped around each other in the form of a double helix. The backbone supports
four bases: guanine, cytosine, adenine, and thymine. Guanine and cytosine are
complementary, always appearing opposite each other on the helix, as are adenine
and thymine. This is critical in the reproduction of genetic material, as it allows a strand
to divide and copy itself since it only needs half of the material in the helix to duplicate
successfully.
A. ANALYSIS
Match Column A with Column B.
Column A Column B
Name of Part Illustration
1. genes
A.
2. DNA double helix B.
3. chromatin C.
4. nucleosome
5. chromosome
Now that you had a brief review of the structure and organization of the chromosomes, let's take a
look at the basic unit of the DNA molecule, the nucleotide.
A. At the bottom is the structure of the nucleotide.
Q1. What are the 3 parts of a nucleotide? _______________________________________________________
______________________________________________________________________________________________
Q2. What part is different among them? _________________________________________________________
______________________________________________________________________________________________
Q3. What parts are similar to the 4 types of nucleotides? _________________________________________
______________________________________________________________________________________________
Q4. What part is different from among them? ____________________________________________________
______________________________________________________________________________________________
Q5. Nucleotides are named according to the nitrogenous base they contain. What are these 4
nucleotides?
________________________________ _________________________________ _________________________
________________________________.
Two of these nitrogenous bases have one ring only whereas the other two have two rings. Nucleotides
with one ring are called Pyrimidines. Those with 2 rings are called Purines.
Look closely at how the nucleotides are attached to one another to
form a strand. A strand is a chain of nucleotides.
Q6. In the illustration at the right, how many strands are there?
____________________________________________________________
Q7. What parts of the nucleotides are connected to form a strand?
____________________________________________________________
Take note that the nitrogenous bases form Hydrogen bonds with
another nitrogenous base from another strand so that they form a
structure that looks like the rung of a ladder.
Q8. To which nucleotide does a Thymine nucleotide pair up?
_______________________________________________________________
What is the pair of Guanine nucleotides?
_______________________________________________________________
Q9-10. Describe the double helix structure of the DNA molecule. __________________________________
______________________________________________________________________________________________
______________________________________________________________________________________________
B. APPLICATION
Use the base pairing rule to determine the sequence of the complementary strand or pair strand of
the given strand. Write your answer in the space provided.
1.
DNA strand AATCCGTACGTACGTACGTAC
Complementary strand
2.
DNA strand CATGACCTGAACTTGGGCAAA
Complementary strand
3.
Create your own strand and its complementary strand.
DNA strand
Complementary strand
C. ABSTRACTION DIRECTIONS: Study the illustration below.
DNA double helix
Core of eight
histone molecules
Levels of Organization of the Chromosomes
A. Supply the needed term or information in the following statements: (Refer to the choices
below)
Genes chromosomes DNA nucleotides
Chromatin nucleosomes
1. The structure that is so compact and becomes visible during cell division is:
________________________________________________________________________
2. The structure is composed of coiled strands of nucleosomes called:
________________________________________________________________________
3. Segments of chromatin code for a trait are called __________________________.
4. In order to shorten during cell division, the DNA double helix coil around histone proteins and
form ___________________________________________________________________.
5. The basic units of the DNA molecule that form the double helix are the ______________________.
6. Arrange these structures from the largest to the smallest (chromatin, DNA nucleotides, genes)
______________________________________________________________________________________________.
IV. Reflection Answers/ Reflections
Questions
How do you feel about this
topic/ lesson? _______________________________________________________________
_______________________________________________________________
_______________________________________________________________.
What part of the lesson did
you enjoy the most? Why? _______________________________________________________________
_______________________________________________________________
_______________________________________________________________.
What challenges did you _______________________________________________________________
encounter while answering/
doing this lesson? How did _______________________________________________________________
you solve it?
_______________________________________________________________.
How does this lesson help
you in your day-to-day living? _______________________________________________________________
_______________________________________________________________
_______________________________________________________________.
