Current Health Sciences Journal Vol. 46, No.

1, 2020 January-March

Original Paper
Seroprevalence of Human Parvovirus B19 in
Neurological Patients: Findings from Region of
Western Saudi Arabia
AYMAN KHALID JOHARGY1, ADIL JAMAL2, SAMI SADAGAH ASHGAR3,
FAHAD RAEES AHMED4, MAMDOUH HASAN KALKATAWI5
1
Department of Microbiology, College of Medicine, Umm Al-Qura University, Saudi Arabia
2
Nursing Sciences&Research, College of Nursing Umm Al-Qura University, Saudi Arabia
3
Department of Microbiology, College of Medicine, Umm Al-Qura University, Saudi Arabia
4
Department of Microbiology, College of Medicine, Umm Al-Qura University, Saudi Arabia
5
Department of Neurology, Al Noor Specialists Hospital, Saudi Arabia

ABSTRACT: Human parvovirus (HPVB19) infection causes Erythema infectiosum, aplastic crises in persons with
blood disorders, aplastic anemia and several other complications such as hydrops fetalis, spontaneous abortions. To
reduce the risk of contamination, plasma screening is recommended. This study was planned to determine the
seroprevalance of IgG and IgM antibodies in neurological patients infected with HPVB19 and assess possible risk
factors for B19 virus transmission. This cross-sectional descriptive study comprised 140 neurological patients. Serum
samples were screened for both IgG and IgM against parvovirus by ELISA. Nested PCR was performed for B19 DNA
detection. In 140 patients’ samples, Seroprevalance of 6.4% and 3.5% was obtained for HPVB19 for IgG and IgM
respectively. Net dual seropositivity (IgG and IgM) was 3.5% recorded among patients aged groups ranging<1-10
years, 31-40 years and 51-60 years. Nested PCR showed around 6.42% B19 viral DNA prevalence among all
samples analyzed. Organ transplant (OR=1.2:1, P=0.1), thalassemia (OR=1.2:1, P=0.1) and pregnancy (OR=0.9:1,
P=0.80) were less important risk factors for HPVB19 transmission in current study. Having history of blood
transfusion (OR=1.9:1, P=0.05) showed maximum fold risk and significant association of HPVB19 infection in
neurological disease patients. B19 prevalence was low in western region compared to serological studies conducted
in other regions in past. Very low prevalence of B19 in neurological patients have no significant provision with
associated risk factors. However further studies need to elucidate the HPVB19 etiological role in neurological disease
patients.

KEYWORDS: Parvovirus B19, IgG, IgM, Nested PCR, Risk factors.

Introduction red blood cell lysis, hydrops fetalis, spontaneous

Human parvovirus B19 (B19) is member of abortion and fetal death [5].
genus Erythrovirus belonging to family B19 causes erythema infectiosum (fifth
Parvoviridae encoding non-structural protein disease) in children arising various clinical
(NS-1) along two viral capsid protein, VP1 and manifestations and complications whose clinical
VP2. VP1 protein detected in lymphocytes, features rely on the connection among viral
neutrophils, macrophages and lymphocytes. features and immunity and physiological aspect
B19 since its accidental discovery during of infected individual [6].
healthy blood donors screening for hepatitis B B19 infection may lead to
[1] and since that it has been documented as glomerulonephritis, myocarditis, hepatic
significant cause of morbidity and mortality failure and peripheral neuropathies [7] and its
among various patients with different age groups infection may lead to red cell aplasia severe
[2]. anemia and less frequently neutropenia and
B19 is the causative agent for number for thrombocytopenia in immunocompromised
diseases [3] and its infection is a global issue. patients [8].
B19 can be found in respiratory secretions and Few reports reveal the role of B19 infection
blood of infectious persons. B19 transmission in association with various clinical syndromes
occurs paternally by transfusion, infectious and neurological disorders. However its role in
products of blood during short viremic phase unclear and not completely implicated yet.
[4]. Survey of various databases revealed 89 articles
In pregnant women, B19 infection occurs describing 129 patients; related to association of
vertically from mother to fetus that results fetal central nervous and peripheral nervous
manifestations with 79 (61.2%) and 41(31.8%)

10.12865/CHSJ.46.01.03 16
Ayman Khalid Johargy et al. - Seroprevalance of HPVB19 in Neurological Patients in Arabia

respectively were associated with myalgic Study population and sample collection
encephalomyelitis [9]. A total of 140 cerebrospinal fluid (CSF)
In another report, it was concluded that acute samples without known genders from different
encephalitis and encephalopathy are most hospitals of Makkah were enrolled in this study
common reason accounting for 38.8% of total between February to August 2015.
B19-associated neurological manifestations [10]. All randomly selected patients in this cross
Specific antibodies (IgA, IgG and IgM) are sectional seroprevalence study were Saudi
produced following natural infection. IgA and national (age ranged between 1-70 years; mean
IgG immunoglobulin can be detected and may age 23+5 years).
play protection against infection. IgM antibody From each enrolled patient, 10mL CSF was
remains in serum samples probably for several collected in sterile tubes.
months [11]. Aliquots from each sample were prepared in
Parvovirus infection diagnosis is possible in 1.5mL Eppendorf tube containing 50μl of 10%
case of recent infection specifically through IgM Tween-20 (Tw20).
detection [12]. All vials were thoroughly mixed by inverting
An immunohistochemical approach 15-20 times and then kept at room temperature
involving monoclonal antibody is routinely used for 15 minutes.
in parvovirus B19 infection in processed tissues All samples were centrifuged (2000g, 10min)
[13]. at room temperature.
Apart from antibodies detection, various Supernatant was transferred into another
other molecular tools like in situ or dot blot sterile tubes and stored immediately at -80 oc
hybridization and PCR are also used for B19 until used for immunoglobulin testing and
DNA detection during parvovirus infection [14]. nested PCR analysis.
Nested PCR based, a sensitive and rapid
Detection of B19 specific IgG and IgM
approach is used in B19 detection [15].
antibodies
Though the connotation between B19 and
The 140 consecutive samples were screened
neurological manifestations has been
for both IgG and IgM antibodies
documented, still there is lack of information
using recombinant antigens (MIKROGEN
regarding the seroprevalence of B19 and
DIAGNOSTIK recomLine Parvovirus B19 IgG
associated neurological risk factors among
Cat#4472, recomLine Parvovirus B19 IgM
individuals in Saudi Arabia. Current study
Cat#4473, Germany) as described by
aimed the molecular detection and
manufacturer guidelines.
seroprevalence of IgG antibodies to B19
The samples for immunoglobulins detection
infected patients in order to further elaborate the
were tested using ELISA system (Human
effect of B19 infection among neurological
Diagnostics, Wiesbaden, Germany).
patients and provide the information on the
Values were calculated as ratio of CSF
immune status of patients infected to virus. In
sample optical density (OD 450nm) calculations to
this study, besides serological detection, nested
cutoff’s OD450nm. An index value >1.0 or <0.9
based polymerase chain approach was
indicated sample positivity or negativity
performed because of its high sensitivity,
respectively.
specificity, minimum cross reactivity and
capability to detect both acute and persistent Amplification of viral DNA
B19 infections [16] Viral DNA extraction from CSF samples was
performed using viral DNA extraction kit
Materials and Methods (QIAamp DNA Mini Kit, Cat#51304, Germany)
as per manufacturer instructions.
Ethical approval Extracted DNA samples were further cleaned
For entire protocol, study ethical approval up before PCR to avoid any inhibitors, enzymes
was obtained from the Institutional Review and others contaminations using DNA Clean and
Board (IRB) Faculty of Medicine, Umm concentrator Kit (ZYMO RESEARCH kit DNA
Al-Qura University, Makkah, Saudi Arabia. Clean and Concentrator-25 Cat# D4033, USA)
The patients included were informed about strictly following manufacturer guidelines.
objective and purpose of study. Eluted DNA was then stored immediately
Informed consents were obtained from all the at-20oc.
patients enrolled in study. Viral DNA samples were amplified using
nested based PCR approach. First round nested

17 10.12865/CHSJ.46.01.03
Current Health Sciences Journal Vol. 46, No. 1, 2020 January-March

PCR was performed in 25μl reaction The prevalence of IgG and IgM were
volume containing 5μl DNA with 2μl (10pmol) analyzed according to the age groups and it was
of each primer; outer sense oligonucleotide interpreted that age group <1 year, 1-10, 11-20,
(5’AATACACTGTGGTTTTATGGGCCG3’) 21-30 showed similar prevalence of IgG and
(position1392-1422) and outer antisense IgM antibodies 10.5%, 8.3%, 5.6%, 11.1%
oligonucleotide (5’ CCATTGCTGGTTATAAC respectively while age group of 31-40 1nd 51-60
CACAGGT 3’) (position 1659-1682) using revealed 10% and 5.6% proportion positive for
thermocycler (Applied Biosystems, Veriti IgG antibodies.
96 well thermal cycler, USA). 0.5μl of 2mM Out of total 140 samples tested, net
dNTPs mix, 0.75μl of 25mM MgCl2, 1.25U Taq prevalence of IgG and IgM to human parvovirus
polymerase (Thermo Scientific™ DreamTaq in our study was 6.4% and 3.5% respectively
DNA Polymerase, Cat#EP0702), 2.5μl 10x (Table 1).
buffer. Table 1. Prevalence of HPVB19 immunoglobulins
First round of nested PCR was performed at IgG and IgM according to age groups
5min at 94oc, followed by 35 cycles of
denaturation at 95 oc for 40 s, annealing at 54 oc Age
Number
IgG IgG
95%
groups positive negative P
for 45 s and extension at 72 oc for 30 sec. (years)
(n)
n (%) n (%)
CI
A volume of 4μl of the first round nested <1 17
19 2 (10.5) 35-62
PCR product was used in second round of nested year (89.4)
11
PCR. 1-10 12 1 (8.3)
(91.6)
31-59
Second round of nested PCR was performed 17
11-20 18 1 (5.6) 37-61
by 35 amplification cycles with similar (94.5)
16
amplification profile as that of first round. 21-30 18 2 (11.1)
(88.8)
41-67
Second round of nested PCR was 31-40 20 2 (10) 18 (90) 42-69
performed with inner sense nucleotide (5 20 0.475
41-50 20 0 (0) 21-52
´AATGAAAACTTTCCATTTAATGATGTAG (100)
3´) (position 1498-1525) and inner antisense 51-60 18 1 (5.6)
17
39-70
(94.5)
nucleotide (5 15
61-70 15 0 (0) 18-46
´CTAAAATGGCTTTTGCAGCTTCTAC 3´) (100)
(position 1576-1600). Amplicons were resolved 131
Total 140 9 (6.4)
(93.5)
using 2% agarose gel electrophoresis and IgM IgM
Number 95%
analyzed by UV light. (n)
positive negative
CI
P
n (%) n (%)
Statistical analysis <1
19 2 (10.5)
17
35-62
Data was statistically analyzed using SPSS year (89.4)
11
(ver 16.0). 1-10 12 1 (8.3)
(91.6)
31-59
Prevalence rates of B19 IgG and IgM 11-20 18 0 (0)
18
22-51
antibodies was analyzed by chi square test. (100)
18
To check the significance, 95% confidence 21-30 18 0 (0)
(100)
22-51
interval (CI) was used and P-values <0.05 were 31-40 20 1 (5) 19 (95) 38-69
considered significant statistically. 20
0.381
41-50 20 0 (0) 21-52
(100)
Results 51-60 18 1 (5)
17
39-70
(94.4)
The study included 140 neurological patients. 61-70 15 0 (0)
15
18-46
The age distribution of our cases included 20 (100)
135
patients (14.2%) between 31-40, and 41-60 Total 140 5 (3.5)
(96.4)
followed by 19 (13.5%) patients less than 1 year Note: n=frequency (number); CI=confidence interval
old.
Patients 11-20, 21-30, 51-60 years of age The IgM and IgG antibodies assay detected
comprised 12.8% of study population while HPVB19 antigens. Presence of viral proteins
cases between 1-10 and 61-70 years of age terminals i,e., VP-N (N-terminal half of the
comprised 12% and 15% of patients structural proteins) and VP-C (C terminal half of
respectively. structural proteins), NS-1 (non-structural
Initially all the 140 samples were screened protein) and VP-1S (unique region of VP1
for both antibodies (IgG and IgM) detection in (VP1u)) tested by recom Line dot blot assays
CSF samples. confirmed the samples positivity and negativity
(Figure 1).

10.12865/CHSJ.46.01.03 18
Ayman Khalid Johargy et al. - Seroprevalance of HPVB19 in Neurological Patients in Arabia

Subsequently, out of 140 CSF samples, a The results suggest that positive HPVB19
total of 9 samples positive for IgG and IGM seroprevalance in patients revealed a possible
were subsequently examined for nested PCR link between B19 infection and neurological
assay. patients.
Molecular detection confirmed prevalence
percentage of 6.42% in seropositive samples of
neurological patients.

Figure 1. PCR for HPVB19. Lane 1 and 13 show 100bp DNA ladder,
Lane 2-3, 5-11 indicating total 9 PCR positive samples with product size of 102bp.
Lane 4 and Lane 12 represent positive and negative control respectively.

Risk factors might be associated with Table 2. Possible risk factors associated with
HPVB19 transmission infection in neurological HPVB19 among patients.
patients analyzed in this study (Table 2).
Variabl Number Positive p-
Our study showed that history of blood e (n) (%) value
OR 95% CI
transfusion may be key factor for B19 infection Organ transplant
in neurological patients who have had No 132 12 (9.0) 1
0.1 0.7-1.8
transfusion (95% CI=0.4-4.2, OR=1.9:1) with Yes 8 5 (62.5) 1.2
statistical significance (P=0.05). History of transfusion
25
Other risk factors such as organ transplant No 112
(22.3) 0.05
1
0.4-4.2
(95% CI=0.7-1.8, OR=1.2:1), pregnancy (95% Yes 28 11 (40) 1.9
CI=0.7-1.6, OR=0.9:1) and thalassemia (95% Pregnancy
CI=0.7-1.8, OR=1.2:1) showed less significant No 128
15
1
association with HPVB19 with maximum (11.7)
0.80 0.7-1.6
prevalence of 62.5%, 16.6% and 42.8% and 02
Yes 12 0.9
(16.6)
minimum prevalence 9%, 11.7% and 6.7% Thalassemia
(P=0.1, P=0.80, P=0.1) respectively. No 133 9 (6.7) 1
0.1 0.7-1.8
Risk factors like organ transplantation, Yes 7 3 (42.8) 1.2
pregnancy and thalassemia disclosed no Note: OR=Odds ratio; CI=Confidence interval
significant association found with HVPB19 in
neurological population enrolled in this study.

19 10.12865/CHSJ.46.01.03
Current Health Sciences Journal Vol. 46, No. 1, 2020 January-March

Discussion Total prevalence of IgM to B19 in our study

B19 is ubiquitous infectious agent and its was 3.5% it may ascribed because of short
transmission is through the blood, respiratory appearance of immunoglobulins following
route and various blood products [17]. infection [25].
The theme of the current study was This might be the reason for low prevalence
estimation of seroprevalance of B19 infections or low seropositivity in current study. Our study
in western region of Saudi Arabia through showed that IgM sero-positivity was higher in
immunoglobulin detection and PCR assay. age groups of 1-10, 31-40 and 51-60 years. It
Studies showed higher prevalence of B19 in can be concluded that IgM seroprevalance in
Saudi Arabia. However current study reported current study reflects an acute infection while
reduced immunoglobulin overall prevalence IgG positive along IgM sero-negativity indicates
around 9%. past B19 infection [26].
This difference may be due the fact that our Detection of IgM antibodies in CSF samples
results are inferred on the basis of small is aligned and supported by previous findings in
population size. Sample size in small may not blood, transfusion, pregnancy and as well as
provide precise a reliable analysis of prevalence neoplasms cases [27].
and to get higher confidence level, large sample Previous findings unveiled the higher
size is preferable. Similar results were reported HPVB19 seroprevalance rates of 61.4% and
in past [18]. 75.6% in pregnant women in countries like
Associated risk factor displayed the Norway [28] and Iran [29] respectively.
B19 transmission and infection among Current study divulged lowest seroprevalance
neurological patients as reported in previous of 16.6% in pregnant women than that of
studies [19]. previous study reported in Saudi Arabia with
The overall prevalence rate of HPVB19 IgG seroprevalance of 26.3% (<20 years age) and
antibody reported in this study was 6.4% which 62.5% (>38 years) [22].The low seroprevalance
is so far less than any studies reported yet. rate of B19 in pregnant women in our study
However low prevalence of 16.2% IgG reported showed IgG antibodies seroprevalance as an age
in earlier in Singapore [20]. dependent [30].
These discrepancies and discordant results Blood donations epidemiological studies
could be due to the replication and tropism of regarding conducted in past showed varied
B19. Such variability can be also attributed to prevalence of B19 infection among different
differences in the sensitivity and specificity of countries around the world [31].
the assays and detection methods used. Earlier studies reported cosmic range of B19
This study also demonstrates that IgG infection with lowest B19 seroprevalance
seropositivity changes among different age [18,33] of B19 in beta thalassemia and
group. hemophilia patients with almost similar mean
In patients 11-20 year minimum age groups as in present study. In our survey,
seroprevalance was reported as compared to mean age was 30 years with an overall positive
other age groups this might be associated with seroprevalance of 42.8% with statistically
risk factor possibly during pregnancy, non-significant (P=0.1) in thalassemia B19
B19 infection is transmitted from mother to patients.
fetus so its prevalence seems to be higher in The higher seroprevalance of B19 IgG
pregnant women (21-30 years) and children antibodies in thalassemia patients in our study
<1 year [21-22] 21-30, 31-40 years age group reflect because of multiple blood transfusion and
[18]. it further elucidates its role in HPVB19 infection
Previous reports suggested overall low IgG [23].
prevalence but our studies indicate significant The molecular approaches are the most
proportion in 51-60 years age group that may be sensitive and reliable diagnostic methods for
because of blood transfusion which plays key detection of B19 DNA. Most reported and
role in virus transmission as reported earlier established PCR procedures have capability to
[23]. detect B19 DNA (1-100 copies/ml) [34].
A study performed in India [24] revealed the In contrast to single primer set simplification,
IgG antibody prevalence of 34% in hematologic using nested PCR it can reveal between
malignancies like lymphoma and leukemia in 10-100 copies of B19 DNA. Risk of cross over
neoplasm group which is similar to as in case of carrying contamination during sample handling
current study findings.

10.12865/CHSJ.46.01.03 20
Ayman Khalid Johargy et al. - Seroprevalance of HPVB19 in Neurological Patients in Arabia

from first round to second round poses a Author Contributions

significant issue in nested PCR [35]. AKJ Conceived the study, designed the
In present study, all 140 CSF samples either experiments and wrote first draft of manuscript, AJ
sero-positive or sero-negative were analyzed wrote, reviewed and approved final manuscript,
through nested PCR for the confirmation of SSA. Analyzed the data and interpreted results,
B19 DNA. In our study, B19 was not detected in FRA and MHK assisted in Sampling and medical
131 samples by PCR which were even negative for history of participants. All authors have read and
both IgG and IgM ELISA simultaneously approved the final version of manuscript with no
suggesting the low risk of B19 transmission allegations.
through blood transfusion and organ transplant
Acknowledgements
[33].
The authors are highly grateful to thanks the
Previous studies from symptomatic patients
neurological patients hospitalized at different
analyzed by the two approaches PCR and ELISA
hospitals of Makkah for their willingness and
reported 8.8% positive simultaneously [36].
participation in study, without whom this study
Another study performed using nested PCR
may not be possible. Special thanks got to medical
approach also reported single sample positive for
and paramedical staff working in Neurology
B19 DNA after testing 100 samples [37].
department of hospitals for their sincere and kind
The results of both ELISA and PCR suggests
cooperation during this study. We are exceedingly
that B19 DNA positive patients especially both
grateful to the Medical Research Center, Deanship
IgG and IgM antibodies display acute resolving
of Scientific and Research, Umm Al-Qura
infection in neurological patients, however those
University, Saudi Arabia for financial support to
with IgG but in case of persistent phase and
complete this study.
chronic B19 infection IgM are no more consistent
[38]. In view of previous studies, our findings Conflict of interests
accord with previous studies where overall PCR None to declare.
positivity of less than 10% in symptomatic
individuals [11]. References
1. Cossart VE, Field AM, Cant B, Widdows D.
Our findings showed that there was no Parvovirus-Like particles in human sera. The
significant association regarding thalassemia, Lancet, 1975, 1:72-73.
pregnancy and because of less statistical 2. Girei AI, Alao OO, Joseph DE, Damulak DO,
significance, further studies with larger sample Banwat EB, Nwadioha SI, Jombo GTA. Human
size are needed to evaluate the association. Parvovirus B19 in Jos, North central Nigeria. J
It has been concluded that HPVB19 persistence Hainan Med College, 2010, 89(10):25-27.
3. Bultmann BD, Klingel K, Sotlar K, Bock CT,
mechanism may be due to lack of antibody Kandolf R. Parvovirus B19: a pathogen
production against parvovirus, possibly due to responsible for more than hematologic disorders.
defect in antigen presenting cells. Virchows Arch, 2003, 442(1): 8-17.
Our study may have limitation small sample 4. Jordan J, Tiangco B, Kiss J, Koch W. Human
size, demographic variable like race so it may Parvovirus B19: prevalence of viral DNA in
reduce the results significance and study power volunteer blood donors and clinical outcomes of
transfusion recipients. Vox Sang, 1998, 75(2): 97-
and hence the results may not be generalized to 102.
entire Saudi population of HPVB19 5. Kinney JS, Anderson LJ, Farrar J, Strikas RA,
Kumar ML, Kliegman RM, Sever JL, Hurwitz ES,
Conclusion Sikes RK. Risk of adverse outcomes of pregnancy
after human parvovirus B infection. J Infect Dis,
In conclusion, HPVB19 seroprevalance were 1988, 157(4):663-67.
detected at very low rates among patients with 6. Salimi V, Gouya MM, Esteghamati AR, Safaie A,
neurological infections. Heshmat R, Saadatmand Z, Mokhtari-Azad T.
There are no guidelines for B19 screening Seroepidemiology of Human Parvovirus B19 in 5-
during blood donations. 25 year old age people in Iran. Iranian J Pub
Health, 2008, 37(4):19-25.
Preventive measure using serology approaches 7. Török TJ. Unusual clinical manifestations reported
like ELISA coupled with sensitive nucleic acids in patients with parvovirus B19 infection. Monogr
testing PCR should implemented while screening Virol Basel, 1997, 34:61-92.
during blood donations to neurological patients in 8. Chernak E, Dubin G, Henry D, Naides SJ,
order to avoid nosocomial transmission of B19 and Hodinka RL, MacGregor RR, Friedman HM.
iatrogenic. Infection due to parvovirus B19 in patients
infected with human immunodeficiency virus. Clin
More studies are required in Saudi Arabia to Infect Dis, 1995, 20(1):170-173.
understand the etiological role of parvovirus B19
prevalence among patients with underlying
neurological infections.

21 10.12865/CHSJ.46.01.03
Current Health Sciences Journal Vol. 46, No. 1, 2020 January-March
9. Barah F, Whiteside S, Batista S, Morris J. 25. Cohen BJ, Mortimer PP, Pereira MS. Diagnostic
Neurological aspects of human parvovirus B19 assays with monoclonal antibodies for the human
infection: a systematic review. Rev Med Virol, serum parvovirus-like virus (SPLV). J Hyg (Lond),
2014, 24(3):154-158. 1983, 91(1):113-130.
10. Watanabe T, Kawashima H. Acute encephalitis 26. Kara M, Balcı M, Yapça ÖE, Yılmaz N. Parvovirus
and encephalopathy associated with human B19 infection during pregnancy: clinical course
parvovirus B19 infection in children. World J Clin and prognosis. JOPP Derg, 2013, 5:1-6.
Pediatr, 2015, 4(4):126-134. 27. Aktaş O, Aydin H, Uslu H. Serological prevalence
11. Kumar S, Gupta RM, Sen S, Sarkar RS, Philip J, of human parvovirus B19 in diseases or disorders
Kotwal A, Sumathi, SH. Seroprevalence of human related to different human body systems. Turk J
parvovirus B19 in healthy blood donors. Med J Med Sci, 2016, 46(2): 368-373.
Armed Forces India, 2013, 69(3):268-272. 28. Barlinn R, Vainio K, Samdal HH, Nordbø SA,
12. van Elsacker-Niele AM, Kroes AC. Human Nøkleby H, Dudman SG. Susceptibility to
parvovirus B19: relevance in internal medicine. cytomegalovirus, parvovirus B19 and
Neth J Med, 1999, 54(6):221-230. age-dependent differences in levels of rubella
13. Morey AL, O'Neill HJ, Coyle PV, Fleming KA. antibodies among pregnant women. J Med Virol,
Immunohistological detection of human parvovirus 2014, 86(5):820-826.
B19 in formalin-fixed, paraffin-embedded tissues. 29. Khameneh ZR, Hanifian H, Barzegari R,
J Pathol, 1992, 166(2):105-108. Sepehrvand N. Human parvovirus B19 in Iranian
14. Frickhofen N, Abkowitz JL, Safford M, Berry JM, pregnant women: A serologic survey. Indian J
Antunez-de-Mayolo J, Astrow A, Cohen R, Pathol Microbiol, 2014, 57(3):442-444.
Halperin I, King L, Mintzer D, Cohen B, Young SN. 30. Abraham M, Rudraraju R, Kannangai R, George
Persistent B19 parvovirus infection in patients K, Cherian T, Daniel D, Ramalingam S, Sridharan
infected with human immunodeficiency virus type G. A pilot study on the seroprevalence of
1 (HIV-1): a treatable cause of anemia in AIDS. parvovirus B19 infection. Indian J Med Res, 2002,
Ann Intern Med, 1990, 113(12):926-933. 115:139-143.
15. Patou G, Pillay D, Myint S, Pattison J. 31. Eis-Hübinger AM, Reber U, Edelmann A, Kalus U,
Characterization of a nested polymerase chain Hofmann J. Parvovirus B19 genotype 2 in blood
reaction assay for detection of parvovirus B19. J donations. Transfusion, 2014, 54(6):1682-1684.
Clin Microbiol, 1993, 31(3):540-546. 32. Slavov SN, Haddad SK, Silva-Pinto AC, Amarilla
16. Sevall JS, Ritenhous J, Peter JB. Laboratory AA, Alfonso HL, Aquino VH, Covas DT. Molecular
diagnosis of parvovirus B19 infection. J Clin Lab and phylogenetic analyses of human Parvovirus
Anal, 1992, 6(4):171-175. B19 isolated from Brazilian patients with sickle cell
17. Brown KE. Hematological consequences of disease and β-thalassemia major and healthy
parvovirus B19 infection. Baillieres Best Pract Res blood donors. J Med Virol, 2012, 84(10):1652-
Clin Haematol, 2000, 13(2):245-259. 1665.
18. Arabzadeh SA, Alizadeh F, Tavakoli A, Mollaei H, 33. Mahmudi F, Shooshtari MM, Sharifi Z, Hosseinni
Bokharaei-Salim, F, Karimi G, Farahmand M, M. Prevalence of parvovirus B19 in blood donors
Mortazavi HS, Monavari SH. Human parvovirus tested by ELISA and PCR. Sci J Iran Blood
B19 in patients with beta thalassemia major from Transfus Organ, 2008, 5(1):47-52.
Tehran, Iran. Blood Res, 2017, 52(1):50-54. 34. de Jong EP, de Haana TR, Kroes ACM, Beersma
19. Barah F, Vallely PJ, Cleator GM, Kerr JR. MFC, Oepkes D, Walther FJ. Parvovirus B19
Neurological manifestations of human parvovirus infection in pregnancy. J Clin Virol, 2006, 36(1):1-
B19 infection. Rev Med Virol, 2003,13(3):185-189. 7.
20. Matsunaga Y, Goh KT, Utagawa E. Low 35. Zerbini M, Gallinella G, Cricca M, Bonvicini F,
prevalence of antibody to parvovirus B19 in Musiani M. Diagnostic procedures in B19
Singapore. Epidemiol Infect, 1994, 113(3):537- infection. Pathol Biol, 2002, 50(5):332-338.
540. 36. Mendonca MCL, Ribeiro SB, Couceiro JNSS, von
21. Johargy A. Seroprevalence of erythrovirus B19 Hubinger MG. B19 infections in state of Rio de
IgG antibody among pediatric patients in Makkah Janeiro, Brasil: 526 sera analyzed by IgM-
and Jeddah, Kingdom of Saudi Arabia. Med Princ enzyme-linked immunosorbent assay and
Pract, 2009, 18(4):339-341. polymerase chain reaction. Mem Inst Oswaldo
22. Johargy AK. Seroprevalence of erythrovirus B19 in Cruz Rio de Janeiro, 2005, 100(8):847-852.
Saudi pregnant women. J Family Community Med, 37. Vallerini D, Barozzi P, Quadrelli C, Bosco R,
2016, 23(2):105-108. Potenza L, Riva G, Gregorini G, Sandrini S, Tironi
23. Işik N, Ağaçfidan A, Ağirbaşli H, Işik DM, Bozkaya A, Montagnani G, Palma MD, Torelli G, Delwart E,
E, Gedikoğlu G, Badur S. The use of real-time Luppi M. Parvoviruses in blood donors and
polymerase chain reaction and enzyme transplant patients, Italy. Emerg Infect Dis, 2008,
immunoassay for the diagnosis of acute 14(1):185-186.
parvovirus B19 infections in immunosuppressed 38. Kleinman SH, Glynn SA, Lee TH, Tobler L,
patients. Mikrobiyol Bul, 2003, 37(4):277-283. Montalvo L, Todd D, Kiss JE, Shyamala V, Busch
24. Kishore J, Srivastava M, Choudhary N. MP. National Heart, Lung, Blood Institute
Standardization of B19 IgG ELISA to study the Retrovirus Epidemiology Donor Study (REDS-II).
seroepidemiology of parvovirus B19 in North Prevalence and quantitation of parvovirus B19
Indian voluntary blood donors. Asian J Transfus DNA levels in blood donors with a sensitive
Sci, 2010, 4(2):86-90. polymerase chain reaction screening assay.
Transfusion, 2007, 47(10):1756-1764.

10.12865/CHSJ.46.01.03 22
Ayman Khalid Johargy et al. - Seroprevalance of HPVB19 in Neurological Patients in Arabia

Corresponding Author: Adil Jamal, Nursing Sciences & Research,

College of Nursing Umm Al-Qura University, Saudi Arabia, e-mail: [email protected]

23 10.12865/CHSJ.46.01.03