IIT/NEET – ACADEMY

NEET GRAND TEST - 9

Date : 29.04.2024 (NEET MODEL) Time : 3hrs
STD : XII & LT SET – 1 Max. Marks : 720

INSTRUCTIONS TO THE CANDIDATES

It is mandatory to use BALL POINT PEN to dark appropriate circle in the

answer sheet.

Marks should be dark and should completely fill the circle.

The question paper consists of four parts (Physics, Chemistry, Botany &

Zoology). Each part contains 50 questions.

In every part contains two sections A&B. Section-A : 35 Q; Section-B : 15 Q

Each question has four choices (1), (2), (3) and (4) out of which ONLY ONE IS

CORRECT.

Candidate have attempt all the questions in Section-A and only 10 questions in

Section-B;

Marking Scheme :

Section-A : 35 questions – 140 Marks

Section-B : 15 Questions – 40 Marks

For each question in every part you will be awarded4 Marks if you darken the

bubble corresponding to the correct and zero mark if no bubbles are

darkened, minus (–1) will be awarded for incorrect answer.

******** WISH YOU ALL THE BEST ********

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
PHYSICS
SECTION – A
ANSWER ALL THE FOLLOWING QUESTIONS:
1. Given below are two statements :
Statement-I : Photovoltaic devices can convert optical radiation into electricity.
Statement-II : Zener diode is designed to operate under reverse bias in
breakdown region.
In the light of the above statements, choose the correct answer from the options
given below.
1) Both statements I & II are correct
2) Statement I and statement II are incorrect
3) Statement I is correct but statement II is incorrect
4) Statements I is incorrect but statement II is correct
2. The respective number of significant figures for the numbers 23.023, 0.0003 and
2.1103 are
1) 5, 1, 2 2) 5, 1, 5 3) 5, 5, 2 4) 4, 4, 2
3. A particle moves in a straight line with a constant acceleration. It changes its
velocity from 10ms 1 to 20ms 1 while passing through a distance 135m in t second.
The value of t is
1) 12s 2) 9s 3) 10s 4) 1.8s
 
4. Position of an ant (S in metres) moving in Y-Z plane is given by S  2t 2 j  5 k
(where t is in second). The magnitude and direction of velocity of the ant at t = 1 s
will be
1) 16 m/s in y-direction 2) 4 m/s in x-direction
3) 9 m/s in z-direction 4) 4 m/s in y-direction
5. A particle of mass m moving eastward with a speed v collides with another
particle of the same mass moving northwards with same speed v. The two
particles coalesce on collision. The new particle of mass 2m will move with
velocity
v v v v
1) North  East 2) South  West 3) North  West 4) North  East
2 2 2 2
6. A horizontal force of 10N is necessary to just hold a block stationary against a
wall. The coefficient of friction between block and wall is 0.2. The weight of the
block is

1) 20N 2) 50N 3) 100N 4) 2N

7. A car is moving at a speed of 60km/h traversing a circular road track of radius
60m. The minimum coefficient of friction to prevent the skidding of the car is
(g=10m/s2)
1) 25/54 2) 21/54 3) 15/44 4) 21/44
8. A nuclear reaction along with the masses of the particles taking part in it is as
follows
A + B  C + D + Q MeV
1.002 + 1.004  1.001 + 1.003 + Q
(a.m.u) (a.m.u) (a.m.u) (a.m.u)
The energy Q liberated in the reaction is:
1) 0.234 MeV 2) 0.931 MeV 3) 0.465 MeV 4) 1.862 MeV
9. Two identical particles each of mass 0.5 kg are interconnected by a light spring of
stiffness 100 N/m, time period of small oscillation is

   
1) s 2) s 3) s 4) s
5 2 10 2 5 10

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
10. Two lenses L1 and L2 having focal length 10cm and 15 cm respectively. The
distance between L1 & L2 is:

1) 10cm 2) 15 cm 3) 25 cm 4) 35 cm
11. The ratio of the diameters of two metallic rods of the same material is 4 :1 and
their lengths are in the ratio 1 : 2. If the temperature difference between them are
equal, the rate of flow of heat in there will be in the ratio of
1) 2 : 1 2) 4 : 1 3) 16 : 1 4) 32 : 1
12. The molecules of an ideal gas at a certain temperature have
1) Only potential energy 2) Only kinetic energy
3) Potential and kinetic energy both 4) None of the above
13. Stream at 100oC is passed into 20 g of water at 10oC. When water acquires a
temperature of 80oC, the mass of water present will be ( Take, specific heat of
water = 1 calg-1 oC-1 and latent heat of steam = 540 cal g-1)
1) 50 g 2) 100 g 3) 150 g 4) 22.5 g
14. Wheatstone bridge principle is used to measure the specific resistance  S1  of
given wire, having length L, radius r. If X is the resistance of wire , then specific
  r2 
resistance is: S1  X   . If the length of the wire gets doubled then the value of
 L 
specific resistance will be
S S
1) 1 2) 2S1 3) 1 4) S1
4 2
15. The translational kinetic energy of gas molecule for one mole of the gas is equal to
3 2 1 2
1) RT 2) RT 3) RT 4) KT
2 3 2 3
16. Light travels in two media A and B with speeds 1.8  108 ms 1 and 2.4  108 ms 1
respectively. Then the critical angle between them is
2 3 2 3
1) sin 1   2) tan 1   3) tan 1   4) sin 1  
3 4 3 4
17. A solid rubber ball is carried from the surface to the bottom of a 200 metre deep
pond as a result of which its volume decreses by 0.1%. The density of pond water
is 1.0  103 kgm 3 . If g = 10 ms 2 then the bulk modulus of elasticity of rubber will be
in Nm 2
1) 2  109 2) 2  102 3) 109 4) 103
18. Assertion (A): The deformation is large, stress not proportional to strain.
stress
Reason (R) : If deformation is small will decrease.
strain
1) Both assertion and reason are correct
2) If assertion is correct but R is wrong
3) If assertion is wrong but R is correct
4) Both assertion and reason are wrong
19. A liquid drop of diameter D breaks into 125 tiny drops. The change in energy is:
1) 2 TD 2) 4 TD 3)  TD 4) 8 TD
2 2 2 2

20. A cell supplies a current of 0.9 A through a 2 resistor and a current of 0.3A
through a 7 resistor. The internal resistance of the cell is :-
1) 1.0  2) 0.5  3) 2.0  4) 1.2 
21. Two satellites A and B go round a planet P in circular orbits having radii 4R and
R respectively. If the speed of the satellite A is 3V, the speed of the satellite B is
1)12V 2) 6V 3) 4V 4) 3V

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
22. The magnetic susceptibility is negative for
1) ferromagnetic material only
2) paramagnetic and ferromagnetic materials
3) diamagnetic matieral only 4) paramagnetic matieral only
23. Two vibrating strings of the same material but of lengths L and 2L have radii 2r
and r respectively. They are stretched under the same tension. Both the strings
vibrate in their fundamental modes, the one of length L with frequency f1 and the
f
other with frequency f2. The ratio 1 is given by:
f2
1) 2 2) 4 3) 8 4) 1
24. A particle of mass m is moving in a straight line with uniform speed v parallel to
x-axis in X-Y plane at a height ‘h’ from the X-axis. Its angular momentum about
the origin is
1) Zero
2) mvh and is directed along positive z-axis
3) mvh and is directed along negative z-axis
4) mvh and is directed along positive x-axis
25. A charged particle of charge 4mc enters a uniform magneric field of induction
B  4 i  yj  zk tesla with a velocity v  2 i  3 j  6k . If the particle continues to
move undeviated, then the strength of the magnetic field induction (B) is
________tesla.
1) 3.5 2) 2 3) 14 4) 28
26. A block of mass m moving at a velocity v collides with another block of mass 2m
at rest. The lighter block comes to rest after collision. Find the coefficient of
restitution.
1 1 1
1) 2) 1 3) 4)
2 3 4
27. If the angle of incidence is twice the angle of refraction in a medium of refractive
index '  ' then the angle of incidence (in air) is
  
1) cos 1   2) sin 1   3) 2 cos 1   4) sin 1 
 
2  
2  
2
28. The product of angular speed and tangential speed of electron in nth orbit of
hydrogen atom is
1) Directly proportional to n2 2) Directly proportional to n3
3) Inversely proportional to n4 4) Independent of n
29. in Young’s double slit experiment, intensity at the point of maxima and minima
are I0 and zero respectively. Intensities of individual sources are
I I
1) 4I0 2) 0 3) 2I0 4) 0
2 4
30. A cell of e.m.f. 2 V and negligible internal resistance is connected to resistors R1
and R2 as shown in the figure. The resistance of the galvanometer, R1 and R2 are
80, 40 and 80 respectively. The p.d across of the galvanometer is:-

1) 1.78V 2) 1.60V 3) 0.80V 4) 1.33V

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
31. Electric charge is unifiormly distributed along a straight wire of radius 1mm, the
charge per centimeter length of the wire is Q coulomb. Another cylindrical surface
of radius 50cm and length 1m symmetrically encloses the wire as shown in fig.
the total electric flux passing through the cylindrical surface is

Q 100Q 10 100Q
1) 2) 3) 4)
0 0  0  0
32. Two condensers, one of capacity C and other of capacity C/2 are connected to a
V-volt battery, as shown. The work done in charging fully both the condensers is

1 3 1
1) CV 2 2) CV 2 3) CV 2 4) 2CV 2
4 4 2
33. A hollow metallic sphere of radIus 10cm is charged such that potential of its
surface is 80V. The potential at the centre of the sphere would be
1) 80 V 2) 800 V 3) Zero 4) 8 V
34. A charged particle of mass m and charge q is released from rest in an electric
field of constant magnitude E. The kinetic enrgy of the particle after time t is
2E 2t 2 E 2 q 2t 2 Eq 2 m Eqm
1) 2) 3) 2
4)
mq 2m 2t 2t
35. Two coherent light sources S1 and S2 are kept at equal distances  from the
cetnre of circle on the same plane of the circle as shown in figure. In one
complete revolution on the circular path, number of maxima observed is ( =
wavelength of light used)

1) 4 2) 6 3) 8 4) 12

SECTION – B
ANSWER ANY TEN OF THE FOLLOWING QUESTIONS:

36. Surface tension of a liquid is 50 N/m. If its thin film is made in a ring of area
0.02cm 2 , then its surface energy will be:
4 4 4 4
1) 5  10 Joule 2) 2.5  10 Joule 3) 3  10 Joule 4) 2  10 Joule
37. The moment of inertia of a thin uniform rod of length L and mass M about an axis
passing through a point at a distance of L/3 from one of its ends and
perpendicular to the rod is
ML2 ML2 7 ML2 7 ML2
1) 2) 3) 4)
6 9 24 48
38. An electric current passes through a long straight wire. At a distance 5 cm from
the wire, the magnetic field is B. The field at 20 cm from the wire would be
B B
1) 2B 2) 3) 4) B
4 2

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
39. The speed of a satellite that revolves around earth at a height 3R from earth’s
surface is (g=10m/s2 at the surface of earth, radius of earth R = 6400km) (in kms-
1)

1) 2 2 2) 4 3) 4 2 4) 8
40. When the engine is switched off a vehicle of mass M is moving on a rough
horizontal road with moment p. If the coefficient of friction between the road and
tyres of the vehicle is k , the distance travelled by the vehicle before it comes to
rest is
p2 2 k M 2 g p2 p2M 2
1) 2) 3) 4)
2 k M 2 g p2 2 k g 2 k g
41. An inductor L, a resistance R, and two identical bulbs, B1 and B 2 are connected to
a battery through a switch S as shown in the figure. The resistance R is the same
as that of the coil that makes L. Which of the following statements gives the
correct description of the happenings when the switch S is closed
L B1

R B2

B
S

1) The bulb B2 lights up earlier than B1 and finally both the bulbs shine equally
bright
2) B1 light up earlier and finally both the bulbs acquire equal brightness
3) B2 lights up earlier and finally B1 shines brighter than B2
4) B1 and B2 light up together with equal brightness all the time
42. A and B are two points in a closed circuit. The potential difference across the
condenser of capacity 5F is

1) 6V 2) 10V 3) 16V 4) 4V
43. A long straight wire of radius ‘a’ carries a steady current i. The curernt is
uniformly distributed across its cross-section. The ratio of the magnetic fields at
a/2 and 2a is
1) 1 2) 1/2 3) 1/4 4) 4
44. The square root of the product of inductance and capacitance has the dimension
of
1) Length 2) Mass 3) Time 4) No dimension
45. The equation of motion of a particle started at t = 0, is given by
 
y  5sin  20t   cm . The least time after which acceleration becomes zero is
 3
   
1) sec 2) sec 3) sec 4) sec
90 120 60 30

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
46. With respect to photoelectric effect experiment, match the entries of Column I
with the entries of Column II
Column-I Column- II
(A) If 𝑓 (frequency) is increased keeping (p) Stopping potential increases
𝐼 (intensity) and 𝜙 (work
function) constant
(B) If 𝐼 is increased keeping 𝑓 and 𝜙 (q) Saturation photocurrent increases
constant
(C) If the distance between anode and (r) Maximum KE of the photoelectrons
cathode increase increases
(D) If 𝜙 is decreased keeping f and 𝐼 (s) Stopping potential remains the same
constnat
CODES :
A B C D
1) p q s r
2) r s p q
3) s r q p
4) r p q s

47. The phenomenon of fusion is used in the construction of:

1) The hydrogen bomb 2) The atom bomb
3) An ordinary bomb 4) The neutron bomb
48. A mass of 10g moving horizontally with a velocity of 100 cm s 1 strikes a pendulum
bob of same mass. The two masses after collision stick together. What will be
the maximum height reached by the system now? (Take, g  10 ms2 )

1) 125 cm 2) 1.25 cm 3) 2.5 cm 4) 5 cm

49. Two full turns of the circular scale of a screw gauge cover a distance of 1mm on
its main scale. The total number of divisions on the circular scale is 50. Further,
it is found that the screw gauge has a zero error of -0.03mm. While measuring
the diameter of a thin wire, a student notes the main scale reading of 3mm and
the number of circular scale divisions in line with the main scale as 35. The
diameter of the wire is
1) 3.73mm 2) 3.67mm 3) 3.38mm 4) 3.32mm
50. The given graph represents V-I characteristic for a semi conductor device.

Which of the following statement is correct?

1) It is V-I characteristic for solar cell where, point A represents open circuit
voltage and point B short circuit current
2) It is a for a solar cell and point A and B represent open circuit voltage and
curent, respectively
3) It is for a photodiode and points A and B represent open circuit voltage and
current, respectively
4) it is for a LED and points A and B represent open circuit voltage and short
circuit curent respectively

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
CHEMISTRY
SECTION – A
ANSWER ALL THE FOLLOWING QUESTIONS :
51. Assertion (A): One molal aqueous acetic acid solution shows slightly higher
boiling point than 100.52o C while one molal acetic acid in benzene shows higher
freezing point than 0.36o C .
[Given : Kb of H 2O  0.52 K.molal1 . Kg and BP of H 2O  100o C; K f for benzene is
5.12 K .molal 1 and F.P. of pure benzene  5.48o C ]
Reason (R) : In water acetic acid dissociates while in benzene acetic acid
dimerises.
1) Both assertion and reason are correct, and reason is the correct explanation of
the assertion
2) Both assertion and reason are correct, but reason is not the correct
explanation of the assertion
3) Assertion is correct, but reason is incorrect
4) Both assertion and reason are incorrect
52. The freezing points of 1 molal aqueous solutions of binary electrolytes AB, XY and
CD are 3.42o C , 3.18o C and 2.96o C respectively. Which of the following
dissociates more? [Kf for water  1.86 K.mol1kg ]
1) CD 2) XY 3) AB 4) Insufficient data
53. If the sodium fusion extract of an organic compound develops a blood red colour
on treatment with FeCl3 solution, which of the following ions must be present in
the sodium extract that responds to this colour test?
1) CN  2) CNO  3) SCN  4) S 2
54. At 270C if the solubility product of M(OH)2 is 3.2 x 10-11, its solubility in gL-1 is
(molar mass of M(OH)2 is 58 g mol-1)
1) 2  104 2) 1.16 1014 3) 1.16 102 4) 5.8 103
55. Atomic radii of fluorine and neon in Angstrom units are respectively given by
1) 0.72, 1.60 2) 1.60, 1.60 3) 0.72, 0.72 4) 1.60, 0.72
56. The IUPAC name of acrylaldehyde is
1) Prop-2-en-1-al 2) propenylaldehyde
3) but-2-en-1-al 4) propanal
57. In a photoelectric effect experiment, irradiation of a metal with light of frequency
5.2  1014 s 1 ejects electrons with maximum kinetic energy 1.3  10 19 J . Then the
threshold frequency of the metal is
1) 3.24  1014 s 1 2) 3.24  1012 s 1 3) 2.64  1011 s 1 4) 2.64  1014 s 1
58. Which of the following is violation of Pauli’s exclusion principle?

59. Assertion : The boiling point of cis-2-butene is more than trans-2-butene.

Reason : Cis-2-butene is more polar than trans-2-butene
1) Both ‘A’ and ‘R’ are true and ‘R’ is a the correct explanation of ‘A’
2) Both ‘A’ and ‘R’ are true and ‘R’ is not the correct explanation of ‘A’
3) ‘A’ is true and ‘R’ is false
4) ‘A’ is false and ‘R’ is true
60. To the given metal chloride solution excess NH4OH is added then dimethyl
glyoxime is added. Formation of red colour complex confirms the presence of
1) Cu2+ 2) Fe3+ 3) Ni2+ 4) Zn2+
61. Methyl orange gives red colour in
1) KOH solution 2) HCl solution 3) Na2CO3 solution 4) NaCl solution
62. A mixture contains 1 mole each of Fe2 and Fe3 ions. Volume of 1M KMnO4
required by mixture for the oxidation of the given mixture is ______
1) 400 ml 2) 200 ml 3) 100 ml 4) 1000 ml
63. Which of the following is wrong?
1) Al2O3  MgO   Lattice energy 2) CH 3Cl  CH 3 F 
 Dipole moment
3) O2  B2 
 Bond strength 4) Na   Mg 2 
 Hydration enthalpy

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
64. The correct combination is:
1)  NiCl4 
2 2
-square-planar;  Ni  CN  4  -paramagnetic
2
2)  Ni  CN  4  -tetrahedral;  Ni  CO 4  -paramagnetic
3)  NiCl4  -paramagnetic;  Ni  CO 4  -tetrahedral
2

4)  NiCl4  -diamagnetic;  Ni  CO 4  -square-planar

2

65. Assertion : N2, CO and CN  are having same bond order.

Reason : Bond order is equal to the half of the difference between number of
electrons in bonding molecular orbitals and number of electrons in anti-bonding
molecular orbitals
1) ‘A’ is false but ‘R’ is true 2) ‘A’ is true but ‘R’ is false
3) Both ‘A’ and ‘R’ are true and ‘R’ is the correct explanation of ‘A’
4) Both ‘A’ and ‘R’ are true but ‘R’ is not the correct explanation of ‘A’
66. The decreasing order of bond length of C = C in the following compounds is :

1) II>I>IV>III 2) III>I>II>IV 3) II>III>IV>I 4) IV>I>II>III

67. Among the following the correct order of basicity is :

1) 2)

3) 4)
68. Which of the following statements are not true?
1) PbX2 is more stable than PbX4 2) SiO exists only at high temperature
3) IUPAC name of Flerovium is ununquadium
4) CCl4 undergoes hydrolysis readily.
69. Assertion : N2 is less reactive than P4.
Reason : Nitrogen has more negative electron gain enthalpy than that of
phosphorous.
1) Both Assertion and Reason are correct and Reason is the correct explanation
of Assertion
2) Both Assertion and Reason are correct and Reason is not the correct
explanation of Assertion
3) Assertion is correct but Reason is incorrect
4) Assertion is incorrect but Reason is correct
70. When propyne is treated with aqueous H2SO4 in presence of HgSO4, the major
product is
1) Propanal 2) Propyl hydrogensulphate
3) Propanone 4) Propanol
71. Match the following :
Column – I Column – II
(  of light absorbed)
(A) CoCl  NH 3 5 
2 (I) 310

(B) Co  NH 3 6 
3 (II) 475

(C) Co  CN 6 
3 (III) 535

(D) Co  H 2O 6 
3 (IV) 600
.

Choose the correct answer from the options given below:

(A) (B) (C) (D) (A) (B) (C) (D)
1) IV I III II 2) III II I IV
3) III I II IV 4) II III IV I

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
72. Benzene on nitration gives nitrobenzene in presence of conc.HNO3 and H2SO4
mixture, where:
1) Both H2SO4 and HNO3 act as bases
2) HNO3 acts as an acid and H2SO4 acts as a base
3) Both H2SO4 and HNO3 act as acids
4) HNO3 acts as a base and H2SO4 acts as an acid
73. A solution of sodium sulphate contains 92 g of Na+ ions per kilogram of water.
The molality of Na+ ions in that solution in mol kg–1 is :
(1) 16 (2) 12 (3) 8 (4) 4
74. Volume of oxygen at NTP will be required to react with 1g of calcium is
1) 0.28L 2) 0.56L 3) 1.12L 4) 2.24L
75. Which of the following arrangements represent increasing order of oxidation
number of the central atom?
1) BrF3 , ClO3 , CrO42  , MnO4 2) ClO3 , CrO42 , MnO4 , ClO2
3) ClO2 , ClO3 , MnO4 , CrO42 4) CrO42  , MnO4 , ClO2 , ClO3
76. Methyl bromide reacts with AgF to give methyl fluoride and silver bromide. This
reaction is called
1) Fittig reaction 2) Swarts reaction
3) Wurtz reaction 4) Finkelstein reaction
77. Allyl phenyl ether can be prepared by heating:
1) C6 H5 Br  CH 2  CH  CH 2  ONa 2) CH 2  CH  CH 2  Br  C6 H5ONa
3) C6 H  CH  CH  Br  CH3  ONa 4) CH 2  CH  Br  C6 H5  CH 2  ONa
78. Which of the following is not correctly matched?
1) SF4  gas 2) SeF4  liquid 3) TeF4  solid 4) SF6  solid
79. Which of the following order correctly represents the stability of oxides of
halogens.
1) Cl  I  Br 2) I  Cl  Br 3) Br  Cl  I 4) Br  I  Cl
80. For a reaction, A → product, the conc. of ‘A’ is decreased from 1M to 0.6M in 26
minutes. The time taken for decreasing the concentration of A from 0.6M to
0.36M is 26 minutes, then the order of reaction is _____
1) 0 2) 1 3)2 4) 3
81. For the decomposition of ozone, the following mechanism is given.
O3 →O2 + O(fast)
O+O3 →2O2(slow)
Then the rate law is given by
1) Rate = K[O3]4/3 2) Rate =K[O3]2[O2]
3) Rate = K[O3]2[O2]-1 4) Rate = K[O3][O2]-1
82. 50ml of 0.2M ammonia solution is treated with 25mL of 0.2 M HCl. If pKb of
ammonia solution is 4.75, the pH of the mixture will be:
1) 3.75 2) 4.75 3) 8.25 4) 9.25

83.

84. At 298K, the enthalpy of fusion of a solid (X) is 2.8 kJ mol-1 and the enthalpy of
vaporization of the liquid (X) is 98.2 kJmol-1. The enthalpy of sublimation of the
substance (X) in kJ mol-1 is ______.
1) 101 2) 95.4 3) 103.8 4) 92.6

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
q
85. The entropy change can be calculated by using the expression S  rev . When
T
water freezes in a glass beaker. Choose the correct statement among the
following :
1) S (system) decreases but S (surroundings) remains the same
2) S (system) increases but S (surroundings) decreases
3) S (system) decreases but S (surroundings) increases
4) S (system) decrease but S (surroundings) also decreases

SECTION – B
ANSWER ANY TEN OF THE FOLLOWING QUESTIONS:
86. The set of correct statements is:
(I) Manganese exhibits +7 oxidation state in its oxide.
(II) Ruthenium and Osmium exhibit +8 oxidation in their oxides
(III) Sc shows +4 oxidation state which is oxidizing in nature.
(IV) Cr shows oxidizing nature in +6 oxidation state
1) II and III 2) I, II and IV 3) I and III 4) II, III and IV
87. Which one among the following are good oxidizing agent(s)?
A) Gd3+ B) Eu2+ C) Ce4+ D) Tb4+
Choose the most appropriate answer from the options given below:
1) C only 2) D only 3) B only 4) C and D only

88. CH3Cl HNO3/H2SO4 KMnO4

A B C
Anhyd.AlCl3

In the above reaction, C is

CHO COOH CHO COOH

1) 2) 3) 4)
NO2 NO2
NO2 NO2
89. In the given reaction,
 2RCOO Na  X
2RCOOH  2Na 
 RCOO Na  H2O  Y
RCOOH  NaHCO3 
Identify X and Y in the given reaction.
X Y
1) H2 CO
2) H2 O CO2
3) H2 CO2
4) H2 O CO
90. In which of the following dehydration by conc.H2SO4, rearrangement is not
favourable?

91. Choose the compound of each of the following pairs that has the more solubility
in water :
(a) BeSO4, BaSO4 (b) NaCl, MgCl2 (c) AgCl, AgI
1) BeSO4, MgCl2, AgI 2) BeSO4, MgCl2, AgCl
3) BeSO4, NaCl, AgCl 4) BaSO4, MgCl2, AgI
92. The compound that inhibits the growth of tumors is
1) trans-[Pt(Cl)2(NH3)2] 2) cis-[Pd(Cl)2(NH3)2]
3) cis-[Pt(Cl)2(NH3)2] 4) trans-[Pd(Cl)2(NH3)2]
93. In the manufacture of H2SO4 the oxidation of SO2 to SO3 by O2 is an exothermic
reaction. The yield of SO3 will be maximum if:
1) temperature is increased and the pressure is decreased
2) both the temperature and pressure are decreased
3) the temperature is reduced and V2O5 is used as catalyst
4) both the temperature and pressure are increased

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
94. Resistance of 0.2M solution of an electrolyte is 50 . The specific conductance of
the solution is 1.3Sm-1. If resistance of the 0.4M solution of the same electrolyte
is 260 , its molar conductivity is
1) 6.25 104 Sm2 mol 1 2) 625 104 Sm2 mol 1
3) 62.5 Sm2 mol 1 4) 6250 Sm2 mol 1
95. Pair of elements with the following atomic numbers have the same chemical
properties
1) 13 & 22 2) 3 & 11 3) 4 & 24 4) 2 & 1
96. Match the columns.
Column-I Column-II
A)  
ArN 2 Cl   ArOH (p) HBF4 / NaNO2, Cu 
B) ArN 2 Cl  
 ArNO2 (q) H2 O
C) ArN 2 Cl  
 ArH (r) HBF4, 
D) ArN 2 Cl  
 ArF (s) CH3CH2OH
1) A – (q), B – (p), C – (s), D – (r) 2) A – (s), B – (p), C – (q), D – (r)
3) A – (q), B – (s), C – (p), D – (r) 4) A – (q), B – (s), C – (r), D – (p)
97. Assertion : Acetanilide is less basic than aniline.
Reason : Acetylation of aniline results in decrease of electron density on nitrogen.
1) Assertion is correct, reason is correct; reason is a correct explanation for
assertion.
2) Assertion is correct, reason is correct; reason is not a correct explanation for
assertion
3) Assertion is correct, reason is incorrect
4) Assertion is incorrect, reason is correct
98. Given that EH 2O H 2 Pt  0 at 298K. The pressure of H2 gas would be
1) 107 atm 2) 1014 atm 3) 1010 atm 4) 1012 atm

99.

100. Which of following statements is/are true? (A, T, G, C and U are nitrogenous
bases)
1) DNA has A,G,C,T bases 2) RNA has G,U,T bases
3) In DNA, A makes three hydrogen bonds with C 4) All the above

BOTANY
SECTION – A
ANSWER ALL THE FOLLOWING QUESTIONS :
101. The fungal groups that show exogenous sexual spores and endogenous sexual
spores respectively are
1) Ascomycetes and Basidiomycetes 2) Algal fungi and club fungi
3) Club fungi and Sac fungi 4) Sac Fungi and imperfect fungi

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
102. With respect to fungal sexual cycle choose the correct sequence of events.
1) Plasmogamy, meiosis, karyogamy 2) Plasmogamy, karyogamy, meiosis
3) Karyogamy, plasmogamy, meiosis 4) Meiosis, karyogamy, plasmogamy
103. Match the Column I and Column II and select the correct option.
Column – I Column - II
(A) Non mycelial fungus (I) Phycomycetes
(B) Fungi with no asexual spores (II) Yeast
(C) Fungi without dikaryotic stage (III) Basidiomycetes
.
(D) Fungi without sexual reproduction (IV) Deuteromycetes
(A) (B) (C) (D) (A) (B) (C) (D)
.

1) II I III IV 2) II III IV I
3) II III I IV 4) III I II IV
104. The technology of biogas production was developed in India mainly due to the
efforts of
1) IPM 2) IARI and KVIC 3) IRRI 4) ICAR
105. Methanogenic bacteria are not found in
1) Rumen of cattle 2) Gobar gas plant
3) Thermophilic areas 4) Both 1 and 2
106. The chitinous exoskeleton of arthropods is formed by the polymerisation of
1) lipoglycans 2) keratin sulphate and chondroitin sulphate
3) D-glucosamine 4) N-acetyl glucosamine
107. Select the mismatch.
1) Pinus – Dioecious 2) Cycas – Dioecious
3) Salvinia – Heterosporous 4) Equisetum – Homosporous
108. Male gametophyte with least number of cells is present in……..
1) Pteris 2) Funaria 3) Hibiscus 4) Lycopodium
109. Study the following statements regarding the liverworts .
1) The liverworts grow usually in moist, shady habitats such as banks of streams,
marshy ground, damp soil, bark of trees and deep in the woods.
2) Gemmae are green, unicellular, sexual buds.
3) The leafy members of liverworts have tiny leaf-like appendages in two rows on
the stem-like structures.
4) The plant body of a liverwort is thalloid, e.g., Marchantia.
Which of the statements given above are correct
1) I, III and IV are correct 2) II, III and IV are correct
3) I, II and III are correct 4) I, II, and IV are correct
110. Study the given diagrammatic and identify the enzymes A and B involved in Step
I and Step II:

1) Step-I: EcoRI, Step-II: DNA ligase 2) Step-I: EcoRI, Step-II: EcoRI

3) Step-I: DNA ligase, Step-II: DNA ligase 4) Step-I: DNA ligase, Step-II: EcoRI
111. The floral formula of Pea is represented as :

112. Of the dsDNA sequences given below, the sequence that is expected have higher
temperature to induce denaturation
1) ATGACATTATTACATTAGTGTAT 2) ATGATTACTACGTAATGTATATA
3) GCATATTACTATATCTATATATA 4) GCCGACGCTGCGCCGTGGCCGCG

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
113. Statement-I: When DNA is cut by the same restriction enzyme, the resultant DNA
fragments have the same kind of sticky ends
Statement-II: Restriction exonucleases are used in genetic engineering to form
recombinant DNA
1) Statement-I is true, Statement-II is false 2) Statement-I is false, Statement-true
3) Both Statements I and II are false 4) Both Statements I and II are true
114. Match Column-I with Column-II and find correct option w.r.t. PCR.
Column-I Column-II
p) Denaturation a) Breaking of phosphodiester bonds
q) Annealing b) Breaking of hydrogen bonds
r) Extension c) Formation of hydrogen bonds
d) Formation of phosphodiester bonds
1) p-b, q-c, r-a 2) p-b, q-a, r-d 3) p-b, q-c, r-d 4) p-a, q-c, r-d
115. Identify the modified structure (labeled A) in the given diagram.

1) Stem tendril 2) Axillary bud tendril

3) Leaf tendril 4) Stipular tendril
116. The 1 largest petal, 2 lateral petals and 2 anterior fused petals in vexillary
aestivation are called
1) Standard, keel, wing respectively 2) Standard, wing, keel respectively
3) Keel, wing, standard respectively 4) Wings, keel, standard respectively
117. Read the following statements w.r.t. characters of Asteraceae.
A) The inflorescence is captiulum (or) Head inflorescence.
B) Hairy pappus are observed in both ray and disc florets.
C) Seeds are endospermous.
D) Fruits are mostly one seeded caryopsis.
The correct statements are
1) A and B 2) B and C 3) C and D 4) D and A
118. Match the following :
List-I List-II
A) 
C A (I) Fabaceae
5 

B) C4A2+4 (II) Malvaceae

C) C1+2+(2) A(9)+1 (III) Solanaceae
`
`
D) C(5) A5 (IV) Brassicaceae
A B C D A B C D
1) I II III IV 2) II I III IV
3) II IV I III 4) III I IV II
119. If coding strand of DNA has the nitrogenous base sequence as 5’ATCTG3’ what
would be the m RNA strand sequence?
1) 5’AUCUG3’ 2) 5’TUGUC3’ 3) 5’UACAG3’ 4)3’UAGUC3’
120. Which of the following represents the floral characters of Poaceae?
1) Pedicellate, bracteates, bisexual, trimerous actinomorphic, complete and
superior ovary
2) Pedicellate, bracteates, bisexual, pentamerous, zygomorphic, comlete and
superior ovary
3) Sessile, bracteates, bracteolate, incomplete, uni or bisexual, perianth modified
into lodicules, stamens three, superior ovary and feathery stigma
4) Bracteate, unisexual, actinomorphic stamens five and inferior ovary
121. How many chromosomes shall be present in a diploid cell at mitotic anaphase if
ovum of same species has ten chromosomes?
1) 10 (Ten) 2) 20 (Twenty) 3) 30 (Thirty) 4) 40 (Forty)

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
122. Nirenberg synthesized an m-RNA containing 34 poly-Adenine (A-A-A-A-A-A--) and
found a polypeptide formed of 11 poly-lysine this proved that genetic code for
lysine was :
1) one-adenine 2) A-A doublet 3) A-A-A triplet 4) Many adenines
123. The radioactive elements used by Hershey and chase in their experiment?
1) P30, S34 2) N14, P32 3) N15, S35 4) P32, S35
124. Select the incorrect match.
1) Rhofactor – Initiation of transcription 2) RNA polymerase I- r-RNA
3) Promoter – binding site for RNA polymerose
4) Amino acyl tRNA synthetase – Activation of aminoacids
125. Which of the following is true about guard cells?
1) Outerwall is thin
2) Innerwall is thick
3) Bean-shaped in dicots and dumb-bell shaped in grasses
4) All of the above
126. Assertion : Monocot stem have sclerenchymatous hypodermis.
Reason : In monocot stem peripheral vascular bundles are generally large &
centrally located are small
1) Both ‘A’ and ‘R’ are true and ‘R’ is a the correct explanation of ‘A’
2) Both ‘A’ and ‘R’ are true and ‘R’ is not the correct explanation of ‘A’
3) ‘A’ is true and ‘R’ is false
4) ‘A’ is false and ‘R’ is true
127. Match List -I with List - II.
List-I List-II
a) Lenticels (i) Phellogen
b) Cork cambium (ii) Suberin deposition
c) Secondary cortex (iii) Exchange of gases
d) Cork (iv) Phelloderm
Choose the correct answer from the options given below.
a b c d a b c d
1) iv i iii ii 2) iii i iv ii
3) ii iii iv i 4) iv ii i iii
128. Which of the following is a monohybrid?
1) RrYy 2) RRYY 3) RrYY 4) rryy
129. In a dihybrid cross 400 individuals are produced in F2 generation. Approximately
how many will be phenotypically different to parents?
1) 225 2) 175 3) 150 4) 100
130. Crossing over in diploid organism is responsible for
1) Dominance of genes 2) Linkage between genes
3) Recombination of linked genes 4) Segregation of alleles
131. Select the odd one out with respect to the chromosomal theory of inheritance
1) It was proposed by Sutton and Boveri
2) The behaviour of chromosomes is parallel to the behaviour of genes
3) Chromosomes and genes occur in pairs in diploid and haploid cells respectively
4) The paired condition of both, chromosome as well as mendelian factor is
restored during fertilization.
132. Assertion (A): Emasculation is the process of removal of pistils from bisexual
flowers.
Reason (R): Emasculation is used to induce self pollination.
1) Both A & R are correct and R is correct explanation of A.
2) Both A & R are correct but R is not correct explanation of A.
3) A is correct but R is incorrect. 4) Both A and R are incorrect
133. Which of the following statements is not correct?
1) A single human cell has 2.2 m long thread of DNA
2) Part of chromosomes after second constriction is called telomere
3) Centromere forms first site of constriction
4) Chromatin consists of DNA, RNA, histones and non-histones
134. If selfing occurs in the plant having genotype RrYy, then ratio of given genotype
will be :
RRYY, RrYY, RRYr, RrYy
1) 1 : 2 : 2 : 4 2) 1 : 2 : 2 : 1 3) 1 : 1 : 1 :1 4) 2 : 2 : 2 : 1

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
135. Attractants and rewards are required for:
1) Anemophily 2) Entomophily 3) Hydrophily 4) Cleistogamy
SECTION – B
ANSWER ANY TEN OF THE FOLLOWING QUESTIONS:
136. Continued self-pollination results in:
1) Genetic drift 2) Heterosis
3) Inbreeding depression 4) Polyembryony
137. The ovule of an angiosperm is technically equivalent to:
1) Megaspore mother cell 2) Megaspore
3) Megasporangium 4) Megasporophyll
138. In majority of angiosperms:
1) Reduction division occurs in the megaspore mother cell
2) A small central cell is present in the embryo sac
3) Egg has a filiform apparatus 4) There are numerous antipodal cells
139. Biogas generation is three stage anaerobic digestion of animal and other organic
waste. Study the following flow chart and select the correct option for stages I, II
and III.

1) In stage- I, anaerobic microorganisms bring about enzymatic breakdown of

complex organic copounds into simple soluble compounds or monomers.
2) In state – II, monomers are converted into organic acids by fermentation
causing microbes
3) In stage- III, organic acids are acted upon by methanogenic bacteria to produce
biogas
4) All of these
140. Statement–I : More than one polypeptide upon each other in the form of a cube
(or) plate etc.
Statement–II : In adult human beings of hemoglobin two sub units of -type and
two subunits of  type polypeptides form cuboid quarternary structure.
1) Both statements-I and Statement-II are wrong
2) Both statements-I and Statement-II are correct
3) Statement-I is correct, Statement-II is wrong
4) Statement-I is wrong, Statement-II is correct
141. Examples of tissues that are formed by redifferentiation are
1) Secondary xylem 2) Secondary phloem
3) Cork cell 4) All of these
142. Statement–I: Natural cytokinins are synthesized in regions where rapid cell
division occurs.
Statement–II : Cytokinins promote nutrient mobilization which inhibits the delay
of leaf senescence.
1) Both statement I and statement – II are correct
2) Statement – I is correct and statement – II is incorrect.
3) Statement – I is incorrect and statement – II is correct.
4) Both statement I and Statement – II are incorrect
143. Ethylene initiates
1) Flowering in pineapple 2) Floweirng in mango
3) Fruit ripening in tomato 4) All of these
144. Read the statements:
I) The complete disintegration of nuclear envelope marks metaphase.
II) Pairing of homologous chromosomes is called synopsis.
III) Condentation of chromosomes is completed.
Select correct option.
1) I and III true for Metaphase 2) II is true for Anaphase – I
3) II is true for prophase 4) I and II true for Metaphase

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
145. In x phase centrosome undergone duplication & in y phase begins to move
opposite poles of the cell.
1) x – prophase, y – interphase 2) x – interphase, y – prophase
3) x – interphase, y – metaphase 4) x – prophase, y – metaphase
146. During breakdown of proton gradient, energy is released. It causes
conformational change in -
1) Proton pump 2) Fo of ATPase 3) F1 to ATPase 4) NADP reductase
147. Calvin cycle takes place in :-
1) Only C3 plants 2) Only C4 plants
3) Both C3 and C4 plants 4) Neither C3 nor C4 plants
148. Select incorrect statement w.r.t. LHC.
1) Made up of hundreds of pigment molecules
2) Pigment molecules are bound to lipids
3) Harvest different wavelengths of light
4) Help to make photosynthesis more efficient
149. For every molecule of glucose during glycolysis, the ratio between pyruvic acid
formed and net gain of ATP molecules formed by S.L.P is
1) 1 : 1 2) 2 : 1 3) 2 : 3 4) 3 : 1
150. Pyruvic acid enters into krebs cycle as
1) Phosphoenol pyruvate 2) 2 - PGA
3) 3 - PGA 4) Acetyl CoA
ZOOLOGY
SECTION – A
ANSWER ALL THE FOLLOWING QUESTIONS :
151. Assertion(A): The immune responses of old persons are generally weak.
Reason(R): Thymus is degenerated in old individuals resulting in the decreased
production of thymosins.
1) Both A & R are true, and R is correct explanation of A
2) Both A & R are true, and R is not correct explanation of A
3) A is true but R is false 4) A is false but R is true
152. Food and air pathway are divided at
1) Pharynx 2) Larynx 3) Oesophagus 4) Glottis
153. What is being represented by the end of the T wave?
1) End of systole of heart 2) End of systole and starting of a new wave
3) End of atrial systole only 4) Disorder of SA node
154. Statement–I : Only two factors affect Hardy Weinberg equilibrium
Statement–II : Hugo de Vries gave idea of mutation by working on evening
primerose.
1) Both Statement-I and Statement-II are true.
2) Both Statement-I and Statement-II are false.
3) Statement-I is true, but Statement-II is false.
4) Statement-I is false, but Statement-II is true.
155. Following are signs which indicate improved reproductive health of the society
a) Better awareness about sex-related problem.
b) Better detection and cure of STDs.
c) Increased number of couples with large families.
1) (a) & (c) 2)(b) & (c) 3) (a) & (b) 4)(a),(b) &(c)
156. The relationship between the species richness and the area for a wide variety of
taxa appears as
1) straight line 2) sigmoid curve
3) J-shaped curve 4) rectangular hyperbola
157. Amongest birds, mammals, amphibians and Gymnosperms, the minimum and
maximum threat of extinction is faced respectively by
1) Birds, Amphibians 2) Amphibians, Gymnosperms
3) Mammals, Amphibians 4) Mammals, Birds
158. The nervous system in cockroach
1) Is does not spreads throughout the body because head holds a bit of nervous
system
2) Is represented by segmentally arranged ganglia and ventral nerve cord
3) Confined only to head and thorax region
4) Consists of supra-oesopharyngeal ganglia in head and dorsal nerve cord

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
159. The excretory organs in cockroach are
1) Green glands 2) Hepatic caecae
3) Malpighian tubules 4) Malpighian corpuscles
160. Frog heart is
1) 2-chambered 2) 3-chambered 3) 4-chambered 4) 5-chambered
161. The MAP (mean annual precipitation) of tropical forest is about ______ (in cm).
1) 150-400 2) 50-80 3) 100-150 4) 10-50
162. The Abingdon tortoise in Galapagos islands versus introduction of goats in the
some island stood as an example for
1) Competitive exclusion 2) Competitive release
3) Resource partitioning 4) Competitive interference
163. Organ of corti is located on/in
1) Basilar membrane 2) Reissner’s membrane
3) Tectorial membrane 4) Scala vestibuli
164. Which of the following is not the function of skeleton?
1) Movement 2) Storage of minerals
3) Production of body heat 4) Both 1 and 2
165. Which one of the following statement is correct with respect to kidney function
regulation?
1) Expossure to cold temperatures stimulates ADH release
2) An increase in glomerular blood flow stimulates the formation of angiotensin–II
3) When the body loses a lot of water by sweating, the release of vasopressin is
suppressed.
4) When blood pressure increases, atria of heart release ANF.
166. The correct functions of ascending limb of LH is _____
1) Impermeable to water and active transport of electrolytes
2) Permeable to water and sodium-potassium balance in blood.
3) Selective secretion of H+ and reabsorption of large amount of water.
4) Both 1 & 3.
167. Assertion (A) :Urinary blader & ureter are lined by involuntary muscles.
Reason (R) :Ureters carry the urine to urinary bladder where it is stored.
1) Both A & R are correct but R is not the correct explanation of A.
2) Both A & R are correct and R is the correct explanation of A.
3) A is correct but R is incorrect. 4) Both A and R are incorrect.
168. The human heart pumps _______ of blood every minute
1) 1 to 2L 2) 5 to 6 L 3) 8 to 10 L 4) 12 to 15 L
169. The portal circulation in human body exists between
a) Hypothalamus and adenohypophysis b) Intestine and liver
c) Hind limbs and kidney d) Gonads and kidney
1) a and b 2) a,b and c 3) c and d 4) b only
170. Evolution of life shows that life forms had a trend of moving from
1) Land to water 2) Dry land to wet land
3) Freshwater to sea water 4) Water to land
171. Which of the following are not taken into account in ecological pyramids?
(a) Omnivores (b) Carnivores (c) Herbivores (d) Saprophytes
Options :
1) a, d 2) b, c 3) c, d 4) a, c
172. A) Cannabinoids - P) Depressant
B) Cocaine - Q) Accelerant
C) Heroin - R) Euphoria
- S) Cardiovascular system
1) A-P, B-Q, C-S 2) A-Q, B-R, C-S 3) A-S, B-P, C-Q 4) A-S, B-R, C-P
173. The break bone fever is caused by
1) Bacteria 2) Virus 3) Protozoan 4) Helminths
174. HIV virus enters into which of the following cells?
1) B-lymphocytes 2) Monocytes 3) Macrophages 4) Neutrophils

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
175. Read the following statements and choose the correct.
1) One ejaculatory duct is formed by the union of ducts from seminal vesicles and
vasa deferentia of both sides
2) The placenta facilitate the supply of oxygen and nutrients from mother to
embryo
3) Gametogenesis is one of the event between parturition and lactation
4) Female offspring inherits both X-chromosomes from mother only (in normal
condition)
176. For increasing the food production, which biotechnological application is applied
1) Agro-chemical based agriculture
2) Organic agriculture
3) Genetically engineered crop based agriculture
4) All of the above
177. Statement –I : The functions are unknown for over 50% of the discovered genes.
Statement–II : More than 2% of the genome codes for proteins.
1) Both statements-I and Statement-II are true
2) Both statements-I and Statement-II are false
3) Statement-I is true, but Statement-II is false
4) Statement-I is false, but Statement-II is true
178. Which of the following pairs incorrectly matchetd related to locomotory organs?
1) Pseudopodia - Amoeba
2) Combplates - Cnidaria
3) Limbs - Mammalia
4) Parapodia - Neries
179. Given the following possess pharyngeal Gill slits except
1) Dog fish 2) Pristis 3) Clarius 4) Echinus
180. The critical research area of biotechnology is/are :
1) Downstream processing technologies to purify the protein/organic compound
2) Providing the best catalyst in the form of improved organism usually a microbe
or pure enzyme
3) Creating optimal conditions through engineering for a catalyst to act
4) All of the above
181. The example of adaptive radiation in the development of new species is
1) Darwin finches 2) Marsupials of Australia
3) Placental mammals of Australia 4) All of these
182. Melatonin regulates the following functions except:
1) Pigmentation 2) Diurnal rhythm
3) Body temperature 4) Erythropoiesis
183. Statement–I : In PKU phenylpyruvic acid and other derivatives are excreted
through urine because of their poor absorption by kidney.
Statement–II : Aneuploidy is due to segregation of chromatids during cell
division cycle.
1) S–I and S–II are correct. 2) S–I is incorrect & S–II is correct.
3) S–I is correct & S–II is incorrect. 4) S–I and S–II are incorrect.
184. Assertion: UV radiation has the ability to cause mutations in the organisms.
Reason: UV radiation is a common mutagen.
1) Both Assertion and Reason are correct and reason is the correct explanation of
assertion.
2) Both Assertion and Reason are correct and reason is not the correct
explanation of assertion.
3) Assertion is true and reason is false
4) Assertion is false and reason is true
185. Statement–I : Mendelian disorders are mainly determined by mutation of single
gene.
Statement–II : Mendelian disorders can be traced in a family by pedigree
analysis.
1) S–I and S–II are correct. 2) S–I is incorrect & S–II is correct.
3) S–I is correct & S–II is incorrect. 4) S–I and S–II are incorrect.

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
SECTION – B
ANSWER ANY TEN OF THE FOLLOWING QUESTIONS:
186. If both parents carrier for Sickle cell anaemia, what is the probability of progeny
getting affected with the disease?
1) 75% 2) 50% 3) 25% 4) 100%
187. The given pedigree is

1) X-linked recessive 2) Y-linked

3) X-linked dominant 4) Autosomal dominant
188. The ‘r’ value of human population in 1981 is _____
1) 0.0205 2) 0.12 3) 0.015 4) 0.10
189. Spleen is a bean shaped organ it contains abundant
a) Monocytes b) Phagocytes c) Lymphocytes d) Neutrophils
1) a, b 2) b, c 3) c,d d) a,d
190. Fill in the blanks (A – D) with the appropriate terms with respect to the detritus
food chain (DFC).
The detritus food chain begins with ___A___. It is made up of decomposers which
are ___B__ organisms, mainly ___C___. They meet their energy and nutrient
requirements by degrading ___D____.
1) A - detritus, B - autotrophic, C – earthworm, D - dead organic matter
2) A - dead organic matter, B - heterotrophic, C - fungi and bacteria, D – detritus
3) A – dead organic matter, B – autotrophic, C - fungi and plants, D – dead
organic matter
4) A – grass, B – heterotrophic, C – fungi and bacteria, D – dead organic matter
191. Statement–I : IUDs are most widely used contraceptives by female in India.
Statement–II : IUDs prevents ovulation and STDs.
1) S–I and S–II are correct. 2) S–I is correct & S–II is incorrect.
3) S–I is incorrect & S–II is correct. 4) S–I and S–II are incorrect.
192. The common man would find it hard to believe that there are more than _____
species of ants, ________ species of beetles, _______species of fishes.
1) 3,00,000 ; 20,000 ; 28,000 2) 28,000 ; 20,000 ; 3,00,000
3) 3,00,000 ; 20,000 ; 20,000 4) 20,000 ; 3,00,000 ; 28,000
193. Match the following and chose the correct option:
A. Family i. tuberosum
B. Kingdom ii. Polymoniales
C. Order iii. Solanum
D. Species iv. Plantae
E. Genus v. Solanaceae
1) A-iv, B-iii, C-v, D-ii, E-i 2) A-v, B-iv, C-ii, D-i, E-iii
3) A-iv, B-iii, C-v, D-i, E-ii 4) A-iv, B-iii, C-ii, D-v, E-i
194. Statement-I : Rate of breathing is regulated by respiratory rhythm centres
present in the medulla oblongata.
Statement-II : Changes in the CO2 and H+ concentration in the arterial blood is
recognized by the chemo receptors.
1) S–I and S–II are correct. 2) S–I is incorrect & S–II is correct.
3) S–I is correct & S–II is incorrect. 4) S–I and S–II are incorrect.
195. Find out correct statement from the following:
I) According to Darwin there is a gradual evolution of life forms.
II) Darwin travel in H.M.S Beagle
III) Alfred Wallace worked in Malay Archipelago
IV) Fossils are remains of life forms which have found in sedementary rocks
1) I, II only 2) III, IV only 3) I, II, IV only 4) I, II, III, IV
196. Mammalian lungs contain a large number of minute alveoli (air sacs). This is to
allow.
1) More space for increasing the total volume of inspired air
2) More surface area for diffusion of gases
3) More spongy texture for keeping lungs in proper shape
4) More nerve supply to keep the organs working more efficiently

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY

GT - 9 (SET-1) XII & LT-NEET MODEL-29.04.2024
197. Match the following :
Column-I Column-II
A) White matter (i) 3 Na out, 2K  in


B) Na+/K+ pumps transport (ii) Cortex

C) Gastric secretion (iii) Inner to cortex
D) Prominent folds (iv) Fore brain
E) Cerebral hemispheres (v) Medulla oblongata
1) A-iv, B-v, C-iii, D-i, e-ii 2) A-i, B-v, C-iv, D-ii, e-iii
3) A-i, B-iv, C-ii, D-iii, e-v 4) A-iii, B-i, C-v, D-ii, e-iv
198. Match List I and List II:
List I List II
A. Vertebrochondral ribs I. 12
B. Facial bones II. 6
C. Thoracic vertebrae III. 7
D. Ankle bones IV. 14
Choose the correct answer from the options given below:
1) A – I, B – II, C – III, D – IV 2) A – IV, B – II, C – I, D – III
3) A – III, B – I, C – IV, D – II 4) A – II, B – IV, C – I, D – III
199. Assertion (A): Fertilisation in Scoliodon is internal.
Reason (R): Male Scoliodon bears claspers on its pectoral fins.
1) Both A & R are correct and R is correct explanation of A.
2) Both A & R are correct but R is not correct explanation of A.
3) A is correct and R is incorrect.
4) Both A and R are incorrect
200. Select the incorrect statement.
1) Spermatogenesis starts at the puberty due to significant increase in the
secretion of GnRH
2) LH acts on the Leydig cells and stimulates synthesis and secretion of
androgens
3) Androgens stimulate the seprmatogenesis
4) Menstrual cycle is the reproductive cycle in all mammals

*******

VELAMMAL BODHI CAMPUS, PONNERI IIT/NEET ACADEMY