MPMI Vol. 36, No. 1, 2023, pp. 4–13, https://doi.org/10.

1094/MPMI-08-22-0166-SC

SHORT COMMUNICATION

Differential Colonization of the Plant Vasculature

Between Endophytic Versus Pathogenic
Fusarium oxysporum Strains
Domingo Martínez-Soto, Houlin Yu, Kelly S. Allen, and Li-Jun Ma †
Department of Biochemistry and Molecular Biology and the Plant Biology Graduate Program, University of Massachusetts,
Amherst, MA 01003, U.S.A.
Accepted for publication 22 October 2022.

Plant xylem colonization is the hallmark of vascular wilt dis- vestigations of molecular arm-races are needed to understand
eases caused by phytopathogens within the Fusarium oxyspo- how plants differentiate friend from foe.
rum species complex. Recently, xylem colonization has also
been reported among endophytic F. oxysporum strains, re- Keywords: differential plant colonization, endophytic fungus, Fusa-
sulting in some uncertainty. This study compares xylem col- rium oxysporum Fo47, pathogenic fungus, plant-fungus interaction
onization processes by pathogenic versus endophytic strains in
Arabidopsis thaliana and Solanum lycopersicum, using Arabidop-
sis pathogen Fo5176, tomato pathogen Fol4287, and the endo- The ascomycete fungal Fusarium oxysporum species com-
phyte Fo47, which can colonize both plant hosts. We observed plex (FOSC) includes plant pathogens that are responsible for
that all strains were able to advance from epidermis to endo- devastating vascular wilt diseases of many economically im-
dermis within 3 days postinoculation (dpi) and reached the root portant crops, including tomato (Michielse and Rep 2009), cot-
xylem at 4 dpi. However, this shared progression was restricted ton (Halpern et al. 2018), watermelon (Rahman et al. 2021),
to lateral roots and the elongation zone of the primary root. Only and banana (Viljoen et al. 2020). Causing billions of dollars
pathogens reached the xylem above the primary-root matura- in annual yield losses, F. oxysporum is listed among the top
tion zone (PMZ). Related to the distinct colonization patterns, five most important plant pathogens with direct impacts on the
we also observed stronger induction of callose at the PMZ and global economy and food security (Dean et al. 2012). Typical
lignin deposition at primary-lateral root junctions by the endo- vascular wilt symptoms include stunting, leaf epinasty, chloro-
phyte in both plants. This observation was further supported by sis, necrosis, and vascular bundle discoloration, all resulting
stronger induction of Arabidopsis genes involved in callose and from the colonization of the plant vascular xylem tissue by
lignin biosynthesis during the endophytic colonization (Fo47) this group of pathogens (Lagopodi et al. 2002; Li et al. 2017;
compared with the pathogenic interaction (Fo5176). Moreover, Olivain et al. 2003, 2006). It is well-documented that host-
both pathogens encode more plant cell wall–degrading enzymes specific vascular colonization is controlled by host-specific mo-
than the endophyte Fo47. Therefore, observed differences in cal- bile accessory chromosomes (Armitage et al. 2018; Delulio et al.
lose and lignin deposition could be the combination of host pro- 2018; Dong et al. 2015; Fokkens et al. 2020; Galazka and Freitag
duction and the subsequent fungal degradation. In summary, 2014; Hane et al. 2011; Ma et al. 2010, 2013; van Dam et al.
this study demonstrates spatial differences between endophytic 2016; Vlaardingerbroek et al. 2016; Wang et al. 2020; Williams
and pathogenic colonization, strongly suggesting that further in- et al. 2016; Yang et al. 2020; Yu et al. 2020; Zhang and Ma
2017). Effector genes encoded in these accessory chromosomes
can interfere with plant defense and assist the pathogen propa-
gation (Houterman et al. 2007; Ma et al. 2010; Rep et al. 2004;
† Corresponding author: L.-J. Ma; [email protected] Yang et al. 2020).
Arguably, nonpathogenic F. oxysporum strains are more
Funding: This project was supported by Natural Science Foundation (IOS- prevalent in nature, including many endophytes associated with
165241) and the United States Department of Agriculture (USDA) National land plants (Bao et al. 2004; Demers et al. 2015), offering pro-
Institute of Food and Agriculture (NIFA) (MAS00496). L.-J. Ma is also sup-
ported by an Investigator Award in Infectious Diseases and Pathogenesis by
tective advantages to host plants that are exposed to diverse envi-
the Burroughs Wellcome Fund BWF-1014893 and the National Eye Institute ronmental stresses (Kistler 1997; Ma et al. 2013; Michielse and
of the National Institutes of Health under award number R01EY030150. H. Rep 2009). Notably, some endophytic F. oxysporum strains have
Yu is also supported by a Lotta M. Crabtree Fellowship and Constantine been used to suppress Fusarium wilts (Alabouvette 1986). For in-
J. Gilgut Fellowship. K. S. Allen is also supported by USDA/SCRI/NIFA stance, F. oxysporum Fo47, one of several nonpathogenic strains
award (2016-68004-24931). The funding bodies played no role in the design isolated from the Châteaurenard region disease-suppressive soil,
of the study and collection, analysis, and interpretation of data and in writing
of the manuscript.
has been used to control Fusarium diseases in different crops, in-
cluding cucumber, carnations, dianthus, tomato, and the model
e-Xtra: Supplementary material is available online. plant Arabidopsis (Brader et al. 2017; de Lamo and Takken 2020;
Guo et al. 2021). The same strain is also reported to contribute
The author(s) declare no conflict of interest. systemic induced resistance in pepper and tomato plants (Aimé
et al. 2013; Veloso and Díaz 2012).
Copyright © 2023 The Author(s). This is an open access article Phenotypically, pathogens lead to diseased plants, while en-
distributed under the CC BY-NC-ND 4.0 International license. dophytic plant interactions result in healthy plants. At the

4 / Molecular Plant-Microbe Interactions

transcription level, our recent study revealed a shared pattern and metaxylem) (Fig. 1D). The Arabidopsis pathogenic strain
of expression for about 80% of plant genes when Arabidop- Fo5176 followed temporal and spatial patterns similar to the
sis was independently challenged with the endophyte Fo47 or fungus growing through the epidermal cells, eventually reach-
the pathogen Fo5176 (Guo et al. 2021). The remaining approxi- ing the root vascular system at 4 dpi (Fig. 1F to H).
mately 20% of differentially expressed genes offered insight into A similar course of colonization was observed for the endo-
these two distinct interactions. Within 12 h postinoculation, the phyte Fo47 in colonizing tomato plants and reaching the vas-
pathogenic interaction activated plant stress responses and sup- culature of lateral roots. At 1 dpi, Fo47 penetrated the tomato
pressed plant growth and development-related functions, while epidermal tissue (Fig. 1J), and it then colonized the root cortex
the endophytic interaction mainly attenuated host immunity and at 2 and 3 dpi (Fig. 1K). The root vascular system of lateral
activated plant nitrogen assimilation (Guo et al. 2021). roots was colonized at 4 dpi (Fig. 1L). Analogous times of colo-
The conventional wisdom is that only pathogenic FOSC nization were registered for Fol4287 (Fig. 1N to P). The fungus
strains, not endophytes, can colonize plant vascular xylem tis- penetrated the epidermis, then the cortex and reached into vessel
sue, a hallmark of vascular wilt diseases. This was supported by elements at 4 dpi (Fig. 1P). We also observed that Fo47 reached
electron microscopic study of the endophyte Fo47, which was the vessel cells of the elongation zone of the primary roots just
able to grow at the host root surface and colonize epidermal and before the presence of lateral roots (Supplementary Fig. S1).
cortical cells but was deterred from entering the plant vascular We further confirmed the colonization of the endophyte
tissue (Benhamou and Garand 2001; Benhamou et al. 2002). In Fo47 in the root vasculature of Arabidopsis and tomato
recent years, this conventional wisdom was challenged by multi- plants by amplifying and sequencing Fo47 strain-specific ef-
ple observations. For example, in addition to inducing a priming fector genes, namely, FOZG_17267 (jgi|FusoxFo47_2|262755),
effect (significant expression of genes involved in plant defense), FOZG_10369 (jgi|FusoxFo47_2|239495), and FOZG_17668
the endophyte strain F. oxysporum CS-20 was observed in the (jgi|FusoxFo47_2|276745) (Supplementary Fig. S2), and by
xylem of cucumber seedlings (Pu et al. 2014). Moreover, Fo47 tracking the Fo47 strain tagged with red florescent protein
was reported to colonize tomato xylem under both confocal and (Fo47-RFP [Supplementary Fig. S3]).
electron microscopy (Redkar et al. 2022). With the confirmation of the presence of endophyte Fo47 in
Upon learning that endophytic F. oxysporum strains may oc- the vascular vessels of the lateral roots of both plant hosts, we
cupy plant vasculature, the question of how pathogenic and en- examined fungal-plant interactions along primary roots in both
dophytic interactions differ emerges as a key unknown entity plant hosts. A similar fungal progression as described above for
in the field of plant-microbe interactions. This study addresses the lateral roots was also observed at the elongation zone of pri-
this question by tracking the endophyte and pathogen coloniza- mary roots for both endophytic and pathogenic strains in both
tion processes over 16 days postinoculation (dpi) in two hosts, plant hosts. Interestingly, distinct colonization patterns between
Arabidopsis thaliana Columbia-0 and tomato Solanum lycoper- the endophyte and both pathogens became apparent once we
sicum cv. M82. The endophytic strain F. oxysporum Fo47 that moved our focus to the PMZ, where the protoxylem vessels are
can colonize both plant hosts, the Arabidopsis pathogenic strain specified and lateral roots are clearly visible (Cajero-Sánchez
Fo5176, and the tomato pathogenic strain Fol4287 were used et al. 2017; Kondo et al. 2014; Somssich et al. 2016). While the
for the study. Interestingly, fungal hyphae from Fo47 were ob- pathogenic strains reached the vessel elements of Arabidopsis
served in the vasculature of both Arabidopsis and tomato roots. (Fig. 2A) and tomato (Fig. 2C) plants, the endophyte Fo47 was
But such presence was limited to the vasculature of lateral roots absent from the vascular vessels from the PMZ in both Arabidop-
and elongation zone of primary roots. We revealed the most sig- sis (Fig. 2B) and tomato plants (Fig. 2D). Another important dif-
nificant difference at the primary-root mature zone (PMZ), as ference was the first-time observation of chlamydospores in the
the endophyte was excluded from the vasculature of that zone in lateral roots of both Arabidopsis and tomato plants colonized by
both host plants but both pathogens were present in the vascu- the endophyte Fo47 at 5 dpi (Fig. 2F and H), as chlamydospores
lature of that root zone. We also observed stronger callose and production had only been described in the later infection stages
lignin deposition at the PMZ and at the junctions of the primary by pathogens (Akhter et al. 2016; Cal et al. 1997; Gordon 2017).
and the lateral roots along with the exclusion of endophyte from Inspecting stems above the ground, we observed the presence
the PMZ. of only pathogenic strains in the vasculature tissues, not the en-
The endophytic strain Fo47 and two pathogenic strains dophytic strain Fo47, in both plant hosts (Fig. 3A), which is
(Fo5176 and Fol4287) were inoculated into two plant hosts consistent with the difference observed in the PMZ. We further
according to published inoculation protocols with some mod- monitored fungal presence in the above-ground plant tissues us-
ifications (Di Pietro and Roncero 1998; Guo et al. 2021). ing quantitatve PCR (qPCR). Total DNA was extracted from the
To briefly describe the experiment, cleaned Arabidopsis and stems of inoculated plants. The F. oxysporum actin gene was used
tomato roots were soaked in 106 -spores/ml suspensions for to detect fungal strains. Using the A. thaliana pentatricopeptide
45 min. Inoculated plants were then gently transplanted in repeat gene as the reference, we detected the relative abundance
sterilized soil (discussed below). In agreement with existing of the A. thaliana pathogen Fo5176, the endophyte Fo47, and
knowledge, Fo47-inoculated plants remained healthy (Fig. 1A the mock-inoculated samples in the Arabidopsis stems to be 0.7,
and I), while Fo5176- and Fol4287-infected plants developed 0.0, and 0.0, on average, respectively (Fig. 3B). Similarly, using
disease symptoms at 6 and 12 dpi respectively (Fig. 1E and tomato beta-tubulin gene as the reference, we detected the rela-
M). The process of fungal colonization of the plant root was tive abundance of the tomato pathogen Fol4287, the endophyte
tracked daily, using confocal microscopy after WGA-Alexa Fo47, and the mock-inoculated samples to be 1.1, 0.0 and 0.0
Fluor staining of fungal cell walls and propidium iodide staining respectively (Fig. 3C). With no difference between the stems
of plant cell walls (Ghareeb et al. 2011). of mock-inoculated and the Fo47-inoculated plants provided us
Following the progression of the endophyte Fo47 in Arabidop- strong evidence that the endophyte wasn’t able to advance to
sis lateral roots, we repeatedly observed the same process. At 1 plant above-ground tissues. The exclusion of endophytic Fo47
dpi and after the germination of microconidia around 6 hpi, Fo47 in the PMZ likely contributes to the absence of endophytic F.
hyphae were growing on the Arabidopsis root surface and pen- oxysporum in the plant stems, as reported in literature (de Lamo
etrating root epidermis cell layers (Fig. 1B). Between 2 and 3 and Takken 2020).
dpi, Fo47 continued to colonize the root cortex (Fig. 1C). At 4 To address whether a plant responds differently to an en-
dpi, Fo47 reached the lateral root vascular system (protoxylem dophyte versus a pathogen, we examined the plant cell-wall

Vol. 36, No. 1, 2023 / 5

composition, focusing on callose, lignin, and suberin. Callose Significantly, we observed stronger induction of callose at the
is a high molecular weight polymer comprised of beta-(1,3)- PMZ (Fig. 4A to H) and lignin at junctions of primary and lat-
glucans, documented to accumulate at sites of pathogen attack eral roots by the endophyte (Fig. 4I to P) in both Arabidopsis and
(Iriti and Faoro 2009) that can be measured using the aniline tomato roots colonized by the endophyte Fo47, as compared with
blue staining method (Zhang et al. 2015). Similarly, lignin is an either pathogen-inoculated or mock-inoculated plants. However,
important component of cell walls of vascular plants, considered no visible differences in suberin deposition were observed (Sup-
a first line of defense against pathogenic fungi (Bhuiyan et al. plementary Fig. S4).
2009; Lee et al. 2019). Suberin is a lipophilic macromolecule To quantify the callose induction, we measured the relative
produced in the plant cell walls when protection and insulation intensity of aniline blue. At 3 dpi, Arabidopsis plants colonized
toward the surroundings is needed (Graca 2015). We visualized by Fo47 showed 1.5 times greater intensities than mock-infected
lignin with basic fuchsin and suberin with auramine O (according plants (P value of 8.8E-7) and plants infected with pathogenic
to the methodologies described by Kurihara et al. 2015 [details strain Fo5176 (P value of 7.5E-7) (Fig. 4D). Similarly, the tomato
below]). plants colonized by Fo47 showed 6.9 and 2.6 times greater

1 dpi 3 dpi 4 dpi

A B C D

Fo47
Arabidopsis

E F G H

Fo5176
I J K L

Fo47
Tomato

M N O P
Fol4287

Fig. 1. The course of lateral root colonization by Fusarium oxysporum strains. In all microscopy photographs, fungal structures are shown in green and plant
root tissues in red. A to D, Arabidopsis plants and roots colonized by Fo47. E to H, Arabidopsis plants and roots infected by Fo5176. I to L, Tomato plants
and roots colonized by Fo47. M to P, Tomato plants and roots colonized by Fol4287. Images in A and E show representative Arabidopsis plants colonized
by Fo47 (without symptoms) or infected by Fo5176 (with symptoms), respectively, at 16 days postinoculation (dpi). Images in I and M show representative
tomato plants colonized by Fo47 (without symptoms) or infected by Fol4287 (with symptoms), respectively, at 12 dpi. Images in B, F, J, and N show root tissue
penetration by the “penetration hyphae” or “appressorium-like small structure”. Images in C, G, K, and O show Fusarium strains growing close to vessels cells.
White dotted lines in C and K indicate the root cortex zone. Images in D and L show Fo47 has reached the root protoxylem and metaxylem of lateral roots.
Images in H and P show Fo5176 and Fol4287 have reached the vessels cells of primary roots. Scale bar = 20 µm.

6 / Molecular Plant-Microbe Interactions

intensities than mock-infected plants (P value of 5.7E-7) and is consistent with our observation that Fo47 induces stronger
plants infected with pathogenic strain Fol4287 (P value of 1.9E- callose and lignin deposition (Fig. 4A, E, D, and H).
5), respectively (Fig. 4H). Notice, callose deposition was ob- The difference in plant cell-wall composition can also be at-
served only in vessel elements and around vascular cells (Fig. 4A tributed to the differences in degradation of the plant cell wall by
and E). the fungus. In fact, both pathogens, Fo5176 and Fol4287, encode
The measurement of relative intensity of fuchsin revealed the higher numbers of cell wall–degrading enzymes, including en-
induction of lignin deposition at early stages in roots of both plant zymes lacking homologs in Fo47 (Supplementary Table S1; Sup-
hosts colonized by the endophyte. For instance, Fo47 coloniza- plementary Fig. S6A). For example, the genome of Fo47 only
tion Arabidopsis plant exhibited 1.3 times greater and 1.5 times encodes one glycoside hydrolase, while Fol4287 and Fo5176
greater intensities compared with mock-infected plants (P value genomes contain 13 and nine glycoside hydrolases, respectively.
of 5.2E-6) and plants infected with pathogenic strain Fo5176 A total of 20 enzymes in Fo5176 did not have ortholog pairs in
(P value of 9.5E-6) (Fig. 4L). Our observations were similar in Fo47 and showed clear upregulation during plant infection at
tomato plants, where Fo47 colonized plants produced 2.5 and one or multiple timepoints postinoculation (Supplementary Fig.
2.4 more than mock-infected tomato plants (P value of 0.0012) S6C, asterisks). The exclusion of endophytic Fo47 from above-
and Fol4287 infected plants (P value of 0.0011), respectively ground plant tissues and these comparative genomics results,
(Fig. 4P). The lignin deposition was observed at the junctions of suggest that pathogenic F. oxysproum has an improved capacity
the primary and the lateral roots (Fig. 4I and M). to degrade host structural structures to facilitate colonization.
To understand potential mechanisms underpinning the dif- Alternatively, these plant structural defenses are either not trig-
ferential induction of callose and lignin in plants colonized gered or actively suppressed by the pathogenic isolates.
by the endophyte Fo47 and the pathogen Fo5176, we ana- This study documented the presence of the endophytic F. oxys-
lyzed our former published metatranscriptomic data to exam- porum Fo47 strain in the xylem of lateral roots and the elonga-
ine the expression of Arabidopsis genes involved in callose tion zone of the primary root in both Arabidopsis and tomato
biosynthesis (GLUCAN SYNTHASE-LIKE [GSL]) (Ellinger plants, in agreement with recent literature reports (Pu et al.
and Voigt 2014) and key regulators of the lignin biosynthetic 2014; Redkar et al. 2022). However, this work also demonstrated
pathways (MYB46, MYB63, and KNAT) (Liu et al. 2018; Van- under microscopy and with the quantification of the relative
holme et al. 2010).Nine of the 12 GSLs were up-regulated when fungal biomass that, in contrast to F. oxysporum pathogenic
inoculated with the endophyte Fo47 when compared with the strains Fo5176 and Fol4287, the endophytic strain was excluded
pathogen at 4 dpi (Supplementary Fig. S5A). Among the three from the vasculture xylem of the PMZ and the stem plant tis-
key lignin biosynthesis genes (Supplementary Fig. S5B), MYB46 sues in the two most important host models for studying the
and KNAT show pronounced downregulation by the pathogen at interaction of F. oxysporum with plants. This confirms previous
12 and at 96 hpi, respectively, while MYB63 was continuously reports on the restricted endophytic fungal growth to the out-
up-regulated only in the endophytic interaction through the full ermost cell layers of host plants (Benhamou and Garand 2001;
course of interaction. The unique induction by the endophyte Benhamou et al. 2002, Pu et al. 2014). Instead of the uncertainty

Fo5176 Fo47 Fol4287 Fo47

A B C D

E F G H

Arabidopsis Tomato
Fig. 2. Differences in colonizing primary root above maturation zone by endophyte Fo47 and pathogenic strains and early chlamydospore production of Fo47
in lateral roots. Fungal structures are shown in green and plant root tissues in red. A and B, Arabidopsis roots colonized by Fo5176 and Fo47, respectively. C
and D, Tomato roots colonized by Fol4287 and Fo47, respectively. Images in B and D show Fo47 reaching vessel cells of lateral roots (pink arrows) but not
the primary root (blue arrows), in contrast to pathogenic strains Fo5176 (A) and Fol4287 (C), which reach both lateral (pink arrows) and primary roots (blue
arrows). E to H, The production of chlamydospores of Fo47 (white arrows) in lateral roots of Arabidopsis (F) and tomato (H) begins to be observed after 5 or
6 days postinoculation. Notice the absence of Fo5176 and Fol4287 spores (E and G, respectively) in roots of Arabidopsis and tomato, at the same time frame.
Scale bar = 20 µm.

Vol. 36, No. 1, 2023 / 7

about whether endophytic isolates can colonize plant xylem, this opment of disease symptoms, by largely unknown mechanisms
study unites these two different views based on the spatial oc- (Gawehns et al. 2015; Jangir et al. 2021). This evidence further
cupation of the endophyte within the host plants. underpins the importance of these xylem-localized interactions
In connection to this pronounced difference that distinguishes and distinctions between pathogen and endophyte.
the endophyte from both pathogens, we observed significant cal- Lastly, we only observed damaged cells among pathogen
lose deposition in the primary root and lignin deposition at the Fo5176- and Fo4287-infected plant roots (Supplementary Fig.
junctions of primary root and lateral roots upon endophyte col- S7A), using a trypan blue staining method to discriminate viable
onization. Both callose and lignin are often rapidly deposited at cells from cells with damaged membranes (Altman et al. 1993),
sites of pathogen infection and in response to injuries (Hück- although none of the colonized or infected plants showed H2 O2
elhoven 2007). Depositions of amorphous granular material, as accumulation around the interaction sites with fungal hyphae
well as lignification into pit membranes, have been suggested (Supplementary Fig. S7B). One explanation for the absence of
to contribute to plant defense against or preventing plant cell- the reactive oxygen species (ROS) is the presence of oxidative
wall degradation (Araujo et al. 2014). Redkar et al. (2022), burst inhibitory effectors, such catalase, peroxidase, and reduc-
Bishop and Cooper (1983), and Pegg 1976 reported the deposi- tase (Hemetsberger et al. 2012; Marroquin-Guzman et al. 2017;
tion of amorphous granular material around the endophyte Fo47 Molina and Kahmann 2007), which are present in pathogenic and
hypha. While this is likely not the only factor that differentiates endophytic F. oxysporum strains (L.-J. Ma unpublished data).
the endophytic and pathogenic interactions, callose and lignin The other possibility is that ROS burst was induced within
deposition are certainly involved in constraining the endophyte minutes to a few hours postinoculation (de Lamo and Takken
spread from lateral root vasculature to the primary root matura- 2020; Humbert et al. 2015) and our observation may have missed
tion zone. this critical time window.
The observed differences of plant cell-wall components could Plants and microbes may establish beneficial, neutral, or an-
result from the interactions between host production and subse- tagonistic relationships. Our results introduced a focal point of
quent degradation by the fungus. From the host perspective, we one or both the host vasculature and its surrounding tissues at the
observed the induction of genes involved in biosynthesis path- PMZ, where the molecular battle differentiating endophytes ver-
ways at the transcriptional level. From the fungal perspective, sus pathogens is likely to take place. From the fungal evolution-
both pathogenic strains possess a much larger repertoire of genes ary perspective, this study draws attention to differential nutrient
involved in the degradation of plant structural compounds. More- acquisition within hosts (e.g., amino acids, nitrogen sources) as
over, plant-pathogenic F. oxysporum strains but not endophytic well as to the differential secretion of effectors that interfere in
strains contain Secreted in Xylem (SIX) effectors that can be host immunity and induce differential deposition of structural
detected in the xylem sap proteome of infected plants, and it has components, such as callose and lignin, to have distinct colo-
been shown that these effectors play important roles in the devel- nization levels within the xylem. Collectively, this work added

A Fo5176 Fo47 B 0.8

aa
Relative fungal biomass

0.6
Arabidopsis stem

0.4

0.2

b b
0.0
Fo5176 Fo47 Mock

Fol4287 Fo47
C 1.6
Relative fungal biomass

1.4
1.2 a
Tomato stem

1.0
0.8
0.6
0.4
0.2
0.0
b b
Fol4287 Fo47 Mock

Fig. 3. Colonization of stem by pathogenic but not the endophytic strain of Fusarium oxysporum. A, White arrows indicate fungal cells in the stem vasculature
of plants inoculated with the pathogenic strains of F. oxysporum. Notice the absence of fungal cells in the stems of plants inoculated with the endophytic strain
Fo47. Scale bar = 50 µm. B, Relative fungal biomass by quantitative PCR (qPCR) in stems of Arabidopsis thaliana plants inoculated with Fo5176 or Fo47 at
16 days postinoculation (dpi). C, Relative fungal biomass by qPCR in stems of tomato plants inoculated with Fol4287 or Fo47 at 16 dpi. Genomic DNA was
extracted from the stems of inoculated plants and was used for relative fungal biomass determination for qPCR. Error bars indicate standard error. Different
letters in B and C denote significant differences (analysis of variance, Tukey).

8 / Molecular Plant-Microbe Interactions

to our understanding of the differential interactions between a ing conditions (200 rpm) at 28°C for 5 days. The microconidia
Fusarium endophyte and Fusarium pathogens with plant hosts. were collected using a Miracloth filter, were recovered, and were
The researchers used endophyte strain F. oxysporum Fo47 washed three times with sterile distilled water (SDW) by cen-
and the plant pathogens Fo5176 and Fol4287 in this study. The trifugation at 4,000 × g for 10 min. Finally, spore concentration
strains were stored in 50% glycerol at −80°C for long-term was determined with a hemocytometer and was diluted to 106
maintenance, were recovered onto potato dextrose agar media, spores per milliliter before plant inoculation.
then were inoculated in liquid NO3 -based medium (per milliliter, Seeds of Arabidopsis thaliana Columbia-0 and Solanum
1.7 mg of yeast nitrogen base, 30 mg of sucrose, and 10.1 mg of lycopersicum cv. M82 were propagated as follows. These seeds
KNO3 ). Liquid media suspensions were incubated under shak- were maintained in darkness at 4°C for 3 days, sterilized in 70%

Fo47 Fo5176 Mock Fluorescence quanficaon

A B C D Fo47

Relave callose intensity

10 a
Fo5176
Arabidopsis

b ab Mock
8
c
cd cde
6 de
e de

Fo47 Fol4287 Mock

E F G H 30
a Fo47

Relave callose intensity

Fol4287
Mock
Tomato

20
b b
10 b
bc
c
c c
c
0

Fo47 Fo5176 Mock

I J K L a
Fo47
12
Relave callose intensity

Fo5176
Arabidopsis

Mock
10 b
bc bc
bc
bc
8 bc
bc
c
6

Fo47 Fol4287 Mock

M N O P 40 Fo47
Fol4287
Relave callose intensity

a
30 Mock
Tomato

20
b
b b
10 b b b b
b

Fig. 4. Callose and lignin deposition in roots of plants colonized or infected by Fusarium oxysporum. A, Arabidopsis roots inoculated with Fo47, B, Fo5176,
and C, mock-inoculated. E, Tomato roots inoculated with Fo47, F, Fol4287 and G, mock-inoculated. D and H, Callose quantification in Arabidopsis and
tomato roots, respectively. In A and E, high blue fluorescence of aniline blue indicates high callose deposition in vessel cells of colonized roots by Fo47. I,
Arabidopsis roots inoculated with Fo47, J, Fo5176, and K, mock-inoculated. M, Tomato roots inoculated with Fo47, N, Fol4287 and O, mock-inoculated. L
and P, Lignin quantification in Arabidopsis and tomato roots respectively. In I and M, high red fluorescence of basic fuchsin indicates high lignin deposition
mostly in the primary and lateral root junctions of plants colonized by Fo47. The microscopy photographs are representative images of roots colonized by the
endophyte or infected by the pathogens at 3 days postinoculation (dpi). Scale bar = 20 µm. Different letters in D, H, L and P denote significant differences
(analysis of variance, Tukey).

Vol. 36, No. 1, 2023 / 9

(vol/vol) ethanol (5 min), followed by 20% NaClO (5 min), and overnight, was rinsed and washed for 30 min, and was washed
were then rinsed with SDW (four times) before being planted again overnight. Basic fuchsin was observed with excitation at
into pots with autoclaved soil-less growing media (Promix BX). 561 nm and emission at 600 to 650 nm. Suberin was stained
Plants were grown under standard greenhouse conditions in a 0.5% auramine O for 16 h, was rinsed and washed for 30 min,
controlled environment growth chamber at 24°C, with photope- and was washed again for 2 h. Auramine O was analyzed at
riods of 14 h of light and 10 h of dark. The soil was gently 488 nm excitation and 505 to 530 nm emission.
removed from Arabidopsis and tomato roots when they were 8 Callose and lignin quantification were processed and analyzed
and 10 days old, respectively, using distilled water and SDW to using ImageJ software, according to Xu et al. (2020). Callose
avoid root tissue damage. Fungal inoculation followed the root- deposition was observed only in vessel cells and around the vas-
dipping protocol described by Di Pietro and Roncero (1998), cular cells, which facilitated its measurement using photographs
with some modifications. The washed roots were dipped in the with a black background to eliminate possible autofluorescence.
respective endophytic or pathogenic Fusarium spore suspension Lignin deposition was measured focusing only on the junctions
or SDW as mock-infection for 45 min, then, the inoculated plants of the primary and secondary roots, sites where the lignin deposi-
were gently transplanted in fresh sterile soil medium and were tion was observed, using photographs with a black background.
maintained in a controlled environment growth chamber at 28°C, Average callose measurements were based on at least 10 pho-
with photoperiods of 14 h of light and 10 h of dark. The experi- tographs from different roots. Data were analyzed by analysis of
ments were carried out six times with at least 10 tomato plants variance (ANOVA) and Tukey’s range test (P < 0.05) to com-
and 20 Arabidopsis plants per treatment in each repetition. pare the means among the different treatments. The Statistic 8.0
The staining methods that were followed for fungal visual- program was used for the statistical analyses.
ization were previously described by Ghareeb et al. (2011). The For visualization and analysis of cell damage, colonized or
infected roots were soaked in ethanol overnight, were rinsed infected roots were submerged for 3 to 5 min in 0.4% trypan
with SDW, and were incubated in 10% KOH for 12 h. After blue solution with 0.81% NaCl and 0.06% dibasic potassium
washing with SDW again, roots were incubated for 30 min (in- phosphate and were washed twice with PBS, according to the
cluding three intervals of 2 min on vacuum conditions) in a methodology described by Altman et al. (1993). The observa-
staining solution containing 10 mg of WGA-Alexa Fluor 488 per tion of H2 O2 production was performed using the protocol de-
milliliter, 20 mg of propidium iodide per milliliter, and 0.02% scribed by Molina and Kahmann (2007). Colonized or infected
Tween 20 in phosphate-buffered saline, pH 7.4. The samples roots were dipped in 1-mg/ml diaminobenzedene solution for 1 h
were observed under an Olympus FluoView FV1000 confocal in darkness at room temperature, then were washed with PBS
microscope (Tokyo and were photographed with a Hamamatsu once. Cell damage and H2 O2 were observed under the light mi-
camera (Hamamatsu, Japan). Following the manufacturer sug- croscope Nikon Eclipse E200 (Tokyo) and were photographed
gestions, WGA-Alexa Fluor 488 was detected with excitation with a Pixelink camera (Ontario, Canada).
at 488 nm and emission at 500 to 540 nm (staining the fun- To confirm the presence of Fo47 in the root tissues of
gal structures green), while propidium iodide was detected with Arabidopsis and tomato plants, the fungus was re-isolated from
excitation at 561 nm and emission at 580 to 660 nm (staining the roots of plants after 8, 16, and 25 dpi, using the protocol
the plant tissues red). Moreover, 1-cm pieces of the infected described by Elmer et al. (1994),with some modifications. The
stem were embedded in 5.4% agarose, were cut into thin slices entire plants were removed from the soil and were washed first
with a Leica VT1000S vibratome (Wetzlar, Gemany), accord- under tap water, then with abundant SDW, to remove the soil
ing to Pradhan-Mitra and Loqué (2014), were then stained, and particles. Under the laminar flow hood, roots were dipped in
finally, were observed as described above. For visualization of 10% NaClO for 1 min, were washed several times with SDW,
structures of RFP-tagged Fo47, the infected plant tissues were and were blotted dry, using Kimwipe paper towels. Small plant
observed directly under the confocal microscope, using the RFP tissue pieces were placed on a solid Komada Fusarium-selective
channel (excitation at 555 nm and emission at 584 nm). medium (Komada 1975) and were incubated at 28°C. After 2 to
Callose visualization was performed according to the method 3 days, the fungal colonies were transferred to new Petri dishes
described by Zhang et al. (2015), with some adaptations. with Komada medium and were used for single-spore isolation.
Colonized/infected roots were cleaned in 95% ethanol for Using the Qiagen plant DNA extraction kit (Hilden, Germany),
30 min, were incubated in an emulsifiable solution (phenol, glyc- DNA of three different fungal colonies isolated from Ara-
erol, lactic acid, water, and ethanol at 1:1:1:1:8 concentration) bidopsis and tomato plants was collected. Fo47 strain-specific
at 65°C for 1 h, were washed with 50% ethanol and SDW, and effector genes FOZG_17267 (jgi|FusoxFo47_2|262755),
were then stained by soaking in 0.1% aniline blue for 1 h. Callose FOZG_10369 (jgi|FusoxFo47_2|239495), and FOZG_17668
deposition stained by aniline blue was analyzed with excitation (jgi|FusoxFo47_2|276745) were used to design primers for
at 395 nm and emission at 495 nm under Olympus FluoView strain-specific PCR amplification and sequencing as fol-
FV1000 confocal microscope. lows: Fo47_262755 F: CTACCAGGAAGCCTAGGCCGT
Visualization of lignin and suberin was performed accord- C; R: CATAGACCAACCACGGCCCAGG; Fo47_239495 F:
ing to the protocol described by Kurihara et al. (2015), with CTTCAACAACGCCATTGTCGCC; R: CTGAGGGCATTGT
some modifications made by the N. Geldner research group TGGCTGACC; Fo47_276745 F: CACCAGGACAATCTTATC
from the University of Lausanne, Switzerland. Colonized or in- ACAC; R: GAGCGCCCCTAAGGACGATGCG. PCR products
fected roots were fixed with 4% paraformaldehyde in phosphate- were sequenced by Genewiz Inc. (Cambridge, MA, U.S.A.),
buffered saline (PBS) for 1 h at room temperature in vacuum and the sequences were analyzed by BLAST in Joint Genome
conditions, were then washed twice for 1 min with PBS, and Institute (JGI) Genome Portal, FungiDB, and the National
were transferred to ClearSee solution (10% xylitol, 15% sodium Center for Biotechnology Information (NCBI).
deoxycholate, 25% urea, and SDW to the final volume) at room For detection of the pathogenic Fol4287 and Fo5175 as
temperature with gentle agitation for 4 days. Colonized or in- well as the endophytic Fo47 from above-ground tissues, the
fected roots were stained by soaking in different staining solu- stems of 10 tomato and 50 Arabidopsis plants were har-
tions. All staining solutions were prepared in ClearSee solution, vested after 16 dpi. For genomic DNA extraction, stem ma-
and that same solution was used for all washed steps. All sam- terial was frozen in liquid nitrogen, was ground to powder,
ples were analyzed under the confocal microscope and camara and was extracted, using the Qiagen plant DNA extraction kit
described above. Lignin was stained with 0.2% basic fuchsin described above. The reverse transcription-qPCR analysis was

10 / Molecular Plant-Microbe Interactions

performed using a Mastercycler (Eppendorf), following the man- 5.0 improves signal peptide predictions using deep neural networks. Nat.
ufacturer instructions of the SYBR Green PCR master mix Biotechnol. 37:420-423.
kit (Applied Biosystems). F. oxysporums strains were detected Altman, S. A., Banders, L., and Bao, G. 1993. Comparison of trypan blue
dye exclusion and fluorometric assays for mammalian cell viability de-
with primers Actin-fw (5’-GCACGATGTTGCTGTAGAGAG- terminations. Biotechnol. Progr. 9:671-674.
3’) and Actin-re (5’-GATTGGCGCGGAACGCTTTAG-3’), Araujo, L., Bispo, W. M. S., Cacique, I. S., Moreira, W. R., and Rodrigues,
amplifying a conserved region of the actin gene. Arabidopsis F. Á. 2014. Resistance in mango against infection by Ceratocystis fim-
pentatricopeptide repeat was amplified with primers Pent-fw briata. Phytopathology 104:820-833.
(5’-GAGGATGATTCACCCCAACGAAG-3’), Pent-re (5’- CC Armitage, A. D., Taylor, A., Sobczyk, M. K., Baxter, L., Greenfield, B. P. J.,
TCACTAATGTGTCCATCAATC-3’), and tomato beta-tubulin Bates, H. J., Wilson, F., Jackson, A. C., Ott, S., Harrison, R. J., and
Clarkson, J. P. 2018. Characterisation of pathogen-specific regions and
served as reference genes for normalization, amplified with novel effector candidates in Fusarium oxysporum f. sp. cepae. Sci. Rep.
primers Tubulin-fw (5’- GATTTGCCCACTAACCTCTCGT-3’) 8:13530.
and Tubulin-re (5’- ACCTCCTTTGTGCTCATCTTACCC-3’). Ayhan, D. H., López-Díaz, C., Di Pietro, A., and Ma, L. J. 2018. Improved
Relative amounts of fungal DNA were calculated relative to the assembly of reference genome Fusarium oxysporum f. sp. lycopersici
amount of pentatricopeptide repeat (for A. thaliana) and beta- strain Fol4287. Microbiol. Resource Announc. 7:e00910-18.
tubulin (for tomato) DNA respectively, using the cycle threshold Bao, J., Fravel, D., Lazarovits, G., Chellemi, D., van Berkum, P., and O’Neill,
N. 2004. Biocontrol genotypes of Fusarium oxysporum from tomato
2−Ct method (Livak and Schmittgen 2001). Three biological fields in Florida. Phytoparasitica 32:9-20.
replicates with three repetitions in each one was analyzed, and Benhamou, N., and Garand, C. 2001. Cytological analysis of defense-related
significant differences were determined (ANOVA, Tukey). mechanisms induced in pea root tissues in response to colonization by
The proteomes of Fo47 (Wang et al. 2020), Fo5176 (Fokkens nonpathogenic Fusarium oxysporum Fo47. Phytopathology 91:730-740.
et al. 2020), and Fol4287 (Ayhan et al. 2018; Ma et al. 2010) Benhamou, N., Garand, C., and Goulet, A. 2002. Ability of nonpathogenic
were downloaded from the JGI MycoCosm portal (Grigoriev Fusarium oxysporum strain Fo47 to induce resistance against Pythium
ultimum infection in cucumber. Appl. Environ. Microbiol. 68:4044-4060.
et al. 2012). SignalP 5.0 (Almagro-Armenteros et al. 2019) was Bhuiyan, N. H., Selvaraj, G., Wei, Y., and King, J. 2009. Role of lignification
used to identify putative secreted proteins. These proteins were in plant defense. Plant Signal. Behav. 4:158-159.
analyzed with OrthoFinder 2.5.4 (Emms and Kelly 2019) for Bishop, C. D., and Cooper, R. M. 1983. An ultrastructural study of root
orthogroups determination. Finally, protein annotation was per- invasion in three vascular wilt diseases. Physiol. Plant Pathol. 22:15-
formed using InterProScan 5.38-76.0 (Jones et al. 2014). Anno- IN13.
tations of proteins involved in plant compound degradation were Brader, G., Compant, S., Vescio, K., Mitter, B., Trognitz, F., Ma, L. J., and
Sessitsch, A. 2017. Ecology and genomic insights into plant-pathogenic
then manually extracted. and plant-nonpathogenic endophytes. Ann. Rev. Phytopathol. 55:61-83.
Arabidopsis genes involved in callose biosynthesis were pre- Cajero-Sánchez, W., García-Ponce, B., Sánchez, M. P., Álvarez-Buylla,
viously described by Ellinger and Voigt 2014. Genes involved E. R., and Garay-Arroyo, A. 2017. Identifying the transition to the mat-
in the regulation of lignin deposition were identified from infor- uration zone in three ecotypes of Arabidopsis thaliana roots. Commun.
mation reported by Liu et al. (2018) and Vanholme et al. (2010). Integr. Biol. 11:e1395993.
The RNA-seq dataset was previously described and de- Cal, A. D., Pascual, S., and Melgarejo, P. 1997. Infectivity of chlamydospores
vs microconidia of Fusarium oxysporum f.sp. lycopersici on tomato. J.
posited in the NCBI Short Read Archive with accession number Phytopathol. 145:231-233.
GSE87352. In short, reads were mapped to reference genomes of Cheng, C.-Y., Krishnakumar, V., Chan, A. P., Thibaud-Nissen, F., Schobel,
Arabidopsis (annotation version Araport11 [Cheng et al. 2017]), S., and Town, C. D. 2017. Araport11: A complete reannotation of the
Fo5176 (Fokkens et al. 2020), and Fo47 (Wang et al. 2020), us- Arabidopsis thaliana reference genome. Plant J. 89:789-804.
ing HISAT2 version 2.0.5 (Kim et al. 2015). Mapped reads were Dean, R., Van Kan, J. A. L., Pretorius, Z. A., Hammond-Kosack, K. E., Di
used to quantify the transcriptome by StringTie version 1.3.4 Pietro, A., Spanu, P. D., Rudd, J. J., Dickman, M., Kahmann, R., Ellis, J.,
and Foster, G. D. 2012. The top 10 fungal pathogens in molecular plant
(Pertea et al. 2015). Read count normalization was conducted pathology. Mol. Plant Pathol. 13:414-430.
using DESeq2 version 1.27.32 (Love et al. 2014). Researchers de Lamo, F. J., and Takken, F. L. W. 2020. Biocontrol by Fusarium oxyspo-
first averaged normalized read counts per condition and were rum using endophyte-mediated resistance. Front. Plant Sci. 11:37.
then transformed by log2 (normalized read count + 1) and Delulio, G. A., Guo, L., Zhang, Y., Goldberg, J. M., Kistler, H. C., and Ma, L.
Z-scaled, and were then visualized in ggplot2 version 3.3.0 and J. 2018. Kinome expansion in the Fusarium oxysporum species complex
pheatmap (version 1.0.12). driven by accessory chromosomes. mSphere 3:e00231-18.
Demers, J. E., Gugino, B. K., and Jiménez-Gasco, M. M. 2015. Highly
diverse endophytic and soil Fusarium oxysporum populations associated
Acknowledgments with field-grown tomato plants. Appl. Environ. Microbiol. 81:81-90.
Di Pietro, A., and Roncero, M. I. 1998. Cloning, expression, and role in
We appreciate D. Tieman at University of Florida and Tomato Genetics pathogenicity of pg1 encoding the major extracellular endopolygalactur-
Resource Center (TGRC) for making available seeds of Solanum lycoper- onase of the vascular wilt pathogen Fusarium oxysporum. Mol. Plant-
sicum cv. M82; J. Manners and D. Gardiner of CSIRO for providing strain Microbe Interact. 11:91-98.
Fo5176; C. Joyner and D. O’Neil of the College of Natural Sciences Green- Dong, S., Raffaele, S., and Kamoun, S. 2015. The two-speed genomes of
house at University of Massachusetts (UMASS) and UMASS undergraduate filamentous pathogens: Waltz with plants. Curr. Opin. Genet. Dev. 35:
students M. Rodrigues, S. Andersen, and H. Lynch for their support with 57-65.
some of the experiments conducted in the greenhouse. Ellinger, D., and Voigt, C. 2014. Callose biosynthesis in Arabidopsis with a
focus on pathogen response: What we have learned within the last decade.
Ann. Bot. 114:1349-1358.
Literature Cited Elmer, W. H., Wick, R. L., and Aviland, P. H. 1994. Vegetative compatibility
Aimé, S., Alabouvette, C., Steinberg, C., and Olivain, C. 2013. The en- among Fusarium oxysporum f. sp. basilicum isolates recovered from basil
dophytic strain Fusarium oxysporum Fo47: A good candidate for prim- seed and infected plants. Plant Dis. 78:789-791.
ing the defense responses in tomato roots. Mol. Plant-Microbe Interact. Emms, D. M., and Kelly, S. 2019. OrthoFinder: Phylogenetic orthology
26:918-926. inference for comparative genomics. Genome Biol. 20:238.
Akhter, A., Hage-Ahmed, K., Soja, G., and Steinkellner, S. 2016. Potential Fokkens, L., Guo, L., Dora, S., Wang, B., Ye, K., Sánchez-Rodríguez, C., and
of Fusarium wilt-inducing chlamydospores, in vitro behaviour in root Croll, D. A. 2020. Chromosome-scale genome assembly for the Fusar-
exudates and physiology of tomato in biochar and compost amended ium oxysporum strain Fo5176 to establish a model Arabidopsis-fungal
soil. Plant Soil 406:425-440. pathosystem. G3 Genes Genom. Genet. 10:3549-3555.
Alabouvette, C. 1986. Fusarium-wilt suppressive soils from the Châteaure- Galazka, J. M., and Freitag, M. 2014. Variability of chromosome structure
nard region: Review of a 10-year study. Agronomie 6:273-284. in pathogenic fungi of ‘ends and odds’. Curr. Opin. Microbiol. 20:19-26.
Almagro-Armenteros, J. J., Tsirigos, K. D., Sønderby, C. K., Petersen, T. N., Gawehns, F., Ma, L., Bruning, O., Houterman, P. M., Boeren, S., Cornelis-
Winther, O., Brunak, S., von Heijne, G., and Nielsen, H. 2019. SignalP sen, B. J. C., Rep, M., and Takken, F. L. W. 2015. The effector repertoire

Vol. 36, No. 1, 2023 / 11

 of Fusarium oxysporum determines the tomato xylem proteome compo- Livak, K. J., and Schmittgen, T. D. 2001. Analysis of relative gene expression
sition following infection. Front. Plant Sci. 6:967. data using real-time quantitative PCR and the 2− C(T) method. Methods
Ghareeb, H., Becker, A., Iven, T., Feussner, I., and Schirawski, J. 2011. 25:402-408.
Sporisorium reilianum infection changes inflorescence and branching ar- Love, M. I., Huber, W., and Anders, S. 2014. Moderated estimation of fold
chitectures of maize. Plant Physiol. 156:2037-2052. change and dispersion for RNA-seq data with DESeq2. Genome Biol.
Gordon, T. R. 2017. Fusarium oxysporum and the Fusarium Wilt Syndrome. 15:550.
Annu. Rev. Phytopathol. 55:23-39. Ma, L. J., Geiser, D. M., Proctor, R. H., Rooney, A. P., O’Donnell, K.,
Graca, J. 2015. Suberin: The biopolyester at the frontier of plants. Front. Trail, F., Gardiner, D. M., Manners, J. M., and Kazan, K. 2013. Fusarium
Chem. 3:62. pathogenomics. Annu. Rev. Microbiol. 67:399-416.
Grigoriev, I. V., Nordberg, H., Shabalov, I., Aerts, A., Cantor, M., Goodstein, Ma, L. J., van der Does, H. C., Borkovich, K. A., Coleman, J. J., Daboussi, M.
D., Kuo, A., Minovitsky, S., Nikitin, R., Ohm, R. A., Otillar, R., Poliakov, J., Di Pietro, A., Dufresne, M., Freitag, M., Grabherr, M., Henrissat, B.,
A., Ratnere, I., Riley, R., Smirnova, T., Rokhsar, D., and Dubchak, I. 2012. Houterman, P. M., Kang, S., Shim, W. B., Woloshuk, C., Xie, X., Xu, J. R.,
The genome portal of the Department of Energy Joint Genome Institute. Antoniw, J., Baker, S. E., Bluhm, B. H., Breakspear, A., Brown, D. W.,
Nucleic Acids Res. 40:D26-D32. Butchko, R. A., Chapman, S., Coulson, R., Coutinho, P. M., Danchin,
Guo, L., Yu, H., Wang, B., Vescio, K., DeIulio, G. A., Yang, H., Berg, E. G., Diener, A., Gale, L. R., Gardiner, D. M., Goff, S., Hammond-
A., Zhang, L., Edel-Hermann, V., Steinberg, C., Kistler, H. C., and Ma, Kosack, K. E., Hilburn, K., Hua-Van, A., Jonkers, W., Kazan, K., Kodira,
L.-J. 2021. Metatranscriptomic comparison of endophytic and pathogenic C. D., Koehrsen, M., Kumar, L., Lee, Y. H., Li, L., Manners, J. M.,
Fusarium-Arabidopsis interactions reveals plant transcriptional plastic- Miranda-Saavedra, D., Mukherjee, M., Park, G., Park, J., Park, S. Y.,
ity. Mol. Plant-Microbe Interact. 34:1071-1083. Proctor, R. H., Regev, A., Ruiz-Roldan, M. C., Sain, D., Sakthikumar,
Halpern, H. C., Bell, A. A., Wagner, T. A., Liu, J., Nichols, R. L., Olvey, S., Sykes, S., Schwartz, D. C., Turgeon, B. G., Wapinski, I., Yoder, O.,
J., Woodward, J. E., Sanogo, S., Jones, C. A., Chan, C. T., and Brewer, Young, S., Zeng, Q., Zhou, S., Galagan, J., Cuomo, C. A., Kistler, H. C.,
M. T. 2018. First report of Fusarium wilt of cotton caused by Fusar- and Rep, M. 2010. Comparative genomics reveals mobile pathogenicity
ium oxysporum f. sp. vasinfectum race 4 in Texas, U.S.A. Plant Dis. chromosomes in Fusarium. Nature 464:367-373.
102:446. Marroquin-Guzman, M., Hartline, D., Wright, J. D., Elowsky, C., Bourret, T.
Hane, J. K., Rouxel, T., Howlett, B. J., Kema, G. H., Goodwin, S. B., and J., and Wilson, R. A. 2017. The Magnaporthe oryzae nitrooxidative stress
Oliver, R. P. 2011. A novel mode of chromosomal evolution peculiar to response suppresses rice innate immunity during blast disease. Nature
filamentous Ascomycete fungi. Genome Biol. 12:R45. Microbiol. 2:17054.
Hemetsberger, C., Herrberger, C., Zechmann, B., Hillmer, M., and Doehle- Michielse, C. B., and Rep, M. 2009. Pathogen profile update: Fusarium
mann, G. 2012. The Ustilago maydis effector Pep1 suppresses plant oxysporum. Mol. Plant Pathol. 10:311-324.
immunity by inhibition of host peroxidase activity. PLoS Pathog. Molina, L., and Kahmann, R. 2007. An Ustilago maydis gene involved in
8:e1002684. H2 O2 detoxification is required for virulence. Plant Cell 19:2293-2309.
Houterman, P. M., Speijer, D., Dekker, H. L., DE Koster, C. G., Cornelissen, Olivain, C., Humbert, C., Nahalkova, J., Fatehi, J., L´Haridon, F., and
B. J., and Rep, M. 2007. The mixed xylem sap proteome of Fusarium Alabouvette, C. 2006. Colonization of tomato root by pathogenic and
oxysporum-infected tomato plants. Mol. Plant Pathol. 8:215-221. nonpathogenic Fusarium oxysporum strains inoculated together and sep-
Hückelhoven, R. 2007. Cell wall-associated mechanisms of disease resis- arately into the soil. Appl. Environ. Microbiol. 72:1523-1531.
tance and susceptibility. Annu. Rev. Phytopathol 45:101-127. Olivain, C., Trouvelot, S., Binet, M.-N., Cordier, C., Pugin, A., and Al-
Humbert, C., Aimé, S., Alabouvette, C., Steinberg, C., and Olivain, C. 2015. abouvette, C. 2003. Colonization of flax roots and early physiological
Remodelling of actin cytoskeleton in tomato cells in response to inocu- responses of flax cells inoculated with pathogenic and nonpathogenic
lation with a biocontrol strain of Fusarium oxysporum in comparison to strains of Fusarium oxysporum. Appl. Environ. Microbiol. 69:5453-5462.
a pathogenic strain. Plant Pathol. 64:1366-1374. Pegg, G. F. 1976. The response of ethylene-treated tomato plants to infection
Iriti, M., and Faoro, F. 2009. Chitosan as a MAMP, searching for a PRR. by Verticillium albo-atrum. Physiol. Plant Pathol. 9:215-226.
Plant Signal. Behav. 4:66-68. Pertea, M., Pertea, G. M., Antonescu, C. M., Chang, T.-C., Mendell, J. T.,
Jangir, P., Mehra, N., Sharma, K., Singh, N., Rani, M., and Kapoor, R. and Salzberg, S. L. 2015. StringTie enables improved reconstruction of
2021. Secreted in xylem genes: Drivers of host adaptation in Fusarium a transcriptome from RNA-seq reads. Nat. Biotechnol. 33:290-295.
oxysporum. Front. Plant Sci. 12:628611. Pradhan Mitra, P., and Loqué, D. 2014. Histochemical staining of Arabidop-
Jones, P., Binns, D., Chang, H.-Y., Fraser, M., Li, W., McAnulla, C., sis thaliana secondary cell wall elements. J. Vis. Exp. 87:51381.
McWilliam, H., Maslen, J., Mitchell, A., Nuka, G., Pesseat, S., Quinn, Pu, X., Xie, B., Li, P., Mao, Z., Ling, J., Shen, H., Zhang, J., Huang, N., and
A. F., Sangrador-Vegas, A., Scheremetjew, M., Yong, S. Y., Lopez, R., Lin, B. 2014. Analysis of the defence-related mechanism in cucumber
and Hunter, S. 2014. InterProScan 5: Genome-scale protein function clas- seedlings in relation to root colonization by nonpathogenic Fusarium
sification. Bioinformatics 30:1236-1240. oxysporum CS-20. FEMS Microbiol. Lett. 355:142-151.
Kim, D., Langmead, B., and Salzberg, S. L. 2015. HISAT: A fast spliced Rahman, M. Z., Ahmad, K., Siddiqui, Y., Saad, N., Hun, T. G., Mohd Hata,
aligner with low memory requirements. Nat. Methods 12:357-360. E., Rashed, O., Hossain, M. I., and Kutawa, A. B. 2021. First report of
Kistler, H. C. 1997. Genetic diversity in the plant-pathogenic fungus Fusar- Fusarium wilt disease on watermelon caused by Fusarium oxysporum
ium oxysporum. Phytopathology 87:474-479. f. sp. niveum (FON) in Malaysia. Plant Dis. 105:4169.
Komada, H. 1975. Development of a selective medium for quantitative iso- Redkar, A., Sabale, M., Schudoma, C., Zechmann, B., Gupta, Y. K., López-
lation of Fusarium oxysporum from natural soil. Rev. Plant. Prot. Res. Berges, M. S., Venturini, G., Gimenez-Ibanez, S., Turrà, D., Solano, R.,
8:114-125. and Di Pietro, A. 2022. Conserved secreted effectors contribute to endo-
Kondo, Y., Tamaki, T., and Fukuda, H. 2014. Regulation of xylem cell fate. phytic growth and multihost plant compatibility in a vascular wilt fungus.
Front. Plant Sci. 5:315. Plant Cell 34:3214-3232.
Kurihara, D., Mizuta, Y., Sato, Y., and Higashiyama, T. 2015. ClearSee: Rep, M., van der Does, H. C., Meijer, M., van Wijk, R., Houterman, P. M.,
A rapid optical clearing reagent for whole-plant fluorescence imaging. Dekker, H. L., de Koster, C. G., and Cornelissen, B. J. 2004. A small,
Development 142:4168-4179. cysteine-rich protein secreted by Fusarium oxysporum during coloniza-
Lagopodi, A. L., Ram, A. F., Lamers, G. E., Punt, P. J., Van den tion of xylem vessels is required for I-3-mediated resistance in tomato.
Hondel, C. A., Lugtenberg, B. J., and Bloemberg, G. V. 2002. Novel Mol. Microbiol. 53:1373-1383.
aspects of tomato root colonization and infection by Fusarium oxyspo- Somssich, M., Khan, G. A., and Persson, S. 2016. Cell wall heterogeneity
rum f. sp. radicis-lycopersici revealed by confocal laser scanning mi- in root development of Arabidopsis. Front Plant Sci. 07:1242.
croscopic analysis using the green fluorescent protein as a marker. Mol. van Dam, P., Fokkens, L., Schmidt, S. M., Linmans, J. H. J., Kistler, H. C.,
Plant-Microbe Interact. 15:172-179. Ma, L. J., and Rep, M. 2016. Effector profiles distinguish formae speciales
Lee, M. H., Jeon, H. S., Kim, S. H., Chung, J. H., Roppolo, D., Lee, H. J., of Fusarium oxysporum. Environ. Microbiol. 18:4087-4102.
Cho, H. J., Tobimatsu, Y., Ralph, J., and Park, O. K. 2019. Lignin-based Vanholme, R., Demedts, B., Morreel, K., Ralph, J., and Boerjan, W. 2010.
barrier restricts pathogens to the infection site and confers resistance in Lignin biosynthesis and structure. Plant Physiol. 153:895-905.
plants. EMBO J. 38:e101948. Veloso, J., and Díaz, J. 2012. Fusarium oxysporum Fo47 confers protection
Li, C., Yang, J., Li, W., Sun, J., and Peng, M. 2017. Direct root penetration to pepper plants against Verticillium dahliae and Phytophthora capsici,
and rhizome vascular colonization by Fusarium oxysporum f. sp. cubense and induces the expression of defence genes. Plant Pathol. 61:281-288.
are the key steps in the successful infection of Brazil Cavendish. Plant Viljoen, A., Mostert, D., Chiconela, T., Beukes, I., Fraser, C., Dwyer, J.,
Dis. 101:2073-2078. Murray, H., Amisse, J., Matabuana, E. L., Tazan, G., Amugoli, O. M.,
Liu, Q., Luo, L., and Zheng, L. 2018. Lignins: Biosynthesis and biological Mondjana, A., Vaz, A., Pretorius, A., Bothma, S., Rose, L. J., Beed, F.,
functions in plants. Int. J. Mol. Sci. 19:335. Dusunceli, F., Chao, C. -. P., and Molina, A. B. 2020. Occurrence and

12 / Molecular Plant-Microbe Interactions

 spread of the banana fungus Fusarium oxysporum f. sp. cubense TR4 in speciales facilitates identification of candidate effectors. BMC Genomics
Mozambique. S. Afr. J. Sci. 116:1-11. 17:191.
Vlaardingerbroek, I., Beerens, B., Rose, L., Fokkens, L., Cornelissen, Xu, Y., Zhang, J., Shao, J., Feng, H., Zhang, R., and Shen, Q. 2020. Extra-
B. J. C., and Rep, M. 2016. Exchange of core chromosomes and hori- cellular proteins of Trichoderma guizhouense elicit an immune response
zontal transfer of lineage-specific chromosomes in Fusarium oxysporum. in maize (Zea mays) plants. Plant Soil 449:133-149.
Environ. Microbiol. 18:3702-3713. Yang, H., Yu, H., and Ma, L. J. 2020. Accessory chromosomes in Fusarium
Wang, B., Yu, H., Jia, Y., Dong, Q., Steinberg, C., Alabouvette, C., Edel- oxysporum. Phytopathology 110:1488-1496.
Hermann, V., Kistler, H. C., Ye, K., Ma, L. J., and Guo, L. 2020. Yu, H., Ayhan, D. H., Diener, A. C., and Ma, L. J. 2020. Genome sequence
Chromosome-scale genome assembly of Fusarium oxysporum strain of Fusarium oxysporum f. sp. matthiolae, a Brassicaceae pathogen. Mol.
Fo47, a fungal endophyte and biocontrol agent. Mol. Plant-Microbe In- Plant-Microbe Interact. 33:569-572.
teract. 33:1108-1111. Zhang, M., Ahmed Rajput, N., Shen, D., Sun, P., Zeng, W., Liu, T., Juma
Williams, A. H., Sharma, M., Thatcher, L. F., Azam, S., Hane, J. K., Mafurah, J., and Dou, D. 2015. A Phytophthora sojae cytoplasmic effec-
Sperschneider, J., Kidd, B. N., Anderson, J. P., Ghosh, R., Garg, G., tor mediates disease resistance and abiotic stress tolerance in Nicotiana
Lichtenzveig, J., Kistler, H. C., Shea, T., Young, S., Buck, S.-A. G., benthamiana. Sci. Rep. 5:10837.
Kamphuis, L. G., Saxena, R., Pande, S., Ma, L. J., Varshney, R. K., and Zhang, Y., and Ma, L. J. 2017. Deciphering pathogenicity of Fusar-
Singh, K. B. 2016. Comparative genomics and prediction of conditionally ium oxysporum from a phylogenomics perspective. Adv. Genet. 100:
dispensable sequences in legume–infecting Fusarium oxysporum formae 179-209.

Vol. 36, No. 1, 2023 / 13