TYPE Original Research

PUBLISHED 04 May 2023

DOI 10.3389/fnins.2023.1059496

Network pharmacology reveals

OPEN ACCESS that Berberine may function
against Alzheimer’s disease via the
EDITED BY
Dennis Chang,
Western Sydney University, Australia

REVIEWED BY
Pengda Liu,
AKT signaling pathway
University of North Carolina at Chapel Hill,
United States
Anurag Kumar Singh,
Wei Wei 1,2†, Jiu-xiu Yao 3†, Ting-ting Zhang 1, Jia-yu Wen 2,
Alabama State University, United States Zhen Zhang 2, Yi-miao Luo 2, Yu Cao 2* and Hao Li 1*
Elena Mitroshina,
Lobachevsky State University of Nizhny 1
Wangjing Hospital, China Academy of Chinese Medical Science, Beijing, China, 2 Institute of Geriatrics,
Novgorod, Russia Xiyuan Hospital, China Academy of Chinese Medical Science, Beijing, China, 3 College of First Clinical
Md Abdul Hannan, Medicine, Shandong University of Traditional Chinese Medicine, Jinan, Shandong, China
Bangladesh Agricultural University, Bangladesh

*CORRESPONDENCE
Yu Cao
[email protected] Objective: To investigate the mechanism underlying the effects of berberine
Hao Li
[email protected]
(BBR) in the treatment of Alzheimer’s disease (AD).
These authors have contributed equally to this
† Methods: 3×Tg AD mice were treated with BBR for 3months, then the open field
work and share first authorship test (OFT), the novel object recognition test (NOR) and the Morris water maze
RECEIVED 01October 2022 (MWM) test were performed to assess behavioral performance. Hematoxylin–
ACCEPTED 12 April 2023 eosin (HE) staining, Nissl staining were used to examine histopathological
PUBLISHED 04 May 2023
changes. The pharmacological and molecular properties of BBR were obtained
CITATION from the TCMSP database. BBR-associated AD targets were identified using the
Wei W, Yao J-x, Zhang T-t, Wen J-y, Zhang Z,
Luo Y-m, Cao Y and Li H (2023) Network
PharmMapper (PM), the comparative toxicogenomics database (CTD), DisGeNet
pharmacology reveals that Berberine may and the human gene database (GeneCards). Core networks and BBR targets for
function against Alzheimer’s disease via the the treatment of AD were identified using PPI network and functional enrichment
AKT signaling pathway.
Front. Neurosci. 17:1059496.
analyses. AutoDock software was used to model the interaction between BBR
doi: 10.3389/fnins.2023.1059496 and potential targets. Finally, RT-qPCR, western blotting were used to validate the
COPYRIGHT expression of core targets.
© 2023 Wei, Yao, Zhang, Wen, Zhang, Luo, Cao Results: Behavioral experiments, HE staining and Nissl staining have shown
and Li. This is an open-access article
distributed under the terms of the Creative that BBR can improve memory task performance and neuronal damage in the
Commons Attribution License (CC BY). The hippocampus of AD mice. 117 BBR-associated targets for the treatment of AD
use, distribution or reproduction in other were identified, and 43 genes were used for downstream functional enrichment
forums is permitted, provided the original
author(s) and the copyright owner(s) are analysis in combination with the results of protein–protein interaction (PPI)
credited and that the original publication in this network analysis. 2,230 biological processes (BP) terms, 67 cell components (CC)
journal is cited, in accordance with accepted terms, 243 molecular function (MF) terms and 118 KEGG terms were identified.
academic practice. No use, distribution or
reproduction is permitted which does not ALB, EGFR, CASP3 and five targets in the PI3K-AKT signaling pathway including
comply with these terms. AKT1, HSP90AA1, SRC, HRAS, IGF1 were selected by PPI network analysis,
validated by molecular docking analysis and RT-q PCR as core targets for further
analysis. Akt1 mRNA expression levels were significantly decreased in AD mice
and significantly increased after BBR treatment (p<0.05). Besides, AKT and ERK
phosphorylation decreased in the model group, and BBR significantly increased
their phosphorylation levels.
Conclusion: AKT1, HSP90AA1, SRC, HRAS, IGF1 and ALB, EGFR, CASP3 were core
targets of BBR in the treatment of AD. BBR may exert a neuroprotective effect by
modulating the ERK and AKT signaling pathways.

KEYWORDS

Berberine, Alzheimer’s disease, AKT, pharmacology, neuroprotective effect

Frontiers in Neuroscience 01 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

Introduction Committee of the Xiyuan Hospital of the China Academy of

Chinese Medical Sciences (No. 2022XLC020-2). Each mouse was
Alzheimer’s disease International (ADI) estimates that fed 0.1 ml/10 g body weight by gavage for 3 months, and the BBR
approximately 50 million people worldwide have dementia and that group received the corresponding drug, while the 3 × Tg AD model
this number will triple by 2050, placing a great burden on families and group and the control group received equal amounts of distilled
society. Despite the urgent need, the development of new drugs faces water. The final numbers of animals in the control group, model
significant challenges. Currently, only cholinesterase inhibitors and group and BBR group were 9, 9 and 7, respectively due
N-methyl-D-aspartate receptor antagonists have been approved for to mishandling.
cognitive enhancement, although tremendous progress has been made
in the understanding of the molecular mechanisms (Scheltens et al.,
2021). In addition to the classical targets related to Aβ and tau protein Chemical reagents
hyperphosphorylation, lysosomal pathways, autophagy, apoptosis,
transcription factor EB (TFEB), and TREM2 are also potential Berberine at ≥98% purity (LDSW220209-1) was supplied by
therapeutic pathways and targets for Alzheimer’s disease (AD) (Singh Shaanxi Langde Biotechnology Co., Ltd., and the HE staining kit was
et al., 2019a; Rai et al., 2021). Multi-target effect of Traditional Chinese purchased from Servicebio (G1003).
medicine (TCM) has been attributed with unique benefits in the
treatment of AD. Pharmacological data show that various formulas,
extracts and compounds can alleviate symptoms and improve the Behavioral experiments
quality of life of AD patients (Alexiou et al., 2019; Pei et al., 2020).
Recently, Berberine (BBR) has attracted much interest due to its The open field test (OFT) was performed by placing the mice in
pharmacological effects in the treatment and/or management of AD a box (40 cm L × 40 cm W × 40 cm H). The test area in the box was
(Singh et al., 2019b, 2021a). BBR is an isoquinoline alkaloid and the divided into 16 squares (10 × 10 cm) by the computer software and
main active component of several well-known herbs used in TCM, the four innermost squares were defined as the central area. During
such as Coptis chinensis Franch (Huanglian) and Phellodendron sinii 5 min OFT test, total distance (cm), total movement (s), speed (cm /
Y.C. Wu (Huangbo). Previous data suggest that BBR is a promising s), distance in the center (cm), and time in the center (s)
therapeutic agent for the treatment of bacterial diarrhea, were calculated.
cardiovascular and metabolic diseases (Jiang et al., 2011; Feng et al., Twenty-four hours after OFT test, a novel object recognition test
2019; Xu et al., 2021). BBR has therapeutic potential in the treatment (NOR) was performed. This test consisted of an exposure phase to a
of AD by targeting amyloid beta plaques, neurofibrillary tangles, familiar object, followed by a phase of exposure to a novel object the
neuroinflammation, and oxidative stress (Zhu and Qian, 2006; Jiang next day. Each phase lasted 10 min. During the exposure phase to a
et al., 2015). However, the molecular basis of these effects has not familiar object, mice were placed in the same box with two identical
been elucidated. objects in two parallel corners. 24 h later, one of the two objects was
To further explore the therapeutic potential and efficacy basis of replaced by a novel one. The preference index (PI) and the recognition
BBR in AD, we used network pharmacology to investigate the index (RI) were recorded. PI was defined as the time spent exploring
mechanisms underlying the multiple effects of BBR in this work. two objects during the exposure phase to a familiar object, while RI
Network pharmacology is an emerging field of pharmacology that can was calculated as follows: Tnovel/(Tnovel + Tfamiliar). Notes: Tnovel and Tfamiliar
be used to study drug action and interaction with targets (Berger and indicate the time spent with the novel and familiar objects during the
Iyengar, 2009). The dose of BBR used in our experiments was based exposure phase to the novel object.
on a previous research report (Kong et al., 2004). The workflow of this Next, the Morris water maze (MWM) test was used to assess
study is presented in Figure 1. This study may provide the basis for the spatial memory of mice. The facility consists of a white tank (diameter
development of BBR applications in the prevention and 120 cm, height 50 cm), an automatic camera, and a computer analysis
treatment of AD. system. The pool was divided into four quadrants with specific
markers, respectively, and a cylindrical escape platform (diameter
10 cm, height 15 cm) was placed in the first quadrant 1 cm beneath
Materials and methods the water filled with nontoxic white dye. For training, spatial
navigation experiments were performed for five consecutive days;
Animals each mouse was trained four trials per day for 90 s each using different
entry points. The mice were placed in the water facing the wall of the
Twenty 11–12 months 3 × Tg AD female mice (No: 14002A) pool, and the time between entering the water and finding the escape
were randomly divided in 2 groups: the 3 × Tg AD model group and platform (with all limbs on the platform for 6 s; escape latency) was
the BBR group (50 mg∙kg−1∙d−1). Ten age-matched wild-type female recorded using a video tracking system. On day 6, the escape platform
C57 mice were used as controls. All animals were purchased from was removed for spatial exploration experiments; mice were placed
Beijing HFK Bioscience Co., Ltd. All animals were caged in SPF in the water facing the wall of the pool (at the midpoint of the third
barrier-protected facilities with a temperature of (22 ± 3) °C, relative quadrant), and the number of times the mouse crossed the original
humidity of (50 ± 10) % and automatic light cycles (12 h light/dark). platform area within 90 s was recorded, the time in the target
Food and water were freely available. This experiment started after quadrant and distance moved in the target quadrant were also
1 week of adaptive feeding. All experiments were carried out recorded to examine memory of the target quadrant where the
according to animal care guidelines and were approved by the Ethics original platform was located. A quiet environment with a stable light

Frontiers in Neuroscience 02 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

FIGURE 1
Workflow of the study.

source and a water temperature of 23 ± 1°C were maintained used for HE staining, and Toluidine blue staining solution (G1032;
during experiments. Wuhan Servicebio Technology Co., Ltd.) was used for Nissl staining.
Sections were finally sealed with neutral gum and examined under an
upright optical microscope (NIKON ECLIPSE E100) for
Tissue preparation image acquisition.

After the behavioral experiments, the brains were quickly

removed. For each group, half of the brains were fixed in 4% Data on the pharmacological and
paraformaldehyde, and the other half were snap frozen in liquid molecular properties of BBR
nitrogen and stored at −80° C for further analysis.
MOL001454 (CAS, 2086-83-1) was found by searching for the
chemical name “berberine” in the traditional Chinese medicine
Histomorphological observation of brain systems pharmacology database (TCMSP),1 and absorption,
tissue distribution, metabolism, and excretion (ADME) parameters for BBR
were also obtained. The molecular structure of BBR was downloaded
Brain tissues were embedded in paraffin and sectioned. Then from the PubChem database2 and dealed with PyMOL2.4.0 software.
sections were processed as follows: Xylene for 20 min, two times; 100%
ethanol for 5 min, two times; 75% ethanol for 5 min; and tap water
rinsing. Sections were subjected to hematoxylin–eosin (HE) and
toluidine blue (Nissl) staining. Hematoxylin–Eosin Staining Kit 1 https://tcmsp-e.com/tcmsp.php
(G1003; Wuhan Servicebio Technology Co., Ltd., Wuhan, China) was 2 https://pubchem.ncbi.nlm.nih.gov/compound/2353

Frontiers in Neuroscience 03 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

Identification and collection of potential Protein Data Bank (PDB) database.8 PyMOL 2.4.0 software,9 Auto Dock
targets of BBR Tools 1.5.7 software were used for pre-docking molecular processing to
obtain PDBQT file. The Auto Dock Vina software 1.1.210 was then used
Potential BBR targets were identified and collected using the for molecular docking and calculation of the affinity score. A lower
PharmMapper platform,3 which is an integrated pharmacophore affinity score indicates stronger binding. The results of molecular
matching platform including targets extracted from TargetBank, docking were visualized by PyMOL2.4.0 software. We calculated the
DrugBank, BindingDB, and PDTD database and over 7,000 receptor- RMSD (Root Mean Square Deviation) using PyMOL2.4.0 to verify the
based pharmacophore models (Liu et al., 2010; Wang et al., 2017). All reliability, and RMSD <2A was considered reliable.
predicted targets were imported in EXCEL to establish the BBR
target database.
RT-qPCR analysis

BBR-associated targets of Alzheimer’s An RNA extraction kit (Servicebio, G3640-50 T) was used to
disease extract total RNA from brain tissue. ReverTra Ace qPCR RT Master
Mix (TOYOBO, FSQ-201) was used for reverse transcription to
The comparative toxicogenomics database (CTD),4 DisGeNet5 generate cDNA templates and then real-time PCR was performed
(Piñero et al., 2015, 2017, 2020, 2021) and the human gene database under the following conditions: 95° C for 10 min, followed by 40 cycles
(GeneCards)6 were used to identify AD targets with the keyword of 95 ° C for 15 s and 60 ° C for 60 s. Real-time PCR was performed
‘Alzheimer’s disease’. Then, BBR-associated targets of AD were using Applied Biosystem 7,500 Real-Time PCR System, and the
generated by intersecting BBR targets with the above targets of relative expression of mRNA was calculated using the 2−ΔΔCt method.
Alzheimer’s disease. The primer sequences of all target genes are shown in Table 1.

Network construction and analysis of the Western blotting

protein–protein interaction
Brain tissues were lysed on ice in lysis buffer and then centrifuged
BBR-associated targets of AD were imported into STRING,7 and at 12,000 rpm for 20 min at 4°C. The protein content was determined
protein–protein interaction (PPI) data were exported under the using the bicinchoninic acid (BCA) method (G2026, Servicebio,
condition that the minimum required interaction score was 0.700. Wuhan, China). The extracted proteins were subjected to SDS-PAGE
We then built a network diagram using the Cytoscape 3.7.2 software. electrophoresis, transferred to 0.45 μm polyvinylidene difluoride
In addition, the MCODE and cytoHubba plug-ins were used to screen membranes (Millipore, Bedford, MA), and then blocked with 5% BSA
important PPI network modules. in TBST for 60 min. The membranes were subsequently incubated with
primary antibodie. The primary antibodies were listed as follows: Erk
1/2 (diluted 1:2000, rabbit, Cell Signaling Technology, Cat# 4695), p-Erk
Functional enrichment analysis 1/2 (diluted 1:2000, rabbit, Cell Signaling Technology, Cat# 4370), Akt
(diluted 1:5000, rabbit, proteintech, Cat No. 10176-2-AP), p-Akt
The biological process (BP), molecular function (MF), and cellular (diluted 1:5000, Mouse, proteintech, Cat No: 66444-1-Ig), or β–actin
component (CC) are three important parts of gene ontology (GO). (diluted 1:10000, Mouse, proteintech, Cat No: 66009-1-Ig) overnight at
GO and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway 4°C. The membrane was incubated with the HRP conjugated secondary
analysis were used for functional enrichment analysis. The R 3.6.3 antibodies, goat anti-mouse (diluted 1:10000, Abbkine, China) or goat
software was used for statistical analysis and visualization; the ggplot2 anti-rabbit IgG (diluted 1:10000, Abbkine, China) for 90 min after the
package 3.3.3 and the clusterProfiler package 3.14 were used. membrane had been washed with TBST 4 times for 10 min each. The
Significant terms were identified under the condition that false blots of proteins of interest were visualized using sensitive ECL western
discovery rate (FDR) was <0.05. The top terms identified were HRP substrate (# 17046, ZENBIO, Chengdu, China). Quantitative
visualized in a diagram. analysis of protein bands were performed using ImageJ software.

Molecular docking verification Statistical analysis

The molecular structure of BBR was downloaded from TCMSP, Data were statistically analyzed using SPSS 22.0 software (IBM
while the crystal structures of target proteins were obtained from the Corp., Armonk, NY, USA). Quantitative data were expressed as mean
with standard error of mean (SEM). Comparison between two groups
were performed using t test. The MWM latency data were analyzed
3 http://lilab-ecust.cn/pharmmapper/
4 http://ctdbase.org/about/
5 https://www.disgenet.org/ 8 https://www.rcsb.org/
6 https://www.genecards.org/ 9 https://pymol.org/2/
7 https://string-db.org/ 10 http://vina.scripps.edu/

Frontiers in Neuroscience 04 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

TABLE 1 Primer sequences of all target genes.

Gene Forward Primer (5′-3′) Reverse Primer (5′-3′)

Hsp90 TTTACTCTGCCTATTTGGTTGCTG CACAAAGAGAGTAATGGGATAGCC

Akt1 TTTGGGAAGGTGATTCTGGTG CAGGACACGGTTCTCAGTAAGC

Src AGATCACTAGACGGGAATCAGAGC GCACCTTTTGTGGTCTCACTCTC

Hras AGTACAGGGAGCAGATCAAGCG TGGCTGATGTTTCAATGTAGGG

Igf1 GACCGCACCTGCAATAAAGATAC CCTGTGGGCTTGTTGAAGTAAA

Alb AACAAGAGCCCGAAAGAAACG CTGGCAACTTCATGCAAATAGTG

Casp3 TGGAATGTCATCTCGCTCTGGT GAAGAGTTTCGGCTTTCCAGTC

Egfr CCGAAACTACGTGGTGACAGAT TGCCATTACAAACTTTGCGAC

Gapdh CCTCGTCCCGTAGACAAAATG TGAGGTCAATGAAGGGGTCGT

from the model group in speed (t = 3.59, p = 0.003), total move time
(t = 3.07, p = 0.008), time in the center (t = 2.27, p = 0.039), total
distance (t = 3.59, p = 0.003), and distance in the center (t = 2.46,
p = 0.0273), indicating differences in overall activity or anxiety-like
behavior (Figures 3B–F). During the novel object recognition test,
neither the control group nor the BBR group differed significantly
from the model group in the preference index (PI) (p > 0.05,
Figure 3G). After 3 months of BBR administration, mice in the BBR
group spent significantly more time with the novel object in the NOR
test as indicated by a significantly higher recognition index (t = −2.47,
p = 0.028) in the NOR test (Figure 3H).
The MWM test consists of a navigation test and an exploratory
experiment, which can be used to evaluate the learning memory
FIGURE 2
The molecular structure of BBR. The red structure in the figure ability of mice. In the navigation test, as shown in Figure 3I, the escape
represents the oxygen atom and the blue structure represents the latency of all mice gradually decreased with the increasing number of
hydrogen atom. training sessions, indicating that their ability to locate the platform
was enhanced. The escape latency of mice in the BBR group was
diminished compared to the model group and exhibited a significant
using a repeated-measures analysis of variance. All tests were two-sided difference on day 1 (p = 0.003), day 2 (p = 0.011) and day 5 (p = 0.007).
with an α of 0.05 and statistical significance threshold of p < 0.05. There were no significant differences in the speed of swimming among
the groups (p > 0.05, Figure 3J), and effects on locomotor ability could
be excluded. In addition, compared to the model group, mice in the
Results BBR group had a significantly higher number of platform crossings in
the exploratory experiment on day 6 (p = 0.039, Figure 3K).
Evaluation of druggability of BBR These results suggest that BBR alleviated the tense, manic, and
anxious behaviors of AD mice and improves recognition and memory
The pharmacological and molecular properties of BBR were performance, although more studies are necessary to clarify the
obtained from TCMSP (Ru et al., 2014) and are as follows: molecular mechanisms involved. See details in Supplementary data S1.
weight (MW) = 336.39, oral bioavailability (OB) = 36.86%, drug-likeness
(DL) = 0.78, blood brain barrier (BBB) = 0.57, half-life (HL) = 6.57. BBR
half-life (t1/2) is in the mid-elimination group. The molecular structure BBR ameliorates neuronal damage in the
of BBR (C20H18NO4) is shown in Figure 2. BBR is believed to be more hippocampus
druggable in the 180–500 Dalton MW range. It is a promising
therapeutic agent that can act in the central nervous system and is The size, density and arrangement of neurons in the hippocampus
characterized by high OR (≥20%) (Xu et al., 2012), high DL (≥0.18) (Tao may indicate neuronal damage. Using HE staining, chromatin in the
et al., 2013), and strong penetration (BBB > 0.3)(Tattersall et al., 1975). nucleus and ribosomes in the cytoplasm were stained blue-violet, while
components in the cytoplasm and extracellular matrix were stained
red, and the degree of staining may reflect the functional properties of
BBR improves the performance of memory hippocampal neurons. Under normal conditions, the cytoplasm is only
and recognition tasks in AD mice slightly stained, but it becomes overstained when cellular senescence
or neurodegenerative alterations occur. The hippocampal neurons of
The sequence of behavioral experiments is shown in control mice were dense and neatly organized, with full nuclei and
Figure 3A. During the OFT test, the BBR group differed significantly clear boundaries, whereas the neurons of model mice were overstained

Frontiers in Neuroscience 05 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

FIGURE 3
BBR improves recognition and memory task performance in AD mice. (A) Workflow of behavioral experiments; (B) Speed (cm/s), (C) Total move time
(S), (D) Time in center (s), (E) Total distance (CM), and (F) Distance in center (cm) during OFT test; PI (G) and RI (H) of NOR test; Escape latency (I);
Swimming speed (J) and Platform crossover number (K) during the MWM test, n=7–9, *p<0.05, compared with model group; ◆p<0.05 for latency data
between groups on the same day compared with the model group; #p<0.05 for latency data within groups compared with the first day.

and loosely arranged, with cytoplasmic deformation and swelling. In were densely arranged (Figure 4B). Quantitatively, in the CA1
the model mice, BBR treatment was able to reverse this phenotype and region of the hippocampus, neuron numbers were significantly
the neuronal morphology resembled that of controls (Figure 4A). higher in the BBR (t = −4.07, p = 0.015) group compared to the
Neurons in the model group showed relatively lighter blue model group (Figure 4C), suggesting that BBR can protect
staining, with a reduced number of Nissl bodies. Besides, in the hippocampal neurons to some extent and prevent
BBR groups, there was stronger cytoplasmic staining and neurons degenerative necrosis.

Frontiers in Neuroscience 06 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

FIGURE 4
BBR ameliorated neuronal damage in the hippocampus. (A) HE staining and Nissl staining (B) and its quantitative analysis (C) of the CA1 region. Data
were analyzed by t test between two groups, presented as mean±SEM, n=3, *p<0.05 compared to the model group.

FIGURE 5
BBR-associated targets of Alzheimer’s disease. (A) BBR-associated targets of AD from the intersection between BBR-targets and targets of AD, zoom in
to show the specific target in (B).

Identification of BBR-associated targets of expression, energy and material metabolism, and cell cycle regulation.
Alzheimer’s disease By detecting the interrelationship between target proteins, the possible
pathways of action of drugs can be predicted and provide directions for
Using the keyword ‘Alzheimer’s disease’, 215 potential BBR targets in-depth research. In this study, PPI analysis between BBR-associated
were obtained from the PM database, 24,282 AD targets from the CTD AD targets was performed to explore underlying mechanisms using
database, 3,397 AD targets from the DisGeNet database and 11,301 AD STRING and the results are shown in Supplementary data S3. The PPI
targets from GeneCards. 117 BBR-associated AD targets were network is visualized in Figure 6A. The results of MCODE (Figure 6B)
generated from the intersection of these three databases using a Venn and cytoHubba are shown in Supplementary data S4. Combining the
plot (Figure 5A). The names of these targets are shown in data obtained from the above algorithms, we obtained 43 genes for
Figure 5B. See detailed gene information in Supplementary data S2. downstream functional enrichment analysis. In total, 2,230 BP terms,
67 CC terms, 243 MF terms (p < 0.01 and FDR<0.01) and 118 KEGG
terms (p < 0.05 and FDR<0.01) (Supplementary data S5) were obtained.
Identification of the core networks and The top terms for each category are shown in Figure 6C: regulation of
targets of BBR in AD pathology cell death, cell death, regulation of programmed cell death, cellular
response to chemical stimulus, programmed cell death, regulation of
Proteins interact with each other to participate in various aspects apoptotic process, apoptotic process, cellular response to organic
of life processes such as biological signaling, regulation of gene substance, response to oxygen-containing compound, response to

Frontiers in Neuroscience 07 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

FIGURE 6
Core BBR targets in AD and GO/KEGG analysis. (A) PPI network of 117 BBR-associated targets of AD; (B) representative clusters extracted using
MCODE; (C) GO analysis of all the targets identified above; (D) KEGG analysis of all the targets identified above.

chemical in BP enrichment analysis Furthermore, Pathways in cancer, TABLE 2 Molecular docking results of core targets and BBR.
Proteoglycans in cancer, PI3K-AKT signaling pathway, MAPK
Affinity
signaling pathway, Prostate cancer, EGFR tyrosine kinase inhibitor Target name PDB RMSD (A)
(kcal/mol)
resistance, Endocrine resistance, AGE-RAGE signaling pathway in
AKT1 4ejn −10.2 0.001
diabetic complications, Estrogen signaling pathway, PD-L1 expression
and PD-1 checkpoint pathway in cancer involved in BBR treatment for HSP90AA1 3t0h −6.5 0.000
AD based on KEGG pathway analysis (Figure 6D). Importantly, ALB, SRC 1fmk −9.6 0.000
EGFR, CASP3 and five members of the PI3K-Akt signaling pathway
HRAS 2ce2 −5.2 0.001
including AKT1, HSP90AA1, SRC, HRA, and IGF1 were identified as
IGF1 1wqj −7.8 0.000
core BBR targets in AD for further study.
ALB 6hn1 −8.4 0.000

CASP3 2dko −6.6 0.001

Molecular docking analysis of core targets EGFR 8a27 −9.5 0.000

PDB, Protein Data Bank; RMSD, Root Mean Square Deviation.

To validate the core targets of BBR in AD, semi-flexible molecular
docking was performed using Auto Dock Vina software. A lower
affinity score indicates a stronger binding force. The crystal structures values were less than 2A, suggesting the molecular docking results are
of the target proteins are listed below: AKT1 (PDB: 4ejn), HSP90AA1 reliable (Table 2). Docking of core targets and BBR is shown in Figure 7.
(PDB: 3t0h), SRC (PDB: 1fmk), HRAS (PDB: 2ce2), IGF1 (PDB: 1wqj),
ALB (PDB: 6hn1), CASP3 (PDB: 2dko), EGFR (PDB: 8a27). After
molecular docking and interaction analysis, BBR was found to bind in BBR acts through the AKT pathway
a stable conformation to its targets as indicated by the low affinity
scores: −10.2 kcal/mol (AKT1), −6.5 kcal/mol (HSP90AA1), −9.6 kcal/ Relative expression changes of the core targets were detected
mol (SRC), −5.2 kcal/mol (HRAS), −7.8 kcal/mol (IGF1), −8.4 kcal/mol by RT-qPCR (Figure 8A). The level of Akt1 mRNA was
(ALB), −6.6 kcal/mol (CASP3) and − 9.5 kcal/mol (EGFR). All RMSD significantly reduced in AD mice (t = 2.96, p = 0.025). A similar

Frontiers in Neuroscience 08 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

FIGURE 7
Molecular docking results of core protein targets with BBR. The dotted line represents hydrogen bond interaction.

trend was observed for Hsp90aa1, Hras, Igf1, and Src mRNA of BBR suggest that it may be able to cross the blood–brain barrier
levels, but none of them was statistically significant (p > 0.05). (BBB) thus facilitating direct binding to potential targets within the
Among the core targets, Akt1 (t = −5.01, p = 0.002), Hsp90aa1 central nervous system (Peng et al., 2004; Jiang et al., 2015). After
(t = −3.66, p = 0.011), Hras (t = −2.99, p = 0.024) and Igf1 (t = 3.75, intravenous administration, BBR is quickly removed from the plasma
p = 0.019) mRNA levels were significantly increased after BBR (t1/2β = 1.13 h) and sharply increased in the hippocampus
treatment, while Src, Egfr mRNA levels showed a similar trend but (t1/2α = 0.215 h) with a delayed clearance rate (t1/2β = 12.0 h), indicating
lacked statistical significance (p > 0.05). Alb, Casp3 mRNA levels that it has the potential to act instantly through BBB, and can be stored
showed the opposite trend. These results suggest that Akt1, in the hippocampus, affecting memory and recognition performance
Hsp90aa1, Hras, Igf1 could play important roles in BBR (Wang et al., 2005).
treatment of AD. Several in vitro and in vivo experiments have revealed that BBR
Then, we explored whether BBR affects protein phosphorylation elicits neuroprotective effects in AD models as indicated by the
of AKT as well as ERK by western blotting at the protein assay level. following lines of data: ① BBR reduces Aβ levels by modulating APP
As shown in Figures 8B,C, AKT (t = 4.489, p = 0.004) and ERK processing and ameliorates Aβ pathology by inhibiting the mTOR/
(t = 5.645, p = 0.001) phosphorylation decreased in the model group, p70S6K signaling pathway (Asai et al., 2007; Durairajan et al., 2012;
and BBR significantly increased AKT (t = −3.721, p = 0.010) and ERK Panahi et al., 2013; Wang et al., 2021); ② it inhibits tau
(t’ = −4.126, p = 0.014) phosphorylation levels. hyperphosphorylation at Thr205 and Thr231 in the hippocampus via
the GSK3β/PGC-1α (Yang and Wang, 2022) or NF-κB signaling
pathways (He et al., 2017); ③ it reduces the production of
Discussion pro-inflammatory cytokines in activated microglial cells and
modulates mitochondrial bioenergetics (He et al., 2017; Wong et al.,
The molecular characteristics and physicochemical properties of 2021); ④ it reduces lactate dehydrogenase release and reactive oxygen
BBR indicate good druggability (Kumar et al., 2015). The properties species (ROS) generation (Chen et al., 2015), as well as the relative

Frontiers in Neuroscience 09 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

FIGURE 8
BBR acts through the AKT pathway. (A) Relative expression changes of the core targets; (B) BBR increased AKT phosphorylation; (C) BBR increased ERK
phosphorylation. Data were analyzed by t test between two groups, presented as mean±SEM, n=4, *p<0.05 compared to the model group.

mRNA expression of endoplasmic reticulum (ER) stress related observe are not from these impurities in a more in-depth study in
pathway genes (Xuan et al., 2020); ⑤ it rescues synaptic damage by the future.
activating LKB1/AMPK signaling in AD mice (Cai et al., 2019); ⑥ it Network pharmacology is considered the next paradigm in drug
promotes the formation of brain microvessels by enhancing CD31, discovery because it allows to analyze the “herb-compound-protein/
VEGF, N-cadherin, Ang-1 and inhibits neuronal apoptosis (Ye et al., gene-disease” interaction network from a systems biology perspective.
2021). Consistent with a previous study (Ye et al., 2021), our work Therefore, we investigated the targets of the action of BBR in AD using
shows that BBR improves memory and recognition performance in network pharmacology. 117 BBR-associated targets of AD were
AD mice. Furthermore, we show that BBR also ameliorates neuronal identified, of which 43 targets were selected for downstream functional
damage in the hippocampus. These results suggest that BBR plays a analysis by protein–protein interaction analysis using MCODE and
potential therapeutic role in AD by protecting hippocampal neurons. cytoHubba. The PI3K-AKT signaling pathway and MAPK signaling
However, the specific targets and mechanisms involved in this pathway are members of the most significant terms identified. ALB,
protective effect are currently poorly understood and more basic and EGFR, CASP3 and five targets that are members of the PI3K-AKT
clinical studies will be needed to confirm these results. In addition, pathway, including AKT1, HSP90AA1, SRC, HRAS, IGF1 were
BBR, together with epiberberine, coptisine, palmatine, and extracted as core targets of BBR in AD.
gatrorrhizine are the main active constituents of Coptis chinensis AKT, which functions downstream of PI3K, is the core component
Franch (Huanglian), participating in the prevention and treatment of of the PI3K-AKT pathway. Many cytokines or growth factors induce
AD (Meng et al., 2018; Wang et al., 2020). Among them, BBR is the phosphorylation of tyrosine residues by binding to the RTK
component with the highest content. Due to the similarity of membrane receptor. The regulatory subunit of PI3K, P85, binds to
physicochemical properties of these substances, the purification and phosphorylated tyrosine residues through its SH2 domain, which in
separation process of BBR by conventional methods such as acid- turn recruits the catalytic subunit P110 to form the active PI3K
water and ethanol inevitably incorporates other impurities, and it is enzyme. Activated PI3K further acts on PDK1, PIP3, to promote AKT
difficult to achieve 100% purity (Sun et al., 2014). Although most of phosphorylation (Thorpe et al., 2015; Long et al., 2021). AKT, also
the commercially purchased BBR products can reach a purity of 98% known as protein kinase B (PKB), is a serine/threonine kinase
or more, there are still less than 2% impurities that may have participating in the PI3K-Akt pathway. AKT1/PKBα is encoded by
undeniable influence on the study results. Thus, HPLC purification to AKT1, which is composed of three isoforms that contain a conserved
remove contaminants would need to be performed to ensure activities plekstrin homology domain, a central fragment, and a regulatory

Frontiers in Neuroscience 10 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

domain (Hanada et al., 2004). Thr308 and Ser473 are essential binding affinity. The results showed strong binding between BBR and
phosphorylation sites for AKT activation (Wei et al., 2019). the identified core targets. This suggests to us that BBR may play a role
HSP90AA1, SRC, HRAS, and IGF1 are members of the PI3K-AKT by altering the function of these proteins through compound binding.
pathway. The heat shock protein (Hsp) 90 encoded by HSP90AA is a Furthermore, we determined the relative expression changes of the
molecular chaperone involved in protein folding that regulates the main targets in AD mice by RT-qPCR, and found that Akt1, Hsp90aa1,
activity of AKT (Jhaveri and Modi, 2015). In the brain, Hsp90 is Hras, and Igf1 mRNA levels were significantly altered after BBR
involved in synaptic plasticity (Chen et al., 2014) as well as in the treatment. In addition, our results confirm that BBR significantly
targeting of tau for proteosomal degradation (Dickey et al., 2007), increased AKT and ERK phosphorylation levels. Phosphorylated AKT
regulate Aβ processing (Blair et al., 2014). Hsp90 usually forms a activates a range of downstream pathways, including the P53 pathway,
protein complex with other co-chaperones Hsp70, Hsp60, Hsp23, regulating protein translation, cell cycle, apoptosis. Activation of
acting as the core of the complex to promote the activation or stabilize PI3K/AKT signaling protects neurons from Aβ-induced neurotoxicity
the conformation of the target protein. Inhibitors of Hsp90 bind to the (Do et al., 2014), inhibits the formation of pathogenic neurogenic fiber
regulatory site of Hsp90 and act on it. There are two possible pathways: tangles (NFT) (Kitagishi et al., 2014), and regulates synaptic plasticity
one occurs by inducing a cytoprotective heat shock response, and the (Spinelli et al., 2019), playing an important regulatory role in
other acts by directing the degradation of pathogenic proteins. In AD, AD. Phosphorylation of ERK1/2 protein activates the ERK pathway,
Hsp90 expression is downregulated, and after administration of and accumulation of intra-neuronal (Aβ1–42) causes the significant
Hsp90 inhibitor, Aβ-induced neurotoxicity could be prevented by reduction in phosphorylation of ERK1/2 protein, affecting neuronal
increasing the level of Hsp70 and Hsp90 (Ansar et al., 2007; Gezen-Ak viability (Cruz et al., 2018; Kumar et al., 2023). Taken together, these
et al., 2013; Ou et al., 2014). The SRC protein-tyrosine kinase family results suggest that the ERK and AKT signaling pathways are crucial
mainly consists of 11 members, including SRC, FYN, and YES, three pathways to mediate the therapeutic effects of BBR in AD mice.
closely related group I enzymes (Brown and Cooper, 1996). Members BBR can have multiple effects in the treatment of AD, and this is
of the SRC kinase family are controlled by cytokine receptors, important because of the complex pathological changes and symptoms
G-protein coupled receptors, etc., participating in pathways that at different stages of AD. Given the low water solubility and limited
regulate survival, proliferation, and regulation of gene expression gastrointestinal absorption of BBR, nanotechnological modifications
through AKT or MAPKs (Thomas and Brugge, 1997; Roskoski, 2015). of BBR and its use in combination with other drugs may be useful to
Recently, FYN was shown to have several functions in the central improve both bioavailability and therapeutic efficacy (Singh A. et al.,
nervous system (CNS), and FYN dysfunction has been implicated in 2021; Singh et al., 2021b; Behl et al., 2022). More in-depth studies are
the pathological processes leading to AD (Nygaard, 2018). Rho needed in the future.
GTPases, including HRAS, have significant therapeutic potential in
the treatment of neurodegenerative diseases, as they have been
implicated in nearly all stages of brain development (Zamboni et al., Conclusion
2018; Schmidt et al., 2022). IGF1 may have a therapeutic effect in
neurodegenerative disorders by enhancing hippocampal neurogenesis AKT1, HSP90AA1, SRC, HRAS, IGF1, and ALB, EGFR, CASP3
(Morel et al., 2017) and promoting neuronal survival through the were core targets of BBR in the treatment of AD. BBR can exert a
PI3K / AKT and MAPK pathways (Vincent et al., 2004; Bronzi et al., neuroprotective effect by modulating the ERK and AKT
2010). Extracellular-signalregulated protein kinase (ERK), as one of signaling pathways.
the MAPK signaling subfamilies, is usually downstream of the AKT
pathway. Phosphorylation of ERK1/2 protein activates the ERK
pathway and plays an important role in regulating cell growth and Data availability statement
differentiation (Kumar et al., 2023).
The ALB gene encodes the most abundant protein in the blood, The original contributions presented in the study are included in
which is albumin. Higher levels of albumin in the cerebrospinal fluid the article/Supplementary material, further inquiries can be directed
(CSF) of AD patients respond to damage to the BBB (Lin et al., 2021). to the corresponding authors.
It can differentiate AD patients from controls together with hub genes
including JUN, SLC2A1, TFRC, and NFE2L2 (Wang et al., 2022). EGFR
is a potential therapeutic target for AD (Tsuji et al., 2021; Zhang et al., Ethics statement
2022).The protein encoded by CASP3 gene is a cysteine-aspartic acid
protease that plays an important role in the execution-phase of cell The animal study was reviewed and approved by the Ethics
apoptosis in AD, and the PI3K/AKT signaling pathway is the most Committee of Xiyuan Hospital of China Academy of Chinese
important intracellular factor involved in regulation of cellular Medical Sciences.
apoptosis (Khezri et al., 2023). In addition, it can be activated upstream
by the presence of extracellular factors and then act downstream on tau
protein (Avila, 2010). However, interactions obtained using STRING Author contributions
for PPI analysis are not specific for brain, which may interfere with the
specificity of the targets and the subsequent validation results. WW and J-xY performed experiments and data analysis and
To validate identified core targets, we performed molecular wrote the manuscript. T-tZ, J-yW, ZZ, and Y-mL assisted in the
docking analysis using AutoDock Vina (Trott and Olson, 2010), a experiments. YC and HL assisted with ideas and modification of the
computational method for predicting bound conformations and manuscript. All authors reviewed and approved the manuscript.

Frontiers in Neuroscience 11 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

Funding Publisher’s note

This study was funded National Key R&D Program of China All claims expressed in this article are solely those of the authors
(2022YFC3501400), and the Fundamental Research Funds for the Central and do not necessarily represent those of their affiliated organizations,
public welfare research institutes (ZZ15-YQ-013 and ZZ15-XY-PT-02), or those of the publisher, the editors and the reviewers. Any product
and science and technology innovation project of Chinese Academy of that may be evaluated in this article, or claim that may be made by its
traditional Chinese Medicine (CI2021A01401 and CI2021A04618). manufacturer, is not guaranteed or endorsed by the publisher.

Conflict of interest Supplementary material

The authors declare that the research was conducted in the The Supplementary material for this article can be found online
absence of any commercial or financial relationships that could at: https://www.frontiersin.org/articles/10.3389/fnins.2023.1059496/
be construed as a potential conflict of interest. full#supplementary-material

References
Alexiou, A., Kamal, M. A., and Ashraf, G. M. (2019). Editorial: the Alzheimer's disease Gezen-Ak, D., Dursun, E., Hanağası, H., Bilgiç, B., Lohman, E., Araz, Ö. S., et al.
challenge. Front. Neurosci. 13:768. doi: 10.3389/fnins.2019.00768 (2013). BDNF, TNFα, HSP90, CFH, and IL-10 serum levels in patients with early or late
onset Alzheimer's disease or mild cognitive impairment. J. Alzheimers Dis. 37, 185–195.
Ansar, S., Burlison, J. A., Hadden, M. K., Yu, X. M., Desino, K. E., Bean, J., et al. (2007).
doi: 10.3233/JAD-130497
A non-toxic Hsp90 inhibitor protects neurons from Abeta-induced toxicity. Bioorg. Med.
Chem. Lett. 17, 1984–1990. doi: 10.1016/j.bmcl.2007.01.017 Hanada, M., Feng, J., and Hemmings, B. A. (2004). Structure, regulation and function
of PKB/AKT—a major therapeutic target. Biochim. Biophys. Acta 1697, 3–16. doi:
Asai, M., Iwata, N., Yoshikawa, A., Aizaki, Y., Ishiura, S., Saido, T. C., et al. (2007).
10.1016/j.bbapap.2003.11.009
Berberine alters the processing of Alzheimer's amyloid precursor protein to decrease
Abeta secretion. Biochem. Biophys. Res. Commun. 352, 498–502. doi: 10.1016/j. He, W., Wang, C., Chen, Y., He, Y., and Cai, Z. (2017). Berberine attenuates cognitive
bbrc.2006.11.043 impairment and ameliorates tau hyperphosphorylation by limiting the self-
Avila, J. (2010). Alzheimer disease: caspases first. Nat. Rev. Neurol. 6, 587–588. doi: perpetuating pathogenic cycle between NF-κB signaling, oxidative stress and
10.1038/nrneurol.2010.157 neuroinflammation. Pharmacol. Rep. 69, 1341–1348. doi: 10.1016/j.pharep.2017.06.006

Behl, T., Singh, S., Sharma, N., Zahoor, I., Albarrati, A., Albratty, M., et al. (2022). Jhaveri, K., and Modi, S. (2015). Ganetespib: research and clinical development. Onco.
Expatiating the pharmacological and Nanotechnological aspects of the alkaloidal drug Targets. Ther. 8, 1849–1858. doi: 10.2147/OTT.S65804
Berberine: current and future trends. Molecules 27:3705. doi: 10.3390/ Jiang, W., Li, S., and Li, X. (2015). Therapeutic potential of berberine against
molecules27123705 neurodegenerative diseases. Sci. China Life Sci. 58, 564–569. doi: 10.1007/
Berger, S. I., and Iyengar, R. (2009). Network analyses in systems pharmacology. s11427-015-4829-0
Bioinformatics 25, 2466–2472. doi: 10.1093/bioinformatics/btp465 Jiang, Q., Liu, P., Wu, X., Liu, W., Shen, X., Lan, T., et al. (2011). Berberine attenuates
Blair, L. J., Sabbagh, J. J., and Dickey, C. A. (2014). Targeting Hsp90 and its co- lipopolysaccharide-induced extracelluar matrix accumulation and inflammation in rat
chaperones to treat Alzheimer's disease. Expert Opin. Ther. Targets 18, 1219–1232. doi: mesangial cells: involvement of NF-κB signaling pathway. Mol. Cell. Endocrinol. 331,
10.1517/14728222.2014.943185 34–40. doi: 10.1016/j.mce.2010.07.023

Bronzi, D., Bramanti, V., Tomassoni, D., Laureanti, F., Grasso, S., Volsi, G. L., et al. Khezri, M. R., Ghasemnejad-Berenji, M., and Moloodsouri, D. (2023). The PI3K/AKT
(2010). Neural markers expression in rat bone marrow mesenchymal stem cell cultures signaling pathway and Caspase-3 in Alzheimer's disease: which one is the beginner? J.
treated with neurosteroids. Neurochem. Res. 35, 2154–2160. doi: 10.1007/ Alzheimers Dis. 92, 391–393. doi: 10.3233/JAD-221157
s11064-010-0283-3 Kitagishi, Y., Nakanishi, A., Ogura, Y., and Matsuda, S. (2014). Dietary regulation of
Brown, M. T., and Cooper, J. A. (1996). Regulation, substrates and functions of SRC. PI3K/AKT/GSK-3β pathway in Alzheimer's disease. Alzheimers Res. Ther. 6:35. doi:
Biochim. Biophys. Acta 1287, 121–149. doi: 10.1016/0304-419x(96)00003-0 10.1186/alzrt265
Cai, Z. Y., Wang, C. L., Lu, T. T., and Yang, W. M. (2019). Berberine alleviates amyloid- Kong, W., Wei, J., Abidi, P., Lin, M., Inaba, S., Li, C., et al. (2004). Berberine is a novel
beta pathogenesis via activating LKB1/AMPK signaling in the brain of APP/PS1 transgenic cholesterol-lowering drug working through a unique mechanism distinct from statins.
mice. Curr. Mol. Med. 19, 342–348. doi: 10.2174/1566524019666190315164120 Nat. Med. 10, 1344–1351. doi: 10.1038/nm1135
Chen, M., Tan, M., Jing, M., Liu, A., Liu, Q., Wen, S., et al. (2015). Berberine protects Kumar, H., Chakrabarti, A., Sarma, P., Modi, M., Banerjee, D., Radotra, B. D., et al.
homocysteic acid-induced HT-22 cell death: involvement of Akt pathway. Metabolic (2023). Novel therapeutic mechanism of action of metformin and its nanoformulation
Brain Disease 30, 137–142. doi: 10.1007/s11011-014-9580-x in Alzheimer's disease and role of AKT/ERK/GSK pathway. Eur. J. Pharm. Sci.
181:106348. doi: 10.1016/j.ejps.2022.106348
Chen, Y., Wang, B., Liu, D., Li, J. J., Xue, Y., Sakata, K., et al. (2014). Hsp90 chaperone
inhibitor 17-AAG attenuates Aβ-induced synaptic toxicity and memory impairment. J. Kumar, A., Ekavali, C. K., Mukherjee, M., Pottabathini, R., and Dhull, D. K. (2015).
Neurosci. 34, 2464–2470. doi: 10.1523/JNEUROSCI.0151-13.2014 Current knowledge and pharmacological profile of berberine: an update. Eur. J.
Pharmacol. 761, 288–297. doi: 10.1016/j.ejphar.2015.05.068
Cruz, E., Kumar, S., Yuan, L., Arikkath, J., and Batra, S. K. (2018). Intracellular
amyloid beta expression leads to dysregulation of the mitogen-activated protein kinase Lin, Z., Sur, S., Liu, P., Li, Y., Jiang, D., Hou, X., et al. (2021). Blood-brain barrier
and bone morphogenetic protein-2 signaling axis. PLoS One 13:e0191696. doi: 10.1371/ breakdown in relationship to Alzheimer and vascular disease. Ann. Neurol. 90, 227–238.
journal.pone.0191696 doi: 10.1002/ana.26134
Dickey, C. A., Kamal, A., Lundgren, K., Klosak, N., Bailey, R. M., Dunmore, J., et al. Liu, X., Ouyang, S., Yu, B., Liu, Y., Huang, K., Gong, J., et al. (2010). PharmMapper
(2007). The high-affinity HSP90-CHIP complex recognizes and selectively degrades server: a web server for potential drug target identification using pharmacophore
phosphorylated tau client proteins. J. Clin. Invest. 117, 648–658. doi: 10.1172/JCI29715 mapping approach. Nucleic Acids Res. 38, W609–W614. doi: 10.1093/nar/gkq300
Do, T. D., Economou, N. J., Chamas, A., Buratto, S. K., Shea, J. E., and Bowers, M. T. Long, H. Z., Cheng, Y., Zhou, Z. W., Luo, H. Y., Wen, D. D., and Gao, L. C. (2021).
(2014). Interactions between amyloid-β and tau fragments promote aberrant aggregates: PI3K/AKT signal pathway: a target of natural products in the prevention and treatment
implications for amyloid toxicity. J. Phys. Chem. B 118, 11220–11230. doi: 10.1021/ of Alzheimer's disease and Parkinson's disease. Front. Pharmacol. 12:648636. doi:
jp506258g 10.3389/fphar.2021.648636
Durairajan, S. S., Liu, L. F., Lu, J. H., Chen, L. L., Yuan, Q., Chung, S. K., et al. (2012). Meng, F. C., Wu, Z. F., Yin, Z. Q., Lin, L. G., Wang, R., and Zhang, Q. W. (2018).
Berberine ameliorates β-amyloid pathology, gliosis, and cognitive impairment in an Coptidis rhizoma and its main bioactive components: recent advances in chemical
Alzheimer's disease transgenic mouse model. Neurobiol. Aging 33, 2903–2919. doi: investigation, quality evaluation and pharmacological activity. Chin. Med. 13:13. doi:
10.1016/j.neurobiolaging.2012.02.016 10.1186/s13020-018-0171-3
Feng, X., Sureda, A., Jafari, S., Memariani, Z., Tewari, D., Annunziata, G., et al. (2019). Morel, G. R., León, M. L., Uriarte, M., Reggiani, P. C., and Goya, R. G. (2017).
Berberine in cardiovascular and metabolic diseases: from mechanisms to therapeutics. Therapeutic potential of IGF-I on hippocampal neurogenesis and function during aging.
Theranostics 9, 1923–1951. doi: 10.7150/thno.30787 Neurogenesis (Austin) 4:e1259709. doi: 10.1080/23262133.2016.1259709

Frontiers in Neuroscience 12 frontiersin.org

Wei et al. 10.3389/fnins.2023.1059496

Nygaard, H. B. (2018). Targeting Fyn kinase in Alzheimer's disease. Biol. Psychiatry Tattersall, M. H., Sodergren, J. E., Dengupta, S. K., Trites, D. H., Modest, E. J., and
83, 369–376. doi: 10.1016/j.biopsych.2017.06.004 Frei, E. 3rd. (1975). Pharmacokinetics of actinoymcin D in patients with malignant
melanoma. Clin. Pharmacol. Ther. 17, 701–708. doi: 10.1002/cpt1975176701
Ou, J. R., Tan, M. S., Xie, A. M., Yu, J. T., and Tan, L. (2014). Heat shock protein 90 in
Alzheimer's disease. Biomed. Res. Int. 2014:796869. doi: 10.1155/2014/796869 Thomas, S. M., and Brugge, J. S. (1997). Cellular functions regulated by Src
family kinases. Annu. Rev. Cell Dev. Biol. 13, 513–609. doi: 10.1146/annurev.
Panahi, N., Mahmoudian, M., Mortazavi, P., and Hashjin, G. S. (2013). Effects of
cellbio.13.1.513
berberine on β-secretase activity in a rabbit model of Alzheimer's disease. Arch. Med.
Sci. 9, 146–150. doi: 10.5114/aoms.2013.33354 Thorpe, L. M., Yuzugullu, H., and Zhao, J. J. (2015). PI3K in cancer: divergent roles of
isoforms, modes of activation and therapeutic targeting. Nat. Rev. Cancer 15, 7–24. doi:
Pei, H., Ma, L., Cao, Y., Wang, F., Li, Z., Liu, N., et al. (2020). Traditional Chinese
10.1038/nrc3860
medicine for Alzheimer's disease and other cognitive impairment: a review. Am. J. Chin.
Med. 48, 487–511. doi: 10.1142/S0192415X20500251 Trott, O., and Olson, A. J. (2010). AutoDock Vina: improving the speed and accuracy
of docking with a new scoring function, efficient optimization, and multithreading. J.
Peng, W. H., Wu, C. R., Chen, C. S., Chen, C. F., Leu, Z. C., and Hsieh, M. T. (2004).
Comput. Chem. 31, 455–461. doi: 10.1002/jcc.21334
Anxiolytic effect of berberine on exploratory activity of the mouse in two experimental
anxiety models: interaction with drugs acting at 5-HT receptors. Life Sci. 75, 2451–2462. Tsuji, S., Hase, T., Yachie-Kinoshita, A., Nishino, T., Ghosh, S., Kikuchi, M., et al.
doi: 10.1016/j.lfs.2004.04.032 (2021). Artificial intelligence-based computational framework for drug-target
prioritization and inference of novel repositionable drugs for Alzheimer's disease.
Piñero, J., Bravo, À., Queralt-Rosinach, N., Gutiérrez-Sacristán, A., Deu-Pons, J.,
Alzheimers Res. Ther. 13:92. doi: 10.1186/s13195-021-00826-3
Centeno, E., et al. (2017). DisGeNET: a comprehensive platform integrating information
on human disease-associated genes and variants. Nucleic Acids Res. 45, D833–D839. doi: Vincent, A. M., Mobley, B. C., Hiller, A., and Feldman, E. L. (2004). IGF-I prevents
10.1093/nar/gkw943 glutamate-induced motor neuron programmed cell death. Neurobiol. Dis. 16, 407–416.
doi: 10.1016/j.nbd.2004.03.001
Piñero, J., Queralt-Rosinach, N., Bravo, À., Deu-Pons, J., Bauer-Mehren, A.,
Baron, M., et al. (2015). DisGeNET: a discovery platform for the dynamical exploration Wang, Y., Chen, G., and Shao, W. (2022). Identification of Ferroptosis-related genes
of human diseases and their genes. Database (Oxford) 2015:bav028. doi: 10.1093/ in Alzheimer's disease based on Bioinformatic analysis. Front. Neurosci. 16:823741. doi:
database/bav028 10.3389/fnins.2022.823741
Piñero, J., Ramírez-Anguita, J. M., Saüch-Pitarch, J., Ronzano, F., Centeno, E., Sanz, F., Wang, X., Shen, Y., Wang, S., Li, S., Zhang, W., Liu, X., et al. (2017). PharmMapper
et al. (2020). The DisGeNET knowledge platform for disease genomics: 2019 update. 2017 update: a web server for potential drug target identification with a comprehensive
Nucleic Acids Res. 48, D845–D855. doi: 10.1093/nar/gkz1021 target pharmacophore database. Nucleic Acids Res. 45, W356–W360. doi: 10.1093/nar/
gkx374
Piñero, J., Saüch, J., Sanz, F., and Furlong, L. I. (2021). The DisGeNET cytoscape app:
exploring and visualizing disease genomics data. Comput. Struct. Biotechnol. J. 19, Wang, X., Wang, R., Xing, D., Su, H., Ma, C., Ding, Y., et al. (2005). Kinetic difference
2960–2967. doi: 10.1016/j.csbj.2021.05.015 of berberine between hippocampus and plasma in rat after intravenous administration
of Coptidis rhizoma extract. Life Sci. 77, 3058–3067. doi: 10.1016/j.lfs.2005.02.033
Rai, S. N., Tiwari, N., Singh, P., Mishra, D., Singh, A. K., Hooshmandi, E., et al. (2021).
Therapeutic potential of vital transcription factors in Alzheimer's and Parkinson's Wang, Y. Y., Yan, Q., Huang, Z. T., Zou, Q., Li, J., Yuan, M. H., et al. (2021).
disease with particular emphasis on transcription factor EB mediated autophagy. Front. Ameliorating Ribosylation-induced amyloid-β pathology by Berberine via inhibiting
Neurosci. 15:777347. doi: 10.3389/fnins.2021.777347 mTOR/p70S6K signaling. J. Alzheimers Dis. 79, 833–844. doi: 10.3233/JAD-200995
Roskoski, R. Jr. (2015). Src protein-tyrosine kinase structure, mechanism, Wang, Z., Yang, Y., Liu, M., Wei, Y., Liu, J., Pei, H., et al. (2020). Rhizoma Coptidis for
and small molecule inhibitors. Pharmacol. Res. 94, 9–25. doi: 10.1016/j.phrs.2015.01.003 Alzheimer's disease and vascular dementia: a literature review. Curr. Vasc. Pharmacol.
18, 358–368. doi: 10.2174/1570161117666190710151545
Ru, J., Li, P., Wang, J., Zhou, W., Li, B., Huang, C., et al. (2014). TCMSP: a database of
systems pharmacology for drug discovery from herbal medicines. J. Cheminform. 6:13. Wei, Y., Zhou, J., Yu, H., and Jin, X. (2019). AKT phosphorylation sites of Ser473 and
doi: 10.1186/1758-2946-6-13 Thr308 regulate AKT degradation. Biosci. Biotechnol. Biochem. 83, 429–435. doi:
Scheltens, P., De Strooper, B., Kivipelto, M., Holstege, H., Chételat, G., Teunissen, C. E., 10.1080/09168451.2018.1549974
et al. (2021). Alzheimer's disease. Lancet 397, 1577–1590. doi: 10.1016/ Wong, L. R., Tan, E. A., Lim, M. E. J., Shen, W., Lian, X. L., Wang, Y., et al. (2021).
S0140-6736(20)32205-4 Functional effects of berberine in modulating mitochondrial dysfunction and
Schmidt, S. I., Blaabjerg, M., Freude, K., and Meyer, M. (2022). RhoA signaling in inflammatory response in the respective amyloidogenic cells and activated microglial
neurodegenerative diseases. Cells 11:1520. doi: 10.3390/cells11091520 cells–in vitro models simulating Alzheimer's disease pathology. Life Sci. 282:119824. doi:
10.1016/j.lfs.2021.119824
Singh, A., Dhaneshwar, S., and Mazumder, A. (2021). Investigating neuroprotective
potential of Berberine, Levetiracetam and their combination in the Management of Xu, X., Yi, H., Wu, J., Kuang, T., Zhang, J., Li, Q., et al. (2021). Therapeutic effect of
Alzheimer's disease utilizing drug repurposing strategy. Curr. Rev. Clin. Exp. Pharmacol. berberine on metabolic diseases: both pharmacological data and clinical evidence.
18, 182–190. doi: 10.2174/2772432816666210910104306 Biomed. Pharmacother. 133:110984. doi: 10.1016/j.biopha.2020.110984

Singh, A. K., Mishra, G., Maurya, A., Awasthi, R., Kumari, K., Thakur, A., et al. Xu, X., Zhang, W., Huang, C., Li, Y., Yu, H., Wang, Y., et al. (2012). A novel
(2019a). Role of TREM2 in Alzheimer's disease and its consequences on β- amyloid, tau chemometric method for the prediction of human oral bioavailability. Int. J. Mol. Sci. 13,
and neurofibrillary tangles. Curr. Alzheimer Res. 16, 1216–1229. doi: 10.217 6964–6982. doi: 10.3390/ijms13066964
4/1567205016666190903102822 Xuan, W. T., Wang, H., Zhou, P., Ye, T., Gao, H. W., Ye, S., et al. (2020). Berberine
Singh, A. K., Rai, S. N., Maurya, A., Mishra, G., Awasthi, R., Shakya, A., et al. (2021a). ameliorates rats model of combined Alzheimer's disease and type 2 diabetes mellitus via
Therapeutic potential of Phytoconstituents in Management of Alzheimer's disease. Evid. the suppression of endoplasmic reticulum stress. 3 Biotech 10:359. doi: 10.1007/
Based Complement. Alternat. Med. 2021:5578574. doi: 10.1155/2021/5578574 s13205-020-02354-7
Singh, A. K., Singh, S. K., Nandi, M. K., Mishra, G., Maurya, A., Rai, A., et al. Yang, M., and Wang, J. (2022). Berberine ameliorates cognitive disorder via GSK3β/
(2019b). Berberine: a plant-derived alkaloid with therapeutic potential to combat PGC-1α signaling in APP/PS1 mice. J. Nutr. Sci. Vitaminol. 68, 228–235. doi: 10.3177/
Alzheimer's disease. Cent. Nerv. Syst. Agents Med. Chem. 19, 154–170. doi: 10.217 jnsv.68.228
4/1871524919666190820160053 Ye, C., Liang, Y., Chen, Y., Xiong, Y., She, Y., Zhong, X., et al. (2021). Berberine
Singh, A. K., Singh, S. S., Rathore, A. S., Singh, S. P., Mishra, G., Awasthi, R., et al. improves cognitive impairment by simultaneously impacting cerebral blood flow and
(2021b). Lipid-coated MCM-41 mesoporous silica nanoparticles loaded with Berberine β-amyloid accumulation in an APP/tau/PS1 mouse model of Alzheimer's disease. Cells
improved inhibition of acetylcholine esterase and amyloid formation. ACS Biomater. Sci. 10:1161. doi: 10.3390/cells10051161
Eng. 7, 3737–3753. doi: 10.1021/acsbiomaterials.1c00514 Zamboni, V., Jones, R., Umbach, A., Ammoni, A., Passafaro, M., Hirsch, E., et al.
Spinelli, M., Fusco, S., and Grassi, C. (2019). Brain insulin resistance and hippocampal (2018). Rho GTPases in intellectual disability: from genetics to therapeutic
plasticity: mechanisms and biomarkers of cognitive decline. Front. Neurosci. 13:788. doi: opportunities. Int. J. Mol. Sci. 19:1821. doi: 10.3390/ijms19061821
10.3389/fnins.2019.00788
Zhang, T., Wei, W., Chang, S., Liu, N., and Li, H. (2022). Integrated network
Sun, C., Li, J., Wang, X., Duan, W., Zhang, T., and Ito, Y. (2014). Preparative separation pharmacology and comprehensive bioinformatics identifying the mechanisms and
of quaternary ammonium alkaloids from Coptis chinensis Franch by pH-zone-refining molecular targets of Yizhiqingxin formula for treatment of comorbidity with
counter-current chromatography. J. Chromatogr. 1370, 156–161. doi: 10.1016/j. Alzheimer's disease and depression. Front. Pharmacol. 13:853375. doi: 10.3389/
chroma.2014.10.043 fphar.2022.853375
Tao, W., Xu, X., Wang, X., Li, B., Wang, Y., Li, Y., et al. (2013). Network pharmacology- Zhu, F., and Qian, C. (2006). Berberine chloride can ameliorate the spatial memory
based prediction of the active ingredients and potential targets of Chinese herbal Radix impairment and increase the expression of interleukin-1beta and inducible nitric oxide
Curcumae formula for application to cardiovascular disease. J. Ethnopharmacol. 145, synthase in the rat model of Alzheimer's disease. BMC Neurosci. 7:78. doi: 10.1186/1471-
1–10. doi: 10.1016/j.jep.2012.09.051 2202-7-78

Frontiers in Neuroscience 13 frontiersin.org