Journal of Food Protection 86 (2023) 100130

Contents lists available at ScienceDirect

Journal of Food Protection

journal homepage: www.elsevier.com/locate/jfp

Research Paper

Prevalence and Antimicrobial Resistance of Salmonella spp. Isolated From

Chilled Chicken Meat Commercialized at Retail in Federal District, Brazil
Sabrina Lunara Santos Pavelquesi, Ana Carolina Almeida de Oliveira Ferreira, Letícia Fernandes Silva Rodrigues,
Calliandra Maria de Souza Silva, Izabel Cristina Rodrigues da Silva, Daniela Castilho Orsi ⇑
University of Brasilia (UnB), Laboratory of Food Control, Centro Metropolitano, Conjunto A, lote 01, Ceilandia, CEP: 72220-900 Brasilia, DF, Brazil

A R T I C L E I N F O A B S T R A C T

Keywords: Salmonella represents one of the most common foodborne pathogens, frequently associated with the contam-
Multidrug resistance ination of poultry products, constituting a prominent worldwide public health concern. This study determined
Poultry the prevalence and antimicrobial resistance of Salmonella spp. in chilled chicken meat (115 samples) commer-
Resistance genes cialized at retail in the Federal District, Brazil. Microbiological tests were performed to screen for Salmonella
Salmonella
spp. in the chicken meat samples, and the isolated strains were confirmed by the invA gene presence (PCR tech-
nique). The strains were evaluated for antimicrobial susceptibility by the disk diffusion technique (Kirby‐Bauer
method) and tested for the presence of the sul2, blaCTX, and tetB antimicrobial resistance genes. The Salmonella
spp. prevalence in chilled chicken meat sold at retail in the Federal District, Brazil, was 46.1% (53 of 115
chicken meat samples analyzed had invA gene‐positive strains). Seventy‐eight strains of Salmonella spp. isolated
from the 53 contaminated samples showed higher resistance to amoxicillin/clavulanic acid (83.3%), followed
by sulfonamide (64.1%) and tetracycline (46.2%); 53.8% of the isolates were multidrug‐resistant (MDR). The
sul2 gene that confers resistance to sulfonamide was found in 53 strains (68.0%), the blaCTX gene that confers
resistance to beta‐lactams was identified in 39 strains (50.0%), and the tetB gene that confers resistance to
tetracycline was identified in 29 strains (37.2%). The high percentage of Salmonella contamination in chicken
meat can pose a risk to consumers’ health due to the possibility of causing salmonellosis. In addition, many
isolates were MDR and carried antimicrobial resistance genes. Public agencies can use these results to develop
effective public health policies and strategies to ensure the safety of these food products.

Brazil is the world’s largest exporter and second‐largest chicken et al., 2016; Choi et al., 2014). Salmonella transmission in the poultry
meat producer, exporting its products to more than 150 countries production chain may occur directly or indirectly from animal feed, at
(US Department of Agriculture, 2021; Brazilian Association of the farm, within the slaughterhouse or packing plant, and in the man-
Animal Protein, 2021). Nontyphoidal salmonellosis cases are often ufacturing, processing, and retailing of chicken meat. So, healthy poul-
related to consuming contaminated food of animal origin, mainly poul- try carrying Salmonella can act as a reservoir and contaminate chicken
try products, such as eggs and raw chicken meat (Perin et al., 2020; meat and eggs, allowing the bacteria to be easily transmitted to the
Borges et al., 2019; Antunes et al., 2016; Castro‐Vargas et al., 2020). final consumers (Antunes et al., 2016; Choi et al., 2014; Borges
Nonetheless, Salmonella spp. remain the leading pathogens responsible et al., 2019).
for foodborne diseases worldwide (Brasil Ministry of Health, 2019; Another critical concern is the presence of antimicrobial‐resistant
Centers for Disease Control and Prevention, 2020; European Food Salmonella strains in chicken meat. Recent studies have demonstrated
Safety Authority/European Centre for Disease Prevention and increasing resistance of Salmonella strains isolated from humans and
Control, 2021). animals to the most used antimicrobials (Perin et al., 2020; Borges
Poultry populations are frequently colonized with Salmonella with- et al., 2019; Yamatogi et al., 2016; Lee et al., 2016; Vilela et al.,
out noticeable symptoms (subclinical infections or healthy carriers) by 2019; Cunha‐Neto et al., 2018). Salmonella has also been identified
horizontal and vertical transmission at the production level (Antunes as an important resistance‐coding genes carrier often involved in infec-

⇑ Corresponding author.
E-mail addresses: [email protected] (S. Lunara Santos Pavelquesi), [email protected] (A. Carolina Almeida de Oliveira Ferreira), [email protected] (L.
Fernandes Silva Rodrigues), [email protected] (C. Maria de Souza Silva), [email protected] (I. Cristina Rodrigues da Silva), [email protected] (D. Castilho
Orsi).

https://doi.org/10.1016/j.jfp.2023.100130
Received 17 November 2022; Accepted 8 July 2023
Available online 12 July 2023
0362-028X/© 2023 The Authors. Published by Elsevier Inc. on behalf of International Association for Food Protection.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
S. Lunara Santos Pavelquesi et al. Journal of Food Protection 86 (2023) 100130

tion outbreaks with multidrug‐resistant (MDR) bacteria (Castro‐Vargas tetB for tetracycline, and sul2 for sulfonamide. Bacterial DNA was
et al., 2020; Yamatogi et al., 2016; Cunha‐Neto et al., 2018). extracted with the PureLink® Genomic DNA kit (Thermo Fisher Scien-
Considering that most Brazilian studies assess the Salmonella preva- tific), starting from strains cultivated in Mueller‐Hinton broth (Kasvi)
lence in chicken meat from chicken slaughterhouses (Borges et al., at 37°C for 18 h. The extracted DNA quality was evaluated by elec-
2019; Cunha‐Neto et al., 2018; Mattiello et al., 2015; Baptista et al., trophoresis in a 2% agarose gel, and the DNA concentration was quan-
2018), the present study evaluated the prevalence of Salmonella spp. tified using NanoDrop 2000 (Thermo Fisher Scientific).
isolated from retail chicken meat in the Federal District, Brazil. In Gene fragments amplification was performed using the Life Express
addition, the antimicrobial resistance and the presence of resistance Thermal Cycler (model TC‐98/G/H(b), BIOER). Amplified PCR prod-
genes blaCTX, sul2, and tetB were investigated in Salmonella spp. ucts’ electrophoresis was carried out in 2% (w/v) agarose gel (Invitro-
strains isolated from chicken meat. gen Life Technologies), stained with ethidium bromide. The DNA
fragments separated on the gel were visualized under ultraviolet
(UV) lighting with a 100 bp marker (Ludwig Biotecnologia Ltda).
Material and Methods
The primers’ design and the PCR’s thermocycling conditions are pre-
sented in Table 1.
Sample collection

Between February 2019 and March 2021, 115 samples of chilled Antimicrobial susceptibility testing
chicken cuts (thigh, drumstick, breast, wing, and wing drumstick) rep-
resenting the main Brazilian slaughterhouse brands were collected in Antimicrobial susceptibility testing was performed according to the
83 different supermarkets in the Federal District, Brazil. These samples Brazilian Committee on Antimicrobial Susceptibility Testing Guideli-
were exposed to refrigerated counters in the establishments and nes, following the standard Kirby–Bauer disk diffusion method
packed in polystyrene trays within the expiration date. All samples (Brazilian Committee on Antimicrobial Susceptibility Testing, 2019).
were transported refrigerated (5‐8°C) to the laboratory within a max- The bacterial inoculum was prepared using a direct suspension from
imum period of 1 h, and then, the microbiological analyzes were microbial growth in Mueller‐Hinton broth with turbidity equivalent
initiated. to 0.5 McFarland standard (1.0 × 108 UFC/mL), adjusted between
the optical density of 0.08 and 0.10 on a spectrophotometer
(625 nm). The following antimicrobial agents obtained from Newprov
Salmonella isolation and biochemical characterization
(Brazil) were tested: amoxicillin/clavulanic acid (AMC, 20/10 μg), cef-
tazidime (CAZ, 30 μg), cefotaxime (CTX, 30 μg), gentamycin (GEN,
The Salmonella isolation from chicken meat followed the methodol-
10 μg), chloramphenicol (CLO, 30 μg), tetracycline (TET, 30 μg), imi-
ogy described in the Technical Guide for Laboratory Detection of Sal-
penem (IMP, 10 μg), sulphonamide (SUL, 300 μg), and ciprofloxacin
monella spp. (Brasil Ministry of Health, 2011). In triplicate, 25 g of
(CIP, 5 μg). The isolates were classified as susceptible (S), intermediate
each sample was inoculated in 225 mL of buffered peptone water
(I), or resistant (R), according to the CLSI guidelines (CLSI, 2020). Sal-
(BPW) (Kasvi), homogenized for 5 min, and incubated at 37°C for
monella isolate resistant to three or more antimicrobials were defined
24 h. Then, 1.0 mL each of the preenrichment BPW aliquots was trans-
as multidrug‐resistant (MDR) isolates.
ferred into 10 mL of tetrathionate broth (Himedia) and selenite cystine
broth (Acumedia,), respectively, and incubated at 37°C for 24 h. A
loopful (10 µL) of enriched broth was streaked onto the xylose lysine Statistical analysis
deoxycholate (XLD) agar (Himedia) and Salmonella Shigella (SS) agar
(Himedia) and incubated at 37°C for 24 h. Presumptive Salmonella The chi‐square test determined if there was a difference between
colonies in XLD and SS agars were confirmed biochemically using tri- the occurrence of Salmonella spp. in different types of chicken cuts.
ple sugar iron (TSI) agar (Himedia) and lysine iron (LIA) agar (Hime- Values of p < 0.05 were considered significant. The analysis was per-
dia) slants. These slants were incubated at 37°C for 24 h. The formed using the IBM® SPSS Statistics version 28.0 program.
presumptive Salmonella isolates, which tested positive on TSI and
LIA biochemical testing, were confirmed by amplifying a targeted Sal- Results and Discussion
monella‐specific invasive (invA) gene by polymerase chain reaction
(PCR) (Table 1). Salmonella spp. prevalence in chilled chicken meat sold at retail in
the Federal District, Brazil, was 46.1% (53 of 115 chicken meat sam-
Confirmation of Salmonella and detection of antimicrobial genes using PCR ples analyzed had invA gene‐positive strains). Table 2 shows Sal-
monella spp. prevalence in different types of chicken cuts, and the
The presumptive Salmonella isolates were confirmed by identifying Salmonella occurrence did not differ between the different chicken cuts
the invA gene. The confirmed Salmonella strains (n = 78) were then (p > 0.05). Perin et al. (2020) reported similar results in frozen
screened for antimicrobial resistance genes: blaCTX for beta‐lactams, chicken meat samples collected in retail stores in Paraná state, Brazil,

Table 1
Primers’ sequence and the polymerase chain reaction (PCR) thermocycling conditions for the invA virulence gene and the blaCTX, tetB, and sul2 resistance genes

Target Primer sequence (5’→ 3’) Product PCR conditions Reference

gene size (bp)

invA CATTGGTGATGGTCTTGTCG 298 denaturation for 2 min at 95°C, followed by 35 cycles for 1 min at 95°C, annealing for 1 min at 60°C, Cruz et al.
CTCGCCTTTGCTGGTTTTAG with final extension for 1 min at 72°C (2019)
blaCTX CGATGTGCAGTACCAGTAA 585 denaturation for 5 min at 94°C, followed by 30 cycles for 30 s at 94°C, annealing for 30 s at 55°C, 50 s at Li et al.
AGTGACCAGAATCAGCGG 72°C with final extension for 7 min at 72°C (2013)
tetB TTGGTTAGGGGCAAGTTTTG 659 denaturation for 5 min at 94°C, followed by 34 cycles for 25 s at 94°C, annealing for 30 s at 55°C, 50 s at (21)
GTAATGGGCCAATAACACCG 72°C with final extension for 7 min at 72°C
sul2 GCGCTCAAGGCAGATGGCATT 285 denaturation for 10 min at 95°C, followed by 35 cycles for 45 s at 94°C, annealing for 50 s at 55°C, 50 s (22)
GCGTTTGATACCGGCACCCGT at 72°C with final extension for 10 min at 72°C

2
S. Lunara Santos Pavelquesi et al. Journal of Food Protection 86 (2023) 100130

Table 2 (83.3%), sulfonamide (64.1%), tetracycline (46.2%), and ciprofloxacin

Overall prevalence of Salmonella spp. in chilled chicken meat and different types had 65.4% of intermediate and resistant results.
of chicken cuts S: sensitive; I: intermediate; R: resistant; n (%) = number and per-
Types of chicken Number of Number of samples with p centage in relation to the total of 78 strains; AMC: amoxicillin‐
cuts samples (%) Salmonella spp. (%) value clavulanic acid; CAZ: ceftazidime; CTX: cefotaxime; IPM: imipenem;
Thigh 22 (19.1) 13 (59.1)
SUL: sulfamethoxazole; GEN: gentamycin; TET: tetracycline; CLO:
Wing drumstick 35 (30.4) 17 (48.6) chloramphenicol; CIP: ciprofloxacin. *Interpretation of zones of inhibi-
Drumstick 27 (23.5) 8 (29.6) 0.33 tion according to the CLSI guidelines (CLSI, 2020)
Breast 23 (20.0) 11 (47.8) Perin et al. (2020) reported similar results from Salmonella strains
Wing 8 (7.00) 4 (50.0)
isolated from frozen chicken meat samples collected in retail stores
Total 115 (100.0) 53 (46.1)
in Paraná state, Brazil, which presented high resistance to tetracycline
(94.0%), amoxicillin with clavulanic acid (84.0%), and ciprofloxacin
(76.0%). A meta‐analysis conducted in Brazil compared the antimicro-
where they found 30.0% of Salmonella spp. contamination with also no
bial resistance of poultry‐origin nontyphoidal Salmonella isolated from
statistical difference between the analyzed cuts. Frozen chicken cuts,
1995 to 2014. The highest antimicrobial resistance levels were verified
in general, have a lower Salmonella occurrence than chilled chicken
for sulfonamides (44.3%), nalidixic acid (42.5%), and tetracycline
cuts; however, Borges et al. (2019) detected Salmonella in frozen
(35.5%) (Voss‐Rech et al., 2017).
chicken carcasses even after long periods of storage.
In addition to the high resistance to amoxicillin‐clavulanic acid
The Brazilian government has officially reported the prevalence of
(83.3%) presented by the Salmonella strains, resistant and intermediate
Salmonella spp. in whole chicken carcasses after being slaughtered in
values were also observed for cefotaxime (41.1%), imipenem (32.1%),
the slaughterhouses and before being transformed into cuts or trans-
and ceftazidime (23.1%). In Enterobacteriaceae, the resistance to beta‐
ported and distributed for sale in supermarkets: 17.97% in 2017,
lactamases antimicrobials is generally attributed to the production of
12.61% in 2018, and 15.08% in 2019 (Ministry of Agriculture,
beta‐lactamases that cleaves the beta‐lactam ring to inactivate the drug
2021). Baptista et al. (2018) found 26.7% of chicken carcasses contam-
as ESBL (extended‐spectrum beta‐lactamase) (Chon et al., 2015). The
inated by Salmonella spp. in slaughterhouses in Rio de Janeiro state,
resistance to beta‐lactam antimicrobials, such as cephalosporins, the
Brazil. Overall, chicken carcasses at slaughterhouses are less contami-
drugs of choice to treat clinical salmonellosis, limit the available ther-
nated by Salmonella than chicken cuts at retail establishments, as they
apeutic options (Chon et al., 2015; Crump et al., 2015).
are handled less, which reduces cross‐contamination (Sodagari et al.,
Sulfonamides were, starting in 1948, the first drugs used in thera-
2015). According to Sodagari et al. (2015), the variations observed
peutic doses in veterinary medicine and, for many years, as prophy-
between the studies that reported the Salmonella prevalence might also
laxis for avian diseases. Tetracyclines and sulfonamides were used as
be due to the differences in isolation methods applied to detect Sal-
additives in animal feed in Brazil until 1998, when their use became
monella. Golden and Mishra (2020) also reported an increased Sal-
restricted to therapeutic purposes. However, these drugs still exert
monella spp. prevalence in the United States from 14.3% in broiler
selection pressure on microorganisms (Voss‐Rech et al., 2017; Lees
chicken samples to 19.0–23.0% in retail chicken samples.
et al., 2021).
According to Golden and Mishra (2020), the analyses of retail
The increased resistance to quinolones has been found in human‐
chicken meat samples are crucial because they are the sample types
origin nontyphoidal Salmonella in the United States since 1996
available to consumers for direct use. Although raw chicken is cooked
(Voss‐Rech et al., 2017; Centers of Disease Control and Prevention,
before consumption, Salmonella spp. control in chicken meat is vital to
2019). Salmonella isolates from poultry displayed increased resistance
avoid cross‐contamination of surfaces and other foods in the kitchen
to nalidixic acid, which in Enterobacteriaceae generally correlates to
and potential risks of salmonellosis from undercooking the meat.
reduced susceptibility to ciprofloxacin. Ciprofloxacin is a recognized
The virulence gene invA was used to confirm Salmonella spp. in our
first‐line drug for treating severe human salmonellosis cases, and treat-
study. Other studies also used the invA gene as a molecular marker to
ments with fluoroquinolones have failed in patients infected with Sal-
confirm Salmonella spp. isolated from chicken meat samples (Perin
monella spp. resistant to nalidixic acid. The reduced susceptibility of
et al., 2020; Borges et al., 2019; Zishiri et al., 2016; Zhu et al.,
nontyphoidal Salmonella to quinolones seems attributed to the wide-
2017). The invA gene encodes a protein in the inner membrane of bac-
spread use of these antimicrobials in both human and veterinary med-
teria, which is necessary to invade the host’s epithelial cells. This gene
icine (Voss‐Rech et al., 2017; Centers of Disease Control and
is essential for virulence in Salmonella, so the invA gene is a specific
Prevention, 2019; Lai et al., 2014).
method for detecting Salmonella at the genus level in a variety of sam-
Only 1.3% (1/78) of the isolates were sensitive to all tested antimi-
ples (Ammar et al., 2016; Amini et al., 2010).
crobials. The remaining isolates were resistant to one or more classes
Table 3 shows the antimicrobial susceptibility profile of 78 Sal-
of antimicrobials. The present study observed that 53.8% (42/78) of
monella spp. strains isolated from chicken meat samples. The highest
Salmonella isolates were multidrug‐resistant (MDR) (Table 4). Other
resistance rates observed were for amoxicillin with clavulanic acid
studies have reported high rates of MDR Salmonella isolated from

Table 3
Antimicrobial susceptibility profile of 78 Salmonella spp. strains isolated from chicken meat samples

Antimicrobials R n (%) I n (%) S n (%) R* I* S*

AMC 65 (83.3) 3 (3.8) 10 (12.8) < 13 14-17 > 18

SUL 50 (64.1) 1 (1.3) 27 (34.6) < 12 13-16 > 17
TET 36 (46.2) 6 (7.7) 36 (46.2) < 11 12-14 > 15
CTX 23 (29.5) 9 (11.5) 46 (59.0) < 22 23-25 > 26
CAZ 17 (21.8) 1 (1.3) 60 (76.9) < 17 18-20 > 21
CIP 13 (16.7) 38 (48.7) 27 (34.6) < 20 21-30 > 31
GEN 11 (14.1) 11 (14.1) 56 (71.8) < 12 13-14 > 15
IPM 8 (10.3) 17 (21.8) 53 (67.9) < 19 20-22 > 23
CLO 4 (5.1) 11 (14.1) 63 (80.8) < 12 13-17 > 18

3
S. Lunara Santos Pavelquesi et al. Journal of Food Protection 86 (2023) 100130

Table 4 encode beta‐lactamase enzymes, commonly located in mobile genetic

Number of antimicrobial classes to which Salmonella spp. strains showed elements, such as plasmids, transposons, and integrons. Consequently,
resistance resistance can spread horizontally between the isolates (Crump et al.,
Number of antimicrobial classes with Salmonella isolates Salmonella isolates 2015; Bythwood et al., 2019). Lee et al. (2016) reported that the Sal-
resistance (n) (%) monella strains isolated from duck carcasses in South Korea phenotyp-
0 1 1.3
ically resistant to both cefotaxime and ceftazidime harbored the
1 9 11.5 blaCTX gene, while genes encoding TEM and SHV enzymes were not
2 26 33.3 detected. Djeffal et al. (2017) reported ESBL presence in avian‐ and
3 21 26.9 human‐origin Salmonella in northeastern Algeria (12 avian and six
4 13 16.7
human strains), and the blaCTX gene as the most prevalent (66.7%
5 8 10.3
MDR (sum of 3, 4 and 5) 42 53.8 of the strains), 27.8% contained both blaTEM and blaCTX genes and
5.5% contained the blaTEM gene.
MDR = multidrug-resistant; strains resistant to 3, 4, and 5 antimicrobials Among this study’s 36 phenotypically tetracycline‐resistant
classes were defined as MDR; % = percentage in relation to the total of 78 strains (46.2%), 14 strains (38.9%) carried the tetB resistance gene.
strains
The tetracycline resistance frequently found in Salmonella spp. is
mainly due to the tet genes' presence in these bacteria (Maka &
chicken meat, with values of 85.7% (Brazil) (Perin et al., 2020); 84.8% Popowska, 2016; McMillan et al., 2019). The most frequent types
(Japan) (Moe et al., 2017); 62.2% (Iran) (Sodagari et al., 2015), 60.8% of tet genes belong to classes A, B, C, D, and G (Xu et al., 2020),
(China) (Zhu et al., 2017); and 52.2% (Myanmar) (Furukawa et al., and the tetB gene is specific for Gram‐negative bacteria (Roberts &
2017). Schwarz, 2016). The tet genes are responsible for encoding
In recent years, multidrug‐resistant (MDR) phenotypes have been membrane‐associated tetracycline efflux pumps and are usually asso-
increasingly described among Salmonella species in animal products ciated with plasmids, transposons, or both and are often conjugative
worldwide. Outbreaks of human salmonellosis have been associated (Maka & Popowska, 2016; Roberts & Schwarz, 2016). Zhu et al.
with antimicrobial‐resistant Salmonella isolates. The emergence of (2017) evaluated the presence of tetracycline resistance genes in
MDR Salmonella is a worldwide concern, representing increased dis- Salmonella strains isolated from broiler chickens along the slaughter-
ease severity leading to higher hospitalization rates and possibly death ing process in China and found the tetB gene in 50% of the total 98
(Antunes et al., 2016; Castro‐Vargas et al., 2020; Cunha‐Neto et al., strains phenotypically resistant to tetracycline.
2018). Resistance genes were also detected in phenotypically susceptible
The blaCTX, sul2, and tetB resistance genes were searched in the 78 and intermediate Salmonella strains. Our study found 18 strains
Salmonella strains isolated from chicken meat samples (Table 5). In (23.1%) sensitive to sulfonamides with the sul2 resistance gene, 15
total, the sul2 gene was identified in 53 strains (68.0%), the blaCTX strains (19.3%) sensitive and intermediate to tetracycline with the tetB
gene in 39 strains (50.0%), and the tetB gene in 29 strains (37.2%). gene, and five strains (6.4%) sensitive and intermediate to β‐lactams
Most of the phenotypically sulfonamide‐resistant Salmonella spp. with the blaCTX gene. Deekshit et al. (2012) also reported silent genes
strains (64.1%) in this study carried the sul2 resistance gene in Salmonella strains (40% of chloramphenicol‐susceptible strains car-
(44.9%). Four sul genes (sul1, sul2, sul3, and sul4) encode insensitive ried the catA1 gene). Silent genes are DNA sequences usually unex-
dihydropteroate synthase to escape the sulfonamide activity; however, pressed or expressed at an insufficient level but still can spread
dissemination of sul1 and sul2 genes among Salmonella spp. is reported through horizontal gene transfer (Stasiak et al., 2021). According to
more often than the sul3 and sul4 genes. Sul genes are transferred Adesiji et al. (2014), some antimicrobial resistance genes are silent
between bacteria via integrons, transposons, or plasmids (Maka in bacteria in vitro and activate in vivo, especially under the selective
et al., 2015; Xu et al., 2019). Deng et al. (2018) reported that sul1 pressure of antibiotic use. Silent genes have also been proven to
and sul2 gene prevalence was equal in trimethoprim‐resistant Sal- become active after being transferred to a new host (Stasiak et al.,
monella strains isolated from chicken meat in China (20.4%, 2021).
n = 20). Maka et al. (2015) studied the sul genes dissemination among Due to the limited number of resistance genes (sul2, blaCTX, and
sulfonamide‐resistant Salmonella spp. isolated from food in Poland and tetB) tested in this study, Salmonella strains phenotypically resistant
found that 44.0% of isolates carried the sul1 gene, 46.4% were sul2 to sulfonamides, β‐lactams, or tetracycline may be carrying other genes
positive, while the sul3 gene was undetected. that encode resistance to these antimicrobials. This study’s findings
The resistance gene blaCTX was present in 43.6% of the Salmonella indicate that retail chilled chicken meat may act as a reservoir of
isolates phenotypically resistant to amoxicillin‐clavulanic acid. Salmonella‐harboring antimicrobial resistance genes. Therefore, the
Extended‐spectrum beta‐lactamase (ESBL) with the ability to hydro- need for the rational use of antimicrobial agents in poultry production
lyze penicillins and most cephalosporins are synthesized by an increas- systems is evident to reduce the proliferation of multidrug resistance
ing number of Enterobacteriaceae, and blaCTX is one of the most among species.
prevalent ESBL genes worldwide (Chon et al., 2015). The emergence
of Salmonella ESBL has been attributed to the acquisition of genes that
Declaration of Competing Interest

Table 5 The authors declare that they have no known competing financial
Percentage of resistance genes in the 78 Salmonella spp. strains isolated from interests or personal relationships that could have appeared to influ-
chicken meat samples ence the work reported in this paper.
Resistance genes Antimicrobial resistance profile Total n (%)
R n (%) S n (%) I n (%)
Acknowledgments
blaCTX-M 34 (43.6) 2 (2.6) 3 (3.8) 39 (50.0)
sul2 35 (44.9) 18 (23.1) 0 53 (68.0) This work was carried out with the support of the Coordenação de
tetB 14 (17.9) 13 (16.7) 2 (2.6) 29 (37.2)
Aperfeiçoamento de Pessoal de Nível Superior (CAPES, Financing
R: resistant, S: sensitive, I: intermediate; n (%) = number and percentage in Code 001) and was funded by the Fundação de Apoio à Pesquisa do
relation to the total of 78 strains Distrito Federal (FAPDF).

4
S. Lunara Santos Pavelquesi et al. Journal of Food Protection 86 (2023) 100130

References Zhu, Y., Lai, H., Zou, L., Yin, S., Wang, C., Han, X., Xia, X., Hu, K., He, L., Zhou, K., Chen,
S., Ao, X., & Liu, S. (2017). Antimicrobial resistance and resistance genes in
US Department of Agriculture (2021). Foreign Agricultural Service – Custom Query. Salmonella strains isolated from broiler chickens along the slaughtering process in
Accessed January 15, 2022, from https://apps.fas.usda.gov/psdonline/app/index. China. International Journal of Food Microbiology, 259, 43–51.
html#/app/advQuery Brazilian Committee on Antimicrobial Susceptibility Testing. 2019. Disc-diffusion
Brazilian Association of Animal Protein (2021). Relatório Anual. Brasil. Accessed method for antimicrobial susceptibility testing. Accessed January 15, 2022, from
January 15, 2022, from https://abpa-br.org/wp-content/uploads/2021/04/ABPA_ http://brcast.org.br/documentos/
Relatorio_Anual_2021_web.pdf CLSI – Clinical & Laboratory Standards Institute (2020). Performance Standards for
Perin, A. P., Martins, B., Barreiros, M., Yamatogi, R. S., Nero, L. A., & Dos Santos Bersot, Antimicrobial Susceptibility Testing (30. ed.). Wayne, PA: Clinical and Laboratory
L. (2020). Occurrence, quantification, pulse types, and antimicrobial susceptibility Standards Institute. CLSI supplement M100.
of Salmonella sp. isolated from chicken meat in the state of Paraná, Brazil. Brazilian Ministry of Agriculture, Livestock and Supply (2021). Anuário dos Programas de
Journal of Microbiology, 51(1), 335–345. https://doi.org/10.1007/s42770-019- Controle de Alimentos de Origem Animal do DIPOA. Accessed January 15, 2022,
00188-x. from https://www.gov.br/agricultura/pt-br/assuntos/inspecao/produtos-animal/
Borges, K. A., Furian, T. Q., Souza, S. N., Salle, C. T. P., Moraes, H. L. S., & Nascimento, anuario-dos-programas-de-controle-de-alimentos-de-origem-animal-do-dipoa/
V. P. (2019). Antimicrobial resistance and molecular characterization of Salmonella anuario-dos-programas-de-controle-de-alimentos-de-origem-animal-volume-6.pdf
enterica serotypes isolated from poultry sources in Brazil. Brazilian Journal of Poultry Sodagari, H. R., Mashak, Z., & Ghadimianazar, A. (2015). Prevalence and antimicrobial
Science, 21(1), 1–8. https://doi.org/10.1590/1806-9061-2018-0827. resistance of Salmonella serotypes isolated from retail chicken meat and giblets in
Antunes, P., Mourão, J., Campos, J., & Peixe, L. (2016). Salmonellosis: The role of Iran. Journal of Infection in Developing Countries, 9, 463–469. https://doi.org/
poultry meat. Clinical Microbiology and Infection, 22(2), 110–121. https://doi.org/ 10.3855/jidc.5945.
10.1016/j.cmi.2015.12.004. Golden, C. E., & Mishra, A. (2020). Prevalence of Salmonella and Campylobacter spp. in
Castro-Vargas, R. E., Herrera-Sánchez, M. P., Rodríguez-Hernández, R., & Rondón- alternative and conventionally produced chicken in the United States: A systematic
Barragán, I. S. (2020). Antibiotic resistance in Salmonella spp. isolated from poultry: review and meta-analysis. Journal of Food Protection, 83(7), 1181–1197. https://doi.
A global overview. Veterinary World, 13(10), 2070–2084. https://doi.org/ org/10.4315/JFP-19-538.
10.14202/vetworld.2020.2070-2084. Ammar, A. M., Mohamed, A. A., Abd El-Hamid, M. I., & El-Azzouny, M. M. (2016).
Brasil Ministry of Health (2019). Outbreaks of Foodborne Diseases in Brazil. Brasília, Virulence genotypes of clinical Salmonella serovars from broilers in Egypt. Journal of
Brasil: Secretaria de Vigilância em Saúde, Departamento de Vigilância das Doenças Infection in Developing Countries, 10(4), 337–346. https://doi.org/10.3855/
Transmissíveis. jidc.7437.
Centers for Disease Control and Prevention (2020). Foods That Can Cause Food Amini, K., Salehi, T. Z., Nikbakht, G., Ranjbar, R., Amini, J., & Ashrafganjooei, S. B.
Poisoning. Accessed January 15, 2022, from https://www. (2010). Molecular detection of invA and spv virulence genes in Salmonella enteritidis
cdc.gov/foodsafety/communication/leafy-greens.html#:∼:text=During 2014 to isolated from human and animals in Iran. African Journal of Microbiology Research, 4
2018%2C 51, were linked to romaine lettuce (21), 2202–2210. https://doi.org/10.5897/AJMR2021.9562.
European Food Safety Authority/European Centre for Disease Prevention and Control Voss-Rech, D., Potter, L., Vaz, C. S., Pereira, D. I., Sangioni, L. A., Vargas, Á. C., & de
(2021). The European Union One Health 2019 Zoonoses Report. EFSA Journal, 19 Avila Botton, S. (2017). Antimicrobial resistance in nontyphoidal Salmonella
(2), 1–285. https://doi.org/10.2903/j.efsa.2019.5926. isolated from human and poultry-related samples in Brazil: 20-year meta-analysis.
Choi, S. W., Ha, J. S., Kim, B. Y., Lee, D. H., Park, J. K., Youn, H. N., Hong, Y. H., Lee, S. Foodborne Pathogens and Disease, 14(2), 116–124. https://doi.org/10.1089/
B., Lee, J. B., Park, S. Y., Choi, I. S., & Song, C. S. (2014). Prevalence and fpd.2016.2228.
characterization of Salmonella species in entire steps of a single integrated broiler Chon, J. W., Jung, H. I., Kuk, M., Kim, Y. J., Seo, K. H., & Kim, S. K. (2015). High
supply chain in Korea. Poultry Science, 93(5), 1251–1257. https://doi.org/10.3382/ occurrence of extended-spectrum β-lactamase-producing Salmonella in broiler
ps.2013-03558. carcasses from poultry slaughterhouses in South Korea. Foodborne Pathogens and
Borges, K. A., Martelo, E. B., Dos Santos, L. A., Furian, T. Q., Cisco, I. C., Manto, L., & Dos Disease, 12(3), 190–196. https://doi.org/10.1089/fpd.2014.1847.
Santos, L. R. (2019). Detection and quantification of Salmonella spp. in poultry Crump, J. A., Sjölund-Karlsson, M., Gordon, M. A., & Parry, C. M. (2015). Epidemiology,
slaughterhouses of southern Brazil. Journal of Infection in Developing Countries, 13(5), clinical presentation, laboratory diagnosis, antimicrobial resistance, and
455–460. https://doi.org/10.3855/jidc.11107. antimicrobial management of invasive Salmonella infections. Clinical Microbiology
Yamatogi, R. S., Oliveira, H. C., Possebon, F. S., Pantoja, J. C. F., Joaquim, J. G. F., Pinto, Reviews, 28(4), 901–937.
J. P. A. N., & Araújo, J. P. (2016). Qualitative and quantitative determination and Lees, P., Pelligand, L., Giraud, E., & Toutain, P.-L. (2021). A history of antimicrobial
resistance patterns of Salmonella from poultry carcasses. Journal of Food Protection, drugs in animals: Evolution and revolution. Journal of Veterinary Pharmacology and
79(6), 950–955. https://doi.org/10.4315/0362-028X.JFP-15-489. Therapeutics, 44, 137–171. https://doi.org/10.1111/jvp.12895.
Lee, S. K., Choi, D., Chon, J. W., & Seo, K. H. (2016). Resistance of strains producing Centers of Disease Control and Prevention (2019). Antibiotic/Antimicrobial Resistance.
extended-spectrum β-lactamases among Salmonella from duck carcasses at Accessed July 25, 2022 at, https://www.cdc.gov/DrugResistance/Biggest-Threats.
slaughterhouses in three major provinces of South Korea. Foodborne Pathogens and html
Disease, 13(3), 135–141. https://doi.org/10.1089/fpd.2015.2042. Lai, J., Wu, C., Wu, C., Qi, J., Wang, Y., Wang, H., Liu, Y., & Shen, J. (2014).
Vilela, F. P., Gomes, C. N., Passaglia, J., Rodrigues, D. P., Costa, R. G., Tiba Casas, M. R., Serotype distribution and antibiotic resistance of Salmonella in food-producing
Fernandes, S. A., Falcão, J. P., & Campioni, F. (2019). Genotypic resistance to animals in Shandong province of China, 2009 and 2012. International Journal of
quinolone and tetracycline in Salmonella Dublin strains isolated from humans and Food Microbiology, 180, 30–38. https://doi.org/10.1016/j.
animals in Brazil. Microbial Drug Resistance, 25(2), 143–151. https://doi.org/ ijfoodmicro.2014.03.030.
10.1089/mdr.2017.0329. Moe, A. Z., Paulsen, P., Pichpol, D., Fries, R., Irsigler, H., Baumann, M. P. O., & Oo, K. N.
Cunha-Neto, A. D., Carvalho, L. A., Carvalho, R. C. T., Dos Prazeres Rodrigues, D., Mano, (2017). Prevalence and antimicrobial resistance of Salmonella isolates from chicken
S. B., Figueiredo, E. E. S., & Conte-Junior, C. A. (2018). Salmonella isolated from carcasses in retail markets in Yangon, Myanmar. Journal of Food Protection, 80(6),
chicken carcasses from a slaughterhouse in the state of Mato Grosso, Brazil: 947–951. https://doi.org/10.4315/0362-028X.JFP-16-407.
Antibiotic resistance profile, serotyping, and characterization by repetitive Furukawa, I., Ishihara, T., Teranishi, H., Saito, S., Yatsuyanagi, J., Wada, E., Kumagai,
sequence-based PCR system. Poultry Science, 97(4), 1373–1381. https://doi.org/ Y., Takahashi, S., Konno, T., Kashio, H., Kobayashi, A., Kato, N., Hayashi, K. I.,
10.3382/ps/pex406. Fukushima, K., Ishikawa, K., Horikawa, K., Oishi, A., Izumiya, H., Ohnishi, T.,
Mattiello, S. P., Drescher, G., Barth, V. C., Jr., Ferreira, C. A., & Oliveira, S. D. (2015). Konishi, Y., & Kuroki, T. (2017). Prevalence and characteristics of Salmonella and
Characterization of antimicrobial resistance in Salmonella enterica strains isolated Campylobacter in retail poultry meat in Japan. Japanese Journal of Infectious
from Brazilian poultry production. Antonie Van Leeuwenhoek, 108(5), 1227–1238. Diseases, 70(3), 239–247. https://doi.org/10.7883/yoken.JJID.2016.164.
https://doi.org/10.1007/s10482-015-0577-1. Maka, L., Mackiw, E., Sciezynska, H., Modzelewska, M., & Popowska, M. (2015).
Baptista, D. Q., Santos, A. F. M., Aquino, M. H. C., Abreu, D. L. C., Rodrigues, D. P., Resistance to sulfonamides and dissemination of sul genes among Salmonella spp.
Nascimento, E. R., & Pereira, V. L. A. (2018). Prevalence and antimicrobial isolated from food in Poland. Foodborne Pathogens and Disease, 12, 383–389. https://
susceptibility of Salmonella spp. serotypes in broiler chickens and carcasses in the doi.org/10.1089/fpd.2014.1825.
State of Rio de Janeiro, Brazil. Pesquisa Veterinaria Brasileira, 38(7), 1278–1285. Xu, F., Min, F., Wang, J., Luo, Y., Huang, S., Chen, M., Wu, R., & Zhang, Y. (2019).
https://doi.org/10.1590/1678-5150-PVB-5289. Development and evaluation of a Luminex xTAG assay for sulfonamide resistance
Brasil Ministry of Health (2011). Technical Manual of Laboratory Diagnosis of Salmonella genes in Escherichia coli and Salmonella isolates. Molecular and Cellular Probes, 49,
spp. Brasília, Brasil: Secretaria de Vigilância em Saúde. 1–4.
Cruz, M. R. G., Leite, Y. J. B. S., Marques, J. L., Pavelquesi, S. L. S., Oliveira, L. R. A., Deng, W., Quan, Y., Yang, S., Guo, L., Zhang, X., Liu, S., Chen, S., Zhou, K., He, L., Li, B.,
Silva, I. C. R., & Orsi, D. C. (2019). Microbiological quality of minimally processed Gu, Y., Zhao, S., & Zou, L. (2018). Antibiotic resistance in Salmonella from retail
vegetables commercialized in Brasilia, DF, Brazil. Food Science and Technology, 39 foods of animal origin and its association with disinfectant and heavy metal
(2), 498–503. https://doi.org/10.1590/fst.16018. resistance. Microbial Drug Resistance, 782–791. https://doi.org/10.1089/
Li, R., Lai, J., Wang, Y., Liu, S., Li, Y., Liu, K., Shen, J., & Wu, C. (2013). Prevalence and mdr.2017.0127.
characterization of Salmonella species isolated from pigs, ducks and chickens in Bythwood, T. N., Soni, V., Lyons, K., Hurley-Bacon, A., Lee, M. D., Hofacre, C., Sanchez,
Sichuan Province, China. International Journal of Food Microbiology, 163(1), 14–18. S., & Maurer, J. J. (2019). Antimicrobial resistant Salmonella enterica Typhimurium
https://doi.org/10.1016/j.ijfoodmicro.2013.01.020. colonizing chickens: The impact of plasmids, genotype, bacterial communities, and
Zishiri, O. T., Mkhize, N., & Mukaratirwa, S. (2016). Prevalence of virulence and antibiotic administration on resistance. Frontiers in Sustainable Food Systems, 3(20),
antimicrobial resistance genes in Salmonella spp. isolated from commercial 1–15. https://doi.org/10.3389/fsufs.2019.00020.
chickens and human clinical isolates from South Africa and Brazil. Onderstepoort Djeffal, S., Bakour, S., Mamache, B., Elgroud, R., Agabou, A., Chabou, S., Hireche, S.,
Journal of Veterinary Research, 83(1), 1067. https://doi.org/10.4102/ojvr. Bouaziz, O., Rahal, K., & Rolain, J. M. (2017). Prevalence and clonal relationship of
v83i1.1067. ESBL-producing Salmonella strains from humans and poultry in northeastern

5
S. Lunara Santos Pavelquesi et al. Journal of Food Protection 86 (2023) 100130

Algeria. BMC Veterinary Research, 13(1), 132. https://doi.org/10.1186/s12917-017- Roberts, M. C., & Schwarz, S. (2016). Tetracycline and phenicol resistance genes and
1050-3. mechanisms: Importance for agriculture, the environment, and humans. Journal of
Maka, Ł., & Popowska, M. (2016). Antimicrobial resistance of Salmonella spp. isolated Environmental Quality, 45(2), 576–592. https://doi.org/10.2134/jeq2015.04.0207.
from food. Roczniki Państwowego Zakładu Higieny, 67, 343–358. https://doi.org/ Deekshit, V. K., Kumar, B. K., Rai, P., Srikumar, S., Karunasagar, I., & Karunasagar, I.
10.5604/12321966.1167701. (2012). Detection of class 1 integrons in Salmonella Weltevreden and silent
McMillan, E. A., Gupta, S. K., Williams, L. E., Jové, T., Hiott, L. M., Woodley, T. A., antibiotic resistance genes in some seafood-associated nontyphoidal isolates of
Barrett, J. B., Jackson, C. R., Wasilenko, J. L., Simmons, M., Tillman, G. E., Salmonella in south-west coast of India. Journal of Applied Microbiology, 112(6),
McClelland, M., & Frye, J. G. (2019). Antimicrobial resistance genes, cassettes, and 1113–1122. https://doi.org/10.1111/j.1365-2672.2012.05290.x.
plasmids present in Salmonella enterica associated with United States food animals. Stasiak, M., Maćkiw, E., Kowalska, J., Kucharek, K., & Postupolski, J. (2021). Silent
Frontiers in Microbiology, 10, 1–18. https://doi.org/10.3389/fmicb.2019.00832. genes: Antimicrobial resistance and antibiotic production. Polish Journal of
Xu, X., Biswas, S., Gu, G., Elbediwi, M., Li, Y., & Yue, M. (2020). Characterization of Microbiology, 70(4), 421–429. https://doi.org/10.33073/pjm-2021-040.
multidrug resistance patterns of emerging Salmonella enterica serovar Rissen along Adesiji, Y. O., Deekshit, V. K., & Karunasagar, I. (2014). Antimicrobial resistant genes
the food chain in China. Antibiotics, 9(10), 660. https://doi.org/10.3390/ associated with Salmonella spp. isolated from human, poultry, and seafood sources.
antibiotics9100660. Food Science & Nutrition, 2, 436–442.