PHYLOGENETIC AFFINITIES AMONG SIDA SPECIES AND ALLIED GENERA

(MALVACEAE: MALVEAE), AND EXAMINATION OF SIDA FALLAX WITHIN THE

HAWAIIAN ISLANDS AND THROUGHOUT THE PACIFIC

A DISSERTATION SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY

OF HAWAI‘I AT MĀNOA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR
THE DEGREE OF

DOCTOR OF PHILOSOPHY

IN

BOTANY

MAY 2022

BY

Mersedeh Pejhanmehr

DISSERTATION COMMITTEE:

Clifford W. Morden, Chairperson

Michael B. Kantar
Tom A. Ranker
Alison R. Sherwood
Robert H. Cowie
Acknowledgments

I would like to express my sincere gratitude to the following people for helping with this

research project: my advisor Dr. Clifford Morden, for his support, encouragement, kindness, and

patience with the project and throughout my time as a PhD student; my dissertation committee,

Tom Ranker, Alison Sherwood, Michael Kantar, and Robert Cowie for all their helpful

comments and support; our lab manager, Mitsuko Yorkston for teaching me every lab technique

I know and assisting with analyzing my data and her support and kindness during my research.

I would also like to thank the following organizations and people: Todd MacClay (Royal

Botanic Gardens Victoria) and Jennifer Tate (Massey University, New Zealand) for providing

samples and consultation; Jesse Adams for collecting samples from Kauaʻi island; Allan

Herbarium (CHR), Arizona State University Vascular Plant Herbarium (ASU), The Herbarium

of the Missouri Botanical Garden (MO), and the United States National Herbarium (US) for

providing samples; and Emiko Eguchi (Tokyo, Japan) for MIG-seq Library construction and

sequencing.

I would like to acknowledge UH School of Life Science, Harold and Elizabeth St. John

Scholarship, and Pacific Cooperative Studies Unit (PCSU) for financial support for this project.

Lastly, I thank my family and friends for all the support and encouragements to achieve my

goals.

ii
Abstract

Malveae has the greatest generic and species diversity of the three tribes of subfamily

Malvoideae (Malvaceae) with approximately 70 genera and 1040 species. Within Malveae, Sida

is one of the largest genera with over 100 species of mostly herbs and small shrubs with world-

wide distribution. The generic circumscription of Sida is problematic. Previous genetic analysis

with a limited representation of species and genera and one gene region internal transcribed

spacer (ITS) indicated that Sida is polyphyletic with a core group of species forming a distinct

clade, but many species more closely associated with other genera and clades. In addition,

section classification of Sida is problematic and many of these sections are not monophyletic. A

study was conducted to investigate these objectives: first characterize the relationships among

Sida species; second, determine their relationship to other Malveae genera; third, examine how

these associations compare to the section classification; and fourth, investigate the biogeography

of species within Sida. To do this, phylogenetic analyses of an extensive sampling of Sida

species and most Malveae genera based on nuclear (ITS) and chloroplast DNA (psbA–trnH,

rpl16, ndhF and matK) markers were carried out. Sequences were compared using Bayesian

phylogenetic analyses.

The nuclear and plastid phylogenies indicated that Sida as currently recognized is

polyphyletic. The main Sida clade is monophyletic and represents the true “Sida” and is sister to

the monotypic genus Fryxellia. The main Sida clade consists of at least 66 species including the

type species, S. rhombifolia. Evidence indicates that Sida is largely of central and south

American origins which is the center of diversity of the genus. There are at least 18 species

currently classified as Sida that were not within the main Sida clade and should be revaluated.

iii
The previously identified section alliances are not consistent with the phylogeny and are in need

of reevaluation based on morphological and phylogenetic grounds.

Sida fallax Walp. (`ilima) (Malveae; Malvoideae; Malvaceae) is native to the Pacific area

and is extensively distributed throughout this region. It is noteworthy that Sida fallax is the most

widespread and variable taxon of Malvaceae in Hawaiian Islands and it occurs with diverse

morphological forms and in different habitats from Hawaii Island to Midway Atoll. There are

two extreme ecological forms of S. fallax with many intermediate morphological types between

them in the Hawaiian Islands. A low elevation ecotype that is a sprawling, or prostrate shrubs

with densely pubescent leaves that occurs along beaches and in dry, coastal shrublands. Sida

fallax from other Pacific locations exhibit this form only. In contrast, the mountain ecotype is an

erect shrub up to 2 m tall with glabrous leaves that is found in upland communities and mesic

forest sites. The range of morphological and ecological diversity in Sida fallax suggest that this

species requires further biosystematics investigation.

Phylogenetic and population studies were carried out on S. fallax. The purpose of the

phylogenetic study was two-fold. The first objective was to explore the genetic diversity among

S. fallax populations throughout its native range in the Pacific region. The diversity in habitat

and its wide distribution throughout the Pacific regions calls into question whether S. fallax is a

single species or potentially multiple cryptic species. The second objective was to investigate the

origin of S. fallax. To do this, populations of Sida fallax throughout Hawaiian Islands and

different parts of Pacific region were collected. Bayesian phylogenetic analyses based on nuclear

[(ITS) and external transcribed spacer (ETS)] and chloroplast regions (psbA–trnH) were carried

out. The nuclear and plastid phylogenies of this study clearly demonstrated that Sida fallax is a

single species throughout the Pacific region and the different forms of Hawaiian S. fallax are not

iv
genetically distinct at the sequence level. Although the pattern of dispersal of S. fallax is not

clear, it is evident that an American origin is most likely.

The population study objective was to investigate the genetic variation within and among

populations from the various habitats and geographic locations throughout the Hawaiian range of

S. fallax. To do this, populations were collected from six of the main Hawaiian Islands (Kauaʻi,

Oʻahu, Maui, Molokaʻi, Lānaʻi, and Hawaiʻi) and Nihoa in the Northwestern Hawaiian Islands.

DNA samples of 124 samples from 26 populations were selected for Multiplexed ISSR

genotyping by sequencing (MIG-seq) to detect single nucleotide polymorphisms (SNP). Genetic

differences among individuals and populations from across the range of habitat and locations of

S. fallax in the Hawaiian Islands were evaluated using PCO analyses. The relationship of FST

with the geographical distance between the populations was assessed using Mantel test. The

Mantel test identified a significant positive correlation between genetic and geographic distances

among S. fallax populations. Three main island groupings were evident in PCO graphs: 1)

Oʻahu, Kauaʻi and Nihoa; 2) Maui, Molokaʻi, and Lānaʻi (collectively referred to as Maui Nui);

3) Hawaiʻi Island. Populations from each island grouping intersect at the center of the graph, the

zone of intersection (ZOI), suggesting gene flow still exists among them. There was a trend of

coastal/beach populations occurring more predominantly near the ZOI, and the mountain/inland

or most isolated populations being more away from the ZOI.

Overall, populations on a single island were more closely related to each other and to

populations on islands within their respective groups than they were to populations on other

islands. Because long-distance seed dispersal via ocean currents is more probable for beach

ecotype populations, the beach ecotype populations of all islands showed somewhat closer

relationships to each other than to mountain ecotype populations and provided some continuity

v
among all the island groups. The overall genetic relationships among islands were to a large

extent predictive based on island position within the chain, and, to a lesser extent, within island

topography.

vi
 Table of Contents

Acknowledgments ......................................................................................................................... ii
Abstract ......................................................................................................................................... iii
Table of Contents ........................................................................................................................ vii
List of Tables ................................................................................................................................. x
List of Figures............................................................................................................................... xi
Tables of Appendixes ................................................................................................................. xiii
Chapter 1: Literature review and the dissertation proposal .................................................... 1
Literature review ......................................................................................................................... 1
Habit ........................................................................................................................................ 1
Ethnobotany ............................................................................................................................. 2
Geographic distribution ........................................................................................................... 3
Taxonomy of Sida and its relatives worldwide ....................................................................... 4
Phenotypic polymorphism and population genetics of Sida fallax in the Hawaiian Islands . 10
Dissertation Proposal................................................................................................................. 12
Research questions ................................................................................................................ 12
Research approach ................................................................................................................. 15
Literature cited .......................................................................................................................... 17
Chapter 2: Phylogenetic analysis of Sida (Malvaceae) and association with other Malveae
genera ........................................................................................................................................... 22
Introduction ............................................................................................................................... 22
Materials and Methods .............................................................................................................. 30
Taxon Sampling..................................................................................................................... 30
DNA Extraction, Marker Selection, Amplification and Sequencing .................................... 49
Sequence Alignment and Phylogenetic Analyses ................................................................. 50
Results ....................................................................................................................................... 52
Sequence characteristics ........................................................................................................ 52
Phylogenetic Analysis ........................................................................................................... 54
Discussion ................................................................................................................................. 57
Subclade I-A: ......................................................................................................................... 62
Subclade I-B: ......................................................................................................................... 62

vii
 Subclade I-C: ......................................................................................................................... 62
Subclade I-D: ......................................................................................................................... 63
Subclade I-E: ......................................................................................................................... 64
Subclade I-F:.......................................................................................................................... 65
Clade II: ................................................................................................................................. 66
Outlier Sida species ............................................................................................................... 67
Australian species of Sida...................................................................................................... 69
Biogeography of Sida ............................................................................................................ 71
Literature Cited ......................................................................................................................... 83
Chapter 3: Low genetic diversity in the highly morphologically diverse Sida fallax Walp.
(Malvaceae) throughout the Pacific .......................................................................................... 89
Introduction ............................................................................................................................... 89
Materials and methods .............................................................................................................. 92
Sampling and DNA extraction .............................................................................................. 92
Marker Selection and Amplification ..................................................................................... 99
Sequencing, Sequence Alignment and Phylogenetic Analyses ........................................... 101
Results ..................................................................................................................................... 102
Sequence characteristics ...................................................................................................... 102
Phylogenetic Analysis ......................................................................................................... 102
Discussion ............................................................................................................................... 109
Literature Cited ....................................................................................................................... 113
Chapter 4: Population genetics of Sida fallax Walp. (Malvaceae) in the Hawaiian Islands
..................................................................................................................................................... 118
Introduction ............................................................................................................................. 118
Materials and Methods ............................................................................................................ 122
Sampling and DNA Extraction ............................................................................................ 122
MIG-seq Library Construction and Sequencing .................................................................. 122
Quality control and SNP detection ...................................................................................... 127
Population genetic analysis ................................................................................................. 127
Results ..................................................................................................................................... 129
Numbers of reads, SNPs, and polymorphic loci .................................................................. 129
Population Differentiation and Genetic Distance ................................................................ 131
Genetic Assignment ............................................................................................................. 131

viii
 Discussion ............................................................................................................................... 137
Litreture cited .......................................................................................................................... 140
Chapter 5: Research questions revisited................................................................................. 144
Literature cited ........................................................................................................................ 147

ix
 List of Tables

Table 2.1. Historical classification systems of Malveae by various authors ................................ 23

Table 2.2. Genera of tribe Malveae and their alliances ................................................................ 25

Table 2.3. Genera of Abutilon alliance (Malveae, Malvaceae), with their reported chromosome
numbers and geographic distributions .......................................................................................... 26

Table 2.4. Sections of Sida species .............................................................................................. 28

Table 2.5. Representative Malveae and outgroup species used in phylogenetic analyses. .......... 31

Table 2.6. List of sequence primers with references used for phylogenetic analysis .................. 51

Table 2.7. Sequence characteristics of Sida and Malveae specimens included in the study ....... 53

Table 3.1. Taxa used for Sida fallax phylogenetic analyses ........................................................ 93

Table 3.2. List of sequence primers with references used for phylogenetic analysis ............... 100

Table 3.3. Sequence characteristics of Hawaiian Island and Pacific Sida fallax samples and their
close Sida relatives included in the study ....................................................................................103

Table 4.1. Taxa used for Sida fallax population genetic analyses ............................................. 124

Table 4.2. Population diversity statistics .................................................................................... 130

Table 4.3. Pairwise FST among 26 population of Sida fallax in Hawaiian Islands ................... 132

x
 List of Figures

Figure 1.1. Phylogenetic analysis using Maximum Parsimony of the Malvoideae based on ITS
sequences (from Fuertes Aguilar et al., 2003) ................................................................................ 8

Figure 1.2. Phylogeny and section alignments of the core Sida species (from Fuertes Aguilar et
al., 2003) ......................................................................................................................................... 9

Figure 2.1. ITS and Plastids Bayesian phylogenetic analysis of Sida species and their
relationship with other Malveae genera. ....................................................................................... 55

Figure 2.2. Portion of ITS and plastids Bayesian consensus tree showing main Sida clade, Sida
sections and main subclades I and II, I-A, I-B, I-C, I-D, I-E and I-F ........................................... 56

Figure 2.3. ITS and Plastids Bayesian phylogenetic analysis of Sida species and their
relationship with other Malveae genera ........................................................................................ 58

Figure 3.1. Three major groups of islands in the Pacific Ocean: Melanesia, Micronesia and
Polynesia, and the territories, islands, and archipelagos in each .................................................. 98

Figure 3.2. ITS phylogeny of Hawaiian Island and Pacific Sida fallax samples and their close
Sida relatives ............................................................................................................................... 104

Figure 3.3. ETS phylogeny of Hawaiian Island and Pacific Sida fallax samples and their close
Sida relatives. .............................................................................................................................. 105

Figure 3.4. psbA–trnH phylogeny of Hawaiian Island and Pacific Sida fallax samples and their
close Sida relatives ...................................................................................................................... 107

Figure 3.5. Phylogeny of Hawaiian Island and Pacific Sida fallax samples and their close Sida
relatives based of combined regions (ITS, ETS, and psbA–trnH). ............................................. 108

Figure 4.1. Ecotype variation within Sida fallax. ...................................................................... 120

Figure 4.2. a) The Hawaiian archipelago including Northwestern and main Hawaiian Islands. b)
Inset from above showing the 26 populations of Sida fallax locations in the Hawaiian Islands ......
..................................................................................................................................................... 123

Figure 4.3. Principal coordinate analysis using MIG-seq data identifying individuals from each
island in the Hawaiian Islands using a matrix of covariance values calculated from population
allele frequencies ........................................................................................................................ 133

xi
Figure 4.4. Principal coordinate analysis using MIG-seq data identifying the 26 S. fallax
populations in across the Hawaiian Islands using a matrix of covariance values calculated from
population allele frequencies ...................................................................................................... 134

Figure 4.5. Principal coordinate analysis using MIG-seq data of S. fallax populations in
Hawaiian Islands distinguished by habitat - mountain or inland vs. beach ecotypes ................. 135

xii
 Tables of Appendixes

Appendix 1. ITS Bayesian phylogenetic analysis of Sida species and their relationship with
other Malveae genera .................................................................................................................... 73

Appendix 2. Plastid concatenated data (rpl16, ndhF, psbA–trnH, matK) Bayesian phylogenetic
analysis of Sida species and their relationship with other Malveae genera. ................................. 74

Appendix 3. Portion of ITS Bayesian consensus tree showing main Sida clade, Sida sections and
main subclades A, B, C, D and E in it. ......................................................................................... 75

Appendix 4. ITS Bayesian consensus tree showing outlier Sida species and Sida sections in
them............................................................................................................................................... 76

Appendix 5. Portion of Plastids concatenated (rpl16, ndhF, psbA–trnH, matK) Bayesian

consensus tree showing main Sida clade, Sida sections and main subclades A, B, C, D and E in it
....................................................................................................................................................... 77

Appendix 6. Plastids concatenated (rpl16, ndhF, psbA–trnH, matK) Bayesian consensus tree
showing outlier Sida species and Sida sections in them ............................................................... 78

Appendix 7. matK Bayesian phylogenetic analysis of Sida species and their relationship with
other Malveae genera .................................................................................................................... 79

Appendix 8. ndhF Bayesian phylogenetic analysis of Sida species and their relationship with
other Malveae genera .................................................................................................................... 80

Appendix 9. psbA–trnH Bayesian phylogenetic analysis of Sida species and their relationship
with other Malveae ....................................................................................................................... 81

Appendix 10. rpl16 Bayesian phylogenetic analysis of Sida species and their relationship with
other Malveae................................................................................................................................ 82

xiii
Chapter 1: Literature review and the dissertation proposal

Literature review

Habit

Malvaceae, the hibiscus, or mallow family (order Malvales) contains approximately 244

genera and 225 species of herbs, shrubs, and trees (Staples and Herbst, 2005; Christenhusz and

Byng, 2016). Species occur in all except the coldest parts of the world but mostly in tropical to

warm-temperate regions (Staples and Herbst, 2005). Several unifying morphological characters

define the family. Stems and leaves have stellate hairs and mucilaginous sap. Leaves are

palmately veined, often lobed. Flowers have valvate calyx lobes in bud, and the stamens are

fused into a column surrounding the style in the center of the flower, with single-celled anthers,

and spiny pollen. Also, flowers have five or more carpels, superior ovary, branched style, and

their ovules have axile placentation. Fruits are usually capsule or schizocarp (Staples and Herbst,

2005; APG IV, 2016)

My dissertation research focused on the genus Sida L. (tribe Malveae, Malvoideae,

Malvaceae) and its closely related genera. Sida as currently circumscribed is a complex genus of

between 100 (Fryxell, 1997) and 150 species (Wagner et al., 1999). The species of Sida are

mainly distributed in the tropics and subtropics throughout the world with two-thirds of the

species restricted to North and South America (Fryxell, 1997). Sida species are annual or

perennial herbs or shrubs that are often pubescent with usually stellate hairs, but simple and/or

glandular hairs in some species. Their leaf blades are simple, linear to elliptic or broadly ovate,

and are usually unlobed with serrated margins. Leaf bases can be cordate to cuneate. Petioles are

often short, and stipules are present. Flowers are solitary or glomerate in leaf axils or can be

spicate or paniculate in some species with terminal inflorescences that are sub-sessile or

1
pedicellate. Flower calices are usually 10-ribbed and sometimes yellowish at base and corollas

are usually rotate to campanulate with yellow to orangish yellow, white, or rose to reddish-

purple. The petals in Sida (and closely related genera) are usually two-lobed with either one of

the lobes larger than the other. Carpels are usually five to ten (or more) with one pendulous ovule

per carpel, and the fruit matures into a schizocarp with single-seeded mericarps (Wagner et al.

1999).

Ethnobotany

Species of Sida are widely used for a variety of ethnobotanical purposes. Many of them

are used as a source of fiber for making cordage, some are used medicinally or ornamentally, and

for some species the whole plant is used as a broom (Staples and Herbst, 2005). In India, Sida

species are among the important ethno-medicinal plants and have been used for over 2000 years.

Various species, including Sida cordifolia L., S. acuta Burm.f., S. rhombifolia L., S. spinosa L.,

Sida carpinifolia L.f., and S. humilis Cav. are used in Ayurvedic (holistic healing) systems for

various purposes including diseases of the respiratory and neural systems (Singh et al., 2021). In

addition, many ethnic groups in Asia, Europe, South America, and Africa used this plant as

medicine for various diseases, such as malaria, tuberculosis, and oral inflammation (Singh et al.,

2021). The medicinal activity within some species has been investigated and antibacterial

activities were found in Sida acuta (Karou et al., 2006) and cardiovascular effects in Sida

cordifolia leaf extract (Medeiros et al., 2006).

In traditional Hawaiian medicine, ‘ilima (Sida fallax) flowers were consumed with other

plants to aid women through pregnancy (Kaaiakamanu and Akina, 2003). A combination of the

flowers and root bark is also used as a medicine for asthma (Krauss, 1979; Kaaiakamanu and

2
Akina, 2003). Sida fallax is commonly used now only for lei making, in both Hawaiian Islands

and other parts of Pacific (Wagner et al. 1999).

Geographic distribution

The Malvoideae (eumalvoids) originated in Australasia with oceanic dispersal and

vicariance contributing to the worldwide distribution and diversification of the group (Baum et

al., 2004; Areces-Berazain and Ackerman, 2016). During the late Cretaceous, the land masses of

Australia, Antarctica and South America were connected and the climate was warmer; these

conditions may have promoted the migration of early eumalvoids among these diverging

continents and enhanced their range expansion. Subsequently, the division of continents would

have isolated the populations, which may already have been segregated into several lineages

(Reguero et al., 2013). In addition, oceanic dispersal had an important role in distribution of

eumalvoids. Fruits of eumalvoids are mostly capsules and schizocarps, and indehiscent form of

these fruits can survive prolonged exposure in saltwater. Indehiscent capsule of Thespesia or

indehiscent mericarps of about two third of Sida are some of these examples (Wagner et al.,

1999; Areces-Berazain and Ackerman, 2017).

The genera of the tribe Malveae (Malvoideae, Malvaceae) have an extensive geographic

distribution in both tropical and temperate regions and occur in a wide range of habitats.

Although nearly 15 of the 70 Malveae genera are distributed in mostly temperate areas, some of

the largest genera in the tribe (i.e., Abutilon, Sida and Nototriche) have principally tropical

distributions (Tate et al., 2005).

The species of Sida are mainly distributed in the tropics and subtropics worldwide. They

occur in Africa, Asia, Australia, North and South America, and the Pacific Islands, but

3
approximately two thirds of the species are restricted to North and South America (Fryxell,

1997).

Sida fallax Walp. (`ilima) is native to the Pacific area and is wildly distributed throughout

this region and extending to mainland China. In Hawaiian Islands, Sida fallax can be found on

rocky or sandy soils near coastlines, on raised limestone reefs, in lava fields, and in dry forests.

Some forms of S. fallax grow naturally in moist forests at elevations up to 2,000 m. It is recorded

from all the main islands and on Midway Atoll and Nihoa (Wagner et al., 1999).

In addition to S. fallax, there are six non-native species of Sida in the Hawaiian Islands.

Several species have naturalized locally on one or more islands, including S. cordifolia L., S.

linifolia L., S. spinosa L., and S. urens L.; the other two species, S. acuta N. L. Burm., S.

rhombifolia L. (the type species of Sida), are pantropical weeds found widely in disturbed areas

(Wagner et al. 1999). Several of these species are used medicinally and were distributed widely

for this purpose (see above).

Taxonomy of Sida and its relatives worldwide

In recent years, morphological and molecular data have indicated that many of the

traditional families of the order Malvales are not monophyletic (Judd and Manchester, 1997;

Alverson et al., 1998, 1999; Bayer et al., 1999). Thus, the circumscription of the Malvaceae has

been expanded to include nine subfamilies: Bombacoideae (formerly Bombacaceae, in part),

Brownlowioideae, Byttnerioideae, Dombeyoideae, Grewioideae, Helicteroideae, Malvoideae

(formerly Malvaceae sensu stricto), Sterculioideae (formerly Sterculiaceae, in part), and

Tilioideae (formerly Tiliaceae, in part) (Bayer et al., 1999; Bayer and Kubitzki, 2003).

Based on morphological and molecular data, subfamily Malvoideae (Baum et al., 2004)

is a monophyletic group (Judd and Manchester, 1997; Alverson et al., 1999; Bayer et al., 1999;

4
APG III, 2009). Malvoideae (eumalvoids or Malvaceae s.s.) is the most diverse subfamily of

Malvaceae, with approximately 1800 species in 111 genera (Fryxell, 1997; Baum et al., 2004).

Bayer and Kubitzki (2003) divided this subfamily into four tribes: Gossypieae, Hibisceae,

Kydieae, and Malveae. In a more recent study, the subfamily was split into three tribes,

Gossypieae, Hibisceae, and Malveae, which was well supported by morphological and molecular

data (Baum et al., 2004). Malveae is the largest tribe of this subfamily with c. 1040 species in c.

70 genera (Fryxell, 1997; Tate et al., 2005); Hibisceae consists of 630 species in 32 genera; and

Gossypieae consists of 126 species in nine genera (Areces-Berazain and Ackerman, 2016).

Numerous classifications of the Malveae have been proposed in the past. Early researchers

divided Malveae into subtribes, an approach that lasted over a century (Bentham and Hooker,

1862; Schumann, 1890; Kearney, 1949, 1951; Hutchinson, 1967). However, this systematic

grouping was not appropriate because it was based on taxonomically plastic morphological

characters that may have resulted from convergent evolution, for example, the number of seeds

per mericarp, presence of an epicalyx, presence of an endoglossum, and an arborescent habit

(Bates, 1968; Fuertes Aguilar et al., 2003). Moreover, generic boundaries among numerous large

genera such as Abutilon, Lavatera, Malva, and Sida were weakly defined (Fryxell, 1997). Bates

(1968) revised the classification replacing it with a new system recognizing 13 generic alliances

based on chromosome numbers. Three more alliances were subsequently added (total 16) by

Bates and Blanchard, (1970). Fryxell (1971, 1988) altered the composition of some alliances and

added five new ones (total 21 alliances). One of the most significant modifications was the

separation of a group of 11 genera from the Abutilon alliance based on their chromosome

numbers (x=7 and 8) and mericarp morphology, creating the Sida alliance (Fryxell, 1971, 1988).

Bayer and Kubitzki (2003) retained 14 of the alliances, altering their generic compositions

5
somewhat. Other changes subsequently occurred or were suggested in the composition of these

alliances by various authors (Fernandez et al., 2003; Fuertes Aguilar et al., 2003; Krapovickas,

2003; Tate, 2003).

A study based on chloroplast DNA restriction sites supported the monophyly of members

of the Gossypieae and Malveae, but did not support monophyly of the Malveae alliances (La

Duke and Doebley, 1995). Instead, that study divided Malveae into two major clades: one

consisting of the Abutilon and Sida alliances, and the other consisting of the remaining Malveae

alliances. Later, Tate et al. (2005) similarly found that analysis of the internal transcribed

spacer (ITS) region did not support monophyly of most Malveae generic alliances but instead

revealed two main well-supported clades that were consistent with the presence or absence of

an epicalyx. The two main clades of Tate et al. (2005) study was consistent with the two major

clades system of La Duke and Doebley study (1995). Other studies have consistently

demonstrated that some genera of Malveae were not monophyletic and required taxonomic

revision, including Malva and Lavatera (Ray, 1995), Tarasa (Tate and Simpson, 2003),

Illamna, Wissadula, Tetrasida (Tate et al., 2005), Abutilon, and Sida (Fuertes Aguilar et al.,

2003).

Sida as currently circumscribed is a complex genus of between 100 (Fryxell, 1997) and

150 species (Wagner et al., 1999). The species of Sida are mainly distributed in the tropics and

subtropics throughout the world with two-thirds of the species restricted to North and South

America (Fryxell, 1997). Sida has long been considered as a heterogeneous assemblage and a

repository for many taxa that were difficult to identify (Fryxell, 1985), and therefore Fryxell

(1997) established several new genera, consisting of Akrosida, Allosidastrum, Billieturnera,

Dendrosida, Krapovickasia, Malvella, Rhynchosida and, Sidasodes Fryxell and Fuertes, and

6
Sidastrum Baker f. However, studies that included only a limited number of Sida species

indicated that some, but not all, of the genera were monophyletic in DNA sequence-based

phylogenies (Figure 1.1) (Fuertes Aguilar et al., 2003; Tate et al., 2005).

Subgeneric classifications of Sida have been problematic. Numerous early studies (Baker,

1892; Monteiro, 1949; Kearney, 1951, 1954; Clement, 1957; Hutchinson, 1967) classifications

was based on elements of three or more genera or omitted many of the Sida species (Fryxell,

1985). Fryxell (1985, 1988) conducted a comprehensive study and split Sida into 11 sections.

This classification was subsequently modified in later treatments and new species were added to

these sections (Burandt, 1992; Baker, 1998; Siedo, 1999, 2001, 2014; Krapovickas, 2003a, 2007,

2012). Molecular examination of the Sida sections has demonstrated that many of them

(Cordifoliae, Ellipticifoliae, Muticae, Sidae, Spinosae, Stenidae) are not monophyletic (Figure

1.2) (Fuertes Aguilar et al., 2003). However, species of these sections, although not individually

monophyletic, formed a well-supported clade (the “Sida core”). This clade also contains the type

species, Sida rhombifolia L. (Fuertes Aguilar et al., 2003). Nonetheless, taxonomic sampling for

that study was limited and contained 56 species and 25 genera, of which only 32 species were

Sida, and 24 species were from other Malveae genera (Figure 1.1). The study by Fuertes Aguilar

et al. (2003) also was based solely on the intergenic transcribed spacer (ITS) region.

Species in the Sida core shared several traits in addition to the common base chromosome

number of x=7. Shared morphological traits are costate calyces, lack of an epicalyx, ovate to

elliptical entire leaves, 5-fasciated staminal columns, and mericarps less than 5 mm high that are

indurate and concave dorsally, and have an upper portion specialized for dehiscence and

dispersal. It is noteworthy that Dendrosida, a segregate genus based on its arborescent habit,

7
Figure 1.1. Phylogenetic analysis using Maximum Parsimony of the Malvoideae based on ITS sequences. Numbers
associated with each branch represent bootstrap support for each clade. (From Fuertes Aguilar et al., 2003).

8
Figure 1.2. Phylogeny and section alignments of the core Sida species (from Fuertes Aguilar et al., 2003).

9
flower structure, and mericarp size (Fryxell, 1971), was also placed within this clade. Species in

section Nelavagae (x=8) formed a monophyletic clade that is sister to the Sida core and together

they form a well-supported clade (Fuertes Aguilar et al., 2003). However, Fuertes Aguilar et al.

(2003) did not consider this section as within Sida because of chromosome number differences.

Fryxellia pygmaea (Correll) D.M.Bates (originally described as Anoda pygmaea Correll (Correll,

1968), was recognized by Bates (1974) as a distinct monotypic genus with x=8 chromosomes

and was later supported as the sister taxon to the Sida core/section Nelavagae clade (Tate et al.,

2005). In contrast, species in other sections of Sida were not associated with the Sida core.

Species placed in sections Malachroideae, Oligandrae, Pseudo-Napaea and Hookeriana, and the

Australian Sida species were more closely related to other Malveae genera and clades (Figure

1.1) (Fuertes Aguilar et al., 2003). The relationships among Sida species and associated genera

are complex and warrant further investigation.

Phenotypic polymorphism and population genetics of Sida fallax in the Hawaiian Islands

Sida fallax is the most variable taxon of Malvaceae in the Hawaiian Islands. The range of

morphological and ecological variation within and among Sida fallax populations suggests that

infraspecific taxa might be recognized. The early Hawaiians also diagnosed and named wild and

cultivated forms of Sida fallax (Wagner et al. 1999).

The wild types consist of ʻilima kū kahakai and ‘ilima papa (flat beach forms), ʻilima kū

kula or ʻilima kū kala (very tall forms), ʻilima kuahiwi (the form “from the mountains”), ʻilima

kū kahakai (a creeping form like ‘ilima papa), ʻilima ōkea (a form with light yellow flowers),

and ʻilima makanaʻā (plants with smaller flowers and plants of medium height found on old lava

flows in the Kaʻū district of Hawaiʻi Island; Handy and Handy, 1991; Krauss, 1993). The

cultivated, or domesticated, forms were also recognized including ʻilima ʻāpiki, ʻilima lei and

10
ʻilima mamo (tall, spreading plants with golden flowers), andʻilima kū kala (the form “standing

on plains”). Forms with bronze or red flowers are referred to as ʻilima kolikukui or ʻilima kolī

kukui (kukui candle or torch), which were cultivated on Oʻahu (Neal, 1948). Also, horticulturists

named particular ‘ilima varieties such as the cultivar “Black Coral”, that is an upright small

shrub with single golden-orange flowers and dark stems, and “Kaneohe Gold” that is a dwarf

shrub, with bright golden flowers (Neal, 1948; Handy and Handy, 1991).

In addition to this early Hawaiian classification, two extreme ecotypes of Sida fallax are

recognized, with and many intermediates between them. The extreme forms are the low

elevation and the mountain ecotypes (Yorkston and Daehler, 2006). The low elevation ecotype in

usually dry habitat is a low sprawling shrub that is typically <50 cm tall with small (commonly

1–4 cm long), densely pubescent ovate leaves. This ecotype can take the extreme form of a

prostrate subshrub in coastal communities. In contrast, the mountain ecotype is an erect shrub

that typically reaches 1–1.5 m in height (in some cases exceeding 2 m) with large (commonly 4–

8 cm long), glabrous or nearly glabrous leaves. This ecotype is found in highland, mesic forest

sites (Stephens, 2000; Yorkston and Daehler, 2006). Many intermediates between these extreme

forms occur in a variety of habitats and exhibit a range of morphology in the Hawaiian Islands,

and many of these were morphological forms recognized by early Hawaiians (see above).

Morphological variation exists both within and among populations, particularly variation in

stature, leaf size and shape, pubescence, and inflorescence characters. Some forms are common

on all Hawaiian Islands, while some are unique to particular islands (Wagner et al. 1999).

11
Dissertation Proposal

Research questions

Key questions to be addressed regarding Sida were therefore at the genus/section level

and within Hawaiian Islands at the species level. This research focused on three areas, as

follows, with specific questions and hypotheses outlined

SECTION 1: Sida Systematics and Biogeography

Genetic relations of Sida species within Malveae genera were examined and how these

associations correspond to the section classification of Fryxell (1985) were assessed. In addition,

the biogeography of species within Sida was investigated.

Question 1: What are the relationships of Sida to other Malveae genera?

Question 2: What are the relationships among Sida species?

Question 3: Are the sections within Sida monophyletic?

Question 4: Where are the centers of origin and diversity of genus Sida?

Hypothesis 1: Sida as currently circumscribed is polyphyletic and in need of taxonomic

revision.

Rationale: It is evident from molecular phylogenetic analysis that a core group of

Sida form a distinctive clade, but other species are more closely allied to genera in the

Malveae. However, this was based on only a single nuclear gene region (ITS) with only a

partial representation of Sida species (Fuertes Aguilar et al., 2003). Nuclear (ITS) and

chloroplast DNA (psbA–trnH, rpl16, ndhF and matK) DNA regions of 82 Sida species

were examined to confirm it.

12
 Hypothesis 2: Most sections of Sida are not monophyletic.

Rationale: The ITS tree clearly indicates that most of the sections of Sida are not

monophyletic, including sections Cordifoliae, Ellipticifoliae, Sidae, and Spinosae

(Fuertes Aguilar et al., 2003). Nuclear (ITS) and chloroplast DNA (psbA–trnH, rpl16,

ndhF and matK) DNA regions of 82 Sida species with at least two representatives from

each section, were examined to confirm it.

Hypothesis 3: Sida originated from Australasia.

Rationale: The Malvoideae (eumalvoids) originated in Australasia with oceanic

dispersal and vicariance contributing to the worldwide distribution and diversification of

the group (Baum et al., 2004; Areces-Berazain and Ackerman, 2016). Sida species from

most of its distribution range were collected for assessing this origin.

SECTION 2: Sida fallax diversity throughout its distribution

The genetic relationships among Sida fallax populations from throughout its native range in the

Pacific were examined.

Question 1: Where is the center of origin of S. fallax?

Question 2: Is S. fallax across its distribution a single species or should it be

divided into multiple species?

Hypothesis 1: The center of origin for S. fallax is tropical China with subsequent

dispersal to the islands of the Pacific, including Hawaiian Islands.

Rationale: Much of the Hawaiian flora originated from continental sources with

dispersal to the Pacific. Sida fallax (sensu lato) distribution is consistent with such a

13
 probability. Data from additional species, particularly from Asia and the Indo-Pacific

region, were collected to test this.

Hypothesis 2: Sida fallax is a single species throughout its distribution.

Rationale: Based on flora data available for this species across its distribution, S.

fallax is a single species (Wagner et al. 1999). Sida fallax were collected from most of its

distribution range to test this.

SECTION 3: Sida fallax population diversity within the Hawaiian ecoregions

The variation within and among populations of S. fallax in Hawaiian Islands were evaluated,

focusing on the different morphological forms.

Question: Are there genetic differences among various morphological forms

of S. fallax in the Hawaiian Islands?

Hypothesis: the expectation is that genetic relations will mirror the dispersion among

islands. Parallel evolution is occurring with morphologically different forms on a

single island being more closely related to each other than they are to the

morphologically similar forms on different islands.

Rationale: It is common in the analysis of population variation among species

that are distributed throughout the Hawaiian Islands that individuals and populations

within an island show a closer genetic relationship to other populations on that island

than to populations from other islands. This has been demonstrated repeatedly using

other methods for a wide variety of genera including Hibiscus (Malvaceae; Huppman,

2013), Erythrina (Fabaceae; Grave, 2018), and Sesbania publication (Fabaceae; Cole

and Morden, 2021). Sida fallax populations were collected from different habitats of

14
 six of the main Hawaiian Islands (Kauaʻi, Oʻahu, Maui, Molokaʻi, Lānaʻi, and

Hawaiʻi) and Nihoa in the Northwestern Hawaiian Islands to test this.

Research approach

Sampling:

Sida fallax from throughout its range and other Sida species as well as other Malveae

species were collected by travelling to other Hawaiian Islands and by contacting other botanists

and herbaria worldwide and asking them to send fresh or preserved material; when necessary,

permission was sought to collect tissue from herbarium specimens. For the Sida fallax population

genetic study, at least 10 individuals (when possible) were collected from each population

throughout the Hawaiian Islands. When possible, samples were collected fresh for DNA

extraction, populations and plants were photographed. Voucher specimens were deposited into

the Joseph F. Rock Herbarium (HAW) at the University of Hawaiʻi at Mānoa.

DNA Extraction, Amplification, and Sequencing:

Total genomic DNA was extracted using the CTAB method described by Morden et al.

(1996) and deposited in the Hawaiian Plant DNA Library (HPDL) at the University of Hawaiʻi at

Mānoa (UHM). PCR amplifications were carried out following established protocols (Morden et

al., 2003) to amplify nuclear (ITS and ETS) and chloroplast DNA (psbA–trnH, rpl16, ndhF and

matK) regions. PCR products were separated by gel electrophoresis on 2.0 % agarose gels in

0.5x TBE buffer and visualized by means of ethidium bromide staining. Amplified DNA

products were cleaned using ExoSap-IT and sequenced by GENEWIZ, LLC (South Plainfield,

NJ) or at the Advanced Studies in Genomics, Proteomics, and Bioinformatics (ASGPB) Lab at

the University of Hawaii at Mānoa.

15
 For population-based studies, Multiplexed ISSR genotyping by sequencing (MIG-seq)

(Suyama and Matsuki, 2015) were used to detect single nucleotide polymorphisms (SNP) to

assess genetic diversity within populations.

Sequence alignments and phylogenetic analysis:

The multiple sequencing reads were attained as chromatograms and were assembled and

edited using Sequencher (Gene Codes Corporation, 1995). Sequences were aligned using

MEGA-X v.10.0.5 (Kumar et al., 2018) and then adjusted by eye. Bayesian phylogenetic

analyses were conducted using the CIPRES Science Gateway (Miller et al., 2010). BI analyses

were performed in MrBayes 3.2.7 (Ronquist et al., 2012). Patterns and processes of divergence

and relationships and biogeography of species were inferred from the results of the phylogenetic

analyses.

Population genetic analysis:

Genetic differences among various morphological forms of S. fallax were inferred from

Stacks2 denovo map and populations (Galaxy Version 2.4+galaxy1) (Catchen et al., 2011, 2013;

Afgan et al., 2018). Relationships within and among populations were projected from the

similarity matrixes using principal coordinate analysis (PCO) and cluster analysis with MVSP

Plus ver. 3.1 (Kovach, 2007) using Gower similarity (Gower, 1971). The relationship of FST with

the geographical distance between the populations was assessed using the function Mantel test in

ade4 library of the R package ape v5.3 (Dray and Dufour, 2007; R Core Team, 2021) with 9,999

permutations.

16
Literature cited

Afgan, E., D. Baker, B. Batut, M. Van Den Beek, D. Bouvier, M. Ech, J. Chilton, et al. 2018.
The Galaxy platform for accessible, reproducible and collaborative biomedical analyses:
2018 update. Nucleic Acids Research 46: W537–W544.
Alverson, W. S., K. G. Karol, D. A. Baum, M. W. Chase, M. Susan, W. S. Alverson, K. G.
Karol, et al. 1998. Circumscription of the Malvales and relationships to other Rosidae:
evidence from rbcL sequence data. American journal of botany 85: 876–887.
Alverson, W. S., B. A. Whitlock, R. Nyffeler, C. Bayer, and D. A. Baum. 1999. Phylogeny of the
core Malvales: Evidence from ndhF sequence data. American Journal of Botany 86: 1474–
1486.
APG IV. 2016. An update of the Angiosperm Phylogeny Group classification for the orders and
families of flowering plants: APG IV. Botanical Journal of the Linnean Society 181: 1–20.
Areces-Berazain, F., and J. D. Ackerman. 2017. Diversification and fruit evolution in
eumalvoids (Malvaceae). Botanical Journal of the Linnean Society 184: 401–417.
Areces-Berazain, F., and J. D. Ackerman. 2016. Phylogenetics, delimitation and historical
biogeography of the pantropical tree genus Thespesia (Malvaceae, Gossypieae). Botanical
Journal of the Linnean Society 181: 171–198.
Baker, E. G. 1892. Synopsis of genera and species of Malveae, XVII. Sida. Journal of the
Botanical Research Institute of Texas 30: 138–142, 235–240, 290–296, 324–332.
Baker, R. M. 1998. Sida section Sida in Australia: a revised key, a newly introduced species, S.
subcordata span., and name changes for S. rohlenae var. Mutica (benth.) Fryxell and S.
magnifica Domin. Journal of the Adelaide Botanic Gardens 18: 33–41.
Bates, D. M. 1974. Fryxellia , a new genus of North American Malvaceae. Brittonia 26: 95–100.
Bates, D. M. 1968. Generic relationships in the Malvaceae, tribe Malveae. Gentes Herbarum 10:
117–135.
Bates, D. M., and O. J. Blanchard. 1970. Chromosome numbers in the Malvales. II. New or
otherwise noteworthy counts relevant to classification in the Malvaceae, tribe Malveae.
American Journal of Botanyurnal of botany 57: 927–934.
Baum, D. A., S. D. W. Smith, A. Yen, W. S. Alverson, R. Nyffeler, B. A. Whitlock, and R. L.
Oldham. 2004. Phylogenetic relationships of Malvatheca (Bombacoideae and Malvoideae;
Malvaceae sensu lato) as inferred from plastid DNA sequences. American Journal of
Botany 91: 1863–1871.
Bayer, C., M. F. Fay, A. Y. D. E. Bruijn, V. Savolainen, C. M. Morton, K. Kubitzki, W. S.
Alverson, et al. 1999. Support for an expanded family concept of Malvaceae within a
recircumscribed order Malvales: a combined analysis of plastid atpB and rbcL DNA
sequences. 267–303.
Bayer, C., and K. Kubitzki. 2003. Malvaceae. In K. Kubitzki and C. Bayer [eds.], Flowering
plants, dicotyledons: Malvales, Capparales, and nonbetalain Caryophyllales. 225–311.

17
 Springer-Verlag, Berlin, Germany.
Bentham, G., and D. Hooker. 1862. Malvaceae. In G. Bentham and J. D. Hooker [eds.], Genera
Plantarum. 195–213. London, England.
Burandt, C. L. 1992. A Monograph of Sida Sect. Oligandrae (Malvaceae). Systematic Botany 17:
164–179.
Catchen, J., P. A. Hohenlohe, S. Bassham, A. Amores, and W. A. Cresko. 2013. Stacks: an
analysis tool set for population genomics. Molecular Ecology 22: 3124–3140.
Catchen, J. M., A. Amores, P. Hohenlohe, W. Cresko, and J. H. Postlethwait. 2011. Stacks:
building and genotyping loci de novo from short-read sequences. G3: Genes, Genomes,
Genetics 1: 171–182.
Christenhusz, M. J. M., and J. W. Byng. 2016. The number of known plants species in the world
and its annual increase. Phytotaxa 261: 201–217.
Clement, I. D. 1957. Studies in Sida. Contributions from the Gray Herbarium of Harvard
University 180: 5–91.
Cole, D. M., and C. W. Morden. 2021. Population divergence and evolution of the Hawaiian
endemic Sesbania tomentosa (Fabaceae). Pacific Science 75: in press .
Correll, D. S. 1968. Some additions to the flora of Texas—IV. Madroño 19: 187–192.
Dray, S., and A. B. Dufour. 2007. The ade4 package: Implementing the duality diagram for
ecologists. Journal of Statistical Software 22: 1–20.
La Duke, J. C., and J. Doebley. 1995. A Chloroplast DNA Based Phylogeny of the Malvaceae.
Systematic Botany 20: 259–271.
Fernandez, A., A. Krapovickas, G. Lavia, and G. Seijo. 2003. Cromosomas de Malváceas.
Bonplandia 12: 141–145.
Fryxell, P. A. 1971. A New Genus from Mexico: Dendrosida (Malvaceae). Brittonia 23: 231–
237.
Fryxell, P. A. 1988. Malvaceae of Mexico. Systematic Botany Monographs 25: 1–522.
Fryxell, P. A. 1985. Sidus sidarum V. The North and Central American species of Sida. Sida 11:
62–91.
Fryxell, P. A. 1997. The American Genera of Malvaceae_II. Brittonia 49: 204–269.
Fuertes Aguilar, J., P. A. Fryxell, and R. K. Jansen. 2003. Phylogenetic relationships and
classification of the Sida generic alliance (Malvaceae) based on nrDNA ITS evidence.
Systematic Botany 28: 352–364.
Gower, J. C. 1971. A general coefficient of similarity and some of its properties. Biometrics 27:
857–871.
Grave, E. F. 2018. Reproductive ecology and population genetics of Hawaiian Wiliwili,
Erythrina sandwicensis (Fabaceae). Master thesis. University of Hawaii, Honolulu.

18
Handy, E. S. C., and E. G. Handy. 1991. Native Planters in Old Hawaii-Their Life, Lore, and
Environment. Bishop Museum Press, Honolulu, HI.
Huppman, E. R. H. 2013. Analysis of relationships among endemic Hawaiian Hibiscus. Doctoral
dissertation. University of Hawaii, Honolulu.
Hutchinson, J. 1967. The genera of flowering plants. Clarendon Press, Oxford, England.
Judd, W. S., and S. R. Manchester. 1997. Circumscription of Malvaceae (Malvales) as
determined by a preliminary cladistic analysis of morphological, anatomical, palynological,
and chemical characters. Brittonia 49: 384–405.
Kaaiakamanu, D. M., and J. K. Akina. 2003. Hawaiian Herbs of Medicinal Value . Pacific Book
House. Pacific Book House, Honolulu.
Karou, D., A. Savadogo, A. Canini, S. Yameogo, C. Montesano, J. Simpore, V. Colizzi, and A.
S. Traore. 2006. Antibacterial activity of alkaloids from Sida acuta. African Journal of
Biotechnology 4: 1452–1457.
Kearney, T. H. 1954. A tentative key to the North American species of Sida L. Leafl. W. Bot. 7:
138–150.
Kearney, T. H. 1949. Malvaceae: a new subtribe and genus, and new combinations. Leaflets of
Western Botany 5: 189–191.
Kearney, T. H. 1951. The American Genera of Malvaceae. American Midland Naturalist 46: 93–
131.
Kovach. 2007. Kovach Computing Services 1987-99. Multi Variate Statistical Package, V. 3.0.
Kovach Computing Services, Pentraeth, Wales.
Krapovickas, A. 2007. A Las especies de Sida secc. Malacroideae (Malvaceae) del cono sur de
Sudamérica. Bonplandia 16: 209–253.
Krapovickas, A. 2012. Novedades en las secciones Cordifoliae, Distichifolia, Malacroidea,
Muticae Y Nelavaga del género Sida (Malvaceae). Bonplandia 21: 77–92.
Krapovickas, A. 2003a. Revisión de Sida Sección Muticae C. Presl (Malvaceae-Malveae).
Bonplandia 12: 123–132.
Krapovickas, A. 2003b. Tropidococcus Krapov., nuevo género de Malváceas. Bonplandia 12:
63–66.
Krauss, B. H. 1979. Native plants used as medicine in Hawaii.
Krauss, B. H. 1993. Plants in Hawaiian. University of Hawaii Press, Honolulu, HI.
Kumar, S., G. Stecher, M. Li, C. Knyaz, and K. Tamura. 2018. MEGA X: Molecular
evolutionary genetics analysis across computing platforms. Molecular Biology and
Evolution 35: 1547–1549.
Medeiros, I. A., M. R. V Santos, N. M. S. Nascimento, and J. C. Duarte. 2006. Cardiovascular
effects of Sida cordifolia leaves extract in rats. Fitoterapia 77: 19–27.

19
Miller, M. A., W. Pfeiffer, and T. Schwartz. 2010. Creating the CIPRES Science Gateway for
inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop,
GCE 2010.
Monteiro, H. 1949. As especies argentinas, brasileiras e uruguayas da seccaoa Malvinda do
genero Sida. Lilloa 17: 501–522.
Morden, C. W., V. Caraway, and T. J. Motley. 1996. Development of a DNA library for native
Hawaiian plants. Pacific Science 50: 324–335.
Morden, C. W., D. E. Gardner, and D. A. Weniger. 2003. Phylogeny and biogeography of pacific
Rubus subgenus Idaeobatus (Rosaceae) species: Investigating the origin of the endemic
Hawaiian raspberry R. macraei. Pacific Science 57: 181–197.
Neal, M. C. 1948. In Gardens of Hawaii. Bishop Museum special publication., Honolulu, HI.
R Core Team. 2021. R: A language and environment for statistical computing. R foundation for
statistical computing. https://www.R-project.org/.
Ray, M. F. 1995. Systematics of Lavatera and Malva (Malvaceae, Malveae) — a new
perspective. Plant Systematics and Evolution 198: 29–53.
Reguero, M., F. Goin, H. C. Acosta, T. Dutra, and S. Marenssi. 2013. Late Cretaceous/Paleogene
west Antarctica terrestrial biota and its intercontinental affinities. Springer, Berlin.
Ronquist, F., M. Teslenko, P. Van Der Mark, D. L. Ayres, A. Darling, S. Höhna, B. Larget, et al.
2012. Mrbayes 3.2: Efficient bayesian phylogenetic inference and model choice across a
large model space. Systematic Biology 61: 539–542.
Schumann, K. 1890. Malvaceae. In A. Engler and K. Prantl [eds.], Die naturlichen
pflanzenfamilien. 30–53. Wilhelm Engelmann, Leipzig, Germany.
Sequencher®. 1995. Version 5.4.6 DNA sequence analysis software, Gene Codes Corporation,
Ann Arbor, MI USA http://www.genecodes.com.
Siedo, S. J. 2001. A new species of Sida sect. Ellipticifoliae (Malvaceae). Lundellia 4: 69–75.
Siedo, S. J. 1999. At taxonomic treatment of Sida Sect. Ellipticifoliae (Malvaceae). Lundellia 2:
100–127.
Siedo, S. J. 2014. Sida littoralis, a new name for a species of Sida sect. Ellipticifoliae
(Malvaceae) endemic to Florida. Phytoneuron 75: 1–5.
Singh, D. K., P. K. Singh, R. K. Pandey, and R. K. Agnihotri. 2021. Ethno botanical approaches,
pharmacological and phytochemical benefits of genus Sida used in traditional medicines.
Journal of Medical Pharmaceutical and Allied Sciences 10: 3304–3309.
Staples, G. W., and D. R. Herbst. 2005. A tropical garden flora. Bishop Museum Press,
Honolulu.
Stephens, M. L. 2000. The comparative ecophysiology of mountain and coastal populations of
Sida fallax Walp. (Malvaceae) in Hawaii. Master thesis. University of Hawaii, Honolulu.
Suyama, Y., and Y. Matsuki. 2015. MIG-seq: An effective PCR-based method for genome-wide
20
 single-nucleotide polymorphism genotyping using the next-generation sequencing platform.
Scientific Reports 5: 1–12.
Tate, J. A. 2003. Andeimalva, a New Genus of Malvaceae from Andean South America.
Lundellia 6: 10–18.
Tate, J. A., J. F. Aguilar, S. J. Wagstaff, J. C. La Duke, T. A. Bodo Slotta, and B. B. Simpson.
2005. Phylogenetic relationships within the tribe Malveae (Malvaceae, subfamily
Malvoideae) as inferred from ITS sequence data. American Journal of Botany 92: 584–602.
Tate, J. A., and B. B. Simpson. 2003. Paraphyly of Tarasa (Malvaceae) and diverse origins of
the polyploid species. Systematic Biology 28: 723–737.
Wagner, W. L., D. R. Herbst, and S. H. Sohmer. 1999. Manual of the Flowering Plants of
Hawaiʻi, revised edition. University of Hawaiʻi Press, Honolulu.
Yorkston, M., and C. C. Daehler. 2006. Interfertility between Hawaiian ecotypes of Sida fallax
(Malvaceae) and evidence of a hybrid disadvantage. International Journal of Plant Sciences
167: 221–230.

21
 Chapter 2: Phylogenetic analysis of Sida (Malvaceae) and

association with other Malveae genera

Introduction

Classification systems based on morphology are frequently revised due to the results of

molecular phylogenetic analyses. A stark example of this is the plant order Malvales, in which

sequence-based studies demonstrated that traditional families within the order were not

monophyletic (Judd and Manchester, 1997; Alverson et al., 1998, 1999; Bayer et al., 1999).

Subsequently, the families within the order were revised, resulting in a recircumscription of

Malvaceae that consists of nine groups previously recognized as families that are now

recognized as subfamilies (Bayer et al., 1999; Bayer and Kubitzki, 2003).

Malvoideae (eumalvoids or Malvaceae s.s.) is the most diverse subfamily of Malvaceae,

with approximately 1800 species in 111 genera (Fryxell, 1997; Baum et al., 2004). Bayer and

Kubitzki (2003) divided this subfamily into four tribes: Gossypieae, Hibisceae, Kydieae, and

Malveae. In a more recent study, the subfamily was split into three tribes, Gossypieae,

Hibisceae, and Malveae, which was well supported by morphological and molecular data

(Baum et al., 2004). Malveae is the largest tribe of this subfamily with c. 1040 species in c. 70

genera (Fryxell, 1997; Tate et al., 2005); Hibisceae consists of 630 species in 32 genera

(Areces-Berazain and Ackerman, 2016); and Gossypieae consists of 126 species in nine genera

(Areces-Berazain and Ackerman, 2016). Numerous classifications of the Malveae have been

proposed in the past (Table 2.1). Early researchers divided Malveae into subtribes, an approach

that lasted over a century (Bentham and Hooker, 1862; Schumann, 1890; Kearney, 1949, 1951;

Hutchinson, 1967). However, this systematic grouping was not appropriate because it was

22
Table 2.3. Historical classification systems of Malveae by various authors.

Author/s and year Classification Characters considered as Taxa and their

system base of Classification Modifications
Bentham and Hooker 1862 Tribe/subtribes Carpel arrangement, ovule Abutilinae, Malopinae,
number and position. Malvinae, and Sidinae

Schumann (1890) Tribe/subtribes Carpel arrangement and Abutilinae, Malvinae,

morphology Sidinae, Malopeae
Kearney (1949, 1951) Tribe/subtribes Carpel arrangement and Abutilinae, Malvinae,
morphology Sidinae, Malopeae and
Corynabutilinae
Hutchinson (1967) Tribe/subtribes Morphology of stigma, Abutileae (composed of
ovule number and position subtribes Abutilinae and
Sidinae), Malopeae, and
Malveae (containing
subtribes Corynabutilinae
and Malvinae)
Bates (1968) Generic Chromosome number and 13 generic alliances
alliances morphology
Bates and Blanchard (1970) Generic Chromosome number and 16 generic alliances
alliances morphology
Fryxell (1988) Generic Chromosome number and 21 generic alliances
alliances morphology
Bayer and Kubitzki (2003) Generic Chromosome number and 14 generic alliances
alliances morphology
La Duke and Doebley, 1995 Two major cpDNA phylogeny Two clades: one including
clades Abutilon and Sida alliances
and the other consisting of
the remaining Malveae
alliances.
Tate et la., (2005) Two major ITS phylogeny Two clades: one had
clades involucral bract, including
Abutilon and Sida alliances
and the second group did not
have it, including the rest of
Malveae.

23
based on taxonomically plastic morphological characters that may have resulted from

convergent evolution, for example, the number of seeds per mericarp, presence of an epicalyx,

presence of an endoglossum, and an arborescent habit (Bates, 1968; Fuertes Aguilar et al.,

2003). Moreover, generic boundaries among numerous large genera such as Abutilon,

Lavatera, Malva, and Sida were weakly defined (Fryxell, 1997). Bates (1968) revised the

classification, replacing it with a new system recognizing 13 generic alliances based on

chromosome numbers. Three more alliances were subsequently added (total 16) by Bates and

Blanchard, (1970). Fryxell (1971, 1988) altered the composition of some alliances and added

five new ones (total 21 alliances). One of the most significant modifications was the separation

of a group of 11 genera from the Abutilon alliance (Table 2.3) based on their chromosome

numbers (x=7 and 8) and mericarp morphology, creating the Sida alliance (Fryxell, 1971,

1988). Bayer and Kubitzki (2003) retained 14 of the alliances, altering their generic

compositions somewhat (Table 2.1 and Table 2.2). Other changes in the composition of these

alliances were suggested subsequently by various authors (Fernandez et al., 2003; Fuertes

Aguilar et al., 2003; Krapovickas, 2003a, b, c; Tate, 2003).

A study based on chloroplast DNA restriction sites supported the monophyly of members

of the Gossypieae and Malveae, but did not support monophyly of the Malveae alliances

(LaDuke and Doebley, 1995). Instead, that study divided Malveae into two major clades: one

consisting of the Abutilon and Sida alliances, and the other consisting of the remaining Malveae

alliances. Later, Tate et al. (2005) similarly found that analysis of the internal transcribed

spacer (ITS) region did not support monophyly of most Malveae generic alliances, but instead

revealed two main well-supported clades that were consistent with the presence or absence of

24
Table 2.4. Genera of tribe Malveae and their alliances (Fryxell, 1997; Bayer and Kubitzki, 2003, Fernandez et al.,
2003; Fuertes Aguilar et al., 2003; Krapovickas, 2003a, b, c; Tate, 2003).

Alliances Genera

Abutilon Abutilon, Akrosida, Allosidastrum, Allowissadula, Bastardia, Bastardiastum,

Bastardiopsis, Billieturnera, Corynabutilon, Dendrosida, Herissantia, Hochreutinera,
Krapovickasia, Malvella, Meximalva, Neobaclea, Pseudabutilon, Rhynchosida,
Robinsonella, Sida, Sidastrum, Tetrasida, Wissadula,

Anisodontea Anisodontea

Anoda Anoda, Periptera

Batesimalva Bakeridesia, Batesimalva, Briquetia, Dirhamphis, Fryxellia, Horsfordia

Gaya Cristaria, Gaya, Lecanophora

Kearnemalvastrum Kearnemalvastrum

Malacothamnus Iliamna, Malacothamnus, Neobrittonia, Phymosia,

Malope Kitaibelia, Malope

Malva Alcea, Althaea, Lavatera, Malva, Navaea

Malvastrum Malvastrum

Modiola Modiola, Modiolastrum, Tropidococcus

Plagianthus Asterotrichion, Gynatrix, Hoheria, Lawrencia, Plagianthus

Sidalcea Callirhoe, Sidalcea

Sphaeralcea Acaulimalva, Andeimalva, Calyculogygas, Calyptraemalva, Eremalche, Fuertesimalva,

Monteiroa, Napaea, Nototriche, Palaua, Sidasodes, Sphaeralcea, Tarasa, Urocarpidium

25
Table 2.3. Genera of Abutilon alliance (Malveae, Malvaceae), with their reported chromosome numbers and
geographic distributions (Fryxell, 1997; Bayer and Kubitzki, 2003; Fuertes Aguilar et al., 2003; Tate, 2003).
Genus Haploid Chromosome number Distribution

Abutilon Mill. n=7, 8, 14, 16, 18, 21, 36 Pantropical

Akrosida Fryxell and Fuertes n=7 Brazil

Allosidastrum (Hochr.) Krapov., Fryxell n=7 Neotropics

and D.M. Bates

Allowissadula D.M. Bates n=8 Texas, Mexico

Bastardia H.B.K. n=7, 14 Neotropics

Bastardiastrum (Rose) D.M. Bates n=15 W Mexico

Bastardiopsis (K. Schum.) Hassl. n=14 S America

Billieturnera Fryxell n=8 S Texas to NE Mexico

Corynabutilon (K. Schum.) Kearney n=8 Temperate Chile and Argentina

Dendrosida Fryxell n=21 Colombia, Venezuela

Herissantia Medik n=6, 7 Neotropics

Hochreutinera Krapov. n=7 Mexico, Paraguay, Argentina

Krapovickasia Fryxell n=8 SW Texas, NE Mexico, S America

Malvella Jaub. and Spach n=11, 16 W USA, Mexico, S America, Mediterranean

Meximalva Fryxell n=8 S Texas to central Mexico

Neobaclea Hochr n=8 Temperate Argentina

Pseudabutilon R.E. Fr. n=8, 16 USA to Argentina

Rhynchosida Fryxell n=8 S Texas, N Mexico, Bolivia, Argentina

Robinsonella Rose and Baker f. n=16 Mexico to Costa Rica

Sida L. n=6, 7, 8, 14, 16, 17, 21, 28 Pantropical

Sidastrum Baker f. n=16 Mexico, West Indies to Argentina

Tetrasida Ulbr. n=? Ecuador and Peru

Wissadula Medik. n=7 Neotropics

26
 an epicalyx. Two clades identified by Tate et al. (2005) was consistent with the two clades from

La Duke and Doebley (1995). Other studies have consistently demonstrated that some genera

of Malveae are not monophyletic and require taxonomic revision, including Malva and

Lavatera (Ray, 1995), Tarasa (Tate and Simpson, 2003), Illamna, Wissadula, and Tetrasida

(Tate et al., 2005), and Abutilon and Sida (Fuertes Aguilar et al., 2003).

Sida as currently circumscribed is a complex genus of between 100 (Fryxell, 1997) and

150 species (Wagner et al., 1999). The species of Sida are mainly distributed in the tropics and

subtropics throughout the world with two-thirds of the species restricted to North and South

America (Fryxell, 1997). Sida has long been considered as a heterogeneous assemblage and a

repository for many taxa that were difficult to identify (Fryxell, 1985), and therefore Fryxell

(1997) established several new genera: Akrosida, Allosidastrum, Billieturnera, Dendrosida,

Krapovickasia, Malvella, Rhynchosida, Sidasodes, and Sidastrum. However, phylogenetic

studies that included only a limited number of Sida species suggested that this genus is not

monophyletic. (Fuertes Aguilar et al., 2003; Tate et al., 2005).

Sectional classifications of Sida have been problematic. Numerous early studies (Baker,

1892; Monteiro, 1949; Kearney, 1951, 1954; Clement, 1957; Hutchinson, 1967) produced very

complex classifications based on elements of three or more genera, or omitted many of the Sida

species from consideration (Fryxell, 1985). Fryxell (1985, 1988) conducted a comprehensive

study and split Sida into 11 sections (Table 2.4.). This classification was subsequently modified

and new species were added to these sections (Burandt, 1992; Baker, 1998; Siedo, 1999, 2001,

2014; Krapovickas, 2003a, b, 2007, 2012). Molecular examination of the Sida sections has

demonstrated that many of them (Cordifoliae, Ellipticifoliae, Muticae, Sidae, Spinosae,

27
Table 2.4. Sections of Sida species (Fryxell, 1985, 1987, 1988; Burandt, 1992; Baker, 1998; Siedo, 2001, 2014, 1999; Fuertes Aguilar et al., 2003; Krapovickas,
2003a, b, 2007, 2012).
Name of section Number of Distribution Base Members of each section
species in each chromosome
section number
Stenindae Griesbach 2 pantropical x=7 S. linifoli, S. hassleri
Oligandrae Clement 5 W South America x=8 S. palmata, S. oligandra, S. decandra, S. jatrophoides, S. patuliloba
Pseudo-Napaeae A. 1 temperate N x=7 S. hermaphrodita
Gray America
Hookeriana Clement 2 E Africa and W x=7 S. hookeriana, S. ternata
Australia
Nelavagae Borssum- c. 20 pantropical x=8 S. elongata, S. mysorensi, S.dictyocarpa, S.caudata, S. jussieana, S.
Waalkes repen, S. cordata, S. urens, S. glabra, S. xavieri, S. nesogena, S.
alamosana, S. anodifolia, S. michoacana, S. monticola, S. japiana, S.
Lilianae, S. glutinosa, S. martiana
Spinosae Small c. 30 pantropical x=7 S. nummularia, S. abutifolia, S. jamaicensis, S. glomerata, S. viarum, S.
spinosa, S. fastuosa, S. parvifolia, S. odorata
Muticae C. Presl 7 neotropical x=7 S. aggregate, S. salzmannii, S. ulei, S. pires-Blackii, S. coradinii, S.
gertiana, S. vallsii, S. cabraliana, S. rhizomatosa, S. sucupirana
Cordifoliae (DC.) c. 30 pantropical x=7 S. xanti, S. barclayi, S. tragiifolia, S. hyalina, S. maculate, S.cordifolia, S.
Fryxell salviifolia, S. prolifica, S. rohlenae, S. atherophora, S. magnifica, S.
chiquitana, S. angustissima, S. cerradoensis
Malachroideae G. c. 30 pantropical x=8 S. anomala, S. centuriata, S. surumuensis, S. paradoxa, S. plumosa S.
Don cuneifolia, S. brachystemon, S. brittonii, S. ciliaris, S. cavernicola, S.
glocimari, S. bordasiana, S. castanocarpa, S. caulorrhiza, S.
cristobaliana, S. dureana, S. ferrucciana, S. harleyi, S. pedersenii, S.
simpsonii, S. albiflora, S. Monteiroi, S. meridiana
Ellipticifoliae Fryxell 9 N America x=7 S. rzedowskii, S. longipes, S. potosina, S. lindheimeri, S. inflexa, S.
turneroides, S. neomexicana, S. elliottii, Sida littoralis
Sidae L. c. 20 pantropical x=7 S. dregei, S. glaziovii, S. szechuensis, S. fallax, S. acuta, S. collina, S.
haenkeana, S. setosa, S. antillensis, S. troyana, S. santaremensis, S.
rhombifolia, S. subcordata, S. poeppigiana, S. urosepala

28
Stenidae) are not monophyletic (Fuertes Aguilar et al., 2003). However, these sections, although

not individually monophyletic, formed a well-supported clade (the “Sida core”). This clade also

contains the type species, Sida rhombifolia L. (Fuertes Aguilar et al., 2003). Nonetheless,

taxonomic sampling for that study was limited and included 56 species and 25 genera, of which

only 32 species were Sida and 24 species were from other Malveae genera. The study by Fuertes

Aguilar et al (2003) also was based solely on the internal transcribed spacer (ITS) region.

Species in the Sida core shared several traits in addition to the common base chromosome

number of x=7. Shared morphological traits are costate calyces, lack of an epicalyx, ovate to

elliptical entire leaves, 5-fasciated staminal columns, and mericarps less than 5 mm high that are

indurate, and concave dorsally, and have an upper portion specialized for dehiscence and

dispersal. It is noteworthy that Dendrosida, a segregate genus based on its arborescent habit,

flower structure and mericarp size (Fryxell, 1971), was also placed within this clade. Species in

section Nelavagae (x=8) formed a monophyletic clade that is sister to the Sida core and together

they form a well-supported clade (Fuertes Aguilar et al., 2003). However, Fuertes Aguilar et al.

(2003) did not consider this section as within Sida because of chromosome number differences.

Fryxellia pygmaea (originally described as Anoda pygmaea (Correll, 1968), was recognized by

Bates (1974) as a distinct monotypic genus with x=8 chromosomes and was later supported as

the sister taxon to the Sida core/section Nelavagae clade (Tate et al., 2005). In contrast, species

in other sections of Sida were not associated with the Sida core. Species placed in sections

Malachroideae, Oligandrae, Pseudo-Napaea and Hookeriana, and the Australian Sida species

were more closely related to other Malveae genera and clades (Fuertes Aguilar et al., 2003).

The relationships among Sida species and associated genera are complex and warrant

further investigation. In this study, a phylogenetic analysis was conducted that included an

29
extensive sampling of Sida species and most Malveae genera. There were four objectives to this

study. First, to characterize the relationships among Sida species; second, to determine their

relationship to other Malveae genera; third, to examine how these associations compare to the

sectional classification; and fourth, to investigate the biogeography of species within Sida. To

investigate these questions, phylogenetic analyses based on nuclear (ITS) and chloroplast DNA

(psbA–trnH, rpl16, ndhF and matK) markers were performed.

Materials and Methods

Taxon Sampling

Specimens were obtained from fresh collected samples and herbarium specimens. Sida

fallax was collected in the Hawaiian Islands and DNA was extracted from fresh material. The B.

P. Bishop Museum (BISH) and Joseph F. Rock (HAW) herbaria were visited to select specimens

for destructive sampling of other species from Hawaiian Islands and other parts of the Pacific.

Requests were sent for dried leaf samples to herbaria worldwide to assist in gathering collections

of Sida from other regions of the world. Samples were received from the following herbaria:

Allan Herbarium (CHR) in New Zealand, Arizona State University Vascular Plant Herbarium

(ASU), the Missouri Botanical Garden herbarium (MO), and the United States National

Herbarium (US). Material of 48 species of Sida were obtained from herbaria for analysis (Table

2. 5.). Sequence data for additional Sida species and other

30
Table 2.5. Representative Malveae and outgroup species used in phylogenetic analyses. Sequence accession numbers in GenBank, and locality (if available) are
provided. Voucher ID, and Hawaiʻi Plant DNA Library accession number (HPDL) are provided for species sequenced in this study.

Taxon Voucher ID HPDL ITS ndhF psbA–trnH rpl16 matK Origin

Abutilon indicum (L.) — — KT779103.1 KX099891.1 KP095692.1 KX984276.1 MN553681.1 —

Sweet

Abutilon theophrasti — — KT779105.1 — MH197410.1 — MH265201.1 —

Medik.

Alcea_rosea L. — — AH010172.2 EU346847.1 KU198270.1 — MG946949.1 —

Allosidastrum — — AJ274965/ — HG963758.1 — JQ588217.1 —

pyramidatum (Cav.)
AJ274996
Krapov., Fryxell and D. M.

Bates

Allowissadula holosericea — — AJ274963/ — — — — —

(Scheele) Bates
AJ274993

Anoda crenatiflora Orteg. — — AJ251042/ — — — — —

AJ274987

31
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Asterotrichion discolor — — AY591811.1 — — — GU045813.1 —

(Hook.) Melville

Bakeridesia macrantha — — JQ753297.1 — — — — —

(A.St. Hil.) Leite and

H.C.Monteiro

Bastardia bivalvis (Cav.) — — KT966958.1 KT967034.1 — KT967072.1 KT966996.1 —

Kunth

Bastardiastrum cinctum — — AY591814.1 — — — — —

(Brandegee) D.M.Bates

Bastardiopsis densiflora — — AY591815.1 — — — — —

(Hook. and Arn.) Hassl.

Batesimalva violacea — — AY591816.1 — — — — —

(Rose) Fryxell

Billieturnera helleri (Rose — — AY591817.1 FJ204742.1 — FJ204758.1 FJ204699.1 —

and Heller) Fryxell

Briquetia denudata (Nees — — MF948736.1 — — MF948804.1 — —

and Mart.) Chodat

32
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Briquetia spicata (Kunth) — — — — — — JQ588218.1 —

Fryxell

Briquetiastrum spicatum — — MF948737.1 — — — — —

(Kunth) Bovini

Callianthe regnellii (Miq.) — — MF948713.1 — — MF948784.1 — —

Donnell

Callirhoe involucrata — — AJ251166/ MF350025.1 MF348655.1 JF799583.1 MF350025.1 United States of

(Torrey and A. Gray) A. America

AJ251173
Gray

Corynabutilon — — MH781184.1 — — — — —

ceratocarpum (Hook. and

Arn.) Kearney

Cristaria andicola Gay — — AY372999.1 MK728866.1 AY371670.1 MN120551.1 MN129842.1 —

Cristaria_gracilis Gay — — AY373003.1 MN129841.1 AY371676.1 MN120550.1 MK728865.1 —

Dendrosida breedlovei — — AJ251032/ — — — — Mexico

Fryxell
AJ274976

33
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Dendrosida sharpiana — — AJ251031/ — — — — Mexico

(Miranda) Fryxell subsp.

AJ274975
pubescens Fryxell in edit.

Dendrosida wingfieldii — — AJ251033/ — — — — Venezuela

Fryxell
AJ274977

Fryxellia pygmaea — — AY591824.1 — — — — —

(Correll) D.M.Bates

Gaya atiquipana Krapov. — — AY591825.1 FJ204748.1 — FJ204766.1 FJ204706.1 —

Gynatrix pulchella (Willd.) — — AY591826.1 — — — GU045814.1 —

Alef.

Herissantia crispa (L.) — — MH768227.1 — HG963846.1 MF948800.1 MH767931.1 —

Brizicky

Hibiscus clayi O. Deg. and — — AY962408.1 KX984268.1 EF694836.1 KX984272.1 MT250692.1 —

I. Deg.

Hoheria angustifolia Raoul — — AY944585.1 FJ204722.1 — FJ204757.1 AY944608.1 —

Horsfordia exalata Fryxell — — AY591831.1 FJ204747.1 — FJ204767.1 FJ204707.1 —

34
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Krapovickasia physaloides — — AJ251047/ — — — — United states of

(C. Presl) Fryxell America

AJ274991

Lawrencia glomerata — — AY591835.1 — — — GU045815.1 —

Hook.

Lawrencia spicata Hook. — — AY591836.1 — — — GU045817.1 —

Lecanophora chubutensis — — AY591837.1 FJ204744.1 — FJ204769.1 FJ204709.1 —

(Speg.) Rodrigo

Lecanophora heterophylla — — AY373010.1 MK728845.1 AY371673.1 MN120530.1 — —

(Cav.) Krapov.

Malva alcea L. — — EF419493.1 EU346840.1 GQ248337.1 — GQ248154.2 —

Malvastrum — — MH050249.1 FJ204741.1 — FJ204787.1 KX518647.1 —

coromandelianum (L.)

Garcke

Malvella sherardiana (L.) — — EF419546.1 — EF419663.1 — EU346806.1 —

Jaub. and Spach

Meximalva filipes (A. — — AJ251039/ — — — — Mexico

Gray) Fryxell
AJ274983

35
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Periptera punicea (Lag.) — — DQ826562.1 FJ204751.1 — FJ204786.1 FJ204715.1 —

DC.

Plagianthus divaricatus — — AY944606.1 — — — AY944629.1 —

J.R.Forst. and G.Forst.

Plagianthus regius (Poit.) — — AY944607.1 FJ204723.1 — FJ204759.1 AY944630.1 —

Hochr.

Pseudabutilon umbellatum — — AJ274995.1/ — — — — Venezuela

(L.) Fryxell AJ274964.1

Pseudabutilon virgatum — — MF948739.1 — — MF948806.1 — —

(Cav.) Fryxell

Rhynchosida physocalyx — — AJ251046.1/ — — — — Mexico

(A. Gray) Fryxell AJ274990.1

Robinsonella lindeniana — — — FJ204750.1 — FJ204774.1 FJ204711.1 —

(Turcz.) Rose and Baker f.

Robinsonella Rose and — — AY591851.1 — — — — —

Baker f. sp.

36
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sida abutifolia Mill. — — AJ274961/ — — — — Colombia

AJ251617

Sida acuta Burm.f. Imada 99– 8317 — OM751917 ON098151 ON365810 — Hawaiʻi, HI,

35 (BISH) USA

Sida acuta Burm.f. — — OM639974.1 — — — MH767934.1

Sida aggregata C. Presl — — AJ274943/ — — — — Venezuela

AJ251599

Sida alamosana S. Watson Van 12694 OM752105 OM751902 OM718733 OM718835 OM938055 Mexico

Devender

98–1297

(ASU)

Sida albiflora (Chodat and Krapovickas 10870 OM752097 — OM718731 — — Paraguay

Hassl.) Krapov. 45657 (MO)

Sida alnifolia L. — — KM073065.1 — MG601504.1 — MH767937.1 South and

Southeast Asia

Sida angustissima A. St. — — AJ274950/ — — — — Brazil

Hil. AJ251606

37
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sida argentina K. Schum. Seijo 3397 12706 OM752110 OM751914 OM718748 OM718849 OM938067 Bolivia

(ASU)

Sida bakeriana Rusby ex Abbott 10872 OM752120 — OM718745 — — Bolivia

Baker f. 16066 (MO)

Sida barclayi Baker f. González 10871 OM752116 — OM718739 — OM938076 Nicaragua

5657 (MO)

Sida carpinifolia L.f. Sykes 12689 OM752132 OM751908 OM718755 — — Norfolk Island

Norfolk/493

(CHR)

Sida cerradoensis Krapov. — — AJ274951/ — — — — Brazil

AJ251607

Sida chinensis Retz. — — MH768232.1 — — — MH767936.1 China

Sida chrysantha Ulbr. Rugheimer 10878 OM752108 OM751924 OM718753 OM718850 OM938066 Namibia

and Burke

3613 (US)

Sida ciliaris L. H20712 8314 — OM751896 OM718730 OM718831 OM938042 Molokaʻi, HI,

(BISH) USA

38
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sida ciliaris L. — — AJ251044.1/ — — — — Venezuela

AJ274988.1

Sida cordata (Burm.f.) — — MH768235.1 — MG601502.1 — MH767938.1 South and

Borss.Waalk. Southeast Asia

Sida cordifolia L. Flynn 7495 8315 — OM751911 — ON365808 — Kauaʻi, HI,

(BISH) USA

Sida cordifolia L. — — MN106540.1 — KX779064.1 — MH767941.1 —

Sida cuspidata (A.Robyns) Rueda 10868 OM752107 OM751923 OM718735 OM718845 OM938070 Nicaragua

Krapov. 18919 (MO)

Sida dureana Krapov. Solis Neffa 10867 OM752098 — OM718732 — OM938044 Bolivia

1297 (MO)

Sida elliottii Torr. and Yatskievych 10866 OM752122 — — — — United States

A.Gray 10–44 (MO)

Sida elliottii Torr. and — — — — MH622088.1 — MH621712.1 United States

A.Gray

Sida emilei Hochr. Seijo 3315 10865 OM752102 OM751905 OM718734 OM718838 OM938051 Bolivia

(MO)

39
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sida fallax Walp. Pejhanmehr 8278 OM752126 OM751918 OM718765 OM718852 OM938058 Oʻahu, HI,

101 (HAW) USA

Sida galheirensis Ulbr. Hatschbach 12705 OM752114 — OM718738 OM938073 OM938073 Brazil

78768

(ASU)

Sida glabra Mill. — — AJ251035/ — — — — Colombia

AJ274979

Sida glomerata Cav. — — AJ274956/ — — — — Venezuela

AJ251612

Sida glutinosa Cav. — — AJ251037/ — — — — Colombia

AJ274981

Sida gracilipes Rusby Parada- 10863 OM752112 OM751912 OM718741 OM718842 OM938071 Bolivia

Gutierrez

5254 (MO)

Sida gracillima Hassler Stevens 10862 OM752103 OM751906 OM718751 OM718839 OM938052 Paraguay

31291 (MO)

40
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sida haenkeana C.Presl Gracia 124 12708 OM752127 OM751915 OM718763 OM718856 OM938060 Mexico

(ASU)

Sida hassleri Hochr. Stevens 10861 — — OM718744 — — Paraguay

31140 (MO)

Sida hassleri Hochr. — — AJ274958.1/ — — — — Paraguay

AJ251616.1

Sida hermaphrodita (L.) Roberts 12710 OM752134 OM751899 OM718727 OM718832 OM938045 United States of

Rusby (synonym of 4177 (ASU) America

Ripariosida hermaphrodita

(L.) Weakley and

D.B.Poind.)

Sida hookeriana Miquel ex — — AJ274967/ — AF384624.1 — — Australia,

Lehmann Western
AJ274998
Australia

Sida hyalina Fryxell Felger 12711 OM752111 OM751913 OM718754 OM718841 OM938075 Mexico

20151028–8

(ASU)

41
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sida inflexa Fernald Fernald and 10876 OM752109 OM751909 OM718743 OM718847 OM938049 United States

Long 13689

(US)

Sida jamaicensis L. Stevens 10859 OM752118 OM751922 OM718736 OM718848 OM938069 Nicaragua

32187 (MO)

Sida jussieana DC — — AJ251036/ — — — — Venezuela

AJ274980

Sida linifolia L. — — AJ274959/ — — — JQ588268.1 Mexico

AJ251613

Sida longipes A. Gray — — AJ251030/AJ — — — — Mexico

274974

Sida martiana A. St.-Hil. — — AJ251038/ — — — JQ588272.1 Colombia

AJ274982

Sida microphylla Cav. Sohmer 12688 OM752133 — OM718756 — OM938059 Sri Lanka

(Synonym of Sida alnifolia 8551 (BISH)

var. microphylla (Cav.)

S.Y. Hu and Sida

42
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

rhombifolia var.

microphylla (Cav.) Mast.)

Sida monteiroi Krapov. Krapovickas 10850 OM752100 — OM718747 OM718830 — Argentina

47766

(ASU)

Sida mysorensis Wight and — — KM073066.1 — KM073070.1 — — India

Arn.

Sida neomexicana A. Gray — — AJ274948/ — — — — Mexico

AJ251604

Sida odorata Monteiro — — AJ274960 — — — — Brazil

Sida oligandra K.Schum. FLSP 961 10858 OM752136 — OM718724 — OM938047 Peru

(MO)

Sida palmata Cav. Estela s.n. 10857 OM752137 OM751907 OM718725 OM718844 OM938048 Peru

(MO)

Sida paradoxa Rodrigo Schinini 12693 OM752101 OM751895 OM718728 OM718829 OM938041 Argentina

36224

(ASU)

43
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sida parvifolia DC. Rakotonand 10881 OM752125 — OM718758 — OM938057 Madagascar

rasana 1169

(US)

Sida poeppigiana Terán 10856 OM752131 — OM718762 — OM938064 Bolivia

(K.Schum.) Fryxell Aguilar

2750 (MO)

Sida pusilla Cav. — — KX689346.1 — — — — Australia

Sida repens Cav. Stevens 10855 OM752104 OM751901 OM718752 OM718834 OM938054 Nicaragua

33859 (MO)

Sida rhizomatosa Krapov. Keller 12709 OM752123 OM751919 OM718760 OM718851 OM938063 Argentina

10962

(ASU)

Sida rhombifolia L. Herbst 2340 8233 — OM751921 ON098151 ON365811 — Kauaʻi, HI.

(BISH) USA

Sida rhombifolia L. — — OM639975.1 — — JQ588281.1

44
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sida rodrigoi Monteiro Krapovickas 12698 OM752121 — OM718746 OM718855 OM938061 Argentina

46703

(ASU)

Sida salviifolia C.Presl Acevedo- 10879 OM752119 OM751925 OM718737 OM718846 OM938068 Puerto Rico

Rodriguez

15354 (US)

Sida salzmannii Monteiro — — AJ274943/ — — — — Brazil

AJ251600

Sida samoensis Rech. Sykey 12690 OM752130 OM751898 OM718757 OM718853 OM938056 Niue

1609/N

(CHR)

Sida santarimensis Schinini 12692 OM752124 OM751920 OM718761 OM718857 OM938065 Argentina

Monteiro 35396

(ASU)

Sida schumanniana Padilla 4055 10854 OM752106 OM751904 OM718749 OM718836 OM938053 Bolivia

Krapov. (MO)

45
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sida setosa Mart. ex Colla Landrum 12695 OM752128 — OM718759 — — Ecuador

10851

(ASU)

Sida spinosa L. Herbst 5505 8316 — — — ON365809 — Oʻahu, HI,

(BISH) USA

Sida spinosa L. — — KY645507.1 OM751926 DQ006201.1 — MK290567.1

Sida szechuensis Matsuda — — KX779091.1 — — — — China

Sida tenuicarpa Vollesen Simon 711 10880 OM752099 OM751897 OM718729 OM718828 OM938043 Tanzania,

(US) United

Republic of

Sida ternata L. f. Luke 16176 10873 OM752135 OM751900 OM718726 OM718833 OM938046 Tanzania,

(MO) United

Republic of

Sida tobatiensis Ulbr. Lewis 35133 10874 OM752129 OM751916 OM718764 OM718854 OM938062 Bolivia

(MO)

Sida tragiifolia A. Gray Mays s.n. 12712 OM752117 OM751910 OM718742 OM718843 OM938074 United States of

(ASU) America

46
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sida turneroides Standley — — AJ274947/ — — — — Mexico

AJ251603

Sida ulei Ulbr. Hatschbach 12697 OM752115 — — — — Brazil

71288

(ASU)

Sida urens L. H100521 8318 — OM751903 OM718750 OM718837 OM938050 Maui, HI, USA

(BISH)

Sida urens L. — — AJ251034.1/ — — — — Venezuela

AJ274978.1

Sida urosepala R. E. Fries — — AJ274955/ — — — — Brazil

AJ251611

Sida variegata (Griseb.) Solis Neffa 12696 OM752113 — OM718740 OM718840 OM938072 Argentina

Krapov. 599 (ASU)

Sida xanti A. Gray — — AJ274946/ — — — — Mexico

AJ251602

Sida ulmifolia Cav. — — MW364816.1 — MH622090.1 — MH621755.1 United States of

America

47
Table 2.5. (Continued) Representative Malveae and outgroup species used in phylogenetic analyses.

Sidalcea campestris — — AF196549.1 — — JQ217477.1 — —

Greene

Sidasodes colombiana — — AJ274969/ — — — — Colombia

Fryxell and Fuertes

AJ275000

Sidastrum paniculatum (L.) — — AJ251040/ — — — — Colombia

Fryxell
AJ274984

Sphaeralcea cordobensis — — AY172194.1 FJ204732.1 AY184298.1 FJ204775.1 AY213101.1 —

Krapov.

Tarasa trisecta (Griseb.) — — AY172236.1 FJ204738.1 AY184333.1 FJ204781.1 AY213136.1 —

Krapov.

Tetrasida weberbaueri — — AY591855.1 FJ204749.1 — FJ204782.1 FJ204712.1 —

(Ulbr.) Fryxell and Fuertes

Wissadula periplocifolia — — AY591858.1 FJ204717.1 — FJ204784.1 FJ204713.1 —

(L.) C.Presl ex Thwaites

48
representatives of Malveae were obtained from GenBank (Tables 2.5.). In addition, ITS and

plastid sequences for nine Australian Sida species (S. arsiniata R. M. Barker, S. cardiophylla E.

Pritz., S. clementii Domin, S. echinocarpa F. Muell., S. ectogama W. R. Barker and R. M.

Barker, Sida fibulifera Lindl., Sida platycalyx F. Muell. ex Benth., S. rohlenae Domin, S.

trichopoda F. Muell.) and Pseudabutilon thurberi (A. Gray) Fryxell were obtained from Todd

MacClay (Royal Botanic Gardens Victoria). Sequences of Lawrencia densiflora (Baker f.)

Melville were obtained from Jennifer Tate (Massey University, New Zealand). In total, 139

species representing 82 Sida species and 57 species in 44 other Malveae genera were examined.

These genera represented nine of the 14 alliances of Malveae (Table 2.2.) (Bayer and Kubitzki,

2003). At least two representative species from each of the 11 Sida sections (Table 2.4.) (Fryxell,

1985, 1988) were included in this study. Hibisceae is closely related to the Malveae within the

Malvoideae, and Hibiscus clayi O. Deg and I. Deg from this tribe was obtained for outgroup

comparison. Vouchers of Sida fallax were deposited in the Joseph F. Rock Herbarium (HAW) at

the University of Hawaiʻi at Mānoa.

DNA Extraction, Marker Selection, Amplification and Sequencing

Total genomic DNA was extracted using a modified CTAB method described by Morden

et al. (1996) and deposited in the Hawaiian Plant DNA Library (HPDL) at the University of

Hawaiʻi at Mānoa (UHM). One noncoding nuclear DNA region (internal transcribed spacer,

ITS), and one noncoding (psbA–trnH intergenic spacer) and three coding (rpl16, ndhF, matK)

chloroplast DNA regions were selected for amplification and sequencing. These regions have

been previously used in studies involving members of Malveae and shown to be highly valuable

for phylogenetic inference at the species level in Malvoideae (Pfeil et al., 2002; Fuertes Aguilar

et al., 2003; Small, 2004; Tate et al., 2005; Koopman and Baum, 2008; Escobar García et al.,

49
2009; Schneider et al., 2011; Tate, 2011). Polymerase Chain Reaction (PCR) was performed in

20 µl reaction mixtures containing H2O, 1× (1.5 mM MgCl) GoTaq G2 PCR buffer, 0.1% BSA,

0.2 mM each dNTP, 0.2 mM each amplification primer (Table 2.6.), 0.025 U GoTaq G2

polymerase (Promega, Madison, Wisconsin), and 20–100ng template DNA.

For both nuclear and chloroplast markers, amplification was initiated by a denaturation of

95ºC for 2 minutes, followed by 30 cycles of 95ºC for 1 minute; 55ºC for 1 minute; 72ºC for 2

minutes, and a final extension at 72ºC for 3 minutes. Negative control reactions were run for all

PCR amplifications to ensure reaction components were uncontaminated. All PCR products were

visualized on 2% agarose gel to check for amplification. PCR products were then cleaned using

exoSAP-IT (Affymetrix, Cleveland, Ohio) following manufacturer recommendations.

Primer extension sequencing was performed by GENEWIZ, LLC (South Plainfield, NJ)

or at the University of Hawaiʻi Advanced Studies in Genomics, Proteomics and Bioinformatics

(ASGPB) sequencing facility. Forward and reverse sequences were assembled into contigs and

edited using Sequencher (Gene Codes Corporation, 1995).

Sequence Alignment and Phylogenetic Analyses

The sequences were aligned using MEGA-X v.10.0.5 (Kumar et al., 2018) and visually

adjusted as needed. For the internal transcribed spacer (ITS) region, the highly conserved 5.8S

was not available for all sequences and was omitted from phylogenetic analyses. All gene

regions were first aligned individually and then concatenated to be subsequently analyzed as

nuclear, chloroplast, and combined data sets in Geneious v10.2.2 (Biomatters, Auckland, NZ).

50
Table 2.6. List of sequence primers with references used for phylogenetic analysis.

Gene Region Genome origin, type of DNA Primer Name, Sequence (5'–3') and reference References

ITS Nuclear, transcribed spacer region ITS2: GCT GCG TTC TTC ATC GAT GC White et al., 1990

ITS3: GCA TCG ATG AAG AAC GCA GC

ITS4: TCC TCC GCT TAT TGA TAT GC

ITS5: GGA AGT AAA AGT CGT AAC AAG G

ndhF Chloroplast, coding 972F: GTCTCAATTGGGTTATATGATG Olmstead et al., 1993

10R: CCCCCTATATATTTGATACCTTCTCC

trnH–psbA Chloroplast, intergenic spacer trnH–f: CGCGCATGGTGGATTCACAAATC Dong et al., 2012

psbA–r: TGCATGGTTCCTTGGTAACTTC

rpl16 Chloroplast, coding rpL16F71: GCT ATG CTT AGT GTG TGA CTC GTT Cronn et al., 2002

rpL16R1516: CCC TGC ATT CTT CCT CTA TGT TG

matK Chloroplast, coding matK–4F: CTT CGC TAC CGG GTG AAA GAT G Nyffeler et al., 2005

matK–P10R: CAA ATA CCA AAT TCG TCC CCT A

trnK–P3F: TTC AAA GTT GGG TCG AGT GA

matK–P6R: AAG ACT CCA GAA GAT GTT GAT CG

51
Bayesian phylogenetic analyses were conducted using the CIPRES Science Gateway (Miller et

al., 2010). BI analyses were performed in MrBayes 3.2.7 (Ronquist et al., 2012) and the

GTR+I+G model was selected as the model of nucleotide substitution for the combined dataset

based on Abadi et al. (2019) by setting the number of substitution types to “mixed.” The analysis

was performed for two runs of four MCMC chains for 10 million generations and trees were

sampled every 1000 generations. The initial 25% of the trees were discarded as burn-in and a

50% majority-rule consensus tree was constructed from the post-burn-in trees. The program

Tracer 1.6.0 (Rambaut et al., 2014) was used to confirm that all MCMC outputs reached

stationarity and converged on the same distribution.

Results

Sequence characteristics

ITS and plastid sequences were generated for 51 individuals of Malveae, representing 48

Sida species and three other Malveae genera (Table 2.5.). ITS and psbA–trnH intron sequences

were generated for all 48 Sida species. However, new intron sequences were generated for only

36 individuals for matK, 35 individuals for rpl16, and 32 individuals for ndhF because of

degradation of the herbarium specimens. Sequence characteristics for the ITS and plastid

datasets are summarized in Table 2.7. The ITS region had the shortest aligned length (647 bp)

and the matK region had the longest aligned length (2425) bp. The highest number of parsimony

informative characters were found in the matK region (605), and the fewest parsimony

informative characters were found in the ndhF region (146). Likewise, the matK region had the

highest number of variable sites (1007) and the ndhF region

52
Table 2.7. Sequence characteristics of Sida and Malveae specimens included in the study.

Region Aligned length Variable sites No. parsimony informative Model of

[bp] characters evolution

ITS 647 520 425 GTR+I+G

psbA–trnH 1231 825 452 GTR+I+G

rpl16 1618 569 298 GTR+I+G

ndhF 1105 287 146 GTR+I+G

matK 2425 1007 605 GTR+I+G

53
the lowest number (287). Sida acuta had the longest ITS region insertion (10 bp) among the

Malveae species sequenced. The psbA–trnH and rpl16 regions had a large number of insertions

and deletions in their sequences, nearly all of them being small and confined to one or a few

species.

Phylogenetic Analysis

The combined-gene phylogenetic analysis of all Malveae species resulted in an initial

trichotomy separating two clades and the species Sidasodes colombiana (Figure 2.1). The first

clade included Sida terneta, S. hookeriana, Ripariosida hermaphrodita, and representatives of

the five Plagianthus alliance genera (Asterotrichion discolor, Gynatrix pulchella, Hoheria

angustifolia, two species of Plagianthus, and three species of Lawrencia) (Table 2.2). The

second clade consisted of the remainder of the Malveae genera. The Plagianthus alliance is the

terminal segment of a clade with species of Sida and Ripariosida. The Malva alliance is

represented by only two species that are sister to each other. The Malvastrum alliance is also

present, but is represented by only one species. Six other alliances are largely polyphyletic:

Anoda, Batesimalva, Gaya, Sphaeralcea, Sidalcea, and the large Abutilon alliance.

Sida as currently circumscribed is polyphyletic. There are five clades that include Sida

species (Figure 2.1). Four of these are small with two to eight species included. Sida section

Hookeriana (Clade 1) is sister to the Plagianthus alliance. Clade 2 consists of Section

Oligandrae (two species) that is sister to the large clade that includes mostly members of the

Abutilon alliance. Two closely related clades include eight Australian species (Clade 4) and

species of Sida section Malachroideae (Clade 5).

The majority of Sida species formed a monophyletic clade (Clade 3, the “main Sida

clade”). This study placed 66 species of Sida in the main Sida clade (Figure 2.2). Fryxellia

54
 Plagianthus Alliance
Plagianthus Alliance
Plagianthus Alliance
Plagianthus Alliance
Plagianthus Alliance
Plagianthus Alliance
Plagianthus Alliance
Plagianthus Alliance
Abutilon Alliance
Abutilon Alliance
Clade 1 Abutilon Alliance
Sphaeralcea Alliance
Gaya Alliance
Gaya Alliance
Gaya Alliance
Gaya Alliance
Malva Alliance
Malva Alliance
Sidalcea Alliance
Malvastrum Alliance
Sphaeralcea Alliance
Sphaeralcea Alliance
Sidalcea Alliance
Abutilon Alliance
Batesimalva Alliance
Abutilon Alliance
Clade 2 Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Clade 3 Abutilon Alliance
Batesimalva Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Clade 4 Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Clade 5 Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Batesimalva Alliance
Batesimalva Alliance
Batesimalva Alliance
Abutilon Alliance
Batesimalva Alliance
Gaya Alliance
Abutilon Alliance
Abutilon Alliance
Anoda Alliance
Abutilon Alliance
Batesimalva Alliance
Anoda Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance
Abutilon Alliance

Figure 2.1. ITS and Plastids Bayesian phylogenetic analysis of Sida species and their relationship with other
Malveae genera. Numbers above the branches represent Bayesian posterior probabilities. The position of five clades
of Sida were shown by blue boxes and the position of the main Sida clade is indicated by red color as well.

55
 Section Spinosae I-A
Section Distichifolia I-B
Section Cordifoliae

Section Nelavagae
Section Cordifoliae
I-C

Section Muticae

Section Sidae

Section Distichifolia

Section Sidae

Section Muticae Clade I

I-D

Section Sidae
Section Spinosae

Section Distichifolia
Section Sidae
Section Spinosae
Section Stenindae

Section Ellipticifoliae I-E

Section Spinosae
Section Distichifolia

Section Ellipticifoliae I-F

Section Nelavagae
Clade II

Figure 2.2. Portion of ITS and plastids Bayesian consensus tree showing main Sida clade, Sida sections and main
subclades I and II, I-A, I-B, I-C, I-D, I-E and I-F. Colors are used to indicate the different sections; species identified
in black print indicate species of uncertain section affiliation.

56
pygmaea, identified with the Batesimalva alliance, was positioned as sister to the main Sida

clade. There are two major subclades within the main Sida clade with most of the section

diversity present in subclade I and only section Nelavagae in subclade II. Subclade I consists of

six subclades (I-A through I-F), each of which includes species representing multiple sections

except for subclade I-F that is entirely composed of species from section Ellipticifoliae.

However, all sections are polyphyletic except Section Stenindae with only two species, both

represented here. The three species of Dendrosida, not assigned to sections, are positioned inside

the main Sida clade. The species of Dendrosida are not monophyletic as D. sharpiana is sister to

subclade I and D. wingfieldii and D. breedlovei are associated with subclade I-E (Figure 2.2).

The geographical ranges of all studied Sida species are in tropical and subtropical regions

world-wide (Figure 2.3). Of the 66 main Sida clade species examined, 59% are from Central and

South America, 14% from North America, 9% from Asia, and 3% from each of Australia,

Africa, and islands of the Pacific, and 9% are pantropical. Of the 18 outlier Sida species (species

not in the main Sida clade), 50% are from Australia, 33% from Central and South America, 11%

from Africa, and 6% are pantropical.

Discussion

The generic sampling of the Malveae in this study was not complete, but it included the

majority of the recognized alliances (Bayer and Kubitzki, 2003). The Malveae were separated

into three clades that were not consistent with presence or absence of an epicalyx, a trait

suggested by Tate et al. (2005) as a possible important feature in the evolution of the tribe. Their

analysis separated the Malveae into two clades based on presence or absence of an epicalyx, yet

57
 Main Sida Clade

Africa

Australia

North America

Central and South America

Pantropical

South and Southeast Asia

Pacific

Figure 2.3. ITS and Plastids Bayesian phylogenetic analysis of Sida species and their relationship with other
Malveae genera. Numbers above the branches represent Bayesian posterior probabilities. The colors indicate the
geographical location of species. The brace shows the main Sida clade, and the boxes show the outlier Sida species.

58
there were notable exceptions, including species of Malva and Malvella both with and without an

epicalyx.

Although Sida as currently circumscribed is polyphyletic, the majority of Sida species

formed a monophyletic group, the main Sida clade. The main Sida clade contained species

representing eight of the eleven sections currently recognized in the genus: Cordifoliae,

Ellipticifoliae, Muticae, Sidae, Spinosae, Distichifolia, Stenidae, and Nelavagae.

The sections within Sida are not monophyletic. The morphological characters (mericarp,

calyx and leaf morphology) that were used to separate main Sida clade species into sections

(Fryxell, 1985, 1987) did not match with the phylogeny. However, the three sections that were

placed outside the main Sida clade (sections Hookeriana, Oligandrae, and Malachroideae) and

the Australian Sida formed well defined clades. The species of the main Sida clade are

morphologically and ecologically very similar to each other, thus it is hard to separate them

based on the traditional characters used. Many Sida species exhibit almost the same flowering

phenology, floral morphology, floral biology, sexual expression, breeding and pollination

systems, fruiting behavior, and seed dispersal. Two reasons have been proposed for the high rate

of diversification in Sida that has nonetheless led to similar morphology among the species. First,

they are able to reproduce quickly because they complete vegetative and reproductive cycles fast

and their fruits mature quickly (Raju and Rani, 2016). Second, fruits are schizocarps with a high

number of carpels (Areces-Berazain and Ackerman, 2017). Areces-Berazain and Ackerman

(2017) suggested that the interplay of these two characters increases the probability of colonizing

different areas, which leads to higher diversification rates.

Within the main Sida clade, there are many species with a herbaceous habit. Examples

include widespread species such as S. acuta, S. rhombifolia, S. urens, and S. schumanniana.

59
Most Sida species occur in tropical regions and it has been suggested that herbaceous annual

plants are favored by warmer climates, which will often lead to higher diversification rates

(Fryxell, 1985; Givnish, 2010; Soltis et al., 2013; Areces-Berazain and Ackerman, 2017).

Furthermore, polyploidy is widespread among the weedy species of Malveae, including Sida,

and has played a significant role in diversification of this tribe. For example, the base

chromosome number in Sida is x=7, and most species have chromosome numbers of 2n=14 and

2n=28 (Bates and Blanchard, 1970; Fernandez, 1981; Fernandez et al., 2003). However, some

species have multiple chromosome numbers. For example, S. acuta has recorded chromosome

counts of 2n=14, 18, 28 and S. rhombifollia has counts of 2n=14, 16, 18, 28, 32, 36, suggesting

that aneuploidy in addition to polyploidy has played a role. Both these species are also

polymorphic pantropical weeds (Tate et al., 2005; Wagner et al., 1990). The diversification rate

is high in Sida, and rapid diversification can occur with little morphological change (Adams et

al., 2009). Thus, the rates of species diversification and morphological evolution are not

necessarily correlated. Changes necessary to adapt to specific and or special habitats may be very

small and difficult to detect (Adams et al., 2009; Wagner et al., 1990).

The species of Dendrosida were considered a distinct genus based on its arborescent

habit, flower structure, and mericarp size (Fryxell 1971). Despite this morphological distinction,

in this analysis they fell within the main Sida clade. Moreover, the monophyly of Dendrosida

was not supported, as D. sharpiana did not group with the other two species of the genus, D.

breedlovei and D. wingfieldii. Fuertes Aguilar et al. (2003) placed the three species close

together although it was not clear whether they were monophyletic (D. sharpiana was associated

with a polytomy distinct from the clade with D. breedlovei and D. wingfieldii). Here, the species

were well separated with D. sharpiana being sister to subclade I of the mian Sida clade and the

60
other species part of subclade I-E within subclade I. Hence, the tree habit has evolved twice

within the main Sida clade.

The classification of Fryxellia pygmaea has been variously treated previously. The

species is morphologically distinct with a caespitose-rosulate habit, an inflated calyx, a mericarp

differentiated into upper and lower cells, and the presence of an endoglossum and dorsal spines

among other features (Bates, 1974; Fryxell and Valdés R., 1991). The morphological characters

do not match with any other genera of Malveae, and thus it was placed in the monotypic

Fryxellia alliance (Bates, 1974), but was later moved into the polyphyletic Batesimalva alliance

(Fryxell 1997; Bayer and Kubitizki 2003). Here, Fryxellia pygmaea is sister to the mian Sida

clade. However, the results of the present study are based only on ITS gene sequences and the

position of both Dendrosida and Fryxellia in the mian Sida clade requires further study

(Appendix 1, 3, and 4).

The main Sida clade was divided into two major subclades, subclades I and II. Although

only one small section (section Stenindae) was monophyletic within the main Sida clade,

subclade II consisted entirely of species in section Nelavagae. However, section Nelavagae was

not monophyletic because one species was also placed in subclade I. Subclade I consisted of six

subclades (I-A to I-F). The species associated with subclade I shared several common

characteristics such as a base chromosome number of x=7, morphological traits consisting of

costate calyces, 5-fasciated staminal columns, and mericarps that are indurate, concave dorsally,

and bear an upper portion specialized for dehiscence and dispersal. Subclades I-A to I-F are

discussed in more detail below.

61
Subclade I-A:

This subclade is sister to subclades I-B, I-C, and I-D and consists of two species. Sida

abutifolia is from section Spinosae and S. argentina is of uncertain section. Sida abutifolia is

distributed from the southern United States, through Mexico, Central America, and the

Caribbean to northern South America, south to Peru and Brazil; it grows on rocky and arid soils

(Fryxell 1985, Fuertes Aguilar, 1995). Sida argentina occurs in Argentina, Bolivia, and Paraguay

(GBIF, 2021). Both have chromosome number of 2n=14 (Fernandez, 1974; Fernandez et al.,

2003; Krapovickas, 2003b).

Subclade I-B:

This subclade forms a trichotomy with subclades I-C and I-D and contains two species.

Sida salviifolia grows on sandy or stony soils along roadsides or disturbed grassland and has

been placed in Cordifoliae (Lourenco Brandao et al., 2017). It has a chromosome number of

2n=14 (Fernandez, 1974; Fernandez et al., 2003; Krapovickas, 2003b). Sida jamaicensis occurs

in moist coastal and highland regions of South America and has been placed in section

Distichifolia (Krapovickas, 2003b).

Subclade I-C:

This strongly supported subclade includes almost all species of sections Cordifoliae and

Muticae. However, one species of section Nelavagae (which is the sole section constituting

subclade II) occurred in subclade I. The majority of the species in this clade are from arid

ecosystems of the Americas. For example, S. galheirensis grows on dry, rocky and arid soils in

northeast Brazil (Batista Lima and Souza Conceicao, 2016; Lourenco Brandao et al., 2017). Sida

barclayi is from southern Mexico and Central America and is sister to S. tragiifolia, which

occurs in northeastern Mexico and southern Texas. The widespread Sida cordifolia occurs in low

62
elevation pantropical regions often near coastal communities, in grassland, or open woodland, or

as a weed in disturbed places (WFO, 2021; Wagner et al., 1999). Similarly, Sida rohlenae occurs

on sandy or sometimes clay flats of Western and Northern Australia (Baker, 1998). The species

of subclade I-C share several morphological characters such as petiolate, serrate to crenate

usually ovate leaves, axillary racemose inflorescence, and indumentum, 10-ribbed calyx and 5–8

mericarps. The chromosome number in this subclade is usually 2n=14 or 28; however, S.

aggregata (section Muticae) has a chromosome number of 2n=16 (Fernandez et al., 2003).

Subclade I-D:

This subclade consisted of all species of sections Sidae and Stenidae, and the majority of

species of sections Distichaefolia and Spinosae. One species representing section Muticae is also

present with the other species of this section found in subclade I-C. Four species of uncertain

section also belong to this subclade: S. microphylla, S. chinensis, S. samoensis, and S.

tobatiensis.

Species with a distichous leaf arrangement, despite their varied fruit morphology, were

placed in section Sidae subsection Distichaefolia by Monteiro (1967). However, Fryxell (1985)

placed these distichous species into either section Spinosae or section Sidae based on the number

of mericarps and leaf morphology. Later, Krapovickas (2003b) considered the distichous-leafed

species as the distinct section Distichifolia. The results of the present investigation do not

support separation of section Distichifolia based on the ITS (Appendix 1 and 3) and plastid

phylogenies (Appendix 2, 5, 7–10), with most species examined belonging to section Sidae and

one (S. carpinifolia) equivocally placed within section Sidae or in combination with other

sections. Three of the species of section Distichifolia (S. acuta, S. ulmifolia, and S. carpinifolia)

63
have often been considered as synonyms (Fryxell, 1985), each having a chromosome number of

2n=28. However, here they occurred as distinct species in the phylogeny.

Species in subclade I-D are geographically diverse. Although roughly half of them are

from Central and South America, other species are from diverse geographical regions among the

Pacific Islands, in eastern and southern Asia, Africa, and Australia. Subclade I-D was split into

three smaller subclades, and species with similar geographical ranges and habitats often occurred

in the same smaller subclade. For example, S. bakeriana and S. rodrigoi, both occurring in moist

highland or coastline regions of South America, grouped with the South and Central American

species S. glomerata and S. urosepala (GBIF, 2021). Likewise, South American S. odorata was

placed as sister to S. linifolia and S. hassleri, the former occurring in North and Central America

and throughout much of South America and the latter in Paraguay and Brazil (Fryxell, 1985;

Krapovickas, 2003a; Lourenco Brandao et al., 2017). The largest of these smaller subclades

contained the most geographically diverse species. For example, S. parvifolia grows on coastal

sands and coralline seashores of the Philippines and among islands of the Indian and Pacific

Oceans. Similarly, S. fallax and S. samoensis occur on Pacific Islands, and S. chinensis, S.

alnifolia, S. szechuensis and S. microphylla are from coastal regions of tropical Asia (Fryxell,

1987). Three mostly coastal South American species (S. setosa, S. tobatiensis, S. poeppigiana)

place in this group as well. Because of their close proximity to the ocean, it is likely that seed

dispersal and gene flow via ocean currents is occurring for each species among all of these

regions.

Subclade I-E:

Subclade I-E includes species with both diverse morphologies and distinct geographical

ranges. The two species of Dendrosida have an arborescent habit and occur in Central and South

64
America. Sister to Dendrosida are three species (S. longipes, S. spinosa, and S. cupidata), each

from a different section. Sida longipes (section Ellipticifoliae) is separated from the other species

of this section (in subclade I-F) and has unique characters that distinguish it, including unusually

long peduncles (6–20 cm), lanceolate-linear leaves, beaked mericarps. It also has a discrete range

distributed in western Texas and northern Coahuila straddling the Rio Grande Valley. . The

salmon-colored corolla with darker reddish or purplish veins is also distinctive (Siedo, 1999).

Sida longipes occurs in the southern United States and Mexico (Fryxell, 1985; Siedo, 1999). Sida

spinosa (section Spinosae) and S. cuspidata (section Distichifolia) are morphologically similar

and occurred as sister species. However, S. spinosa is pantropical, while S. cuspidata is from

Central and South America (Fryxell, 1985; Krapovickas, 2003b).

Subclade I-F:

This subclade contains four species of section Ellipticifoliae (S. inflexa, S. neomexicana,

S. turneroides, and S. elliottii) that also grouped with S. chrysantha of uncertain affiliation. Siedo

(1999) identified S. inflexa as a peripherally derived population of S. elliottii and reduced them to

synonyms. In this study, S. inflexa showed a closer relationship with S. chrysantha, with S.

elliottii sister to them in the ITS tree (Appendix 1 and 3), but S. inflexa and S. elliottii clustered

together in the plastids tree (Appendix 5, 7–10) and in the combined analysis. In addition, their

clade posterior probability in the concatenated tree is 0.86. Thus, they do not appear to be the

same species. Species of the section Ellipticifoliae are distinct from the remainder of the genus

because of their unique leaf structure (truncate to attenuate at base, very rarely pseudo-cordate)

and a mericarp number that varies from seven to 12. These species are distributed in arid zones

of the southeastern United States and south to Guatemala (Siedo, 1999). Sida chrysantha also

matches the leaf, inflorescence, and mericarp morphology exhibited by other members of this

65
section, and occurs in similar ecosystems of south and southwest Africa (dry grassland, rocky

slopes and soils derived from acidic rocks, growing among grasses and low-growing plants or in

woodland in light shade) (WFO, 2021). As such, it is here recognized as also belonging to

section Ellipticifoliae.

Clade II:

All members of this clade belong to Sida section Nelavagae. Almost all members of this

section (including the section type species, S. cordata) formed a strongly supported clade at the

base of the main Sida clade in ITS (Appendix 1 and 3), plastid (Appendix 5, 7–10), and

combined (Figure 2.2) analyses in this study. Sida gracilipes was placed out of this clade

(subclade I-C) and clustered with South American species of section Cordifoliae; S. martiana

was placed separately in the plastid phylogeny (Appendix 5). Species of section Nelavagae are

widely distributed in south and southeast Asia and in North and South America. Fuertes Aguilar

et al. (2003) considered the species of clade II (Section Nelavagae) as forming a separate genus,

one of their reasons being the base chromosome number of x=8 in this clade. However, S.

aggregata, which was placed inside clade I also has a base chromosome number of x=8

(Fernandez et al., 2003). Krapovickas (2006) found that the species with trigonal mericarps are

x=7 whereas species with rounded mericarps are x=8. This suggests that an aneuploid change

has occurred in the evolution of this section, with gaining a chromosomebeing correlated with

possessing rounded mericarps. However, chromosome numbers for many Sida species have not

been reported. Although section Nelavagae species have unique morphological characters, for

example a pentangular or pyramidal calyx with dark green margins and midribs (Krapovickas,

2006), the cohesion of Clade I and Clade II as a strongly supported group suggests that they

should remain together as members of the genus Sida.

66
Outlier Sida species

Sections Pseudo-Napaea and Hookerianae

Among outlier Sida species, three are closely related to the Plagianthus alliance (S.

hermaphrodita, S. hookeriana and S. ternata) (Fuertes Aguilar et al. 2003; Tate et al. 2005). Sida

hermaphrodita has been placed in the monotypic section Pseudo-Napaea and is

morphologically, geographically, and ecologically distinct from the remainder of Sida. Sida

hermaphrodita is not congeneric with any of the Plagianthus alliance genera on morphological

or biogeographic grounds. Sida hermaphrodita has a terminal panicle forming an umbellate

corymb inflorescence, cupuliform calyx, subconic schizocarps, and a temperate North American

distribution (Weakley et al., 2017), as opposed to Plagianthus alliance genera, which have

terminal or axillary panicles, or inflorescences of a solitary small flower, campanulate calyx,

subglobular schizocarps, and a Australian and New Zealand distribution (Melville, 1966).

Therefore, it was recently placed in the monotypic, isolated, temperate, North American genus

Ripariosida (Weakley et al., 2017). In the present study, R. hermaphrodita was closely affiliated

with the Plagianthus alliance and with S. hookeriana and S. ternata in both the ITS (Appendix 1

and 4) and plastid phylogenies (Appendix 2, 6–10).

Sida hookeriana and S. ternata were classified in section Hookerianae (Fryxell, 1985).

Sida hookeriana is from southwestern Australia and S. ternata is from eastern Africa, Ethiopia to

South Africa (Fryxell, 1985). It is obvious that these two species do not belong to the genus Sida

and require taxonomic revision. The morphology of these two species supports this separation, as

the combination of palmately lobed leaves and fruit and inflorescence morphology is sufficiently

striking and unlike that found in any other section of the genus, being most similar to species in

section Pseudo-Napaea (Fryxell, 1985). The close relationship in the phylogeny of S. hookeriana

67
from southwestern Australia and S. ternata from eastern Africa, and their location within the

mostly Australasian Plagianthus alliance clade, could be because of long distance dispersal

probably from Australasia to Africa via Indian Ocean currents.

Section Oligandrae

Burandt (1992) recognized four species in section Oligandrae. The present study

included two species, S. oligandra and S. palmata. This section was placed outside of the main

Sida clade as a separate clade among Abutilon alliance genera (Fig. 1.1). Some morphological

characters of this section are prominently distinct from those in the rest of the genus, notably the

large and deeply lobed leaves, and mericarps with long, protruding, clinging awns. Glandular

trichomes are often abundant and are lethal to insects (Burandt, 1991, 1992). Other traits, such as

the dorsal concave wall of the mericarps and retrorsely barbate awns, are remarkably like those

of species in section Cordifoliae in Clade I (Fuertes Aguilar et al., 2003) .

Species of this section are indigenous to relatively high elevations of western South

America (Ecuador, Peru, and Bolivia). The only known chromosome number of this group is

2n=16 for S. patuliloba R.E. Fries (not examined in this study) (Diers, 1961). Based on these

data, taxonomic revision of this section is necessary.

Section Malachroideae

Section Malachroideae groups a series of species that share the trait of a subsessile

flower inserted in the petiole base welded to the base of the stipules. Some other morphological

characters consistent with this group are mericarps with a convex dorsal wall that is absent from

the mian Sida clade, ornamentation ranging from smooth to spinose, stellate-tomentose seeds,

small oblong to oblanceolate leaves, and a prostrate habit (Fryxell, 1985; Krapovickas, 2007).

Species in this section are found in South America, the Pacific region, and eastern Africa.

68
Vollesen (1986) identified two important centers of variation for this section in South America,

one in the Chaco region of Paraguay and the other in the caatinga of northeastern Brazil.

Different researchers have suggested moving section Malachroideae into these other

already existing genera: Melochia (Willdenow, 1801), Riedleia (de Candolle, 1824),

Dictyocarpus (Wight, 1837), and Pseudomalachra (Monteiro, 1966, 1974). Others have

recognized this section within Sida (Clement, 1957; Fryxell, 1985). The base chromosome

number of x=8 was reported for the species of this section, such as S. ciliaris 2n=16, S. anomala

A.St.-Hil. 2n=16 (not examined in this study), S. monteiroi 2n=16, S. paradoxa 2n=32, S.

plumosa Cav. 2n=32 (not examined in this study), and S. cristobaliana Krapov. 2n=32 (not

examined in this study) (Krapovickas, 2007). The x=8 base chromosome number is consistent

with this section being placed with outlier Sida species.

In the phylogeny examined here, all species of section Malachroideae clustered in a

robustly supported clade that was outside of the main Sida clade and part of the Abutilon

alliance. This section is sister to a clade that consists of Sidastrum, Meximalva and a group of

Australian Sida species. In addition, the convex dorsal mericarp wall and their unique form of

inflorescence are characters absent from the Sida main clade (Krapovickas, 2007). Therefore,

this study indicates that taxonomic revision is necessary, and this section should probably raise

to full generic status within the Abutilon alliance.

Australian species of Sida

Australian Sida species can be divided into four groups. The first group consists of eight

species, with six of them represented in this analysis (S. rohlenae, S. rhombifolia, S. acuta, S.

spinosa, S. cordifolia, and S. pusilla), all of which are properly placed in the main Sida clade.

Three of these species are endemic to Australia, including S. rohlenae. The remaining five

69
species occur widely in tropical and/or temperate regions worldwide (S. rhombifolia, S. acuta, S.

spinosa, S. cordifolia, and S. pusilla) (Fryxell, 1987; Baker, 1998). Sida carpinifolia is not in

Australia but is closely affiliated with these species in the phylogeny and is found on nearby

Norfolk Island and in Central and South America, and Africa. The second group consists of 20 to

25 species that should be assigned to Sidastrum based on their morphological characters, but it

needs more investigation. For example, S. trichopoda has pseudo-involucels in the inflorescence

and simple, unornamented mericarps that are consistent with species of Sidastrum (Fryxell,

1978, 1987; Holland and Reynolds, 1988). The third group contains the species with

membranaceous fruiting calyces that occasionally have corky mericarps with protruding spines

not matching either Sida or Sidastrum (e.g. S. platycalyx, S. clementii) (Clement, 1957; Fryxell,

1987; Fuertes Aguilar et al., 2003). The last group consist of a single species, S. hookeriana,that

grouped with S. ternata from Africa, Ripariosida hermaphrodita from North America, and the

Plagianthus alliance clade. These species were not closely positioned with the mian Sida clade

and are in need of taxonomic revision.

In this phylogeny, species of the second and third groups were intermixed, despite their

morphological differences, clustering together in a robustly supported clade as sister to

Sidastrum and Meximalva. Thus, the phylogeny does not support segregation of the second and

third groups of Australian Sida as distinct genera. They should either merge with Sidastrum or

constitute a new genus. However, more species of Australian Sida and Sidastrum are required to

clarify this. The genera Sidastrum and Meximalva are sister taxa in the phylogeny and could be

merged, a result similarly found by Fuertes Aguilar et al. (2003).

70
Biogeography of Sida

The Malvoideae (eumalvoids) originated in Australasia with oceanic dispersal and

vicariance contributing to the worldwide distribution and diversification of the group (Baum et

al., 2004; Areces-Berazain and Ackerman, 2016). During the late Cretaceous, the land masses of

Australia, Antarctica and South America were connected and the climate was warmer; these

conditions may have promoted the migration of early eumalvoids among these diverging

continents and enhanced their range expansion. Subsequently, the division of continents would

have isolated the populations, which may already have been segregated into several lineages

(Reguero et al., 2013). In addition, oceanic dispersal had an important role in distribution of

eumalvoids. Fruits of eumalvoids are mostly capsules and schizocarps, and indehiscent form of

these fruits can survive prolonged exposure in saltwater. Indehiscent capsules of Thespesia or

indehiscent mericarps of about two thirds of Sida species are some of these examples (Wagner et

al., 1999; Areces-Berazain and Ackerman, 2017).

Although eumalvoids originated in Australasia, most of the species of the main Sida

clade, as well as other Abutilon alliance species (Table 2.3), are found in South and Central

America. Thus, it is possible that South and Central America was the center of diversification of

Sida with most species having arisen there, followed by subsequent dispersal via oceanic drift to

North America, Pacific regions, Asia, and Africa. Evidence to support this can be seen in

subclade I-D where there exists a close relationship of S. setosa, S. tobatiensis, S. poeppigiana

from coastal regions of South America with S. chinensis, S. szechuensis, S. alnifolia, and S.

microphylla from coastal regions of tropical Asia. Species such as S. samoensis and S. fallax

diverged from these, dispersing to the islands of the Pacific, and S. parvifolia diverged in

71
Madagascar in the Indian Ocean. In addition, Fryxellia, which is positioned at the base of the

main Sida clade, is also from the Central and South America region.

Sida elliottii, S. inflexa, S. neomexicana and S. turneroides are from North America and

group with S. chrysantha from south and southwest Africa in subclade I-F. This could have

resulted from long distance oceanic dispersal from North America to Africa.

Oceanic dispersal may also be used to explain the close relationships among outlier Sida

species. For example, African S. ternata and Australian S. hookeriana are basal to the Austral

Plagianthus clade. This is best explained as a result of oceanic dispersal with S. ternata being

found in eastern Africa where it was the result of a probable dispersal event from Australia.

In summary, Sida as currently recognized is polyphyletic. The main Sida clade is

monophyletic and represents the true “Sida” and is sister to the monotypic genus Fryxellia. The

main Sida clade consists of at least 66 species including the type species, S. rhombifolia.

Evidence indicates that Sida is largely of Central and South American origin, the center of

diversity of the genus, following dispersal of its progenitor from Australasia. There are at least

18 species currently classified as Sida that were not within the main Sida clade and should be

revaluated. The previously identified section alliances are not consistent with the phylogeny and

are in need of reevaluation based on an integrated morphological and phylogenetic revision.

72
 0.98

0.54

Appendix 1. ITS Bayesian phylogenetic analysis of Sida species and their relationship with other Malveae genera.
Numbers above the branches represent Bayesian posterior probabilities. The position of main Sida clade is indicated
by its’ clade red color and a red arrow and the Sida species that placed out of main Sida clade by blue braces.

73
 1

Appendix 2. Plastid concatenated data (rpl16, ndhF, psbA–trnH, matK) Bayesian phylogenetic analysis of Sida
species and their relationship with other Malveae genera. Numbers above the branches represent Bayesian posterior
probabilities. The position of main Sida clade is indicated by its’ red color and a red arrow and the Sida species that
placed out of main Sida clade by blue braces.

74
 Section Spinosae
Section Muticae
Section Cordifoliae
Section Muticae

Section Cordifoliae

Section Nelavagae

Section Distichifolia

Section Sidae

Section Distichifolia

Section Spinosae

Section Muticae

Section Sidae

Section Distichifolia

Section Cordifoliae

Section Ellipticifoliae

Section Sidae
Section Stenindae
Section Spinosae
Section Distichifolia
Section Ellipticifoliae

Section Nelavagae

Appendix 3. Portion of ITS Bayesian consensus tree showing main Sida clade, Sida sections and main subclades A,
B, C, D and E in it.

75
 Section Hookeriana

Section Pseudo-Napaeae

Section Oligandrae

Australian Sida species

Section Malachroideae

Appendix 4. ITS Bayesian consensus tree showing outlier Sida species and Sida sections in them.

76
 Section Cordifoliae

Section Nelavagae

Section Ellipticifoliae
Section Spinosae
Section Cordifoliae

Section Distichifolia

Section Sidae

Section Muticae

Section Spinosae

Section Sidae

Section Distichifolia

Section Stenindae

Section Nelavagae

Section Nelavagae

Appendix 5. Portion of Plastids concatenated (rpl16, ndhF, psbA–trnH, matK) Bayesian consensus tree showing
main Sida clade, Sida sections and main subclades A, B, C, D and E in it.

77
 Section Pseudo-Napaeae
Section Hookeriana

Section Oligandrae

Australian Sida species

Section Malachroideae

Appendix 6. Plastids concatenated (rpl16, ndhF, psbA–trnH, matK) Bayesian consensus tree showing outlier Sida
species and Sida sections in them.

78
Appendix 7. matK Bayesian phylogenetic analysis of Sida species and their relationship with other Malveae genera.
Numbers above the branches represent Bayesian posterior probabilities. The position of main Sida clade is indicated
by red brace and Sida species that placed out of main Sida clade by blue braces.

79
Appendix 8. ndhF Bayesian phylogenetic analysis of Sida species and their relationship with other Malveae genera.
Numbers above the branches represent Bayesian posterior probabilities. The position of main Sida clade is indicated
by red brace and Sida species that placed out of main Sida clade by blue braces.

80
Appendix 9. psbA–trnH Bayesian phylogenetic analysis of Sida species and their relationship with other Malveae
genera. Numbers above the branches represent Bayesian posterior probabilities. The position of main Sida clade is
indicated by red brace and Sida species that placed out of main Sida clade by blue braces.

81
Appendix 10. rpl16 Bayesian phylogenetic analysis of Sida species and their relationship with other Malveae
genera. Numbers above the branches represent Bayesian posterior probabilities. The position of main Sida clade is
indicated by red brace and Sida species that placed out of main Sida clade by blue braces.

82
Literature Cited

Abadi, S., D. Azouri, T. Pupko, and I. Mayrose. 2019. Model selection may not be a mandatory
step for phylogeny reconstruction. Nature Communications 10: 934.
Adams, D. C., C. M. Berns, K. H. Kozak, and J. J. Wiens. 2009. Are rates of species
diversification correlated with rates of morphological evolution? Proceedings: Biological
Sciences 276: 2729–2738.
Alverson, W. S., K. G. Karol, D. A. Baum, M. W. Chase, M. Susan, W. S. Alverson, K. G.
Karol, et al. 1998. Circumscription of the Malvales and relationships to other Rosidae:
evidence from rbcL sequence data. American journal of botany 85: 876–887.
Alverson, W. S., B. A. Whitlock, R. Nyffeler, C. Bayer, and D. A. Baum. 1999. Phylogeny of the
core Malvales: Evidence from ndhF sequence data. American Journal of Botany 86: 1474–
1486.
Areces-Berazain, F., and J. D. Ackerman. 2016. Phylogenetics, delimitation and historical
biogeography of the pantropical tree genus Thespesia (Malvaceae, Gossypieae). Botanical
Journal of the Linnean Society 181: 171–198.
Areces-Berazain, F., and J. D. Ackerman. 2017. Diversification and fruit evolution in
eumalvoids (Malvaceae). Botanical Journal of the Linnean Society 184: 401–417.
Baker, E. G. 1892. Synopsis of genera and species of Malveae, XVII. Sida. Journal of the
Botanical Research Institute of Texas 30: 138–142, 235–240, 290–296, 324–332.
Baker, R. M. 1998. Sida section Sida in Australia: a revised key, a newly introduced species, S.
subcordata span., and name changes for S. rohlenae var. Mutica (benth.) Fryxell and S.
magnifica Domin. Journal of the Adelaide Botanic Gardens 18: 33–41.
Bates, D. M. 1968. Generic relationships in the Malvaceae, tribe Malveae. Gentes Herbarum 10:
117–135.
Bates, D. M., and O. J. Blanchard. 1970. Chromosome numbers in the Malvales. II. New or
otherwise noteworthy counts relevant to classification in the Malvaceae, tribe Malveae.
American Journal of Botanyurnal of botany 57: 927–934.
Bates, D. M. 1974. Fryxellia , a new genus of North American Malvaceae. Brittonia 26: 95–100.
Batista Lima, J., and A. de Souza Conceicao. 2016. Malvoideae Burnett (Malvaceae) in the
environmental protection area Serra Branca, Raso da Catarina, Jeremoabo, Bahia, Brazil.
Biotaneotropica 16: 395–409.
Baum, D. A., S. D. W. Smith, A. Yen, W. S. Alverson, R. Nyffeler, B. A. Whitlock, and R. L.
Oldham. 2004. Phylogenetic relationships of Malvatheca (Bombacoideae and Malvoideae;
Malvaceae sensu lato) as inferred from plastid DNA sequences. American Journal of
Botany 91: 1863–1871.
Bayer, C., M. F. Fay, A. Y. D. E. Bruijn, V. Savolainen, C. M. Morton, K. Kubitzki, W. S.
Alverson, et al. 1999. Support for an expanded family concept of Malvaceae within a
recircumscribed order Malvales: a combined analysis of plastid atpB and rbcL DNA

83
 sequences. 267–303.
Bayer, C., and K. Kubitzki. 2003. Malvaceae. In K. Kubitzki and C. Bayer [eds.], Flowering
plants, dicotyledons: Malvales, Capparales, and nonbetalain Caryophyllales. 225–311.
Springer-Verlag, Berlin, Germany.
Bentham, G., and D. Hooker. 1862. Malvaceae. In G. Bentham and J. D. Hooker [eds.], Genera
Plantarum. 195–213. London, England.
Burandt, C. L. 1991. Biocidal Sida (Malvaceae). Sida 14: 405–410.
Burandt, C. L. 1992. A Monograph of Sida Sect. Oligandrae (Malvaceae). Systematic Botany 17:
164–179.
de Candolle, A. P. 1824. Prodromus systematis naturalis regni vegetabilis. Vol. 1. Paris.
Clement, I. D. 1957. Studies in Sida. Contributions from the Gray Herbarium of Harvard
University 180: 5–91.
Correll, D. S. 1968. Some additions to the flora of Texas—IV. Madroño 19: 187–192.
Cronn, R. C., R. L. Small, T. Haselkorn, and J. F. Wendel. 2002. Rapid diversification of the
Cotton genus (Gossypium : Malvaceae) revealed by analysis of sixteen nuclear and
chloroplast genes. American Journal of Botany 89: 707–725.
Diers, L. 1961. Der anteil an polyploiden in den vegetationsgürteln der westkordillere Perus.
Zeitschrift für Botanik 49: 437– 487.
Dong, W., J. Liu, J. Yu, L. Wang, and S. Zhou. 2012. Highly variable chloroplast markers for
evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PloS one 7: 1–
9.
Escobar García, P., P. Schönswetter, J. Fuertes Aguilar, G. Nieto Feliner, and G. M.
Schneeweiss. 2009. Five molecular markers reveal extensive morphological homoplasy and
reticulate evolution in the Malva alliance (Malvaceae). Molecular Phylogenetics and
Evolution 50: 226–239.
Fernandez, A. 1974. Recuentos cromosómicos en Malváceas. Boletín de la Sociedad Argentina
de Botánica 15: 403–410.
Fernandez, A. 1981. Recuentos cromosomicos en Malvales. Bonplandia 5: 63–71.
Fernandez, A., A. Krapovickas, G. Lavia, and G. Seijo. 2003. Cromosomas de Malváceas.
Bonplandia 12: 141–145.
Fryxell, P. A. 1971. A New Genus from Mexico: Dendrosida (Malvaceae). Brittonia 23: 231–
237.
Fryxell, P. A. . 1978. Neotropical Segregates from Sida L. (Malvaceae). Brittonia 30: 447–462.
Fryxell, P. A. 1985. Sidus sidarum V. The North and Central American species of Sida. Sida 11:
62–91.
Fryxell, P. A. 1987. Sidus sidarum VII. The genus Sida (Malvaceae) in Australia. Sida 12: 22–

84
 27.
Fryxell, P. A. 1988. Malvaceae of Mexico. Systematic Botany Monographs 25: 1–522.
Fryxell, P. A., and J. Valdés R. 1991. Observations on Fryxellia pygmaea (Malvaceae). Sida 14:
399–404.
Fryxell, P. A. 1997. The American Genera of Malvaceae_II. Brittonia 49: 204–269.
Fuertes Aguilar, J. 1995. Sida L. (Malvaceae). Flora de Colombia, 1–142.
Fuertes Aguilar, J., P. A. Fryxell, and R. K. Jansen. 2003. Phylogenetic relationships and
classification of the Sida generic alliance (Malvaceae) based on nrDNA ITS evidence.
Systematic Botany 28: 352–364.
GBIF.org. (01 June 2021) GBIF Occurrence Download. Website
https://doi.org/10.15468/dl.xrexrg.
Givnish, T. J. 2010. Ecology of plant speciation. Taxon 59: 1326–1366.
Holland, A. E., and S. T. Reynolds. 1988. Five new species of Sida L. (Malvaceae) from
Australia. Austrobaileya 2: 459–468.
Hutchinson, J. 1967. The genera of flowering plants. Clarendon Press, Oxford, England.
Judd, W. S., and S. R. Manchester. 1997. Circumscription of Malvaceae (Malvales) as
determined by a preliminary cladistic analysis of morphological, anatomical, palynological,
and chemical characters. Brittonia 49: 384–405.
Kearney, T. H. 1949. Malvaceae: a new subtribe and genus, and new combinations. Leaflets of
Western Botany 5: 189–191.
Kearney, T. H. 1951. The American Genera of Malvaceae. American Midland Naturalist 46: 93–
131.
Kearney, T. H. 1954. A tentative key to the North American species of Sida L. Leafl. W. Bot. 7:
138–150.
Koopman, M. M., and D. A. Baum. 2008. Phylogeny and Biogeography of Tribe Hibisceae
(Malvaceae) on Madagascar. Systematic Botany 33: 364–374.
Krapovickas, A. 2003a. Revisión de Sida Sección Muticae C. Presl (Malvaceae-Malveae).
Bonplandia 12: 123–132.
Krapovickas, A. 2003b. Sida seccion Distichifolia (Monteiro) Kapov. COMB. NOV., STAT.
NOV. (Malvacae-Malveae). Bonplandia 12: 83–121.
Krapovickas, A. 2003c. Tropidococcus Krapov., nuevo género de Malváceas. Bonplandia 12:
63–66.
Krapovickas, A. 2006. Las especies Argentinas y de países vecinos de Sida secc. Nelavaga
(Malvaceae, Malveae). Bonplandia 15: 5–45.
Krapovickas, A. 2007. A Las especies de Sida secc. Malacroideae (Malvaceae) del cono sur de

85
 Sudamérica. Bonplandia 16: 209–253.
Krapovickas, A. 2012. Novedades en las secciones Cordifoliae, Distichifolia, Malacroidea,
Muticae Y Nelavaga del género Sida (Malvaceae). Bonplandia 21: 77–92.
Kumar, S., G. Stecher, M. Li, C. Knyaz, and K. Tamura. 2018. MEGA X: Molecular
evolutionary genetics analysis across computing platforms. Molecular Biology and
Evolution 35: 1547–1549.
Lourenco Brandao, J., G. Sidney Baracho, M. Ferreira de Sales, and M. P. Viegas Filho. 2017.
Synopsis of Sida (Malvaceae, Malvoideae, Malveae) in the state of Pernambuco, Brazil.
Phytotaxa 307: 205–227.
Melville, R. 1966. Contributions to the Flora of Australia: VII: generic delimitation in the
Plagianthus complex. Kew Bulletin 20: 511–516.
Miller, M. A., W. Pfeiffer, and T. Schwartz. 2010. Creating the CIPRES Science Gateway for
inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop,
GCE 2010.
Monteiro, H. 1949. As especies argentinas, brasileiras e uruguayas da seccaoa Malvinda do
genero Sida. Lilloa 17: 501–522.
Monteiro, H. 1966. Pseudomalachra , novo género de Malvaceae. Anais do XVII Congreso
Brasileiro de Botanica, 115–118.
Monteiro, H. 1967. Revisão das espeécies do gênero Sida secçaõ Sida subsecçaõ Distichaefolia.
Anais do XVII Congreso Brasileiro de Botanica, 53–71.
Monteiro, H. 1974. Comentários sobre algumas especies de Cavanilles. Portugaliae Acta Biol
12: 132–141.
Morden, C. W., V. Caraway, and T. J. Motley. 1996. Development of a DNA library for native
Hawaiian plants. Pacific Science 50: 324–335.
Nyffeler, R., C. Bayer, W. S. Alverson, A. Yen, B. A. Whitlock, M. W. Chase, and D. A. Baum.
2005. Phylogenetic analysis of the Malvadendrina clade (Malvaceae s.l.) based on plastid
DNA sequences. Organisms Diversity and Evolution 5: 109–123.
Olmstead, R. G., J. A. Sweere, and K. H. Wolfe. 1993. Ninety extra nucleotide in ndhF gene of
tobacco chloroplast DNA: a summary of revisions to the 1986 genome sequence. Plant
Molecular Biology 22: 1191–1193.
Pfeil, B. E., C. L. Brubaker, L. A. Craven, and M. D. Crisp. 2002. Phylogeny of Hibiscus and the
tribe Hibisceae (Malvaceae) using chloroplast DNA sequences of ndhF and the rpl16 intron.
Systematic Botany 27: 333–350.
Raju, A. J. S., and D. S. Rani. 2016. Pollination ecology of Sida acuta, S. cordata and S.
cordifolia (Malvaceae). phytologia balcanica 22: 363–376.
Rambaut, A., M. A. Suchard, D. Xie, and J. Drummond. 2014. Tracer v1.6 Available from
<http://beast.bio.ed.ac.uk/Tracer>.

86
Ray, M. F. 1995. Systematics of Lavatera and Malva (Malvaceae, Malveae) — a new
perspective. Plant Systematics and Evolution 198: 29–53.
Reguero, M., F. Goin, H. C. Acosta, T. Dutra, and S. Marenssi. 2013. Late Cretaceous/Paleogene
west Antarctica terrestrial biota and its intercontinental affinities. Springer, Berlin.
Ronquist, F., M. Teslenko, P. Van Der Mark, D. L. Ayres, A. Darling, S. Höhna, B. Larget, et al.
2012. Mrbayes 3.2: Efficient bayesian phylogenetic inference and model choice across a
large model space. Systematic Biology 61: 539–542.
Schneider, J. V., K. Schulte, J. F. Aguilar, and M. L. Huertas. 2011. Molecular evidence for
hybridization and introgression in the neotropical coastal desert-endemic Palaua (Malveae,
Malvaceae). Molecular Phylogenetics and Evolution 60: 373–384.
Schumann, K. 1890. Malvaceae. In A. Engler and K. Prantl [eds.], Die naturlichen
pflanzenfamilien. 30–53. Wilhelm Engelmann, Leipzig, Germany.
Sequencher®. 1995. Version 5.4.6 DNA sequence analysis software, Gene Codes Corporation,
Ann Arbor, MI USA http://www.genecodes.com.
Siedo, S. J. 1999. At taxonomic treatment of Sida Sect. Ellipticifoliae (Malvaceae). Lundellia 2:
100–127.
Siedo, S. J. 2001. A new species of Sida sect. Ellipticifoliae (Malvaceae). Lundellia 4: 69–75.
Siedo, S. J. 2014. Sida littoralis, a new name for a species of Sida sect. Ellipticifoliae
(Malvaceae) endemic to Florida. Phytoneuron 75: 1–5.
Small, R. L. R. 2004. Phylogeny of Hibiscus sect. Muenchhusia (Malvaceae) based on
chloroplast rpL16 and ndhF, and nuclear ITS and GBSSI sequences. Systematic Botany 29:
385–392.
Soltis, D. E., M. E. Mort, M. Latvis, E. V Mavrodiev, C. Brian, S. American, N. May, et al.
2013. Phylogenetic relationships and character evolution analysis of Saxifragales using a
supermatrix approach. American journal of botany 100: 916–929.
Tate, J. A. 2003. Andeimalva, a New Genus of Malvaceae from Andean South America.
Lundellia 6: 10–18.
Tate, J. A., and B. B. Simpson. 2003. Paraphyly of Tarasa (Malvaceae) and diverse origins of
the polyploid species. Systematic Biology 28: 723–737.
Tate, J. A., J. F. Aguilar, S. J. Wagstaff, J. C. La Duke, T. A. Bodo Slotta, and B. B. Simpson.
2005. Phylogenetic relationships within the tribe Malveae (Malvaceae, subfamily
Malvoideae) as inferred from ITS sequence data. American Journal of Botany 92: 584–602.
Tate, J. A. 2011. The status of Urocarpidium (Malvaceae): Insight from nuclear and plastid-
based phylogenies. Taxon 60: 1330–1338.
Vollesen, K. 1986. The Sida cuneifolia-complex (Malvaceae) in Africa. Kew Bulletin 41: 91–98.
Wagner, W. L., D. R. Herbst, and S. H. Sohmer. 1999. Manual of the Flowering Plants of
Hawaiʻi, revised edition. University of Hawaiʻi Press, Honolulu.

87
Weakley, A. S., B. A. Sorrie, R. J. LeBlond, D. B. Poindexter, A. J. Floden, E. E. Schilling, A.
R. Franck, and J. C. Kees. 2017. New combinations, rank changes, and nomenclatural and
taxonomic comments in the Vascular Flora of the Southeastern United States. II. Journal of
the Botanical Research Institute of Texas 12: 461–480.
WFO (2021): World Flora Online. Website http://www.worldfloraonline.org.
White, T. J., Bruns T, Lee S., T. J. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and
T. J. White [eds.], PCR Protocols: A guide to methods and applications. Academic Press,
New York, 315–322.
Wight, R. 1837. Dictyocarpus. Madras Journal of literature and Science 5: 309.
Willdenow, C. L. 1801. Species Plantarum. 755. Nauk, Berlin.

88
 Chapter 3: Low genetic diversity in the highly morphologically

diverse Sida fallax Walp. (Malvaceae) throughout the Pacific

Introduction

Oceanic archipelagos have been long considered as natural laboratories for studying

evolution (Darwin, 1859; Lack, 1947; Carlquist, 1974; Schluter, 2000). Their isolation,

topographic complexity and habitat heterogeneity of many archipelagos can lead to

diversification and adaptive evolution (Howarth and Baum, 2005; Weller et al., 2007; Rijsdijk et

al., 2014; Crawford and Archibald, 2017). For instance, the Pacific islands support remarkable

biodiversity that has evolved in the context of complicated geological histories (Neall and

Trewick, 2008). Approximately half of the Earth is covered by the Pacific Ocean, in which there

are more than 30,000 islands that are mostly volcanic in origin and that have never been attached

to a continental landmass (Keast, 1996). The original colonists were dispersed to these islands

via oceanic currents, on the wind, or were transported by birds. The newly arrived species

subsequently became adapted to diverse and often isolated environments on islands, resulting in

diverse radiations of new species (Neall and Trewick, 2008). Therefore, the flora and fauna of

the Pacific Islands exhibit some of the most notable cases of adaptive radiation, non-adaptive

radiation, and hybrid speciation (Wagner and Funk, 1995; Ziegler, 2002; Rundell and Price,

2009; Keeley and Funk, 2011). Examples include the silversword alliance (Asteraceae) (Baldwin

and Sanderson, 1998; Carlquist et al., 2003) and Scaevola (Goodeniaceae) (Howarth and Baum,

2005) in the Hawaiian Islands, Darwin’s finches in the Galápagos Islands (Grant, 1986, 1998;

Grant and Grant, 2008, 2014), and Chenopodium and Urtica in the Juan Fernández Archipelago

(Takayama et al., 2018).

89
 Eumalvoids (mallow clade of the Malvaceae) are among the taxa that radiated in the

Pacific region, having probably originated in Australasia, with both oceanic dispersal and

vicariance playing important roles in their worldwide distribution and diversification (Baum et

al., 2004; Areces-Berazain and Ackerman, 2016, 2017). Sida L. (Malveae; Malvoideae;

Malvaceae) is one of the largest and most complex genera of Malvaceae, with over 100 species

that are distributed mainly in the tropics and subtropics of the world but that also extend into

temperate zones. Sida fallax Walp. (‘ilima in the Hawaiian language) is a prostrate or erect shrub

up to 1.5 m tall, with glabrate to densely velvety tomentose leaves widely distributed in the

Pacific region. Wagner et al. (1999) included China in its distribution, however, there is no

record of Sida fallax in the Flora of China (’eFloras, 2008). There are fourteen Sida species

reported in China, one of which is Sida alnifolia L. that has been confused with S. fallax

(’eFloras, 2008). Therefore, the report of S. fallax in China by Wagner et al. (1999) may be a

misidentification and needs further investigation.

Based on personal observations of several Pacific islands and habitats by Kenneth R.

Wood and David H. Lorence (National Tropical Botanical Garden, Kaua'i, HI), and my personal

observations of herbarium sheets, evidence of diversity in habitat and morphological form of this

species has not been found across most of the Pacific region. However, Sida fallax is the most

widespread and variable taxon of Malvaceae in the Hawaiian Islands. It exhibits diverse

morphological forms and occurs in different habitats from Hawaiʻi Island to Midway Atoll

(Gagné and Cuddihy, 1990; Wagner et al., 1999). Morphological variation exists both within and

among populations, particularly in plant stature, leaf size and shape, degree of pubescence, and

inflorescence characters. Sida fallax can be found in a variety of habitats from dry to mesic

90
coastal zones and mesic upland zones, and in communities occurring from 0 to 2,000 m elevation

(Gagné and Cuddihy, 1990; Wagner et al., 1999).

Two extreme ecotypes are recognized in this species, the beach and mountain ecotypes.

The beach ecotype is a prostrate shrub with small, pubescent leaves that can be found along

beaches and in dry, coastal shrublands. In contrast, the mountain ecotype occurs as an erect shrub

with larger, nearly glabrous leaves that is generally found in more mesic and forested habitats

further from the coast. There are diverse intermediate forms between these extreme ecotypes that

grow in a variety of habitats throughout the Hawaiian Islands (Yorkston and Daehler, 2006).

Some forms are common on all of the Hawaiian Islands, while other unique forms occur on only

one island (Wagner et al. 1999). The range of morphological and ecological diversity in Sida

fallax suggests that this species requires further systematic investigation (Wagner et al. 1999).

The purpose of this study was two-fold. The first objective was to explore the genetic

diversity among S. fallax populations throughout its native range in the Pacific region. The

diversity in habitat and its wide distribution throughout the Pacific regions calls into question

whether S. fallax is a single species or multiple cryptic species.

The second objective was to investigate the origin of S. fallax. It is thought to be derived

from Australasian species with subsequent dispersal to the islands of the Pacific, including the

Hawaiian Islands (Baum et al., 2004; Areces-Berazain and Ackerman, 2016). Data from

additional species, particularly from Asia and the entire Pacific region, are necessary to assess

this. To this end, species identified as closely related to Sida fallax in a broader phylogenetic

analysis of Sida (Chapter 2) were used in this analysis as outgroup taxa.

91
Materials and methods

Sampling and DNA extraction

One sample was selected from each of 24 distinct populations of Sida fallax throughout

the Hawaiian Islands. Collections represented widely separated populations from the coastal

strand to montane zones and habitats ecologically intermediate between these two extremes.

Populations were from six of the main Hawaiian Islands (Kauaʻi, Oʻahu, Maui, Molokaʻi, Lānaʻi,

and Hawaiʻi) and Nihoa in the Northwestern Hawaiian Islands (Table 3.1). Vouchers were

deposited in the Joseph F. Rock (HAW) Herbarium of the University of Hawaiʻi at Mānoa. In

addition, to obtain samples from other parts of the Pacific, the B. P. Bishop Museum (BISH) and

Joseph F. Rock (HAW) herbaria were visited; the Allan Herbarium (CHR), Arizona State

University Vascular Plant Herbarium (ASU), the Missouri Botanical Garden herbarium (MO),

and the United States National Herbarium (US) also sent dried leaf samples. In total, samples

from 12 herbarium specimens of Sida fallax were obtained from Micronesia (Marshall Islands,

Jarvis Island, and the Gilbert Islands of Kiribati) and Polynesia (Society Islands, Tonga, and Line

Islands of Kiribati) (Figure 3.1).

Outgroups were selected from species closely related to S. fallax from a previous

phylogenetic analysis (Chapter 2): Sida rhizomatosa, S. santarimensi S. poeppigina, and S.

tobatiensis from South America; S. haenkeana from Mexico; S. samoensis and S. carpinifolia

from the South Pacific; S. parvifolia from Madagascar, and the pantropically distributed species

S. rhombifolia and S. acuta collected in the Hawaiian Islands (Table 3.1).

Total genomic DNA was extracted using a modified CTAB method (cetyl

trimethylammonium bromide) (Morden et al., 1996). DNA samples were accessioned into the

92
Table 3.1. Taxa used for Sida fallax phylogenetic analyses. Voucher Identification (ID), Hawaiian Plant DNA
Library accession number (HPDL) are provided for samples collected or obtained during this study along with
GenBank accessions. Sequence data obtained from GenBank are also provided although collection data was not
always available. Collection localities for all samples were provided.

Taxon Voucher ID HPDL ITS ETS PsbA–trnH Origin

Sida acuta Starr, F. 8317 OM639974.1 OM938077 ON098151 Hawaiian Islands,

Burm.f. Martz, K. Polynesia
020225–5
(BISH)
Sida alnifolia L. — — KM073065.1 — India

MG601504.1 Sri Lanka

Sida W.R. Sykey 12689 OM752132 OM938078 OM718755 Norfolk Island,

carpinifolia L.f. Norfolk/493 Australia
(CHR)
Sida fallax V. Caraway 10581 OM868152 OM938102 OM938153 Middle ridge,
Walp. s.n. (HAW) Nihoa, Hawaiian
Islands, Polynesia

J. Adams 9616 OM868144 OM938094 OM938148 Makaleha, Kauaʻi,

262 (NTBG) Hawaiian Islands,
Polynesia

J. Adams OM868142 OM938092 OM938131 Nukoli‘i beach

s.n. (NTBG) park, Kauaʻi,
OM868143 OM938093 OM938128
8319, Hawaiian Islands,
Polynesia
8320
J. Adams 9617 OM868145 OM938095 OM938134 Mahaʻulepu,
261 (NTBG) Kauaʻi, Hawaiian
Islands, Polynesia

M. 8278 OM868153 OM938103 OM938127 Waʻahila Ridge,

Pejhanmehr Oʻahu, Hawaiian
101 (HAW) Islands, Polynesia

M. 8303 OM868154 OM938104 OM938135 Makapuʻu point,

Pejhanmehr Oʻahu, Hawaiian
102 (HAW) Islands, Polynesia

93
Table 3.1. (Continued) Taxa used for Sida fallax phylogenetic analyses.

Sida fallax M. 10088 OM868157 OM938105 OM938140 Kaʻena Point, Near

Walp. Pejhanmehr Parking, Oʻahu,
103 (HAW) Hawaiian Islands,
Polynesia
M. 10089 OM868155 OM938106 OM938129 Kaʻena Point, After
Pejhanmehr Iron Wood Bush,
104 (HAW) Oʻahu, Hawaiian
Islands, Polynesia
M. 10121 OM868156 OM938107 OM938154 Kealia Trail,
Pejhanmehr Oʻahu, Hawaiian
105 (HAW) Islands, Polynesia
C. Morden 8339 OM868150 OM938100 OM938152 Moʻomomi,
s.n. (HAW) Molokaʻi,
Hawaiian Islands,
Polynesia
C. Morden 8588 OM868151 OM938101 OM938126 Anahaki upper
s.n. (HAW) Moʻomomomi,
Molokaʻi,
Hawaiian Islands,
Polynesia
C. Morden 8324 OM868148 OM938098 OM938139 Olowalu, Maui,
s.n. (HAW) Hawaiian Islands,
Polynesia
C. Morden 8337 OM868149 OM938099 OM938151 Keʻopuolani Park,
s.n. (HAW) Maui, Hawaiian
Islands, Polynesia
K. Bogner 10560 OM868146 OM938096 OM938149 Keomoku Road,
101 (HAW) Lānaʻi, Polynesia
K. Bogner 10570 OM868147 OM938097 OM938150 Palawai Basin,
102 (HAW) Lānaʻi, Polynesia
O. Baldos 10543 OM868133 OM938082 OM938132 South Point,
s.n. (HAW) Hawaiʻi, Polynesia
C. Morden 10186 OM868134 OM938083 OM938141 Punalu‘u Beach,
2511 Hawaiʻi, Polynesia
(HAW)

94
Table 3.1. (Continued) Taxa used for Sida fallax phylogenetic analyses.

Sida fallax C. Morden 10238 OM868135 OM938084 OM938142 South Point, at

Walp. 2514 coastline, Hawaiʻi,
(HAW) Polynesia
C. Morden 10196 OM868136 OM938085 OM938143 South Point, above
2512 coast, Hawaiʻi,
(HAW) Polynesia
M. 10619 OM868137 OM938086 OM938144 Waikōloa, Hawaiʻi,
Pejhanmehr Polynesia
106 (HAW)
M. 10638 OM868138 10638 OM938145 Kawai Hai,
Pejhanmehr Hawaiʻi, Polynesia
107 (HAW)
M. 10660 OM868139 OM938088 OM938146 Koaiʻa Tree
Pejhanmehr Sanctuary,
108 (HAW) Hawaiʻi, Polynesia
M. 10593 OM868140 OM938089 OM938147 Saddle Road,
Pejhanmehr below Waikiʻi,
109 (HAW) Hawaiʻi, Polynesia
M. 10678 OM868141 OM938090 OM938133 Belt Road,
Pejhanmehr Hawaiʻi, Polynesia
110 (HAW)
Imada. C 11009 OM868158 OM938079 OM938155 Abemama atoll,
2003–125 Kiribati, Gilbert

(BISH) Islands, Micronesia

Fosberg, 11013 OM868161 OM938080 OM938138 Bikini atoll,

F.R.65159 Marshall Islands,
(BISH) Micronesia
D. Herbst 11014 OM868167 OM938113 OM938159 Taongi atoll, Ratak
9091 (BISH) chain, Marshall
Islands, Micronesia
Stevens s.n. 11020 OM868163 OM938109 OM938156 Rongelap atoll,
(HAW) Ralik chain,
Marshall Island,
Micronesia

95
Table 3.1. (Continued) Taxa used for Sida fallax phylogenetic analyses.

Sida fallax Stevens s.n. 11032 OM868162 OM938108 OM938137 Enewetak atoll,
Walp. (HAW) Marshall Island,
Micronesia

Stevens s.n. 11033 OM868164 OM938110 OM938157 Rongelap atoll,

(HAW) Ralik chain,
Marshall Island,
Micronesia
C.R. Long 11038 OM868160 OM938091 OM938130 Jarvis island,
s.n. (HAW) Micronesia
Robert 12675 OM868159 OM938081 OM938136 Kiritimati
Hobdy 1195 (Christmas Island)
(BISH) Line Islands,
Kiribati, North
Polynesia
F.R Fosberg 12680 OM868165 OM938111 OM938125 Tetiaroa atoll,
54581 Society Islands,
(BISH) French Polynesia,

M. Vadel 12681 OM868168 OM938114 — Tongatapu, Tonga's

1847 (BISH) southern island
group, West
Polynesia

G. Mc 12684 OM868166 OM938112 OM938158 Starbuck Island,

Cormack Line Islands,
s.n. (CHR) Kiribati, Polynesia

Sida haenkeana Esther 12708 OM752127 OM938115 OM718763 Mexico

C. Presl Sánchez
García 124
(ASU)
Sida Sohmer 12688 OM752133 OM938116 OM718756 Sri Lanka
microphylla 8551 (BISH)
Cav.

Sida parvifolia S. 10881 OM752125 OM938117 OM718758 Madagascar

DC. Rakotonand
rasana 1169
(US)

96
Table 3.1. (Continued) Taxa used for Sida fallax phylogenetic analyses.

Sida Terán 10856 OM752131 OM938118 OM718762 Bolivia

poeppigiana Aguilar
(K.Schum.) 2750 (MO)
Fryxell

Sida H.A. Keller 12709 OM752123 OM938119 OM718760 Argentina

rhizomatosa 10962
Krapov. (ASU)

Sida C. Morden 10223 OM639975.1 OM938120 ON098151 South Point, above

rhombifolia L. 2513 coast, Hawaiʻi,
(HAW) Polynesia
Sida samoensis W.R. Sykey 12690 OM752130 OM938121 OM718757 Niue, Polynesia
Rech. 1609/N
(CHR)
Sida A. Schinini 12692 OM752124 OM938122 OM718761 Argentina
santaremensis 35396
Monteiro (ASU)

Sida setosa L. R. 12695 OM752128 OM938123 OM718759 Ecuador

Mart. ex Colla Landrum
10851
(ASU)
Sida tobatiensis Lewis 35133 10874 OM752129 OM938124 OM718764 Bolivia
Ulbr. (MO)

Sida ulmifolia — — MW364816.1 — MH622090.1 USA

Cav.

97
 Kiribati

Figure 3.1. Three major groups of islands in the Pacific Ocean: Melanesia, Micronesia and Polynesia, and the
territories, islands, and archipelagos in each (Wikipedia, 2021; Motteler and Bryan, 2006; Kirch, 2017).

98
Hawaiian Plant DNA Library (HPDL) at the University of Hawaiʻi at Mānoa (UHM) (Morden et

al., 1996, Randell and Morden, 1999).

Marker Selection and Amplification

Two non-coding nuclear regions, the internal transcribed spacer (ITS) region of the 18S-

26S nuclear ribosomal repeat, external transcribed spacer (ETS) of the ribosomal DNA (rDNA)

(Baldwin, 1992; Baldwin et al., 1995; Bena et al., 1998; Álvarez and Wendel, 2003), and the

non-coding psbA–trnH chloroplast region (Sang et al., 1997), were selected because they are

appropriate for intra-species studies and have been used widely in the Malvoideae (Seelanan et

al., 1997; Whittall et al., 2000; Andreasen and Baldwin, 2003; Fuertes Aguilar et al., 2003; Tate

and Simpson, 2003; Escobar García et al., 2009).

Polymerase Chain Reactions (PCR) were performed in 20 µl aliquots containing 1x (1.5

mM MgCl) GoTaq G2 PCR buffer, 0.1% BSA, 0.2 mM of each dNTP (dATP, dCTP, dGTP,

dTTP), 0.2 mM of both forward and reverse primers (Table 3.2), and 0.025 units GoTaq G2

polymerase (Promega, Madison, Wisconsin) and 20–100 ng template DNA. For both nuclear and

chloroplast markers, amplification conditions were initiated by a denaturation cycle of 95ºC for 2

minutes, followed by 30 cycles of denaturation at 95ºC for 1 minute; annealing at 55ºC for 1

minute; elongation at 72ºC for 2 minutes, and a final extension at 72ºC for 3 minutes. Negative

control reactions were run without DNA for all PCR amplifications to ensure reaction

components were uncontaminated. All PCR products were visualized on 2% agarose gels to

check for amplification.

99
Table 3.2. List of sequence primers with references used for phylogenetic analysis.

Gene Region Genome origin Primer Name, Sequence (5'–3') Reference

Internal Transcribed Nuclear, spacer ITS2: (White et al., 1990)

Spacer (ITS) GCT GCG TTC TTC ATC GAT GC
ITS3:
GCA TCG ATG AAG AAC GCA GC
ITS4:
TCC TCC GCT TAT TGA TAT GC
ITS5:
GGA AGT AAA AGT CGT AAC
AAG G
External Transcribed Nuclear, spacer ETS 18S: (Wright et al., 2001)
Spacer (ETS) GAG CCA TTC GCA GTT TCA
CAG
JKETS-9: (Mitchell et al.,
CGT WMA GGY GYA TGA GTC 2009)
GT
psbA– trnH Chloroplast, trnH-f: (Dong et al., 2012)
spacer CGCGCATGGTGGATTCACAAATC
psbA-r:
TGCATGGTTCCTTGGTAACTTC

100
Sequencing, Sequence Alignment and Phylogenetic Analyses

PCR products were cleaned using ExoSAP-IT (Affymetrix, Cleveland, Ohio) following

the manufacturer’s specifications. Samples were sequenced at the University of Hawaiʻi

Advanced Studies in Genomics, Proteomics and Bioinformatics (ASGPB) facility

(http://hawaii.edu/microbiology/asgpb) or GENEWIZ, LLC (South Plainfield, NJ), with PCR

products undergoing a cycle sequencing reaction using BigDye terminator chemistry (Applied

Biosystems, Foster City, California). All samples were bi-directionally sequenced using forward

and reverse primers (Table 3.2) and the sequences were edited and assembled into contigs using

Sequencher (Gene Codes Corporation, 1995).

The sequences were aligned using MEGA-X v.10.0.5 (Kumar et al., 2018) and visually

adjusted as needed. All gene regions were first aligned individually and then concatenated to be

analyzed subsequently as nuclear, chloroplast, and combined data sets in Geneious v10.2.2

(Biomatters, Auckland, NZ). Bayesian Inference (BI) phylogenetic analyses were conducted in

MrBayes 3.2.7 (Ronquist et al., 2012) using the CIPRES Science Gateway (Miller et al., 2010).

The GTR+I+G model was selected as the model of nucleotide substitution for the combined

dataset based on Abadi et al. (2019) by setting the number of substitution types to “mixed.”. The

analysis was performed for two runs of four MCMC chains for 10 million generations and trees

were sampled every 1000 generations. The initial 25% of the trees were discarded as burn-in and

a 50% majority-rule consensus tree was constructed from the post-burn-in trees. The program

Tracer 1.6.0 (Rambaut et al., 2014) was used to confirm that all MCMC outputs reached

stationarity and converged on the same distribution.

101
Results

Sequence characteristics

The sequence characteristics of ITS, ETS, and psbA–trnH datasets are summarized in

Table 3.3. ITS sequences ranged from 580 to 796 bp; ETS sequences from 450 to 509 bp; and

psbA–trnH sequences from 350 to 440 bp. For all three markers, S. fallax from the Society

Islands had the longest and most divergent sequences among all Hawaiian and Pacific region

samples. The psbA–trnH region from Tonga and both ITS and psbA–trnH regions from Tuvalu

could not be amplified.

Phylogenetic Analysis

The ITS tree (Figure 3.2) supported all S. fallax samples as a single clade with a posterior

probability (PP) of 0.95. There were three subclades within this clade. The first subclade

included samples from Jarvis Island and the Society Islands (0.68 PP). The second subclade

consisted of one Tongan sample as sister to a clade that included three Kiribati and two Marshall

Islands samples (0.86 PP). The third subclade included samples from the two Molokaʻi

populations (1.0 PP). Of the outgroup species, S. acuta, S. ulmifolia, and S. haenkeana were the

most closely related taxa to S. fallax (1.0 PP).

The ETS tree (Figure 3.3) identified a single S. fallax clade (0.73 PP) that also included S.

acuta and S. rhombifolia. The sample of S. fallax from the Society Islands was sister to the

remainder of the S. fallax samples. These latter samples formed a comb including a mix of both

Hawaiian (Nihoa, Kauaʻi, Oʻahu, and Molokaʻi) and non-Hawaiian samples, and a subclade with

samples from Maui, Lānaʻi, and Hawaiʻi islands (0.94 PP).

102
Table 3.3. Sequence characteristics of Hawaiian Island and Pacific Sida fallax samples and their close Sida relatives
included in the study.

Region Length (bp) Aligned length (bp) Variable sites No. parsimony Model of

informative characters evolution

ITS 580–796 562 47 17 GTR+I+G

ETS 450–509 429 38 17 GTR+I+G

psbA–trnH 350–440 354 23 8 GTR+I+G

103
 0.93

0.68

0.98
1 0.86

0.95

0.82

0.57
1
1

Figure 3.2. ITS phylogeny of Hawaiian Island and Pacific Sida fallax samples and their close Sida relatives.
Numbers above the branches represent Bayesian posterior probabilities. The number next to taxon names is the
HPDL number (Table 3.1.). Oʻahu: OAH, Kauaʻi: KAU, Lānaʻi: LAN, Nihoa: NIH, Molokaʻi: MOL, Maui: MAU,
Hawaiʻi (island): HAW, Society Islands: SOC, Tonga: TON, Kiribati: KIR, Marshall Islands: MAR, Jarvis Island:
JAR, Norfolk Island: NOR, Niue: NIU, Sri Lanka: SRI, Argentina: ARG, Ecuador: ECU, Bolivia: BOL,
Madagascar: MAD. Neotropical: NT, South, and Southeast Asia: SEA.

104
 1

0.73

0.94

0.98
1

0.99
1
0.97
1
1

Figure 3.3. ETS phylogeny of Hawaiian Island and Pacific Sida fallax samples and their close Sida relatives.
Numbers above the branches represent Bayesian percentage posterior probabilities. The number next to taxon names
is the HPDL number (Table 3.1.). Oʻahu: OAH, Kauaʻi: KAU, Lānaʻi: LAN, Nihoa: NIH, Molokaʻi: MOL, Maui:
MAU, Hawaiʻi (island): HAW, Society Islands: SOC, Tonga: TON, Kiribati: KIR, Marshall Islands: MAR, Jarvis
Island: JAR, Norfolk Island: NOR, Niue: NIU, Sri Lanka: SRI, Argentina: ARG, Ecuador: ECU, Bolivia: BOL,
Madagascar: MAD.

105
 The psbA–trnH tree (Figure 3.4) produced a single clade including all S. fallax samples as

well as S. acuta, S. haenkeana, S. poeppigiana, and S. tobatiensis. There were three subclades.

One subclade included two Hawaiʻi and one Kauaʻi samples (0.84 PP). The second subclade

included the S. poeppigiana and S. tobatiensis samples (0.91 PP). The third subclade was poorly

supported (0.64 PP) and included one sample each from Oʻahu and the Society Islands, the latter

associated with a long branch. In addition, S. acuta was associated with a very long branch.

The concatenation of nuclear and chloroplast sequences (Figure 3.5) resulted in a single

S. fallax clade (0.82 PP) and S. rhombifolia, S. acuta, S. ulmifolia forming a polytomy with it

(0.74 PP). There were several subclades present, including the Maui, Lānaʻi, Hawaiʻi subclade

identified in the ETS phylogeny (0.84 PP), a subclade of most of the Pacific samples from

Kiribati, Marshall Islands and Tonga (0.97 PP), a Molokaʻi subclade (1.0 PP), and the Oʻahu-

Society Islands subclade identified in the psbA–trnH phylogeny (0.76 PP).

106
 0.84
0.91

0.64

0.67

0.92

1
0.98

Figure 3.4. psbA–trnH phylogeny of Hawaiian Island and Pacific Sida fallax samples and their close Sida relatives.
Numbers above the branches represent Bayesian posterior probabilities. The number next to taxon names is the
HPDL number (Table 3.1.). Oʻahu: OAH, Kauaʻi: KAU, Lānaʻi: LAN, Nihoa: NIH, Molokaʻi: MOL, Maui: MAU,
Hawaiʻi (island): HAW, Society Islands: SOC, Tonga: TON, Kiribati: KIR, Marshall Islands: MAR, Jarvis Island:
JAR, Norfolk Island: NOR, Niue: NIU, Sri Lanka: SRI, Argentina: ARG, Ecuador: ECU, Bolivia: BOL,
Madagascar: MAD. Neotropical: NT, South, and Southeast Asia: SEA.

107
 1
0.76

0.82

0.97

0.99

Hawaiian Islands
0.67
Other Pacific Islands
0.84

South and Southeast Asia/Indian ocean

0.74
Central and South America

0.82 North America

0.99 1

1 1
1

1
0.98

Figure 3.5. Phylogeny of Hawaiian Island and Pacific Sida fallax samples and their close Sida relatives based of
combined regions (ITS, ETS, and psbA–trnH). Numbers above the branches represent Bayesian posterior
probabilities. The number next to taxon names is the HPDL number (Table 3.1.). The colors indicated the
geographical locations. Oʻahu: OAH, Kauaʻi: KAU, Lānaʻi: LAN, Nihoa: NIH, Molokaʻi: MOL, Maui: MAU,
Hawaiʻi (island): HAW, Society Islands: SOC, Tonga: TON, Kiribati: KIR, Marshall Islands: MAR, Jarvis Island:
JAR, Norfolk Island: NOR, Niue: NIU, Sri Lanka: SRI, Argentina: ARG, Ecuador: ECU, Bolivia: BOL,
Madagascar: MAD. Neotropical: NT, South, and Southeast Asia: SEA.

108
Discussion

Gene flow is an important force in maintaining species cohesion because it prevents

populations from differentiating through local adaptation and/or genetic drift (Futuyma, 1987).

One immigrant per generation is sufficient to prevent strong differentiation among populations

(Slatkin, 1987; Ellstrand and Elam, 1993). The seed dispersal ability of a species has an

important effect on its regional distribution. Most plants have ecological and physical limitations

in seed dispersal, so they are not distributed globally. However, some plants are capable of

dispersing their seeds extensively via bird migration, wind, and/or ocean currents (Takayama et

al., 2006). Outstanding examples of long-distance dispersal include pantropical plant species

with seeds that disperse via ocean-drift; such examples are Ipomoea pes-caprae (L.) R. Br.

(Convolvulaceae), Canavalia rosea Sweet. (Fabaceae), Hibiscus tiliaceus L. (Malvaceae)

(Takayama et al., 2008), and Scaevola taccada Gaertn. (Goodeniaceae) (Howarth et al., 2003).

Each of these species is distributed over tropical littoral areas worldwide. To survive oceanic

dispersal, seeds or vegetative plant parts must be able to float and have resistance to the osmotic

damage that results from being in saltwater (Areces-Berazain and Ackerman, 2016).

Oceanic dispersal has an important role in the evolution of eumalvoids (Malvoideae,

Malvaceae) in the Pacific region. Malvoid fruits are indehiscent capsules or schizocarps that are

capable of surviving prolonged exposure in saltwater (Areces-Berazain and Ackerman, 2016,

2017). The indehiscent capsule of Thespesia populnea and indehiscent mericarps of about two

thirds of Sida species are examples. For Sida species, dispersal is thought to be mostly by ocean

currents, although bird dispersal is possible for some species because their mericarp is often

acute or apically spined so that they may attach to a bird’s wings or become mixed with mud and

attach to the bird’s feet or legs (Baum et al., 2004; Areces-Berazain and Ackerman, 2016, 2017).

109
Sida fallax is a good example of dispersal via ocean currents as it is among the most widespread

of Pacific taxa, being distributed across the region (Wagner, 1999).

The nuclear and plastid phylogenies clearly support S. fallax as a single species

throughout its native range in the Pacific region. All populations of S. fallax clustered in a single

clade with limited further resolution. The sample from the Society Islands showed the greatest

divergence from samples collected at other locations but was still placed within the S. fallax

clade (except in the ETS tree in which it was sister to the remaining S. fallax species). Sida fallax

represents an excellent example of widespread dispersal throughout the islands of the Pacific

without speciation and in which genetic cohesion is maintained, probably through infrequent

dispersal via ocean-drifting fruits.

Although the populations across most of the range are highly similar in both growth form

and ecology, populations in the Hawaiian Islands include many forms that are highly divergent

in growth form, leaf pubescence, and habitat. However, this is not reflected genetically in the

sequence data. This genetic cohesion across the range of the species may be a consequence of

either recent dispersal and radiation into new habitats (Keeley and Funk, 2011; Wagner and

Funk, 1995).

The species found closest to S. fallax in these analyses were S. acuta, S. haenkeana, S.

rhombifolia, and S. ulmifolia. However, the ETS analysis placed S. acuta and S. rhombifolia

within the S. fallax clade and the psbA–trnH analysis placed S. acuta and S. haenkeana along

with S. poeppigiana and S. tobatiensis within it. These placements reflect a more conservative

evolutionary rate of change associated with these gene regions, resulting in the closely related

species being included in the large polytomy visualized with the analyses for these two markers.

In the ETS tree, the Hawaiian Islands samples showed an interesting pattern, as samples from the

110
younger islands of Hawaiʻi, Lānaʻi and Maui formed a distinct clade of the large polytomy

involving other S. fallax samples (from both within the Hawaiian Islands and across the Pacific).

This distinct clade is probably associated with the close proximity of the islands and their

younger age and may reflect a linear evolution within the species such as applied in the

progression rule (Hennig, 1966).

The pantropically dispersed S. acuta and S. rhombifolia, and the neotropical S. ulmifolia

form a polytomy with the S. fallax clade, all forming a clade that is sister to the Mexican S.

haenkeana. This larger clade is in turn sister to a clade composed of species from Central and

South America including S. poeppigina, S. tobatiensis, S. rhizomatosa, S. santarimensis, and S.

setosa. From these associations, it is likely that there were multiple dispersal events from Central

or South America to the Pacific region giving rise to S. fallax, S. rhombifolia and S. acuta. Sida

rhombifolia and S. acuta dispersed to pantropical regions throughout the world. In contrast, S.

fallax has remained only in the Pacific.

There is no evidence to suggest where the ancestor of S. fallax first colonized, but two

hypotheses seem reasonable. First, colonization of the Hawaiian Islands occurred with

subsequent evolution of a distinct species and morphological diversification among the different

habitats there. This was followed by multiple dispersal events of the coastal form to other Pacific

Islands. The second hypothesis is that there was dispersal from Central or South America to

regions in the Pacific followed by evolution of a new species. This new species subsequently

spread throughout the Pacific and eventually to the Hawaiian Islands where it diversified

morphologically in the different habitats. An example supporting the first hypothesis includes

species in the genus Phyllostegia (Lamiaceae), which is derived from Stachys in western North

America (Roy et al., 2013). Phyllostegia radiated into 33 species in the Hawaiian Islands and

111
colonized Tahiti and Tonga from Hawai‘i (Lindqvist et al., 2003). However, this example

incorporates speciation along with the dispersal. An example supporting the second hypothesis is

Waltheria indica, which is derived from the Americas and is a widespread pantropical species

(Wagner et al 1999). However, in contrast to S. fallax, W. indica has not diversified

morphologically in the Hawaiian Islands.

In summary, this study demonstrated clearly that Sida fallax is a single species

throughout the Pacific region and the different forms of Hawaiian S. fallax are not genetically

distinct at the DNA sequence level, at least regarding the markers used. Although the pattern of

dispersal of S. fallax is not clear, it is evident that an American origin is most likely. Further

studies of the relationships among it and the related S. rhombifolia and S. acuta at the population

level would shed additional insight into their shared history.

112
Literature Cited

Abadi, S., D. Azouri, T. Pupko, and I. Mayrose. 2019. Model selection may not be a mandatory
step for phylogeny reconstruction. Nature Communications 10.
Álvarez, I., and J. F. Wendel. 2003. Ribosomal ITS sequences and plant phylogenetic inference.
Molecular Phylogenetics and Evolution 29: 417–434.
Andreasen, K., and B. G. Baldwin. 2003. Reexamination of relationships, habital evolution, and
phylogeography of checker mallows (Sidalcea; Malvaceae) based on molecular
phylogenetic data. American Journal of Botany 90: 436–444.
Areces-Berazain, F., and J. D. Ackerman. 2016. Phylogenetics, delimitation and historical
biogeography of the pantropical tree genus Thespesia (Malvaceae, Gossypieae). Botanical
Journal of the Linnean Society 181: 171–198.
Areces-Berazain, F., and J. D. Ackerman. 2017. Diversification and fruit evolution in
eumalvoids (Malvaceae). Botanical Journal of the Linnean Society 184: 401–417.
Baldwin, B. G. 1992. Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal
DNA in plants: An example from the compositae. Molecular Phylogenetics and Evolution
1: 3–16.
Baldwin, B. G., M. J. Sanderson, M. Porter, M. F. Wojciechowski, C. S. Cambell, and M. J.
Donoghue. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence
on angiosperm phylogeny. Annals of the Missouri Botanical Garden 82: 247–277.
Baldwin, B. G., and M. J. Sanderson. 1998. Age and rate of diversification of the Hawaiian
silversword alliance (Compositae). Proceedings of the National Academy of Sciences of the
United States of America 95: 9402–9406.
Baum, D. A., S. D. W. Smith, A. Yen, W. S. Alverson, R. Nyffeler, B. A. Whitlock, and R. L.
Oldham. 2004. Phylogenetic relationships of Malvatheca (Bombacoideae and Malvoideae;
Malvaceae sensu lato) as inferred from plastid DNA sequences. American Journal of
Botany 91: 1863–1871.
Bena, G., M. F. Jubier, I. Olivieri, and B. Lejeune. 1998. Ribosomal external and internal
transcribed spacers: Combined use in the phylogenetic analysis of Medicago
(Leguminosae). Journal of Molecular Evolution 46: 299–306.
Brach, A. R., and H. Song. 2006. eFloras: New directions for online floras exemplified by the
Flora of China Project. Taxon 55: 188–192.
Carlquist, S. (1974). 1974. Island Biology. Columbia University Press, New York.
Carlquist, S., B. G. Baldwin, and G. D. Carr. 2003. Tarweeds and silverswords: evolution of the
Madiinae (Asteraceae). Missouri Botanical Garden Press, Saint Louis, MO.
Cowie, R. H., and B. S. Holland. 2008. Review. Molecular biogeography and diversification of
the endemic terrestrial fauna of the Hawaiian Islands. Philosophical Transactions of the
Royal Society B: Biological Sciences 363: 3363–3376.

113
Crawford, D. J., and J. K. Archibald. 2017. Island floras as model systems for studies of plant
speciation: Prospects and challenges. Journal of Systematics and Evolution 55: 1–15.
Darwin, C. 1859. The origin of species. Oxford University Press, Oxford.
Dong, W., J. Liu, J. Yu, L. Wang, and S. Zhou. 2012. Highly variable chloroplast markers for
evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PloS one 7: 1–
9.
eFloras. 2008. Published on the Internet http://www.efloras.org [accessed 15 February 2021]*’
Missouri Botanical Garden, St. Louis, MO & Harvard University Herbaria, Cambridge,
MA.
Ellstrand, N. C., and D. R. Elam. 1993. Population genetic conseqences of small population size:
Implications for plant conservation. Annual Review of Ecology and Systematics 24: 217–
242.
Escobar García, P., P. Schönswetter, J. Fuertes Aguilar, G. Nieto Feliner, and G. M.
Schneeweiss. 2009. Five molecular markers reveal extensive morphological homoplasy and
reticulate evolution in the Malva alliance (Malvaceae). Molecular Phylogenetics and
Evolution 50: 226–239.
Fuertes Aguilar, J., P. A. Fryxell, and R. K. Jansen. 2003. Phylogenetic relationships and
classification of the Sida generic alliance (Malvaceae) based on nrDNA ITS evidence.
Systematic Botany 28: 352–364.
Futuyma, D. J. 1987. On the role of species in anagenesis. The American Naturalist 130: 465–
473.
Gagné, W. C., and W. L. Cuddihy. 1999. Vegetation. In W. L. Wagner, D. R. Herbst, and S. H.
Sohmer [eds.], Manual of the Flowering Plants of Hawai’i, University of Hawai‘i Press,
Honolulu, HI.
Grant, P. R. 1986. Ecology and evolution of Darwin’s finches. Princeton University Press,
Princeton.
Grant, P. R. 1998. Evolution on islands. Oxford University Press, Oxford.
Grant, P. R., and B. R. Grant. 2008. How and why species multiply. The radiation of Darwin’s
finches. Princeton University Press, Princeton.
Grant, P. R., and B. R. Grant. 2014. 40 Years of Evolution: Darwin’s Finches on Daphne Major
Island. Princeton University Press, 2014. Princeton University Press, Princeton.
Hennig, W. 1966. Phylogenetic systematics. Urbana: Illinois Natural History Survey.
Howarth, D. G., M. H. G. Gustafsson, D. A. Baum, and T. J. Motley. 2003. Phylogenetics of the
genus Scaevola (Goodeniaceae): Implication for dispersal patterns across the Pacific Basin
and colonization of the Hawaiian Islands. American Journal of Botany 90: 915–923.
Howarth, D. G., and D. A. Baum. 2005. Genealogical evidence of homoploid hybrid speciation
in an adaptive radiation of Scaevola (Goodeniaceae) in the Hawaiian Islands. Evolution 59:
948–961.

114
Keast, A. 1996. Pacific biogeography: patterns and processes. In: Keast A, Miller SE, eds. The
origin and evolution of Pacific Island biotas, New Guinea to eastern Polynesia: patterns and
processes. Amsterdam: SPB Academic Publishing: 477–512.
Keeley, S. C., and V. A. Funk. 2011. Origin and evolution of Hawaiian endemics: new patterns
revealed by molecular phylogenetic studies. The biology of island floras (ed. by D.
Bramwell). Cambridge University Press, Cambridge.
Kirch, P. V. 2017. On the Road of the Winds: An Archaeological History of the Pacific Islands
before European Contact. 2nd edition. University of California Press, Berkeley.
Kumar, S., G. Stecher, M. Li, C. Knyaz, and K. Tamura. 2018. MEGA X: Molecular
evolutionary genetics analysis across computing platforms. Molecular Biology and
Evolution 35: 1547–1549.
Lack, D. 1947. Darwin’s finches. Cambridge University Press, Cambridge.
Lindqvist, C., T. J. Motley, J. J. Jeffery, and V. A. Albert. 2003. Cladogenesis and reticulation in
the Hawaiian endemic mints (Lamiaceae). Cladistics 19: 480–495.
Miller, M. A., W. Pfeiffer, and T. Schwartz. 2010. Creating the CIPRES Science Gateway for
inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop,
GCE 2010.
Mitchell, A. D., P. B. Heenan, and A. M. Paterson. 2009. Phylogenetic relationships of
Geranium species indigenous to New Zealand. New Zealand Journal of Botany 47: 21–31.
Morden, C. W., V. Caraway, and T. J. Motley. 1996. Development of a DNA library for native
Hawaiian plants. Pacific Science 50: 324–335.
Motteler, L. S., and E. H. Bryan. 2006. Pacific island names: a map and name guide to the new
Pacific. Bishop Museum Press, Honolulu.
Neall, V. E., and S. A. Trewick. 2008. The age and origin of the Pacific islands: A geological
overview. Philosophical Transactions of the Royal Society B: Biological Sciences 363:
3293–3308.
Rambaut, A., M. A. Suchard, D. Xie, and J. Drummond. 2014. Tracer v1.6 Available from
<http://beast.bio.ed.ac.uk/Tracer>.
Randell, R. A., and C. W. Morden. 1999. Hawaiian Plant DNA Library II: Endemic, indigenous,
and introduced species. Pacific Science 53: 401–417.
Rijsdijk, K. F., T. Hengl, S. J. Norder, R. Otto, B. C. Emerson, S. P. Ávila, H. López, et al. 2014.
Quantifying surface-area changes of volcanic islands driven by Pleistocene sea-level cycles:
Biogeographical implications for the Macaronesian archipelagos. Journal of Biogeography
41: 1242–1254.
Ronquist, F., M. Teslenko, P. Van Der Mark, D. L. Ayres, A. Darling, S. Höhna, B. Larget, et al.
2012. Mrbayes 3.2: Efficient bayesian phylogenetic inference and model choice across a
large model space. Systematic Biology 61: 539–542.
Roy, T., T. H. Chang, T. Lan, and C. Lindqvist. 2013. Phylogeny and biogeography of New

115
 World Stachydeae (Lamiaceae) with emphasis on the origin and diversification of Hawaiian
and South American taxa. Molecular Phylogenetics and Evolution 69: 218–238.
Rundell, R. J., and T. D. Price. 2009. Adaptive radiation, nonadaptive radiation, ecological
speciation and nonecological speciation. Trends Ecol Evol. 2009 Jul;24(7):394-9. doi:
10.1016/j.tree.2009.02.007. Epub 2009 May 4. PMID: 19409647. Trends in Ecology and
Evolution 24: 394–399.
Sang, T., D. J. Crawford, and T. F. Stuessy. 1997. Chloroplast DNA phylogeny, reticulate
evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84:
1120–1136.
Schluter, D. 2000. The ecology of adaptive radiation. Oxford University Press, Oxford.
Seelanan, T., A. Schnabel, and J. F. Wendel. 1997. Congruence and Concensus in Cotton Tribe
(Malvaceae). Systematic Botany 22: 259–290.
Slatkin, M. 1987. Gene flow and the geographic structure of natural populations. Science 236:
787–792.
Takayama, K., T. Kajita, J. Murata, and Y. Tateishi. 2006. Phylogeography and genetic structure
of Hibiscus tiliaceus - Speciation of a pantropical plant with sea-drifted seeds. Molecular
Ecology 15: 2871–2881.
Takayama, K., Y. Tateishi, J. Murata, and T. Kajita. 2008. Gene flow and population subdivision
in a pantropical plant with sea-drifted seeds Hibiscus tiliaceus and its allied species:
evidence from microsatellite analyses. Molecular Ecology 17: 2730–2742.
Takayama, K., D. J. Crawford, P. López-Sepúlveda, J. Greimler, and T. F. Stuessy. 2018. Factors
driving adaptive radiation in plants of oceanic islands: a case study from the Juan Fernández
Archipelago. Journal of Plant Research 131: 469–485.
Tate, J. a., and B. B. Simpson. 2003. Paraphyly of Tarasa (Malvaceae) and diverse origins of the
polyploid species. Systematic Botany 28: 723–737.
Wagner, W. L., and V. A. Funk. 1995. Hawaiian biogeography: evolution on a hot spot
archipelago. Smithsonian Institution Press, Washington, DC.
Wagner, W. L., D. R. Herbst, and S. H. Sohmer. 1999. Manual of the Flowering Plants of
Hawaiʻi, revised edition. University of Hawaiʻi Press, Honolulu.
Weller, S. G., C. A. Domínguez, F. E. Molina-Freaner, J. Fornoni, and G. LeBuhn. 2007. The
evolution of distyly from tristyly in populations of Oxalis alpina (Oxalidaceae) in the Sky
Islands of the Sonoran Desert. American Journal of Botany 94: 972–985.
White, T. J., Bruns T, Lee S., T. J. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and
T. J. White [eds.], PCR Protocols: A guide to methods and applications. Academic Press,
New York, 315–322.
Whittall, J., A. Liston, S. Gisler, and R. J. Meinke. 2000. Detecting nucleotide additivity from
direct sequences is a SNAP: An example from Sidalcea (Malvaceae). Plant Biology 2: 211–

116
 217.
Wikipedia. [internet]. [accessed 24 October 2021]. Available from:
https://en.wikipedia.org/wiki/Polynesia.
Wright, S. D., C. G. Yong, S. R. Wichman, J. W. Dawson, and R. C. Gardner. 2001. Stepping
stones to Hawaii: A trans-equatorial dispersal pathway for Metrosideros (Myrtaceae)
inferred from nrDNA (ITS + ETS). Journal of Biogeography 28: 769–774.
Yorkston, M., and C. C. Daehler. 2006. Interfertility between Hawaiian ecotypes of Sida fallax
(Malvaceae) and evidence of a hybrid disadvantage. International Journal of Plant Sciences
167: 221–230.
Ziegler, A. C. 2002. Hawaiian natural history, ecology, and evolution. University of Hawaii
Press, Honolulu, HI.

117
 Chapter 4: Population genetics of Sida fallax Walp. (Malvaceae) in

the Hawaiian Islands

Introduction

Oceanic archipelagos have long been considered natural laboratories for studying

evolution because of their role in speciation and adaptive radiation (Darwin, 1859; Lack, 1947;

Carlquist, 1974; Schluter, 2000). The remote archipelago of the Hawaiian Islands (ca. 4000 km

from the nearest continental landmass) supports a variety of geographically isolated habitats

resulting from the volcanic nature of the islands and ranging from mesic mountain to dry coastal

zones. In addition, on the youngest island, lava flows continuously destroy old habitats and

create new ones (Sohmer and Gustafson, 1987; Westerbergh and Saura, 1994; Wagner et al.,

1999). Consequently, the flora of the Hawaiian Islands exhibits some notable cases of adaptive

radiation (Wagner and Funk, 1995; Ziegler, 2002; Keeley and Funk, 2011). In many cases,

adaptive radiation is accompanied by speciation. Examples include the silversword alliance

(Asteraceae; (Witter and Carr, 1988; Baldwin and Sanderson, 1998; Carlquist et al., 2003),

Hawaiian Bidens (Asteraceae; Knope et al., 2012), lobeliads (Campanulaceae; Givnish et al.,

2009), mints (Lamiaceae; Lindqvist et al., 2003), Cyrtandra (Gesneriaceae; Johnson et al., 2019)

and Schiedea (Caryophyllaceae; Sakai et al., 2006). In all of these examples, the evolution of

widely divergent growth forms and morphologies were derived from a single colonizing and are

found in a wide range of habitats (Wagner and Funk, 1995; Price and Wagner, 2004). In other

cases, adaptive radiation was not followed by abundant speciation and species have highly

variable intraspecific morphological diversity, for example, Metrosideros polymorpha Gaud., the

dominant tree species in the Hawaiian Islands (Percy et al., 2008).

118
 Sida fallax (Malvaceae) is widely distributed throughout the Pacific region. It is the most

widespread and variable taxon of Malvaceae in the Hawaiian Islands, growing with a diversity of

morphological forms and in different habitats of Midway Atoll, Nihoa, and all the main islands.

Morphological variation exists both within and among populations, particularly in plant stature,

leaf size and shape, degree of pubescence, and inflorescence characters. Ecologically, it is found

in a variety of habitats from dry and mesic coastal zones to upland forest habitats, with an

elevation range from 0 to 2,000 m (Gagné and Cuddihy, 1999).

Sida fallax (or ‘ilima in the Hawaiian language) was widely recognized and used within

the native Hawaiian culture, in which forms of both wild and cultivated plants were given

distinctive names. The wild types consist of ʻilima kū kahakai and ‘ilima papa (flat beach

forms), ʻilima kū kula or ʻilima kū kala (very tall forms), ʻilima kuahiwi (the form “from the

mountains”), ʻilima kū kahakai (a creeping form like ‘ilima papa), ʻilima ōkea (a form with light

yellow flowers), and ʻilima makanaʻā (plants with smaller flowers and plants of medium height

found on old lava flows in the Kaʻū district of Hawaiʻi Island (Handy and Handy, 1991; Krauss,

1993). Cultivated, or domesticated forms were also recognized, including ʻilima ʻāpiki, ʻilima lei

and ʻilima mamo (tall, spreading plants with golden flowers) andʻilima kū kala (the form

“standing on plains”). Forms with bronze or red flowers are referred to as ʻilima kolikukui or

ʻilima kolī kukui (kukui candle or torch), which were cultivated on Oʻahu (Neal, 1948). Also,

horticulturists named particular ‘ilima varieties such as the cultivar “Black Coral”, that is an

upright small shrub with single golden-orange flowers and dark stems, and “Kaneohe Gold” that

is a dwarf shrub, with bright golden flowers (Neal, 1948; Handy and Handy, 1991).

There are two ecological forms of Sida fallax with many intermediates in the Hawaiian

Islands (Figure 4.1) (Wagner et al. 1999; Yorkston and Daehler, 2006). A low elevation ecotype

119
Figure 4.1. Ecotype variation within Sida fallax. Beach ecotype a) habit, b) flower and smaller densely pubescent,
ovate leaves; intermediate/inland ecotype c) habit, d) flower buds and mildly pubescent, acute leaves; mountain
ecotype e) habit, f) flower and larger glabrous, acute leaves.

120
occurs along beaches and in dry, coastal shrublands. These are low sprawling shrubs that are

typically less than 50 cm tall with small (up to 4 cm long), densely pubescent ovate leaves. This

form can take the extreme form of a prostrate subshrub in coastal communities. Sida fallax from

other Pacific locations exhibit this form only. In contrast, the mountain ecotype is an erect shrub

that typically reaches 1–1.5 m in height (in some cases exceeding 2 m) with large (commonly 4

to 8 cm long), glabrous or nearly glabrous leaves. These forms are found in upland communities

and mesic forest sites, usually away from coastal influences (Wagner et al. 1999; Yorkston and

Daehler, 2006). The many intermediate morphological types between these extreme forms, many

of which were recognized by early Hawaiians (see above), occur in a variety of habitats

throughout the Hawaiian Islands.

Several studies have been carried out on the different ecotypes of S. fallax. Stephens

(2000) compared the ecophysiology of beach and mountain ecotypes and found that the beach

ecotype had a greater tolerance of drought than the mountain ecotype. Experimental crosses

carried out by Yorkston and Daehler (2006) between the beach and mountain forms

demonstrated a lack of fertility barriers between them. Furthermore, a phylogenetic study of all

ecotypes of S. fallax from the Hawaiian Islands and areas throughout the Pacific demonstrated

that it is a single species with very little variation among the nuclear and chloroplast gene regions

examined (see Chapter 2).

The objective of the present study was to investigate the genetic variation within and

among populations from the various habitats and geographic locations throughout the Hawaiian

range of S. fallax. The various ecological and morphological forms of S. fallax discussed above

occur on many of the islands. However, the expectation is that genetic relations will mirror the

121
dispersion among islands. Parallel evolution is occurring with morphologically different forms

on a single island being more closely related to each other than they are to the morphologically

similar forms on different islands.

Materials and Methods

Sampling and DNA Extraction

When possible, up to five samples were selected from collections representing 26 distinct

populations of Sida fallax throughout the Hawaiian Islands. For some populations, fewer samples

were available. Collections represented widely separated populations from the coastal strand to

montane zones and habitats ecologically intermediate between these two extremes. Populations

were from six of the main Hawaiian Islands (Kauaʻi, Oʻahu, Maui, Molokaʻi, Lānaʻi, and

Hawaiʻi) and Nihoa in the Northwestern Hawaiian Islands (Figure 4.2 and Table 4.1). Vouchers

were deposited in the Joseph F. Rock (HAW) herbarium of the University of Hawaiʻi at Mānoa.

Total genomic DNA was extracted using a modified CTAB method (cetyl trimethylammonium

bromide) (Morden et al., 1996) and deposited in the Hawaiian Plant DNA Library (HPDL) at the

University of Hawaiʻi at Mānoa.

MIG-seq Library Construction and Sequencing

In total, 124 samples from 26 populations (Figure 4.2 and Table 4.1) were selected for

Multiplexed ISSR genotyping by sequencing (MIG-seq) to detect single nucleotide

polymorphisms (SNP) (Suyama and Matsuki, 2015). MIG-seq library preparation and primer

selection were performed according to Suyama and Matsuki (2015). After measurement of the

final concentration of the libraries, approximately 10 pM of the libraries were used for

122
 a

1
2
3 9
7 8 6
4 10 11
13 14
5
15
12
16 23
22 24
21
25
26
20
18
19
17

b
Figure 4.2. a) The Hawaiian archipelago including Northwestern and main Hawaiian Islands. Both English (white
labeling) and Hawaiian (yellow labeling) names of the Northwestern Islands are provided. b) Inset from above
showing the 26 populations of Sida fallax locations in the Hawaiian Islands. Numbers indicate the populations
identified in Table 4.1. Map image is from Downey (2017)

123
Table 4.1. Taxa used for Sida fallax population genetic analyses with population number, voucher identification,
Hawaiian Plant DNA Library accession number (HPDL), collection locality, and ecotype. Herbarium acronyms
follow Thiers (2021).
Population Voucher HPDL Origin Ecotype

number identification

1 Caraway s.n. (HAW) 10577–10583 Middle ridge, Nihoa, Hawaiian Mountain/inland

Islands

2 Adams 262 (PTBG) 9615, 9616 Makaleha, Kauaʻi, Hawaiian Mountain/inland

Islands

3 Adams s.n. (PTBG) Nukoliʻi beach park, Kauaʻi, Beach

8319–8321
Hawaiian Islands

4 Adams 261 (PTBG) 9617–9621 Mahaʻulepu, Kauaʻi, Hawaiian Beach

Islands

5 Pejhanmehr 101 8278, 8290, Waʻahila Ridge, Oʻahu, Hawaiian Mountain/inland

(HAW) 8291, 8293, Islands

8294

6 Pejhanmehr 102 8303, 8310– Makapuʻu point, eastside near Beach

(HAW) 8313 highway and near sandy beach

Oʻahu, Hawaiian Islands

7 Pejhanmehr 103 10075, 10080 Kaʻena Point, Near Parking, Beach

(HAW) 10086–10088 Oʻahu, Hawaiian Islands

8 Pejhanmehr 104 10089, 10091 Kaʻena Point, After Iron Wood Mountain/inland

(HAW) 10094–10096 Bush, Oʻahu, Hawaiian Islands

9 Pejhanmehr 105 10121, Kealia Trail, Oʻahu, Hawaiian Mountain/inland

(HAW) 10127–10130 Islands

10 Morden s.n. (HAW) 8339–8343 Moʻomomi dunes, Molokaʻi, Beach

Hawaiian Islands

124
Table 4.1. (Continued) Taxa used for Sida fallax population genetic analyses.

11 Morden s.n. (HAW) 8588–8592 Anahaki upper Moʻomomomi, Mountain/inland

Molokaʻi, Hawaiian Islands

12 Morden s.n. (HAW) 8323–8327 Olowalu, above stream, Maui, Beach

Hawaiian Islands

13 Morden s.n. (HAW) 8328 Keʻopuolani Park on top of the Beach

8334–8337 sand dunes, Maui, Hawaiian

Islands

14 Baldos s.n. (HAW) 10554 Kanaha Beach Park, Maui, Beach

Hawaiian Islands

15 Bogner 101 (HAW) 10558,10560– Near Keomoku Road, Lānaʻi, Mountain/inland

10563 Hawaiian Islands

16 Bogner 102 (HAW) 10570–10574 Palawai Basins, Lānaʻi, Hawaiian Mountain/inland

Islands

17 Baldos s.n. (HAW) 10543–10547 South Point, Hawai’i, Hawaiian Beach

Islands

18 Morden 2511 (HAW) 10174, 10178, Punaluʻu Beach, Hawai’i, Beach

10181, 10182, Hawaiian Islands

10186

19 Morden 2514 (HAW) 10236–10239, Upper South Point, at coastline, Beach

10241 Hawaiʻi, Hawaiian Islands

20 Morden 2512 (HAW) 10211,10212, Upper South Point, above coast, Mountain/inland

10215,10196, Hawaiʻi, Hawaiian Islands

10201

21 Pejhanmehr 106 10606, 10613, Waikōloa, along highway, Mountain/inland

(HAW) 10617–10619 Hawaiʻi, Hawaiian Islands

22 Pejhanmehr 107 10622, 10628 Kawaihae near Heidi, Hawaiʻi, Beach

(HAW) 10636–10638 Hawaiian Islands

125
Table 4.1. (Continued) Taxa used for Sida fallax population genetic analyses.

23 Pejhanmehr 108 10645, 10656 Koai'a Tree Sanctuary, Hawaiʻi, Mountain/inland

(HAW) 10657, 10660 Hawaiian Islands

10668

24 Pejhanmehr 109 10590–10594 Saddle Road, Hawaiʻi, below Mountain/inland

(HAW) Waikiʻi, Hawaiian Islands

25 Baldos s.n. (HAW) 10550–10553 Saddle Road, Hawaiʻi, Hawaiian Mountain/inland

Islands

26 Pejhanmehr 110 10677–10679 Belt Road, between Kailua and Mountain/inland

(HAW) 10696, 10697 Waikōloa, Hawaiʻi, Hawaiian

Islands

126
sequencing on an Illumina MiSeq Sequencer (Illumina, San Diego, California), using a MiSeq

Reagent Kit v3 (150 cycle, Illumina).

Quality control and SNP detection

Adapter and anchor sequence trimming of raw data were performed according to Suyama

and Matsuki (2015), using FASTQ Trimmer (Galaxy Version 1.1.5) (Blankenberg et al., 2010;

Afgan et al., 2018). High-quality reads were assessed using the Filter by Quality application

(Galaxy Version 1.0.2+galaxy0) (Gordon, 2010; Afgan et al., 2018) with the criterion of q = 30

and p = 40 (q: quality cut-off value, p: percent of bases in a sequence that must have quality

equal to or higher than q). Cutadapt (Galaxy Version 3.4+galaxy0) (Martin, 2011; Afgan et al.,

2018) was used to remove reads from extremely short library entries (Maximum error rate =

0.01). Filtered reads were assembled using de novo map pipelines (ustacks, cstacks, sstacks,

gstacks) in Stacks2: de novo map (Galaxy Version 2.4+galaxy1) (Catchen et al., 2011, 2013;

Afgan et al., 2018) with the following settings: Mismatches allowed between loci when

processing a single individual = 2, Mismatches allowed between loci when building the catalog =

1, minimum percentage of individuals in a population required to process a locus for that

population = 0, and minimum number of populations a locus must be present in to process a

locus = 1.

Population genetic analysis

The assembled reads (gstackes) were used as input for population genetic analysis using

Stacks2: populations (Galaxy Version 2.4+galaxy1) (Catchen et al., 2011, 2013; Afgan et al.,

2018) with the following settings: Minimum percentage of individuals in a population required

to process a locus for that population = 0, Minimum number of populations a locus must be

present in to process a locus = 1, minimum percentage of individuals across populations required

127
to process a locus = 0, Fraction of samples possessing both loci to prune remaining samples from

analysis = 1. Robustness of results was examined by choosing different numbers for Minimum

percentage of individuals in a population required to process a locus for that population, and

minimum percentage of individuals across populations required to process a locus, i.e., 0 and 0.7,

0.5 and 0, 0.7 and 0, 0 and 0.5, 0.4 and 0, 0.3 and 0.1, 0.45 and 0, 0.3 and 0, 0.1 and 0, and 0.2

and 0. The outputs of Stacks2: populations were used as input data to generate covariance values

from population allele frequencies using GenoDive v2.0b27 (Meirmans and Van Tienderen,

2004) to investigate relationships of individuals within and among populations. Genetic

similarity indices were calculated using both Gower (1971) and Nei and Li (1979) similarity

coefficients for populations using MVSP Plus ver. 3.1 (Kovach 2007). Relationships within and

among populations were estimated from the similarity matrixes using principal coordinate

analysis (PCO) with MVSP Plus ver. 3.1 (Kovach, 2007) using Gower similarity (Gower 1971).

Finally, the relationship of FST with the geographical distance between the populations was

assessed using the function mantel.test in ade4 library of the R package ape v5.3 (Dray and

Dufour, 2007; R Core Team, 2021) with 9,999 permutations.

128
Results

Numbers of reads, SNPs, and polymorphic loci

The number of reads per sample ranged from 1,789 to 216,730 in the raw data (from

1,539 to 210,631 after quality filtering) and the removal rate varied from 0 to 11% for 124

individuals. The forward and reverse reads were treated independently because they do not

overlap and could not be combined. The results of both reads were compared and provided near-

identical outcomes, and only the reverse reads are presented here. Stacks verified 57,475 loci

composed of 3,838,616 (bp) sites. Twenty-five sites that were pseudo-variant (PCR error) loci

and detected only in one sample were filtered (Suyama and Matsuki, 2015), and 12,796 variant

sites (or SNP) remained. The mean genotyped sites per locus was 66.79 bp (stderr 0.01).

The population diversity statistics are summarized in Table 4.2. Polymorphic sites per

population ranged from 82 to 1209 and variant sites (SNP) from 999 to 6074. Private alleles

(alleles occurring in only a single population) ranged from 50 to 414 among populations.

Observed heterozygosity ranged from 0.082 to 0.136 and nucleotide diversity (Pi) from 0.82 to

0.131. Among all population diversity statistics, the smallest values belonged to population 14

from Maui Beach where only one individual was found. The largest values for each statistic were

mostly from Hawaiʻi Island (populations 17 and 24, inland/mountain habitats) and Lānaʻi

(population 21, beach habitat). Observed homozygosity ranged from 0.864 from Hawaiʻi Island

(population 24, mountain habitat) to 0.918 from both Kauaʻi (population 4, beach habitat) and

Oʻahu (population 5, mountain habitat). The inbreeding coefficient (FIS) ranged from -0.015 on

Nihoa (population 1, inland/mountain habitat of Nihoa) to 0.009 on both Kauaʻi (population 4,

beach habitat) and Hawaiʻi (population 17, beach habitat).

129
Table 4.2. Population diversity statistics. All: all sites. Pm_s: polymorphic sites (when different individuals differ from the reference stack at the same position),
Variant: variant sites (SNP), Private: private alleles, alleles that occur in only that population, Var: number of variances per population., StdErr: standard error,
Obs_Het: observed heterozygosity, Exp_Het: expected heterozygosity, Obs_Hom: observed homozygosity, Exp_Hom: expected homozygosity, Pi: nucleotide
diversity (number of nucleotide differences per site between two randomly chosen sequences from a population)., FIS: inbreeding coefficient.
Pop ID All Pm_s Variant Private Var StdErr Obs_Het StdErr Obs_Hom StdErr Exp_Het StdErr Exp_Hom StdErr Pi StdErr Fis StdErr

1 571725 856 5476 263 5.051 0.030 0.111 0.004 0.889 0.004 0.068 0.002 0.932 0.002 0.102 0.004 -0.015 0.030

2 402447 383 3906 182 0.243 0.008 0.088 0.004 0.912 0.004 0.047 0.002 0.953 0.002 0.083 0.004 -0.007 0.008

3 524893 608 4838 212 0.574 0.011 0.100 0.004 0.900 0.004 0.058 0.002 0.942 0.002 0.100 0.004 -0.001 0.011

4 409642 432 3631 227 1.045 0.017 0.082 0.004 0.918 0.004 0.053 0.002 0.947 0.002 0.088 0.004 0.009 0.017

5 592719 641 4823 373 1.349 0.017 0.082 0.004 0.918 0.004 0.057 0.002 0.943 0.002 0.087 0.003 0.006 0.017

6 705392 956 5951 399 1.815 0.017 0.108 0.004 0.892 0.004 0.070 0.002 0.930 0.002 0.111 0.004 0.005 0.017

7 514824 631 4446 339 0.908 0.014 0.101 0.004 0.899 0.004 0.063 0.002 0.937 0.002 0.104 0.004 0.005 0.014

8 618086 834 5407 326 1.969 0.019 0.103 0.004 0.897 0.004 0.066 0.002 0.934 0.002 0.102 0.004 -0.002 0.019

9 599487 809 5438 255 2.260 0.020 0.107 0.004 0.893 0.004 0.066 0.002 0.934 0.002 0.103 0.004 -0.006 0.020

10 629118 1049 5538 414 2.240 0.020 0.129 0.004 0.871 0.004 0.080 0.002 0.920 0.002 0.124 0.004 -0.010 0.020

11 526591 727 4738 306 1.453 0.018 0.108 0.004 0.892 0.004 0.068 0.002 0.932 0.002 0.111 0.004 0.004 0.018

12 501152 627 4645 272 1.004 0.015 0.100 0.004 0.900 0.004 0.061 0.002 0.939 0.002 0.098 0.004 -0.004 0.015

13 587089 1015 5455 337 2.333 0.021 0.129 0.004 0.871 0.004 0.081 0.002 0.919 0.002 0.126 0.004 -0.003 0.021

14 116124 82 999 50 0.000 0.000 0.082 0.009 0.918 0.009 0.041 0.004 0.959 0.004 0.082 0.009 0.000 0.000

15 591205 976 5580 323 2.395 0.021 0.119 0.004 0.881 0.004 0.074 0.002 0.926 0.002 0.113 0.004 -0.011 0.021

16 654765 1072 5962 412 2.332 0.020 0.120 0.004 0.880 0.004 0.075 0.002 0.925 0.002 0.116 0.004 -0.007 0.020

17 706318 616 4323 244 1.072 0.016 0.096 0.004 0.904 0.004 0.064 0.002 0.936 0.002 0.102 0.004 0.009 0.016

18 545314 892 5236 246 2.277 0.021 0.121 0.004 0.879 0.004 0.074 0.002 0.926 0.002 0.115 0.004 -0.009 0.021

19 656137 1061 5931 311 2.020 0.018 0.132 0.004 0.868 0.004 0.079 0.002 0.921 0.002 0.127 0.004 -0.007 0.018

20 485995 776 4893 130 2.185 0.021 0.116 0.004 0.884 0.004 0.070 0.002 0.930 0.002 0.108 0.004 -0.014 0.021

21 671176 1209 6074 373 2.412 0.020 0.130 0.004 0.870 0.004 0.083 0.002 0.917 0.002 0.125 0.004 -0.007 0.020

22 665764 1085 5910 387 2.062 0.019 0.126 0.004 0.874 0.004 0.079 0.002 0.921 0.002 0.125 0.004 0.000 0.019

23 643946 1006 5641 350 1.742 0.018 0.126 0.004 0.874 0.004 0.078 0.002 0.922 0.002 0.124 0.004 -0.002 0.018

24 669847 1164 6036 334 2.345 0.020 0.136 0.004 0.864 0.004 0.085 0.002 0.915 0.002 0.131 0.004 -0.008 0.020

25 470827 553 4172 197 0.594 0.012 0.098 0.004 0.902 0.004 0.061 0.002 0.939 0.002 0.101 0.004 0.004 0.012

26 298318 384 3151 77 0.472 0.012 0.116 0.006 0.884 0.006 0.060 0.003 0.940 0.003 0.113 0.006 -0.004 0.012

130
Population Differentiation and Genetic Distance

The Mantel test identified a significant positive correlation between genetic and

geographic distances among S. fallax populations (r=0.295, p = 0.0209). Populations that were

more closely associated geographically were also more closely related genetically. Overall, most

FST values were approximately 0.20 with very low genetic variance among the 26 populations

(Table 4.3). However, populations that were located on the same island and in similar habitats

had smaller FST values, and populations on different islands and in different habitats had larger

FST values. The smallest pairwise FST was between two populations from the mountain/inland

habitat of Hawaiʻi Island (populations 21 and 26) that were located close to each other (FST =

0.15). In contrast, populations from different habitats and islands showed the largest FST, for

example population 2 from a mountain/inland habitat on Kauaʻi and population 14 from a beach

habitat on Maui (FST = 0.44).

Genetic Assignment

Genetic differences among individuals and populations from across the range of habitat

and locations of S. fallax in the Hawaiian Islands were evaluated using PCO analyses. Three

main islands groupings were evident: 1) Oʻahu, Kauaʻi and Nihoa; 2) Maui, Molokaʻi, and

Lānaʻi (collectively referred to as Maui Nui); 3) Hawaiʻi Island. Populations from each island

grouping intersect at the center of the graph (Figure 4.3 and 4.4).

There was a trend of coastal/beach populations occurring more predominantly near the

zone of intersection (ZOI) of the island groups and the mountain/inland or most isolated

populations being more distant from this zone of intersection (Figure 4.5). Within the Oʻahu-

Kauaʻi-Nihoa group, populations near the ZOI include the coastal Kaʻena Point, Oʻahu

131
Table 4.3. Pairwise FST among 26 population of Sida fallax in Hawaiian Islands.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26
1 0.27 0.23 0.25 0.27 0.20 0.23 0.21 0.22 0.21 0.24 0.26 0.22 0.35 0.22 0.21 0.28 0.24 0.26 0.24 0.22 0.26 0.25 0.24 0.26 0.26
2 0.31 0.35 0.32 0.30 0.32 0.28 0.30 0.26 0.32 0.34 0.28 0.44 0.27 0.27 0.35 0.29 0.32 0.28 0.27 0.29 0.29 0.29 0.34 0.35
3 0.26 0.28 0.24 0.24 0.23 0.24 0.21 0.24 0.27 0.22 0.36 0.22 0.22 0.29 0.25 0.28 0.25 0.24 0.23 0.25 0.25 0.28 0.27
4 0.31 0.27 0.28 0.27 0.27 0.25 0.28 0.31 0.25 0.38 0.25 0.27 0.34 0.28 0.30 0.28 0.28 0.27 0.28 0.28 0.30 0.32
5 0.27 0.28 0.24 0.25 0.24 0.26 0.28 0.24 0.32 0.23 0.25 0.31 0.27 0.29 0.25 0.26 0.28 0.27 0.28 0.29 0.27
6 0.23 0.21 0.23 0.22 0.24 0.26 0.23 0.33 0.21 0.23 0.28 0.24 0.27 0.24 0.24 0.26 0.25 0.25 0.28 0.25
7 0.22 0.23 0.22 0.26 0.29 0.23 0.35 0.22 0.22 0.29 0.25 0.28 0.24 0.24 0.25 0.26 0.25 0.27 0.26
8 0.21 0.20 0.23 0.25 0.21 0.35 0.20 0.21 0.27 0.23 0.25 0.22 0.22 0.24 0.24 0.24 0.25 0.26
9 0.20 0.24 0.27 0.22 0.33 0.20 0.22 0.29 0.25 0.26 0.24 0.23 0.23 0.25 0.25 0.28 0.26
10 0.19 0.21 0.19 0.27 0.19 0.18 0.23 0.21 0.23 0.18 0.19 0.21 0.21 0.21 0.22 0.20
11 0.26 0.20 0.29 0.21 0.20 0.25 0.22 0.25 0.20 0.21 0.24 0.24 0.23 0.24 0.22
12 0.22 0.31 0.21 0.21 0.26 0.22 0.25 0.22 0.21 0.23 0.24 0.24 0.27 0.25
13 0.27 0.18 0.17 0.24 0.21 0.21 0.20 0.19 0.20 0.21 0.20 0.23 0.19
14 0.25 0.28 0.29 0.22 0.30 0.26 0.27 0.30 0.27 0.25 0.30 0.36
15 0.18 0.22 0.20 0.20 0.18 0.17 0.20 0.20 0.20 0.22 0.20
16 0.24 0.20 0.22 0.18 0.18 0.21 0.20 0.21 0.22 0.19
17 0.19 0.23 0.20 0.21 0.24 0.24 0.23 0.28 0.20
18 0.19 0.16 0.18 0.20 0.20 0.21 0.21 0.20
19 0.16 0.18 0.21 0.22 0.21 0.24 0.20
20 0.16 0.19 0.17 0.18 0.19 0.18
21 0.17 0.18 0.17 0.20 0.15
22 0.20 0.20 0.23 0.18
23 0.18 0.23 0.20
24 0.21 0.19
25 0.22

132
 2
5

4 Nihoa

3
Kauai
2

Oahu
1
2

Molokai
-6 -5 -4 -3 -2 -1 1 2 3 4 5

-1
Maui
-2

Lanai

3
-3

1 -4
Hawaii

-5

Figure 4.3. Principal coordinate analysis using MIG-seq data identifying individuals from each island in the Hawaiian Islands using a matrix of
covariance values calculated from population allele frequencies. The three groups of S. fallax populations include 1) Nihoa, Oʻahu and Kauaʻi; 2)
Maui, Molokaʻi, and Lānaʻi (Maui Nui); 3) Hawaiʻi.

133
 5

4 1- N
2- K- Makaleha
3- K- Nukolii
3 4- K- Mahaulepu
5- O- Waahila
6- O- Makapuu
2 7- O- Kaena
8- O- Kaena
9- O- Kealia
1 10- Mo- Moomomi
11- Mo- Anahaki
2

12- M- Olowalu
13- M- Keopuolani
-6 -5 -4 -3 -2 -1 1 2 3 4 5 14- M- Kanaha
15- L- Keomoku
-1 16- L- Palawai
17- H- South Point
18- H- Punaluu
-2 19- H- South Point
20- H- South Point
21- H- Waikoloa
-3 22- H- Kawaihae
23- H- Koaia
24- H- Saddle Rd
-4 25- H- Saddle Rd
26- H- Belt Rd
-5

Figure 4.4. Principal coordinate analysis using MIG-seq data identifying the 26 S. fallax populations in across the Hawaiian Islands using a matrix
of covariance values calculated from population allele frequencies. Island abbreviations: N, Nihoa; K, Kauaʻi; O, Oʻahu; M, Maui; Mo, Molokaʻi;
L, Lānaʻi; H, Hawaiʻi (Table 4.1). Population numbers correspond to those in Figure 4.2.

134
 5

3 Mountain/inland

1
2

-6 -5 -4 -3 -2 -1 1 2 3 4 5

-1

-2

Beach
-3

-4

-5

Figure 4.5. Principal coordinate analysis using MIG-seq data of S. fallax populations in Hawaiian Islands distinguished by habitat - mountain or
inland vs. beach ecotypes - based on the same analysis presented in Figure 4.3. Nihoa plants, although near coastal were considered inland as there
is no beach habitat on that island.

135
(population 7), and Mahaʻulepu, Kauaʻi (Population 4) populations. One individual from

Waʻahila (a mountain population; population 5) was located within the ZOI, but the remaining

individuals from this population were not. Other populations outside the ZOI included those

from Makaleha and Nukoliʻi from Kauaʻi; and Kealia, inland Kaʻena, and Makapuʻu from

Oʻahu. Plants from Nihoa (the island being well separated from the main Hawaiian Islands) were

well differentiated from the ZOI (Figure 4.2). The habitat of Nihoa is largely mountain basaltic

slopes with no beach habitat.

The second island group consisted of populations from Maui Nui. All Maui Nui

populations were collected from beach or inland regions close to the beach. A few individuals

from Molokaʻi (population 11) were within the ZOI (Figure 4.4), but most fell outside it. Maui

Nui plants form a cohesive group that does not exhibit extensive diversification and does not

extend as far from the ZOI as do the other two groups.

The third island group consisted of plants from Hawaiʻi Island. As the largest island,

more populations (10) were investigated, throughout the island, than on the other islands.

Populations extend from the ZOI, with plants from South Point and Belt Road (populations 17

and 26, respectively) relatively close to the ZOI to populations well separated from the ZOI,

notably those from Saddle Road (population 24). There was broad overlap in coastal/beach and

mountain/inland populations within the diversity of the Hawaiʻi Island group.

136
Discussion

It is common in the analysis of population variation among species that are distributed

throughout the Hawaiian Islands that individuals and populations within an island show a closer

genetic relationship to other populations on that island than to populations from other islands.

This has been demonstrated repeatedly using other methods for a wide variety of genera

including Hibiscus (Malvaceae; Huppman, 2013), Erythrina (Fabaceae; Grave, 2018), and

Sesbania (Fabaceae; Cole and Morden, 2021). In this study of Sida fallax, the population

organization reflected a Nihoa-Kauaʻi-Oʻahu group, a Maui Nui group, and a Hawaiʻi Island

group. Populations within each of these three groups broadly overlapped genetically and were

distinct from those in the other two groups, suggesting that each group has retained intra-group

connectivity. On closer inspection of the variation in the previous studies noted above it is

evident that, although the island populations are distinct, they also are consistent with these same

three groups of islands found for Sida fallax. A major distinction in this study is that the three

groups are connected (the ZOI) suggesting gene flow still exists among them. This is probably a

reflection of Sida fallax having many coastal populations and fruits with indehiscent mericarps

capable of long-distance dispersal via ocean currents. These factors allow it to maintain genetic

cohesion among populations throughout the Hawaiian Islands and even across the Pacific Ocean

(Chapter 2) as has been found in other groups (Baum and Smith, 2004; Takayama et al., 2008;

Areces-Berazain and Ackerman, 2016, 2017).

Within each of the three island groups, populations were largely intermixed genetically

and there was no island-by-island separation. There was no clear genetic delineation between

beach and mountain/inland ecotypes. However, there was some evidence of more coastal or

beach populations being closer to the zone of intersection and inland populations more distant

137
from it, suggesting diversification within each of these groups. However, there was also a large

degree of overlap suggesting continuing introgression among the forms of Sida fallax as well as

across the habitats. As found by Yorkston and Daehler (2006), there are no fertility barriers

among populations and forms of the species. Sida fallax are pollinated by native insects such as

yellow-faced bees, Hylaeus spp., and non-native insects such as honey bees, Apis mellifera, and

other generalist Hymenoptera, butterflies, and moths (Yorkston and Daehler, 2006; Shay et al.,

2016; Shay and Drake, 2018; Aslan et al., 2019). Fruits of other Sida spp. were demonstrated to

disperse readily by air or water when mature (Raju and Rani, 2016).

Some populations fell far from the zone of intersection. These included the Nihoa,

Makaleha (Kauaʻi), and Saddle Road (Hawaiʻi) mountain ecotype populations, along with some

individuals from beach ecotype populations. The mountain ecotypes were more ecologically

isolated from other parts of islands so they may have some unique genetic differences. Moreover,

the beach ecotypes could receive seeds from other parts of the Pacific via ocean currents and

accumulate some unique genetic diversity. This suggests that there is ongoing population

diversification, but gene flow among populations is keeping them from fully segregating from

others within their groups.

Overall, populations on a single island were more closely related to each other and to

populations on islands within their respective groups than they were to populations on other

islands. Because long distance seed dispersal via ocean currents is more probable for beach

ecotype populations, the beach ecotype populations of all islands showed somewhat closer

relationships to each other than to mountain ecotype populations and provided some continuity

among all the island groups. The overall genetic relationships among islands were to a large

138
extent predictive based on island position within the chain, and, to a lesser extent, within island

topography.

139
Litreture cited

Afgan, E., D. Baker, B. Batut, M. Van Den Beek, D. Bouvier, M. Ech, J. Chilton, et al. 2018.
The Galaxy platform for accessible, reproducible and collaborative biomedical analyses:
2018 update. Nucleic Acids Research 46: W537–W544.
Areces-Berazain, F., and J. D. Ackerman. 2017. Diversification and fruit evolution in
eumalvoids ( Malvaceae ). Botanical Journal of the Linnean Society 184: 401–417.
Areces-Berazain, F., and J. D. Ackerman. 2016. Phylogenetics, delimitation and historical
biogeography of the pantropical tree genus Thespesia (Malvaceae, Gossypieae). Botanical
Journal of the Linnean Society 181: 171–198.
Aslan, C. E., A. B. Shiels, W. Haines, and C. T. Liang. 2019. Non-native insects dominate
daytime pollination in a high-elevation Hawaiian dryland ecosystem. American Journal of
Botany 106: 313–324.
Baldwin, B. G., and M. J. Sanderson. 1998. Age and rate of diversification of the Hawaiian
silversword alliance (Compositae). Proceedings of the National Academy of Sciences of the
United States of America 95: 9402–9406.
Baum, D., and S. Smith. 2004. Phylogenetic relationships of Malvatheca (Bombacoideae and
Malvoideae; Malvaceae sensu lato) as inferred from plastid DNA sequences. American
Journal of Botany 91: 1863–1871.
Blankenberg, D., A. Gordon, G. Von Kuster, N. Coraor, J. Taylor, A. Nekrutenko, and G. Team.
2010. Manipulation of FASTQ data with Galaxy. Bioinformatics 26: 1783–1785.
Carlquist, S. (1974). 1974. Island Biology. Columbia University Press, New York.
Carlquist, S., B. G. Baldwin, and G. D. Carr. 2003. Tarweeds and silverswords: evolution of the
Madiinae (Asteraceae). Missouri Botanical Garden Press, Saint Louis, MO.
Catchen, J., P. A. Hohenlohe, S. Bassham, A. Amores, and W. A. Cresko. 2013. Stacks: an
analysis tool set for population genomics. Molecular Ecology 22: 3124–3140.
Catchen, J. M., A. Amores, P. Hohenlohe, W. Cresko, and J. H. Postlethwait. 2011. Stacks:
building and genotyping loci de novo from short-read sequences. G3: Genes, Genomes,
Genetics 1: 171–182.
Cole, D. M., and C. W. Morden. 2021. Population divergence and evolution of the Hawaiian
endemic Sesbania tomentosa (Fabaceae). Pacific Science 75: in press .
Darwin, C. 1859. The origin of species. Oxford University Press, Oxford.
Downey, K. 2017. All Hawaii news (cited October 2021). Civil beat. Website
https://www.civilbeat.org/2017/11/gop-lawmakers-open-papahanaumokuakea-to-
commercial-uses/.
Dray, S., and A. B. Dufour. 2007. The ade4 package: Implementing the duality diagram for
ecologists. Journal of Statistical Software 22: 1–20.
Gagné, W. C., and W. L. Cuddihy. 1999. Vegetation. In W. L. Wagner, D. R. Herbst, and S. H.

140
 Sohmer [eds.], Manual of the Flowering Plants of Hawai’i, University of Hawai‘i Press,
Honolulu, HI.
Givnish, T. J., K. C. Millam, A. R. Mast, T. B. Paterson, T. J. Theim, A. L. Hipp, J. M. Henss, et
al. 2009. Origin, adaptive radiation and diversification of the Hawaiian lobeliads (Asterales:
Campanulaceae). Proceedings of the Royal Society B: Biological Sciences 276: 407–416.
Gordon, A. 2010. FASTQ/A short-reads pre-processing tools. Retrieved from
http://hannonlab.cshl.edu/fastx_toolkit/.
Gower, J. C. 1971. A general coefficient of similarity and some of its properties. Biometrics 27:
857–871.
Grave, E. F. 2018. Reproductive ecology and population genetics of Hawaiian Wiliwili,
Erythrina sandwicensis (Fabaceae). Master thesis. University of Hawaii, Honolulu.
Handy, E. S. C., and E. G. Handy. 1991. Native Planters in Old Hawaii-Their Life, Lore, and
Environment. Bishop Museum Press, Honolulu, HI.
Huppman, E. R. H. 2013. Analysis of relationships among endemic Hawaiian Hibiscus. Doctoral
dissertation. University of Hawaii, Honolulu.
Johnson, M. A., Y. Pillon, T. Sakishima, D. K. Price, and E. A. Stacy. 2019. Multiple
colonizations, hybridization and uneven diversification in Cyrtandra (Gesneriaceae)
lineages on Hawai’i Island. Journal of Biogeography 46: 1178–1196.
Keeley, S. C., and V. A. Funk. 2011. Origin and evolution of Hawaiian endemics: new patterns
revealed by molecular phylogenetic studies. The biology of island floras (ed. by D.
Bramwell). Cambridge University Press, Cambridge.
Knope, M. L., C. W. Morden, V. A. Funk, and T. Fukami. 2012. Area and the rapid radiation of
Hawaiian Bidens (Asteraceae). Journal of Biogeography 39: 1206–1216.
Kovach. 2007. Kovach Computing Services 1987-99. Multi Variate Statistical Package, V. 3.0.
Kovach Computing Services, Pentraeth, Wales.
Krauss, B. H. 1993. Plants in Hawaiian. University of Hawaii Press, Honolulu, HI.
Lack, D. 1947. Darwin’s finches. Cambridge University Press, Cambridge.
Lindqvist, C., T. J. Motley, J. J. Jeffery, and V. A. Albert. 2003. Cladogenesis and reticulation in
the Hawaiian endemic mints (Lamiaceae). Cladistics 19: 480–495.
Martin, M. 2011. Cutadapt removes adapter sequences from high-throughput sequencing reads.
EMBnet.journal 17: 10.
Meirmans, P. G., and P. H. Van Tienderen. 2004. GENOTYPE and GENODIVE: Two programs
for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes 4: 792–
794.
Morden, C. W., V. Caraway, and T. J. Motley. 1996. Development of a DNA library for native
Hawaiian plants. Pacific Science 50: 324–335.
Neal, M. C. 1948. In Gardens of Hawaii. Bishop Museum special publication., Honolulu, HI.
141
Nei, M., and W.-H. Li. 1979. Mathematical Model for Studying Genetic Variation in Terms of
Restriction Endonucleases. Proceedings of the National Academy of Sciences of the United
States of America 76: 5269–5273.
Percy, D. M., A. M. Garver, W. L. Wagner, H. F. James, C. W. Cunningham, S. E. Miller, and
R. C. Fleischer. 2008. Progressive island colonization and ancient origin of Hawaiian
Metrosideros (Myrtaceae). Proceedings of the Royal Society B: Biological Sciences 275:
1479–1490.
Price, J. P., and W. L. Wagner. 2004. Speciation in Hawaiian angiosperm lineages : cause,
consequence, and mode. Evolution 58: 2185–2200.
R Core Team. 2021. R: A language and environment for statistical computing. R foundation for
statistical computing. https://www.R-project.org/.
Raju, A. J. S., and D. S. Rani. 2016. Pollination ecology of Sida acuta, S. cordata and S.
cordifolia (Malvaceae). phytologia balcanica 22: 363–376.
Sakai, A. K., S. G. Weller, W. L. Wagner, M. Nepokroeff, and T. M. Culley. 2006. Adaptive
radiation and evolution of breeding systems in Schiedea (Caryophyllaceae), an endemic
Hawaiian genus. Annals of the Missouri Botanical Garden 93: 49–63.
Schluter, D. 2000. The ecology of adaptive radiation. Oxford University Press, Oxford.
Shay, K., D. R. Drake, A. D. Taylor, H. F. Sahli, M. Euaparadorn, M. Akamine, J. Imamura, et
al. 2016. Alien insects dominate the plant-pollinator network of a hawaiian coastal
ecosystem. Pacific Science 70: 409–429.
Shay, K. R., and D. R. Drake. 2018. Pollination biology of the Hawaiian coastal vine
Jacquemontia sandwicensis (Convolvulaceae). Pacific Science 72: 485–499.
Sohmer, S. H., and R. Gustafson. 1987. Plants and flowers of Hawai’i. University of Hawaii
Press, Honolulu, HI.
Stephens, M. L. 2000. The comparative ecophysiology of mountain and coastal populations of
Sida fallax Walp. (Malvaceae) in Hawaii. Master thesis. University of Hawaii, Honolulu.
Suyama, Y., and Y. Matsuki. 2015. MIG-seq: An effective PCR-based method for genome-wide
single-nucleotide polymorphism genotyping using the next-generation sequencing platform.
Scientific Reports 5: 1–12.
Takayama, K., Y. Tateishi, J. Murata, and T. Kajita. 2008. Gene flow and population subdivision
in a pantropical plant with sea-drifted seeds Hibiscus tiliaceus and its allied species:
evidence from microsatellite analyses. Molecular Ecology 17: 2730–2742.
Wagner, W. L., and V. A. Funk. 1995. Hawaiian biogeography: evolution on a hot spot
archipelago. Smithsonian Institution Press, Washington, DC.
Wagner, W. L., D. R. Herbst, and S. H. Sohmer. 1999. Manual of the Flowering Plants of
Hawaii, revised edition. University of Hawaii Press, Honolulu.
Westerbergh, A., and A. Saura. 1994. Genetic differentiation in endemic Silene
(Caryophyllaceae) on the Hawaiian Islands. American Journal of Botany 81: 1487–1493.

142
Witter, M. S., and G. D. Carr. 1988. Adaptive radiation and genetic differentiation in the
Hawaiian silversword alliance (Compositae : Madiinae). Society for the Study of Evolution
42: 1278–1287.
Yorkston, M., and C. C. Daehler. 2006. Interfertility between Hawaiian ecotypes of Sida fallax
(Malvaceae) and evidence of a hybrid disadvantage. International Journal of Plant Sciences
167: 221–230.
Ziegler, A. C. 2002. Hawaiian natural history, ecology, and evolution. University of Hawaii
Press, Honolulu, HI.

143
 Chapter 5: Research questions revisited

The following research questions were formulated at the beginning of this dissertation

based on the research and literature on phylogeny and biogeography of Sida (Malveae,

Malvoideae, Malvaceae) and the phylogeny, biogeography, and population genetics of Sida

fallax. The following conclusions are drawn from the study.

Chapter 2:

Question 1: What are the relationships of Sida to other Malveae genera?

Sida as currently recognized is polyphyletic. My results support a Sida s.s. clade that represents

the true “Sida” and is sister to the monotypic genus Fryxellia. The main Sida clade consists of at

least 66 species including the type species, S. rhombifolia. There are at least 18 species currently

classified as Sida that were not within the main Sida clade and should be reevaluated.

Question 2: What are the relationships among Sida species?

The main Sida clade was divided into two major subclades, subclades I and II. Although only

one small section (section Stenindae) was monophyletic within the main Sida clade, subclade II

consisted entirely of species in section Nelavagae. However, section Nelavagae was not

monophyletic because one species was placed in subclade I. Subclade I consisted of six

subclades (I-A to I-F). The hypothesis for questions one and two was that Sida as currently

circumscribed is polyphyletic and in need of taxonomic revision. Therefore, the evidence of the

chapter supported this hypothesis.

Question 3: Are the sections within Sida monophyletic?

The previously identified section alliances are not consistent with the phylogeny and are in need

of reevaluation based on morphological and phylogenetic grounds. The hypothesis for question

144
three was that most sections of Sida are not monophyletic. Therefore, the evidence of the chapter

supported this hypothesis.

Question 4: Where are the centers of origin and diversity of Sida?

Evidence indicates that Sida is largely of Central and South American origins which is the center

of diversity of the genus. The hypothesis for this question was Sida originated from Australasia.

Therefore, the evidence of the chapter did not support this hypothesis.

Chapter 3:

Question 1: Where is the center of origin of S. fallax?

It is evident that its American origin is most likely, although the pattern of dispersal of S.

fallax is not clear. The hypothesis for this question was that the center of origin for S. fallax is

tropical China with subsequent dispersal to the islands of the Pacific, including the Hawaiian

Islands. Therefore, the evidence of the chapter did not support this hypothesis.

Question 2: Is S. fallax across its distribution a single species or should it be divided into

multiple species?

This study demonstrated clearly that Sida fallax is a single species throughout the Pacific

region and the different forms of Hawaiian S. fallax are not genetically distinct at the DNA

sequence level. The hypothesis for this question was Sida fallax is a single species throughout its

distribution. Therefore, the evidence of the chapter supported this hypothesis.

Chapter 4:

Question: Are there genetic differences among various morphological forms of S. fallax in the

Hawaiian Islands?

Populations on a single island were more closely related to each other and to populations

on islands within their respective groups than they were to populations on other islands. Three

145
main island groupings were evident in this study: 1) Oʻahu, Kauaʻi, and Nihoa; 2) Maui,

Molokaʻi, and Lānaʻi (collectively referred to as Maui Nui); 3) Hawaiʻi Island. Populations from

each island grouping intersect at the center of the PCO graph, the zone of intersection (ZOI),

suggesting gene flow still exists among them. There was a trend of coastal/beach populations

occurring more predominantly near the ZOI, and the mountain/inland or most isolated

populations being further away from the ZOI. Because long-distance seed dispersal via ocean

currents is more probable for beach ecotype populations, the beach ecotype populations of all

islands showed somewhat closer relationships to each other than to mountain ecotype

populations and provided some continuity among all the island groups. The overall genetic

relationships among islands were to a large extent predictive based on island position within the

chain, and, to a lesser extent, within island topography.

The hypothesis for this question was that genetic relations will mirror the dispersion

among islands. Parallel evolution is occurring with morphologically different forms on a single

island being more closely related to each other than they are to the morphologically similar

forms on different islands. Therefore, the evidence of the chapter supported this hypothesis.

146
Literature cited

Abadi, S., D. Azouri, T. Pupko, and I. Mayrose. 2019. Model selection may not be a mandatory
step for phylogeny reconstruction. Nature Communications 10: 934.
Adams, D. C., C. M. Berns, K. H. Kozak, and J. J. Wiens. 2009. Are rates of species
diversification correlated with rates of morphological evolution? Proceedings: Biological
Sciences 276: 2729–2738.
Afgan, E., D. Baker, B. Batut, M. Van Den Beek, D. Bouvier, M. Ech, J. Chilton, et al. 2018.
The Galaxy platform for accessible, reproducible and collaborative biomedical analyses:
2018 update. Nucleic Acids Research 46: W537–W544.
Álvarez, I., and J. F. Wendel. 2003. Ribosomal ITS sequences and plant phylogenetic inference.
Molecular Phylogenetics and Evolution 29: 417–434.
Alverson, W. S., K. G. Karol, D. A. Baum, M. W. Chase, M. Susan, W. S. Alverson, K. G.
Karol, et al. 1998. Circumscription of the Malvales and relationships to other Rosidae:
evidence from rbcL sequence data. American journal of botany 85: 876–887.
Alverson, W. S., B. A. Whitlock, R. Nyffeler, C. Bayer, and D. A. Baum. 1999. Phylogeny of the
core Malvales: Evidence from ndhF sequence data. American Journal of Botany 86: 1474–
1486.
Andreasen, K., and B. G. Baldwin. 2003. Reexamination of relationships, habital evolution, and
phylogeography of checker mallows (Sidalcea; Malvaceae) based on molecular
phylogenetic data. American Journal of Botany 90: 436–444.
APG IV. 2016. An update of the Angiosperm Phylogeny Group classification for the orders and
families of flowering plants: APG IV. Botanical Journal of the Linnean Society 181: 1–20.
Areces-Berazain, F., and J. D. Ackerman. 2017. Diversification and fruit evolution in
eumalvoids (Malvaceae). Botanical Journal of the Linnean Society 184: 401–417.
Areces-Berazain, F., and J. D. Ackerman. 2016. Phylogenetics, delimitation and historical
biogeography of the pantropical tree genus Thespesia (Malvaceae, Gossypieae). Botanical
Journal of the Linnean Society 181: 171–198.
Aslan, C. E., A. B. Shiels, W. Haines, and C. T. Liang. 2019. Non-native insects dominate
daytime pollination in a high-elevation Hawaiian dryland ecosystem. American Journal of
Botany 106: 313–324.
Baker, E. G. 1892. Synopsis of genera and species of Malveae, XVII. Sida. Journal of the
Botanical Research Institute of Texas 30: 138–142, 235–240, 290–296, 324–332.
Baker, R. M. 1998. Sida section Sida in Australia: a revised key, a newly introduced species, S.
subcordata span., and name changes for S. rohlenae var. Mutica (benth.) Fryxell and S.
magnifica Domin. Journal of the Adelaide Botanic Gardens 18: 33–41.
Baldwin, B. G. 1992. Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal
DNA in plants: An example from the compositae. Molecular Phylogenetics and Evolution
1: 3–16.

147
Baldwin, B. G., and M. J. Sanderson. 1998. Age and rate of diversification of the Hawaiian
silversword alliance (Compositae). Proceedings of the National Academy of Sciences of the
United States of America 95: 9402–9406.
Baldwin, B. G., M. J. Sanderson, M. Porter, M. F. Wojciechowski, C. S. Cambell, and M. J.
Donoghue. 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence
on angiosperm phylogeny. Annals of the Missouri Botanical Garden 82: 247–277.
Bates, D. M. 1974. Fryxellia , a new genus of North American Malvaceae. Brittonia 26: 95–100.
Bates, D. M. 1968. Generic relationships in the Malvaceae, tribe Malveae. Gentes Herbarum 10:
117–135.
Bates, D. M., and O. J. Blanchard. 1970. Chromosome numbers in the Malvales. II. New or
otherwise noteworthy counts relevant to classification in the Malvaceae, tribe Malveae.
American Journal of Botanyurnal of botany 57: 927–934.
Batista Lima, J., and A. de Souza Conceicao. 2016. Malvoideae Burnett (Malvaceae) in the
environmental protection area Serra Branca, Raso da Catarina, Jeremoabo, Bahia, Brazil.
Biotaneotropica 16: 395–409.
Baum, D. A., S. D. W. Smith, A. Yen, W. S. Alverson, R. Nyffeler, B. A. Whitlock, and R. L.
Oldham. 2004. Phylogenetic relationships of Malvatheca (Bombacoideae and Malvoideae;
Malvaceae sensu lato) as inferred from plastid DNA sequences. American Journal of
Botany 91: 1863–1871.
Bayer, C., M. F. Fay, A. Y. D. E. Bruijn, V. Savolainen, C. M. Morton, K. Kubitzki, W. S.
Alverson, et al. 1999. Support for an expanded family concept of Malvaceae within a
recircumscribed order Malvales: a combined analysis of plastid atpB and rbcL DNA
sequences. 267–303.
Bayer, C., and K. Kubitzki. 2003. Malvaceae. In K. Kubitzki and C. Bayer [eds.], Flowering
plants, dicotyledons: Malvales, Capparales, and nonbetalain Caryophyllales. 225–311.
Springer-Verlag, Berlin, Germany.
Bena, G., M. F. Jubier, I. Olivieri, and B. Lejeune. 1998. Ribosomal external and internal
transcribed spacers: Combined use in the phylogenetic analysis of Medicago
(Leguminosae). Journal of Molecular Evolution 46: 299–306.
Bentham, G., and D. Hooker. 1862. Malvaceae. In G. Bentham and J. D. Hooker [eds.], Genera
Plantarum. 195–213. London, England.
Blankenberg, D., A. Gordon, G. Von Kuster, N. Coraor, J. Taylor, A. Nekrutenko, and G. Team.
2010. Manipulation of FASTQ data with Galaxy. Bioinformatics 26: 1783–1785.
Brach, A. R., and H. Song. 2006. eFloras: New directions for online floras exemplified by the
Flora of China Project. Taxon 55: 188–192.
Burandt, C. L. 1992. A Monograph of Sida Sect. Oligandrae (Malvaceae). Systematic Botany 17:
164–179.
Burandt, C. L. 1991. Biocidal Sida (Malvaceae). Sida 14: 405–410.

148
de Candolle, A. P. 1824. Prodromus systematis naturalis regni vegetabilis. Vol. 1. Paris.
Carlquist, S. 1974. Island Biology. Columbia University Press, New York.
Carlquist, S., B. G. Baldwin, and G. D. Carr. 2003. Tarweeds and silverswords: evolution of the
Madiinae (Asteraceae). Missouri Botanical Garden Press, Saint Louis, MO.
Catchen, J., P. A. Hohenlohe, S. Bassham, A. Amores, and W. A. Cresko. 2013. Stacks: an
analysis tool set for population genomics. Molecular Ecology 22: 3124–3140.
Catchen, J. M., A. Amores, P. Hohenlohe, W. Cresko, and J. H. Postlethwait. 2011. Stacks:
building and genotyping loci de novo from short-read sequences. G3: Genes, Genomes,
Genetics 1: 171–182.
Christenhusz, M. J. M., and J. W. Byng. 2016. The number of known plants species in the world
and its annual increase. Phytotaxa 261: 201–217.
Clement, I. D. 1957. Studies in Sida. Contributions from the Gray Herbarium of Harvard
University 180: 5–91.
Cole, D. M., and C. W. Morden. 2021. Population divergence and evolution of the Hawaiian
endemic Sesbania tomentosa (Fabaceae). Pacific Science 75: in press .
Correll, D. S. 1968. Some additions to the flora of Texas—IV. Madroño 19: 187–192.
Crawford, D. J., and J. K. Archibald. 2017. Island floras as model systems for studies of plant
speciation: Prospects and challenges. Journal of Systematics and Evolution 55: 1–15.
Cronn, R. C., R. L. Small, T. Haselkorn, and J. F. Wendel. 2002. Rapid diversification of the
Cotton genus (Gossypium : Malvaceae) revealed by analysis of sixteen nuclear and
chloroplast genes. American Journal of Botany 89: 707–725.
Darwin, C. 1859. The origin of species. Oxford University Press, Oxford.
Diers, L. 1961. Der anteil an polyploiden in den vegetationsgürteln der westkordillere Perus.
Zeitschrift für Botanik 49: 437– 487.
Dong, W., J. Liu, J. Yu, L. Wang, and S. Zhou. 2012. Highly variable chloroplast markers for
evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PloS one 7: 1–
9.
Downey, K. 2017. All Hawaii news (cited October 2021). Civil beat. Website
https://www.civilbeat.org/2017/11/gop-lawmakers-open-papahanaumokuakea-to-
commercial-uses/.
Dray, S., and A. B. Dufour. 2007. The ade4 package: Implementing the duality diagram for
ecologists. Journal of Statistical Software 22: 1–20.
La Duke, J. C., and J. Doebley. 1995. A Chloroplast DNA Based Phylogeny of the Malvaceae.
Systematic Botany 20: 259–271.
eFloras. 2008. Published on the Internet http://www.efloras.org [accessed 15 February 2021]*’
Missouri Botanical Garden, St. Louis, MO & Harvard University Herbaria, Cambridge,
MA.
149
Ellstrand, N. C., and D. R. Elam. 1993. Population genetic conseqences of small population size:
Implications for plant conservation. Annual Review of Ecology and Systematics 24: 217–
242.
Escobar García, P., P. Schönswetter, J. Fuertes Aguilar, G. Nieto Feliner, and G. M.
Schneeweiss. 2009. Five molecular markers reveal extensive morphological homoplasy and
reticulate evolution in the Malva alliance (Malvaceae). Molecular Phylogenetics and
Evolution 50: 226–239.
Fernandez, A. 1974. Recuentos cromosómicos en Malváceas. Boletín de la Sociedad Argentina
de Botánica 15: 403–410.
Fernandez, A. 1981. Recuentos cromosomicos en Malvales. Bonplandia 5: 63–71.
Fernandez, A., A. Krapovickas, G. Lavia, and G. Seijo. 2003. Cromosomas de Malváceas.
Bonplandia 12: 141–145.
Fryxell, P. A. 1971. A New Genus from Mexico: Dendrosida (Malvaceae). Brittonia 23: 231–
237.
Fryxell, P. A. 1988. Malvaceae of Mexico. Systematic Botany Monographs 25: 1–522.
Fryxell, P. A. 1985. Sidus sidarum V. The North and Central American species of Sida. Sida 11:
62–91.
Fryxell, P. A. 1987. Sidus sidarum VII. The genus Sida (Malvaceae) in Australia. Sida 12: 22–
27.
Fryxell, P. A. 1997. The American Genera of Malvaceae_II. Brittonia 49: 204–269.
Fryxell, P. A. . 1978. Neotropical Segregates from Sida L. (Malvaceae). Brittonia 30: 447–462.
Fryxell, P. A., and J. Valdés R. 1991. Observations on Fryxellia pygmaea (Malvaceae). Sida 14:
399–404.
Fuertes Aguilar, J. 1995. Sida L. (Malvaceae). Flora de Colombia, 1–142.
Fuertes Aguilar, J., P. A. Fryxell, and R. K. Jansen. 2003. Phylogenetic relationships and
classification of the Sida generic alliance (Malvaceae) based on nrDNA ITS evidence.
Systematic Botany 28: 352–364.
Futuyma, D. J. 1987. On the role of species in anagenesis. The American Naturalist 130: 465–
473.
Gagné, W. C., and W. L. Cuddihy. 1999. Vegetation. In W. L. Wagner, D. R. Herbst, and S. H.
Sohmer [eds.], Manual of the Flowering Plants of Hawai’i, University of Hawai‘i Press,
Honolulu, HI.
GBIF.org. (01 June 2021) GBIF Occurrence Download. Website
https://doi.org/10.15468/dl.xrexrg.
Givnish, T. J. 2010. Ecology of plant speciation. Taxon 59: 1326–1366.
Givnish, T. J., K. C. Millam, A. R. Mast, T. B. Paterson, T. J. Theim, A. L. Hipp, J. M. Henss, et

150
 al. 2009. Origin, adaptive radiation and diversification of the Hawaiian lobeliads (Asterales:
Campanulaceae). Proceedings of the Royal Society B: Biological Sciences 276: 407–416.
Gordon, A. 2010. FASTQ/A short-reads pre-processing tools. Retrieved from
http://hannonlab.cshl.edu/fastx_toolkit/.
Gower, J. C. 1971. A general coefficient of similarity and some of its properties. Biometrics 27:
857–871.
Grant, P. R. 1986. Ecology and evolution of Darwin’s finches. Princeton University Press,
Princeton.
Grant, P. R. 1998. Evolution on islands. Oxford University Press, Oxford.
Grant, P. R., and B. R. Grant. 2014. 40 Years of Evolution: Darwin’s Finches on Daphne Major
Island. Princeton University Press, 2014. Princeton University Press, Princeton.
Grant, P. R., and B. R. Grant. 2008. How and why species multiply. The radiation of Darwin’s
finches. Princeton University Press, Princeton.
Grave, E. F. 2018. Reproductive ecology and population genetics of Hawaiian Wiliwili,
Erythrina sandwicensis (Fabaceae). Master thesis. University of Hawaii, Honolulu.
Handy, E. S. C., and E. G. Handy. 1991. Native Planters in Old Hawaii-Their Life, Lore, and
Environment. Bishop Museum Press, Honolulu, HI.
Hennig, W. 1966. Phylogenetic systematics. Urbana: Illinois Natural History Survey.
Holland, A. E., and S. T. Reynolds. 1988. Five new species of Sida L. (Malvaceae) from
Australia. Austrobaileya 2: 459–468.
Howarth, D. G., and D. A. Baum. 2005. Genealogical evidence of homoploid hybrid speciation
in an adaptive radiation of Scaevola (Goodeniaceae) in the Hawaiian Islands. Evolution 59:
948–961.
Howarth, D. G., M. H. G. Gustafsson, D. A. Baum, and T. J. Motley. 2003. Phylogenetics of the
genus Scaevola (Goodeniaceae): Implication for dispersal patterns across the Pacific Basin
and colonization of the Hawaiian Islands. American Journal of Botany 90: 915–923.
Huppman, E. R. H. 2013. Analysis of relationships among endemic Hawaiian Hibiscus. Doctoral
dissertation. University of Hawaii, Honolulu.
Hutchinson, J. 1967. The genera of flowering plants. Clarendon Press, Oxford, England.
Johnson, M. A., Y. Pillon, T. Sakishima, D. K. Price, and E. A. Stacy. 2019. Multiple
colonizations, hybridization and uneven diversification in Cyrtandra (Gesneriaceae)
lineages on Hawai’i Island. Journal of Biogeography 46: 1178–1196.
Judd, W. S., and S. R. Manchester. 1997. Circumscription of Malvaceae (Malvales) as
determined by a preliminary cladistic analysis of morphological, anatomical, palynological,
and chemical characters. Brittonia 49: 384–405.
Kaaiakamanu, D. M., and J. K. Akina. 2003. Hawaiian Herbs of Medicinal Value . Pacific Book
House. Pacific Book House, Honolulu.
151
Karou, D., A. Savadogo, A. Canini, S. Yameogo, C. Montesano, J. Simpore, V. Colizzi, and A.
S. Traore. 2006. Antibacterial activity of alkaloids from Sida acuta. African Journal of
Biotechnology 4: 1452–1457.
Kearney, T. H. 1954. A tentative key to the North American species of Sida L. Leafl. W. Bot. 7:
138–150.
Kearney, T. H. 1949. Malvaceae: a new subtribe and genus, and new combinations. Leaflets of
Western Botany 5: 189–191.
Kearney, T. H. 1951. The American Genera of Malvaceae. American Midland Naturalist 46: 93–
131.
Keast, A. 1996. Pacific biogeography: patterns and processes. In: Keast A, Miller SE, eds. The
origin and evolution of Pacific Island biotas, New Guinea to eastern Polynesia: patterns and
processes. Amsterdam: SPB Academic Publishing: 477–512.
Keeley, S. C., and V. A. Funk. 2011. Origin and evolution of Hawaiian endemics: new patterns
revealed by molecular phylogenetic studies. The biology of island floras (ed. by D.
Bramwell). Cambridge University Press, Cambridge.
Kirch, P. V. 2017. On the Road of the Winds: An Archaeological History of the Pacific Islands
before European Contact. 2nd edition. University of California Press, Berkeley.
Knope, M. L., C. W. Morden, V. A. Funk, and T. Fukami. 2012. Area and the rapid radiation of
Hawaiian Bidens (Asteraceae). Journal of Biogeography 39: 1206–1216.
Koopman, M. M., and D. A. Baum. 2008. Phylogeny and Biogeography of Tribe Hibisceae
(Malvaceae) on Madagascar. Systematic Botany 33: 364–374.
Kovach. 2007. Kovach Computing Services 1987-99. Multi Variate Statistical Package, V. 3.0.
Kovach Computing Services, Pentraeth, Wales.
Krapovickas, A. 2007. A Las especies de sida secc. Malacroideae (Malvaceae) del cono sur de
Sudamérica. Bonplandia 16: 209–253.
Krapovickas, A. 2006. Las especies Argentinas y de países vecinos de Sida secc. Nelavaga
(Malvaceae, Malveae). Bonplandia 15: 5–45.
Krapovickas, A. 2012. Novedades en las secciones Cordifoliae, Distichifolia, Malacroidea,
Muticae Y Nelavaga del género Sida (Malvaceae). Bonplandia 21: 77–92.
Krapovickas, A. 2003a. Revisión de Sida Sección Muticae C. Presl (Malvaceae-Malveae).
Bonplandia 12: 123–132.
Krapovickas, A. 2003b. Sida seccion Distichifolia (Monteiro) Kapov. COMB. NOV., STAT.
NOV. (Malvacae-Malveae). Bonplandia 12: 83–121.
Krapovickas, A. 2003c. Tropidococcus Krapov., nuevo género de Malváceas. Bonplandia 12:
63–66.
Krauss, B. H. 1979. Native plants used as medicine in Hawaii.
Krauss, B. H. 1993. Plants in Hawaiian. University of Hawaii Press, Honolulu, HI.
152
Kumar, S., G. Stecher, M. Li, C. Knyaz, and K. Tamura. 2018. MEGA X: Molecular
evolutionary genetics analysis across computing platforms. Molecular Biology and
Evolution 35: 1547–1549.
Lack, D. 1947. Darwin’s finches. Cambridge University Press, Cambridge.
Lindqvist, C., T. J. Motley, J. J. Jeffery, and V. A. Albert. 2003. Cladogenesis and reticulation in
the Hawaiian endemic mints (Lamiaceae). Cladistics 19: 480–495.
Lourenco Brandao, J., G. Sidney Baracho, M. Ferreira de Sales, and M. P. Viegas Filho. 2017.
Synopsis of Sida (Malvaceae, Malvoideae, Malveae) in the state of Pernambuco, Brazil.
Phytotaxa 307: 205–227.
Martin, M. 2011. Cutadapt removes adapter sequences from high-throughput sequencing reads.
EMBnet.journal 17: 10.
Medeiros, I. A., M. R. V Santos, N. M. S. Nascimento, and J. C. Duarte. 2006. Cardiovascular
effects of Sida cordifolia leaves extract in rats. Fitoterapia 77: 19–27.
Meirmans, P. G., and P. H. Van Tienderen. 2004. GENOTYPE and GENODIVE: Two programs
for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes 4: 792–
794.
Melville, R. 1966. Contributions to the Flora of Australia: VII: generic delimitation in the
Plagianthus complex. Kew Bulletin 20: 511–516.
Miller, M. A., W. Pfeiffer, and T. Schwartz. 2010. Creating the CIPRES Science Gateway for
inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop,
GCE 2010.
Mitchell, A. D., P. B. Heenan, and A. M. Paterson. 2009. Phylogenetic relationships of
Geranium species indigenous to New Zealand. New Zealand Journal of Botany 47: 21–31.
Monteiro, H. 1949. As especies argentinas, brasileiras e uruguayas da seccaoa Malvinda do
genero Sida. Lilloa 17: 501–522.
Monteiro, H. 1974. Comentários sobre algumas especies de Cavanilles. Portugaliae Acta Biol
12: 132–141.
Monteiro, H. 1966. Pseudomalachra , novo género de Malvaceae. Anais do XVII Congreso
Brasileiro de Botanica, 115–118.
Monteiro, H. 1967. Revisão das espeécies do gênero Sida secçaõ Sida subsecçaõ Distichaefolia.
Anais do XVII Congreso Brasileiro de Botanica, 53–71.
Morden, C. W., V. Caraway, and T. J. Motley. 1996. Development of a DNA library for native
Hawaiian plants. Pacific Science 50: 324–335.
Morden, C. W., D. E. Gardner, and D. A. Weniger. 2003. Phylogeny and biogeography of pacific
Rubus subgenus Idaeobatus (Rosaceae) species: Investigating the origin of the endemic
Hawaiian raspberry R. macraei. Pacific Science 57: 181–197.
Motteler, L. S., and E. H. Bryan. 2006. Pacific island names: a map and name guide to the new

153
 Pacific. Bishop Museum Press, Honolulu.
Neal, M. C. 1948. In Gardens of Hawaii. Bishop Museum special publication., Honolulu, HI.
Neall, V. E., and S. A. Trewick. 2008. The age and origin of the Pacific islands: A geological
overview. Philosophical Transactions of the Royal Society B: Biological Sciences 363:
3293–3308.
Nei, M., and W.-H. Li. 1979. Mathematical model for studying genetic variation in terms of
restriction endonucleases. Proceedings of the National Academy of Sciences of the United
States of America 76: 5269–5273.
Nyffeler, R., C. Bayer, W. S. Alverson, A. Yen, B. A. Whitlock, M. W. Chase, and D. A. Baum.
2005. Phylogenetic analysis of the Malvadendrina clade (Malvaceae s.l.) based on plastid
DNA sequences. Organisms Diversity and Evolution 5: 109–123.
Olmstead, R. G., J. A. Sweere, and K. H. Wolfe. 1993. Ninety extra nucleotide in ndhF gene of
tobacco chloroplast DNA: a summary of revisions to the 1986 genome sequence. Plant
Molecular Biology 22: 1191–1193.
Percy, D. M., A. M. Garver, W. L. Wagner, H. F. James, C. W. Cunningham, S. E. Miller, and
R. C. Fleischer. 2008. Progressive island colonization and ancient origin of Hawaiian
Metrosideros (Myrtaceae). Proceedings of the Royal Society B: Biological Sciences 275:
1479–1490.
Pfeil, B. E., C. L. Brubaker, L. A. Craven, and M. D. Crisp. 2002. Phylogeny of Hibiscus and the
tribe Hibisceae (Malvaceae) using chloroplast DNA sequences of ndhF and the rpl16 intron.
Systematic Botany 27: 333–350.
Price, J. P., and W. L. Wagner. 2004. Speciation in Hawaiian angiosperm lineages : cause,
consequence, and mode. Evolution 58: 2185–2200.
R Core Team. 2021. R: A language and environment for statistical computing. R foundation for
statistical computing. https://www.R-project.org/.
Raju, A. J. S., and D. S. Rani. 2016. Pollination ecology of Sida acuta, S. cordata and S.
cordifolia (Malvaceae). phytologia balcanica 22: 363–376.
Rambaut, A., M. A. Suchard, D. Xie, and J. Drummond. 2014. Tracer v1.6 Available from
<http://beast.bio.ed.ac.uk/Tracer>.
Randell, R. A., and C. W. Morden. 1999. Hawaiian Plant DNA Library II: Endemic, indigenous,
and introduced species. Pacific Science 53: 401–417.
Ray, M. F. 1995. Systematics of Lavatera and Malva (Malvaceae, Malveae) — a new
perspective. Plant Systematics and Evolution 198: 29–53.
Reguero, M., F. Goin, H. C. Acosta, T. Dutra, and S. Marenssi. 2013. Late Cretaceous/Paleogene
west Antarctica terrestrial biota and its intercontinental affinities. Springer, Berlin.
Rijsdijk, K. F., T. Hengl, S. J. Norder, R. Otto, B. C. Emerson, S. P. Ávila, H. López, et al. 2014.
Quantifying surface-area changes of volcanic islands driven by Pleistocene sea-level cycles:
Biogeographical implications for the Macaronesian archipelagos. Journal of Biogeography

154
 41: 1242–1254.
Ronquist, F., M. Teslenko, P. Van Der Mark, D. L. Ayres, A. Darling, S. Höhna, B. Larget, et al.
2012. Mrbayes 3.2: Efficient bayesian phylogenetic inference and model choice across a
large model space. Systematic Biology 61: 539–542.
Roy, T., T. H. Chang, T. Lan, and C. Lindqvist. 2013. Phylogeny and biogeography of New
World Stachydeae (Lamiaceae) with emphasis on the origin and diversification of Hawaiian
and South American taxa. Molecular Phylogenetics and Evolution 69: 218–238.
Rundell, R. J., and T. D. Price. 2009. Adaptive radiation, nonadaptive radiation, ecological
speciation and nonecological speciation. Trends Ecol Evol. 2009 Jul;24(7):394-9. doi:
10.1016/j.tree.2009.02.007. Epub 2009 May 4. PMID: 19409647. Trends in Ecology and
Evolution 24: 394–399.
Sakai, A. K., S. G. Weller, W. L. Wagner, M. Nepokroeff, and T. M. Culley. 2006. Adaptive
radiation and evolution of breeding systems in Schiedea (Caryophyllaceae), an endemic
Hawaiian genus. Annals of the Missouri Botanical Garden 93: 49–63.
Sang, T., D. J. Crawford, and T. F. Stuessy. 1997. Chloroplast DNA phylogeny, reticulate
evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84:
1120–1136.
Schluter, D. 2000. The ecology of adaptive radiation. Oxford University Press, Oxford.
Schneider, J. V., K. Schulte, J. F. Aguilar, and M. L. Huertas. 2011. Molecular evidence for
hybridization and introgression in the neotropical coastal desert-endemic Palaua (Malveae,
Malvaceae). Molecular Phylogenetics and Evolution 60: 373–384.
Schumann, K. 1890. Malvaceae. In A. Engler and K. Prantl [eds.], Die naturlichen
pflanzenfamilien. 30–53. Wilhelm Engelmann, Leipzig, Germany.
Seelanan, T., A. Schnabel, and J. F. Wendel. 1997. Congruence and Concensus in Cotton Tribe
(Malvaceae). Systematic Botany 22: 259–290.
Sequencher®. 1995. Version 5.4.6 DNA sequence analysis software, Gene Codes Corporation,
Ann Arbor, MI USA http://www.genecodes.com.
Shay, K., D. R. Drake, A. D. Taylor, H. F. Sahli, M. Euaparadorn, M. Akamine, J. Imamura, et
al. 2016. Alien insects dominate the plant-pollinator network of a hawaiian coastal
ecosystem. Pacific Science 70: 409–429.
Shay, K. R., and D. R. Drake. 2018. Pollination biology of the Hawaiian coastal vine
Jacquemontia sandwicensis (Convolvulaceae). Pacific Science 72: 485–499.
Siedo, S. J. 2001. A new species of Sida sect. Ellipticifoliae (Malvaceae). Lundellia 4: 69–75.
Siedo, S. J. 1999. At taxonomic treatment of Sida Sect. Ellipticifoliae (Malvaceae). Lundellia 2:
100–127.
Siedo, S. J. 2014. Sida littoralis, a new name for a species of Sida sect. Ellipticifoliae
(Malvaceae) endemic to Florida. Phytoneuron 75: 1–5.

155
Singh, D. K., P. K. Singh, R. K. Pandey, and R. K. Agnihotri. 2021. Ethno botanical approaches,
pharmacological and phytochemical benefits of genus Sida used in traditional medicines.
Journal of Medical Pharmaceutical and Allied Sciences 10: 3304–3309.
Slatkin, M. 1987. Gene flow and the geographic structure of natural populations. Science 236:
787–792.
Small, R. L. R. 2004. Phylogeny of Hibiscus sect. Muenchhusia (Malvaceae) based on
chloroplast rpL16 and ndhF, and nuclear ITS and GBSSI sequences. Systematic Botany 29:
385–392.
Sohmer, S. H., and R. Gustafson. 1987. Plants and flowers of Hawai’i. University of Hawaii
Press, Honolulu, HI.
Soltis, D. E., M. E. Mort, M. Latvis, E. V Mavrodiev, C. Brian, S. American, N. May, et al.
2013. Phylogenetic relationships and character evolution analysis of Saxifragales using a
supermatrix approach. American journal of botany 100: 916–929.
Staples, G. W., and D. R. Herbst. 2005. A tropical garden flora. Bishop Museum Press,
Honolulu.
Stephens, M. L. 2000. The comparative ecophysiology of mountain and coastal populations of
Sida fallax Walp. (Malvaceae) in Hawaii. Master thesis. University of Hawaii, Honolulu.
Suyama, Y., and Y. Matsuki. 2015. MIG-seq: An effective PCR-based method for genome-wide
single-nucleotide polymorphism genotyping using the next-generation sequencing platform.
Scientific Reports 5: 1–12.
Takayama, K., D. J. Crawford, P. López-Sepúlveda, J. Greimler, and T. F. Stuessy. 2018. Factors
driving adaptive radiation in plants of oceanic islands: a case study from the Juan Fernández
Archipelago. Journal of Plant Research 131: 469–485.
Takayama, K., T. Kajita, J. Murata, and Y. Tateishi. 2006. Phylogeography and genetic structure
of Hibiscus tiliaceus - Speciation of a pantropical plant with sea-drifted seeds. Molecular
Ecology 15: 2871–2881.
Takayama, K., Y. Tateishi, J. Murata, and T. Kajita. 2008. Gene flow and population subdivision
in a pantropical plant with sea-drifted seeds Hibiscus tiliaceus and its allied species:
evidence from microsatellite analyses. Molecular Ecology 17: 2730–2742.
Tate, J. A. 2003. Andeimalva, a New Genus of Malvaceae from Andean South America.
Lundellia 6: 10–18.
Tate, J. A. 2011. The status of Urocarpidium (Malvaceae): Insight from nuclear and plastid-
based phylogenies. Taxon 60: 1330–1338.
Tate, J. A., J. F. Aguilar, S. J. Wagstaff, J. C. La Duke, T. A. Bodo Slotta, and B. B. Simpson.
2005. Phylogenetic relationships within the tribe Malveae (Malvaceae, subfamily
Malvoideae) as inferred from ITS sequence data. American Journal of Botany 92: 584–602.
Tate, J. A., and B. B. Simpson. 2003. Paraphyly of Tarasa (Malvaceae) and diverse origins of the
polyploid species. Systematic Biology 28: 723–737.

156
Vollesen, K. 1986. The Sida cuneifolia-complex (Malvaceae) in Africa. Kew Bulletin 41: 91–98.
Wagner, W. L., and V. A. Funk. 1995. Hawaiian biogeography: evolution on a hot spot
archipelago. Smithsonian Institution Press, Washington, DC.
Wagner, W. L., D. R. Herbst, and S. H. Sohmer. 1999. Manual of the Flowering Plants of
Hawaiʻi, revised edition. University of Hawaiʻi Press, Honolulu.
Weakley, A. S., B. A. Sorrie, R. J. LeBlond, D. B. Poindexter, A. J. Floden, E. E. Schilling, A.
R. Franck, and J. C. Kees. 2017. New combinations, rank changes, and nomenclatural and
taxonomic comments in the Vascular Flora of the Southeastern United States. II. Journal of
the Botanical Research Institute of Texas 12: 461–480.
Weller, S. G., C. A. Domínguez, F. E. Molina-Freaner, J. Fornoni, and G. LeBuhn. 2007. The
evolution of distyly from tristyly in populations of Oxalis alpina (Oxalidaceae) in the Sky
Islands of the Sonoran Desert. American Journal of Botany 94: 972–985.
Westerbergh, A., and A. Saura. 1994. Genetic differentiation in endemic Silene
(Caryophyllaceae) on the Hawaiian Islands. American Journal of Botany 81: 1487–1493.
WFO (2021): World Flora Online. Website http://www.worldfloraonline.org.
White, T. J., Bruns T, Lee S., T. J. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and
T. J. White [eds.], PCR Protocols: A guide to methods and applications. Academic Press,
New York, 315–322.
Whittall, J., A. Liston, S. Gisler, and R. J. Meinke. 2000. Detecting nucleotide additivity from
direct sequences is a SNAP: An example from Sidalcea (Malvaceae). Plant Biology 2: 211–
217.
Wight, R. 1837. Dictyocarpus. Madras Journal of literature and Science 5: 309.
Wikipedia. [internet]. [accessed 24 October 2021]. Available from:
https://en.wikipedia.org/wiki/Polynesia.
Willdenow, C. L. 1801. Species Plantarum. 755. Nauk, Berlin.
Witter, M. S., and G. D. Carr. 1988. Adaptive radiation and genetic differentiation in the
Hawaiian silversword alliance (Compositae : Madiinae). Society for the Study of Evolution
42: 1278–1287.
Wright, S. D., C. G. Yong, S. R. Wichman, J. W. Dawson, and R. C. Gardner. 2001. Stepping
stones to Hawaii: A trans-equatorial dispersal pathway for Metrosideros (Myrtaceae)
inferred from nrDNA (ITS + ETS). Journal of Biogeography 28: 769–774.
Yorkston, M., and C. C. Daehler. 2006. Interfertility between Hawaiian ecotypes of Sida fallax
(Malvaceae) and evidence of a hybrid disadvantage. International Journal of Plant Sciences
167: 221–230.
Ziegler, A. C. 2002. Hawaiian natural history, ecology, and evolution. University of Hawaii
Press, Honolulu, HI.

157