en O = =

PATENT LA'
AND PRACTICE
MMM

rab
,
SIRS
Soe
SES CARRE

4
Pe

‘Kal yeanc nk t
ae

A KON arasal
Go

‘ /
Z

run’
,

v inita ‘Ra d akr s

tty

7
/ a
P70

OXFORD
a ‘INDIAN a
-ANDPRACTICE
Apractical and comprehensive reference
~ workon patent
lawinindia, this book covers
_ the gamut of the law from a practitioner's
perspective. It blends technology, management,
and law te give an insight into patent concepts.
| Supplemented by analyses of relevant cases
and illustrations, the work provides information
for professionais across disciplines. It delves
into aspects of patent law relating to chemistry,
pharmaceuticals, biotechnology, software,
electronics, and manufacturing.

The book covers various aspects of Indian

Patent Law ranging from patent protection to
enforcement and management. In addition to
substantive law, the book also delves into patent
procedures including the process for getting a
patent and opposition proceedings. Discussions
on skill-based aspects of patent law such as
specification and claim drafting, licence drafting,
patent searching, and infringement analysis are
also included in the ook.

ee and analytical, this work will

be invaluable tostudents and teachers of law,
_ sociclogy, and economics,
and will be a rich
; source ofinformation for lawyers, patent agents ’

a counsels, managers, and scientists.

Indian Patent Law and Practice
Indian Patent Law and Practice

KALYAN C. KANKANALA
ARUN K. NARASANI
VINITA RADHAKRISHNAN

OXFORD
UNIVERSITY PRESS
 OXFORD
UNIVERSITY PRESS
YMCA Library Building, Jai Singh Road, New Delhi 110 001

Oxford University Press is a department of the University of Oxford. It furthers the

University’s objective of excellence in research, scholarship, and education
by publishing worldwide in

Oxford New York

Auckland Cape Town Dar es Salaam Hong Kong Karachi Kuala Lumpur
Madrid Melbourne Mexico City Nairobi New Delhi Shanghai Taipei Toronto

With offices in
Argentina Austria Brazil Chile Czech Republic France Greece Guatemala
Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland
Thailand Turkey Ukraine Vietnam

Oxford is a registered trademark of Oxford University Press

Pep i “ewe in the UK and in certain other countries
‘ASO, a
ae
Pr oy xl Published in India
G by Oxford Ufiversity Press, New Delhi

Ne} ; The moral rightg of the author have been asserted

hd. : o, 'Ratpbase right Oxford University Press (maker)

SB hy fy irst published 2010

4
Risin. All rights reserved. part of this publication may be reproduced,
a ‘GG ‘© ®.or transmitted in any tm or by any means, electronic or mechanical,
i ing photocopying, recording or by any information storage and
retrieval system: rmission in writing from Oxford University Press.
Enquiries concerning reproduction outside the scope of the above should be
sent to the Rights Department, Oxford University Press, at the address above

You must not circulate this book in any other binding or cover
and you must impose this same condition on any acquirer

ISBN-13: 978-0-19-806774-0
ISBN-10: 0-19-806774-7

Typeset in Minion Pro 10/12

by Sai Graphic Design, New Delhi 110 055
Printed in India at Rajshri Photolithographers, New Delhi 110 032
Published by Oxford University Press
YMCA Library Building, Jai Singh Road, New Delhi 110 001
We would like to dedicate this book to our parents,
Krishna Mohan Kankanala & Rama Devi Kankanala
Ravindra Narasani & Krishnamma Narasani
Radhakrishnan e& Sharada Radhakrishnan
 Contents

List of Tables and Figures a.

List of Abbreviations ss
List of Cases
Preface HS
1. Patent System in India: An Overview
1.1 Indian Patent History
1.2 The Patents (Amendment) Act, 1999
1.3 The Patents (Amendment) Act, 2002
1.4 The Patents (Amendment) Act, 2005
1.5 Patent Rules and Patent Manual
1.6 The Indian Patent Office
1.7 International Instruments BW
we.
Gu
@&:
GG.
Oo
ee

1.8 Patent Trends

1.9 PCT Filing Trends —wn
—_&

2. Patentability Requirements N

2.1 Patentable Subject Matter

2.2 Industrial Application —_>
NI
Noe
viii CONTENTS

2.3 Novelty 24
2.4 Inventive Step 32
2.5 Specification 42

3. Patent Procedure 48
3.1 Filing of a Patent Application 50
3.2 Examination of Patent Applications 60
3.3 Publication of Patent Applications 66
3.4 Pre-grant Opposition and Representation 67
3.5 Patent Grant and Publication 71
3.6 Post-grant Opposition 71
3.7 Appeals to Appellate Board 75

4. Patent Amendment and Maintenance 98

4.1 Amendment of a Patent 98
4.2 Patent of Addition 103
4.3 Patent Maintenance 105
5. Patent Specification Drafting 113
5.1 Specification 113
5.2 Parts of a Specification 114
5.3 Sufficiency of Disclosure 123
5.4 Specification Drafting 127
5.5 Alternative Drafting Approach 132
6. Claim Drafting 135
6.1 Parts of a Claim 135
6.2 Types of Claims Based on Dependency 138
6.3 Types of Claims Based on Subject Matter 139
6.4 ‘Types of Claims Based on Field of Invention 139
6.5 Claim Interpretation and Analysis 167
7. Patent Assignment and Licences 170
7.1 Assignment and Licences 170
7.2 Compulsory Licences 172
7.3 Drafting Licences and Assignments 183
 CONTENTS

8. Infringement and Defences

8.1 Patent Rights
8.2 Term of a Patent
8.3 Territory of Validity
8.4 Infringement of a Patent
8.5 Jurisdiction
8.6 Persons Entitled to Sue
8.7 Burden of Proof
8.8 Defences to Patent Infringement
9. Patent Revocation and Surrender
9.1 Revocation of a Patent
9.2 Revocation on Surrender of a Patent

10. Remedies
10.1 Injunction
10.2 Damages and Account of Profits
10.3 Destruction, Seizure, or Forfeiture
10.4 Innocent Infringement
10.5 Declaration of Patent Validity
10.6 Declaration of Non-Infringement
10.7 Threats of Infringement
10.8 Study of a Relevant Case
11. PCT Applications
11.1 Advantages of the PCT System
11.2 PCT Procedure
11.3 PCT Statistics
IZ. Mining Patent Information
12.1 Patent Searching in india
12.2 Patent Searching in USA
12.3 Searching PCT Applications
12.4 Searching the European Patent Office Database
12.5 Search Strategy
xX CONTENTS

Appendices
I Chapter IV-A of the Patents (Amendment) Act, 1999 291
IIA Forms at the Indian Patent Office 295
IIB Schedule of Fees (2009) 306
IIC Convention Countries 309
IIIA PCT Forms
315
IIIB State Parties to the PCT and the Paris Conventions and
Members of the World Trade Organization 317
IVA Invention Disclosure Form
324
IVB Sample Specification Draft
327
VA Sample Assignment of Invention
341
VB Sample Licence Agreement
344
VI Year-wise Renewal Fees Payable (2009)
348
Glossary
350
 Tables and Figures

TABLES
1.1 Exclusive Marketing Rights Granted in India since
the 1999 Amendment
LZ Patent Filings and Grants
12 Top Ten Patent Owners Based on Patent Grants in 2007
1.4 Top Ten Patent Owners Based on Patent Grants in 2008
|
ee Indian PCT Filings
2.1 Prior Art and Anticipation
3.1 Territorial Jurisdiction of Patent Offices
3:2 Timeline for Taking Necessary Action at the Indian
Patent Office
5.1 Procedural Requirements 121
6.1 Claim Examples—Reference Table—Electronic/Software 149
6.2 Claim Examples—Reference Table—Mechanical/
Manufacturing 153
6.3 Claim Examples—Reference Table—Chemical/
Pharmaceutical 160

6.4 Claim Examples—Reference Table—Bio- Technology 164

 TABLES AND FIGURES

6.5 Claim Examples—Reference Table—Diagnostic Methods 166

Lia PCT Applications Published by the International Bureau 272
11.2 PCT Filings: Indian Patent Office as Receiving Office 272
11.3. Time Lines for PCT Process 272

FIGURES
3.1 The Indian Patent Process 49
i A Examination Flow Diagram 61
3.3 Flow Diagram—Pre-grant Representation 68
3.4 Flow Diagram—Post-grant Opposition 72
6.1 Example of a Method Claim 140
6.2 Molecular Structure of Compound 155
6.3 Molecular Formula of the Compound 156
vad Flow Diagram—Compulsory License Procedure 176
i Flow Diagram of the PCT Process, The International Phase 260
 Abbreviations

ARIPO African Regional Intellectual Property Organization

CAG Controller General
CGPDTM _ Controller General of Patents Designs and Trademarks
CSIR Council for Scientific and Industrial Research
DCGI Drugs Controller General of India
DO Designated Office
DOE Doctrine of Equivalence
EMR Exclusive Marketing Rights
EO Elected Office
EPO European Patent Office
FDA Food and Drug Administration
FER First Examination Report
HUL Hindustan Unilever Limited
IB International Bureau
IIT Indian Institute of Technology
IPAB Intellectual Property Appellate Board
IPC International Patent Classification
IPE International Preliminary Examination
IPEA International Preliminary Examining Authority
IPO Indian Patent Office
IPRP International Preliminary Report on Patentability
IS International Search
xiv ABBREVIATIONS

ISA International Search Authority

ISR International Search Report
MPPP Manual of Patent Practice and Procedure
MTCC Microbial Type Culture Collection and Gene Bank
NCE New Chemical Entity
PCT Patent Cooperation Treaty
PCT-SAFE PCT Electronic Filing Software
RO Receiving Office
TIFAC Technology Information, Forecasting and Assessment
Council
TRIPS Trade Related Aspects of Intellectual Property Rights
USPTO United States Patent and Trademark Office
WIPO World Intellectual Property Organization
WTO World Trade Organization
 Cases

AGC Flat Glass Europe SA v. Anand Mahajan and Ors, MANU/

DE/2490/2009.
Ajanta Pharma Limited (A company duly incorporated under The
Companies Act, 1956) through Mr Prabhakar Sonawane, Company
Secretary and Vice President, Corporate Affairs) v. The Controller
General of Patents, The Assistant Controller of Patents and Designs and
Elli Lilly and Co., MANU/IC/0064/2008.
American Cyanamid v. Ethicon Limited, 1975[2] WLR 316.
Braun Melsungen AG and Ors v. Rishi Baid and Ors, MANU/
DE/0376/2009.
Bajaj Auto Limited vy. TVS Motor Company Limited, 8(36) PTC
417(Mad) (2008).
Bajaj Auto Limited v. TVS Motor Company Limited, MANU/
TN/0174/2008.
TVS Motor Company Limited v. Bajaj Auto Limited, MANU/
TN/0976/2009.
AMP Incorporated vy. Hellerman Limited, (1962) RPC 55.
Bilcare Limited v. Amartara Private Limited, MANU/DE/0889/2007.
Bishwanath Prasad Radhey Shyam v. Hindustan Metal Industries,
MANU/SC/0255/1978.
Bishwanath Prasad Radhey Shyam vy. Hindustan Metal Industries, AIR
1982 SC 1444.
xvi CASES

Chemtura Corporation v. Union of India (UOI) and Ors, MANU/

DE/1880/2009.
Chrome-Alloying Co. Limited. v. Metal Diffusions Limited., (1962) RPC
33.
Dhanpat Seth and Ors v. Nil Kamal Plastic Crates Limited, MANU/
HP/0206/2007.
Dimminaco A.G. v. Controller of Patents, 2002 IPLR 255.
EBZ Online PrivateLimited v. The Controller of Patents, MANU/
IC/0069/2008.
Beecham Group Limited v. Bristol Laboratories Limited and another,
1967 (16) R.P.C. 406 at Para 25.
Electrical and Musical Industries, Ld. and Boonton Research Corpora-
tion Ld. v. Lisson Ld. and another, 1937 (54) R.P.C. 307(1) at Para 11.
F. Hoffmann-La Roche Limited and Anr. v. Cipla Limited , MANU/
DE/0517/2008.
Farbewerke Hoechst Aktiengesellschaft Vormals Meister Lucius &
Bruning a Corporation etc. v. Unichem Laboratories and Ors, MANU/
MH/0064/1969.
Farbewerke Hoechst Aktiengesellschaft Vormals Meister Lucius &
Bruning a Corporation etc. v. Unichem Laboratories and Ors, MANU/
MH/0064/1969 at Para 7.
Franz Xaver Huemer v. New Yash Engineers, MANU/DE/0015/1997.
Garware Wall Ropes Limited v. A.I. Chopra, Engineers and Contractors
and Konkan Railway Corporation Limited, MANU/MH/1317/2008 at
Para 7.
Garware Wall Ropes Limited (a company incorporated under the Com-
panies Act, 1956 through its Company Secretary Shri Anil Sadashiv
Wagle) v. A.I. Chopra, Engineers and Contractors a Proprietary Concern
through its Sole Proprietor A.I. Chopra and Konkan Railway Corpora-
tion Limited A company incorporated under the Companies Act, 1956,
MANU/MH/1317/2008 at Para 21.
Garware-Wall Ropes Limited v. Mr. Anant Kanoi and Ors,
MANU/
GJ/8265/2006.
Garware-Wall Ropes Limited v. Techfab India and 5 Ors
MANU/
GJ/0272/2008.
Hindustan Lever Limited v. Mr. Lalit Wadhwa and Anr, MANU/
DE/2328/2007 at Paras 8 and 9.
Hindustan Unilever Limited, (formerly known as Hindu
stan Lever
Limited) v. The Controller of Patents and Design, Sri
Rakesh Kumar,
 CASES xvii

Assistant Controller of Patents and Design and The Examiner of Patents

and Design, MANU/IC/0048/2008.
Hindusthan Lever Limited v. Godrej Soaps Limited and others, MANU/
WB/0049/1996.
Indian Network for People living with HIV/AIDS, rep. by its President
and Tamil Nadu Networking People with HIV/AIDS, rep. by its President
v., Union of India (UOI) rep. by the Secretary, Department of Industrial
Policy and Promotion, Ministry of Industry and Commerce, Control-
ler General of Patents and Designs, Assistant Controller of Patents and
Designs and F. Hoffmann-La Roche AG. MANU/TN/1217/2008.
J. Mitra and Co. Private Limited v. Kesar Medicaments and Anr, MANU/
DE/0306/2008.
K. Manivannan, Proprietor, Trading as Kumar Industries v. Shri M.
Mani, Proprietor, Valasumani Lathe Works, MANU/IC/0020/2009.
Kirin-Amgen Inc. v. Hoechst Marion Roussel Limited and Ors, (004)
UKHL 46.
Krone Aktingesellschaft and Anr v. Kartik Telecomptrols (Private) Lim-
ited, MANU/DE/0532/1992.
Lakha Ram Sharma v. Balar Marketing PrivateLimited, MANU/
SC/0711/2003.
Lakhpat Rai and Ors v. Sri Kishan Das and Ors, MANU/
UP/0155/1918.
Lallubhai Chakubhai Jariwala v. Chimanlal Chunilal and Co., MANU/
MH/0038/1935.
Laxmi Dutt Roop Chand v. Nankau and Ors, MANU/UP/0012/1964.
M.C. Jayasingh v. Mishra Dhatu Nigam Limited (MIDHANI), Apollo
Hospitals, Apollo Hospitals Enterprise Limited and Cancer Institute
(W.I.A.), (Regional Cancer Centre), MANU/TN/1045/2009.
Mariappan v. A.R. Safiullah, Mr Daniel, Jayam Industries represented
by its partner Mrs Indira Daniel and M.A. Rajabudeen, Proprietor,
trading as Shalimar Traders, MANU/TN/0828/2008.
Marconi’ Wireless Telegraph Co. v. Mullard Radio Value Co. Limited
Michigan State University v. The Assistant Controller of Patents and The
Controller General of Patents, Trademarks, Designs and Geographical
Indications, Patent Office Branch, MANU/IC/0013/2008.
Monsanto Company by their Patent Agent, De v. Coramandal Indag
Products (P) Limited, MANU/SC/0317/1986.
National Research Development Corpn. v. ABS Plastics Limited, MANU/
DE/0696/2009.
 XViil CASES

¢ National Research Development Corporation of India v. The Delhi Cloth

& General Mills Co. Limited and Ors, MANU/DE/0304/1979.
¢ Nokia Corporation of Keilalahdentie, a Finnish Company v. The Assis-
tant Controller of Patents and Designs, Government of India, MANU/
IC/0019/2009.
¢ Novartis AG represented by its Power of Attorney Ranjna Mehta Dutt
v. Union of India (UOI) through the Secretary, Department of Industry,
Ministry of Industry and Commerce and Ors, MANU/TN/1263/2007
and MANU/IC/0034/2009.
* Novo Nordisk Health Care AG v. The Assistant Controller of Patents and
Designs, Government of India, MANU/IC/0008/2009.
¢ Officine Lovato S.P.A. v. Raajan Automobiles (P) Limited and Ors,
MANU/TN/2763/2002.
+ PN. Krishna Murthy v. Cooperative for American Relief Everywhere,
MANU/DE/0017/2000.
¢ Pepsico Inc. and Ors v. Sunrise Beverages, MANU/DE/2228/2007.
¢ Pillalamarri Lakshmikantham and Ors v. Ramakrishna Pictures and
Ors, MANU/AP/0093/1981.
* Press Metal Corporation Limited v. Noshir Sorabji Pochkhanawalla,
1982 PTC 259 (Bom).
* Raj Prakash v. Mangat Ram Chowdhry and Ors, MANU/
DE/0152/1977.
* Rajesh Kumar Aggarwal and Ors v. K.K. Modi and Ors, MANU
/
SC/8043/2006: (2006) 4 SCC 385.
* Ravi Kamal Bali v. Kala Tech and Ors, MANU/MH/0549/2008.
¢ Rickett & Colman of India Limited v. Godrej Hi Care Limite
d, 2001
PTC 637 (PO).
* Roche Products, Inc. v. Bolar Pharmaceutical Co. Inc.,
733 F.2d 858
(C.A. Fed., 1984).
* Rohtas Industries Limited and Ors, v. Indian Hume
Pipe Co. Limited,
MANU/BH/0169/1954.
« Rolic AG et al v. The Controller General of Patents
and The Assistant
Controller of Patents and Designs, MANU/IC/0012/200
8.
¢ S. Ram Kumar vy. Micromax Informatics
Limited, MANU/
PH/0627/2009.
+ Secretary, Department of Atomic Energy, Governme
nt of India v. The
Controller General of Patents, Designs and Trad
emarks and Ors,
MANU/WB/0015/2009,
¢ Shining Industries and Anr vy. Shri Krishna Industries MANU/
UP/0056/1975.
 CASES xix

Smith v. Grigg Limited, 41 R.P.C. 149(1)

Standipack Private Limited & Anr. v. M/s. Oswal Trading Co. Limited,
MANU/DE/0471/1999.
Surendra Lal Mahendra v. Jain Glazers and Ors, MANU/
DE/0330/1980.
Synthon BV v. Smithkline Beecham PLC, [2005] UKHL 59 (20 October
2005).
The Himalaya Drug Company v. Sumit, MANU/DE/2794/2005.
Time Incorporated v. Lokesh Srivastava and Anr., MANU/
DE/0104/2005.
TVS Motor Company Limited v. Bajaj Auto Limited, MANU/
TN/0976/2009.
UCB Farchim SA v. M/s Cipla Limited and Ors, W.P. (C) Nos 332 of
2010 and 13295, 12006, 8393, 8392 and 8389 of 2009.
V. Manika Thevar v. Star Plough Works, Melur, MANU/
TN/0222/1965.
V.B. Mohammed Ibrahim vy. Alfred Schafraneck and Ors, MANU/
KA/0061/1960.
Vikram India Limited v. Kilburn Engineering Limited, The Controller
of Patents and The Controller General of Patents and Designs and Trade
Marks, MANU/IC/0089/2008.
103. Wockhardt Limited vy. Hetero Drugs Limited and Ors 2006 (32)
PTC 65 (Madras).
 rn cing
Pde ahr aes
« aa

‘ peril: bp ia
* ry acral
mes eun
te
 Preface

fter founding Brain League with the objective of providing Patent

Services with a blend of law, technology, and management, we started
a new trend for such services, which were traditionally being offered by
lawyers having no technology and/or management background. In our
pursuit towards establishing standards for patent services, we initiated
research and education programmes for patent professionals at various
levels. Our training programmes for corporates and patent profession-
als, which converge patent concepts with practical issues, were well-
received and have been highly rated by participants from national and
multinational companies.
As a part of our endeavour towards contributing to the flow of
knowledge in patent law, we carried out research on various ambiguous
aspects of patent law, such as patentability of biotech inventions, testing
parameters for software patentability, scope of research exemptions,
standards of non-obviousness, opposition strategies, and so on, and
published articles in national and international journals. Years of research
and work in the field have culminated in this book, which attempts to fill
the dearth in Indian patent literature regarding practice aspects of patent
lawThe book merges our experience as patent agents having diverse
technology backgrounds with patent concepts and gives a practical
insight into the law of patents.
 xxii PREFACE

To help a beginner understand the subject with ease, we have used

simple examples to explain complicated concepts of patent law such
as inventive step, equivalence, research exemptions, and so on. Special
chapters in the book have been dedicated to skill-based aspects of patent
practice, such as specification drafting, claim drafting, licence drafting,
and patent searching, with an aim to impart skills to aspiring professionals.
Examples taken from various fields of science and technology, such as
software, electronics, chemistry, pharmacology, biotechnology, and
mechanical engineering, have been used in specific chapters in order
to enable readers having the said backgrounds to comprehend issues
relevant to their respective fields. In addition to substantive aspects of
patent law, the book also focuses on patent procedure and issues related
to it. Based on our experience in the field, strategic aspects of patent law
relevant for businesses have also been elaborated in various sections of
the book.
For a beginner, the best approach to this book would be to read the
chapters in the order provided in the book. The chapters have been
logically organized in order to enable easy comprehension. Each chapter
gives the reader an insight into theory before elaborating on practice
issues. It must be noted that analytical sections of the book and skill-
based chapters are based on the experience of the authors, and the reader
may consider alternative approaches derived from concepts and theory
explained in the book.
A patent professional may use the book to refer to specific issues with
ease. As the book provides an understanding of various aspects of the
law
based on provisions in the Act, Rules, and decided cases, a practitioner
will find it easy to refer to important issues in question. Business
managers
may refer to strategic elements and business parameters that
have been
expounded in the book in order to enable decision-making on
various
points in the patent life cycle. Patent researchers may read
relevant topics
enunciated in the book and carry out further research
based on leads
provided in the references by the authors.
We have cited primary and secondary sources of law
in order to explain
various concepts in the book. The reader must give great
er importance to
primary sources of law such as the Patents Act, Indian cases,
and Patent
Rules, rather than secondary sources such as foreign
cases, Manual of
Patent Practice and Procedure, and articles. The secon
dary sources have
been cited to explain concepts under the Patents
Act and may not be
considered to be conclusive. The reader is advised
to refer to a book or
 PREFACE Xxiil

article on sources of law in order to understand the binding nature of

each source.
After about two years of hard work, we are happy that we have
successfully completed the book with the help of our friends and
colleagues. We would like to thank every one who has worked with us
on the book at various stages. Vishal’s case research, drawing skills, and
organization of data played an important role in supporting our effort and
we would like to thank him for everything he has done for us. We would
like to thank Vikram, Venkatesh, Adithi, Vijay, and Vintee for helping
us with the drawings and organization of content. Our special thanks to
Nishant and Anil for giving their critical inputs on various topics. We are
very grateful to Anil Suraj for critiquing and giving us valuable inputs for
improving the quality of the book.
Ae a
: tlio
 l
Patent System in India
An Overview

he Indian patent law has been designed with the primary objective
of promoting the progress of scientific research and technology for
public good (Bishwanath Prasad Radhey Shyam v. Hindustan Metal In-
dustries). It achieves this objective by granting exclusive rights to inven-
tors over their inventions for a limited period of time. Through the grant
of exclusive rights, the law encourages inventors to invent and investors
to invest in research and development. The exclusive right enables the in-
ventor to gain monetary benefits from the invention by commercializing
or licensing his invention (Garware Wall Ropes Limited vy. A.I. Chopra,
Engineers and Contractors, and Konkan Railway Corporation Limited). As
a result of the incentive offered by patent law, the inventor is encouraged
to create new inventions, which in turn promotes the progress of science
and technology. It is a quid pro quo or give and take relationship, where
an inventor gives his invention to the society and takes exclusive rights
over it for a limited period of time, after which the invention enters the
public domain (Raj Prakash v. Mangat Ram Chowdhry and Ors).

1.1 INDIAN PATENT HISTORY

Indian patent law evolved during the mid-nineteenth century. The first
patent law was passed in British India in the year 1856. The Act of 1856,
on protection of inventions, was based on the British law of 1852. Under
for a
the Act, privileges were granted to inventors over their inventions
 2 INDIAN PATENT LAW AND PRACTICE

period of fourteen years. In 1859, the Act was modified and exclusive
privileges were granted to inventors for making, using, and selling their
inventions within India for a period of fourteen years from the date of
filing of the specification. Later, in the year 1872, the Patterns and De-
signs Protection Act was passed followed by the Protection of Inventions
Act in 1883, and the law was consolidated in 1888 by the Inventions and
Designs Act.
In the year 1911, the Indian Patents and Designs Act, which was
repealed by the current Act, was enacted to replace the 1888 Act. The Act
provided the right to claim priority from certain countries. The term of a
patent under the Act was initially fourteen years and was later extended
to sixteen years through an amendment. The Act also provided for filing
of a provisional specification before a complete specification.
The Patent Act in force today was enacted in 1970, based on the
recommendations of the report submitted by Justice N. Rajagopala
Ayyangar and is called The Patents Act, 1970.! The Act came into force
on 20 April 1972. The Act was amended in 1999, with retrospective
effect from 1 January 1995. The Act was amended for the second time
in 2002, which amendment came into force on 20 May 2003. The latest
amendment to the Act was passed in 2005, which came into force from
1 January 2005.

1.2 THE PATENTS (AMENDMENT) ACT, 1999

Being a developing member state of the World Trade Organization
(WTO), India was given transition time until 2005, under the
Agree-
ment on Trade Related Aspects of Intellectual Property Rights
(TRIPS),
to provide for the grant of product and process patents to all
inventions
including drugs and medicines.’ As Section 5 of The Indian
Patent Act,
1970 provided only process patent protection for invent
ions relating
to food, medicines, and drugs, India was required to
grant exclusive
marketing rights to medicines or drugs as an alterna
tive to product
patent protection during the transition period.’ In
order to fulfil this
requirement under the TRIPS Agreement, the Patent
Act was amended
in 1999 to introduce Chapter IVA relating to exclusive
marketing rights
for medicines and drugs during the transition period.
’ Under Chapter
IVA, exclusive marketing rights to sell and distribute
a drug or medicine
were granted for applicants on satisfaction of certain
conditions.* Once
granted, the Exclusive Marketing Rights were typical
ly valid for a period
of five years and would come to an end earlier
on grant or rejection of the
patent.° The chapter relating to Exclusive Market
ing Rights was omitted
 PATENT SYSTEM IN INDIA 3

in the 2005 amendment Act after the expiry of the transition period given
to India. During the transition period, the Indian patent offices accepted
the product patent applications for food, medicine and drugs, and kept
them in, what is known as the ‘Mail Box. These applications were opened
for examination for the grant of patent only after 1 January 2005.
The Exclusive Marketing Rights granted in India since the 1999
amendment have been depicted in Table 1.1.

Table 1.1 Exclusive Marketing Rights Granted in India

since the 1999 Amendment
EMR No. EMR Applicant Name Title

EMR/1/2004’ Hoffmann-La Roche Inc. Interferon conjugates

EMR/2/2004° Eli Lilly & Co. Tadalafil and its dosage forms
EMR/3/2004’? _‘Panacea Bio Tec. Limited Pharmaceutical composition (Details
not available)
EMR/3/2003"” Eli Lilly & Co. Tetracyclic derivative preparation
and use
EMR/2/2003"' United Phosphorus Limited Insecticidal composition of
Carbendazim and Mancozeb
EMR/1/2003” Nichola Piramal India Limited Combination of Kit for Malaria
EMR/3/2003" Eli Lilly & Co. On Teteractadic Derivative Process
EMR/3/2003"" Novartis AG of Crystal modification of a N phenyl-
Schwarzwaldallee 2-phenyl-2-pyrimidineamine
derivative, process for its
manufacture and its use
EMR/2/2001" United Phosphorus Limited A synergistic composition of
Carbendazim and Mancozeb
EMR/4/2001'° Ranbaxy Laboratories Limited Pharmaceutical composition in the
form of oral controlled release tablets
or capsules
EMR/2/2000"” Schering-Plough Corporation Formulation for protection of PEG-
of USA Interferon Alpha Conjugate
EMR/1/2000"* Hoffman-La Roche Inc. Pharmaceutical composition (Details
not available)

In addition to incorporation of provisions relating to Exclusive Market-

ing Rights, the 1999 amendment also made other changes in the Patents
Act, one of which relates to the non-disclosure of inventions relating to
defence or security of India.”
 INDIAN PATENT LAW AND PRACTICE

1.3 THE PATENTS (AMENDMENT) ACT, 2002

After the Amendment in 1999, numerous changes were made to the
Indian Patent Act in 2002 through the Patents (Amendment) Act of 2002.
Some of the important changes are as follows:
_ . The definition ofthe term Invention was substituted by a new definition,

which included Inventive Step as an element of an invention under the

Act.”° Inventive Step was not a patentability criterion for grant of a
patent before the amendment. In addition to adding Inventive Step as
a criterion, the amendment defined the meaning of Inventive Step and
Industrial Application.”
. Prior to the amendment, the term of patent was fourteen years for
all inventions. Moreover, an exception was made for patents relating
to processes dealing with food, drugs, or chemicals, whose term was
five or seven years. As per the amendment, the term of a patent was
made twenty years from the filing date of the patent application for all
inventions.”
. Inthe amendments, the list of non-patentable inventions under Section
3 was modified. Some of the clauses were changed and new clauses
were added to the section. Clause (b) of the section was substituted
by a new clause which provided that any invention contrary to public
order, or morality, or prejudicial to health or environment, was not
patentable.” Some of the new clauses that were added to Section 3 are
as follows:
a) Clause (j) provided that plants and animals in whole or any part
thereof other than micro-organisms but including seeds, varieties
and species, and essential biological processes for production or
propagation of plants and animals were not patentable;
b) Clause (k) provided that a mathematical or business method, or a
computer program, per se, or algorithm, was not patentable;?5
c) Clause (1) provided that a literary, dramatic, musical, or artistic
work, or any other aesthetic creation whatsoever, including
cinematographic work and television production, was not
patentable;”°
d) Clause (m) provided that a mere scheme or rule, or method
of
performing a mental act or method of playing a game was not
patentable;””
e) Clause (n) provided that presentation of information was not
patentable;”*
f) Clause (0) provided that topography of integrated circui
ts was not
patentable;” and,
 PATENT SYSTEM IN INDIA 5

g) Clause (p) provided that an invention which, in effect, is traditional

knowledge or which is an aggregation or duplication of known
properties of traditionally known component or components was
not patentable.*°
The Amendment Act provided for deposit of biological materials that
formed part of a patent specification and conditions were laid down
for mentioning the deposit details in the specification.*!
The provisions relating to publication of a patent application on
completion of eighteen months from the priority date or filing date
were incorporated in the Act.”
As per Section 11B, which was incorporated under the amendment,
the examination of a patent application would be done by the patent
office only on filing of a request for examination by the applicant, as
opposed to automatic examination on filing of an application.”
Non-disclosure of the biological source of an invention and the
fact that an invention forms part of traditional knowledge were
incorporated as grounds of opposition and revocation.”
As per a new section that was incorporated, a patent application
cannot be filed abroad without the permission from the Controller
General (CAG), or Central Government, or before expiry of six weeks
from the date of filing of the application in India.”
The patent office was authorized to maintain electronic records.”
10. The provisions relating to grant of license of right were omitted and
new provisions relating to compulsory licences were incorporated.
The new sections laid down the conditions for grant of compulsory
licenses, powers of the Controller to grant such licences, powers of
the Central Government in case of national emergency and extreme
urgency, and so on.”
A: In case of a suit relating to infringement of a process patent, the
presumption was in favour of patent infringement in case of identical
products and the burden was placed on the defendant to prove that
there was no infringement.”
2, The amendment exempted the use of a patented invention for
purposes of obtaining drug approval from patent infringement.”
As per the amended provision, a person using a patented drug for
obtaining approval of the drug controller would not be liable for
infringement.
| The Appellate Board under the Trademark Act was given jurisdiction
for patent appeals. The powers of the Appellate Board and provisions
relating to appeals were laid down in the Act.”
 6 INDIAN PATENT LAW AND PRACTICE

14. A science background was made compulsory for a person seeking to

be registered as a patent agent under the Act. Earlier, lawyers without
science background could become patent agents.*!

1.4 THE PATENTS (AMENDMENT) ACT, 2005

The transition period given to India under the TRIPS agreement ended in
December 2004 and the Indian parliament passed the Patents (Amend-
ment) Act of 2005 in order to bring the Indian patent law in conformity
with the Agreement on TRIPS. In addition to provisions directed to the
TRIPS agreement, the amendment also modified and incorporated other
provisions in the Act. Some of the important changes brought about in
the amendment were as follows:
1. The chapter relating to definitions was once again modified. The
term, Budapest Treaty, was defined and provisions relating to deposit
of microorganisms were incorporated in order to bring the Act in
conformity with the Budapest Treaty on the International Recognition
of the Deposit of Microorganisms.” The terms, ‘High Court, ‘Inventive
Step, and ‘Patent’ were substituted by modified definitions.** New
definitions were added for the terms, ‘New Invention, ‘Opposition
Board, and ‘Pharmaceutical Substance’*
2. Section 3(d) of the Act was substituted by a new clause, which
provided that discovery of a new form, property or use of a known
substance was not patentable unless it results in enhanced efficacy.
The explanation to the clause provided that salts, esters, polymorphs,
and so on, of a substance are considered to be the same substance.*5
The primary objective of the clause was to prevent pharmaceutical
companies from obtaining patent protection over modifications of
known molecules or chemical entities. The constitutional validity
of
the section was challenged by Novartis through a writ petition before
the Madras High Court and the High Court rejected its plea and
held
that Section 3(d) was not violative of fundamental rights and
was
valid (Novartis AG v. Union of India).
3. The amendment omitted Section 5 of the Act, which
provided for only
process patent protection for food products, chemical
compositions,
and drugs. As a result, both process and product patent
s are now
available for all inventions in India. Chapter IVA of
the Act, which
related to exclusive marketing rights to drugs or medic
ines was also
omitted.
4, Various provisions of the Act were modified
in order to give
recognition to Patent Cooperation Treaty (PCT)
applications,
 PATENT SYSTEM IN INDIA 7)

Provisions have been incorporated in the Act with regard to filing,

priority, processing, and so on, of PCT applications.
The process involving the step of acceptance of a patent application
before it is granted has been modified. The application will now
be directly granted after it is examined. And there will be no
acceptance.
As per the modified Section 11A, an applicant can file an application
for early publication of his patent application. The amendment further
provided that the rights of the patent holder would start from the date
of publication of the patent. Furthermore, a provision provided that
manufacturer of drugs, or food materials or chemical compositions,
would not be liable for infringement of patents if the manufacturer
had made significant investment and was producing and marketing
the concerned product prior to the 1 January 2005;*
The time for putting the application in order for grant was made
twelve months from the date of receipt of the first examination report
from the patent office;*”
The amendment modified opposition proceedings and provided for
pre-grant opposition (representation) to a patent application, within
at least six months from the date of publication of the application,
and post-grant opposition, within a period of one year from the date
of publication of the patent grant, based on certain grounds. The
amended sections also provided for the constitution of an Opposition
Board by the patent office for dealing with post-grant Opposition;
Provisions relating to acquisition of a foreign filing permit were
modified. As per the provision, a person residing in India, who is
seeking to file a patent application outside India, is required to get a
foreign filing permission from the patent office or file an application
in India and wait for six weeks before filing abroad;
10. In a proceeding for revocation, the Appellate Board or the High
Court was given the power to allow the applicant to modify the patent
specification before the patent is revoked;”°
11. Section 68 of the Act was substituted and it provided that an
assignment would be valid only if it was executed and registered with
the patent office;”!
12. Compulsory licence relating to a patented pharmaceutical product
was made available for purposes of supplying the product to a country
lacking or having insufficient manufacturing capability during a
health crisis;*”
8 INDIAN PATENT LAW AND PRACTICE

13. The meaning of Convention Country was defined and conditions

relating to convention applications were laid down.”

1.5 PATENT RULES AND PATENT MANUAL

The Patent Rules are issued by the Central Government in order to imple-
ment the Act. The first set of rules under the Indian Patent Act, 1970,
were passed in 1972. Since then, the rules have been amended several
times. Significant changes were made to the rules in the years 1999, 2002,
2003, 2005, and 2006, based on the amendments to the Act.
The Manual of Patent Practice and Procedure (MPPP) lays down the
practice and procedure followed by the patent office while dealing with
patent applications. The MPPP was initially published by the Indian Patent
Office in 2005. Owing to the limitations and ambiguities in the Manual,
the Indian Patent Office has now published a new draft of MPPP.
The meaning and scope of provisions of the Patent Act are interpreted
and understood in the light of cases decided by the courts. The Patent
Rules have to be in consonance with the Patent Act and the case law or
decisions of courts. Any rule that is not in confirmation with the Patent
Act and case law will be considered to be invalid. As the MPPP lays down
guidelines to the patent office, it does not have the force of law. Any
procedure followed by the patent office must be in conformity with the
Patent Act, case law, and Patent Rules.

1.6 THEINDIAN PATENT OFFICE

The Patent Office is the administrative authority responsible for grant-
ing patents in India. The Patent, Trademark, and Design Offices in India
are governed by the regulations of Department of Industrial Policy and
Promotion, which is a department in the Ministry of Commerce and
Technology. The Department of Industrial Policy and Promotion has
appointed the Controller General of Patents, Designs, and Trademarks
(CGPDTM) to administer and supervise the said offices. The CGPTDM
along with his other subordinates including the Senior Joint Controller,
Joint Controller, Deputy Controllers, and Assistant Controllers adminis-
ter the smooth functioning of the Indian Patent Office. The patent office
has patent examiners specialized in various technology areas, who are
responsible for examining the patent applications referred to them by the
Controller.
There are four patent offices in India, which are located at Kolkata,
New Delhi, Mumbai, and Chennai. The Kolkata office is the head office
and other offices are branch offices. Additionally, an office for the Patent
 PATENT SYSTEM IN INDIA 9

Information System is located in Nagpur. The Patent Offices examine

and grant patents to applications across various technological domains.
The pre-grant and post-grant publications of the patent applications and
granted patents are done every week in the official gazette published by
the Patent Office.™
Apart from processing national applications, the Indian Patent
Offices also act as receiving offices for PCT applications. Recently, the
Indian Patent Office has been accorded the status of the International
Search Authority and International Preliminary Examination Authority
under the Patent Cooperation Treaty by the World Intellectual Property
Organisation.
Most decisions of the Controller of Patents are appealable to the
Appellate Board. The Board has jurisdiction to hear appeals from
examination decisions, opposition decisions, and so on. The Board has
the power to make rules regarding proceedings before it.

1.7 INTERNATIONAL INSTRUMENTS

1.7.1 Paris Convention

India is a member of the Paris Convention having acceded to it in 1998.
The Paris Convention for Protection of Industrial Property was signed in
1883 by fourteen contracting states also called as Convention Countries
and was the first major international convention relating to Industrial
Property.” The Convention enabled applicants to obtain international in-
tellectual property protection by requiring the Convention Countries to
give National Treatment, recognize Priority Rights, and so on. As per the
National Treatment requirement, each of the Convention Countries is re-
quired to treat patent applicants from all the other Convention Countries
in the same manner as its own applicants.*° With regard to recognition of
Priority Rights, the Convention requires each of the Convention Coun-
tries to recognize the date of first filing of a patent application in any of
the Convention Countries as the date of priority for a patent application
filed in that Country, provided such application is filed within twelve
months from the date of first filing.” The Convention also provides other
minimum standards to be followed by all Convention Countries relat-
ing to independence of patents, inventorship, importation of articles and
so on. The Indian patent law is in line with the basic principles relating
to National Treatment, Priority Rights, and so on, provided in the Paris
Convention.
10 INDIAN PATENT LAW AND PRACTICE

1.7.2 TRIPS Agreement

India became a member of the WTO in 1995 and as a WTO member,
India was bound to comply with various agreements that govern WTO
members one of which is the Agreement on TRIPS. The TRIPS Agree-
ment is to date the most comprehensive multilateral agreement on intel-
lectual property.** The Agreement provides the minimum standards of
protection for intellectual property to be provided by each member state
of WTO.” With regard to standards for patent protection, the provisions
of the Agreement are in addition to the requirements under the Paris
Convention. The TRIPS Agreement also provides domestic procedures
and remedies to be implemented for enforcement of intellectual property
rights.” In addition, it also sets forth provisions for dispute settlement
for resolving disputes regarding compliance.*' The member states have
the freedom to implement the minimum standards in their legal system
in an appropriate manner and may provide stronger protection under
their national laws than what is provided under the TRIPS Agreement.
India amended its Patents Act in 1999, 2002, and 2005 in order to bring it
in conformity with the Agreement on TRIPS and the amendments have
been explained in the section on Indian patent history.

1.7.3 Patent Cooperation Treaty

The PCT was adopted at Washington in 1970 by member states in order to
bring about co-operation between members regarding international pat-
ent filing, searching, examination, and other technical services.” Patent
Cooperation Treaty provides an international filing process for obtaining
patents in multiple countries. It enables an applicant in a member state to
file a patent application and obtain a patent in all countries designated in
the application. The PCT involves an international phase that enables the
patent applicant to obtain an international search and/or examination
report, and a national phase through which the applicant can acquire a
patent.®* By opting for the PCT filing process, the applicant can get cer-
tain strategic and cost benefits. After India became a member of PCT in
1998, it modified its patent law in order to enable and recognize PCT
application filings at the Indian Patent Office.
1.8 PATENT TRENDS
1.8.1 Patent Filings at the Indian Patent Office
The number of patents filed every year at the Indian Patent Office (IPO)
has been increasing at a steady rate. Table 1.2 shows the statistics for the
patent filings and grants from the years 2001 to 2008.
 PATENT SYSTEM IN INDIA ll

Table 1.2 Patent Filings and Grants

Se nsesesiisssesennis-roosereneerenme-ieresceeesiiipensesieeeeeee ee.
(2001-8)
Year Applications Filed Indian Origin Examined Granted
2001-2 10,592 2,371 5,104 ¥;591
2002-3 11,466 2,693 9,538 13379
2003-4 12,613 3,218 10,709 2,469
2004-5 17,466 3,630 14,813 1,911
2005-6 24,505 4,521 11,569 4,320
2006-7 28,940 5,314 14,119 13939
2007-8 35,218 6,040 1751 15,261
Source: Annual Report of Office of CGPDTM.*

As shown in the table, the total number of patent applications filed before
IPO in the year 2001-2 was 10,592. The number increased to 35,218 pat-
ent application filings in 2007-8. The number of patents granted in the
year 2001-2 was 1,591, which increased to 15,261 in the year 2007-8.
The table shows a steady increase in patent filings and grants every year
from 2001 to 2008. The total number of patents granted to Indian and
foreign applicants in 2001-2 were 654 and 937. The number increased
to 3,173 and 12,088 for Indian and foreign applicants in 2007-8. The
increase in patent activity may be attributed to the increase in awareness
levels among companies and research institutes, and strengthening of the
patent administrative and enforcement mechanism after India became a
member of WTO.
It may be noted that the share of patents granted to Indian applicants
in the total patent grants decreased from 41.1 per cent in 2001-2 to
20.8 per cent in 2007-8. The statistics indicate that the patent activity
of Indian applicants did not increase at the rate at which the activity of
oreign patent applicants at the IPO increased. While the reason for such
i decrease needs to be studied, the following statistics fortify the trend.

|.8.2 Top Ten Patent Applicants

‘able 1.3 shows the top ten companies based on the number of patents
ranted in 2007 and 2008. -
It can be seen from the tables that only three among the top ten
atent owners, based on number of patents granted in 2007, were
idian organizations. The number reduced to two Indian organizations
1 the following year. It is to be noted that two out of the organizations
12 INDIAN PATENT LAW AND PRACTICE

Table 1.3 Top Ten Patent Owners Based on Patent Grants in 2007
No. Name of the Company No. of Patents Granted in 2007
391
1 Hindustan Lever Limited
Honda Giken Kogyo Kabushiki Kaisha 252
23
3 Samsung Electronic Co. Limited 211

a Council of Scientific & Industrial Research 165

5 Basf Aktiengesel Lschaft 126

6 Qualcomm Incorporated 122

7 Silverbrook Research Pty Limited 116

8 Matsushita Electric Industrial Co. Limited 116

9 Intel Corporation 113

10 _ Indian Institute of Technology 95

Source: IP Convergence, Brain League's IP Newsletter, January 2008.

Table 1.4 Top Ten Patent Owners Based on Patent Grants in 2008
No. Name of the Company No. of Patents Granted in 2008
eT ee ee ee ee ee
1 Council of Scientific and Industrial Research 682
2 Honda Giken Kogyo Kabushiki Kaisha 276
Ms Qualcomm Incorporated 272
4 Koninklijke Philips Electronics N.V 205
5 Procter & Gamble Company 192
6 Hindustan Unilever Limited 190
7 Motorala Inc. 153
8 Samsung Electonics Co. Limited 147
9 International Business Machines Corporation 142
10 Sony Corporation 135

Source: IP Convergence, Brain League's IP Newsletter, January 2009.“

are Council for Scientific and Industrial Research (CSIR) and Indian
Institutes of Technology (IITs), which are research and educational
institutes and the third organization is Hindustan Lever Limited, which
is a subsidiary of a foreign company. The reasons for the domination of
foreign companies may be high levels of awareness in such companies,
business value attributed to patents by them, and their economic
capabilities, as opposed to Indian companies. However, further research
must be done to understand the reasons for the trend.
 PATENT SYSTEM IN INDIA 13

1.9 PCT FILING TRENDS

Table 1.5 shows PCT filings by Indian applicants.

Table 1.5 Indian PCT Filings

Year PCT Filing with Indian Origin

2000 190

2001 295

2002 525
2003 764

2004 724

2005 679

2006 833
2007 901

2008 849

Source: Statistics on the PCT System, WIPO Website.”

PCT filings from India have been increasing since 2000. The number of
PCT filings originating from India has increased from 190 in the year
2000 to 849 in the year 2008. The increase in number of PCT filings
can be considered to be an indication of increase in international patent
activity of Indian applicants. Having said that, international filing
statistics are not conclusive and statistics relating to national phase of
the PCT applications must be studied in order to validate international
patent activity of Indian companies.

NOTES
1. Report on the revision of the patents law, September 1959.
2. Article 70, Para 9 of the TRIPS Agreement, 1994.
3. Section 5, Indian Patent Act, 1970.
4. Chapter IVA, Indian Patent Act, 1970 as amended in 1999.
5. Section 24A and 24B, Indian Patent Act, 1970 as amended in 1999.
6. Ibid.
7. Reg No. DL(N)-04/0007/2003-05 Delhi, Sat (3 April-9 April 2004) Pg-2063
Part III Sec 2.
8. Reg No. DL(N)-04/0007/2003-05 New Delhi, Sat (25 September-1 October
2004) Pg-7351 Part III Sec 2.
9. Reg No. DL(N)-04/0007/2003-05 New Delhi, Sat (16 October-22 October
2004) Pg-7871 Part III Sec 2.
14 INDIAN PATENT LAW AND PRACTICE

10. Reg no. DL(N)-04/0007/2003-05 New Delhi, Sat (27 November-3

December 2004) Pg-8639 Part III Sec 2.
lye Reg No. DL(N)-04/0007/2003-05 New Delhi, Sat (11 October-17 October
2003) Part III Sec 2.
12. Reg No. DL(N)-04/0007/2003-05 New Delhi, Sat (12 November-19
November 2003) Part III Sec 2.
13. Reg No. DL(N)-04/0007/2003-05 New Delhi, Sat (29 November-5
December 2003) Part III Sec 2.
14. Reg No. DL(N)-04/0007/2003-05 New Delhi, Sat (13 December-19
December 2003) Part III Sec 2.
15. Reg No. Dl-33001/2001 New Delhi, Sat (8 September-15 September 2001)
Part III Sec 2.
16. Reg No. DI-33001/2001 New Delhi, Sat (13 December-19 December
2001) Part III Sec 2.
17. Reg No. DI-33001/2000 New Delhi, Sat (17 November-24 November
2001) Part III Sec 2.
18. Reg No. DI-33001/2001 New Delhi, Sat (8 April-15 April 2000) Part III
Sec 2.
19. Section 157A, Indian Patent Act, 1970 as amended in 1999.
20. Section 2(1))(j), Indian Patent Act, 1970 as amended in 2002.
21. Section 2(1)(ac) and Section 2(1)(ja), Indian Patent Act, 1970 as amended
in 2002.
22. Section 53, Indian Patent Act, 1970 as amended in 2005.
23. Section 3(b), Indian Patent Act, 1970 as amended in 2002. .
24. Section 3(j), Indian Patent Act, 1970 as amended in 2002
25. Section 3(k), Indian Patent Act, 1970 as amended in 2002.
26. Section 3(1), Indian Patent Act, 1970 as amended in 2002.
27. Section 3(m), Indian Patent Act, 1970 as amended in 2002.\
28. Section 3(n), Indian Patent Act, 1970 as amended in 2002
29. Section 3(0), Indian Patent Act, 1970 as amended in 2002. —
30. Section 3(p), Indian Patent Act, 1970 as amended in 2002.
31. Section 10, Indian Patent Act, 1970 as amended in 2002.
32. Section 11A, Indian Patent Act, 1970 as amended in 2002.
33. Section 11B, Indian Patent Act, 1970 as amended in 2002.
34. Sections 25 and 64, Indian Patent Act, 1970 as amended in 2002.
35. Section 39, Indian Patent Act, 1970 as amended in 2002.
36. Section 67, Indian Patent Act, 1970 as amended in 2002.
37. Section 83-94, Indian Patent Act, 1970 as amended in 2002.
38. Section 104A, Indian Patent Act, 1970 as amended in 2002.
39. Section 107A, Indian Patent Act, 1970 as amended in 2002.
40. Sections 116-117E, Indian Patent Act, 1970 as amended in 2002.
41. Section 126, Indian Patent Act, 1970 as amended in 2002.
- 42. Section 2(aba), Indian Patent Act, 1970 as amended in 2005.
 PATENT SYSTEM IN INDIA 15

43. Sections 2(i), 2(ja) and 2(m), Indian Patent Act, 1970 as amended in

44. Section 2(l), 2(la) and 2(ta), Indian Patent Act, 1970 as amended in 2005.
45. Section 3(d), Indian Patent Act, 1970 as amended in 2005.
46. Section 11A, Indian Patent Act, 1970 as amended in 2005.
47. Section 21, Indian Patent Act, 1970 as amended in 2005.
48. Section 25, Indian Patent Act, 1970 as amended in 2005.
49. Section 39, Indian Patent Act, 1970 as amended in 2005.
50. Section 58, Indian Patent Act, 1970 as amended in 2005.
51. Section 68, Indian Patent Act, 1970 as amended in 2005.
52. Section 92A, Indian Patent Act, 1970 as amended in 2005.
53. Sections 133 and 138, .
54. This official gazette is available for public viewing on the Patent office
website, www.patentoffice.nic.in (last accessed on 15 May 2009).
55. Paris Convention for the Protection of Industrial Property (of 20 March
1883, as revised at Brussels on 14 December 1900, at Washington on 2 June
1911, at The Hague on 6 November 1925, at London on 2 June 1934, at Lisbon
on 31 October 1958, and at Stockholm on 14 July 1967, and as amended on 28
September 1979.
56. Ibid., Articles 2 and 3.
Article 2 reads as follows: (1) Nationals of any country of the Union shall, as
regards the protection of industrial property, enjoy in all the other countries of
the Union the advantages that their respective laws now grant, or may hereafter
grant, to nationals; all without prejudice to the rights specially provided for by
this Convention. Consequently, they shall have the same protection as the latter,
and the same legal remedy against any infringement of their rights, provided
that the conditions and formalities imposed upon nationals are complied
with...
Article 3 reads as follows: Nationals of countries outside the Union, who are
domiciled or who have real and effective industrial or commercial establishments
in the territory of one of the countries of the Union, shall be treated in the same
manner as nationals of the countries of the Union.
57. Ibid., Article 5.
58. TRIPS: A more detailed overview of the TRIPS agreement is available at
http://www.wto.org/english/tratop_E/TRIPS_e/intel2_e.htm (last accessed on 31
March 2009).
59. PART II Standards Concerning the Availability, Scope and Use of
Intellectual Property Rights, Trade-Related Aspects of Intellectual Property
Rights, 1994.
60. PART III, Enforcement of Intellectual Property Rights, Trade-Related
Aspects of Intellectual Property Rights, 1994.
61. PART V, Dispute Prevention and Settlement, Trade-Related Aspects of
Intellectual Property Rights, 1994.
16 INDIAN PATENT LAW AND PRACTICE

62. Patent Cooperation Treaty, done at Washington on 19 June 1970, amended

on 28 September 1979, modified on 3 February 1984, and 3 October 2001 (as in
force from 1 April 2002).
63. Ibid., Chapter I and Chapter II.
64. Available on http://www.patentoffice.nic.in/ (last accessed on 31 March
2009).
65. Available on http://www.brainleague.com/Newsletter/Jan08/thisway
please.htm (last accessed on 27 March 2010).
66. Available on http://brainleague.com/Newsletter/IPConvergence/Jan09/
patentgrants.html (last accessed on 27 March 2010).
67. Available on http://www.wipo.int/ipstats/en/statistics/pct/ (last accessed
on 31 March 2009).
 2
Patentability Requirements

pe be patentable in India, an invention should satisfy patentability

requirements. The patentability requirements in India are:
1. Patentable Subject Matter;
2. Industrial Applicability;
3. Novelty;
4. Inventive Step; and
5. Specification.
A patent will be granted only if an invention satisfies all the patentability
requirements. Grant of a patent is the cumulative effect of all the require-
ments and non-satisfaction of even one of the requirements will make
an invention ineligible for a patent grant. For example, an invention sat-
isfying industrial applicability, novelty, inventive step, and specification
requirements will not be patentable if it does not satisfy the patentable
subject matter requirement.

2.1 PATENTABLE SUBJECT MATTER

The patentable subject matter requirement lays down the list of subjects
that are eligible to get a patent (eligible subjects) and the list of subjects
to
that are not eligible for a patent (non-patentable inventions). In order
satisfy this requirement, an invention should fall within the list of eligible
the
subjects and outside the list of non-patentable inventions. Under
In other
Patents Act, eligible subjects include products and processes.'
18 INDIAN PATENT LAW AND PRACTICE

words, an invention should either be a product or a process in order to

fall within the list of eligible subjects.
The Patents Act provides a long list of non-patentable inventions. an
invention would not be eligible for a patent if it is among the list of entries
provided in the non-patentable invention list. As per Sections 3 and 4 of
the Act, the following inventions are not patentable:

2.1.1 Frivolous Inventions and Inventions against Natural Laws

An invention which is frivolous or which claims anything obviously con-
trary to well established natural laws is not patentable.” An invention is
said to be frivolous if it is a compilation of already existing articles. For
example, a gun with a torch light attached to it. Gun and torch light are
well-known articles and, therefore, an invention that claims a torch light
attached to a gun would be considered to be a frivolous invention.
Furthermore, an invention that is against well-established natural laws
is not patentable. For example, a perpetual motion machine alleged to be
giving output without any input would not be patentable as it would be
contrary to well-established principles of natural law.*

2.1.2 Inventions Contrary to Public Order or Morality or

Prejudicial to Life or Environment
An invention the primary or intended use, or commercial exploitation
of which, would be contrary to public order or morality, or which causes
serious prejudice to human, animal, or plant life, or health, or to the
environment, is not patentable.‘ For example, an apparatus for injecting
opium into human body for faster absorption would not be patentable as
it would affect human health. Furthermore, a machine for polluting air
would not be patentable as it would be prejudicial to the environment.
Moreover, a camera that can capture naked pictures of dressed persons
might also not be patentable because it would be contrary to public order
and morality.

2.1.3 Scientific Principle or Abstract Theory or Discovery

The mere discovery of a scientific principle, or the formulatio
n of an
abstract theory, or discovery of any living thing or non-l
iving substance
occurring in nature, would not be patentable. For examp
le, the theory
of equilibrium and Boyle's law are scientific principles
or abstract theo-
ries that cannot get a patent. However, practical applic
ation of a scien-
tific principle or an abstract theory to a process or a product
would be
patentable.
 PATENTABILITY REQUIREMENTS 19

Discovery of a living or a non-living thing is also not patentable.

For example, discovery of a plant in Himalayas, which bears both pears
and apples would not be patentable because it is a mere discovery of a
naturally existing living thing.

2.1.4 New Form, or New Property, or New Use

Mere discovery of a new form, or new use, or new property of a known
substance is not patentable. The discovery of a new form of a known sub-
stance will be patentable only if it results in the enhancement of the known
efficacy of that substance.° Salts, esters, ethers, polymorphs, metabolites,
pure forms, particle size, isomers, mixtures of isomers, complexes, and
combinations and other derivatives of a known substance, will be consid-
ered to be the same substance and are not patentable, unless they differ
significantly in properties with regard to efficacy.’ Efficacy may be shown
by showing improved effect in comparison with the original substance
through objective scientific evidence. For example, if existence of calcium
in carbonate form is well known, discovery of its existence in a sulphate
form would not merit patent grant, unless calcium in sulphate form has
an improved effect when compared to the carbonate form.
Furthermore, the mere discovery of any new property or new use for
a known substance is not patentable. The mere use of a known process,
machine, or apparatus is also not patentable, unless such known process
results in a new product or employs at least one new reactant.* For example,
discovery of the use of Aspirin for treating cardiovascular diseases would
not be patentable, if it was already being used as an analgesic.

2.1.4.1 Constitutional Validity of the Section

The constitutional validity of Section 3(d) was challenged by Novartis
before the Madras High Court in the case of Novartis AG v. Union of
India. In that case, Novartis filed for a patent over Imatinib Masylate,
which was a salt form ofthe patented molecule, Imatinib. Imatinib Masy-
late, commonly called as Glivec is used for cancer treatment. The patent
application was rejected by the Controller and the Appellate Board under
Section 3(d) of The Patents Act on the ground that it was a salt form of a
known substance. Novartis filed a writ petition before the High Court of
Madras challenging the constitutional validity of Section 3(d).
The writ petition contended that Section 3(d) of the Patents Act was
not in compliance with the Agreement on TRIPs and that the Section
violated Article 14 of the Indian Constitution.’ It was argued that the
section did not comply with Article 27 of the TRIPS Agreement, which
20 INDIAN PATENT LAW AND PRACTICE

provided for non-discrimination of inventions based on the field, by

prohibiting patent protection for new forms of a known substance and,
thereby, discriminating against such inventions.'° It was further argued
that Section 3(d) violated Article 14 of the constitution because it was
vague by not defining the meaning of efficacy. It was further argued
that the section was arbitrary and gave un-canalized discretion to the
Controller of Patents for making decisions on patentability."
After hearing the arguments, the court held that it did not have
the jurisdiction to decide on the question of compliance of the TRIPS
Agreement and that the Dispute Settlement Board of the WTO was the
right forum for such a question.'* With regard to the second contention,
the Court held that Section 3(d) of the Act was not vague, ambiguous, and
arbitrary and, therefore, would not violate Article 14 of the Constitution
of India. The Court stated that the section along with the explanation
was very clear and had inbuilt measures under the Act to guide the
Controller.’ As per the court, in order to get patent protection over the
new form of a known substance, efficacy could be proved by showing
a better therapeutic effect by the new form, which could be shown by
scientific and objective evidence." It also stated that the derivative of a
substance should have a better efficacy than that of the substance in order
to be patentable.'®
In relation to the contention concerning the Controller's discretion,
the court stated that the Controller would use his discretion based on
the materials placed before him and that any misuse of his discretion
could be corrected by the appellate authorities." It then pointed out that
the existence of discretion under the Act was a necessity as every case
had to be decided on the facts. As the section was not vague and as there
were well laid down guidelines and checks based on which the Controller
would use his discretion, the Court held that the section was not arbitrary
and does not violate Article 14 of the Indian Constitution.

2.1.5 Mere Admixture

A substance obtained by a mere admixture resulting only in the
aggregation of the properties of the components thereof, or a process
for producing such substance is not patentable.'” However, the substance
would be patentable, if the admixture produces a synergistic effect of
the
properties of the components. For example, an admixture of Ibuprof
en
and Paracetamol, to cure pain and fever would not be patentable, because
it is an admixture in which Ibuprofen and Paracetamol are aggrega
ted
and work independently on pain and fever. However, an
admixture of
 PATENTABILITY REQUIREMENTS 21

Amoxycillin and Clavulonic acid, for respiratory disorders, would be

patentable because the admixture produces a synergistic effect and results
in better action.

2.1.6 Mere Arrangement or Rearrangement of Devices

The mere arrangement, or rearrangement, or duplication of known de-
vices, each functioning independently of one another in a known way,
is not patentable.'* Mere compilation of known devices in which each
device functions in a known way is not patentable as long as they are not
interdependent. For example, a combination of a pen and a torch having
separate switching systems is not patentable because it is a mere arrange-
ment of known devices. However, if the torch comes on and focuses on
the paper when the nib of the pen touches the paper, it would be patent-
able subject matter because the pen and the torch are interdependent.
In a case involving an invention relating to a pouch, the patent holder
claimed rights over the thickness of the films that have been used in the
manufacture of the pouches (Standipack Private Limited and Anr. v. M/s.
Oswal Trading Co. Limited). The Court stated in the case that the claim
relating to thickness of the pouch amounts to a mere arrangement and
re-arrangement of existing materials because the thickness of the plastic
film/layer depends upon the tolerance of the contents in the pouch and
the thickness may be altered based on the contents. The Court concluded
that such alteration amounts to a mere rearrangement of materials,
making the invention unpatentable under Section 3(f) of the Patent Act.

2.1.7 Method of Agriculture or Horticulture

A method of agriculture or horticulture is not patentable.'’ For example,
a method of growing rice in a particular type of soil and a method of
increasing yield by maintaining moisture levels in the soil would not be
patentable because they are agricultural methods.

2.1.8 Medical Methods

Any process for the medicinal, surgical, curative, prophylactic, diagnos-
tic, therapeutic, or other treatment of human beings, or any process for a
similar treatment of animals, to render them free of disease, or to increase
their economic value, or that of their products is not patentable.” This
clause excludes methods of medical treatment from patentable subject
method
matter. For example, a method of performing an eye surgery or a
and
of diagnosing diabetes would not be patentable as they are surgical
methods such
diagnostic methods. It should be noted here that cosmetic
22 INDIAN PATENT LAW AND PRACTICE

as a method of whitening teeth, a method of implanting hair, and so on,

would be patentable as they are not used to treat a disease and would not
be classified as medical methods.
Though, a method of medical treatment is not patentable, substances
and implements used for such treatment would be patentable. For
example, a method of diagnosing diabetes may not be patentable but an
implement, or a kit to diagnose diabetes, would be patentable.

2.1.9 Plants and Animals

Plants and animals in whole or any part thereof, including seeds, variet-
ies and species, and essentially biological processes, for production or
propagation of plants and animals are not patentable.*! However, micro-
organisms and micro-biological processes are patentable. For example,
a genetically modified mouse would not be patentable because it is an
animal. Furthermore, a new variety of mango would also not be patent-
able as it is a plant. However, a genetically modified rhizobium bacte-
rium would be patentable as it is a micro-organism. In the year 2002, a
vaccine for infectious bursitis virus in poultry was held to be patentable
subject matter by the Calcutta High Court (Dimminaco AG v. Controller
of Patents).

2.1.10 Mathematical Algorithms and Computer Programs

A mathematical or business method, or algorithm, or a computer pro-
gram, per se, is not patentable.” For example, a method of calculating
average speed of a train, based on distance and time, would not be patent-
able as it is a mathematical method. Furthermore, a method of selling
cook books by organizing workshops on cooking for house wives would
also not be patentable as it is a business method.
Computer programs standing alone are not patentable in India.
However, if a computer program is embedded in hardware or produc
es a
technical effect, it may be patentable. For example, a computer progra
m for
word processing on a general purpose computer would not be
patentable.
However, a computer program for printing documents
using the printer
may be patentable because it produces a technical effect.
Similarly, a
computer program to send messages from one cell phone
to another cell
phone may also be patentable as it is an embedded softwar
e. The scope
and extent of protectability of computer programs is
very vague and
ambiguous due to lack of legislative history and
judicial interpretation.
While some scholars argue that all kinds of
computer programs are
 PATENTABILITY REQUIREMENTS 23

not patentable, others submit that computer programs integrated with

hardware are patentable.

2.1.11 Copyrightable Works and Presentations

A literary, dramatic, musical, or artistic work, or any other aesthetic cre-
ation, is not patentable.” Cinematographic films and Television produc-
tions are also not patentable. Copyrightable works are precluded from
the scope of patentable subject matter. For example, a book or a painting
would not be patentable. Presentation of information in any format is
also not patentable.“ For example, a power point presentation on patent
law would not be patentable.

2.1.12 Mental Act and Method of Playing a Game

A mere scheme, or rule, or method of performing a mental act or a
method of playing a game is not patentable.** For example, a method
of remembering names would not be patentable as it is a mental act. A
method of attacking a batsman, by placing the fielders close to the bats-
man in cricket, would also not be patentable because it is a method of
playing a game.

2.1.13 Integrated Circuits

Topography of integrated circuits is not patentable.”° Topography of in-
tegrated circuits and semi-conductors is protected under a sui generis
law in India. The Semiconductor Integrated Circuits Layout-Design Act,
2002, provides protection for topographies of integrated circuits.

2.1.14 Traditional Knowledge

An invention which, in effect, is traditional knowledge, or which is an
aggregation or duplication of known properties of traditionally known
component or components, is not patentable.” Patent protection is not
available for traditional knowledge, which is the knowledge that has been
in existence among a community since a long time and was being passed
from generation to generation. For example, the use of turmeric to heal
wounds would not be patentable as it forms part of traditional knowledge.
However, if an invention is developed based on traditional knowledge,
such an invention might be patentable. For example, an ointment for cur-
ng muscle and bone injuries containing active ingredients from the leaf
»f a plant, whose paste is traditionally used for topical application in case
»f muscle injuries, would be patentable subject matter.
24 INDIAN PATENT LAW AND PRACTICE

2.1.15 Atomic Energy

An invention relating to atomic energy falling within sub-Section (1) of
Section 20 of the Atomic Energy Act, 1962, is not patentable.” Inventions
relating to atomic energy have been excluded from the scope of patent-
ability for national security reasons.

2.2 INDUSTRIAL APPLICATION

An invention should be industrially applicable or capable of industrial
application in order to be patentable in India. Section 2(ac) of the Patents
Act, provides that an invention is capable of industrial application if it
is capable of being made or used in an industry.” An invention would
satisfy this requirement if it can be made any number of times, and can be
used for at least one purpose in any industry. For example, a pen, which
can be replicated, would be industrially applicable because it can be used
in the education industry. The pen would not be industrially applicable
if the same pen cannot be manufactured repeatedly. Economic signifi-
cance of an invention may also be considered for determining industrial
applicability.

2.3 NOVELTY
An invention will be patentable only if it is novel or new in the light of
prior art, or is not anticipated by the prior art. Prior art includes all infor-
mation and knowledge relating to the invention that was available on the
date of patent application. A New Invention has been defined in the Act
as any invention or technology which has not been anticipated by publi-
cation in any document, or used in the country or elsewhere in the world
before the date of filing of patent application with complete specification,
that is, the subject matter has not fallen in the public domain or that it
does not form part of the state of the art.*°
As per the definition, an invention will not be novel if it forms part
of state of the art (prior art) or enters the public domain. If an invention
is published in any document or used anywhere in the world, it will be
considered to be part of prior art or public domain, and will, therefore,
not be considered novel. To negate novelty, such publication or use must
be before the date of filing of the patent application. Though, the phrase
New Invention has been defined in the Patents Act, it has not been used
any where in the Act and its usefulness for interpretation of the Act is
not clear.
 PATENTABILITY REQUIREMENTS 25

Novelty is always ascertained in the light of a single prior art reference,

and various prior art references cannot be combined. In order to negate
novelty of an invention, all elements of an invention must be present in
the prior art reference. For example, if a publication provides details of a
chair made of wood and if a person A files for a patent over an invention
comprising of a wooden chair with wheels, the invention would be novel
in the light of the prior art reference because all elements of the invention
are not present in the publication.
In addition to the definition of New Invention, the Indian Patent Act
provides a list of non-exhaustive circumstances that will anticipate an
invention and negate its novelty. Some of such circumstances specified
under various sections in the Act are as follows:

2.3.1 Prior Publication

An invention will not be considered novel if it is anticipated by a publica-
tion in any document anywhere in the world before the date of filing
of the patent application on the invention.*' Such a publication would
include the publication of the complete specification of a patent applica-
tion filed before the date of the application in question.*” Furthermore, if
a complete specification is published after the filing of a patent applica-
tion relating to an invention and if it has a priority date before that of
the patent application relating to the invention, the invention will not be
considered to be novel.’? For example, if X files a patent application on
1 January 2009, relating to an invention and if Y’s application relating to
the same invention, which was filed on 1 September 2007, is published on
1 February 2009, the invention of X will not be novel. An invention will
not be anticipated based only on a specification containing the inven-
tion, which was published in India before the first day of January 1912.”
A prior publication will anticipate an invention only if it contains the
whole of the invention impugned; that is, all the features of the invention
(Farbewerke Hoechst Aktiengesellschaft Vormals Meister Lucius & Bruning
a Corporation etc. v. Unichem Laboratories and Ors).
Prior publication of an invention will not anticipate the invention that
forms part of a complete specification, if:
1. The matter published was obtained from the inventor or any other
person holding rights over the invention without consent; and
the patent applicant learned of the publication of the invention and
filed the patent application within a reasonable period of time.” For
example, if X takes information relating to an invention from Y’s lab
 INDIAN PATENT LAW AND PRACTICE
26

and publishes it without Y’s knowledge, such publication will not

anticipate the invention provided Y files a patent application after
learning about the publication within a reasonable period of time.
However, this exemption will not be available if the invention has
been commercially used in India with the consent of the inventor,
or patent applicant, or holder. For example, if Y, in the earlier
example sells his invention before filing the patent application, the
invention would not be novel; or,
2. (ii) A complete specification was filed by a person and thereafter
the invention is published or used by contravening the rights of the
true and first inventor, or any person deriving rights from him.” For
example, if X is the true and first inventor of an invention and if Y,
his colleague, files for a patent over the invention without informing
X and permits A to use it, Y’s application when published, or use of
the invention by A will not anticipate the patent application filed by
X; OF,
3. The invention is communicated to the Government or to any
person authorized by the Government to investigate the invention
or its merits;** or,
4. (iv) The invention is described in a paper read by the true and first
inventor before a learned society or published with his consent
in the transactions of such a society, and if the application for the
patent is made by the true and first inventor, or a person deriving
title from him, within twelve months after the publication of
the paper.*® For example, if a scientist publishes his research on
treatment of cancer in the Max Planck Institute’s magazine entitled
‘International Oncology Journal, which is distributed among
cancer researchers all over the world, such a publication will not
negate novelty of the invention provided, the patent application
relating to the invention has been filed within twelve months from
the date of the publication. The scope and extent of this exception
has not been subject to judicial scrutiny and is not very clear.

2.3.2 Public Knowledge and Public Use

Public Knowledge about the invention or Public Use of an invention be-
fore the filing date of the patent application will anticipate the invention
and negate its novelty. Prior knowledge must be accessible to the public
in order to anticipate an invention, and it is considered to be accessible if
it is available in a public library or any other similar location (Lallubhai
Chakubhai Jariwala v. Chimanlal Chunilal and Co.). In order to anticipate
 PATENTABILITY REQUIREMENTS 27

an invention, the knowledge in the prior art must enable a person to work
the invention without any experimentation or overcoming any prob-
lems.” For example, if the knowledge for bleaching jute, hemp, or paper
pulp is publicly available, such knowledge will not anticipate a process
for bleaching nuts because there are difficulties in applying the process to
nuts, which will require experimentation.*!
Secret use or knowledge of an invention will not amount to public
use.’ If a few people have access to the invention and such people are
bound by instruments of confidentiality, it will not be considered to be
public use or public knowledge under the Act. For example, X invents a
time machine and allows his colleagues to use it every weekend under an
agreement of secrecy. Such use by X will not be considered to be public
use or public knowledge. Signing confidentiality agreements or secrecy
agreements with people aware of the invention or using the invention will
keep the invention out of the realm of public knowledge and public use.
A process will be considered to be publicly known or used in India, if
a product made by such process is imported into India before the priority
date of the patent application.“ Any use or publication of the invention
after the date of filing of the provisional application, or convention
application relating to the invention, will not anticipate the invention.“
For example, if X imports a drug A, made by a process B, into India
before the date of patent application relating to process B, the process
will be anticipated by the importation of A. However, if the product A
is imported after the date of filing of the provisional patent application,
then the process will not be anticipated by the importation.

2.3.3 On Sale
An invention will not be novel if it is on sale. Ifan invention is on sale or is
commercially worked in India by the applicant or any person authorized
by him before the date of the patent application, it will not be considered
to be novel. However, if the invention was on reasonable trial, it will not
be anticipated.” For example, if the inventor sells his novel road roller to
the government, he cannot get a patent over it as the sale negates novelty
of the invention. However, if the inventor tests the functioning of a road
roller in public under a government contract, such a test will not antici-
pate the invention.

2.3.4 Public Display

Public Display of an invention before the filing date of the patent ap-
plication will anticipate the invention. However, display of the invention
28 INDIAN PATENT LAW AND PRACTICE

author-
or publication of details of the invention by the inventor or his
the
ized person at an exhibition notified by the Central Government in
official gazette, will not anticipate the invention for a period of twelve
months.” In order to avail the grace period provided for anticipation
based on public display, a patent application relating to the invention
must be filed within twelve months from the date of public display. For
example, if an inventor displays his invention in an exhibition notified by
the central government, such a display will not amount to anticipation if
the inventor files a patent application with regard to the invention within
twelve months from the date of public display.
Furthermore, if a patent application is filed within twelve months from
the date of public display, the use of the invention by any person after the
public display at the exhibition will also not anticipate the invention.*
For example, if X displays his invention at an exhibition notified by the
central government and if A uses the invention after seeing the details at
the exhibition before X files the patent application, such public display by
X or use by A will not anticipate X’s invention.

2.3.5 Public Working

An invention will be anticipated if it is publicly worked in India before the
priority date of the patent application relating to the invention. However,
if the public working of the invention by the inventor or a person autho-
rized by him is meant for reasonable trial, and such a trial is required
to be performed in public, then such a working will not anticipate the
invention for a period of twelve months from the date of trial.*’ In order
to avail the grace period of twelve months, the patent application relating
to the invention must be filed within the said period. For example, X
invents a street light having a light sensor and installs some lights on
public roads to test their durability and efficiency as per accepted pa-
rameters, and files a patent application after testing for six months. Such
public working would not anticipate the invention because it was worked
for reasonable trial and the patent application was filed within twelve
months of such working.

2.3.6 Traditional Knowledge

Any invention that forms part of traditional knowledge would not be
novel. An invention will be anticipated, if it forms part of traditional
knowledge of any indigenous community in India or anywhere in the
world.” However, if the invention is a development or improvement over
the traditional knowledge it may be novel.
 PATENTABILITY REQUIREMENTS
29

2.3.6.1 A Study of Relevant Cases

Lakhpat Rai and Ors v. Sri Kishan Das and Ors

The patent claim in the case related to the process of manufacture of
an ancient and well known medicinal commodity called banslochan.*'
The powder was manufactured by a calcining process from bamboo and
possessed restorative and invigorating qualities for the old as well as for
the young.” The powder was made from the interior of bamboo which
was found in Singapore, by baking or calcining. The patented method
related to a process of baking or calcining by heating, using a combination
of earthenware vessels placed one on top of the other in the stove, which
method had the superior advantages of securing slower heat, enabling
the material to be treated with sulphuric acid at red heat, confining the
fumes produced by the sulphuric acid within a closed crucible and of
producing a better colour of pure white or bluish white powder.”
Before the invention of the patented method, the process was
carried out by means of iron pans when the commodity was prepared
in substantial quantities.“ The use of iron pans produced a rapid and
intense heat, operating directly on the material. This made the cost of the
stove greater than if ordinary earthenware pans were used, particularly
because the tendency of the iron pan was to wear out quickly, and also to
produce in the substance a brownish or reddish tint.** The court found
that the essential features of the process patented by the plaintiffs was the
treatment of the substance at red heat with sulphuric acid, inside a closed
crucible or retort made entirely of earthenware.” As per the court, use of
earthenware had the following advantages:
1. As no iron or other metal was being used in the composition of the
crucible, there was no danger of any deleterious action on the part
of the furnace or the acid upon the metal; and,
2. (b) The retort or crucible was entirely closed from the time when
the acid was added until the process of calcination is complete,
which does away with the necessity of a chimney communicating
with the retort, by means of which the fumes of the acid were being
carried away.”
According to the court, the action of the acid on the crude material under
the said conditions was thorough and eliminated the possible nuisance
from the escaping fumes of the acid.
In the light of the advantages of the process, the court held that the
»atented method was new because no one had ever worked it out before,
ind because it effected a useful purpose in reaching the point of heat at
 INDIAN PATENT LAW AND PRACTICE
30

effectively applied,
which the treatment of sulphuric acid could be most
iron matter from the
and because it eliminated the brownish tint or
ty powder.*
material to produce a purer colour and a better quali

Raj Prakash v. Mangat Ram Chowdhry and Ors

a process for
In this case, the court held that an invention relating to
the said
making printed picture films for use in a film strip viewer and
from
films to be novel, as the steps involved in the process were different
the novelt y of
those existing in the art of photography. While analysing
the invention in the light of prior use by a medical photographer, who
took plurality of pictures on a 24 mm x 35 mm frame, known as the leica
frame, the court pointed out that the process followed by the photogra-
pher was different from that followed by the invention.® It noted that
the process used by the photographer, which included the steps of taking
of plurality of pictures on a 24 mm x 35 mm frame, putting the said
negative in an enlarger and taking pictures of 1 cm x 1 cm and preparing
slides from the film strips in a leica frame was different from preparing
medially cut strips of 35 mm films, having plurality of pictures for use
in viewers specially adapted for half-strips to give a virtual image of a
full cine-frame, which is the process of the invention.” As the prior art
process and the process used in the invention were different, the court
held that the invention was novel in the light of prior art.
The court pointed out in the case that anticipation by prior publication
would exist only if information about the invention, which is equal for
purposes of practical utility, was present in the publication.®' The court
also stated that pieces from various publications may not be combined
for negating novelty. According to the court, the invention has to be
seen as a whole and if the essential steps of the invention are novel, then
the invention would be novel.”

Surendra Lal Mahendra vy. Jain Glazers and Ors

The patent in the case related to a simplified apparatus for producing a
laminate by the wet process.“ The machine existing in the prior art was a
sophisticated machine for producing laminate. The court compared the
drawings of the patented invention and the prior art device and concluded
that the art/process of manufacture of the laminate was identical in both
the machines.” It, therefore, stated that the invention lacked novelty and
pointed out that finding alternatives that are cheap and simple would not
make an invention novel.
 PATENTABILITY REQUIREMENTS 31

Monsanto Company v. Coramandal Indag Products (P) Limited

The patent in the case related to a phytotoxic composition compris-
ing of Butachlor and the process of its emulsification.” As the formula
for Butachlor was mentioned in the report of the International Rice
Research Institute for the year 1969 and the process of emulsification
was well known, the court held that the patented invention lacked
novelty.®
The court went on to state that to satisfy the requirement of being
publicly known, it is not necessary that it should be widely used to the
knowledge of the consumer public.” As per the court, it is sufficient if
it is known to the persons who are engaged in the pursuit of knowledge
of the patented product or process, either as men of science, or men of
commerce, or consumers.” As the ingredients were known, the process
was known, the product was known, and the use was known, the court
stated that the invention was not patentable.

Laxmi Dutt Roop Chand v. Nankau and Ors

The patent in the case related to the process of manufacture of hollow-
wares, such as lotas, batwas, degchis, batlois, and so on.”' The validity of
the patent was challenged on the ground of lack of novelty due to prior
use. As the preparation of a jointless hollow-ware claimed in the pat-
ent was very well known to the people of Bandhua for a long time, and
dodges were being used for more than 25 years at the time of filing of the
patent, the court stated that the patented invention lacked novelty due to
prior use.””

Standipack Private Limited and Anr. v. M/s. Oswal Trading Co.

Limited
The patent in the case related to a pouch for storage and dispensing of a
liquid such as lubricating oil.’”’ The validity of the patent was challenged
on the grounds of novelty and inventive step, based on prior publica-
tion. After reviewing the Report of the Committee appointed by the
Ministry of Petroleum and Natural Gas, which indicated and established
that pouches for storing and dispensing lubricating oil were being used
and were being purchased by the Indian Oil Corporation from diverse
sources before the priority date of the patent, the Court stated that the
patented invention was similar to the pouches specified in the Report
and, therefore, the invention had a prior publication and, therefore,
lacked novelty.”
32 INDIAN PATENT LAW AND PRACTICE

2.3.7 Novelty Analysis

art ref-
Novelty of an invention is determined in the light of a single prior
ned for analys ing
erence and various prior art references cannot be combi
novelty. In order to anticipate an invention, all elements of the invention
must be present in a single prior art reference. Though the elements are
not directly present, they may be inherently present in the prior art refer-
ence. Novelty analysis must be made by comparing elements in the prior
art with that of the invention, element by element.
Knowledge of an invention, or use of the invention, by a small group
of persons or a single person, can anticipate the invention even if that
knowledge or use is limited to that group or person. However, secret
knowledge or use of an invention within a group of people, bound to
maintain confidentiality, will not anticipate the invention. Sale of an
invention or offer to sell an invention will anticipate an invention unless
the sale is for reasonable trial. Public display or public working of an
invention will also anticipate the invention.
A grace period of twelve months is available to the inventor or a
person authorized by the inventor, in case of anticipation by publication
in a learned society, public display in a notified exhibition, and public
working for reasonable trial. The table provided hereunder provides
a summary of anticipation in the light of various prior art references.
It also captures details with respect to grace period and exemptions to
anticipation.

2.4 INVENTIVE STEP

Inventive step is the toughest and ambiguous patentability requirement.
An invention should possess an inventive step in order to be eligible for
patent protection. Section 2(1)(ja) of the Patents Act defines inventive step
as a feature of an invention that involves technical advance as compared
to the existing knowledge, or having economic significance, or both, and
that makes the invention not obvious to a person skilled in the art. As
per the section, an invention will have inventive step only if it satisfies
two conditions_First, the invention should be technically advanced in the
light of the prior art or should have economic significance. And, second,
the invention should be non-obvious to a person with oe
the art in the light of prior art. The Act does not define technical advance
or economic significance, and does not provide guidelines for determin-
ing non-obviousness of an invention from the point of view of a person
with ordinary skill in the art. However, the courts have, through various
 PATENTABILITY REQUIREMENTS 33

Table 2.1 Prior Art and Anticipation

Prior Art Grace Period Party Relevant for Exemption
Anticipation
Prior Available for publication Any person in (a) Publication
Publication within a learned society— the public by wrongful
twelve month grace period is obtainment of
available only for publication information;
by inventor (b) Communication
of invention to
government; and
(c) Publication
before learned
society

Public No grace period Any person in Secret knowledge

Knowledge the public under an instrument
of confidentiality

Public Use No grace period Any person in Secret use under

the public an instrument of
confidentiality

On Sale No grace period Any person in Reasonable trial

the public

Public Available for display in Any person in Display in a central

Display a government notified the public government
exhibition—twelve month notified exhibition
grace period is available only
for public display by the
inventor or his authorized
person
Public Grace period available for Any person in Reasonable trial if
Working reasonable trial—twelve the public such trial needs to
month grace period available be done in public
only to the inventor
ae, a aR
decisions, laid down some guidelines for determining non-obviousness
of an invention.

2.4.1 A Study of Relevant Cases

Bishwanath Prasad Radhey Shyam vy. Hindustan Metal Industries
ls for
The patent in the case related to a means for holding utensi
disclosed in the
turning purposes.” A preferred feature of the invention,
rotatably mounted
patent states that the pressure end of the spindle was
34 INDIAN PATENT LAW AND PRACTICE

and for that purpose it comprised an independent piece engaged by a

hollowed end in a spindle; said hollowed end being preferably fitted
with ball bearings to enable the said independent piece to revolve with
friction when it was in contractual relationship with the utensil.”° The
patent disclosed that the independent piece had a forward pointed end
or a blunt end, which was firmly held against the utensil.” The validity of
the patent was challenged on the ground of lack of novelty and inventive
step.
The Court started its analysis of inventive step by stating that in order
to be patentable, an improvement on something known before, or a
combination of different matters already known, should be something
more than a mere workshop improvement, and must independently
satisfy the test of invention or inventive step.”* It stated that to be
patentable the improvement or the combination must produce a new
result, or a new article, or a better or cheaper article, than what already
existed.” As per the court, an invention would have an inventive step if
the combination of old known integers may be so combined that by their
working interrelation they produce a new process or improved result.
Mere collocation of more than one integers or things, not involving the
exercise of any inventive faculty, would not, according to the court, qualify
for the grant of a patent.*° The court then stated that an invention must
not be the obvious or natural suggestion of what was previously known
and if a person was able to make the invention based on the knowledge
existing on the priority date, the invention would lack inventive step.*!
After considering the prior art in the case, the court stated that the
patented invention was merely an application of an old invention, known
for decades before 1951, for the traditional purpose of scraping
and
turning utensils, with a slight change in the mode of application,
which
was no more than a workshop improvement.® The invention,
according
to the court, was a normal development of an existing
manner of
manufacture, not involving something novel,
which would be outside the
probable capacity of a craftsman.*? According to the
court, the invention
did not lie outside the track of what was known before
and it would have
been obvious to any skilled worker in the field
in the light of existing
knowledge.” As the invention involved a mere
addition of a lever and
bracket, which did not involve a substantial
exercise of the inventive
power or innovative faculty by the inventor,
the court stated that the
invention was obvious." Furthermore, as the invention
was publicly used
by the patent holder before the date of filing
of the patent application,
the court observed that the novelty of the invention
was negated.* In the
 PATENTABILITY REQUIREMENTS 35

light of its analysis, the court concluded that the invention lacked novelty
and inventive step.
This case can be considered to be the most important case in inventive
step jurisprudence in India. The principles laid down in the case are
followed even today and have been codified in the Indian Patent Act.

Garware Wall Ropes Limited v. Mr Anant Kanoi and Ors

In this case, which involved an invention relating to a pre-fabricated
collapsible gabion product in flexible form, made from ropes of syn-
thetic materials such as polypropylene and so on, the court stated that
the invention lacked inventive step because gabions were well known in
the field since 7,000 years, and the rope gabions and polymer gabions
claimed in the patent were being used in Maharashtra and Bihar since
1991 and 1987, respectively. The Court pointed out in the case, that an
invention should be more than a workshop improvement and should be
outside the ordinary probability of a craftsman in order to have an inven-
tive step. As nylon was already being used for manufacture of gabions,
the court observed that the manufacture of gabions using another type of
synthetic material would not amount to an inventive step.*” It stated that
substituting elements of common knowledge in a product would not give
rise to inventive step.”

Bilcare Limited v. Amartara Private Limited

for
The case related to a patent involving moralized packaging film used
of metal-
medicines, comprising the following elements: a certain extent
, thermo
lization of polyvinyledene (PVC) film to maintain translucency
to prevent
formable moralized PVC films, and the thickness of PVC film
tion to the
the migration of additives. The court while denying an injunc
inventive step
patent holder stated that the invention lacked novelty and
in the light of prior art.”
with prior
The court compared the elements of the patented invention
present in various
art and stated that all elements of the invention were
nts of the patented
prior art references. It described the existence of eleme
manner:
invention in the prior art references in the following
the use of PVC in thermoforming
A book cited as a prior art reference talked about ment such
bubble packs, and also about vacuumized treat
for all types of blister and
ng of aluminium onto the surface of
as metallization used for the deposition of a coati
” The book also discussed about coatings
films, which were present in the invention.
that were not present in the base material
as an alternative means ofadding properties
n;
that was an element of the inventio
 36 INDIAN PATENT LAW AND PRACTICE

A US patent bearing number 5,106,670, in respect of metallic package components,

mentioned PVC as one of the layers of the film laminate, which was an element of the
invention;*' and
The second layer of the coating consisting of polyvinyledene chloride and ethyl
vinyl alcohol, which as claimed in the patented invention, was being used for a long
time for packaging of foods, as it prevented entry of light that may cause oxidative
rancidity of fatty and fried foods.”

As the invention was a mere combination of various elements existing

in different prior art references and such a combination did not require
exercise of inventive faculty, the court concluded that it was not novel
and lacked inventive step. It further held that the combination did not
fall within the scope of mosaicing, which involved finding elements in
various prior art references and combining them by hindsight and is not
permitted for determining inventive step.”

Dhanpat Seth and Ors v. Nil Kamal Plastic Crates Limited

The patent in the case related to a device used for manufacture of
manually hauling the agricultural produce.‘ The device comprised
of a container of synthetic polymeric material consisting of a hollow
conical body, open at the top and closed at the base, and taperin
g from
the operative open top to the base with perforated walls.°°
The wall of
the container had a contour adopted to proximate the back
of a human
body. The container had a removable harnessing means
secured to the
container.” The harnessing means had straps and buckle
formations in
order to secure the container to the individual.”
The prior art cited in the case was a Kilta, whic
h was a traditional
product and which was being used for a long time
for carrying produce,
including agricultural produce in hill areas
, especially in the state of
Himachal Pradesh. The traditional Kilta
was made of bamboo.” The
shape of a kilta was conical, having a wide
r circular opening at the top
and it tapered and narrowed down
at the bottom.'”
The court stated that there was virt
ually no difference in the overall
design of the traditional Kilta and
the patented invention.'®! As per
court, a visual comparison of the pate the
nted invention and the traditional
Kilta indicated that they were virtual copies exce
traditional Kilta was made of bamboo pt for the fact the
and the patented de vice was made
of polypropylene copolymer.” The
only visible differenc e in the court’s
view was that the patented devic e
had detachable nylon straps with
buckles.!
 PATENTABILITY REQUIREMENTS 37

As the process of making traditional items out of polymers such as

plastic was a well known and well established process, the court stated that
substitution of bamboo in traditional Kilta by polypropylene copolymer
would not amount to an inventive step.'™ It pointed out that traditional
items made out of wood, steel, brass, leather, and other natural materials,
have been regularly replaced by plastic before the date of invention and it
was a well known art.'® Therefore, the court stated that there was nothing
new or inventive about the process of manufacturing the traditional
Kilta, made of natural material, from synthetic material.'°° With regard
to the nylon straps and buckles, the court pointed out that the adjustable
nylon straps were mere copies of the ropes used in traditional Kilta,
which were also adjustable.” Though the invention had buckles, which
were not present in the traditional Kilta, the court observed that the mere
introduction of buckles would not amount to an inventive step.'” In the
light of its analysis, the court concluded that the invention in question
lacked inventive step.

~F
Hoffmann-La Roche Limited and Anr. v. Cipla Limited
The patent in the case related to a small drug molecule, medically
termed as Human Epidermal Growth Factor Type-1/Epidermal Growth
Factor Receptor (Her/Egfr) inhibitor, popularly known as Erlotinib.'”
The drug molecule is used to destroy some types of cancer cells while
causing little harm to normal human cells.''° The patentability of the
molecule was challenged on the grounds of lack of novelty and inventive
step among other grounds based on existence of prior publications and
patents.
As the decision related to the grant of an interlocutory injunction, the
court did not decide on the question of patent validity but reiterated and
clarified the concept of inventive step. The court stated that the test of
obviousness is: Whether in the light of prior art, it was possible for a
normal but unimaginative person skilled in the art to discern the inventive
step of the invention on the basis of the general common knowledge of
the art at the priority date.'!' The other deciding factor as per the court is:
Whether the differences between the prior art would, without knowledge
of the alleged invention, constitute steps which could have been obvious
to the skilled man or whether they required any degree of invention.'"’
If the answer to the question is yes than the invention is said to have
be
inventive step. The court then stated that the inventive step should
something that could not have been discernable to the unimaginative
 38 INDIAN PATENT LAW AND PRACTICE

person skilled in the art and not something which was published in the
prior art.''? As the patented compound in the case had an ethynyl group
present at metha position of the phenyleniol group at a specific position,
namely, position 3, and the prior art nowhere disclosed the presence
of such ethynyl group particularly substituted at metha position of the
phenyl ring, and a person skilled in the art would not have arrived at the
invention in an obvious manner based on the prior art, the court agreed
with the Controller of Patents that the invention had inventive step.''*

Bajaj Auto Limited v. TVS Motor Company Limited

The case involved an invention relating to the use of twin spark plugs
for efficient combustion of lean air fuel mixture in small bore ranging
from 45 mm to 70 mm internal combustion engine, working on 4-stroke
principle.''* The patentability of the invention was challenged on the
grounds of lack of novelty and inventive step based primarily on a US
patent held by Honda, other patents, publications, and knowledge about
the use of twin spark plugs in engines having large bore size.
While deciding on a plea for injunction, the court stated in the light
of the data provided before it that the invention, prima facie, possessed
novelty and inventive step in the light of prior art because the use of twin
spark plugs in engines with small bore sizes did not form part of the prior
art and was not obvious to a skilled person.'"* The court pointed out that
determination of novelty and inventive step was a mixed question of law
and fact, and reiterated the decision of the Supreme Court in Biswhanath’s
case Which held that an invention would not be patentable if it was a mere
workshop improvement."”” It then cited a Privy Council decision, which
held that there would be novelty in the application of an old contrivance
to an invention if difficulties were overcome in doing so, or if such an
adoption involved ingenuity.''* The court went on to state that in
order
for a prior art reference to be novelty or inventive step, negating
a person
with ordinary skills in the art should be able to make the
invention using
a prior art reference.''’ If a prior art reference gave directions
on making
an invention, it, according to the court, would
be novelty negating as
opposed to a prior art reference, which just provided the
elements of the
invention.'”°

Mitra and Co. Private Limited v. Kesar Medicaments and Anr.

The patent in the case related to a device for detection
of antibodies
to Hepatitis C Virus (HCV) in human serum and plasma."”' The early
detection of HCV was critical as there was no vaccine
for the same. The
 PATENTABILITY REQUIREMENTS 39

validity of the patent was challenged on the ground of lack of novelty and
inventive step.
It was alleged that the invention in the patent was prior knowledge
as a company by the name AccuDx was manufacturing and selling
immunofiltration based diagnostic kits similar to those claimed in the
patent. The court, while deciding on an application for injunction, stated
that in the HCV Rapid Test developed by AccuDx the recombinant proteins
corresponding to NS3 and Core antigens of Hepatltis C were bound to
the membranes of the filtration device unlike the invention of the patent
holder on which a mixture of four antigens were used.'” Therefore, the
court observed that the patent was not part of prior knowledge before
the priority date of the patent.'” The Court then stated that the invention
in the patent was different from the US patents because it did not use
the septum like the product in the US patent and the manner of flow of
the liquid was different.“ It observed that the invention of the patent
had a different function to perform and a different construction then the
devices cited in the prior art.'”
With regard to products of third parties that were cited in the case,
the court observed that the invention in the patent was different from
the products being manufactured by third parties, such as Murex Anti-
HCV, the UBI-HCV test, INNOTEST HCV AbIV, and Hepatitis C
Virus Encoded Antigen Ortho ELISA Test because they had different
components when compared to the invention.'” It then stated that
evaluation of the patented invention by World Health Organisation
(WHO), which was not manufactured before the filing date of the patent
does not amount to anticipation of the invention.'”
Though all the features of the invention were present in different prior
art documents, the court pointed out that their combination could not be
foreseen and the patented invention, therefore, possessed inventive step. mi
The court stated that a product would lack inventive step only if a mosaic
out of the relevant documents can be put together by an unimaginative
man with no inventive capacity.'” It pointed out that it would not be a
defence to show that the various components in the patented product
were known separately.'””

2.4.2 Inventive Step Analysis

deter-
As it can be seen from the decisions of the courts, inventive step
ard. An in-
mination is fraught with ambiguities and is not straightforw
invention is
vention will not satisfy the inventive step requirement if the
a person skilled
within the probable capacity of an ordinary mechanic or
40 INDIAN PATENT LAW AND PRACTICE

in the art. In other words, an inventive step will exist in an invention only
if a person skilled in the art would not be able to make the invention
based on the prior art on the priority or filing date. However, if the ele-
ments in the prior art can be combined by a person skilled in the art to
make the invention without exercising inventive faculty or imagination,
the invention would lack inventive step.
Combining various elements in different prior art references based
on hindsight would amount to mosaicking and that would not negate
inventive step of an invention. Working backwards from the invention
and finding elements of the invention in prior art is not permitted for
performing inventive step analysis. Having said that, incorporating
elements of common knowledge in the prior art to make a product would
not give rise to inventive step. The following steps are generally followed
for analysing inventive step:
1. Determination of the scope and content of the prior art to which
the invention pertains;
2. Assessment of the technical advance or economic value of the
invention;
3. Assessment of the differences between the combined prior art and
the invention;
4. Definition of the technical problem solved by the invention; and,
5. Determination of whether a person skilled in the art deems the
invention obvious in the light of the combined prior art.'*!
An invention will have an inventive step only if the invention has
technical advance or economic significance, and a person skilled in the art
cannot make the invention after combining the prior art. The invention
will be non-obvious if a person skilled in the art cannot think about the
solution given by the invention in the light of prior art.
The inventive step analysis is fraught with multiple ambiguities and
is
considered by scholars to be more vague than metaphysics. Ambiguities
with respect to aspects such as identification of relevant prior art,
combination of prior art, determining level of ordinary skill in
the art,
and assessing differences between invention and prior art,
to ascertain
obviousness makes inventive step determination difficult
and subjective.
2.4.3 Illustration
X invents a door knob made of clay and porcelain, which
could be used
in very low or high temperatures without deformat
ion and was cheaper
than existing knobs. The prior art relating to the knob
includes:
 PATENTABILITY REQUIREMENTS 41

1. Door knobs made of metal, which were being sold and used
extensively; and
2. Kitchen utensils made of clay and porcelain.

2.4.3.1 Novelty analysis

To be novel, the invention should be different from the prior art. The
invention will be novel in the light of prior art if all elements of the inven-
tion are not present in a single prior art reference. Therefore, X’s invention
must be compared with each of the prior art references independently.

2.4.3.2 Comparison with prior art references

The first prior art reference in the illustration relates to door knobs made
of metal. As X’s invention relates to door knobs made of clay and por-
celain instead of metal, all elements of the invention are not present in
the prior art reference and, therefore, the prior art reference does not
anticipate the invention.
The second prior art reference relates to utensils made of clay and
porcelain. As X’s invention is a door knob and does not relate to utensils,
the elements of the invention are not present in the prior art reference.
Therefore, the prior art reference does not anticipate the invention.
As neither of the prior art references have all elements of the invention,
they do not anticipate or negate novelty of the invention.

2.4.3.3 Inventive Step Analysis

The invention will have an inventive step if it has technical advance or
economic significance, and is not obvious to a person skilled in the art in
the light of prior art. To determine non-obviousness of an invention, the
prior art references may be combined from the point of view of a person
skilled in the art. If a person skilled in the art can combine prior art refer-
2nces to make the invention without exercising any inventive faculty or
magination, then the invention would be obvious. The invention would
lso be obvious if the problem solved by the invention is obvious to a per-
‘on skilled in the art. Furthermore, if the invention is a mere workshop
mprovement within the course of work of an ordinary mechanic, the
nvention would be obvious.
X’s invention has economic significance because the door knobs are
heaper than the existing metallic ones. Furthermore, the invention can
Iso be considered to have technical advance because the use of clay and
orcelain instead of metal makes the utility of knobs more effective and
ficient in adverse weather conditions (very cold or very hot weather).
42 INDIAN PATENT LAW AND PRACTICE

The first prior art reference cites door knobs made of metal and the
other prior art reference deals with utensils made of clay and porcelain. As
utensils made of clay and porcelain were being extensively used, a person
with ordinary skill in the art in the field of door knobs would definitely
think about clay and porcelain as substitutes for metal for countering
distortion at high or low temperatures. Therefore, it can be said that
combining elements, in the prior art references to make door knobs of
clay and porcelain, does not require any exercise of inventive faculty by
an ordinary mechanic. It would be a mere workshop improvement that
would bea part of ordinary course of work of the mechanic. Furthermore,
the problem solved by door knobs made of clay and porcelain, which
is withstanding adverse weather conditions, is a solution foreseeable
by a person skilled in the art in the light of clay and porcelain utensils.
Therefore, the invention of X does not have an inventive step.

2.5 SPECIFICATION
To obtain a patent, the applicant must file a patent application containing a
specification. The object of the specification is to provide complete infor-
mation to the public about the invention, and the mode of carrying it out,
and to define the boundaries of the invention that must not be crossed by
the public during the validity of the patent. The specification should con-
tain a written description of the invention and of the manner and process
of making and using it.'*? The written description may contain drawings,
where and when required, to clearly describe the invention.'> A model
or sample may have to be submitted, if the Controller of Patents requires
such a model or sample as an illustration of the invention.'** However,
such a model or sample will not form part of the specification. If the
invention involves biological materials, the biological materials may be
deposited at a recognized depository in order to describe the invention
and such materials would form part of the specification.
| The complete specification should enable the invention, which
means
it must fully and particularly describe the invention and
its operation, or
use and the method by which it is to be performed.'**
It must describe
stig = sa invention claimed in each of the claims (Raj

ether epoca mee act en ea

| : gat Ram Chowdhry and Ors). The description of the

(Farbewerke Hoechst Aktiengesellschaft sont ea ra wie

a Corporation etc. v. Unichem Laborat ories
ws and
Pe Re
Ors). The specification
te vith
 PATENTABILITY REQUIREMENTS 43

must also disclose the best method of performing the invention which is
known to the applicant at the time of filing the patent application.'”°
Furthermore, the specification must end with a claim, or claims,
defining the scope of the invention for which protection is claimed.'”’
The function of the claims is to define the scope of the invention claimed
in the patent application. Claims in a complete specification should relate
to a single invention and should be clear and succinct.'** The claims must
mark out, with adequate distinctiveness, the boundary of the territory of
the invention sought to be protected.'” The principle idea in the invention
must be presented in the claims and must not be left for general review
of the specification." All claims in the patent should be supported by the
matter provided in the written description of the specification.

NOTES
1. Section 2(1)(j), The Patents Act, 1970, as amended in 1999, 2002, and 2005.
Section 2(1)(j) reads as follows:
(1) In this Act, unless the context otherwise requires...
...(j) Invention” means a new product or process involving an inventive step
and capable of industrial application...
2. Section 3(a), The Patents Act, 1970.
3. Manual of Patent Practice and Procedure, 2005.
4. Section 3(a), The Patents Act, 1970.
5. Section 3(c), The Patents Act, 1970.
6. Section 3(d), The Patents Act, 1970. Section 3(d) reads as follows: “The
following are not inventions within the meaning of this Act...
_..(d) the mere discovery of a new form of a known substance which does not
result in the enhancement of the known efficacy of that substance, or the mere
discovery of any new property, or new use for a known substance or of the mere
use of a known process, machine, or apparatus unless such known process results
in a new product, or employs at least one new reactant.
Explanation: For the purposes of this clause, salts, esters, ethers, polymorphs,
metabolites, pure form, particle size, isomers, mixtures of isomers, complexes,
combinations, and other derivatives of known Substances, shall be considered
to be the same substance, unless they differ significantly in properties with regard
to efficacy;...
7. Ibid. at Explanation.
8. Ibid.
9. Ibid.
10. Ibid.
11. Ibid.
12. Ibid., at Para 8.
44. INDIAN PATENT LAW AND PRACTICE

13. Ibid., at Para 19.

14. Ibid., at Para 14.
15. Ibid.
16. Ibid.
17. Section 3(e), The Patents Act, 1970.
18. Section 3(f), The Patents Act, 1970.
19. Section 3(h), The Patents Act, 1970.
20. Section 3(i), The Patents Act, 1970. Section 3(i) reads as follows: “The
following are not inventions within the meaning of this Act...
...(i) any process for the medicinal, surgical, curative, prophylactic, diagnostic,
therapeutic, or other treatment of human beings, or any process for a similar
treatment of animals, to render them free of disease, or to increase their economic
value, or that of their products;...
21. Section 3(j), The Patents Act, 1970. Section 3(j) reads as follows: “The
following are not inventions within the meaning of this Act...
...§) plantsand animals in whole or any part thereof, other than microorganisms
but including seeds, varieties and species, and essentially biological processes for
production or propagation of plants and animals;...
22. Section 3(k), The Patents Act, 1970. Section 3(k) reads as follows: ‘The
following are not inventions within the meaning of this Act...
.-- (k) a mathematical or business method or a computer program per se or
algorithms;...
23. Section 3(1), The Patents Act, 1970.
24. Section 3(n), The Patents Act, 1970.
25. Section 3(m), The Patents Act, 1970. ”
26. Section 3(0), The Patents Act, 1970.
27. Section 3(0), The Patents Act, 1970.
28. Section 4, The Patents Act, 1970.
29. Section 2(1)(ac), The Patents Act, 1970.
(1) In this Act, unless the context otherwise requires...
‘... (ac) “capable of industrial application’, in relation to an
invention, means
that the invention is capable of being made or used
in an industry; ..?
30. Section 2(1)(1), The Patents Act, 1970.
(1) In this Act, unless the context otherwise
requires...
4 -(l) “new invention” means any invention or technology which has
not been
anticipated by publication in any document or used
in the country or elsewhere
in the world before the date of filing of patent
application with complete
specificat ion, i.e, the subject matter has not fallen in publi
c domain or that it does
not form part of the state of the art; ..’
31. Section 13(2), The Patents Act, 1970.
32. Section 13(1)(a), The Patents Act, 1970,
33. Section 13(1)(b), The Patents Act, 1970,
34. Section 30(1), The Patents Act, 1970.
35. Section 29(2)(a), The Patents Act, 1970,
 PATENTABILITY REQUIREMENTS 45

. Section 29(2)(b), The Patents Act, 1970.

. Section 29(3), The Patents Act, 1970.
. Section 30, The Patents Act, 1970.
. Section 31(1)(d), The Patents Act, 1970.
. Ibid.
. Ibid., at Para 11.
. Ibid., at Para 9.
. Ibid.
. Ibid.
. Section 33, The Patents Act, 1970.
. Section 29(2)(b), Section 31(1)(a) and (b), The Patents Act, 1970.
. Section 31(1)(a) and (b), The Patents Act, 1970.
. Section 31(1)(c), The Patents Act, 1970.
. Section 32, The Patents Act, 1970.
. Section 25(1)(k), The Patents Act, 1970.
. Ibid., at Para 2.
. Ibid., at Para 3.
. Ibid.
. Ibid.
. Ibid.
. Ibid., at Para 11.
. Ibid.
. Ibid.
. Ibid., at Para 20.
. Ibid.
. Ibid., at Para 21.
. Ibid.
. Ibid., at Para 19.
. Ibid., at Para 1.
. Ibid., at Para 11.
. Ibid., at Para 12.
. Ibid., at Para 1.
. Ibid., at Para 6.
. Ibid., at Para 7.
. Ibid.
. Ibid., at Para 1.
. Ibid., at Para 29.
. Ibid., at Para 1.
. Ibid., at Para 9.
. Ibid., at Para 41.
. Ibid.
. Ibid.
. Ibid., at Para 21.
. Ibid.
 INDIAN PATENT LAW AND PRACTICE

80. Ibid.
81. Ibid., at Para 27.
82. Ibid., at Para 49.
83. Ibid.
84. Ibid.
85. Ibid.
86. Ibid.
87. Ibid., at Para 28.
88. Ibid., at Para 29.
89. Ibid., at Para 53.
90. Ibid., at Para 54.
91. Ibid.
92. Ibid.
93. Ibid., at Para 55.
94. Ibid., at Para 2.
95. Ibid., at Para 3.
96. Ibid.
97. Ibid.
98. Ibid., at Para 13.
99. Ibid.
100. Ibid.
101. Ibid., at Para 15.
102. Ibid.
103. Ibid.
104. Ibid., at Para 17.
105. Ibid.
106. Ibid.
107. Ibid.
108. Ibid.
109. Ibid., at Para 3.
110. Ibid.
111. Ibid., at Para 77.
112. Ibid.
113. Ibid.
114. Ibid., at Para 69.
115. Ibid., at Para 10,
116. Ibid., at Para 69,
117. Ibid.
118. Ibid.
119. Ibid.
120. Ibid., at Para 70,
121. Ibid.,at Para 1.
122. Ibid., at Para 71.
123. Ibid.
 PATENTABILITY REQUIREMENTS 47

124. Ibid.
125. Ibid.
126. Ibid., at Para 96.
127. Ibid., at Para 108.
128. Ibid., at Para 97.
129. Ibid., at Para 97.
130. Ibid., at Para 101.
131. Para 3.14.1, Draft Manual of Patent Practice and Procedure, 2008.
132. Section 10(1), The Patents Act, 1970.
133. Section 10(2), The Patents Act, 1970.
134. Section 10(3), The Patents Act, 1970.
135. Section 10(4), The Patents Act, 1970.
136. Ibid.
137. Ibid.
138. Section 10(5), The Patents Act, 1970. Section 10(5) reads as follows:
‘The claim or claims of a complete specification shall relate to a single invention,
or to a group of inventions linked so as to form a single inventive concept, shall
be clear and succinct and shall be fairly based on the matter disclosed in the
specification.’
139. Ibid at Para 10 citing Marconi’s Wireless Telegraph Co. v. Mullard Radio
Value Co. Limited.
140. Ibid., at Para 10.
 4
Patent Procedure

A” person may acquire a patent in India by filing a patent application

before the Patent office. The procedure for acquiring a patent
involves the following steps:
1. Filing of a patent application;
- Examination of the application;
- Publication of patent application;
. Pre-grant representation;
On . Patent grant and publication; and
&Wd
6. Post-grant opposition.
The process for acquiring a patent is shown
in Figure 3.1.
As shown in the flow diagram, a patent may
be acquired in India by
filing an application for a patent in the
prescribed form along with the
prescribed fee at the Indian patent offic
e. The patent office examines
the patent application for satisfaction
of patentability requirements and
provides an-examination report to
the applicant. If the report includes
an objection, the patent applicant
may respond to the patent office
writing or may ask the examiner in
for a hearing. If the applicant satis
the patent office on all patentabi fies
lity requirements, the patent off
grant a patent over the invention. ice will
After the application is filed, the
patent office will publish the applicat
within eighteen months from the ion
dat€ of application or priority
The rights of a patent applicant date.
will st art from the date of publ
ication. A
 PATENT PROCEDURE 49

Provisional Application

Complete Application
Within 12 months from the date of
Provisional Application

Office action to be completed Publication within 18 months

within 12 months from the date from the date of filing
of issuance of first objection

Pre-grant opposition
First Examination Report to be filed anytime before
the patent is granted

Office action to be completed

within 12 months from the date
of issuance of first objection

GRANT OF
PATENT

Patent grant opposition can

be filed within 12 months
from the grant of patent

Figure 3.1 The Indian Patent Process

 50 INDIAN PATENT LAW AND PRACTICE

published application will be open for opposition from interested parties

for a period of at least six months from the date of publication. After
the patent is granted by the patent office, it will be published again. The
published patent will once again be open for opposition for a period of
twelve months from the date of publication of the grant. The decisions of
the patent office are appealable to the Appellate Board.

3.1 FILING OF A PATENT APPLICATION

3.1.1 Patent Applicant

In India, a patent application may be filed by a natural and/or a legal per-
son. The application may be filed by any one of the following persons:
1. True and first inventor;
2. Assignee of the inventor; or,
3. Legal representative of the inventor.
Any person claiming to be the true and first inventor of an invention may
file a patent application.' True and first inventor is a person who conceives
the invention. A person who finances an invention but does not play any
role in conceiving the invention cannot be considered to be an inventor
(V.B. Mohammed Ibrahim v. Alfred Schafraneck and Ors). A firm or a
company cannot be named as an inventor in a patent application.’
An assignee of the invention may file the patent application, if the true
and first inventor assigns the invention to the assignee.* An assigne
e may
bea company, firm (Shining Industries and Anr. v. Shri
Krishna Industries),
government,‘ or any other legal person. While filing the patent
application,
the assignee has to submit the assignment deed executed
by the inventor
to the patent office in order to prove his right to file the
application. The
assignment deed must be filed along with the applica
tion or within six
months from the date of filing of the application.’
An employer can file for a patent as
an assignee, if an employee
comes up with an invention during the
course of his e mployment with
the employer. For example, if X, an
employee in a com pany Y is bound
by an employment agreement that
has a clause assigning all intellectual
property created by the employee to
the company and if X comes up
with an invention during his work with the company, Y
application as an assignee. can file a patent
A legal representative of a deceas ed
inventor may also file a patent
application.’ Furthermore, a patent appl
ication may be filed jointly by
more than one person, if an jnvention has
more than one inventor and/
or assignee.’
 PATENT PROCEDURE 51

Q24500
3.1.1.1 Filing by Foreign Applicants
A patent application may be filed by a person from any Convention
Country, which is a country that affords the same rights to its citizens as
Indian citizens for acquiring a patent.’ However, if any country does not
accord to citizens of India the same rights in respect of the grant of patents
and the protection of patent rights as it accords to its own nationals, a
national of such country cannot apply for a patent or be registered as the
proprietor of a patent in India.’ An assignee or licensee of such a nation
is also prohibited from acquiring a patent in India, even if such assignee
or licensee is a person permitted to file a patent in India.'° For example,
if a country A does not allow Indian citizens from acquiring a patent in
that country, the citizens of A also cannot acquire a patent in India. In
such a situation, if an inventor X, who is a citizen of country A assigns
the invention to a person Y, who is a citizen of India or a Convention
Country, Y, also, cannot acquire a patent on the invention in India.

3.1.1.2 Substitution of Patent Applicants

tuted by
The name of an applicant in a patent application may be substi
the patent is
the name of a person to whom the patent is assigned before
after filing
granted. If a person assigns his rights in a patent application
to any person,
the patent application and before the patent is granted
ller of Patents to
such assignee may make an application to the Contro
the prescribed
substitute his name as the patent applicant. On receiving
will incorporate
forms and relevant proof of assignment, the Controller
patent application will
the name of the assignee as the applicant and the
derives rights over a
proceed in the assignee's name.'' A person who
the same rights as
patent application due to operation of law will have
an assignee.’
to make an assignment
An applicant ina joint application is not allowed
the consent of the other
of his right in a patent application without
the joint applicants before
applicant or applicants.'’ On death of one of
may allow the application
the patent is granted, the Controller of Patents
g applicant or applicants on
to proceed on the name of the survivin
iving applicant or applicants
their request.'* In such a case, the surv
representatives of the deceased
should acquire the consent of the legal
joint applicants regarding the
applicant’ If any dispute arises between
the Controller may on receiving an
proceeding of the patent application,
direct that the application should
application from any of the applicants
applicants or regulate the proceeding
proceed on the name of one of the
KI BRARY
SATIONAL LAW SCHO@E @:
INDIA UNIVERSITY
 52 INDIAN PATENT LAW AND PRACTICE

of the apphiédice? im a.specific manner.'® The Controller of Patents will

give such directions only after giving each applicant an opportunity of
being heard."”

3.1.2 Unity of Invention

A patent application can be filed for only one invention or a group of
inventions relating to a single inventive concept.'* If a patent application
contains more than one invention or relates to more than one inventive
concept, separate applications have to be filed with regard to each of
the inventions or inventive concepts. For example, if X files a patent
application relating to a pen and a pen holder, X will be required to divide
the application into two applications because pen and pen holder are two
different inventions. However, if X files a patent application relating to
a pen and a process of making the pen, X will not be required to file
different applications because the pen and process of making the pen
relate to a single inventive concept.

3.1.3 Place of Filing

A patent application must be filed at any of the appropriate
patent offices
located at Kolkata, Delhi, Mumbai, and Chennai. Each
patent office is
given a territorial jurisdiction as shown in Table 3.1:

Table 3.1 Territorial Jurisdiction of Patent Offices

Office Territorial Jurisdiction

Patent Office , The states of Maharashtra, Gujarat, Madhya
Pradesh, Goa, and
Mumbai Chhattisgarh, and the Union Territories of
Daman and Diu, and
Dadra and Nagar Haveli
Patent Office, The states of Andhra Pradesh, Karnatak
a, Kerala, Tamil Nadu
Chennai and the union territories of Pondiche
rry and Lakshadweep.
Patent Office, The states of Haryana, Himachal
Pradesh, Jammu and Kashmir,
New Delhi Punjab, Rajasthan, Uttar Pradesh,
Uttaranchal, Delhi, and the
union territory of Chandigarh.
Patent Office, The rest of India.
Kolkata

accessed on 9 April 2010)

The appropriate patent office for

filing a patent is based Oo
in which: P n the territory
 PATENT PROCEDURE 53

1. The applicant for a patent normally resides, or has his domicile,

or has a place of business. If the application has more than one
applicant, the first mentioned applicant’s residence, domicile, or
business place will be considered; or,
2. The place from where the invention actually originates; or,
3. If the applicant for a patent or party in a proceeding has no place
of business or domicile in India, the place of address of service in
India given by the applicant."
Example: X, a resident of Bangalore and Y, a resident of San Jose, USA,
work with a company Z having offices in San Jose, Bangalore, and Delhi.
X and Y jointly come up with an invention while working at the Banga-
lore office and Z wishes to file a patent application over the invention. Z
can file a patent application either at the Chennai Patent Office because
the invention originated in Bangalore and Z has a place of business in
Bangalore, which falls within the territorial jurisdiction of Chennai
Patent Office, or at the Delhi Patent Office because Z has a place of
business in Delhi.
Assuming that Z does not have offices in Bangalore or Delhi and X and
Y have come up with the invention at San Jose, the patent office at which
Z can file will depend on the address for communication. If Z files the
application through a patent agent, whose address for communication
is at Pune, the appropriate patent office will be the Mumbai Patent
Office because the address for communication falls within the territorial
jurisdiction of Mumbai Patent Office.

3.1.4 Language of Filing and Format

The patent application and related documents have to be filed in either
English or Hindi unless the Controller permits filing in other languages.”
Such documents must be written, typewritten, lithographed, or printed
in large and legible characters with deep indelible ink. The lines must
size
be widely spaced on one side of a strong white paper. The paper
8 inches)
should be approximately 33.00 cm by 20.50 cm (13 inches by
of at
or 29.7 cm by 21 cm (11% inches by 8% inches) with a margin
on left and
least four centimetres on the right and top side and three cm
which is not
bottom side of the paper. Any signature on the application,
or English must
legible or which is written in a script other than Hindi
in Hindi or English
be accompanied by atranscription of the name either
in block letters.
 54 INDIAN PATENT LAW AND PRACTICE

3.1.5 Form of Application

An application may be filed directly at the Indian Patent Office, or as a
national phase application under the Patent Cooperation Treaty (PCT),
or as a Convention application after filing the first application in another
country which is recognized under the Indian Patent Act as a Convention
country. Every application filed directly at the Indian Patent Office may
be accompanied by either a provisional or a complete specification.’ The
applicant can file a provisional application if he conceives a workable
invention but requires time to perfect it or reduce it to practice. After
filing a provisional specification, a complete specification has to be
filed within twelve months from the date of filing of the provisional
specification.” If the complete specification is not filed within the said
period, the application will be considered to be abandoned. In case of
a PCT national phase application, Convention application, or divisional
application, the applicant must file the complete specification and cannot
file a provisional specification.
In a case where two or more provisional specifications are filed by
the same applicant in respect of inventions which are cognate or of
which one is a modification of another, and such inventions constit
ute
a single invention or inventive concept and may properly be include
d in
one patent, the applicant may file one complete specification
in respect
of all the provisional specifications after acquiring permiss
ion from the
Controller.” For example, if X files two provisional patent
applications,
one of which relates to a chair and the other relates to
a process of making
the chair, the applicant can file a single complete
specification including
the chair and process of making the chair after
taking permission from
the Controller of Patents because both the provisi
onal applications are
cognate and relate to a single inventive concept
. The Controller, on
request, has the power to convert a complete
application into a provisional
application.

3.1.6 Filing Documents

The following documents have
to be s ubmitted at the time of filing a
patent application:
1, Form 1—Application for the
grant of a patent;
. Form 2—Provisional or Comple
te Specification;
- Form 3—Statement and Undert
aking by the applicant;
. Form 5—Declaration as to Invent
orship; and,
na
dO
Ww
> - Form 26—Authorization of
the pate nt agent, if the applic
ation
 PATENT PROCEDURE 55

is filed through a patent agent (Power of Attorney). In case of a

general Power of Attorney, a self-attested copy has to be filed.”
(Above forms are reproduced in Appendix II A)
Declaration of inventorship (Form 5) must be filed along with the
patent application with complete specification.” If the declaration of
inventorship is not filed along with the application, it may be filed within
one month from the date of filing of complete specification.” If the Power
of Attorney is not filed along with the application, the patent office will
send an invitation of compliance to the applicant.” In such a case, the
Power of Attorney must be filed within three months from the date of
such invitation.’ Priority documents have to be filed by the applicant, if
the application is a Convention application.

3.1.7 Special Applications

3.1.7.1 Convention Application
Convention application is a patent application filed at the patent office
in India after it was filed earlier in a Convention Country.” Convention
Country is a country that:
1. is a member of an international, regional, or bilateral treaty,
convention, or arrangement in which India is also a member; and
2. affords to the applicants for patents in India or to citizens of India
similar privileges as are granted to its own citizens in respect of the
grant of patents and protection of patent rights.”
The list of member countries of the Paris Convention in which India is a
member has been provided in the Appendices of this book. All members
of the Paris Convention are Convention countries.
An applicant from a foreign country, who is not from a Convention
Country cannot file a patent application in India. A convention
application must be filed within twelve months from the date of filing
of
of the application in a Convention Country in order to claim priority
the application in the Convention Country.” The right to claim priority
beyond
of an application filed in a Convention Country is not extendable
if an
twelve months.” Priority of an application cannot be claimed
the date of
application filed in a Convention Country is withdrawn before
applications
filing of the convention application in India.™ If two or more
period of twelve
have been filed in different Convention Countries, the
the first application.”
months will be calculated from the date of filing of
relating to inventions,
In a situation where two or more applications filed
the other invention(s), were
which are cognate or modifications of
 56 INDIAN PATENT LAW AND PRACTICE

in different Convention Countries, a single convention application

covering all the three applications can be filed in India within twelve
months from the date of filing of the first application.** For example: X
files a patent application relating to a chair in USA on 4 July 2008. X then
files another application in Germany relating to the chair with arm rests
and neck rest on 4 December 2008.In such a situation, X can combine
the two applications and file one convention application because the
application in Germany is a modification of the invention that forms part
of the application in USA. In this case, X must file the Indian application
before 4 July 2009, that is within twelve months from the date of the USA
application.
A convention application must be filed along with a complete
specification and a provisional application cannot be filed with it.3” While
filing the convention application, the applicant must give details of filing
date of the Convention Country in which the first application was filed
and the date on which such application was filed.** When required by the
Controller, the applicant must submit copies of the application filed in
the Convention Country certified by the head of the patent office in that
country.*°

3.1.7.2. PCT National Phase Application

An applicant can file an international patent application through
the
PCT route and designate countries in which the applicant wishes
to get a
patent. PCT national phase application is an application that
designates
India and is filed at the Indian Patent Office after completion
of the PCT
international phase. A PCT application designating India
will be treated
as an application filed at the Indian Patent Office.
“° Furthermore, the
specification filed as a part of the PCT application
will be treated as a
complete specification filed in India."
The date of filing of the PCT national phase appl
ication will be the date
of filing or priority of the PCT applicat
ion.” Any amendment brought
about during the PCT process will also
be considered as an amendment
before the Indian Patent Office if the appl
icant so desires.** The Indian
Patent Office will start examining PCT
national phase applications only
after 31months from the priority date of
the PCT application.“
3.1.7.3 Divisional Application
An applicant may file a divisional
a pplication or applications, if a
provisional or complete application
file d by the applicant contains mor
than one invention.*® Such application e
Ss may be filed on the initiative
of
 PATENT PROCEDURE 57

the applicant or based on a requirement of the Controller.*° The divisional

application has to be a complete application relating to an invention, which
falls within the scope of the subject matter mentioned in the original or
parent specification.” The divisional application must specifically give
reference to the application number of the original patent application.*
No claim present in the parent application can also be present in the
divisional application.” Each of the applications should cover different
subject matter. The date of filing of the divisional application will be the
date of filing of the parent application. For example, if X files a patent
application relating to a table lamp and a table, the Controller will require
the application to be divided and the applicant has to file a divisional
application with regard to one of the inventions. Assuming that such
divisional application is filed regarding the table lamp, it should not
have any claims relating to the table. The date of filing of the divisional
application will be the date on which the first application is filed.

3.1.8 Priority Date

Priority date is the date of first filing, allotted by the patent office to
an application. The priority date is the critical date, considered by the
Indian Patent office to determine the novelty and non-obviousness of
an invention that forms part of a patent application. Each claim of the
complete specification will havea priority date.” Ifa complete specification
is filed after a provisional specification, the priority date of a claim in the
complete specification will be the date of filing of the application with
provisional specification, which contains subject matter of the claim.”'
For a claim having two priority dates, the earlier date among the two will
be the priority date of the claim.” For example, if X files a provisional
application relating to a special chair with different cushions on 22
October 2008, and then files another provisional application relating to
a unique coir cushion and its use in chairs on 22 December 2008 and,
thereafter, on 22 March 2009, X combines the two provisionals and files
a complete specification relating to a special chair with coir cushion, the
claim in the complete specification relating to the chair with cushion will
have two priority dates, 22 October 2008 and 22 December 2008. In such
a situation, the priority date of the claim will be 22 October 2008.
Incase ofa Convention application ora PCT national phase application,
in a
the priority date will be the date of filing of the first application
application. For
convention country or the date of priority of the PCT
ry 2009 and X
example, if X files a patent application in USA on | Janua
1 March 2009 and
files an application on the same invention in UK on
 58 INDIAN PATENT LAW AND PRACTICE

then X files a patent application in India on 1 April 2009, the priority date
of X’s application in India will be 1 January 2009, which is the date of first
convention application. It should be noted here that both USA and UK
are convention countries and, therefore, X can claim priority from the
applications. In the example, if X files a PCT application instead of the
UK application claiming the priority of the US application and then enters
the Indian national phase, the date of filing of the Indian application will
be the priority date of the PCT application, which is once again 1 January
2009, the US filing date.
The priority date of a divisional application is the priority date of the
parent application. For example, if X files a patent application claiming
a fan and a light in the same application on 11 December 2005 and later
divides the application into two divisional applications relating to fan and
light on 11 October 2006, the date of priority of the divisional application
will be 11 December which is the date of filing of the first application or
parent application.

3.1.9 Post-dating of Applications

On receiving a request from an applicant who has filed a complete
specification after a provisional specification, the controller can post-
date the filing date of the application to the date of filing of the complete
specification.** The patent applicant may also request the Controll
er
to post-date his patent application at any time before grant
of the
patent.” On receiving such a request the Controller may
post-date the
application to the date specified in the request.” It should
be noted that
the application cannot be post-dated for more than six
months from the
original application date. For example, if X files
a provisional application
on 14 March 2004 and then files the complete
specification on 1 January
2005, X can request the Controller to post-date
the application to the date
of filing of the complete specification. On accepta
nce by the Controller,
the date of application will be 1 January 2005.
Thereafter, if X requests the
Controller to post-date the application to
14 March 2006, the Controller
cannot post-date it because the request
for post-dating is beyond six
months from the date of the application, which is 1 January
a case, the applicant can post-date the a 2005. In such
lication to any dat
June 2005. PP y date up tto 30
Post-dating of a provisional a ppli
cation enables a patent applicant
to gain extra time to file the complete
specification. By post-dating, a
patent applicant can ge t up to six months
extra time. An applicant may
post-date his provision al application, if
details of the invention for fili
ng
 PATENT PROCEDURE 59

a complete specification would not be ready within twelve months from

the date of provisional application.
As the term of a patent is calculated from the date of filing of the
patent application, by post-dating, an applicant can initiate the patent
term from the new date. While making a decision on post-dating, the
patent applicant must note that the new date after post-dating will be
the date for determining patentability of the invention, and any prior
art reference, dated between the original date and the new date, will be
considered by the patent office for determining novelty and inventive
step of the invention.

3.1.10 Information about Foreign Applications

The applicant of an Indian application must keep the Controller of
Patents informed of all foreign patent applications that relate to the same,
or substantially same invention, until the Indian patent is granted.”
Information regarding the filing of a foreign application must be furnished
by the patent applicant to the Controller within six months from the date
of such filing.** At the time of filing the patent application, the applicant
must submit an undertaking with respect to foreign applications in
Form 3 to the Controller.® If the form is not filed along with the patent
pplication, it must be filed within six months from the date of filing of
he application in India.”
As and when required by the Controller, the applicant must keep the
Controller informed about the proceedings of the foreign applications
ncluding objections relating to patentability and so on until the patent is
sranted in India.*' Such information must be furnished by the applicant
vithin six months of receiving the communication requiring the
nformation from the Controller.”

1.11 Foreign Filing Permit

\ person resident in India can file a foreign patent application only after
aking written permission of the Indian Patent Office or after filing an
pplication at the Indian Patent Office.** On filing an application in India,
he applicant can file a foreign application after six weeks from the date
time.
f Indian filing if secrecy directions are not given within that
relating
‘he objective of the provision is to ensure secrecy of inventions
an invention
) national security such as atomic energy or defence. If
will grant
slates to atomic energy or defence purposes, the Controller
Government.”
ermission only after taking the consent of the Central
permission to file
‘n Indian citizen resident outside India need not take
60 INDIAN PATENT LAW AND PRACTICE

a foreign application. For example, if X, a citizen of India and a resident of

USA, comes up with an invention in USA, he need not acquire a foreign
filing permission before filing his patent application in USA or any other
country. On the other hand, if a person Z, who is a citizen of USA comes
up with an invention while working in India, he has to acquire a foreign
filing permission before filing a foreign application.
Foreign filing permit must be acquired even if the invention falls
outside the scope of patentable subject matter in India. Furthermore,
foreign filing permission must also be acquired before filing a PCT
application at the Indian Patent Office as the receiving office.
The application for permission to file a patent application in a foreign
country must be filed in Form 25. The Controller will ordinarily decide
on the application within 21 days from the date of application.’ The
decision of the Controller may take more than 21 days if the invention
relates to atomic energy or defence purposes. If a foreign application is
filed by an Indian resident without taking foreign filing permission, the
person would be liable for imprisonment up to two years and/or fine.®
Filing of a foreign application without a foreign filing permit is also a
ground for revocation of the patent in India.®

3.2 EXAMINATION OF PATENT APPLICATIONS

After a patent application is filed, the patent office will examine the
eligibility of the application for patent grant under the Patent Act
and Rules. The process of examination, as shown in the flow diagram
hereunder, will start with a request for examination and will proceed to
examination, and grant or rejection.

3.2.1 Request for Examination

The examination process will start with an application requesting for
examination. A patent applicant has to file a request for examination
within 48 months from the date of filing of the application or the priority
date, whichever is earlier, in order to initiate the examination process.”
The request for examination must be filed in Form 18.7 If secrecy
directions have been issued with regard to the application, the request
for
examination must be made within six months from the date of revocat
ion
of secrecy directions or within 48 months from the date of priority
or
filing, whichever is later.” For example, X files a patent applicat
ion over
an invention related to defence on 1 September 2008. After
reviewing
the application the Controller issues directions
to maintain secrecy of
 PATENT PROCEDURE 61

Application filing

Request for Examination within 48 months from

the filing or priority date, whichever is earlier e
Six months
Controller refers the application to examiner within one month from request for
from request or publication, whichever is later examinatio lal
publication,
whichever is later
Examiner submits report within one to three months ?

ApplicantreceivestheER = \y_e--------- 4

Substantive Objection:
Technical Objection: Forms, Patentability Requirements
Allow and Grant }\Fee. Specification, and so on
or other Requirements

Compliance with o If applicant agrees then If applicant disagrees

modification/amendment completely/partially, then he
without hearing
of the application as to provide justification

Hearing (Request to be made within 1 month of report)

PATENT PATENT
REFUSED GRANTED

Figure 3.2 Examination Flow Diagram

the invention until 1 July 2012. In such a case, X can file a request for
examination any time on or before 31 December 2012 because it is later
than 48 months from the filing date, which is 31 August 2012.
62 INDIAN PATENT LAW AND PRACTICE

For an application relating to drugs or food materials, which was filed

before 1 January 2005, the timeline for filing a request for examination
is the later among 48 months from priority date, or filing date, or 12
months from 31 December 2004.” For example, If a product patent
application is filed on 1 December 2001, the deadline for filing a request
for examination would be 31 December 2005, which is twelve months
from 31December, 2004. In this case, the 48 month deadline expires on
30 November 2005, which is earlier than the other deadline.
A request for examination for a divisional application must be filed
within the later among 48 months from the date of filing, or priority
of the parent application, or six months from the date of filing of the
divisional application.” If a request for examination is not made within
the said period, the application will be considered to be withdrawn.” An
applicant may also withdraw a patent application by making a request for
such withdrawal at any time before the grant of the patent.”

3.2.2 Examination of a Patent Application

The examination of the patent application will be done by the Controller
in co-ordination with the patent examiner. After receiving a request for
examination, the Controller will refer the application to an examiner,
generally within one month from the date of publication or request
for examination, whichever is earlier.” The examiner, on receiving the
application, will review the application and make a report in respect of
the following:
1. Whether the form of application and specification are in accordance
with the requirements of the Patent Act and the Rules;
2. Whether the invention that forms part of the patent application
satisfies the patentability requirements such as subject matter,
industrial applicability, novelty, inventive step, and specification;
and,
. Whether the application confirms to any other requirements,
such
as unity of invention and so on, prescribed under
the Act and
Rules.”*
The examiner will perform a patent and literature searc
h in order to
identify prior art relevant to the invention that forms part
of the patent
application. Based on the prior art search, the exam
iner will analyse
novelty and inventive step of the invention. Requ
irements, such as subject
matter, industrial applicability, Specification,
unity of inv ention, and so
on, will be assessed by review of the complete speci
ficatio n.
 PATENT PROCEDURE 63

The examiner is required to submit the report to the Controller within

one to three months from the date of reference by the Controller.” The
Controller will review the report and dispose the examination report of
the examiner within 30 days from the date of receipt from the examiner.”
The report of the examiner to the Controller is confidential and is not
open to public inspection.*' Such reports are not liable to be produced
or inspected in any legal proceeding unless the court certifies that the
production or inspection is desirable in the interests of justice.*

3.2.3 First Examination Report

The first report of the examiner will be sent by the Controller to the
patent applicant and is called the First Examination Report (FER). The
FER, along with the application and specification, will be generally
sent by the Controller to the applicant or his authorized agent within
the later of six months from the date of request for examination, or
six months from the date of publication.*’ In case an interested person
files a request for examination, an intimation of such examination will
be sent to such interested person. The examination reports and other
communications will be sent by the Controller to the applicant or the
agent ordinarily through electronic communication, duly authenticated."
The examination report will be sent in the form of hard copy, if the email
address of the applicant or agent is not available.”
After receiving the FER, the patent applicant has to convince the
Controller and put the application in order for grant within twelve
months from its date.*° Such period may only be extended by the High
Court, if a suit relating to the patent application is pending before it. The
deadline for putting the application in order for grant is otherwise not
extendable in any other circumstance.
The FER may either be favourable or adverse to the applicant. If the
FER is favourable, the patent application will be allowed by the Controller
and granted. However, if the FER is adverse, the gist of objections will
be stated in the report and communicated to the applicant.” An adverse
report may include objections at two levels:
1. Formal objections, relating to the form of application or specification
or fee; and/or,
2. Substantive objections, relating to patentability requirements or
any other requirements under the Act.
ation in
The Controller may require the applicant to amend the applic
order to overcome the objections.
64 INDIAN PATENT LAW AND PRACTICE

The formal objections generally relate to errors in forms, missing

signatures, requisite fee, format of specification, drawings, claims, and
other documents that form part of the application.** In response to the
said objections, the applicant will be required to submit the correctly
filled forms with necessary signatures and specification, drawings, and
other documents in the format required under the Act and Rules. Formal
objections can generally be complied with without any difficulty by the
applicant.
With regard to substantive objections relating to patentability
requirements under the Act, the applicant may take any of the following
steps:
1. Contest the objections of the Controller;
2. Amend the patent application as per the Controller’s directions;
3. Request the Controller for a hearing; or
4. Withdraw the patent application.

3.2.4 Contest/Amend
The applicant can contest the objections by writing a response to the
examination report giving reasons for non-acceptance of the objections.
On receiving the response, the examiner may allow the application based
on reasons provided by the applicant or send a second examination report,
if in his opinion any of the objections have not been met in the response.
The applicant may once again respond to the examination report with
his reasons for non-acceptance of objections. The process may continue
until the expiry of twelve months for putting the application in order
for grant.
During the process, the examiner may require the applicant
to amend
the application to comply with the objections in FER
or subsequent
reports.” In response, the applicant may amend the applic
ation in order
to comply with the objections of the examiner, or
refuse to make such
amendments and state reasons for such refusal
in the response. The
process may continue until the expiry of the term
to put the application
in order for grant. If the application is amended
by the applicant, it will be
examined once again in the amended form as
a new application.
After interacting with the examiner, if the
applicant complies with the
objections, the application will be allowed for
grant, else, the application
will be rejected. If the applicant fails to respond
to an examination report
or re-file the documents returned by the patent
office, the application will
be considered to be abandoned.” For exam
ple, if the patent office sends
 PATENT PROCEDURE 65

the complete specification along with the FER to the patent applicant,
the applicant has to re-file the complete specification at the patent
office along with the response. The application will be considered to be
abandoned if the applicant does not respond to FER or does not re-file the
complete specification at the patent office. The practice of sending patent
specifications along with examination reports has now been stopped by
the Controller General through a public notice issued in 2009.”

3.2.5 Hearing
The applicant may request for a hearing in order to understand the
objections raised in the examination report or to explain the reasons for
non-acceptance of objections to the Controller and examiner. The request
for a hearing may be made by the applicant within one month from the
date of receiving the examination report.” The Controller may also call
for a hearing on his own initiative, if he feels that a hearing is required.”
The Controller must provide the applicant an opportunity to be heard
before taking any adverse decisions with respect to the application. Any
applicant desiring to be heard can file a request for hearing at least ten
days before the expiry of the time limit specified for an action under
the act.”
The Controller will fix a date for hearing and inform the patent
or
applicant through a notice at least ten days before the date of hearing
inform
a reasonable period. On receiving such notice, the applicant must
on the
the Controller about his availability for the hearing and attend it
based on
said date.” The hearing may also be called for on a shorter notice
After hearing
the time left for putting the application in order for grant.
ation and,
the applicant, the Controller will proceed with the examin
cation with or
based on compliance with objections, may allow the specifi
g before the
without amendment, or refuse the application.” The hearin
is conducted after
Controller will be a public proceeding if the hearing
the publication of the complete specification.”

3.2.6 Withdrawal
any time after filing of
The applicant may withdraw the application at
During the examination
the application and before grant of the patent.”
raised by the examiner
process, if the applicant feels that the objections
n by filing a written request
cannot be met, he may withdraw the applicatio
n is withdrawn before the
and paying the requisite fee. If the applicatio
become part of prior art.
publication of the application, it will not
 66 INDIAN PATENT LAW AND PRACTICE

3.3 PUBLICATION OF PATENT APPLICATIONS

A patent application filed at the Patent Office will be kept secret until
it is published.” An application will be published on expiry of eighteen
months from the priority date or filing date of the application, whichever
is earlier." The Controller will generally publish the application within
one month of the expiry of the 18 month period. If an applicant wishes to
publish his application before 18 months, he may apply to the Controller
for early publication and the Controller will generally publish the
application within one month from the date of such application.'®! The
request for early publication must be made in Form 9 (Appendix IIA).
The object of publication of a patent application is to give notice to the
public about the patent application relating to the invention and to give
the public an opportunity of opposing the patent application.
A patent application will not be published if,
1. Secrecy directions are issued with regard to the application
as it
relates to atomic energy or defence purposes; or,
2. The application has been abandoned; or,
3. The application has been withdrawn three month
s prior to the
expiry of eighteen months from priority or filing date.
'
If an application is the subject of secrecy directions
, the application will
be published only on expiry of such secrecy direc
tions.!"
The publication of an application will include,
1. The date of the application;
2. Number of the application;
3. Name and address of the applicant;
and
4. The abstract.'
On publication of an application:
1. The patent office will make the spec
ification and drawing of the
application available to the publ
ic for a fee; and,
2. If the application includes a depo
sit, the depository institution will
make the biological material mentio
ned in the application available
to the public'°.
The rights of the patent applicant
will start from the date of publicati
of the patent application,'° Howeve on
r, a suit for infringement can
only after the patent is granted. be file d
 PATENT PROCEDURE 67

product prior to the 1 January 2005 and which continues to manufacture

the product covered by the patent on the date of grant of the patent, will
be required to pay only reasonable royalty. No infringement proceedings
can be instituted against such a company by the patent holder.'”
For example, Company X files a patent application over a molecule A
used for treating cancer on 22 September 2003. The patent office examines
the patent application after 1 January 2005 and grants the patent on 24
October 2006. The patent rights of X will start from 24 October 2006. Ifa
company Y has been making and selling the molecule A since 1 January
2004, it can continue to sell the molecule after 24 October 2006 by paying
reasonable royalty to X, and X cannot file an infringement suit against NY.

3.4 PRE-GRANT OPPOSITION AND REPRESENTATION

An opposition for the grant of a patent may be filed before or after the
grant of a patent. The opposition filed before the patent is granted is
called Pre-grant Representation and the opposition filed after the patent
is granted is called Post-grant Opposition.
rep-
After a patent application is published, any person may file a
over the
resentation before the Controller against the grant of a patent
followed
invention that forms part of the application.'* The procedure
for representation is shown in Figure 3.3.
the patent is
The Representation may be filed at any time before
t grant a patent
granted.” As per the Patent Rules, the patent office canno
means that the
within six months from the publication date, which
tion is six months
minimum time that a person gets to file a representa
be filed on any of
from the date of publication.''” A representation may
the following grounds:
the invention.'"
1. The applicant for the patent wrongfully obtained
and Y steals X’s
For example, if X is the inventor of a patent
n relating to an
laboratory notes and files a patent applicatio
a representation
invention mentioned in the notes, X can file
rio, the Controller
opposing the grant ofa patent to Y. Insucha scena
of the person from
may continue with the application in the name
X in the example;'””
whom the invention was obtained, which is
patent application lacks
2. The invention that forms part of the
ple, If X files a patent
novelty and/or inventive step. 13 For exam
which Y publishes an article,
application relating to an invention on
t representation against X's
Y or any other person may file a pre-gran
ion rejected on the ground of
application and get the patent applicat
lack of novelty and inventive step;
68 INDIAN PATENT LAW AND PRACTICE

ublication o
Application

File Representation (statement and evidence in support)

any time before grant—Grounds under section 25(1)

Accepted

Review by Controller

If Controller finds that the patent application can be

refused or requires amendment on the basis of this
representation he can forward the same to the applicant

Applicant files response

(within three months)

Hearing before the Controller

(ifapplicant requests)

Grant of Patent with or without

the Amendment

Figure 3.3 Pre-grant Representation

3. The invention is not patentable subject matter.“ For

files a patent applicat ion over an example, if X
invention relating to a geneti
cally
 PATENT PROCEDURE 69

pre-grant opposition against the application on the ground of

insufficient disclosure;
5. The applicant withheld information required by the patent office or
disclosed false information relating to the application to the patent
office.''® For example, if X files an application over an invention and
does not disclose the fact that the subject matter of the application
is also the subject matter of another pending application, the
application may be opposed and rejected. Furthermore, if X
files a patent application on a drug and makes statements about
the functioning of the drug without any scientific proof in the
specification, any person may file a pre-grant representation against
the invention on the ground of disclosure of false information.
6. The convention application was not filed within twelve months
from the date of the first application in a convention country.'””
For example, if X files an application in USA on 1 January 2008,
and files a convention application in India based on the application
in USA on 1 February 2009, any person may file a pre-grant
representation against the application and get it rejected because
the Indian application was filed after twelve months from the date
of first application;
7. The complete specification does not disclose or wrongly mentions
the source or geographical origin of biological material used for
the invention.'* For example, if X files an application relating
to a genetically modified microorganism found in the sea
near Andaman and Nicobar Islands and does not mention the
geographical origin of the microorganism, any person may file a
pre-grant representation against the application; or,
8. The invention forms part of traditional knowledge anywhere in the
world.'"? For example, if X files for a patent over use of turmeric
for healing wounds, any person may file a pre-grant representation
and get the patent application rejected as the invention forms part
of traditional knowledge in India.
office
The Representation for Opposition must be filed at the patent
ent and
at which the application has been filed.'” it must include a statem
The Controller
any existing evidence in support of the Representation.'2!
examination
will consider the representation only after a request for
entation, if the
is filed by the applicant.” After considering the repres
patent must be
Controller is of the opinion that the application for
amendment in the light
refused or the complete specification requires
Controller’s opinion will be
of the representation, a notice stating the
 70 INDIAN PATENT LAW AND PRACTICE

given to the applicant along with a copy of the representation.'”’ The

applicant can respond to the notice within three months from the date
of receiving the notice by filing a statement and relevant evidence in
support of his application.'* On receiving the patent applicant's response,
the Controller may refuse the grant of the patent or require amendment
of the specification before the patent is granted.'*° If a request is made
for a hearing, the Controller will hear the parties and grant, or reject, the
application based on the representation and submissions.!”6

3.4.1 A Study of Relevant Cases

A representation was filed by Natco Pharma Limited against an application
for patent (bearing number 1602/MAS/1998) filed by M/s Novartis AG
claiming Switzerland priority date of 18 July 1997 for an invention relating
to Crystal Modification of N-Phenyl-2-Pyrimidineamine derivative.
After reviewing the representation and hearing the parties the Controller
held that the invention lacked novelty and inventive step in the light of a
US patent application. The Controller also held that the invention is not
patentable subject matter because it is a new form of a known substance
and because the applicant failed to show any improvement in efficacy.
As
Switzerland was not a Convention Country on the date of filing
of the
application, the Controller stated that the applicant cannot claim
priority
from the application in Switzerland.'2”:

Indian Network for People living with HIV/AIDS and

Tamil Nadu
_ Networking People with HIV/AIDS v. Union of
India
The petitioners, societies providing support
to people suffering from
HIV AIDS, filed a Pre-grant Representati
on by way of opposition
under section 25(1) of the Patents Act,
1970, against a patent relating
to Valganciclovir filed by F. Hoffmann-La
Roche, which is a drug used
to treat CMC retinitis,'2> The petitioner
s submitted the grounds of
Opposition and specifically demanded
hearing under Rule 55(1) of
the Patents Rules.!2?> On receiving
the representation, the Controller
of Patents sent a notice to the patent appli
cant and granted the patent
without giving an Opportunity of
being heard to the petitioners, '*°
Aggrieved by the Controller's actio
n, the petitioners filed a writ petit
before the Madras High Court pray ion
ing for quashing of the patent
and requesting grant
for an opportunity of hearing befor
e deciding the fate of
the patent application.'*! After hear
ing the parties, the court set aside
patent grant and ordered the Contr the
oller of Patents to give a hearing
the petitioners before deciding on to
grant of patent.'** The Court state
d
 PATENT PROCEDURE v1

that the petitioners have the right for a hearing under Section 25 of the
Patent Act and Rule 55 of the Patent Rules and directed the patent office
not to assign the hearing to an Assistant Controller who had dealt with
the patent application in the first instance.'*

3.5 PATENT GRANT AND PUBLICATION

If the application satisfies all the requirements of the Patents Act and
Rules, the application is said to be in order for grant. An application in
order for grant will be granted and the date of patent grant will be entered
in the register.'* The patent grant certificate will be sent to the applicant
or agent along with a final version of the complete specification in a
compact disc.'*
A granted patent will be published in the official gazette and will be
open for public inspection.'* The date of the granted patent will be the
date of filing of the patent application.'*” The examination carried out by
the examiner or Controller does not warrant the validity of the patent.'*
Neither the examiner or Controller, nor any other officer can be held
liable for the examination or grant of a patent.'”

3.6 POST-GRANT OPPOSITION

A Post-grant Opposition may be filed by any interested person after the
publication of patent grant and within one year from the date of such
publication.’ An interested person is a person engaged in, or promoting
research in, the field to which the invention relates.'*' For example, if X
gets a patent grant on a gene sequence responsible for diabetes, a scientist
at National Institute of Nutrition, who is researching on diabetes will be
considered to be an interested person.
The Post-grant Opposition process is shown in the flow diagram
hereunder.
A Post-grant Opposition may be filed based on any of the grounds
specified for Pre-grant Representation.'” The grounds listed under the
Act, for both opposition and representation are the same.

3.6.1 Notice of Opposition

by filing a
Any interested person (opponent) may initiate the opposition
in Form
notice of opposition.’ The notice of opposition must be filed
n statem ent
7.\44 In addition to the notice, the opponent must file a writte
t, facts of the
in support of the notice setting out the nature of his interes
in support of the
case, and relief sought by him.'*’ Evidence may be filed
and evidence, if any,
written statement.’ A copy of the written statement
 72 INDIAN PATENT LAW AND PRACTICE

Post-grant
Publication

Notice of Oppositions within 12 months of publication By Interested Person

(opponent)- Grounds Under Section 25(2)

Written Statement and Evidence

Patent Holder is notified Controller constitutes

Opposition Board

Patent Holder can contest reply statement

and evidence within 2 months from date of Refers the opposition to
receipt of notice from controller the Opposition Board

Opponent can file evidence in response Report within three months from
to the Patent Holder evidence within reference every ground of Opposition
one month from receipt of such evidence
with joint recommendations

Hearing notice sent by

Controller

Hearing (if
parties want)

amendment in Reject opposition

Patent

Figure 3.4 Flow Diagram—Post-grant Opp

osition
must be delivered to the patent
holder also. ‘’ Ifa notice of opposition
is filed by a person who is not resi
di ng or does not carry any business
in India, the Controller may require such
a person to give security for
the cost of proceedings and may
reject the notice if such a security
not given.'** is
 PATENT PROCEDURE 73

3.6.2 Response to Notice of Opposition

On receiving the notice of opposition, the Controller will notify the
patent holder regarding the notice.'*? The patent holder may contest
the opposition by filing a reply statement and evidence in response to
the opposition notice within two months from the date of receiving the
notice from the Controller.'* The patent holder must deliver a copy of
the reply statement and evidence to the opponent also.'*! If the patent
holder does not contest the opposition, the patent will be revoked.'”
In response to the patent holder’s statement, the opponent may submit
evidence relevant to patent holder’s evidence in response within one
month of receiving such statement.'”’

3.6.3 Opposition Board

The Controller will constitute a three member Opposition Board
and refer the opposition, along with the documents, to the Board for
examination and submission of its recommendations to the Controller."
An examiner in the patent office is eligible to be a member of the Board.
155

However, the examiner who had examined the application cannot be a

Board member.'* The Opposition Board will conduct the examination
of the notice of opposition and submit a report, with reasons on each
ground taken in the notice of opposition with its joint recommendation,
within three months from the date of reference.'” On receipt of the
recommendation of the Opposition Board and after giving the patentee
and the opponent an opportunity of being heard, the Controller will
order either to maintain, or to amend, or to revoke the patent.'™

3.6.4 Hearing
After receiving the recommendations of the Opposition Board and
completion of submission of evidence, the Controller will fix a date
and time for hearing.’ The Controller may require members of the
ler
Opposition Board to be present during the hearing.’ The Control
will give a notice of hearing at least ten days before the date of hearing
to each party.'*' Any party that desires to attend the hearing must inform
a notice
the Controller through a notice along with the fee.'® If such
If either or
is not sent, the Controller may refuse to hear the party.’
ler will
both parties are interested in attending the hearing, the Control
conduct the hearing.’
 74 INDIAN PATENT LAW AND PRACTICE

3.6.5 Decision
After the hearing and/or based on recommendations of the Opposition
Board, the Controller will decide on maintaining, revoking, or requiring
amendment of the patent.'® The Controller will communicate the
decision with reasons to both the parties.'® If the patent holder decides
to withdraw the patent based on the notice of opposition, the Controller
may grant costs to the opponent.’®

3.6.6 A Study of Relevant Cases

1. A research assistant, who is a laboratory technician filed an opposition
against a patent alleging wrongful obtainment and prayed for
incorporation of his name as an inventor.'® The Controller reviewed
the facts and stated that a laboratory technician, involved in carrying
out experiments or in reducing an invention to practice, cannot be
considered to be an inventor. As the opponent just helped in carrying
out experiments and, therefore, was not an inventor, the Controller
stated that there was no wrongful obtainment and rejected the
opposition.
2. An opposition was filed against a patent relating to a process
for
making a soap composition containing glycerol based on lack of
novelty and inventive step in the light of prior art.'® After review
ing
the prior art documents, the Controller stated that the specifi
c steps
of the invention were not present in the prior art. The
Controller
observed that the right balance of salt and glycerol in
order to avoid a
soap which is too hard or too soft, and balancing quantit
ies of glycerol
or salt against the quantities of total fatty matter
that formed part of
the patent, were not present in the prior art.
As the cited prior art
did not contain the elements of the invention
that formed part of the
patent, the Controller rejected the opposi
tion.
3. An opposition was filed against a pate
nt relating to a process for
the preparation of a therapeutic anti
-inflammatory and analgesic
composition containing Nimesulide
for transdermal use stating that
the invention lacked novelty and inventiv
e step, based on Nigerian and
Sri Lankanpatents.'” As the prior art patents disc
losed the identical
process as that of the invention in the
patent, the Controller revoked
the grant of patent.
4. An opposition was fi
led agaia nst
patent relating toa Mosquit
Repellant Device o n the ground of 8 quito/IInsect
lack of novelt y and inventive
 PATENT PROCEDURE 75

step based on prior publication.'”' The opponent relied on citation

of Registered Design No.56444, photographs of Registered Design
No. 159918 dated 5 July 1988, and advertisement in newspaper with
photographs of mosquito repellent with extended cord in the brand
name of Good Knight dated 6 August 1990 (Ex-Cl), After reviewing
the prior art references, the Controller stated that the invention
possessed novelty as all elements were not present in a single prior
art reference. With regard to inventive step, the Controller stated that
the invention was obvious because the integers of the invention were
present in combined prior art and the invention was nothing more
than a mere workshop improvement of a skilled person in the light
of the prior art. Based on the reasoning, the Controller revoked the
patent.

3.6.7 Review of Decisions by the Controller

The Controller will have the powers of a Civil Court with respect to certain
actions under the Patents Act.'”? Under such powers, the Controller can
review a decision made by him under the Act.'” A person may apply
for a review of the Controller’s decision by filing an application under
Form 24 within one month of the communication of the decision by the
Controller.'“* Such period may be extended on request of the applicant
to a maximum period of one month.'” After reviewing the decision, the
Controller may either uphold the decision or set it aside.

3.7 APPEALS TO APPELLATE BOARD

Appeals from certain decisions, directions, or orders of the Controller or
Central Government, under the Patents Act may be made to the Appellate
Board. The Appellate Board has the jurisdiction to hear appeals from any
decision, order, or direction, relating to any of the following aspects:
1. Refusal of a patent application by the Controller under Section 15
of the Act;
2. Any decision with regard to filing of a divisional application under
Section 16 of the Act;
3. Any decision regarding the post-dating of an application under
Section 17 of the Act;
4. Refusal of the application by the Controller based on anticipation
under Section 18 of the Act;
5. Decision of the Controller regarding insertion of a reference due to
potential infringement under Section 19 of the Act;
76 INDIAN PATENT LAW AND PRACTICE

a Decision of the Controller with regard to substitution or addition

of a person’s name in the patent application under Section 20 of the
Act;
7. Order of the Controller to maintain, or amend, or revoke, the
patent under Section 25(4) of the Act;
aa Decision relating to mentioning of the name of the inventor in the
patent application under Section 28 of the Act;
9. Directions of the Controller with regard to the sale or lease of the
patent, or the grant of licences under the patent under Section 51
of the Act;
10. Decision of the Controller with regard to patent of addition under
Section 54 of the Act;
11. Decision or Order of the Controller regarding the amendment
of an application, specification or any document relating thereto
under Section 57 of the Act;
12. Decision of the Controller with regard to restoration of lapsed
patents under Sections 60 and 61 of the Act;
13. Decision of the Controller with regard to surrender of a patent
under Section 63 of the Act;
14. Decision of the Central Government to revoke a patent as it is
prejudicial to the public interest under Section 66 of the Act;
15. Decision of the Controller to register a person as a proprietor or
co-proprietor of a patent under Section 69(3) of the Act;
16. Correction of errors in a patent or application by the Controller
under Section 78 of the Act; and
17. Order of the Controller with regard to compulsory licences under
Sections 84(1)-(5), 85, 88, 91, 92A, and 94 of the Act.!76
The Appellate Board does not have jurisdiction regarding any direct
ion
made or issued by the central government, or any order, or direct
ion of
the Controller, giving effect to Central Government's direct
ions such as
secrecy directions for inventions relating to defence purpos
es or atomic
energy.'””
In addition to hearing appeals, the Appellate Board has
the jurisdiction
to revoke a patent under Section 64 of the Act and
to rectify the register
under Section 71. Any decision with regard to revoca
tion or rectification
willbe communicated by the Appellate Board to the
Controller, who will
mn turn make necessary changes in the register.’ All cases
of appeals
against any order or decision of the Controller
and all cases pertaining
to revocation of patent and rectification of
register pending before any
High Court have been transferred to the Appellate Board
on 2 April 2007
 PATENT PROCEDURE iV

as notified by the Central Government in the Official Gazette.'” The

Appellate Board may proceed with the matter in each case either de novo
or from the stage it was so transferred.'*°

3.7.1 Composition of the Appellate Board

The Appellate Board, established under the Trademarks Act, 1999, will
have jurisdiction, power, and authority under the Patents Act also.'*! The
Appellate Board consists of a chairman, vice-chairman, and number of
members as deemed fit by the Central Government.'® It will exercise
its jurisdiction through benches constituted by the Board. A Bench of
the Appellate Board consists of one Judicial Member and one Technical
Member and sits at Chennai as notified by the Central Government.'”
However, the Technical Member of the Appellate Board, under the
Patents Act, is different from the one under the Trademarks Act. Unlike
the Technical Member under the Trademarks Act, the member under the
Patents Act must:
1. Have held the post of Controller for at least five years or have
exercised the functions of the Controller for at least five years; or,
2. Have functioned as a Registered Patent Agent for at least ten years
and possesses a degree in engineering, or technology, or a masters
degree in science, from any university.'™

3.7.2 Procedure before the Appellate Board

Every appeal to the Appellate Board must be made within three months
from the date of the decision, order, or direction of the Controller or
the Central Government, or within such further time as the Appellate
Board may allow.'** The Appellate Board has the power to make rules
regarding the conduct and procedure in respect of all proceedings before
it." The Appellate Board has the power to regulate its own procedure,
including the fixing of place and time of its hearing, within the limits
by
of the provisions of the Trademarks Act and Rules.'*” It is not bound
the code of civil procedure but is bound by principles of natural justice.
the civil
‘However, the Appellate Board shall have the same powers as
ing its
court under the Code of Civil Procedure, 1908, while discharg
functions in respect of the following matters:
1. Receiving evidence;
2. Issuing commissions for examination of witnesses;
3. Requisitioning any public record; and,
4. Any other matter.'"
 78 INDIAN PATENT LAW AND PRACTICE

Any proceeding before the Appellate Board is considered to be a judicial

proceeding, and the Appellate Board is deemed to be a civil court.'*”
If the members of a Bench differ in opinion on any point, they will
make a reference to the chairman, who will either hear the point or
points himself, or refer the case for hearing on such point or points by
one or more of the other members. Such point or points will be decided
according to the opinion of the majority of the members who have heard
the case, including those who first heard the case.'”°

3.7.3 A Study of Relevant Cases

Ajanta Pharma Limited v. The Controller General of Patents, The Assistant
Controller of Patents and Designs and Eli Lilly and Co.
The case related to an application for a patent entitled Tetracyclic
derivatives, processes for preparation and use, which was assigned to Eli
Lilly & Company (Eli Lilly).'*! Ajanta Pharma Limited (Ajanta) filed a
pre-grant opposition against the patent application.'*? After considering
the opposition, the Controller allowed the process claims but rejected
the product claims.'”? Aggrieved by the decision of the Controller, Ajanta
filed an appeal to the Delhi High Court under Section 116(2) of the
principal Patents Act.'** Thereafter, the Appellate Board was constituted
and the High Court transferred the case to the Appellate Board under
Section 117G of the Patents Act.
Eli lilly argued before the Appellate Board that the appeal before
the
Appellate Board was not maintainable because Section ]
17A, which deals
with appeals to Appellate Board, does not allow an appeal
from a decision
of the Controller relating to pre-grant opposition." In
response, Ajanta
argued that the appeal was maintainable because
Section 116(2), which
was applicable before Section 117A came into
force, allowed an appeal
from any decision of the Controller, includ
ing a decision relatingto pre-
grant opposition. After reviewing the arguments,
the Appellate Board
held that the appeal was maintainable before
the Appellate Board because
Section 116(2), which was in force before
Section 117A came into force,
allowed an appeal to the High Court and
Section 117G provided for
transfer of cases pending before the High
Court to the Appellate Board.'%
While deciding the case, the Appellat
e Board observed that whenever
there is a repeal of an enactm
 PATENT PROCEDURE 79

According to the Appellate Board, a clear legislative intention of the

re-enacted enactment regarding preservation or obliteration of rights
must be inferred and gathered from the new Act.’ As Ajanta had the
right to go for appeal from pre-grant opposition to the High Court under
Section 116(2), as Patent Bench of IPAB had not been formed, and as
the enactment of the new section does not expressly or by implication
obliterate such a right, the Appellate Board stated that the right would
continue to exist, even after the constitution of the Appellate Board and
coming into force of Section 117A.'” In the light of its reasoning, the
Appellate Board held that the appeal was maintainable.

Vikram India Limited v. Kilburn Engineering Limited, The Controller of

Patents and The Controller General of Patents and Designs and Trademarks
The case related to a petition pleading for hearing by the Appellate
Board at Mumbai instead of Appellate Board at Chennai. After hearing
the arguments, the Appellate Board held that the hearing must be held
at Mumbai Patent Office instead of Chennai Patent Office based on the
following reasons.”
1. The Patent in question was sealed and granted by Patent Office
at Mumbai on 21 April 2006, and all the concerned and relevant
records of the patent files were available at Mumbai Patent Office;
2. The applicant for revocation had its Registered Office at Kolkata;
3. The patent holder had its R&D establishment and head office at
Mumbai, and no cause of action arose in Chennai;
4. The experts conversant with the technical niceties of the patent in
questions were available only at Mumbai;
5. Holding the hearing would cause inconvenience for counsels of
both the parties;
6. The court which has jurisdiction to try any disputes among the
parties is the Bombay High Court; and,
7. As per the Patents Act and Trademarks Act, the Chairman of the
Appellate Board has the power to allocate the appropriate bench to
conduct a hearing, based on the jurisdiction of the business.”

Novo Nordisk Health Care AG v. The Assistant Controller of Patents and

Designs, Government of India
Novo Nordisk filed a PCT national phase application at the Indian
ation,
Patent office on 1 December 2003.” After examining the applic
which meant
the Controller of patents issued the FER on 9 June 2006,
grant was 9 June
that the last date for placing the application in order for
 80 INDIAN PATENT LAW AND PRACTICE

2007.?? The Controller raised objections to grant of the patent in the FER
based on lack of novelty and inventive step in the light of prior art.”
Novo Nordisk responded to the examination report on 7 June 2007, two
days before the last date, with an elaborate response to the objections
and requested for a hearing if the Controller decides to make an adverse
decision on the application.*° On receiving the response from Novo
Nordisk, the Controller rejected the patent application without giving an
opportunity of being heard.” In the rejection letter, the Controller stated
that a hearing was not given because the request was made just two days
before the expiry of the last date.”
After reviewing the facts, the Appellate Board held that rejection of
the application without giving an opportunity of being heard violates
principles of natural justice and set aside the rejection of the application
by the Controller.” Though, Section 80 requires a patent applicant to file
a request for hearing before ten days of the expiry of the deadline, the
Board stated that the requirement under the provision may be relaxed
by the Controller. The Board remanded the application to the Controller
and ordered the Controller to provide an opportunity of being heard
before deciding on the application.”

Michigan State University v. The Assistant Controller of Patents and The

Controller General of Patents, Trademarks, Designs, and Geographical
Indications
Michigan State University (MSU) filed a patent application relatin
g
to Transgenic Plants Producing Polyhydroxyalkanoates.”"° As
the
invention that formed part of the application had plurality of
inventions,
the applicant filed two divisional applications related
to plants having
modified genes through DNA coding.”"' The divisional
application in
question before the Appellate Board related to modifi
cation of gene
sequences through a recombinant technique.?””
After examining the
application, the Assistant Controller objected
to the grant of patent on
the ground that the invention was not patent
abl e subject matter as it
claimed living matter? MSU responded by stating
that the invention
claimed was a chemical compound and a
process related to the compound
and amended the application based on
the objections." After a few
interactions, the Assistant Controller abando
ned the application stating
that MSU failed to put the application
in order for grant.?!5
Aggrieved by the order of the Assistant
Controller, MSU filed a review
application stating that the order did not
give reasons for abandonment.2'*
On rejection of the review application, MSU
appealed to the High Court,
 PATENT PROCEDURE 81

which transferred the case to the Appellate Board after its constitution.”””
After reviewing the facts of the case, the Appellate Board held that the
order of abandonment was not sustainable because MSU was not given
an opportunity of being heard.”'* It remanded the case to the Assistant
Controller for disposal after hearing the applicant.””

Hindustan Unilever Limited v. The Controller of Patents and Design,

Sri Rakesh Kumar, Assistant Controller of Patents and Design, and The
Examiner of Patents and Designs
Hindustan Unilever Limited (HUL) filed a National Phase application
for patent with regard to a Fabric Conditioning Kit. After examining
the application, the examiner initially raised formal objections in the
FER, which were duly complied by HUL.”! Thereafter, the examiner
sent a second examination report with technical objections relating to
novelty and inventive step based on three prior art references.” HUL
responded to the objections and made certain amendments to the patent
application.’ A hearing was requested in the response letter if the
Controller took an adverse decision on the application.™
After reviewing HULS response, the examiner rejected the application
without giving an opportunity of being heard. Thereafter, HUL filed
the
a review petition for which it did not receive any response from
”
Controller and, therefore, filed an appeal before the Appellate Board.
on
After hearing the parties, the Appellate Board held that the rejecti
heard
of the patent application without giving an opportunity of being
ed the
amounted to violation of principles of natural justice and remand
case to the Controller for disposal after giving a hearing.”

EBZ Online Private Limited v. The Controller of Patents

t entitled An
EBZ Online Private Limited (EBZ) applied for a paten
Including Depositing
Apparatus For Conducting Banking Transactions
FER relating to the
and Withdrawal of Cash.” The Controller issued the
Controller objected
application on 8 December 2005. In the FER, the
procedural grounds.”
the patent application based on substantive and
2006.””
EMZ responded to the objections on 29 November,
ted the application
After reviewing the response, the Controller rejec
rejecting the application, the
as it was not in order for grant.”! While
did not give the applicant an
Controller cited prior art references and
of the application in the light of
opportunity to defend the patentability
Board held that the Controller
such references. On appeal, the Appellate an opportunity of
by not giving
violated the principles of natural justice
 82 INDIAN PATENT LAW AND PRACTICE

being heard or opportunity of defending the application.” The Appellate

Board remanded the application to the Controller for disposal after giving
an opportunity of hearing.*”’

Rolic AG et al. v. The Controller General of Patents and The Assistant

Controller of Patents and Designs
Rolic AG et al. (Rolic) filed a PCT national phase application at the
Indian Patent Office for an invention titled Topologically Structured
Polymer Coating and a Method of Creating Thereof.” After examining
the application, the patent office objected to the grant of patent based
on grounds relating to subject matter, novelty, and inventive step.”
Rolic responded to the examination report by amending two claims
in
the application and by submitting arguments against the objections.
Despite the amendment and submissions, the patent office maintaine
d
the objections and gave Rolic an opportunity of being heard.’
After
the hearing, Rolic made further amendments to the application
.** It
also submitted details relating to grant of the patent applicatio
n by
the European Patent Office. After reviewing the amendmen
ts and
documents submitted, the patent office maintained the
objections and
refused the application.2“°
Aggrieved by the decision of the patent office, Rolic
appealed to the
High Court and the case was transferred to the
Appellate Board after
its constitution.’ After hearing both the parti
es, the Appellate Board
stated that the patent office must 8ive its order
of refusal in the light of
submissions of the patent applicant with reaso
ns.” It further stated that
the reasons for refusal of grant of patent
should be clear, explicit, and
should show that the learned Controller
of Patents had avplied his mind,
considered the observations of the appli
cant, and discussed or analysed
the same, while refusing to proceed
with the application.** As per the
Appellate Board, the refusal order
was a mere narration of the paten
examiner's technical objections and t
did not give reasons for refusal.2“

Nokia Corporation of Keilalahdent

i v. The Assistant Controller
and Designs, Government of India of Patents
Nokia Corporation (Nokia) filed
at the Chennai Patent Office.
Aft i
 PATENT PROCEDURE 83

Controller issued an examination report having technical and formal

objections.” The formal objections related to information regarding
national phase patent applications filed in other countries.’ The applicant
provided the information relating to foreign applications required by the
Controller, but specified the international filing date as the date of filing
in Form 3.” Based on the date mentioned, the Controller rejected the
patent application stating that applicant disclosed false information
regarding the date and did not disclose information required under
Section 8 of the Patents Act to the patent office.*°
Aggrieved by the decision, Nokia, the patent applicant, appealed to
the Appellate Board. After hearing the arguments of the parties and
after reviewing relevant provisions, the Appellate Board stated that the
date mentioned by Nokia in Form 3 was not wrong and did not amount
to non-disclosure of material information required under Section
8.2! As per the Appellate Board, as Sections 7 and 138 and Rule 11
of PCT Rules provided very clearly that the date of application of the
national phase application would be date of filing of the international
application, mentioning the international filing date does not amount to
an irregularity on behalf of the patent applicant.” The Appellate Board
further observed that the patent applicant did not gain any advantage by
not disclosing the actual filing date because such information was not
material for grant of a patent.”® In the light of its reasoning, the Appellate
Board set aside the order of the Controller and directed the Controller to
grant the patent.”

Novartis AG v. Union of India and Ors

Novartis AG (Novartis) filed an application for patent in 1998 for an
invention entitled Crystal Modification of a N-Phenyl-2-Pyrimidine-
amine derivative, processes for its manufacture, and its use.” The
of
application claimed the methanesulfonic acid addition salt form
It
the compound, Imatinib, hereinafter called as Imatinib Masylate.’”**
which
specifically claimed the beta crystal form of Imatinib Masylate,
better
is non-needle shaped, having better flow properties, and, thus,
stable, thus
processable, less hygroscopic, and more thermodynamically
characterized
better storable than its needle shaped, alpha crystal form,
X-ray diffraction
by the differences in the melting points and the
priority from an
diagrams. 257 The patent application of Novartis claimed
application filed in Switzerland.
258

Pre-grant representations opposing the gran

t of patent were filed by
Natco Ph arma Limited,
Cancer Patients Aid Association, India, M/s
 84 INDIAN PATENT LAW AND PRACTICE

M/s Cipla Limited, M/s Ranbaxy Laboratories Limited, India, and M/s
Hetro Drugs Limited, India (opponents).*”” The opponents claimed that
the invention claimed in the application was not patentable because it
claimed priority date wrongfully, lacked novelty, and inventive step,
and fell within Section 3(d) of the Patents Act.” After considering the
representations and hearing the parties, the Assistant Controller refused
the grant of the patent.”' Aggrieved by the decision of the Assistant
Controller, Novartis filed writ petitions before the High Court of Madras
and the court converted the said writ petitions into appeals.” After the
constitution of the Appellate Board in 2007, the case was transferred to
the Appellate Board.”
The Appellate Board considered each of the arguments raised by the
opponents and refused to grant the patent over the claimed compound
to Novartis. With regard to priority date, the Appellate Board stated that
an issue relating to convention priority would be a ground for opposition
under Section 25(1) of the Patents Act.“ It went on to state that the ground
cannot be accepted for refusal of patent application in the case because
Novartis could claim priority from a Switzerland Patent application
in
accordance with the amended Section 133 of the Patents Act.2%
Regarding novelty, the Appellate Board reviewed the prior
art
references cited by the opponents and stated that the refere
nces do not
disclose any specific crystalline form of Imatinib Mesylate
as a substance,
leaving apart the beta crystalline form, any pharmaceutic
al composition
containing the same or any process for making the
said beta form.?® It
further observed that a person skilled in the art
would not be able to
predict the polymorphism and prepare the subjec
t compound from the
prior art.” Furthermore, the Appellate Board
stated that Beta-crystalline
form of Imatinib Mesylate was not inherently
anticipated by the prior
art because the salt existed in several polym
orphic forms, there was
no concrete method to prepare the salt
form, and because convention
methods could not be used to prepare
the compound based on the
disclosure.?® In the light of its reasoning, the Appell
ate Board held that
the compound was not anticipated and,
therefore, satisfied the novelty
requirement.”
With regard to the existence of
inventiv e step, the Appellate Board
stated that though the prior art pro
vided va rious salt forms of Imatinib
including the Mesylate form and a
person s killed in the art might choose
the Mesylate fo rm, a person skilled in the art
would not be able to discover
the same and reach to the beta crystal form
of Imatinib Mesylate, or
to find its adv antageous properties, or to
find a Suitable process for its
 PATENT PROCEDURE 85

preparation, or make a solid pharmaceutical composition containing the

said crystal form, because of polymorphism and related unpredictability
in the art.2” It then stated that the invention had a technical advance
as compared to the existing knowledge by way of demonstration of
polymorphism, isolation, and characterization of beta (and alpha)
crystal forms of Imatinib Mesylate, identifying suitable properties in the
beta crystal form usable in the making of oral solid drug formulation
for curing cancer.”' As no one could predict the possibility of existence
of polymorphism in Imatinib Mesylate and as there was no motivation
in the prior art for an uninventive man to try for finding out different
‘polymorphic forms and their relative properties, suitable for preparing
for solid dosage formulation for cancer treatment drug, the Appellate
Board concluded that the Beta Crystalline form of Imatinib Mesylate
possessed inventive step.”
The Appellate Board then discussed about selection patent, which
is a patent granted to a compound that is selected from a group having
certain characteristics and that shows unexpected results.” It laid down
certain minimum requirements that may be considered before granting a
selection patent, which are:
(1) Whether there is any statement in the specification indicating that
the nature of the invention concerns some kind of selection;
is already
(2) Whether the selection is from a class of substances which
generally known;
(3) Whether the selected substance is new;
ention
(4) Whether the selection isa result of any research by human interv
and ingenuity opposed to mere verifications;
and,
(5) Whether the selection is unexpected or unpredictable;
substance possesses any unexpected and
(6) Whether the selected
advantageous property.’ .
different salt forms
As Imatinib Mesylate was selected from a group of
of the compound
cited in the prior art and as the Beta Crystalline form
late Board stated that
had surprising and unpredictable results, the Appel
considered to satisfy
the compound in the patent application might be
t.”
requirements for grant of a selection paten
tability of Imatinib
The Appellate Board then analysed the paten
It started its analysis by
Mesylate under Section 3(d) of the Patents Act.
High Court, which opined
citing the definition of efficacy of the Madras
in healing a disease or having
that efficacy means a therapeutic effect
e Board then observed ope
a good effect on the body.” The Appellat
advantageous property of a drug.
therapeutic efficacy is different from
 86 INDIAN PATENT LAW AND PRACTICE

As per Section 3(d) and its explanation, the Appellate Board stated that
Imatinib Mesylate is a salt form of Imatinib, which was already known
and would not be patentable unless it showed increased efficacy than
Imatinib.”* Though the Beta Crystalline form of Imatinib Masylate had
increased bio-availability, the Appellate Board pointed out that it would
not be sufficient to satisfy the efficacy requirement.”” Furthermore,
the Appellate Board stated that though physical properties such as
improved thermodynamic stability, improved flow properties, and
lower hygroscopicity were important to formulate the active ingredients
in solid dosage forms such as capsules, tablets, and so on, they had no
contribution to actual therapeutic efficacy of the compound.” As the Beta
Crystalline form of Imatinib Mesylate did not Possess any improvement
in the therapeutic effect of Imatinib for treatment of cancer, the Appellate
Board held that the compound fell within the scope of Section
3(d) and
was, therefore, not patentable.
In the light of its analysis, though, Imatinib Mesylate
satisfied the
requirements of industrial applicability, novelty, and invent
ive step, the
Appellate Board held that compound was not patentable
as it fell within
the scope of ineligible inventions under Section 3 of
the Patents Act.
UCB Farchim SA v. M/s Cipla Limited and Ors
Writ petitions were filed by Ucb Farchim, Colo
rcon, Yeda Research &
Development, and Eli Lilly against the orde
r of the Controller rejecting
their patent applications based on pre-
grant representations filed by
various companies. After consolidating the
writ petitions, the Delhi High
Court held that an applicant aggrieved by
the rejection of his application
by the Controller, based on a pre-grant
representation, may file an appeal
to the Intellectual Property Appellate
Board (IPAB). As per the Court,
a rejection by the Controller based
on a pre-grant representation under
Section 25(1) would be a decision
under Section 15 of the Patents Act
and, therefore, may be appealed to
the IPAB under Section 1 17A, though
the said section does not specify Sec
tion 25(1) among the list of sectio
from which an appeal is possible ns
.
After analysing the relevant
sections, the court divided appeal
pre-grant representations int s from
o two categories:
i. Appeals from rejection
of pre-grant representation;
ii. Appeals from rejection and,
of a Patent application bas
representation.”*! ed on pre-grant
With respect to appeals from
the rejection of a pre-grant rep
filed by any person under Sec resentation
tion 25(1), the court stated
that it may
 PATENT PROCEDURE 87

entertain an appeal under Article 226 of the Constitution.” However,

with respect to the second scenario, where the Controller rejects an
application based on a pre-grant representation, the court stated that
such a rejection is in effect a rejection under Section 15 of the Act and,
therefore, an appeal would lie to the IPAB under 117A because the
said section provides for such an appeal.*** While stating so, the court
observed that a rejection based on pre-grant representation under Section
25(1) would be considered as a rejection under Section 15 because a
pre-grant representation is considered as an opportunity given to the
general public in order to aid the Controller in the examination process,
and the Controller would have the discretion to accept or reject the
pre-grant representation. Therefore, though Section 25(1) is not listed
among the sections from which an appeal is possible to the IPAB under
Section 117A, the court stated that an appeal would be possible in case
of rejection of application under Section 15, which is listed as appealable
under the section. In the light of its decision, the court allowed the
patent applicants (petitioners), whose applications have been rejected
based on pre-grant representation to file an appeal with IPAB within two
weeks.”*°

3.7.4 Case Notes

Any decision given by the Controller of Patents must be a speaking order.
It must clearly state and indicate the reasons based on which the decision
has been made. The Controller must follow principles of natural justice
before making a decision that is adverse to the applicant. In a response to
the examination report of the Controller, if the patent applicant requests
for a hearing before rejection of the application, the Controller has to give
the applicant an opportunity of hearing before refusing the application.

3.7.5 Appeals from Appellate Board

A decision of the Appellate Board is appealable to the Supreme Court only
through a special leave petition.”* The constitutional validity of such a
decision may also be questioned by the High Court or Supreme Court by
invoking their writ jurisdiction.” The decisions of the Appellate Board
are otherwise final and not appealable in any other manner.

3.7.6 Timeline Table

Indian
Table 3.2 provides the timelines for taking necessary action at the
Patent Office.
88 INDIAN PATENT LAW AND PRACTICE

Table 3.2 Timeline for Taking Necessary Action at the Indian Patent Office

Application
Particulars Timeline
Complete Application Within twelve months of the provisional
application
Convention Application Within twelve months of Filing the application in
the convention country
Publication of Application Within eighteen months from filing of application
Declaration of Inventorship Along with Complete Specification extendable to
within one month of filing complete specification
Post-dating of the Application Up to six months from the original filing date of
the application
Foreign Filing of the Application After six weeks from the Indian filing (if no secrecy
directions are given) or after written permission
Examination
Request for Examination Within 48 months of filing or priority date, which
ever is earlier
Examination of PCT National Phase After 31 months from the date of priority of PCT
Application application
Request for Examination in Case of Within six month of filing of divisional application
Divisional Application
Application in Order for Grant Within twelve months of receiving the FER
Request for Hearing before Adverse At least ten days before the expiry of time limit for
Decision the action
Opposition
Pre-grant Opposition Application Within six month of publication
Post-grant Opposition Application Within one year of grant of Patent
Notice of Opposition to be Sent to Within one month of receipt of such notice
the Applicant by the Controller
Reply to the Notice of Opposition Within 60 days of receipt of such notice
Appeal
Period of Filing the Appeal to the Within 3 months from the decision,
order
Appellate Board against the Order or or
direction of the Controller or the Centra
Decision of the Controller l
Government or within such further
time as the
Appellate Board may allow
Review
Application to Controller for Review With
in | month from the decision or orde
of an order r of the
Controller
—_—
— —..
_ .. _
.. ~—4eeee
 PATENT PROCEDURE 89

3.7.7 Extension of Timelines

The timelines prescribed under the Patent Rules may be extended by the
Controller on a request made by the patent holder or patent applicant.”
Such a request must be made before the expiry of the timeline under the
Rules.”*? However, the period for putting the application in order for grant
under Rule 24B(4), Pre-grant Opposition under Rule 55, and extension
of period for payment of renewal fee under Section 80(1A), cannot be
extended beyond the timelines specified in the said Rules.”

NOTES
. Section 6(1)(a), Indian Patent Act, 1970.
.Ibid., at Para 6.
.Section 6(1)(b), Indian Patent Act, 1970.
.Section 2(1)(s), The Patents Act, 1970.
_Section 7(2), The Patents Act, 1970 and Rule 10, The Patent Rules, 2003.
.Section 6(1)(c), Indian Patent Act, 1970.
.Section 6(2), Indian Patent Act, 1970.
_Sections 133 and 134, The Patents Act, 1970.
WD
NP
© Section 134(a), Indian Patent Act, 1970.
ONDA
. Section 134(b), Indian Patent Act, 1970.
. Section 20(1), Indian Patent Act, 1970.
. Ibid.
. Section 20(2), Indian Patent Act, 1970.
CO"
WnNre
—|—
SS

. Section 20(4), Indian Patent Act, 1970.

. Ibid.
. Section 20(5), Indian Patent Act, 1970.
. Ibid.
_ Sections 7(1) and 10(5), The Patents Act, 1970.
. Rule 4, The Patent Rules, 2003.
— CONAN

. Rule 9, ibid.
_ Section 7(4), The Patents Act, 1970.
. Section 9(1), The Patents Act, 1970.
WNW
WY
© _ Section 9(2), The Patents Act, 1970.
nNe

24. Section 9(3), The Patents Act, 1970.

General of Patents,
25. Circular No. 12 issuedon 26.6.2009 by Controller
ic.in/OfficeCircular /Circular_
Designs & Trademarks http://www.patentoffice.n
2010).
12_ 26June2009.pdf (last accessed on 11 April
26. Section 10(6), The Patents Act, 1970.
;
27. Rule 13(6), The Patent Rules, 2003.
http://www.patentoffice.nic.
28 Patent Office Procedure (POP), 2009, p. 7; on 11
edure_2009.pdf (last accessed
in/PatentOfficeProcedure/ PatentOfficeProc
April 2010).
29. Ibid.
 90 INDIAN PATENT LAW AND PRACTICE

30. Section 135, The Patents Act, 1970.

31. Section 133, The Patents Act, 1970.
32. Section 135(1), The Patents Act, 1970.
33. Draft Manual of Patent Practice and Procedure, 2008 at Para 5.3.4
citing decision of the Controller in International Chemical Company Limited
(Applicant) for application No. 912/Cal/81.
34. Draft Manual of Patent Practice and Procedure, 2008 at Para 5.3.5 citing
the case of application No 986/Cal/79.
35. Ibid.
36. Section 135(2), The Patents Act, 1970.
37. Section 136(1), The Patents Act, 1970.
39. Ibid.
39. Section 138(1), The Patents Act, 1970.
40. Section 138(4), The Patents Act, 1970.
41. Ibid.
42. Section 138(5), The Patents Act, 1970.
43. Section 138(6), The Patents Act, 1970.
44. Rule 20(4), The Patent Rules, 2003.
45. Section 16(1), The Patents Act, 1970.
46. Ibid.
47. Section 16(2), ibid.
48. Rule 13(2), The Patent Rules, 2003.
49. Rule 13(3), The Patent Rules, 2003.
50. Section 11(1), The Patents Act, 1970. Section
11(1) reads as follows:
‘There shall be a priority date for each claim of a compl
ete specification:
51. Section 11(2), The Patents Act, 1970.
Section 11(2) reads as
follows:
‘Where a complete specification is filed in pursu
ance of a single application
accompanied by:
(a) a provisional specification; or
(b) a specification which is treated by
virtue of a direction under sub-Section
(3) of Section 9 as a provisional specification, and the claim is fairly based on
matter disclosed in the specification refer the
red to in clause (a) or clause (b), the
Priority date of that claim shall be the
date of filing of the relevant specification:
52. Section 11(5) , The Patents Act, 1970. Section
11(5) reads as follows:
Where, under the foregoing provisions
of this section, any claim of a complete
specification would, but for
the provisions of this sub-section,
pea dates, the priority date of that have two or more
claim shall be the earlier or earliest
ates. of those
53. Section 9(4), ibid.
54. Section 17(1), ibid.
55. Ibid.
56. Ibid.
57. Section 8(1)(a), ibid.
 PATENT PROCEDURE 91

58. Rule 12(2), The Patent Rules, 2003.

59. Section 8(1)(b), The Patents Act, 1970 and Rule 12(1), The Patent Rules,
2003.
60. Rule 12(1A), The Patent Rules, 2003.
61. Section 8(2), The Patents Act, 1970
62. Rule 12(3), The Patent Rules, 2003.
63. Section 39(1), The Patents Act, 1970. Section 39 (1) reads as follows: ‘No
person resident in India shall, except under the authority of a written permit
sought in the manner prescribed and granted by or on behalf of the Controller,
make or cause to be made any application outside India for the grant of a patent
for an invention unless:
(a) an application for a patent for the same invention has been made in India,
not less than six weeks before the application outside India; and
(b) either no direction has been given under sub-Section (1) of section in
relation to the application in India, or all such directions have been revoked’
64. Ibid.
65. Section 39(2), The Patents Act, 1970.
66. Rule 17(1), The Patent Rules, 2003.
67. Rule 71(2), The Patent Rules, 2003.
68. Section 118, The Patents Act, 1970.
69. Section 64(1) (n), The Patents Act, 1970.
70. Section 11B(1), The Patents Act, 1970 as amended in 1999, 2002, and
2005 and Rule 24B(1), The Patent Rules, 2003 as last amended in 2005.
71. Ibid.
72. Section 11B(4)(b), The Patents Act, 1970.
73. Section 11B(1), The Patents Act, 1970 as amended in 1999, 2002 and 2005
and Rule 24B(1)(v), The Patent Rules, 2003 as last amended in 2006 and Section
11B(3), The Patens Act, 1970 as amended in 1999 and 2002.
74. Rule 24(B)(iv), The Patent Rules, 2003.
75. Section 11B(4), The Patents Act, 1970.
76. Section 11B(4)(a), The Patents Act, 1970.
77. Section 12(1), The Patents Act, 1970 as amended in 1999, 2002 and 2005
and Rule 24B(1)(I), The Patent Rules, 2003.
78. Section 12(1), The Patents Act, 1970.
79. Rule 24B(1)(II), The Patent Rules, 2003.
80. Rule 24B(1)(III), The Patent Rules, 2003.
81. Section 144, The Patents Act, 1970.
82. Ibid.
83. Rule 24B(3), The Patent Rules, 2003.
issued on 19
84. Patent Office Procedure (POP), 2009, p. 16, Public Notice
Available at
June 2009 by Controller General of Patents, Designs & Trademarks.
(last accessed
http://ipindia.nic.in/OfficeCircular/public_notice_19June2009.pdf
on 9 April 2010).
92 INDIAN PATENT LAW AND PRACTICE

85. Ibid.
86. Section 21, The Patents Act, 1970.
87. Section 14, The Patents Act, 1970.
88. Draft Manual of Patent Practice and Procedure at Para 6.2.6 citing Section
12 (1)(a), The Patents Act, 1970, as last amended in 2005.
89. Section 15, The Patents Act, 1970.
90. Section 21, The Patents Act, 1970.
91 Patent Office Procedure (POP), 2009, p. 16. Available at http://www.patent
office.nic.in/PatentOfficeProcedure/PatentOfficeProcedure_2009.pdf (last
accessed on 11 April 2010).
92. Rule 28(3), The Patent Rules, 2003 as last amended in 2005.
93. Ibid.
94. Section 80, The Patents Act, 1970.
95. Rule 28(4), The Patent Rules, 2003 as last amended in 2005.
96. Rule 28(5), The Patent Rules, 2003 as last amended in 2005.
97. Rule 139, The Patent Rules, 2003 as last amended in 2005.
98. Section 11B(4)(i), The Patents Act, 1970, as amended in 1999, 2002, and
2005 and Rule 26, The Patent Rules, 2003.
99. Section 11A(1), The Patents Act, 1970.
100. Rule 24, The Patent Rules, 2003.
101. Section 11A(2), The Patents Act, 1970.
102. Section 11A(3), The Patents Act, 1970.
103. Section 11A(4), The Patents Act, 1970.
104. Section 11A(5), The Patents Act, 1970.
105. Section 11A(6), The Patents Act, 1970.
106. Section 11A(7), The Patents Act, 1970.
107. Ibid.
108. Section 25(1), The Patents Act, 1970.
109. Ibid.
110. Rule 55(1A), The Patent Rules, 2003..
111. Section 25(1)(a), The Patents Act, 1970.
112. Section 26(1), The Patents Act, 1970.
113. Section 25(1)(b-e), The Patents Act, 1970.
114. Section 25(1)(f), The Patents Act,
1970.
115. Section 25(1)(g), The Patents Act, 1970.
116. Section 25(1)(h), The Patents Act, 1970.
117. Section 25(1)(i), The Patents Act, 1970.
118. Section 25(1)(j), The Patents Act, 1970.
119. Section 25(1)(k), The Patents Act, 1970.
120. Rule 55(1), The Patent Rules,
2003.
121. Ibid.
122. Rule 55(2), The Patent Rules,
2003.
123. Rule 55(3), The Patent Rules, 2003.
 PATENT PROCEDURE 93

124. Rule 55(4), The Patent Rules, 2003.

125. Rule 55(5), The Patent Rules, 2003.
126. Rule 55(6), The Patent Rules, 2003.
127. Draft Manual of Patent Practice and Procedure, 2008 at Para 7.1.3.
128. Ibid., at Paras 1 and 2.
129. Ibid., at Para 4.
130. Ibid., at Para 7.
131. Ibid., at Para 10.
132. Ibid., at Para 68.
133. Ibid., at Para 69.
134. Section 43, The Patents Act, 1970.
135. Patent Office Procedure (POP), 2009, p. 16. Available at http://www.
patent office.nic.in/PatentOfficeProcedure/PatentOfficeProcedure_2009.pdf
(last accessed on 11 April 2010).
136. Section 43(2), The Patents Act, 1970.
137. Section 45(1), The Patents Act, 1970.
138. Section 13(4), The Patents Act, 1970.
139. Ibid.
140. Section 25(2), The Patents Act, 1970.
141. Section 2(1)(t), The Patents Act, 1970.
142. Section 25(2), The Patents Act, 1970.
143. Ibid.
144. Rule 55A, The Patent Rules, 2003.
145. Rule 57, The Patent Rules, 2003.
146. Ibid.
147. Ibid.
148. Section 150, The Patents Act, 1970.
149. Section 25(3)(a), The Patents Act, 1970 as amended in 1999, 2002, and
2005, and Rule 56 and 57, The Patent Rules, 2003.
150. Rule 58(1), The Patent Rules, 2003.
151. Ibid.
152. Rule 58(2), The Patent Rules, 2003.
153. Rule 59, The Patent Rules, 2003.
and
154. Section 25(3)(b), The Patents Act, 1970 as amended in 1999, 2002,
2005, and Rule 56(1), The Patent Rules, 2003.
155. Rule 56(2), The Patent Rules, 2003.
156. Rule 56(3), The Patent Rules, 2003.
157. Rule 56(1), The Patent Rules, 2003.
158. Section 25(4), The Patents Act, 1970.
159. Rule 62(1), The Patent Rules, 2003.
160. Ibid.
161. Rule 62(1), The Patent Rules, 2003.
162. Rule 62(2), The Patent Rules, 2003.
94 INDIAN PATENT LAW AND PRACTICE

163. Rule 62(3), The Patent Rules, 2003.

164. Rule 62(5), The Patent Rules, 2003.
165. Rule 62(2), The Patent Rules, 2003.
166. Rule 62(5), The Patent Rules, 2003.
167. Rule 63, The Patent Rules, 2003.
168. Draft Manual of Patent Practice and Procedure, 2008 at Para 7.2.4 citing
the matter of Patent No.187163, (581/BOM/1999).
169. Draft Manual of Patent Practice and Procedure, 2008 at Para 7.2.5 citing
the matter of Patent No.173953 (223/BOM/1991).
170. Draft Manual of Patent Practice and Procedure, 2008 at Para 7.2.6 citing
the matter of Patent No.- 183458 (454/BOM/1998).
171. Draft Manual of Patent Practice and Procedure, 2008 at para 7.2.11
citing Rickett & Colman of India Limited v. Godrej Hi Care Limited, (2001 PTC
637 (PO).
172. Section 77(1), The Patents Act, 1970.
173. Section 77(1)(f), The Patents Act, 1970.
174. Rule 130, The Patents Rules, 2003 as amended in 2006.
175. Ibid.
176. Section 117A(2), The Patents Act, 1970.
177. Section 117A(1), The Patents Act, 1970.
178. Section 117D(2), The Patents Act, 1970.
179. The Gazette of India Extra-ordinary Part II-Section 3-Sub-section (ii),
published by authority No. 354, New Delhi, Tuesday, April 3, 2007/Chaitra 13,
1929, Ministry of Commerce and Industry (Department of Industrial Policy
and
Promotion), Registered No. D.L.-33004/99.
180. Section 117G, The Patents Act, 1970.
181. Section 116(1), The Patents Act, 1970.
182. Section 84(1), Trademarks Act, 1999,
183. Section 84(2), Trademarks Act, 1999.
184. Section 116(2), The Patents Act, 1970.
185. Section 117A(4), The Patents Act, 1970.
186. Section 117H, The Patents Act, 1970.
187. Section 92(1), Trademarks Act, 1999,
188. Section 92(2), Trademarks Act, 1999.
189. Section 92(3), Trademarks Act, 1999.
190. Section 84(6), Trademarks Act, 1999.
191. Ibid., at Para 3.
192. Ibid., at Para 4,
193. Ibid., at Para 5.
194. Ibid., at Para 5.
195. Ibid., at Para 7.
196. Ibid., at Para 23.
197. Ibid.
 PATENT PROCEDURE 95

198. Ibid.
199. Ibid.
200. Ibid., at Para 7.
201. Ibid., at Para 2.
202. Ibid., at Para 2.
203. Ibid.
204. Ibid.
205. Ibid., at Para 3.
206. Ibid.
207. Ibid.
208. Ibid., at Para 28.
209. Ibid.
210. Ibid., at Para 2.
211. Ibid.
212. Ibid.
213. Ibid., at Paras 5-8.
214. Ibid.
215. Ibid., at Para 8.
216. Ibid., at Para 9
217. Ibid., at Para 10.
218. Ibid., Para 16.
219. Ibid.
220. Ibid., at Para 2.
221. Ibid., at Para 2.
222. Ibid., at Para 3.
223. Ibid.
224. Ibid.
aS. Ibid., at Para 4.
226. Ibid., at Para 12.
754 Ibid., at Para 1.
228. Ibid.
229. Ibid.
230. Ibid.
pai. Ibid.
232. Ibid., at Para 8.
233. Ibid.
234. Ibid., at Para 2.
235. Ibid.
236. Ibid.
237. Ibid.
238. Ibid.
239. Ibid.
240. Ibid.
96 INDIAN PATENT LAW AND PRACTICE

241. Ibid., at Para 3.

242. Ibid., at Para 18.
243. Ibid., at Para 20.
244. Ibid.
245. Ibid.
246. Ibid., at Para 2.
247. Ibid., at Para 3.
248. Ibid.
249. Ibid.
250. Ibid.
251. Ibid., at Para 14.
252. Ibid., at Para 13.
253. Ibid., at Para 11.
254. Ibid., at Para 15.
255. Ibid., at Para 2.
256. Ibid., at Para 3.
257. Ibid.
258. Ibid.
259. Ibid.
260. Ibid., at Para 3.
261. Ibid.
262. Ibid.
263. Ibid.
264. Ibid., at Para 10.
265. Ibid.
266. Ibid., at Para 10(ii)
267. Ibid.
268. Ibid.
269. Ibid.
270. Ibid., at Para 10(iii)
271. Ibid.
272. Ibid.
273. Ibid., at Para 10(iv)
274. Ibid.
275. Ibid.
276. Ibid., at Para 10(v)
277. Ibid.
278: Ibid.
279. Ibid.
280. Ibid.
281. Ibid., at Paras 21 and 22.
282. Ibid., at Para 21.
283. Ibid., at Para 22.
 PATENT PROCEDURE 97

284. Ibid.
285. Ibid., at Paras 24—44.
286. Article 136, Constitution of India.
287. Article 32 and Article 226, Constitution of India.
288. Rule 139(1), The Patent Rules, 2003.
289. Rule 139(2), The Patent Rules, 2003.
290. Rule 139(1), The Patent Rules, 2003.
 +
Patent Amendment and Maintenance

4.1 AMENDMENT OF A PATENT

patent application, granted patent, or any other
document, may
A amended by the applicant or the patent holder
at any point of
time during the patent lifecycle by filing an applicatio
n for amendment.'
The amendment will not be allowed if an infri
ngement or revocation
proceeding relating to the patent or patent appli
cation is pending before
a court or the Appellate Board.
The application for amendment of a patent,
or patent application, or
any other document, must be filed in Form
13 (See Appendix II A).? While
filing an application for amendment, the
patent holder or the applicant
must state the nature of the Proposed amendment
such amendment.‘ The amendment and the reasons for
will be allowed only if the Controller
is satisfied with the reasons for the
amendment.
An application for amendment that
is filed after the patent is granted
will be published if the Proposed amendm
ent is aimed at altering the
 PATENT AMENDMENT AND MAINTENANCE 99

On receiving a notice of opposition to the amendment, the Controller

will notify the same to the patent holder or the patent applicant, and will
decide the case after giving an opportunity of being heard to the parties.*
The process relating to notice of opposition, written statement, evidence,
and hearing that is followed for opposition of a patent grant, will be
followed for opposition procedure for amendment also.” The Controller
may allow any amendment of a patent application as requested or may
subject the amendment to certain conditions he deems fit."®

4.1.1 Amendment Before High Court or Appellate Board

The high court or the Appellate Board may allow the amendment of a
patent when a revocation proceeding is pending before it.'' In such a case,
the high court or the Appellate Board may impose conditions relating to
costs, advertisement, and so on, while allowing such an amendment.””
If a high court or the Appellate Board decides that a patent is invalid, it
may allow the patent holder to amend the patent in order to avoid the
invalidity instead of revoking the patent.'’ For example, if a high court
holds a claim of a patent to be invalid in the light of prior art, the applicant
may amend the claim in order to avoid the prior art.
On filing an application for amendment before a high court or
Appellate Board, the applicant must inform the Controller.'* After being
informed, the Controller will get an opportunity of being heard by the
high court or the Appellate Board before a decision on the amendment
is made.'® After allowing an amendment, the high court or the Appellate
Board will communicate the order of amendment to the Controller, who
will make an entry regarding the amendment in the patent register.'°

4.1.2 Scope of Amendment

ent,
The patent application, complete specification, or any other docum
correction,
can be amended only if it is in the form of a disclaimer,
if it relates
or explanation.” The amendment will be accepted only
a complete
to incorporation of an actual fact.'* Any amendment of
disclosure
specification or claim must fall within the scope of the initial
is not present in the
in the specification.'” Addition of new material that
may also relate to
initial disclosure will not be allowed. The amendment
the priority of the patent application.”
cation, specification,
Once an amendment is made, the amended appli
applicant for amendment
or other documents, must be submitted by the
be deemed to form part of
to the Controller.’ The amendment will
s.” Once submitted to the
the specification along with other document
 100 INDIAN PATENT LAW AND PRACTICE

Controller, the fact of amendment of the specification or any other

document will be published expeditiously.” The right of the applicant
or patentee to make an amendment cannot be questioned based on any
ground except fraud. “

4.1.3 Study of Relevant Cases

AGC Flat Glass Europe SA v. Anand Mahajan and Ors
The patent holder in the case, AGC Flat Glass Europe SA (AGC),
acquired a patent relating to a mirror with no copper layer and process
for manufacturing the same.» AGC filed a suit against Anand Mahajan
and others (Anand) stating that Anand’s mirrors infringe its patent.”* In
response, Anand claimed patent invalidity based on anticipation in the
light of prior art.” After reviewing the prior art, AGC filed an application
before the court for amending a claim in the patent.*
The relevant portion of the claim proposed to be amended by AGC
read as follows:
1. A Mirror with no copper layer comprising:
i) a vitreous substance,
ii) at least one material selected from the group consisting
of bismuth, chromium,
gold, indium, nickel, palladium, platinum, rhodium, ruthen
ium, titanium, vanadium
and zinc at the surface of the said substrate, ...”

AGC proposed to amend the claim to insert ‘a

sensitizing material,
typically tin’ in Clause (ii) of the claim. After revie
wing the application
of AGC, the court allowed the amendment in the
form of a clarification
or disclaimer.
The court started its analysis by stating that
an amendment made to
Overcome an objection based on prior publ
ication would be acceptable
only if it overcomes the said objection.
*' It pointed out that the
amendment would not be acceptable if the
patent holder was aware of the
publication for a long period of time befo
re applying for the amendment.”
Furthermore, the court stated that an
amendment having the effect of
converting a non-essential element
into an essential element would not
be allowed.” It went on to observe
that amendments which limit the
scope of the specification to a sub-
combination, which was within
original claim, would be a disclaimer the
that might be allowed.
As per the court, the absence of
an additional claim in the origin
document to the sub-combination al
would not by itself be a reason
refusing an amendment.* Fur for
thermore, in the court's view,
holder who had chosen to mak a pat ent
e his claim in a wide and Swe
eping form
 PATENT AMENDMENT AND MAINTENANCE 101

and who has had the advantage of the claim stated in that form for some
years, might not be allowed to limit his claim by amendment to make
his patent more secure.** In a situation where a patent holder knew the
defect in the specification and did not seek to amend the specification but
successfully insisted on retaining it in its original form, the court pointed
out that it might be a ground for rejecting an amendmentata considerably
later date, when the validity of the patent was attacked by proceedings for
revocation.” Further, where there was no evidence to indicate either that
the patent holder was aware of the defect in his specification or that he
made use of an unjustified monopoly resulting from the defect to seek
undue advantage from his competitors, the court stated that it might not
refuse an amendment.”
Considering the provisions under the Patents Act, the court stated
that the claims in a patent can be amended before the High Court when a
plea for revocation is raised provided that the amendment is clarificatory
or elaborative in nature, and does not alter the scope of the claim or
introduce any new claim in the invention which was not present in the
original invention.” It then stated that the scope of enquiry in relation
to amendments in the patent claim would be limited to the extent as
to whether it introduces any new claim which extends the scope of the
monopoly rights of the patent holder.” According to the court, the patent
holder might disclaim a portion of his invention by narrowing down or
crystallizing the claims and apportioning the claims which are irrelevant,
and ultimately make a claim narrow and limit the scope of the patent."
Disclaimer, as per the court, means that a right holder is delimiting the
scope of the invention by narrowing down the claims to its inconvenience,
the
in a way which makes the amended claims not inconsistent with
earlier claims in the original specification.”
to be
After going through the specification of the patent, sought
d upon a
amended by AGC, the court observed that the invention worke
three step process, which includes:
1. Sensitizing process;
2. Activating process; and,
3. Silvering process.”
ial, typically tin’
As the addition of the five words ‘a sensitizing mater
invention and did not in
in the claim, related to the first process of the
the court stated that the
any way lie outside the scope of the invention,
The court stated that the
amendment by AGC is a clarificatory one.“
of the invention in the
amendment to the claim falls within the scope
understood on reading claim 1 with
specification, which could be clearly
 102 INDIAN PATENT LAW AND PRACTICE

claim 9 of the patent.*° In the light of its analysis, the court held that the
amendment proposed by AGC was merely a clarificatory, or elaborative
one, or a disclaimer, and does not alter the scope of the invention and,
therefore, would be allowed.” It stated that the decision on whether it is a
clarification or disclaimer would be made at a later stage.*”
The court went on to state that it would not go into merits of whether
the amendment brings tin, which was in the public domain, within the
scope of the patent claim as that would be decided while dealing with
the plea of invalidation and not while making a decision on allowing the
amendment.* It further stated that the merit of the case is immaterial and
could not be looked into while considering an application for amend-
ment. As per the court, the correctness and falsity of the amendment
could not also be visited at the stage of deciding on allowance of the
amendment.”

Secretary, Department of Atomic Energy, Government of India v. The

Controller General of Patents, Designs and Trademarks and Ors
The petitioner, the Department of Atomic Energy, acquired a patent for a
process of treating exhaust gas emission, produced during the combustion
of coal in a coal combustion plant, for reducing suspended particul
ate
matter.” The patent was opposed after its grant and the petitioner filed
an
application for amendment of the patent. The Respondent, Control
ler of
Patents, decided to hear the opposition before taking up the
amendment
application filed by the petitioner.®? Therefore, the petitio
ner filed a writ
petition before the High Court of Kolkata praying for orders
directing
the Controller to deal with the amendment application
before hearing
the opposition.
After reviewing the facts of the case, the court
directed the Controller
to refrain from hearing the Opposition until
the petitioner's appeal
regarding the amendment is decided. It stayed
the opposition hearing for
a period of eight weeks or until the amendmen
t issue is heard, whichever
is earlier, and stated that the Controller may
proceed with the opposition
if the petitioner failed to convince the Appe
llate Board regarding the
amendment of the patent.°®

4.1.4 Correction of Clerical Errors

Any clerical errors in a patent, patent appl
ication, specification, or any
other document, may be corrected by
the Controller. Such correction
may be made by the Controller on his
own accord or in furtherance of a
request made by an interested person.’
If the Controller decides to make
 PATENT AMENDMENT AND MAINTENANCE 103

a correction on his own initiative, he will give a notice to the patent holder
or patent applicant, or any other relevant person about the proposed
correction.» The Controller will finally decide on the correction only
after giving an opportunity of being heard to the parties.”
On receiving a request for correction from an interested person, the
Controller will review the material nature of the proposed correction.
The Controller will publish the proposed correction if he believes that
the correction will materially alter the meaning or scope of the document
in which correction is proposed.® If the correction is material, the
applicant for correction will be required to send copies of his application
to persons deemed by the Controller as interested in the patent or patent
application.*
Any person may oppose the correction by filing a notice of
opposition after publication of the request for correction.” Such notice
of opposition must be filed in Form 14 within three months from the
date of publication.® On receiving such a notice, the Controller will
notify the applicant for correction about the notice and will decide on the
correction after giving an opportunity of being heard.“ The procedure
for filing notice, written statement, evidence, and hearing, will be same as
the procedure for opposition to grant of a patent.* On acceptance of the
correction requested, the correction will be made in the document and
the applicant for correction and the opponent will be notified.

4.1.5 Amendment by Controller's Permission

The Controller may permit any person to amend any document or correct
any procedural irregularity for which no special provision exists under the
Patents Act.” Such an amendment or correction may be permitted only if
it is not detrimental to the interests of any person. Such an amendment
or correction must be made in accordance with the terms deemed fit by
the Controller.”

4.2 PATENT OF ADDITION

A patent of addition is granted for an improvement or modification of an
invention, which is the subject ofa patent application or a granted patent.””
An application for a patent of addition may be filed by the applicant or
patent holder of the main or parent invention.” For example, if X holds a
patent over a ceiling fan and makes an improvement in the design of the
ment.
wings of the fan, X can file for a patent of addition over the improve
n may
A patent relating to an improvement of another patented inventio
a patent over
be granted as a patent of addition, if the patent holder holds
 104 INDIAN PATENT LAW AND PRACTICE

the main invention and also the improvement.” In such a case, the patent
over the improvement will be revoked before it is granted as a patent of
addition.”? For example, if X holds two patents, one over a fan and the
second one with respect to an improved design of its wings, a patent of
addition may be granted with respect to the improved design of the wings
after revoking the independent patent relating to it. In such a case, the
patent of addition will be an addition to the patent over the fan.

4.2.1 Conditions for Grant

In order to be granted as a patent of addition, the patent application
relating to the improvement must be filed on or after the date of filing
of the patent application for the main invention.” Specific reference has
to be given to the patent or application relating to the main invention in
an application for patent of addition and it must be stated clearly in the
specification that the invention claimed is an improvement over the main
invention.” The patent of addition will be granted only after the patent
over the main invention is granted.”°
A patent of addition will be granted over an improvement of an
invention, if the improvement satisfies the requirement of novelty in
the light of prior art.” The main invention from which improvement is
made will also be considered to be part of the prior art for determining
novelty of the improvement. However, an improvement need not have an
inventive step in the light of any publication, or use of the main invention,
or its improvement for the grant of a patent of addition.”* For example, if
X acquires a patent over an ergonomic chair and makes an improvement
to the arm rest, a patent of addition will be granted only if the arm rest
is novel in the light of prior art, including the arm rest of the patented
ergonomic chair. However, the improved arm rest need not
satisfy the
requirement of inventive step in the light of the use of the ergonomic
chair for grant of a patent of addition. A patent of addition
will be granted
on the request by the applicant even if the improvement
claimed in the
application is eligible for an independent patent. For example,
taking the
facts in the previous example, a patent of addition will
be granted over
the improved arm rest even if the arm rest satisfies
the requirement of
novelty and inventive step, and is eligible for an
independent patent.
4.2.2 Term
The term of a patent of addition shall last
fo r the term of the patent over
the main invention.” As a patent of addition is grant
ed after the grant
of the patent over the main invention, its term is gener
ally less than the
 PATENT AMENDMENT AND MAINTENANCE 105

term of patent of the main invention. A patent of addition will expire

on the expiry of the term of the main patent.*° If the patent over the
main invention is revoked, the patent of addition will continue as an
independent patent for the rest of the term of the main patent." Renewal
fee need not be paid separately in order to keep the patent of addition
alive during the term of the patent.*? Payment of renewal fee for the main
patent is sufficient to keep a patent of addition alive. However, if the main
patent is revoked, the renewal fee must be paid for the patent of addition
as an independent patent.*

4.3 PATENT MAINTENANCE

The patent holder has to maintain his patent in order to keep it alive
during the patent term. Maintenance of a patent includes payment of
renewal fee and filing of working of patent statement at regular intervals.
Not complying with the renewal or working of patent requirements under
the Act may result in lapse or revocation of the patent.

4.3.1 Patent Renewal

The term of every patent that is granted on or after 20 May 2003, or that
has not expired on the said date, is twenty years from the date of filing of
the patent." The patent holder has to pay renewal fee at regular intervals
in order to keep his patent alive. The renewal fee has to be paid before
the expiry of two years from the date of patent filing and before the end
of every subsequent year from that date.* For example, if X files a patent
application on 4 July 2006 and the patent is granted on 5 June 2008, the
renewal fee must be paid on or before 3 July 2008. The table relating to
renewal fee provided in the Appendices shows the year wise renewal fee
to be paid by a patent holder during the patent term.
The period for payment of renewal fee may be extended by six months
on the request of the patent holder.” The renewal fee that is due for a
patent application, which is granted after two years from the filing date
fee
must be paid within three months from the date of grant.”” The renewal
.”
due for a patent for coming two or more years may be paid in advance
will be
On payment of the renewal fee by the patent holder, an entry
issued by
made in the patent register and a certificate of payment will be
lapse if the
the patent office.” A patent will cease to have effect or will
renewal fee is not paid in time.”

4.3.2. Restoration of Lapsed Patents

renewal fee, the patent
In case a patent lapses due to non-payment of
 106 INDIAN PATENT LAW AND PRACTICE

holder may file an application for restoration of the patent within

eighteen months from the date of lapse.”' The application must be made
in Form 15 and must be accompanied by a verified statement setting out
the circumstances which led to non-payment of the fee.** Any additional
evidence required by the Controller must also be submitted along with
the statement.”
On receiving the application for restoration, the Controller will accept
and publish the application if:
1. The non-payment of renewal fee was not intentional; and,
2. There was no undue delay in making the application for
restoration.”
However, if the applicant has not made out a prima facie case for
restoration, the Controller will refuse the application.*® The Controller
may give a hearing if the applicant makes a request within one month
from the date of such refusal. After hearing the patent holder, the
Controller will publish the application for restoration only if the patent
holder shows a prima facie case that the delay was not intentional and
that there was no undue delay.”
Any interested person may oppose the restoration of the patent by filing
a notice of opposition within two months from the date of publication by
challenging the intention and delay of the patent holder in paying the
renewal fee.”* On receiving the notice, the Controller will decide the case
after informing the patent holder and giving the parties an opportunity
of
being heard.” The procedure followed during opposition regardi
ng filing
of written statement, submission of evidence, hearing the
parties, and so
on, will be followed for hearing the parties.'° On deciding
the application
for restoration in favour of the patent holder, the Control
ler will restore
the patent on payment of the renewal fee and require
d surcharge by the
applicant.'"' The renewal fee and surcharge must
be paid by the patent
holder within one month from the date of the
Controller's decision.'”
4.3.3 No Infringement Action During Lap
se
The patent holder cannot initiate any infr
ingement suit for activities
carried out by any person during the period of
patent lapse.'® After
the patent is restored, certain terms
and conditions may be imposed
for protection and compensation of pers
ons who had started using the
patented invention during the period
of lapse.'™ The court may not grant
damages or account of profits in case
of infringement of a patent during
the period of non-payment of renewa
l fee.'* For example, if X holds a
patent, whose renewal fee is due before
3] December 2008 and X requests
 PATENT AMENDMENT AND MAINTENANCE 107

an extension for payment of the same and finally pays the fee on 31 March
31 2009, damages may not be granted for infringement activities during
1 January 2009 and 30 March 2009.

4.3.4 Statement of Working of Patent

The patent holder or exclusive licensee of a patent must submit a statement
relating to the working of a patent to the Controller at regular intervals.'”°
The statement must be filed in Form 27 (reproduced in Appendix II A)
and must indicate the extent to which the patent has been commercially
worked in India. Details with respect to manufacturing, import,
licensing, or any other manner of commercialization of the patent in
India must be provided in the statement of working. Though the form
requires the extent of commercialization to be quantified, such data may
not be required if quantification is not possible under circumstances
such as cross-licensing, clinical trials in case of pharma patents, bundling
of patents in a single product, and so on. The statement must be filed
for every calendar year within three months from the end of the year.'”*
A person will be liable for a fine of up to ten lakh rupees if he fails to
submit the statement of working of the patent.'” Furthermore, if a person
supplies false information on working of the patent, he will be liable for
imprisonment up to six months and/or fine.''®

4.3.5 Patent Marking

A patent holder must incorporate patent notices on patented products in
order to claim damages from infringers. The patent notice on the product
may either relate to a granted patent or a pending application. The notice
must be conspicuous and must indicate the patent or application number.
A person must not incorporate false patent notices on a product. If a
person incorporates false patent notices on the patented products, he will
be liable for a fine up to one lakh rupees.""'

4.3.6 Patent Register

The Indian patent office maintains a register of patents which contains
information regarding granted patents.''’ The register contains infor-
mation relating to patent holders, amendments, revocation of patents,
assignments or licences, and other relevant information.''’ The Register
is prima facie evidence of any entry made in it.'“ A true copy of the
in
register or parts of the register, certified by the Controller, is admissible
entries
evidence in all legal proceedings.''’ Any person who makes false
the register as
in the register, or produces false writings or entries in
 108 INDIAN PATENT LAW AND PRACTICE

evidence with knowledge that such entries or writings were false, will be
liable for imprisonment up to two years and/or fine."'®
Any person may inspect the register of patents at a convenient time
and acquire a certified copy of the register or any other document
maintained by the patent office.''” Information relating to granted patents
or applications such as date of filing of complete specification, date of
withdrawal, date of examination report, and so on, may be acquired by
filing an application at the patent office.'’*

NOTES
1. Section 57(1), The Patents Act, 1970 as amended in 1999, 2002, and
2005.Section 57(1) reads as follows: ‘Subject to the provisions of Section 59,
the Controller may, upon application made under this section in the prescribed
manner by an applicant for a patent or by a patentee, allow the application for
the patent, or the complete specification, or any document relating thereto, to be
amended subject to such conditions, if any, as the Controller thinks fit?
2. Ibid.
. Rule 81(1), The Patent Rules, 2003.
. Section 57(2), The Patents Act, 1970 as amended in 1999, 2002, and 2005.
. Rule 81(3), The Patent Rules, 2003.
. Section 57(3) and (4), The Patents Act, 1970.
Ibid.
Ibid.
. Rule 81(3), The Patent Rules, 2003.
Sw
CONAN
10. Rule 81(2), The Patent Rules, 2003.
11. Section 58(1), The Patents Act, 1970. Section 58(1) reads as follows: ‘In any
proceeding before the Appellate Board or the High Court for the revocation of a
patent, the Appellate Board or the High Court, as the case may be, may subject
to
the provisions contained in Section 59, allow the patentee to amend his
complete
specification in such manner and subject to such terms as to costs, advertis
ement
or otherwise, as the Appellate Board or the High Court may think
fit, and if in
any proceedings for revocation the Appellate Board or the High
Court decides
that the patent is invalid, it may allow the specification to be amend
ed under this
section instead of revoking the patent?
12. Ibid.
13. Ibid.
14. Section 58(2), The Patents Act, 1970.
15. Ibid.
16. Section 58(3), The Patents Act, 1970.
17. Section 59(1), The Patents Act, 1970. Secti
on 59 (1) reads as follows:
‘No amendment of an application for a paten
t or a complete specification or
any document relating thereto shall be made excep
t by way of disclaimer,
correction or explanation, and no amendment there
of shall be allowed, except
 PATENT AMENDMENT AND MAINTENANCE 109

for the purpose of incorporation of actual fact, and no amendment of a complete

specification shall be allowed, the effect of which would be that the specification
as amended would claim or describe matter not in substance disclosed or shown
in the specification before the amendment, or that any claim of the specification
as amended would not fall wholly within the scope of a claim of the specification
before the amendment:
18. Ibid.
19. Ibid.
20. Section 57(5) and (4), The Patents Act, 1970.
21: Rule 82, The Patent Rules, 2003.
22. Section 59(2), The Patents Act, 1970.
23. Ibid.
24. Ibid.
25. Ibid., at Para 2.
26. Ibid., at Para 4.
27. Ibid., at Para 5.
28. Ibid., at Para 6.
29. Ibid., at Para 3.
30. Ibid., at Para 6.
mA. Ibid., at Para 14.
32. Ibid.
33. Ibid., citing Windsurfing v. Tabur (1985) RPC 59 at 82 (CA).
34.Ibid., citing Baker Perkins Limited’s Application (1958) RPC 267 and
AMP Incorporated v. Hellerman Limited (1962) RPC 55.
35. Ibid.
36. Ibid., at Para 15.
37. Ibid., citing Farbenindustrie A.G’s Patent (1930) 47 RPC 289.
38. Ibid., at Chrome-Alloying Co. Limited v. Metal Diffusions Limited (1962)
RPC 33.
39. Ibid., at Para 17.
40. Ibid.
. Ibid., at Para 18.
. Ibid.
. Ibid., at Para 20.
. Ibid.
. Ibid., at Para 22.
. Ibid., at Para 25.
. Ibid.
. Ibid., at Para 23.
e Limited,
49. Ibid., citing Lakha Ram Sharma v. Balar Marketing Privat
.
MANU/SC/ 0711/2003 : 2003 (27) PTC 175 (SC).
v. K.K. Modi and Ors,
50. Ibid., citing Rajesh Kumar Aggarwal and Ors
MANU/SC/8043/2006 : (2006) 4 SCC 385.
a) Ibid., at Para 1.
 110 INDIAN PATENT LAW AND PRACTICE

52. Ibid.
53. Ibid., at Para 2.
54. Ibid., at Para 39.
55. Ibid., at Para 40.
56. Section 78(1), The Patents Act, 1970. Section 78(1) reads as follows:
‘Without prejudice to the provisions contained in Sections 57 and 59 as regards
amendment of applications for patents or complete specifications or other
documents relating thereto and subject to the provisions of Section 44, the
Controller may, in accordance with the provisions of this section, correct any
clerical error in any patent or in any specification or other document filed in
pursuance of such application or in any application for a patent or any clerical
error in any matter which is entered in the register:
57. Section 78(2), The Patents Act, 1970.
58. Section 78(3), The Patents Act, 1970.
59. Ibid.
60. Section 78(4), The Patents Act, 1970.
61. Rule 123, The Patent Rules, 2003.
62. Section 78(5), The Patents Act, 1970.
63. Rule 124(1), The Patent Rules, 2003.
64. Ibid.
65. Rule 124(4), The Patent Rules, 2003.
66. Rule 125, The Patent Rules, 2003.
67. Rule 137, The Patent Rules, 2003.
68. Ibid.
69. Ibid.
70. Section 54(1), The Patents Act, 1970. Section 54(1) reads as follows:
‘Subject to the provisions contained in this section, where an application is made
for a patent in respect of any improvement in or modification of an invention
described or disclosed in the complete specification filed thereof (in this
Act
referred to as the “main invention”) and the applicant also applies or
has applied
for a patent for that invention or is the patentee in respect thereof,
the Controller
may, if the applicant so requests, grant the patent for
the improvement or
modification as a patent of addition’
71. Ibid.
72. Section 54(2), The Patents Act, 1970.
73. Ibid.
74. Section 54(3), The Patents Act, 1970.
75. Rule 13(3), The Patent Rules, 2003.
76. Section 54(4), The Patents Act, 1970.
77. Section 56(2), The Patents Act, 1970.
78. Section 56(1), The Patents Act, 1970.
79. Section 55(1), The Patents Act, 1970.
80. Ibid.
81. Proviso to Section 55(1), The Paten
ts Act, 1970.
 PATENT AMENDMENT AND MAINTENANCE lll

82. Section 55(2), The Patents Act, 1970.

83. Ibid.
84. Section 53(1), The Patents Act, 1970. Section 53(1) reads as follows:
‘Subject to the provisions of this Act, the term of every patent granted, after the
commencement of the Patents (Amendment) Act, 2002, and the term of every
patent which has not expired and has not ceased to have effect, on the date of such
commencement, under this Act, shall be twenty years from the date of filing of
the application for the patent.
Explanation— For the purposes of this sub-section, the term of patent in case of
International applications filed under the Patent Cooperation Treaty designating
India, shall be twenty years from the international filing date accorded under the
Patent Cooperation Treaty.
85. Section 53(2), The Patents Act, 1970 and Rule 80(1), The Patent Rules,

86. Rule 80(2)(1A), The Patent Rules, 2003.

87. Section 142(4), The Patents Act, 1970.
88. Rule 80(3), The Patent Rules, 2003.
89. Rule 94, The Patent Rules, 2003.
90. Section 53(2), The Patents Act, 1970.
91. Section 60(1), The Patents Act, 1970.
92. Section 60(2), The Patents Act, 1970.
93. Ibid., and Rule 84(1), The Patent Rules, 2003.
94. Section 61(1), The Patents Act, 1970.
95. Rule 84(2), The Patent Rules, 2003.
96. Ibid.
97. Rule 84(3), The Patent Rules, 2003.
98. Ibid., and Rule 85(1), The Patent Rules, 2003.
99. Section 61(2), The Patents Act, 1970.
100. Rule 85(3), The Patent Rules, 2003.
101. Section 61(3), The Patents Act, 1970.
102. Rule 86(1), The Patent Rules, 2003.
103. Section 62(2), The Patents Act, 1970
104. Section 62(1), The Patents Act, 1970.
105. Section 111(2), The Patents Act, 1970.
106. Section 146(2), The Patents Act, 1970 and Rule 131(1), The Patent
ns
Rules, 2003. Section 146(2) reads as follows: ‘Without prejudice to the provisio
r exclusive or
of sub-Section (1), every patentee and every licensee (whethe
intervals (not
otherwise) shall furnish in such manner and form and at such
as to the extent to
being less than six months) as may be prescribed statements
scale in India.’
which the paterited invention has been worked on a commercial
107. Ibid.
108. Rule 131(2), The Patent Rules, 2003 .
109. Section 122(1), The Patents Act, 1970.
110. Section 122(2), The Patents Act, 1970.
112 INDIAN PATENT LAW AND PRACTICE

111. Section 120, The Patents Act, 1970.

112. Section 67(1), The Patents Act, 1970.
113. Ibid.
114. Sections 72(2) and 147(2), The Patents Act, 1970.
115. Section 67(5), The Patents Act, 1970.
116. Section 119, The Patents Act, 1970.
117. Section 72(1), The Patents Act, 1970 as amended in 1999, 2002, and
2005, and Rule 133, The Patent Rules, 2003.
118. Section 153, The Patents Act, 1970 as amended in 1999, 2002, and 2005,
and Rule 134, The Patent Rules, 2003.
 5
Patent Specification Drafting

5.1 SPECIFICATION
A: discussed in Chapters 3 and 4, a patent applicant must file a patent
specification disclosing the details of the invention along with a
patent application. Specification is a techno-legal document, which
contains scientific information relating to the invention for which patent
a
protection is sought. An application may be accompanied by either
is
provisional or a complete specification. A provisional specification
needs
generally filed when an inventor has conceived the invention but
complete
some time to perfect it. On filing a provisional specification, a
of filing
specification must be filed within twelve months from the date
of the provisional specification.
details of the
The object of a specification is to disclose to public the
applicant. The
invention for which protection is sought by the patent
invention but also
specification not only discloses the embodiments of the
ion. It provides
provides the manner of practising or working the invent
by clearly defining
notice of the patent protection sought by an applicant
is the document used
the boundaries of the invention. As specification
on patent grant and the
by the patent office in order to make a decision
a specification is drafted
courts to enforce the patent, the manner in which
sses nuances of specification
assumes high importance. This chapter discu
specification, approaches to
drafting with emphasis on contents of
derations in drafting.
drafting a specification, and strategic consi
 114 INDIAN PATENT LAW AND PRACTICE

5.2 PARTS OF A SPECIFICATION

5.2.1 Complete Specification

A complete specification must have the following sections:
. Title
Preamble
. Name, address, and nationality
. Field of invention and use of invention
. Prior art and problem to be solved
. Object of invention
. General statement of invention
. Detailed description of invention
SPNDAKH
AWN
9. Statement of claims
10. Drawings
11. Abstract
12. Deposit
Example: Consider an invention pertaining to a pencil with an eraser
attached at one end. Assume that this is an invention that satisfies the basic
requirements of novelty and non-obviousness. The use of such a pencil
is evident as it makes it convenient for a writer to have an attached eraser
and as he does not have to worry about carrying an eraser separately.
This example will be used to illustrate the various sections of a
patent
specification.

weidsl Tetle
The specification must begin with a title sufficient'y indic
ating the subject
matter of the invention.' The title of the invention
has to disclose the
specific features of the invention in not more than
fifteen words.? While
the title has to indicate the nature of the invention,
it need not describe
the invention. Use of laudatory words must be
avoided in the title.
Example: A pencil with an attached eraser
.
Note that in this example, the title could
read as simple as ‘A pencil’
While such a title does indicate the subject
matter of the invention, it
does not disclose the specific features
of the invention and, therefore,
may not be accepted by the patent exam
iner.
5.2.1.2 Preamble
The preamble provided hereunder shou
ld be given on the first page of
Form 2 (see Appendix II A) along
with other details such as title of the
invention, name, address, and national
ity of the applicant(s).
 PATENT SPECIFICATION DRAFTING 115

The following specification particularly describes the invention and

the manner in which it is to be performed.’

5.2.1.3 Name, Address, and Nationality

Full name, address, and nationality of the applicant have to be provided
in the specification. The address may be that of either applicant's place of
business or residence.*

5.2.1.4 Field of Invention and Use of Invention

The field and use of the invention section has to indicate the general art
to which the invention belongs and utility of the invention. This section
may also demonstrate the industrial applicability of the invention for
which protection is sought, and may provide examples of the areas of
application and use of the invention. Furthermore, the advantages that
the invention possesses over conventional practices may also be provided
in this section. The section may start as follows:
This invention relates to ...’

Example: This invention relates to a pencil and more particularly to, a

pencil with an attached eraser.
Note that in the example given above, the field of invention and use
of invention does not capture specifically the utility and the industrial
applicability of the invention. However, such a field of invention and use
of invention may be acceptable to an examiner as industrial applicability
and utility of the invention are clearly evident, as it is in most cases. For
example, in this case, it is evident that a pencil with an attached eraser
would be very useful for writers and that it could be made in an industry.
clearly
However, in certain cases, it may not be so. If the utility is not
use of
evident in an invention, a practitioner might want to include the
invention as well in this section.

ularly to a
Example: This invention relates to a pencil, and more partic
, may be
pencil with an attached eraser. The invention disclosed herein
used by writers who use pencils and erasers.

5.2.1.5 Prior Art and Problem to be Solved

of the art of technology
This section must clearly bring out the current state
on should identify the
relating to the invention. Furthermore, the secti
of application, and bring
closest prior art that may be existing at the time
g disclosed and the prior
out differences between the invention bein
 116 INDIAN PATENT LAW AND PRACTICE

art. The prior art referred in the section may include pending patent
applications, granted patents, technical literature, books, and so on.
Moreover, apart from identifying the closest prior art, this section must
also bring out the distinguishing factors of the invention as compared to
the closest prior art. As indicated in the heading, this section should also
contain the disadvantages or problems existing with the prior art that the
invention solves.

Example: Currently, writers who use pencils to write use erasers to erase
text in case they need to make any correction to text or remove any
unnecessary portions of the text that they are working on.
Existing pencils do not come with attached erasers. Therefore, writers
have to remember to carry or keep erasers separately with them whenever
they are writing. However, it is common for writers to forget to carry or
keep erasers with them, which leads to discomfort while writing as they
cannot make corrections at the time of writing.
Furthermore, when a writer realizes that he or she needs to make
correction to the text, the writer needs to put the pencil down and pick
up an eraser to erase the portions of text that need to be corrected. This
results in spending more time in erasing.
The invention disclosed herein provides for a pencil with an attach
ed
eraser, preferably to one end of the pencil. This eliminates the
need for
writers to specifically remember to carry or keep anothe
r item, namely
eraser, with them. Also, having an eraser attached to
a pencil allows
for a writer to quickly turn the pencil and use it as an
eraser. This can
considerably reduce the time used to erase text while
writing.
Note that the example prior art and problem to be
solved clearly points
out closest prior art, which is a pencil. The secti
on also distinguishes the
inven tion from the prior art by clearly pointing out
that the invention
includes a pencil having an eraser attached,
preferably attached at one
end. Apart from covering these two critical
aspects, the section also
lucidly points out the problems (disadva
ntages) with the prior art and
indicates how the invention solves those
problems.
5.2.1.6 Object of Invention
The Object of Invention section logicall
y flows from the earlier section
relating to prior art and problem to be
solved. The section is expected to
clearly and explicitly state the objects of the inve
ntion. In other words,
the necessity of the invention has to
be fortified in this section.
 PATENT SPECIFICATION DRAFTING 117

While the previous section brings out the disadvantages with the prior
art, this section brings out the positive effects (or solutions) from the
invention. The objects are generally listed in the following format:
‘The principal object of this invention is ...’°
‘Another object of this invention is ...”
‘A further object of this invention is ...*

Example: The principle object of the invention is to provide convenience

to writers in making corrections to the text that they are working on, as
an eraser is attached to the pencil. Another object of the invention is to
reduce the time involved in making corrections to the text, as writers do
not have to drop the pencil and pick up an eraser to erase text.
It can be seen from the example that object of the invention section
is based on the problems that the invention solves. This section informs
an examiner as to why this invention is needed in the light of state of
the art.

5.2.1.7 General Statement of Invention

The General Statement of the Invention (also known as Statement of
the Invention) section must clearly bring out the most essential and
distinguishing features of the invention for which protection is sought
and without which the invention would not be possible.’ This section
may also expressly detail the essential novel features of the invention for
multiple embodiments.
The statement of the invention is intended to complement the
omnibus claim during infringement proceedings.'® An omnibus claim
cation
is a claim that claims the subject matter described in the specifi
to list
without setting any specific boundary. Therefore, it is important
invention
as many embodiments as possible as part of the statement of
require d to
in order to broaden the coverage of claims. However, it is not
A brief
provide complete details of various embodiments in this section.
features will
statement relating to the embodiments with essential novel
be sufficient.

that we selected, the

Example: In the case of the example invention
about the various
statement of the invention should briefly talk
of the invention may
embodiments of the invention. Embodiments
a pencil. For example, one
include various ways of attaching an eraser to
as an attaching mechanism.
embodiment could be achieved by using glue
 118 INDIAN PATENT LAW AND PRACTICE

Another embodiment could be achieved using a cylindrical means

attached to the pencil on one end of the means and to hold an eraser
on the other end. The section should focus on listing briefly the various
embodiments. The statement of the invention section need not go into
details of the embodiments like the types of glue that could be used or the
specific details of the mechanism used to hold the eraser. Such details are
to be covered under the detailed description section.

5.2.1.8 Detailed Description of Invention

The detailed description section of a specification, as the name suggests, is
expected to provide a comprehensive description of the invention sought
to be protected. Description of an invention is required to be furnished in
sufficient detail so as to give a complete understanding of the invention."
The nature of improvements or modifications effected with respect to the
prior art should be clearly and sufficiently described in the description.’
To clearly describe and ascertain the nature of the invention, this section
may use specific examples and refer to drawings in order to illustrate the
various aspects of the invention."

Example: In the case of the example invention, the detailed descri

ption
section will cover all the embodiments of the invention required
to explain
the invention in detail. While the statement of invention merely
lists the
embodiments and provides a brief overview of the listed
embodiments,
the detailed description section elaborates details of
each embodiment.
The detailed description section will also include
details of various
alternatives that are possible for every single embod
iment. Considering
one embodiment of the example invention, namely
, eraser is attached to
a pencil using glue, the detailed description may
talk about various kinds
of glue that could be used to attach an eraser
to pencil.
5.2.1.9 Statement of Claims
Claims constitute the techno-legal part
of the specification. The
description of the invention in the spec
ification must end with one
or more claims.'* Claims define the exte
nt of protection sought for an
invention and form the heart of the spec
ification. Claim may be either
an independent claim, which stands alon
e without depending on other
claims, or dependent claim, which depe
nds on another claim.
Example: A pencil comprising an
eraser attached to one end of the
pencil.
 PATENT SPECIFICATION DRAFTING 119

This claim tries to cover all embodiments that have an eraser attached
to a pencil at one end. Therefore, the example claim is an example of a
reasonably broad claim that seeks to protect multiple embodiments by
drawing a broad boundary around more than one embodiment. However,
please note that this claim does not cover those embodiments where an
eraser is not attached to one end, but is rather attached somewhere in the
middle of the body of the pencil.
Typically, a specification contains more than one claim as part of
statement of claims. And, there are different types of claims based on
dependency and subject matter. This section of the specification will be
dealt in greater details in the subsequent chapter.

5.2.1.10 Drawings
Drawings in the specification must be submitted on separate durable
sheets.'> They must be made on a scale sufficiently large to show the
invention clearly and the dimensions must not be marked on the
drawings.'* Each drawing must be submitted on standard A4 size sheets
with a clear margin of at least 4 cm on the top and left hand side of the
sheet and 3 cm at the bottom and right hand side of every sheet.'” All
sheets of the drawings should be sequentially or systematically numbered
and must have:
1. The name of the applicant in the left hand top corner;
2. The number of the sheets of drawings and the consecutive number
of each sheet in the right hand top corner; and,
3. The signature of the applicant or his agent in the right hand bottom
corner.”®
The drawings must not have any descriptive matter unless they contain
flow diagrams.'? Furthermore, reference letter/numerals as used in
the description should also be used in denoting the corresponding
component/part in the drawings. No descriptive matter should appear
on drawings except under certain circumstances such as usage of flow
chart, chemical, and other reaction, and so on.
The same letters or numerals should be used in different figures for
the same parts. In complicated drawings or when there is no room to
write the reference letters in their proper places, the letters should be
shown outside the figures and connected by fine lines with the parts to
which they refer.”

5.2.1.11 Abstract
of the invention
Claims in a specification are followed by an abstract
 120 INDIAN PATENT LAW AND PRACTICE

that is the subject of the specification. An abstract must start with the
heading Title of the invention and should give a concise summary of
the invention.?! The abstract has to indicate clearly the technical field,
to which the invention belongs, the technical problem, to which the
invention relates, and the solution to the problem through the invention,
and the principal uses of the invention.”
The abstract may not contain more than 150 words.*? Where
necessary, reference should be made to the most relevant figures of the
drawings.** Chemical formulae that characterize an invention may also
be included in the abstract, if necessary. The abstract has to be so drafted
that it constitutes an efficient instrument for searching in the relevant art
and to assess whether there is a need to refer to the specification itself.”
However, the abstract cannot be used for the purpose of interpreting the
scope of protection in legal proceedings.”®

Example: A pencil with an attached eraser, preferably to one end of the

pencil, thereby, eliminating the need for writers to specifically remember
to carry or keep another item, namely eraser, with them. Furthermore,
having an eraser attached to a pencil allows for a writer to quickly turn
the pencil and use it as an eraser, thereby, reducing the time used to erase
text while writing.
Note that the example abstract provided here starts with the title of the
invention, limits itself to within 150 words, and provides a brief summary
of the invention. The example abstract clearly points out the field of the
invention, and problems the invention solves through the advantages
that it highlights, namely the convenience in having an attached eraser,
and reduced time in erasing text while writing.

5.2.1.12 Deposit
A deposit of biological material must be made if the invention
includes
biological materials which cannot be adequately described
in the written
description. On making a deposit, the reference to the
deposit has to be
provided in the specification within three months from the
date of filing of
the specification.” All details and characteristics to identi
fy and indicate
the biological materials including the name, address
of the depository
institution, and the date and number of the deposit
of the material at the
institution, must be mentioned in the specification.”
Access to the material needs to be made avail
able only after the
priority date or date of application in India.® The
geographical origin of
the biological materials should also be mentioned
in the specification.A
 PATENT SPECIFICATION DRAFTING 121

summary of procedural requirements in a specification are provided in

Table 5.1 for reference.

Table 5.1 Procedural Requirements

Section Section/Rules Explanation of the Sections/Rules

Allsections Rule 9(1) All documents and copies except drawings sent to
except the patent office shall be in written, or typewritten,
drawings or printed, either in Hindi or English in large and
legible characters with deep indelible ink, with lines
widely spaced upon one side only of the strong
white paper.
The size of the white paper shall be A4 of
approximately 29.7 cm by 21 cm, with margin of at
least 4 cm on the top and left hand part, and 3 cm
on the bottom and right hand part thereof.
Specification Section 10 Every specification shall have to be made on
Rule 13 Form-2.
Form-2 should contain, title of the invention and
applicant's name, address, and nationality, Preamble
to the description
Description shall start on the next page.
Claims have to start with a preamble—I/We claim
on a separate page.
Date and signature of agent or applicant has to be
made at the end of the last page of specification.
Abstract Section 10(4)(d) An abstract shall commence with the title of the
Rule 13(7) invention.
It shall not exceed more than 150 words.
It shall indicate the reference of the figure which
needs to be published with abstract.
Abstract should be submitted along with complete
specification in a separate page.

Title Rule 13(7) The Title of the invention shall not be more then 15
words.

Drawings Rule 15(4) The drawings shall be on standard A4 size sheets

with clear margin, at least 4 cm on the top and left
hand and 3 cm at the bottom and the right hand of
every sheet.
Drawings shall be on scale sufficiently large to show
the inventions clearly and dimensions shall not be
marked on the drawings.
 122 INDIAN PATENT LAW AND PRACTICE

Drawings shall be sequentially or systematically

numbered and shall bear in the left hand corner the
name of the applicant; in the right hand top corner,
the number of sheets of drawings and consecutive
number of each sheet; and in the right hand bottom
corner, the signature of the applicant or his agent

5.2.2 Provisional Specification

The applicant may prepare a disclosure of the invention in the form of
a written description and submit it to the patent office as a provisional
specification if he requires time to perfect the invention after conceiving
it.° A provisional application helps in establishing priority of the
applicant over any other person that is likely to file an application for a
patent in respect of the same invention. After a provisional specification
is filed, the complete specification relating to the invention must be filed
within twelve months from the date of the provisional specification.
Such complete specification must be within the scope of the provisional
specification.
A provisional specification cannot be considered to be a rough draft
or a skeleton of a subsequent complete specification. It is a separate
application that stands on its own. A complete specification, which is
filed after a provisional specification claiming priority of the provisional
specification, does not replace the provisional specification. Therefore, a
provisional specification must provide enough detail to clearly identify
the invention and its scope.
A provisional specification must contain the title and detailed
description sections.*! Generally, claims are not included in a provisional
specification as the purpose of a provisional specification is not to claim
legal protection but only to establish priority. However, some patent
agents include independent claims as part of a provisional specific
ation
in order to indicate the scope of the invention. Having said that,
there
is no evidence to suggest that Indian patent office takes note
of claims
included in a provisional specification to decide whether
a subsequently
filed complete specification, claiming the priority of the
provisional
specification, falls within the scope of the provisional specific
ation.
The other sections, namely, field of invention and use
of invention, prior
art and problem to be solved, object of invention,
general statement of
invention, and drawings, may be included in the provi
sional specification,
but are not mandatory. However, drawings have to
be supplied, if the
 PATENT SPECIFICATION DRAFTING 123

controller so requires, for the purposes of any specification, whether

complete or provisional.*”

5.3 SUFFICIENCY OF DISCLOSURE

5.3.1 Enablement
The specification must enable a person skilled in the art to carry out
the invention described in it. The skilled person must understand the
invention completely with respect to the relevant prior art from the
specification, and must be capable of recreating the invention. Clear
distinction must be made between disclosing the details of an invention
and disclosing an invention such that a skilled person in the art is able
to recreate the invention. In Synthon BV v. Smithkline Beecham PLC,
the court observed as follows: ‘It is very important to keep in mind that
disclosure and enablement are distinct concepts, each of which has to be
satisfied and each of which has its own rules.
In another case, Kirin-Amgen Inc v. Hoechst Marion Roussel, in
addressing the sufficiency requirement, the court stated as follows:
‘Whether the specification is sufficient or not is highly sensitive to the
nature of the invention. The first step is to identify the invention and
decide what it claims to enable the skilled man to do. Then one can ask
whether the specification enables him to do it:
Anything claimed in a specification must be enabled by the details
provided in the specification. Enabling askilled person in the art to recreate
the invention involves providing specific examples of embodiments that
will allow a skilled person in the art to understand the nuances of the
invention. Therefore, it is a general practice among patent agents to
include specific examples for embodiments disclosed in the specification,
to ensure that the working and implementation specifics of the invention
are clearly illustrated in order to satisfy the requirement of enablement.
For example, if a new device is made that performs a specific Digital
to claim
Signal Processing (DSP) operation and if the inventors intend
devices with a software DSP and devices with a hardware DSP, then the
that
specification must specifically describe at least one embodiment
a software
contains hardware DSP and at least one embodiment with
DSP only
DSP. If the specification describes the working of the hardware
then claims that
and does not describe the workings of the software DSP,
be allowed due
cover uses of both hardware and software DSPs may not
to insufficiency of disclosure and lack of enablement.
 124 INDIAN PATENT LAW AND PRACTICE

The number of embodiments disclosed and the number of corres-

ponding examples provided, depends on the scope of protection sought
for the invention disclosed. At least one embodiment of the invention
sought to be protected must be described in the specification. When
the claims cover a broader scope compared to one or more individual
embodiments described, multiple embodiments must be shown to
substantiate the broader scope of the invention for protection. Finally,
in addition to providing details of the working and implementation of
the invention through various embodiments and specific examples for
those embodiments, a specification should also teach how a skilled
person is assumed to be using the invention, to satisfy the enablement
requirement.”

5.3.2 Best Mode

In addition to providing specific examples and drawings to clearly
describe the invention and to satisfy the requirement of enablement,
the Indian patent law also requires the best method of implementing
the invention to be disclosed in the specification.** Since the description
section provides the details of the working of the invention and its
implementation, the description must also have the best method of
implementing the invention at the time of filing the patent application.
Non-disclosure of best method of implementing the invention may be
used as a ground for revocation of the patent.

5.3.3 Biological Material

Biological material that forms part of an invention must be deposited
at
a recognized depository, and must be referred in the specification
if the
biological material is not available to the public, and the
invention cannot
be described adequately without such a deposit.** The deposi
t must be
made with the International Depository Authority under
the Budapest
Treaty, on or before the date of filing or priority. The
International
Depository Authority in India is the Microbial Type
Culture Collection
and Gene Bank (MTCC), which is located at Chandigarh.*
* After making
a deposit, reference to the biological material must
be made in the
specification.
All the available characteristics of the biolo
gical material required
to identify the material including the name
, address of the depository
institution, and the date and number of
the deposit of the material at
the institution must be provided or indicate
d in the specification.” Fur-
thermore, the source and geographical
origin of the biological material
 PATENT SPECIFICATION DRAFTING 125

mentioned in the specification must also be disclosed.** If an invention

relates to a gene sequence, sequence listing may be submitted to the
patent office and the number of such sequence listing may be provided in
the specification.” The sequence listings must always be submitted to the
patent office in electronic form.”

5.3.4 Clarity of Disclosure

Disclosure of an invention in the specification is intended for a person
skilled in the art to understand and work the invention.*' An applicant
gets exclusive rights over the invention in return for disclosure of the
invention in the specification. The disclosure of the invention in the
specification must be clear, precise, honest, and open.” The specification
and, more specifically, the description must be written in such a way
that no doubts are cast on the scope of the invention. Lack of clarity in
disclosure may be used as a ground for rejection of a patent application
or revocation of a patent.
In the case of Press Metal Corporation Limited v. Noshir Sorabji
Pochkhanawalla, the court stated as follows:
It is the duty of the patent holder to state clearly and distinctly, the nature and limits
of what he claims. If the language used by the patentee is obscure and ambiguous, no
patent can be granted. It is immaterial whether the obscurity in the language is due to
design or carelessness or want of skill. It is undoubtedly true that the language used
in describing an invention would depend upon the class of persons versed in the art
and who intend to act.

To conclude, the specification must be worded clearly and

unambiguously. It must be capable of being understood by a person
skilled in the art.

5.3.5 Superfluous Matter

A specification should not contain superfluous or irrelevant matter.”
Only matter that is necessary to clearly describe the invention may
be included in a patent specification. Complicated mathematical
calculations and analyses are undesirable, unless they are necessary to a
full understanding of the invention.“ Ifa specification is inordinately long
and is found to have superfluous or irrelevant matter, the modification of
such a specification may be required by the patent examiner.”

5.3.6 General Disclaimers

cation.
Patent agents normally include general disclaimers in the specifi
ments
The objective of the general disclaimers is to cover the embodi
126 INDIAN PATENT LAW AND PRACTICE

that are the result of minor modifications or modifications that may be

possible in the future as a result of advancement of technology. While
these general disclaimers may not be objected as a rule during the
examination, the disclaimers themselves must not confuse the scope of
the invention. For example, a disclaimer such as, ‘the invention should
be taken to include any modifications, whether novel or not..; would
be considered to be confusing the scope of the invention and may be
objected.

5.3.7 Technical Terms

Technical jargon that may not be a part of the common use in the relevant
art should be avoided in a patent specification. Since a patent specification
is intended for a skilled person in the art, only terms that are commonly
known in the relevant art may be included to ensure that a skilled person
understands the invention. If any specialized term or terms, that are not
common in the art, have to be used in a specification, such terms must be
clearly defined in the specification.
Terms in foreign languages may be used where there is no alternative.
However, it is mandatory to provide English equivalents to such foreign
terms.*° Furthermore, use of vague slang words and colloquialisms will
be objected and, therefore, must be avoided.” If a specification contains a
reference to a proprietary article or specific product, the details of which
are not well known, the description should provide details of such articles
or products.“

5.3.8 Proper Names and Trademarks

Use of proper names or similar words to refer to articles must be avoided
in the specification. The articles must be clearly identified, without
reliance on the name of the article, in order to enable a skilled person in
the art to carry out the invention.*” However, words that have generally
accepted meanings, such as standard descriptive terms, may
be used
without further explanation. For example, terms such as Bowden cable,
Belleville washer, zip fastener, and so on, must be avoided.*
!
A trademark must not be used to refer to a product or an
article
in a specification because it is an indication of origin rather
than of
composition or content and, therefore, cannot properly
be used to
describe an article. If a registered trademark is used, it
should generally
be accompanied by wording showing that it is a trademark,
since its use
as a descriptive term without acknowled gement may be prejud
icial to the
rights of its owner.
 PATENT SPECIFICATION DRAFTING 127

5.4 SPECIFICATION DRAFTING

Drafting a specification is an art in its own right and there is no silver bullet
approach that is considered to be the best. Having said that, the approach
described hereunder is an approach adopted by most patent agents. The
approach starts with understanding of the invention disclosure and ends
with drafting of the final version of claims.

5.4.1 Invention Disclosure

Drafting a specification requires a thorough understanding of the
invention for which protection is sought. The patent agent generally
collects the invention information from the inventor through an invention
disclosure form (see Appendix IV A) that is filled by the inventor. After
receiving the invention disclosure form from the inventor, the patent
agent has to peruse the form to get an understanding of the invention.
In order to understand the invention thoroughly, the patent agent has
to read background materials relevant to the invention unless he is well
aware of the art relating to the invention.
A patent drafter generally specializes in a few subject areas like
electronics, telecommunication, software, manufacturing, and so on,
based on his technical background. Though, the patent drafter tries
to be updated with the developments in his field of specialization, the
rapid progress of science and technology makes it difficult for him ta
know about everything in the field. Therefore, the patent drafter may
not always have complete knowledge relating to the sub-field or area
to which the invention belongs. In such a scenario, it is very important
for a patent agent to understand the context of the invention by reading
relevant background material.
Relevant material to be reviewed by the patent drafter may include
journal articles, technical magazines, technology society periodicals,
prior patent publications, and any other materials, which will help
the patent drafter to get an understanding of the background of the
invention. Among all materials, prior patent publications, generally, give
a good insight into the dynamics of the field of invention. In addition
tion
to helping in understanding the prior art and providing informa
publications
relating to the current state of the art of the invention, patent
protection of
provide valuable information relating to the dynamics of
s important
similar inventions. Reading prior patent publications provide
the level of
insights into the market dynamics of the product or process,
and nature of protection
protection that is generally sought in the field,
insights are helpful to
sought by applicants of those applications. Such
 128 INDIAN PATENT LAW AND PRACTICE

the patent agent in deciding on the level of protection required and the
nature of protection to be sought through the patent specification.
The invention disclosure form through which the patent agent collects
invention details from the inventor, generally has questions relating to
the current state of technology in the relevant field, the problems. faced
by the inventor that led to the invention, the implementation details of
the invention, utility of the invention in the industry, and other infor-
mation relating to the invention. The form must seek all information
that will help the patent drafter to understand the invention thoroughly.
The patent drafter may also collect the invention information from
the inventor through means other than the invention disclosure form
based on convenience and circumstances. A sample invention disclo-
sure form has been provided in the Appendix IV A for the reference of
the reader.

5.4.2 Inventor Interview

After understanding the background of the invention and reading
through the invention details provided by the inventor in the invention
disclosure form or otherwise, the next step is to conduct an interview
with the inventor in order to collect further information. The primary
objective of the inventor interview is to collect complete information
from the inventor that is necessary to draft the specification. The patent
drafter must collect all information relating to the invention for satisfying
the enablement, best mode, written description, drawings if required, and
other requirements, under the patent law.
Inventors may some times restrict their invention disclo
sure to
a specific implementation, or a specific application, for
which they
developed the invention. From the inventor's point
of view, he might
have encountered a specific problem in a field of application
and created
the invention as a solution for that application. Theref
ore, the inventor
may not give importance to alternate imple
mentations or alternate
applications in order to solve a particular proble
m. However, in such
a situation, it may be possible to extend
the same solution to other
application areas, or provide one or more altern
ate implementations of
the same solution. Under such circumstances,
the patent drafter must ask
the right questions in the inventor interview to understand
of the invention, both in terms of possible the breadth
alternate implementations and
different application areas, in order to prov
ide maximum coverage for
theinvention in the specification.
 PATENT SPECIFICATION DRAFTING 129

5.4.3 Outline of Claims

After understanding about the invention from the invention disclosure
form, review of relevant materials, and inventor interview, the patent
drafter may start the specification drafting process by preparing the
first draft of independent claims. Though, some patent agents draft the
description of the invention before claims, most of them draft an outline of
independent claims before drafting other portions of the specification.
Preparing the claim outline compels the patent drafter to understand
the boundaries of the invention clearly in the light of the background and
prior art information of the invention. After the patent drafter prepares
the outline of the claims, he can discuss the scope of the invention covered
in the claims with the inventor. On getting the inventor’s approval with
regard to the claim scope, the patent drafter can confidently proceed with
drafting other portions of the specification.
Defining the outline of claims is one of the most important steps
in drafting a specification. While drafting claims, the first step is to
prepare independent claims after understanding the different aspects of
the invention that have to be claimed in the specification. Independent
claims must be based on the way in which a product or a process may be
commercialized. For example, for an invention relating to an improved
pump set, which is a result of improved electrical circuitry within the
pump set, the patent drafter has to consider protecting both the pump set
as a whole and the electrical circuitry using separate independent claims.
Such claiming is essential because it is possible for a third party to use
the same circuitry in a different system (or context) other than in pump
sets and obtain improvements in performance of those systems. Writing
an independent claim only for the pump set as a whole may not protect
the usage of the improved circuitry in other systems. Therefore, patent
to the
drafters must consider broad claims that may provide protection
invention across multiple application areas.
patent
Similarly, with regard to the invention in the example, the
on of the
agent must also consider claiming methods relating to the functi
configuration
improved circuitry because it is possible to make changes in
performance.
of circuitry, and still attain the same functionality and
the functionality of
Having independent method claims, that claim
ng solutions that
systems, can be useful in preventing others from creati
Another consideration
are substantially same but differ in specific detail.
claims, must be the
of a patent drafter, while drafting independent
claims. The patent drafter
breadth of the coverage of the independent
 130 INDIAN PATENT LAW AND PRACTICE

must attempt to write independent claims that are as broad as possible

considering the invention and the related prior art. He can do so only if
he analyses the prior art comprehensively.
Once the outline of independent claims is prepared, the next step
is to extend the outline to include dependent claims for each of the
independent claims. All aspects of the invention that are novel but were
not covered under the independent claims must be incorporated in the
dependent claims.

5.4.4 Drawings
Drawings play an important role in giving clarity to the invention that
forms part of the specification. They help in not only giving a good
understanding of the invention but also facilitate the enablement of the
invention. The drawings in a specification must depict all elements that
form part of the claims. In general, detailed drawings help in a clear
description of the invention. However, it must be noted that unnecessary
information may obscure the invention details and must be avoided in
the drawings.
Different forms of diagrams may be used to ensure that the speci-
fication is clear and enables a skilled person in the art to recreate the
invention. For example, while describing a mechanical invention, it
will
be helpful to show different views of a machine or a mechanical part.
Ifa
machine or component is complicated, or has too many parts to
be shown
in regular views, it might be better to include an exploded
view to show
various parts that are part of the particular machine or
component.
The sequence of drawings can play an important role
in making a
patent application easy to understand. In general,
drawings may start
with figures that capture the broader aspects
of the invention, and
subsequent figures may capture the details. For
example, in describing
a new mobile communication device, the first
few figures can represent
the overall network and where the new mobil
e communication device
fits in the overall system, and the figures follo
wing the initial figures can
show detai
ls of the mobile communication devi
ce itself and its various
components.

5.4.5 Describing the Invention

Once the claim outline and drawings
are completed, describing the
invention is a fairly easy task because
most of the planning for the
description is done. The level of detail
in the description is determined
after the drawings are prepared and
the flow of the description is
 PATENT SPECIFICATION DRAFTING 131

determined by the sequencing of the drawings. In patent specifications,

description generally follows the drawings to make it easier for a person
reading the specification to understand the invention clearly.
The level of detail in the description is an important aspect to be
considered by a patent drafter for every specification drafted by him.
From an inventor's point of view, he would like to avoid as much detail as
possible in the specification so as to keep public disclosure of the details
of the invention to the minimum. However, that may defeat the purpose
of the patent system and, in most cases, may not satisfy the specification
requirements. The general guideline to decide on the level of detail is
to look at the invention from a skilled person’s point of view. A skilled
person could be thought of as an average professional working in the
industry of the relevant art. The purpose of the specification must be to
clearly describe the invention such that the skilled person in the art is
able to understand the invention completely, with respect to the relevant
prior art, and is able to recreate the invention completely.
The detailed description must provide all the details relevant to the
working of the invention and the implementation. If the invention is
an improvement over an existing work, the detailed description section
prior
must provide the details of the nature of improvements over the
the
art and the implementation of such improvements. Considering
the pump
pump set example discussed earlier, if claims are included for
the detailed
set, the circuitry, and the functionality of the circuitry, then
its elements;
description must provide the details of the circuitry and
provide the
how the various elements in the circuitry work together to
the efficiency
functionality; and how the improved circuitry improves
need not be
of the pump set. However, commonly known elements
standard and well
described. For example, if the circuitry includes a
circuit need not be
known switch control circuit, such switch control
explained in detail.

5.4.6 Refining and Finalizing Claims

ne of claims may be
Once the invention is described in detail, the outli
finalize the claims of the
revisited by the patent drafter to refine and
lete set of claims at the
specification. It is common to draft the comp
ver, reviewing and refining
outset before describing an invention. Howe
tion has certain advantages.
claims outline after describing the inven
covers the most important aspects
Though the outline of claims typically
details that one might want to
of the invention, there may be many finer
patent agents can easily miss such
include as part of claims. Inventors and
 132 INDIAN PATENT LAW AND PRACTICE

finer details during initial discussions. Once the patent drafter thinks
through the entire specification during the preparation of drawings and
description, he may appreciate the finer details of the invention. After the
description is drafted, the patent drafter may include more dependent
claims based on the finer details of the invention and refine the outline of
claims into final claims.
Referring once again to the decision on the level of detail in the
description, the answer for the level of detail to be included in description
is found in the level of protection desired through claims. Most often,
only aspects that are claimed need to be explained in detail. Aspects
of invention that are to be covered in claims must be clearly explained
through specific embodiments and examples to illustrate such
embodiments. If claims are intended to be broad in their protection,
then, most probably, various embodiments illustrating the alternate
implementations that are possible might have to be clearly described
to substantiate the broader set of claims. Therefore, it is common
to
find specifications with broader set of claims to have
more number
of embodiments being detailed and illustrated. If an invention
is very
specific in nature and requires only a narrow set of claims,
then it is
quite common to find very limited embodiments and
examples being
described and illustrated. Therefore, it must be
noted that claims and
extent of protection sought through claims, often
defines the structure
of the specification, specifically drawings and
description.
5.5 ALTERNATIVE DRAFTING APPROA
CH
An alternative approach to drafting a specific
ation is to start the drafting
with preparing the drawings and the descript
ion. Once the drawings and
description are prepared, claims may be
written to cover the invention
to the extent described. There is one adva
ntage with this approach. The
advantage is that when an invention is
very complex to understand, going
through the process of describing the
invention provides clarity on the
invention itself and that clarity may be
used to understand the breadth of
protection. However, there are drawba
cks with this approach. Since the
description is written first, there is

be revisited once the claims are Pp

claims entirely, and that no add
 PATENT SPECIFICATION DRAFTING 133

description and drawings that is not covered by the claims. As revisiting

is required, a patent drafter might have to spend more time in drafting
the specification if this approach is followed.
A sample specification along with the explanation of various sections
has been provided in the Appendix IVB for the reader’s reference.

NOTES
. Section 10(1), The Patents Act, 1970 as amended in 1999, 2002, and 2005.
. Section 13(7)(a), The Patent Rules, 2003, as last amended in 2006.
. Section 5.6.1, Draft Manual of Patent Practice and Procedure, 2008.
. Section 5.6.1, Draft Manual of Patent Practice and Procedure, 2008.
Ibid.
Ibid.
Ibid.
Ibid.
CONAN
EWH Ibid.
10. Ibid.
— _— Ibid.

12. Ibid.
13. Ibid.
14. Ibid.
15. Rule 15(3), The Patent Rules, 2003, as last amended in 2006.
16. Rule 15(5), The Patent Rules, 2003, as last amended in 2006.
17. Rule 15(4), The Patent Rules, 2003, as last amended in 2006.
18. Rule 15(6), The Patent Rules, 2003, as last amended in 2006.
19. Ibid.
20. Section 5.6.1, Draft Manual of Patent Practice and Procedure, 2008.
21. Ibid.
22. Section 13(7)(b), The Patent Rules, 2003, as last amended in 2006.
23. Section 13(7)(c), The Patent Rules, 2003, as last amended in 2006.
24. Section 13(7)(d), The Patent Rules, 2003, as last amended in 2006.
25. Section 13(7)(e), The Patent Rules, 2003, as last amended in 2006.
26. Section 5.6.1, Draft Manual of Patent Practice and Procedure, 2008.
27. Rule 12(8), The Patent Rules, 2003, as last amended in 2006.
1999, 2002, and
28. Section 10(4), The Patents Act, 1970, as amended in
2005.
29. Ibid.
Procedure, 2008.
30. Section 5.5.2, Draft Manual of Patent Practice and
Procedure, 2008.
31. Section 5.5.4, Draft Manual of Patent Practice and
ed in 1999, 2002, and
32. Section 10(2), The Patents Act, 1970 as amend
2005. 7
and Procedure, 2008.
33. Section 5.9.9, Draft Manual of Patent Practice
134 INDIAN PATENT LAW AND PRACTICE

34. Section 10(4)(b), The Patents Act, 1970, as amended in 1999, 2002, and
2005.
35. Section 5.6.1, Draft Manual of Patent Practice and Procedure, 2008.
36. More information may be obtained at: http://ipindia.nic.in/ipr/patent/d_
inst_456.pdf. Further information on Microbial Type Culture Collection and
Gene Bank (MTCC) may be obtained at http://wdcm.nig.ac.jp/CCINFO/
CCINFO.xml?773, and http://www.imtech.res.in/mtcc (last accessed on 9 April
2010).
37. Section 5.6.1, Draft Manual of Patent Practice and Procedure, 2008.
48. Ibid.
39. Ibid.
40. Ibid.
41. Section 5.9.7, Draft Manual of Patent Practice and Procedure, 2008.
42. Ibid.
43. Ibid.
44. Ibid.
45. Ibid.
46. Section 5.6.1, Draft Manual of Patent Practice and Procedure, 2008.
47. Ibid.
48. Section 5.9.8, Draft Manual of Patent Practice and Procedure, 2008.
49. Ibid.
50. Ibid.
51. Ibid.
52. Ibid.
 6
Claim Drafting

tatement of claims is the most important part of a patent specification.

The purpose of claims is to define the scope of protection sought by
the patent applicant. They define the metes and bounds of an invention.
Any matter that forms part of the specification but does not form part
of claims is considered to be disclaimed and, therefore, enters the public
domain.
Claims form the heart of a patent specification because patentability
of an invention and infringement of a patent are assessed based on
claims. Considering the value attached to claims, drafting claims assumes
great importance. This chapter provides an overview of the anatomy of
claims, types of claims based on dependency, subject matter and field
of invention, and strategic considerations for drafting claims. As there
is a dearth of case laws with respect to claim interpretation, approach
and strategy for claim drafting are explained in the light of principles
provided in the Manual of Patent Practice and Procedure (MPPP).

6.1 PARTS OF A CLAIM

A claim is a single sentence ending with a period. Every claim has three
parts, namely, an introductory phrase, body, and a transition phrase. The
introductory phrase or the preamble introduces the claim. The body
specifies the elements’ of the invention and the transition phrase links the
 136 INDIAN PATENT LAW AND PRACTICE

introductory phrase to the body. Parts of a claim are explained hereunder

with the help of an example:
I claim a pencil having an eraser fastened to one end.
1. Introductory phrase - ‘a pencil’ ;
2. Transition phrase - ‘having’; and
3. Body - ‘an eraser fastened to one end’

6.1.1 Introductory Phrase

The introductory phrase or the preamble generally introduces the
subject matter being claimed. In the example, the phrase ‘a pencil’ is the
introductory phrase of the claim. It introduces the subject matter being
claimed, which is a pencil. The introductory phrase may also include
broad words or phrases such as article, writing device, machine, and
so on. The Indian law permits use of both broad and narrow words or
phrases in the introductory phrase as long as they relate to patentable
subject matter.
Apart from specifying the subject matter being claimed, the introduc-
tory phrase may also be used to set the context for the embodiment of
the invention being claimed. Such introductory phrases are used where
the invention is an improvement over an existing product or process. In
such a situation, the introductory phrase is drafted specifically to set the
context and clearly indicate the boundary between the invention and the
prior art over which the improvement is made.

6.1.2 Body of the Claim

The body of a claim defines a particular embodiment of the invention
using essential elements that form part of the invention. It is the specifi
c
legal description of the invention.’ The phrase ‘an eraser fastene
d to one
end’ in the claim is the body of the claim. It forms the body
of the claim
because the eraser being fastened at one end is the essent
ial element of
the invention being claimed.

6.1.3 Transition Phrase

The transition phrase joins the introductory phras
e and the body of claim
to make the claim a proper and complete sentence.
The word ‘having’ in
the example is the transition phrase. The type of
transition phrase used in
a claim influences the scope of terms used
in the claim.
The MPPP recognizes the following transition
phrases:*
* which comprises/comprising;
 CLAIM DRAFTING 137

e including;
¢ consisting of;
¢ consisting essentially of; and
e characterized by/wherein.
Each of the phrases has a meaning attached to it for claim interpretation.
The meaning of the various transition phrases commonly used is provided
hereunder.
Which Comprises/Comprising: The phrases ‘comprising’ and ‘which
comprises, have the same meaning. ‘Comprising’ means including but
not limited to the elements given in the body. Whenever the phrase is
used in a claim, the elements of the claim are understood to include but
not be limited to what is mentioned in the body of the claim. Therefore,
the transition phrase ‘comprising’ is considered to be an open transition
phrase.
Including: The term ‘including’ is a relatively restrictive term compared
to ‘comprising. The term ‘including’ does not broaden the scope of
protection beyond the elements provided in a claim. The transition
phrase ‘including’ is considered to be a partially open phrase for purposes
of interpretation.
Consisting of: The phrase ‘consisting of’ is very restrictive in its meaning
and means ‘including only’ those elements that are provided in the body
of the claim. It is used in cases where only the elements or steps recited
in the claim are required to be included and no other elements are to be
part of the invention. This transition phrase is useful in cases relating to
chemical and related arts, where in many instances adding alternative or
additional elements, or performing alternative or additional steps, can
cause the result to change drastically. The transition phrase ‘consisting
of’ is considered to be a closed phrase for the purposes of claim
interpretation.
Consisting Essentially of. The phrase ‘consisting essentially of’ is less
restrictive compared to ‘consisting of’ and conveys the meaning including
but not limited to, as long as the elements in the body are essential to the
invention. When using ‘consisting essentially of’ it is important to clearly
indicate in the description the potential changes in invention that can
make the elements given in the body non-essential. In the absence of
such a differentiation, ‘consisting essentially of’ may be considered to be
equal to comprising. The phrase ‘consisting essentially of’ is considered
to be a partially open phrase for purposes of claim interpretation, and
takes middle ground between ‘comprising’ and ‘consisting of’
 138 INDIAN PATENT LAW AND PRACTICE

Characterized by/Wherein: When an invention is an improvement to an

existing product or process, the claim must define the boundary of the
pre-existing product or process, and the improvement very clearly. The
phrase ‘characterized by’ or ‘wherein’ is used to define such a boundary.
In such a case, a claim generally has two parts, existing product or process
(prior art) and the improvement, separated by the word ‘characterized by’
or ‘wherein.

6.2 TYPES OF CLAIMS BASED ON DEPENDENCY

Claims can be categorized into two types based on their dependency.
They may be independent claims and dependent claims.

6.2.1 Independent Claims

Independent claims are claims that do not depend on any other claim.
An independent claim generally defines the essential novel features of the
most preferred embodiments of a product or a process.

Example claim: Claim 1. A pencil having an eraser fastened to one end.

The claim is an independent claim because it does not depend on any other
claim. Independent claims present the broadest possible implementation
of a particular embodiment of a product or a process. Further additions
to the broadest implementation are done through dependent claims.

6.2.2 Dependent Claims

Dependent claims are claims that depend on either an independent claim
or another dependent claim. Dependent claims that depend on more
than one claim are called multiple dependent claims.

Example claim: Claim 2 (dependent). A pencil as in claim

1, where said
eraser is fastened to said pencil on one end using an adhesi
ve.
This is a dependant claim because the claim depends on
another claim.
One form of dependent claim is a multiple dependent
claim. As stated
earlier, a multiple dependent claim is a dependent
claim that depends
on more than one claim. Multiple dependent claim
s may be written as
provided hereunder.

Example claims: Multiple dependent claim. A

pencil as in claim 1 or 2,
where said eraser is fastened to said pencil usin
g an adhesive.
Alternative multiple dependent claim. A
pencil as in one of claim 1
and 2, where said eraser is fastened to said pencil on
one end using an
adhesive.
 CLAIM DRAFTING 139

These claims are multiple dependent claims because they depen

d on
more than one claim.

6.3 TYPES OF CLAIMS BASED ON SUBJECT MATTER

Claims may also be broadly categorized into process claims and produc
t
claims, based on the subject matter being claimed.

6.3.1 Process Claims

A process claim is used to claim process inventions and has to clearly
define the steps or actions involved in the process. It is not uncommon
to find the words ‘method’ and ‘process’ being used interchangeably.
However, the word ‘process’ is commonly associated with methods in the
industrial context (for example, the process of making a mattress) and the
word ‘method’ is generally associated with other methods (for example, a
method of sending a text message in a communication network).

6.3.2 Product Claims

A product claim is used to claim product inventions and has to clearly
define the various elements that form part of the product being claimed.
A product may be claimed as an apparatus, a system, a device, an article,
or any other product. An apparatus is understood to be a single unit with
at least a few active elements (elements that perform a function or a set of
functions on their own; for example, a processor).
A system is understood to be a set of discrete units with at least a few
of the discrete units having active elements. A device, as is commonly
used in the electronic arts, is also understood to be a product with at least
a few active elements. An article is understood to be a product with only
passive elements (elements that are not active; for example, a compact
disc with software).

».4 TYPES OF CLAIMS BASED ON FIELD OF INVENTION

rrespective of what is claimed, a claim that is not directed towards a
rocess must be directed towards a product. However, the specific types
f claims drafted for an invention depends on the field to which the
nvention belongs. Specific types of claims are generally drafted in certain
elds of science and technology, and have become standard practice
mong patent practitioners. This part of the chapter explains the types of
aims that are generally drafted by patent practitioners in manufacturing,
lectronics, software, chemistry, and biotechnology fields.
140 INDIAN PATENT LAW AND PRACTICE

6.4.1 Claims in Electronic and Software Arts

Generally, in any product or process relating to electronics and software
arts, there are active elements involved. Therefore, patent claims in
electronics and software arts may be broadly classified into:
1. Method claims,
2. Apparatus claims, and
3. System claims

6.4.1.1 Method Claims

A method claim generally relates to a method as performed by a system,
a circuit or a process, and so on. Performing a method may sometimes
involve structural elements (for example, a machine or a circuit element).
Though the method may involve structural elements, the method claim
must specify the function performed by various elements as part of the
method. It is not necessary to describe the interrelations between various
elements involved in performing the method. Therefore, method claims
are generally easier to draft when compared to apparatus claims.
Method claims do not recite specific limitations of structural elements
and their interrelations. A method claim gives protection for the method,
irrespective of the physical elements that enable the method. Whereas,
system claims and apparatus claims protect only the specific configuration
of system or apparatus claimed. So, method claims generally provide
broader protection compared to apparatus claims.
Consider the moving average digital filter as given in Figure 6.1, where
z' is a first order delay and z” is a second order delay. Assuming that the

Figure 6.1 Example of a Method Claim

 CLAIM DRAFTING 141

moving average filter is novel and not obvious in the light of prior art, a
method claim claiming implementation of such a moving average filter
may be written as follows:

A method of implementing a moving average filter, said method

comprising:
e Obtaining an input signal;
¢ Delaying said input signal by one unit by a first delay unit;
« Delaying input signal by two units by a second delay unit;
« Adding said input signal, output of said first delay unit, and output
of said second delay unit by an adder; and,
¢ Multiplying output of said adder by a factor of 1/3 using a
multiplier.
Although the example method claim mentions the various elements that
are involved as part of the method, the claim does not recite the inter-
relations between the elements. The primary object of a method claim
is to claim the method and, therefore, recites the actions involved in the
method.

6.4.1.2 Apparatus Claims

An apparatus claim describes an apparatus either in terms of structural
elements or in terms of functions performed by the structural elements.
Apparatus claims having structural elements define specific construc-
tional features of the invention and the interrelations between the various
structural elements.
According to an example provided in the MPPP,’ it is possible to
claim an apparatus through its functionality using the ‘means’ language,
which in effect is the means-plus-function language as it is popularly
known. In a means-plus-function claim, an apparatus or a system is
claimed through the functions (or actions) performed by the elements
of the corresponding apparatus or system, rather than the structural (or
physical) features.

Example: Claim 1 (Constructional or Structural)

A moving average filter comprising:
- A first order delay unit, to delay input signal by one unit, said first
delay unit connected to input signal in parallel;
units, said
- A-second order delay unit, to delay input signal by two
first order
second delay unit connected to input signal and said
delay unit in parallel;
 142 INDIAN PATENT LAW AND PRACTICE

« An adder to add input signal, output from said first order delay
unit, and output from said second order delay unit; and,
- A multiplier, with scaling factor of 1/3 to multiply with output of
said adder.

Example: Claim 2 (Functional)

A moving average filter comprising:
- A first means to delay input signal by one unit, said first means
connected to input signal in parallel;
« A second means to delay input signal by two units, said second
means connected to input signal and said first means in parallel;
¢ A third means to add input signal, output from said first and second
means; and,
« A fourth means to multiply a factor of 1/3 with output of said third
means.
The aforementioned examples illustrate the differences
between a
structural language apparatus claim and a functional language
apparatus
claim. In the first example where structural language
is used, specific
reference is made to the type of elements that are used
to perform delay,
adding and multiplying operations. However, in
the second example
where functional language is used, a generic refere
nce using the word
‘means’ is used to refer to various elements. The
claims with structural
language are useful when there is a specific
structure or specific type of
element to be claimed.
In the case of example claim 1, the specificatio
n would make a specific
reference to a type of delay unit, adder, and
multiplier. On the other hand,
in the case of example claim 2, multiple
implementations of delay units,
adders, and multipliers may be specifie
d to cover multiple implement-
a second means to delay input
signal by two units could be implemented using a comb
ination of
sing a second order delay unit.
es broader protection only when
he different implementations. If
provided in the specification, then
terms of scope of protection,
 CLAIM DRAFTING 143

protection as compared to corresponding means-plus-function claims.

If the example claim in method claims section and example claim 2 in
this section are compared, example claim 2 provides protection only
to the extent the specification supports the claims. In other words, the
example claim 2 only protects those embodiments that are described
in the description. However, method claims are not subject to such
limitations and may provide protection to all possible embodiments
(within reasonable limits) of the filter method through the method claim,
provided a few embodiments are given in the description.

6.4.1.3 System Claims

A system is understood to be a set of discrete elements. As in
apparatus claims, system claims also describe a system either in terms
of constructional features or in terms of function performed by the
constructional or structural elements in the invention.

Example: Claim (System Claim)

A telecommunication network system comprising:
¢ A plurality of feature modules;
- A plurality of interface modules, each of which is associated with
an external line or trunk;
¢ Communication channels connecting the modules;
» Means for dynamically assembling the feature modules in a
graph that connects interface modules that are participating in a
communication; and
* Usage such that the assembled feature modules implement features
for the communication usage.°
In this example, a telecommunication network is claimed with a set of
discrete units that form the telecommunication network.
A system can also be considered as a generalization of an apparatus.
Today, especially with the rapid progress of digital electronics and
communication technology, many examples where functionality of a
single unit being split into multiple and discrete units, and vice versa
are available. One such example is virtualization, where entire operating
system environments are being served by a combination of servers. An
example for combining functionality of multiple units into a single unit
can be a smart phone. Smart phones today seem to include functionality
in
of more than just a phone. Smart phones are computing platforms
an
their own right. Therefore, a system could be easily transformed into
into a system.
apparatus, and an apparatus could be easily transformed
 144 INDIAN PATENT LAW AND PRACTICE

In such a situation, it is possible to use the word system to mean both

an apparatus (a single unit with active elements) and a system (discrete
units that have active elements). Such an approach has the advantage of
using a single claim to cover two possibilities, one possibility is where
all functionality is included in a single unit, and the other possibility is
where functionality is split into multiple units. However, care must be
taken to specifically state the meaning of the word ‘system’ and to describe
both embodiments adequately in the description to support such claims,
especially, when the word ‘system’ is meant to include the traditional
meaning of both an apparatus and a system.
Just like in an apparatus, a system can also be claimed through its
functionality using ‘means language.

Example claim: A digital filter system comprising a plurality of digital

filters having respective counters operated by the same clock signal, at
least one of said digital filters comprising:
¢ An arithmetic control section having one of said counters to count
said clock signal and be cleared with a clear signal, and a circuit
to produce a control signal according to the content of said one
counter,
- A coefficient memory to produce predetermined coefficients
according to an output of said arithmetic control section,
* An arithmetic section to carry out predetermined arithmetic
operations with said coefficients under the control of the control
signal received from said arithmetic control section, and,
A circuit to produce a synchronizing signal at the time of end of
the operation in said arithmetic section, said synchronizing
signal
being supplied to clear terminals of the other counters of
all the
other digital filters to effect synchronization of
all said digital
filters.’
In this claim, the word ‘system’ refers to the set of
multiple digital filters
operated by a single clock signal. Such a system
could be implemented
within a single unit (or an Integrated Circuit)
or with multiple units (or
Integrated Circuits),

6.4.1.4 Considerations for Software Arts

Computer programs, per se, are not an inve
ntion’ and, therefore, do not
fall under patentable subject matter in Indi
a. Thi S means that software
standing alone is not a patentable subject
matter in India. However, it
 CLAIM DRAFTING 145

is possible to claim a software invention provided the invention meets

certain criteria and that the invention is claimed appropriately.
One specific type of claim relating to software programs and that does
not fall under statutory subject matter is the computer program product
or the computer readable medium claim. According to the MPPP, a
computer program product claim is nothing but a claim for a computer
program expressed on a computer readable storage medium. Such claims
are categorically excluded from being patentable and, hence, are not
allowed in India.

Example claim: Considering a pure software implementation of the

moving average filter as given in Figure 6.1, a claim for a media (generally
referred to as computer program product or a program storage device)
that comprises the instructions to perform the operations of a moving
average digital filter may be written as follows:
A program storage device readable by computer, tangibly embodying a
program of instructions executable by said computer to perform a method
of implementing a moving average filter, said method comprising:
¢ Obtaining an input signal;
» Delaying said input signal by a first order delay unit;
» Delaying input signal by a second order delay unit;
and
- Adding said input signal, output of said first order delay unit
output of said second order delay unit by an adder; and,
using a
+ Multiplying output of said adder by a factor of 1/3
multiplier.
Or,
medium,
A computer program product, embodied in a computer readable
a method
comprising instructions executable by said computer to perform
of implementing a moving average filter, said method comprising:
+ Obtaining an input signal ;
+ Delaying said input signal by a first order delay unit;
+ Delaying input signal by a second order delay unit;
delay unit and
Adding said input signal, output of said first order
; and
output of said second order delay unit by an adder
factor of 1/3 using a
Multiplying output of said adder by a 3
multiplier.
ded from patentable subject
As computer programs, per se, are exclu
ns (or software) that requires no
matter in India, a set of general instructio
hardware is not patentable when
specific adaptation or modification of a computer readable
it is claimed as a product, which is in the form of
 146 INDIAN PATENT LAW AND PRACTICE

medium because the novelty lies in the software. That is, when a novel
software program is written onto a general purpose hardware device
(for example, memory device) and claimed as the hardware device, the
invention will still be considered as the software itself and, therefore, will
not be allowed, as the hardware device has not been adapted specifically
for the software program.
The example claims provided earlier may not be allowed as the novelty
lies in the software and the computer program product claimed is not
being adapted to the software program to perform moving average filter
operations.

6.4.1.5 Technical Effect and Machine Limitation

In India, it is not enough to write a novel software program onto a general
purpose hardware device to claim a software invention. When there
is no specific adaptation of a hardware device to run a novel software
program, a software invention may be claimed as a method, provided
that the method implemented as software demonstrates technical effect.
To establish technical effect, it must be demonstrated that the invention
solves a technical problem. A mere enhancement in utility is not
considered as a solution to a technical problem.
One example provided in MPPP to illustrate technical effect in
relation to software arts is a mathematical method for digital image
processing that enhances the quality of image that is seen on a screen.
A general mathematical method carried out on numbers and produci
ng
a result in numerical form without any technical significance may
not
be considered patentable owing to the abstract nature of the
invention.
However, a mathematical method for digital image process
ing that
produces technical results in the form of enhanced image
quality that
can be viewed on a screen may be patentable, but only
in the context of
image processing. Such an invention is considered
to solve a technical
problem and, therefore, satisfies the technical
effect requirement. It
is to be remembered that the claim must not
be directed towards the
mathematical method or software that implements
the mathematical
method, as they are not statutorily allowed
subject matter. The claim
must be directed towards a method of image
processing that includes an
improved mathematical method.
Method claims relating to software inve
ntions should incorporate
the details regarding the mode of the impl
ementation of the invention
via hardware or software. Each method
claim must have a hardware or
 CLAIM DRAFTING 147

machine limitation. Technical applicability of the software, claimed as

a process or method claim, is required to be defined in relation with
the particular hardware components. By doing so, ‘software per se’ is
differentiated from software having its technical application. A claim
directed to a technical process, which process is carried out under the
control of a program (whether by means of hardware or software), cannot
be regarded as relating to a computer program as such. For example, a
method for processing seismic data, comprising the steps of collecting
the time varying seismic detector output signals for a plurality of seismic
sensors placed in a cable, cannot be considered to be a ‘software per se’
claim because the signals are collected from a definite recited structure,
namely seismic sensors.’

Example claim: A digital image processing method, comprising the steps

of:
- Transforming a digital image using an edge sensitive wavelet
transform to produce a plurality of wavelet coefficients at various
resolutions and a residual image;
* Modifying the wavelet coefficients as a function of the rate of
change of the image gradient at a resolution corresponding to the
respective wavelet coefficient, wherein the rate of change comprises
an image gradient curvature that is computed by applying a
Laplacian operator to the image gradient, thereby generating a
modification factor that is invariant to scaling of the image;
» Inverse transforming the modified wavelet coefficients and the
residual image to produce a processed digital image; and,
» Displaying said processed digital image on a display device."
There are two important aspects to be observed in this example claim:
One, the claim is directed to a method of image processing that relates
to the technical quality of an image and does not claim the mathematical
method as such, and, therefore, the method qualifies as a technical
process. Two, the technical effect of the method is realized by displaying
the improved image on a display device, and the step of displaying an
image on a display device adds machine limitation to the method claim.
If a slightly modified version of the previous example claim as shown
in the example below is drafted, it may not be allowed.
l image,
Example Claim: A method of wavelet transform on a digita
comprising the steps of:
 148 INDIAN PATENT LAW AND PRACTICE

¢ Transforming a digital image using an edge sensitive wavelet

transform to produce a plurality of wavelet coefficients at various
resolutions and a residual image;
« Modifying the wavelet coefficients as a function of the rate of
change of the image gradient at a resolution corresponding to the
respective wavelet coefficient, wherein the rate of change comprises
an image gradient curvature that is computed by applying a
Laplacian operator to the image gradient, thereby generating a
modification factor that is invariant to scaling of the image; and,
¢ Inverse transforming the modified wavelet coefficients and the
residual image to produce a processed digital image."
The modified version of the example claim may not be allowed as the
claim attempts to claim the method of wavelet transform itself rather than
a specific technical process (namely, digital image processing) involving
the wavelet transform. Further, the claim does not have a machine
limitation as well.

6.4.2 Claims in Mechanical/Manufacturing Arts

Mechanical and manufacturing related arts also have claims directed to
subject matter similar to those used in the electronic and software arts.
Patent claims in mechanical and manufacturing arts may be broadly
classified into:
1. Process claims;
2. Apparatus claims;
3. System claims; and
4. Article of manufacture claims

6.4.2.1 Process Claims

As observed earlier, it is not uncommon to use
the words process and
method in an interchangeable manner. However,
the word process is
commonly used to refer to methods employed
in the industrial context.
Therefore, process claims are found very often
in the mechanical and
manufacturing art related patent applicatio
ns.
An example claim of a process of manufact
uring roll formed profile
beams is provided hereunder. Just like any
process claim, a process claim
relating to manufacturing or mechanical
inventions must list the steps
involved in the process.

Example claim: A process of manufactu

ring roll formed profile beams
comprising the steps of roll forming a
first sheet material, travelling in
 CLAIM DRAFTING 149

Table 6.1 Claim Examples—Reference Table—Electronics/Software

Subject Matter _— Type of Example
claim

Electronics/Software Arts
Process Method A method of implementing a moving average filter
comprising:
1. Obtaining an input signal;
2. Delaying said input signal by one unit by a first
delay unit;
3. Delaying input signal by two units by a second
delay unit;
4. Adding said input signal, output of said first delay
unit, and output of said second delay unit by an
adder; and,
5. Multiplying output of said adder by a factor of 1/3
using a multiplier.

Process Method— A digital image processing method, comprising the

software steps of:
1. Transforming a digital image using an edge sensitive
wavelet transform to produce a plurality of wavelet
coefficients at various resolutions and a residual
image;
2. Modifying the wavelet coefficients as a function
of the rate of change of the image gradient at a
resolution corresponding to the respective wavelet
coefficient, wherein the rate of change comprises
an image gradient curvature that is computed by
applying a Laplacian operator to the image gradient,
thereby generating a modification factor that is
invariant to scaling of the image;
3. Inverse transforming the modified wavelet
coefficients and the residual image to produce a
processed digital image; and,
4. Displaying said processed digital image on a
display.

Product Apparatus— A moving average filter comprising:

structural 1. A first order delay unit to delay input signal by one
unit, said first delay unit connected to input signal
in parallel;

(contd)
 150 INDIAN PATENT LAW AND PRACTICE

Table 6.1 (contd)

nn
eee
ee
2. A second order delay unit to delay input signal by
two units, said second delay unit connected to input
signal and said first order delay unit in parallel;
3. An adder to add input signal, output from said first
order delay unit, and output from said second order
delay unit; and
4. A multiplier with scaling factor of 1/3 to multip
ly
with output of said adder.
Product Apparatus— 4 moving average filter comprising:
functional 1. first means to delay input signal by one unit, said
first means connected to input signal in paralle
l;
2. A second means to delay input signal by
two units,
said second means connected to input signal
and
said first means in parallel;
3. A third means to add input signal, outpu
t from said
first means, and output from said secon
d means;
and,
4. A fourth means to multiply a facto
r of 1/3 with
output of said third means.
Product System A telecommunication network system
comprising:
1. A plurality of feature modules;
2. A plurality of interface modules,
each of which is
associated with an external line or
trunk:
3. Communication channels connecti
ng the modules;
4. Means for dynamically asse
mbling the feature
modules in a graph that connects
interface modules
that are Participating in a communic
ation:
5. Usage such that the assemble
d feature modules
implement features for the commun
ication usage.

beam,!

6.4.2.2 Apparatus Claims

As illustrated with exampl
es for electronic and sof
necessary, the construction tware arts, wherever
al/structural elements an
between such construct d inter-relationships
ional/structural elements
identified in the apparatus cla must be clearly
ims.
 CLAIM DRAFTING 151

The example provided hereunder is an illustration of an apparatus

claim relating to an apparatus for manufacturing a roll formed profile
beams.

Example claim: An apparatus for manufacturing roll formed profile

beams comprising:
- A first material dispenser for dispensing a first material;
- A first set of rollers having an inlet in communication with the first
material dispenser to receive the first material being dispensed
therefrom, the first set of rollers being adapted to form the first
material into a first profile element having a predefined cross-
sectional profile;
« A second material dispenser for dispensing a second material
adjacent to the first material at an outlet of the first set of rollers;
- A first welding station for welding the first material to the second
material adjacent thereto;
¢ A second set of rollers for receiving the welded first and second
materials from the first welding station, the second set of rollers
being adapted to form the second material into a second profile
element having a predefined cross-sectional profile which encloses
the first profile element; and,
« A second welding station in communication with an outlet of
the second set of rollers for welding portions of the second
material together as the welded first and second materials exit
from the outlet of the second set of rollers to form a closed profile
beam."

6.4.2.3 System Claims

The system claims in the manufacturing or mechanical field must have
the system claim components specified in the section on claims in
electronic and software arts. The system claim, provided in the example,
relates to an automated manufacturing system that has a discrete set of
elements, the discrete elements being a computer processing system and
multiple consolidation systems.

Example claim: An automated manufacturing system, comprising:

+ A computer processing system, configured to define product
packages and one or more product sub-batches within each pro-
duct package in response to input product intimation, to receive
status information from one or more consolidation systems, and
 152 INDIAN PATENT LAW AND PRACTICE

to produce consolidation assignment in response to the status

information;
« A plurality of consolidation systems each comprising: a batch
storage system configured to store product sub-batches for different
product packages in accordance to the consolidation assignment;
and,
¢ A consolidation controller, configured to track the one or more
product sub-batches for a product package in the batch storage
system, to produce the status information about the batch storage
system, and to trigger the consolidation of the one or more product
sub-batches into the product package when all the product sub-
batches for the product package have been received by the
consolidation system.'4

6.4.2.4 Article of Manufacture Claims

Article of manufacture claims are product claims used in mechanical or
manufacturing arts, and refer to an article that is manufactured. An article
of manufacture is an apparatus that does not have any active elements. In
mechanical or manufacturing related arts, an active element is an element
that moves relative to other elements that are part of the apparatus. If a
claim is directed towards a subject matter that does not have parts that
move relative to each other, then the claimed subject matter is considered
to be an article of manufacture. Article of manufacture claims describe
an article in terms of the constructional elements that are part
of the
article of manufacture and their features (See Table 6.2).
In the example
provided hereunder, the article of manufacture is a tree-shap
ed candle
holder. A tree-shaped candle holder comprising:
* At least one twisted tree wire having a root end and a
branch end;
« At least one bead wrappingly connected to said
tree wire adjacent
to said branch end;
* At least one votive cup wrappingly connecte
d to said tree wire;
and,
* A base connected to said tree wire root
end, said base having a
votive cavity therein;
Wherein said tree wire is comprised of
aluminum; said bead is
comprised of coloured glass; and said base
is comprised of plaster.'’
6.4.3 Claims in Chemical and Pha
rmaceutical Arts
Like in other arts, claims Pertaining to
inventions in the chemical and
pharmaceutical sectors can also be broadly
classified into product related
 CLAIM DRAFTING 153

Table 6.2 Claim Examples—Reference Table—Mechanical/Manufacturing

Subject Type of claim Example
Matter

Mechanical/Manufacturing Arts
Process Process A process of manufacturing roll formed profile beams
comprising the steps of:
roll forming a first sheet material travelling in a path into
a first profile element having a predefined cross-sectional
profile followed by roll forming a second sheet material
travelling in a path into a second profile element having a
predefined cross-sectional profile which encloses the first
profile element to form a closed profile beam.
Product Apparatus An apparatus for manufacturing roll formed profile beams
comprising:
l. a first material dispenser for dispensing a first
material;
2. a first set of rollers having an inlet in communication
with the first material dispenser to receive the first
material being dispensed therefrom, the first set of
rollers being adapted to form the first material into a
first profile element having a predefined cross-sectional
profile;
3. a second material dispenser for dispensing a second
material adjacent the first material at an outlet of the
first set of rollers;
4. a first welding station for welding the first material to
the second material adjacent thereto;
5. a second set of rollers for receiving the welded first
and second materials from the first welding station,
the second set of rollers being adapted to form the
second material into a second profile element having
a predefined cross-sectional profile which encloses the
first profile element; and
6. (f) a second welding station in communication with an
outlet of the second set of rollers for welding portions
of the second material together as the welded first and
second materials exit from the outlet of the second set
of rollers to form a closed profile beam.

Product System An automated manufacturing system, comprising:

1. a computer processing system configured to define
product packages and one or more product sub-batches
(contd)
 154 INDIAN PATENT LAW AND PRACTICE

Table 6.1 (contd)

within each product package in response to input

product intimation, to receive status information from
one or more consolidation systems, and to produce
consolidation assignment in response to the status
information; and
2. a plurality of consolidation systems each comprising: a
batch storage system configured to store product sub-
batches for different product packages in accordance to
the consolidation assignment; and
3. a consolidation controller configured to track the one
or more product sub-batches for a product package
in the batch storage system, to produce the status
information about the batch storage system, and to
trigger the consolidation of the one or more product
sub-batches into the product package when all the
product sub-batches for the product package have been
received by the consolidation system.
Product Article of A tree-shaped candle holder comprising:
Manufacture _1. at least one twisted tree wire having a root end and a
branch end;
2. at least one bead wrappingly connected to said tree
wire adjacent to said branch end;
3. at least one votive cup wrappingly connected to said
tree wire; and,
4. a base connected to said tree wire root end, said base
having a votive cavity therein;
5. wherein, said tree wire is comprised of aluminum;
said
bead is comprised of coloured glass; and said base
is
comprised of plaster.

claims and process related claims. Having

said that, considering the
nature of inventions in chemistry and the
pharmaceutical arts different
types of claims are drafted in patent appl
ications.
6.4.3.1 Product Related Claims
The subject matter of product inventio
ns in the chemical and pharma-
ceutical sector can be broadly categori
zed into two types, namely:
1. New chemical entity including a
molecule or a compound, and,
2. Chemical or pharmaceutical com
positions.
A new chemical entity (NCE) also
known as new molecular entity is
a
 CLAIM DRAFTING 155

new chemical molecule or a compound. A chemical molecule developed

in the early discovery stage which later translates into development of a
drug product is generally referred to as a new chemical entity.
An NCE can be claimed in several ways. The simplest and the most
precise way to draft an NCE claim is to refer to the actual molecular
structure of the molecular entity in the claim.

New Chemical Entity Claims: An NCE can be claimed in several ways.

The simplest and the most precise way to draft an NCE claim is to refer
to the actual molecular structure of the NCE in the claim. For example,
what is claimed is a compound with the following (Figure 6.2) molecular
structure:
H
|

OH
Cl —N

Cl

Figure 6.2 Molecular Structure of Compound

It must be noted that the scope of protection rendered by the claim stated
in the illustration is limited to the compound bearing the molecular
structure. Such a claim is relatively easy to be granted since the scope of
the claim is very clear and unambiguous, and the patent office cannot
object to the claim based on lack of clarity. It is advisable to draft such
a claim, if what is attempted to be claimed is precisely the structure and
does not include its variants.
However, to a person having knowledge in chemistry, it is evident
that a chemical molecule can have several variants that share common
characteristics. For example, in the illustration, if Chlorine (Cl) is to be
replaced by another halogen such as Bromine (Br) or Flourine (F) it is
likely that the compound will share similar properties. However, this
protection afforded by the claim will not extend to such a variant. One
method of overcoming this limitation is by incorporating Markush type
claim language.
 156 INDIAN PATENT LAW AND PRACTICE

A Markush type claim broadens the scope of protection of the claim

to include a chemical entity along with the various variants of the same.
Markush claims are primarily close ended claims which enable claiming
a group of chemical entities that share similar properties. For example,
what is claimed is a compound having the following formula (Figure
6.3).
H
)

OH

Figure 6.3 Molecular Formula of the Compound

Wherein X is selected from a group consisting of Cl, Br, FE, and I.
In the illustration, the claim seeks protection for the structure of the
compound where X can be replaced by chlorine, bromine, fluorine, or
iodine. Thus, such a claim renders protection to the actual compound
and
its variants, provided they are substitutable. While drafting a Markush
claim one must note that since these claims are typically close-e
nded
claims, the transition phrase used in such cases should necessar
ily be
‘consisting of’ or ‘consisting essentially of’ and not ‘comprising
of’ which
is an open-ended transition phrase.
In cases where the compound is identified but its chemical
structure is
not known, such claims referring to chemical structure
cannot be drafted.
In a scenario where the chemical structure of
the compound is not
precisely known, the inventions can be claimed by
drafting a ‘fingerprint
claim’ where the novel product is defined in
terms of its physical or
chemical parameters.'°

Example: What is claimed is a chemical entity

characterized by molecular
weight of 280, having a pH of 6.5, which has
a melting point of 123 degree
Celsius and a boiling point of 180 degree
Celsius.
One other type of claim that can be
drafted where the chemical
structure is unknown is the product by
process claim. A product by
 CLAIM DRAFTING 157

process claim is used to claim a product by providing the process of

making the product. It is not clear whether such claiming is allowed in
India. However, such claims are permitted by the European Patent Office,
provided the product is novel and there is no other way of describing the
product. An example of a product by process claim is given below.
A compound prepared by a process comprising of:
1. Crushing the bay leaves;
2. Boiling the crushed extract;
3. Collecting the fumes into the tube; and,
4. Crystallizing the fumes in the tube.
Another way of claiming an NCE is by using omnibus claims where
reference is made to the description provided in the specification without
particularly stating any technical details of the invention as part of the
claim. An example of an omnibus claim is given below.
A compound for treating Hemophilia, wherein the compound is
substantially as discussed in the specification.
It must be noted that most of the patent offices including the United
States and Europe do not allow such claims. Although there is no clarity
in India with regard to granting of omnibus claims, such claims have been
granted in the past by the Indian Patent Office provided it is preceded by
a chemical structure claim sufficiently describing the technical features
of the invention.

Chemical Composition or Combination Claims: Most of the product

patents filed in the chemistry domain relate to composition or
combination of chemical compounds. Numerous chemical composition
patents are filed on a daily basis in the pharmaceutical domain and the
personal care domain.
Novel Combination product patents, including two or more already
known chemical compounds available in the public domain, are routinely
protected and commercialized in the pharmaceutical sector. Many patent
applicants who have secured a patent over a NCE also prefer to file
patents for chemical compositions incorporating the said NCE in order
to ensure maximum protection. Some of the common claims drafted for
compositions are provided hereunder.
For claiming a chemical composition, one must include all the
essential ingredients necessary for the working of the composition.
For example, if an inventor is the first to conceive an idea of making a
shampoo with anti-fungal properties and wishes to file for a patent for his
 158 INDIAN PATENT LAW AND PRACTICE

shampoo composition comprising of alkyl ether sulphate as a surfactant,

dimethicone as a conditioner, and imidazole as an anti-fungal agent, the
claim for the invention may be drafted in the following ways.
What is claimed is a shampoo composition comprising:
1. 25 per cent of alkyl ether sulphate;
2. 10 per cent of dimethicone;
3. 2 per cent of imidazole, and,
4. 63 per cent water.
As discussed in the earlier section, where chemical entity claims were
explained and in which the exact chemical structure was claimed, the
composition claim provided in the example also has a narrow scope of
protection, which is extended to a shampoo composition comprising alkyl
ether sulphate, dimethicone, and imidazole in only the concentrations
mentioned in the example claim. The protection in sucha scenario cannot
be extended to a shampoo composition where a chemical substitute of any
of these three elements is used. For instance, this claim will not provide
protection to a shampoo composition where imidazole is replaced
by
triazole or tetrazole, which is likely to provide similar properties.
Also, such a claim will not provide protection for a shamp
oo
composition having the same ingredients if the concentration
of such
ingredients is different. For example, if the concentration
of imidazole is
changed from 2 per cent to 3 per cent, sucha composition
will fall outside
the scope of protection of the claim.
One effective way of broadening the scope of prote
ction of such an
invention is to substitute the specific elements with
general ones and by
providing a concentration range instead of stati
ng the most preferred
concentration. The broader the range, the broader
will be the protection
conferred. While generalizing the elements of
the claim, the state of the
art must be taken into consideration in order
to avoid claiming what is
already in the prior art. Also, it must be
borne in mind that the invention
should be enabled at any concentration
that falls within the claimed
range. Therefore, the claim may be draft
ed as follows: What is claimed is
a shampoo composition comprising:
1. 20-30 per cent of at least one surf
actant;
2. 5-15 per cent of at least one con
ditioning agen
t;
3. 1-3 per cent of at least one anti-f
ungal agent, and,
4. Water.
The claim may be followed b y depend
ent claims including the specific
and preferred embodiments 0 f the invent
ion. For example, the shampoo
 CLAIM DRAFTING 159

composition as claimed in claim 1, wherein the anti-fungal agent is

selected from a group consisting of pyrazole, imidazole, triazole, tetrazole,
and pentazole.
Another claim may be drafted as follows.
The shampoo composition in claim 1, wherein said anti-fungal agent
is imidazole.
Another way of drafting a composition claim is by including the
‘markush’ language. As discussed in the previous section, markush
claims enable claiming of the entire chemical group which can be
used interchangeably without substantially changing the result. Use of
‘Markush’ language will help in reducing the number of claims in a patent
application. An example of a ‘Markush’ type claim is as follows: What is
claimed is a shampoo composition comprising:
1. 20-30 per cent of at least one surfactant;
2. 5-15 per cent of at least one conditioning agent;
3. 1-3 per cent of at least one anti-fungal agent; and
4. Water.
Wherein, the anti-fungal agent is selected from a group consisting of
pyrazole, imidazole, triazole, tetrazole, and pentazole.

6.4.3.2 Process Related Claims

The process inventions in the chemical and pharmaceutical arts are
generally chemical processes, methods of treatment, and diagnostic
methods.

Chemical Process Claims: A novel process used to make a product or

formulation is patentable subject matter in India. A process claim enu-
merates the step-wise process for manufacturing the compound or for-
mulation. Details with respect to the conditions under which the process
is carried out have to be explicitly mentioned in the claim (Table 6.3).

Example: A process for preparing a modified phosphocalcic compound

comprising:
1. Adding a gem-biphosphonic acid or an alkali metal or alkaline-
earth metal salt thereof to a suspension of a precursor phospho-
calcic compound in ultrapure water;
2. Stirring the reaction medium at room temperature; and,
3. Recovering the formed compound therefrom by centrifugation.
While drafting a process claim the drafter must bear in mind that the
steps should be listed in the logical order.
 160 INDIAN PATENT LAW AND PRACTICE

Table 6.3 Claim Examples—Reference Table—Chemical/

Pharmaceutical

Claim Category Subject matter Type of claim Example

Product Compound Structure claim A compound having the

formula C2H5CL
Markush Claim A compound having the
formula C2H5X, where X
is selected from a group
consisting of Cl, F, and Br.
Finger print A compound characterized
by a boiling point of 100 and
pH 7.
Product by process A compound manufactured
by a process comprising of
a) crush the source and
b) extract the compound.
Composition General A composition comprising of
a) 10-20% of C2H5Cl and
b) 80-90% of water.
Markush Claim A composition comprising of
a) 10-20% of C2H5X and
b) 80-90% of water, where
X is selected from a group
consisting of Cl, Br, and F.
Process Chemical A process of manufacturing
Process X by
. a) crushing the source and
i b) extracting the compound.
RE -)OETRN
6.4.4 Claims in Biotechnology Arts
Various jurisdictions have varied level
of tolerance for biotechnology
related inventions. While it is possible
to get a patent for a genetically
modified multicellular organism in
the United States, it falls under
non-patentable subject matter in India.
The Indian Patent law, however,
allows patenting of isolated gene and
genetically modified unicellular
organisms.
Like in chemical and pharmaceutic
al inventions, biotechnology
related inventions can also
. be broadly classified into two cate
namely, product-related inventions and process- gories,
related inve ntions. This
 CLAIM DRAFTING 161

part of the chapter explains the various types of claims that are usually
drafted in these categories.

6.4.4.1 Product Related Claims

For a novel invention pertaining to gene sequences several aspects can
be claimed as a single inventive concept including gene sequence, amino
acid sequence, a method of expressing the sequence, vector, and host used
for expression of the gene, an antibody against the protein/sequence, and
a kit made from the antibody/sequence."”
Gene Sequence/Amino Acid Sequence Claims: Gene sequences whose
function is disclosed in the specification are patentable in India.'* While
filing an application relating to gene sequences, the sequences must be
submitted to the patent office in digital copy. Each sequence needs to
be provided with a reference number also referred to as SEQ ID no.
Given below are some types of claims that are typically used to claim a
gene sequence. For example, what is claimed is an isolated nucleic acid
comprising a nucleic acid sequence ATGGGCCTAACGTGAGGGAATT
CGAAATTC.
Including the entire sequence in the claim may not be viable in case
of a long nucleotide sequence as it can run into several pages. Since the
digital copy of the sequence is submitted along with the specification, it
is sufficient to incorporate the sequence identification number (SEQ ID.
no.) in the claim. For example: what is claimed is an isolated nucleic acid
molecule comprising a nucleic acid sequence of SEQ ID no. 1. “
Although, nucleotide sequences are very specific, slight variations
in the bases may not entirely change the nature of the final product.
However, these small changes may suffice a competitor to circumvent the
claim. In order to overcome this limitation, one can claim a nucleotide
sequence by referring to its complementary sequence.
Example: A nucleic acid molecule comprising a nucleic acid sequence
i
!

that hybridizes to SEQ ID no.1 under stringent conditions.

Furthermore, a nucleotide sequence can also be claimed by combining-~
both the above mentioned claim types in a single claim.

Example: A nucleic acid molecule comprising:

tet
vi
1) SEQ ID no.1;
™"
or
no.1 under stringen®:
2) anucleic acid sequence that hybridizes to SEQ ID
conditions.
 162 INDIAN PATENT LAW AND PRACTICE

Due to the redundancy of genetic code where a single amino acid can be
coded for by more than one codon, several nucleic acid sequences may
code for the same amino acid sequence. For example: UUA, UUG, CUU,
CUC, CUA, and CUG, code for Leucine. In such a case, if the sequence
having the codon UUA is claimed, it will not protect a sequence having
the codon UUG in place of UUA, although the final product would
remain unchanged. In order to overcome this problem most patents
claim the amino acid sequence separately in addition to claiming the
nucleic acid sequence. For example: What is claimed is an isolated nucleic
acid molecule which encodes a polypeptide comprising the amino
acid
sequence
Met Ala Asp Asp Cys Glu Phe Val Gly Ser Ala Val
or
an isolated nucleic acid molecule which encodes a polypeptide
comprising
the amino acid sequence of SEQ ID no. 2.
In this case one must note that even if the claim comprises
the amino
acid sequence, protection can be conferred to the nucle
ic acid sequence
encoding the said amino acid.

Expression Vector Claims: An expression vector

can be simply claimed as
a vector comprising a nucleic acid molecule comp
rising the nucleic acid
sequence of SEQ ID no.1
In most scenarios the vector is claimed alon
g with the nucleic acid
sequence. Hence, vector claims are invariab
ly dependent on the nucleic
acid claims. For example: What is claimed
is a vector comprising a nucleic
acid molecule as claimed in claim 1.

Host Cell Claims: A host cell can be cla

imed in the following way.
A transgenic host cell that contains the
vector, comprising a nucleic acid
molecule, comprising the nucleic acid
sequence of SEQ ID no.1.
or,
A transgenic host cell that contai
ns the vector claimed in claim 2.
Antibody Claims: The claimed ami
no acid sequence usually forms a
of a protein. In most cases, the ami part
no acid forms a part of an antibo
molecule which can be used in dy
 CLAIM DRAFTING 163

Example: What is claimed is: An isolated antibody or fragment thereof

comprising the amino acid sequence of the VH and VL domains of SEQ
ID no. 2.
Such a claim will confer protection for the antibody comprising the
amino acid sequence claimed in the earlier claim.
Antibody Kit Claims: An antibody kit that includes the antibody
comprising the amino acid sequence can also form a part of the same
inventive concept and, therefore, can be claimed in the same patent
application. A claim for the antibody kit will typically be as follows:
What is claimed is a kit comprising the antibody or fragment thereof of
claim 3.
or,
a kit for producing a protein, at least comprising the nucleotide sequence
of claim 1, or a gene expression vector at least, comprising the nucleotide
sequence of claim 1.

6.4.4.2 Process Related Claims

Like claims for chemical inventions, process claims are also drafted in
the biotechnology field. The basic issues that need to be considered for
drafting process claims for biotechnology inventions is the same as in
chemistry. The steps mentioned should be comprehensive and should
have a logical order. Also, all the conditions required for carrying out the
process should be explicitly mentioned in the claim. The most frequently
used process claims in biotechnology arts are method of expression claim
and the biotechnological process claims.
Method of Expression Claim: Claims relating to method of expression
must include several components including the nucleic acid sequence,
expression vector and host cell. Nucleic acid sequence claims have already
been discussed in the previous section of this chapter. In order to ensure
complete protection over the expression of the nucleic acid, one must
without fail include claims claiming the expression vector and host cells
as well. Given below are a few examples.
The method of expression claims have to include the step-wise
process for expression which includes the nucleic acid, vector, and host.
For example, a method of expressing a target protein or polypeptide
ion
comprising the steps of: (a) transfecting a host cell with the express
expression
vector of claim 2; (b) culturing the host cell transfected with the
protein or
vector under conditions that permit expression of the target
tide.
polypeptide; and (c) isolating the target protein or polypep
 164 INDIAN PATENT LAW AND PRACTICE

Biotechnological Process Claims: These are general process claims. The

rules applicable to a chemical process claim mentioned in the previous
section may also be applicable to these claims.

For example: A process for making an insulin precursor or an insulin

analog precursor, said method comprising (1) culturing a host cell,
comprising a polynucleotide sequence encoding an insulin precursor or
an insulin analog precursor, according to claim 1 under suitable culture
conditions for expression of said precursor; and (2) isolating the expressed
precursor (Table 6.4).

Table 6.4 Claim Examples—Reference Table—Bio-Technology

Claim Category Subject matter Example
Se ee oe en 2 lle SS
Product Gene An isolated nucleic acid molecule comprising a
nucleic acid sequence of SEQ ID no. 1.
An isolated nucleic acid molecule which encodes a
polypeptide comprising the amino acid sequence of
SEQ ID no. 2.
An isolated nucleic acid molecule comprising a
nucleic acid sequence that hybridizes to SEQ ID
no.1 under stringent conditions.
Vector A vector comprising a nucleic acid molec
ule
comprising the nucleic acid sequence of SEQ
ID
no.1.
Host A transgenic host cell that contains the
vector
comprising a nucleic acid molecule comprising
the
nucieic acid sequence of SEQ ID no.1.
Antibody An isolated antibody or fragment there
of compris-
ing the amino acid sequence of SEQ ID no.
2.
Antibody Kit A kit comprising the antibody or frag
ment thereof
of claim 3.
Process Method of A method of expressing a targe
t protein or
expression polypeptide comprising the steps
of: (a) transfecting
a host cell with the expression
vector of\claim 2;
(b) culturing the host cell tran
sfected with the
expression vector under cond
itions that permit
expression of the target protein
or polypeptide; and
(c) isolating the target protein
or polypeptide.
 CLAIM DRAFTING 165

Process of A process for making an insulin precursor or an

isolating the insulin analog precursor, said method comprising
gene product (i) culturing a host cell comprising a polynucleotide
sequence encoding an insulin precursor or an
insulin analog precursor according to claim 1
under suitable culture conditions for expression
of said precursor; and (ii) isolating the expressed
precursor.

6.4.5 Claims Relating to Diagnostic Methods

An in vivo diagnostic method is not patentable in India. However, an
in vitro diagnostic method may be patentable. A patent drafter has to
ensure that the in vitro nature of the test is explicitly included as a part
of the claim in order to qualify for a patent in India and Europe. The
drafter may choose to draft a diagnostic claim as a method claim as well
as a product claim. A method claim must include the in vitro diagnostic
method in a step-wise logical order. For example: A method for in vitro
diagnosis of malaria antibodies in a biological sample, comprising:
1. Contacting said biological sample with a composition comprising a
protein, according to claim 3, under appropriate conditions which
allow the formation of an immune complex, wherein said peptide
is labelled with a detectable label, and,
2. (ii) Detecting the presence of said immune complexes visually or
mechanically.
Another way of claiming a diagnostic method is to claim it as a product
such as a diagnostic kit. Such a claim will include a kit along with its
components, which can be linked to the step-wise method of diagnosis.
For example: A diagnostic kit used for detecting malaria antibodies in
a biological sample comprising of the protein, according to claim 3,
where the said protein is brought in contact with the biological sample
under appropriate conditions which allow the formation of an immune
complex, wherein said peptide is labelled with a detectable label, and the
presence of said immune complexes visually or mechanically detected
(Table 6.5).
To summarize, chemical, biotechnology, and diagnostics related
al
inventions can be claimed both as a product and a process. A chemic
can be
product includes a compound or a composition. Markush claims
type claims
drafted for both NCE and chemical compositions. Markush
r of claims.
enable broader protection and help in reducing the numbe
 166 INDIAN PATENT LAW AND PRACTICE

Table 6.5 Claim Examples—Reference Table—Diagnostic Methods

ee ee eee ee
Claim Category Subject Matter Example
FS PE EE ES |et TP PRET, SFE a eI deel
Product Kit A diagnostic kit used for detecting malaria
antibodies in a biological sample comprising of
the protein according to claim 3 where the said
protein is brought in contact with the biological
sample under appropriate conditions which allow
the formation of an immune complex, wherein
said peptide is labelled with a detectable label.
Process In vitromethod A method for in vitro diagnosis of malaria
antibodies in a biological sample, comprising
(i) contacting said biological sample with a
composition comprising a protein according to
claim 3 under appropriate conditions which allow
the formation of an immune complex, wherein
said peptide is labelled with a detectable label,
and (ii) detecting the presence of said immune
complexes visually or mechanically.

They are always close-ended claims. In composition claim

s it is advisable
to include a concentration range rather than providing
the most preferred
concentrations.
For biotechnology inventions both product and
process claims can
be drafted. Product claims can be drafted for
gene sequences, hosts, and
vectors. A gene sequence can be claimed by
referring to the nucleic acid
or amino acid. In case of very long sequence
s, it is preferable to include
the reference identification numbers in
the claim since a digital copy of
the sequences are submitted to the patent
office at the time of filing.
Process claims can be drafted for the met
hod of expression and process
of isolation of the expressed gene prod
uct. In diagnostic methods, an in
vivo method is not patentable in Indi
a. A diagnostic method may be
patentable if it is carried out outside
the human body, that is, in vitro.
Both process and product claims
can be drafted for a diagnostic met
A diagnostic kit can be claimed as hod.
a product and an in vitro method
diagnosis can be claimed as a process. of
The drafter must always bear
in mind that the Indian patent
evaluates every claim on its Own office
merit.” This means that if one
claims is objected, it does not of the
affect the validity of the others
therefore, important to make . It is,
claims on all aspects of the
enable the applicant to get the inv ent ion to
widest form of protection.
 CLAIM DRAFTING 167

6.5 CLAIM INTERPRETATION AND ANALYSIS

6.5.1 Sources of Interpretation

Claims of a complete specification must be clear and succinct, and fairly
based on the matter disclosed in the specification.” As the claims must be
based on the matter provided in the specification, they must be interpreted
in the light of the specification, which includes the description, drawings,
and so on. Therefore, the primary source of interpreting claims is the
specification. In addition to the specification, prosecution history or file
wrapper history, information in the state of the art and dictionaries in the
field, may also be used as sources to understand the scope and meaning
of claims.

6.5.2 Clarity of Claims

Claims must clearly define the boundaries of protection sought by a
patent application. Patent claims define the boundaries of protection by
reciting the structural elements and their interrelationships in a machine
or a product, or by reciting a sequence of actions involved in a method or
a process. In order to clearly define the boundaries of an invention, it is
important to use unambiguous language in claims.
The following guidelines will help in drafting lucid claims:
Avoid Ambiguous terms: In general, terms that are not exact in the
meaning they convey must not be used in claims. Terms that are not exact
in their meaning may include like, close to, almost, near, and so on. For
example:
Example 1: ...where said short range communication technology is
Bluetooth.
Example 2: ...where said short range communication technology is a
communication technology like bluetooth.
Example 1 is clearer in defining a short range communication
technology that was used as part of an invention compared to
example 2 because example 2 does not clearly state the meaning of the
phrase ‘a communication technology like bluetooth. It could mean a
communication technology that has range similar to bluetooth, or it
could mean a communication technology that has frequency similar to
that is used in bluetooth communication. Therefore, language like the
one in Example 2 should be avoided.
Avoid glorification. Glorification of the invention in claims must be
avoided. The object of a patent application is to demonstrate that the
 168 INDIAN PATENT LAW AND PRACTICE

invention is novel, useful, and has industrial applicability. There is no

need to glorify an invention in the claims as it does not serve the purpose
of the claims to clearly define the boundaries of protection sought in a
patent application.

Example 1: ...where said greatly improved device comprises of:

The phrase greatly improved in Example 1 is not necessary as it
neither adds to the description of device nor helps in clearly defining the
boundary of the protection sought for the device. Adjectives or terms
that glorify an aspect of an invention also fall under the category of
ambiguous terms and must be avoided.
Use appropriate punctuation and references to remove any ambiguity
in claims:
Appropriate punctuation must be used in order to avoid any vagueness
in a claim.
Example 1: A tool for manufacturing a machine comprising...
It is not clear in Example 1 whether the text that follows the word
comprising is part of the machine or is part of the tool. The same may be
rewritten in the following manner:
Example 2: A tool for manufacturingamachine, comprising...
Example 2 is clear as compared to Example 1. However, there may
still be some ambiguity in asserting that the text following the word
comprising forms part of the tool rather than the machine. Exampl
e 2
can be further improved to make the claim clearer in the following
way:
Example 3: A tool for manufacturing a machine, said tool
comprising ...
Example 3 removes any ambiguity in asserting that the text follo
wing
the word ‘comprising’ is in fact part of the tool and theref
ore is the best
mode of writing a claim.
Avoid including material that does not form part
of the invention.
Any material or information that does not form
part of the invention
must be avoided in a claim. For example,
if an invention relates to an
improved ceiling fan where improvement of
air circulation is achieved
through improved design of blades, the essential
aspects of the invention,
which comprise of the number of blades and
the shape of blades that
achieve the improved air circulation, must be
specified. The claim must
not contain other elements like the rotor and
electrical mechanisms that
are essential parts of the fan but do not form
part of the invention.
 CLAIM DRAFTING 169

6.5.2.1 Unity of invention

Claims in a patent application must relate to a single invention or
inventive concept. Claims relating to more than one invention in a single
application will not be accepted and divisional applications may have to
be filed with respect to each additional invention.

NOTES
1. Para 5.8.1, Draft Manual of Patent Practice and Procedure, 2008.
2. The word ‘element’ is used to refer to a structural (physical) feature of the
invention, if the claim is a product claim, and to a step or an action if the claim is
a method or process claim.
3. Para 5.8.4(c), Draft Manual of Patent Practice and Procedure, 2008.
4. Para 5.8.4(d), Draft Manual of Patent Practice and Procedure, 2008.
5. Para 4.11.7, Draft Manual of Patent Practice and Procedure, 2008.
6. Based on independent claim 1 of US patent 6404878.
7. Based on independent claim 1 of US patent 4149258.
8. Section 3(k), The Patents Act, 1970 as amended in 1999, 2002, and 2005.
9. Para 4.11.6, Draft Manual of Patent Practice and Procedure, 2008.
10. Based on independent claim 1 of US patent 6,611,627.
11. Based on independent claim 1 of US patent 6611627.
12. Based on independent claim 14 of US patent 7073259.
13. Based on independent claim 1 of US patent 7073259.
14. Based on independent claim 1 of US patent 7317960.
15. Based on independent claim 1 of US patent 6923641.
16. http://www.intelproplaw.com/Forum/Forum.cgi?board=patent drafting;
action=display; num=1 136203018 (last accessed on 9 April 2010).
17. Para 5.8.11(f) iv, Draft Manual of Patent Practice and Procedure, Indian
Patent Office.
18. Annexure 1(7), p. 142, Manual of Patent Practice and Procedure, Indian
Patent Office.
19. Para 4.4, Manual of Patent Practice and Procedure, Indian Patent Office.
20. Section 10(5), The Patents Act, 1970 as amended in 1999, 2002, and
2005.
 7
Patent Assignment and Licences

7.1 ASSIGNMENT AND LICENCES

Ae holder can transfer his patent rights to any person at any time
before the expiry of the patent.' Transfer of patent rights is generally
done through an assignment or a licence? An assignment involves
a
transfer of ownership in the patent and a licence includes an authori
zation
to exercise the patent rights. For example, If A assigns his patent
over a
Time Machine to B, from the time of assignment, B acquires
ownership
over the patent. However, if A grants a licence to use his
patented Time
Machine to B, B will get the right to exercise rights over
A’s patent for
the period of licence but will not acquire any ownership
rights over the
patent.
An assignment or a licence is valid only if the
parties enter into an
agreement in writing, which is signed by both
the parties.’ All terms
and conditions of the assignment or licen
ce, including rights and
responsibilities of the parties, must be specified
in the agreement.‘ After
an assignment or licence agreement is signe
d by the parties, the party
acquiring title or interest in the patent as
a result of such assignment or
licence must register the title or interest at the
patent office.* Information
concerning the title or interest relating to
a patent may be registered
through an application in writing to the Contr
oller.S Such an application
must be filed in Form 16 by the assignee or the licen
see, as the case may
 PATENT ASSIGNMENT AND LICENCES 171

be, or the patent holder.’ Certified copies of the assignment or licence

agreement, and any other document requested by the Controller must be
filed along with the application as proof of title or interest.*
On receiving such an application, the Controller will review the docu-
ments and on being satisfied with the proof, he will enter the details in
the register of patents.’ In case of an assignment, the assignee will be
entered as a proprietor or co-proprietor of the patent and in case of a
licence, the interest of the licensee will be specified in the register.'° The
details of the assignment or licence agreement, that gives rise to the title
or interest, will also be entered in the register, by the Controller.'! On re-
quest of either of the parties, the terms and conditions of a licence will be
maintained confidential by the Controller.'? The details will be disclosed
only based on a court order.’ It must be noted that an assignment or
licence agreement that is not entered in the register will not be accepted
as evidence by the Controller or the court in any proceeding except for
proceedings relating to rectification of the register.'*

National Research Development Corpn v. ABS Plastics Limited

The National Research Development Corpn. (NRDC), was the assignee
of two patents relating to a process for the manufacture of Terpolymers
of Acrylonitrile Butadine (ABS Resigns) using what was known as
emulsion technology.'® The invention was developed and patented by
Shri Ram Institute of Industrial Research, under one of NRDC’s sponsor-
ship schemes of the Council for Scientific and Industrial Research,
before being assigned to NRDC.'* NRDC licensed the patents to ABS
Plastics Limited (ABS) on 23 July 1975, for a period of eight years.'’
Under the licence, ABS paid a lump sum royalty of Rs 60, 000 (Rupees
sixty thousand) and agreed to pay a running royalty of | per cent on
the net ex-factory sale price of the material manufactured using the
patented process.'* As ABS failed to pay the royalty due under the licence
agreement, NRDC filed a suit to enforce the agreement and claimed the
pending royalty with interest."
After reviewing the facts of the case and hearing the arguments of
the parties, the court held that the licence agreement was not valid and,
therefore, not enforceable because it was not registered at the patent
office.” The court cited Section 68 of the Patents Act, which provides
that a licence agreement must be registered at the patent office within
six months of its execution in order for it to be valid.” Further, the court
stated that the licence agreement would not be valid after 31 October
1979 and 2 May 1981, because the patents expired on the said dates.” It
 72 INDIAN PATENT LAW AND PRACTICE

pointed out that a licence agreement over a patent would not be binding
on the licensee, ABS, after the expiry of the patents.” As the licence
agreement was not valid, the court refused to grant relief to NRDC under
the agreement.

7.2 COMPULSORY LICENCES

The objective of a patent grant is not only to encourage creation of
inventions but also to promote commercial working of such inventions.”
As laid down under the Act, a patent must be made available at a
reasonable price to the consumers and must facilitate technology transfer
and dissemination, nationally and internationally.** It must not impede
protection of public health, be against public interest, or impede national
industrial progress.”
A compulsory licence will be granted on a patent. If the patent holder
uses his patent in a manner that contravenes the aforesaid objective. A
compulsory licence is a licence granted by the government to a third
party without the permission of the patent holder. The purpose of the
grant of such a licence is to ensure that the patent is used in accordance
with the philosophy underlying the patent grant.

7.2.1 Conditions
A compulsory licence will be granted over a patent by the Controller if
any of the following conditions are satisfied:
1. The reasonable requirements of the public have not been satisfied:
2. The patented invention is not available to the public at a reasonably
affordable price; or,
3. That the patented invention is not worked in the territory
of
India.””

7.2.1.1 Reasonable Requirements of the Public

A compulsory licence will be granted if the patent
holder does not meet
the reasonable requirements of the public with respect
to the patent. The
Act provides a list of circumstances in which reasonable
requirements of
the public will not be met. They are:
a. The patent holder does not grant a licence on
reasonable terms and as
a result:

if X acquires a patent over a process

reserving milk for one year at normal temp
erature and refuses
to license the patent, reasonable requirements
of the public may
 PATENT ASSIGNMENT AND LICENCES 173

not be met because that would prejudice the development of the

dairy industry in India;
ii. The demand for the patented product is not met adequately or
on reasonable terms.” For example, if X acquires a patent over
an environment friendly car that can run on water and sells only
two cars every year at a very high price, his refusal to license
the technology may amount to non-satisfaction of reasonable
requirements of the public because the demand for the product is
not being met adequately by the patent holder;
iii. A market for export of the patented article manufactured in India
is not being supplied or developed.*° For example, if X acquires
a patent over a method of making cloth, which has great export
potential, and refuses to give a licence for manufacturing the cloth
for export, the reasonable requirements of the public may not be
met because the export demand is not being supplied; or,
iv. The establishment or development of commercial activities in
India is prejudiced.*' For example, if X acquires a patent over an
advanced financial transaction device, which facilitates fast and
efficient fund transfer, and does not license it to nationalized banks
in India on reasonable terms, the reasonable requirements of the
public may not be met because it can prejudice the development
of commercial activities in India.
b. The patent holder imposes conditions governing the licence, sale, or
use of a patented product or process, which:
1. Prejudice the manufacture, use, or sale of non-patented materials
in India; or,
2. Prejudice the development of any trade or industry in India.” For
example, if X licenses his patent relating to a switch and imposes
a condition that non-patented switches must not be sold by the
licensee, the reasonable requirements of the public may not be
met because the condition prejudices the sale of non-patented
materials. In such a case, a compulsory licence may be granted by
the Controller to the customers of the applicant in addition to the
applicant for the compulsory licence.”
c. The patent holder includes any of the following conditions in the
licence:
1. Exclusive grant back of rights on improvements in the patented
product or process.” An exclusive grant back clause is a clause
that requires the licensee to grant back any rights over the
improvements to the patent holder. For example, if X licenses his
 174 INDIAN PATENT LAW AND PRACTICE

patented lock to Y, and imposes a condition in the licence that

ownership in improvements in the lock must be transferred back
to X exclusively, the reasonable requirements of the public will not
be met because the licence has an exclusive grant back clause;
2. Prohibition of challenge of patent validity.** For example, if the
patent holder includes a clause in the licence stating that the
licensee cannot challenge the validity of the licensed patent, the
reasonable requirements of the public will not be met; or,
3. Clause that amounts to a coercive package licence.** For example,
if X licenses his patent relating to a printer and incorporates a
condition in the licence that the licensee must buy the cartridges,
which are not patented, only from X, the patent will not meet
reasonable requirements of the public because it would amount
to coercive package licensing.
d. The patent holder does not work the patented invention in India to
the fullest possible extent or on a commercial scale to an adequate
extent.*”
For example, if X acquires a patent over a cost effective water pu-
rification system and sells only two of the systems only in Karnataka,
the patent may not meet the reasonable requirements of the public
because it was not available all over India and, therefore, has not been
worked to the fullest possible extent.
e. The working of the patented invention on a commercial scale
in India
is being prevented or hindered due to importation of the
patented
invention by:
1. the patent holder or any person authorized by
him;
2. persons purchasing from the patent holder, direc
tly or indirectly;
or
- any person against whom the patent holder
has not taken
infringement action.**
Example: X acquires a patent over a DVD
player and gives a non-
exclusive licence to Y. Z starts selling the pate
nted players in India by
importing from China and X does not take
any action against Z. In
such a case, the reasonable requirements
of the public will not be met
because X has failed to take any infringement
action against Z.
7.2.1.2 Reasonably Affordable Price
The price of a patented invention must be
reasonable and not beyond the
capacity of the general public. A compulsor
y licence will be granted if a
patented invention is not available at affo
rdable prices to the public. For
 PATENT ASSIGNMENT AND LICENCES 175

example, if X gets a patent over a drug for treating diabetes and prices it at
Rs 1,000 per tablet, then a compulsory licence may be granted because the
patented drug is not available at a price affordable by the general public.

7.2.1.3 Worked in India

The objective of a patent grant is to ensure that the patented invention is
worked in India on a commercial scale and in a reasonably practicable
manner. A compulsory licence will be granted if the patented invention
is not worked in India. A patented invention will be considered to be
commercially worked in India if it is manufactured in India, imported
into India, licensed, forms part of a product that is sold in India, or
commercialized in any other manner. For example, if X acquires a
patent over a cricket ball but does not sell such cricket balls in India, a
compulsory licence may be granted because the invention has not been
worked in India.

7.2.2 Procedure for Grant of a Compulsory Licence

The steps involved in the grant of a compulsory licence are shown in the
flow diagram hereunder (Figure 7.1).
Any interested person may make an application for a compulsory
licence after the expiry of three years from the date of patent grant.”
Even a person, who is the holder of a licence over the patent, may file
an application for a compulsory licence.’ The application must state
the nature of the interest of the applicant, the facts in support of the
application, and the conditions the applicant is willing to accept." It must
be filed in Form 17 or Form 19.”
After reviewing the application, if the Controller is satisfied that the
applicant has made a prima facie case on the conditions for grant of a
compulsory licence, he will direct the applicant to send copies of the
application to the patent holder or any other person having an interest in
the patent.” Thereafter, the Controller will publish the application for the
compulsory licence in the official journal of patents.”
The patent holder or any other person may oppose the application
by filing a notice of opposition within two months from the date of
publication.” The notice of opposition must state the grounds of
opposition, terms and conditions of the licence acceptable by the
opponent, and necessary evidence in support of the opposition.” Once
it is filed, the notice of opposition will be served on the applicant for a
compulsory licence.” The Controller will then fix a date and make a
the
decision on grant of compulsory licence after hearing the parties on
 176 INDIAN PATENT LAW AND PRACTICE

Grant of Patent

Application for Compulsory Licence

may be filed at any time after 3 years of grant of patent

Is there a Prima Facie Case?

Notify the Patent Holder Inform the Applicant

Publish the Application

No Opposition Opposition within

within 2 months 2 months

Opposition proceedings

Compulsory Licence Compulsory Licence

granted Compulsory Licence
refused
refused
Figure 7.1 Flow Diagram—Compulsory
Licence Procedure
 PATENT ASSIGNMENT AND LICENCES 177

said date.** The procedure for opposition of a patent will be followed by

the Controller for conducting the hearing.”
On reviewing the application for compulsory licensing, if the
Controller is of the opinion that a prima facie case has not been made,
he will notify the applicant.*° Thereafter, the applicant may request for
a hearing within one month from the date of such notification and if
such a request is not made, the application for compulsory licence will
be refused by the Controller.*' On receiving the request for hearing, the
Controller will hear the applicant and decide whether to allow or refuse
the application.** On allowance of the application, the patent holder will
be notified and the rest of the aforesaid process will be followed for.grant
of the compulsory licence.

7.2.3 Factors
While deciding on the grant of a Compulsory licence, the Controller will
consider the following factors:
1. The nature of the invention, the time which has passed since the
grant of the patent, and the measures already taken by the patentee
or any licensee to make full use of the invention;
2. The ability of the applicant of the compulsory licence to work the
invention to the public advantage;
3. The capacity of the applicant of the compulsory licence to
undertake the risk in providing capital and working the invention,
if the application were granted; and,
4. Efforts made by the applicant to obtain a licence from the patentee
on reasonable terms and conditions for a period of six months.”
The Controller will not consider the aforesaid factors in case of national
emergency, or other circumstances of extreme urgency, or in case of public
non-commercial use, or on establishment of a ground of anti-competitive
practices adopted by the patent holder before the date of application.” In
such circumstances, the Controller will grant a licence in an expedited
manner in order to cater to the emergency situation.

7.2.4 Terms and Conditions

On deciding to grant a compulsory licence, the Controller will determine
the terms and conditions of such a licence. Through the compulsory
licence, the Controller will ensure that the patented invention is worked
on a commercial scale in India and that the person, who is already
ced in an
working or developing the invention in India, is not prejudi
unfair manner.”
 178 INDIAN PATENT LAW AND PRACTICE

While determining the terms and conditions of the compulsory

licence, the Controller has to make sure that:
1. Reasonable consideration is given to the patent holder after
considering the nature of the invention and the money spent
by the patent holder on creation, protection, development, and
enforcement of the invention or patent;
2. The patented invention is worked by the holder of the compulsory
licence to the fullest extent and is profitable;
3. The patented invention is available to the public at a reasonable
price that is affordable;
4. A non-exclusive licence is granted to the applicant;
5. Rights of the licence holder are not assignable;
6. Licence is granted for the balance term of the patent, unless a
shorter term furthers public interest;
7. Licence is primarily meant for supplying the Indian market;
8. The use of an invention relating to semi-conductor technology is
meant for public non-commercial use; and,
9. The licence holder is allowed to export the invention, if the licence
is granted based on anti-competitive practices of patent holder.
*”
The Controller cannot allow the importation of a patented
invention
into India by granting a compulsory licence, if such activi
ty amounts
to infringement, unless directed by the central gover
nment in public
interest.** On the grant of a compulsory licence
by the Controller, it
will be considered as a licence between the parties
and the terms and
conditions determined by the Controller will be the
terms and conditions
that govern the licence. *

Example: The Controller granted a compulso

ry licence to Rail Udyog,
which was engaged in manufacturing
railway coach and wagon
components, and track fittings over a pate
nt relating to double shaft
springy track spikes. Though an oppo
sition was raised by a company
called Keen Williams limited against the
grant of the compulsory licence,
the Controller rejected the Opposition
as the company failed to prove that
it was an interested party,.*!

7.2.5 Compulsory Licence on Relate

d Patents
The Controller may grant a com
pulsory licence on patents that are
related to a patent that is subject o fa
compulsory licence or forms part
of a application for a compulsory lice
nce. A compulsory licence may be
 PATENT ASSIGNMENT AND LICENCES , 179

granted on patents owned by the patent holder that do not form part of
the application for the compulsory licence, if the patented invention that
forms part of the application cannot be worked without such a licence.

Example: X acquires patents over a wheel and spikes used in the wheel,
and the wheel can be used only with the patented spikes. If Y applies for
a compulsory licence over the patent relating to the wheel, a compulsory
licence may be granted over the patent relating to the spikes also because
the patent over the wheel cannot be worked without a licence over the
patent relating to the spikes.
A compulsory licence may also be granted if the holder of a patent or
a licensee of a patent is prevented or hindered from working the patented
invention efficiently or to the best advantage because of the existence of
another patent.® Such a licence will be granted only if the Controller is
satisfied that:
1. The applicant for compulsory licence is capable and willing to
grant, or procure the grant of a licence, over the patent held or
licensed by him to the holder of the patent or his licensee; and,
2. The invention that is subject of the patent held or licensed, by
the applicant for compulsory licence, has made a substantial
contribution to the establishment or development of commercial
or industrial activities in India.“
For example, if X holds a patent over a spinning machine and Y holds a
patent over a motor that can run the machine with minimum energy and
maximum efficiency, X can acquire a compulsory licence over Y’s patent
because efficient working of X’s spinning machine will be hindered by
Y’s patented motor. In such a case, if there is a non-patented motor that
can help the efficient utilization of the spinning machine, a compulsory
licence will not be granted. Furthermore, in order to acquire a compulsory
licence, X must be willing to give a licence over his patented spinning
machine to Y and X’s spinning machine must play an important role in
development of textile industry in India.
On satisfaction of the conditions for grant of the compulsory licence,
the Controller may grant a licence to the applicant of the compulsory
licence on the patent and also grant a licence to the patent holder over the
applicant’s patent on request.” Such a licence is assignable only through
ry
the assignment of a patent.” All conditions for grant of a compulso
related
licence will be applicable to a compulsory licence concerning
patents.”
 180 INDIAN PATENT LAW AND PRACTICE

7.2.6 Compulsory Licence in Emergency

A compulsory licence may be granted in case of national emergency,
extreme urgency, or public non-commercial use, by notification of the
Central Government in the official gazette. On such a notification, the
Controller will grant a compulsory licence to interested persons, who
make an application for such a licence. While granting the licence,
the Controller will ensure that the patented invention is available to the
public at the lowest prices, bearing in mind the interests of the patent
holder to derive advantage from the patent.” The normal procedure will
not be applied for grant of a compulsory licence if the Controller is of
the opinion that a compulsory licence is necessary in case of national
emergency, extreme urgency, or public non-commercial use, including
public health crises, relating to Acquired Immuno-deficiency Syndrome
(AIDS), Human Immuno-deficiency Virus (HIV), tuberculosis, malaria,
or other epidemics.’!
For example, if there is a outbreak of Swine Flu in India and a company
X holds a patent over a drug for treating patients infected by Swine
Flu, the Central Government will notify that the patent is available for
compulsory licence. On such a notification, an Indian pharmaceutical
company can apply and acquire a compulsory licence over the patent.

7.2.7 Compulsory Licence For Export

A compulsory licence may be granted for manufacture and export
of
patented pharmaceutical products to any country having
insufficient
or no manufacturing capacity in the pharmaceutical sector
for the con-
cerned product in order to address public health problems.”
The licence
may be granted on any drug, formulation, or any other
product, covered
by a patent or made by a patented process, including
ingredients of a
product or diagnostic kits for use of the product.”
For example, if a country X has very high incidence
of AIDS but does
not have the capability to manufacture drugs
for treating the syndrome,
a compulsory licence may be granted over a paten
t relating to a drug for
treating AIDS to a company in India, for expo
rting the drug to X.
This compulsory licensing provision was
introduced through an
amendment into the Patent Act in 2005,
based on Para 6 of the Doha
Declaration which permitted WTO member
s to allow the export of
pharmaceutical products to other deve
loping and underdeveloped
countries not having manufacturing facil
ities to deal with public health
problems that are common among the coun
tries.”4
 PATENT ASSIGNMENT AND LICENCES 181

Such a compulsory licence will be granted only if the country has

granted a compulsory licence relating to the patented product or has
allowed importation of the said pharmaceutical products from India.”* In
such a case, the Controller will grant a compulsory licence to an applicant
on terms and conditions, which will be published by him, only for
manufacture and export of the pharmaceutical products to the specified
country.”°
On granting the compulsory licence, the Controller will publish the
following information:
1. The number of the patent that is the subject of the licence;
2. Details of the person to whom the licence is granted;
3. The quantity of the product allowed by the Controller for
manufacture and export;
4. The countries to which export is permitted and the quantity to be
supplied to each country; and,
5. The term of the licence.”
The Controller will determine the compensation to be paid to the patent
holder and the manner in which the products must be packaged.”
Furthermore, the Controller will also direct the licence holder to
incorporate information relating to quantity and features of the product
being exported to each country before shipping the products. ”

7.2.8 Revision and Termination of a Compulsory Licence

The holder of a compulsory licence may make an application for revi-
sion of the terms and conditions of the compulsory licence after twelve
months from the date of grant of the licence, if the working of the pat-
ented invention, under the existing terms and conditions, gives rise to
loss.*” The application must be filed in Form 20 and must supply the
facts and evidence in support of the application and relief sought by the
applicant.*' After reviewing the application and hearing the applicant, if a
hearing is requested, the Controller will allow or reject the application.”
On being satisfied with the facts and evidence submitted by the applicant,
the Controller will revise the terms and conditions of the compulsory
licence.
The compulsory licence may be terminated if the circumstances based
to
on which the licence was granted no longer exist and are not likely
made
recur.® It may be terminated by the Controller on an application,
patent, in Form
by the patent holder or a person having an interest in the
compulsory
21 along with evidence.” After the application is filed, the
 182 INDIAN PATENT LAW AND PRACTICE

licence holder will be served a copy of it.* On receiving the application,

the holder of the compulsory licence may object to such an application
within one month from the date of receiving the application and such
objection will be provided to the applicant.** Thereafter, the Controller
will hear the parties and decide on the application, based on the facts and
evidence submitted by the parties.®’ If the Controller decides to terminate
the compulsory licence, he will inform the parties about it along with the
terms and conditions of such termination. While making the decision
to terminate, the Controller will ensure that the termination will not
prejudice the interests of the compulsory licence holder.*

7.2.8.1 Case Examples

Compulsory licensing provisions have been used very sparingly in
India. As the data relating to compulsory licences granted in India is not
available, examples of licences granted in Malaysia, Thailand, and Ghana,
have been provided hereunder for the reader’s reference. The examples
relate to compulsory licences granted during public health crisis in those
countries.

Malaysia: Malaysia granted a compulsory licence on Antiretroviral

(ARV) drugs for treatment of AIDS. The licence was granted
on 29
September 2004, by the Malaysian Minister of Domestic Trade
and
Consumer Affairs.” The compulsory licence was granted for
two years,
after the price reduction offered by pharmaceutical companies
holding
patents over the drugs was not sufficient to meet the requir
ements of the
treatment programme of the government. Under the compul
sory licence,
the government was allowed to import ARV drugs, includi
ng didanosine
(ddI), zidovudine (AZT), and lamivudine + zidovid
ine (Combivir) from
India.*' The patent holders, GlaxoSmithKline
and Bristol-Myers, were
offered a royalty rate of four per cent of the cost
of the generic version of
the drug, but refused to take the royalty.
After the grant of compulsory licence, the cost
of ARV drugs reduced
by 81 per cent and the treatment programm
e of the government was
expanded to 4,000 patients from 1,500
patients.°? The compulsory
licence granted by the Malaysian governme
nt proved to be effective for
implementing the AIDS treatment pro
gramme and making drugs more
accessible.

Thailand: Thailand also granted a com

pulsory licence for importation
and local production of efavirenz used
for ARV therapy.® The licence
 PATENT ASSIGNMENT AND LICENCES 183

was granted by the Thailand Ministry of Health on 29 November 2006.”

The initial royalty proposed under the licence to the patent holder was
0.5 per cent of the price of the generic product.” The royalty rate was kept
open for negotiation.
After the grant of compulsory licence, Ranbaxy, an Indian pharma-
ceutical company, supplied 66,000 bottles of the generic version of
efavirens to Thailand. The issuance of licence by the government
reduced the cost of ARV drugs by 50 per cent and provided access to the
drug to 20,000 additional persons.” Furthermore, companies like Merck
also reduced the cost of their ARV drugs.

7.2.9 Value of Compulsory Licences

The compulsory licences granted in Malaysia and Thailand reduced
the price of drugs for treatment of AIDS and improved access to drugs.
Indian companies like Ranbaxy played an important role in supplying
generic versions of the drugs to both the countries. NATCO, an Indian
pharmaceutical company, recently applied for a compulsory licence to
supply to Nepal, two cancer drugs, sunitinib malate and erlotinib, whose
patents are owned by Pfizer and F Hoffman-La Roche, and the application
is pending at the patent office.”
Though, the compulsory licences had a positive impact for addressing
public health problems in the short term, pharmaceutical companies
holding patents argue that grant of such compulsory licences would
negatively impact the development of new drugs in the future. They
argue that grant of compulsory licences would act as a disincentive for
investment in research and development of drugs by preventing them
from recovering the investment expenses.

7.3 DRAFTING LICENCES AND ASSIGNMENTS

The objective of this section is to give a primer on the basic terminology
and clauses in licence and assignment agreements. The section will give
a general understanding of important clauses in the agreements. The
introduction provided in this section may be used by the reader as a
foundation for further reading on the topic.
A licence or assignment agreement must be in conformity with the
contract laws and other laws in force in India. Drafting of an agreement
depends on the terms and conditions agreed by the parties and general
clauses cannot be used without considering such terms and conditions.
The provisions in an agreement may vary, based on the field to which
the
a patent belongs, and the drafter must endeavour to understand
184 INDIAN PATENT LAW AND PRACTICE

issues pertinent to the field of invention while drafting the agreement.

For example, the provisions that are drafted in a software patent licence
agreement will differ from the provisions that go into a biotech patent
licence agreement because the issues relevant for licensing inventions
belonging to each of the fields are different.

7.3.1 Drafting a Licence Agreement

A patent bestows upon its holder the right to exclude others from making,
using, selling, or offering for sale, the patented invention in India or from
importing the patented invention into India. A licence is an authorization
given by the patent holder to a person to exercise one or more of the
patent holder's exclusive rights in the patented invention. Based on its
nature, a licence may generally be classified into three types:
1. Exclusive Licence;
2. Non-exclusive Licence; and,
3. Sole Licence.

7.3.1.1 Exclusive Licence

An exclusive licence is a licence which authorizes a person to exercise one
or more rights of the patent holder exclusively in a defined territory. For
example, if X grants a licence to Y to sell his patented light in the state of
Karnataka, exclusively, it is an exclusive licence because only Y can sell
the patented light in Karnataka.
Through an exclusive licence, the patent holder can give different
rights to different persons, exclusively in the same territory, or same right
to different persons, exclusively in different territories. For example, If X
gives a licence to Y to manufacture the patented light in Karnataka and a
licence to Z to sell the patented light in the state of Karnataka exclusively,
both are exclusive licences because both Y and Z have an exclusive licence
in the same territory to exercise different rights. Furthermore, if X gives
a
licence to sell his patented invention to Y in Karnataka exclusively and
a
licence to Z to sell the said light in Andhra Pradesh exclusively,
both are
exclusive licences because the same right is given by the patent
holder to
Y and Z exclusively in different territories.
An exclusive licence excludes a patent holder also from exerc
ising the
rights granted in the licence in the specified territory. For
example, if
X, a patent holder, grants an exclusive licence to sell his
patented table
in the tertitory of Gujarat to Y, X cannot sell such a table
in the State of
Gujarat.
 PATENT ASSIGNMENT AND LICENCES 185

7.3.1.2 Non-exclusive Licence

A non-exclusive licence is a licence, which gives the same right to more
than one person in the same territory. For example, if X gives a licence to
Y and Z to sell his patented laptop in Delhi, the licences are non-exclusive
licences because the same right is given to more than one person in the
same territory.

7.3.1.3 Sole Licence

A sole licence is a licence where the patent holder gives exclusive licence
to the licence holder and also retains the right to exercise the rights given
to the licence holder in the said territory. In an exclusive licence, even
the patent holder cannot exercise the rights given to the exclusive licence
holder. However, in a sole licence, both the licence holder and the patent
holder can exercise patent rights in the said territory. For example, if X
gives a sole licence to Y to sell his patented pen in Assam, both X and Y
will have the right to sell the pen in Assam.

7.3.2 Important Clauses in a Licence Agreement

A person who gives a licence is called the licensor and a person to whom
the licence is granted is called licensee. Some of the most important
clauses in a licence agreement are:
1. Recitals;
. Definitions;
. Grant;
. Royalty;
NY
WB
ne. Term and Termination; and
6. Warranty, Indemnity, and Liability.
Each of the aforementioned clauses have been explained with the help of
examples. It must be noted that the examples have been incorporated to
provide an understanding of the clauses and may not be considered as
comprehensive or model provisions.

7.3.2.1 Recitals
The recitals of the agreement may also be called as introduction or
background section of the agreement. The recitals section introduces
the parties to the agreement and explains the background of the
agreement. It puts the licence agreement in context and may be referred
for understanding the meaning and scope of various provisions in the
agreement.
 186 INDIAN PATENT LAW AND PRACTICE

Example: This agreement is entered on the 1st day of September, 1999

(effective date) by and between XYZ, a company registered under the
Companies Act, 1956, having its registered office at XXX, YYY, hereinafter
called the Licensor and ABC, a company registered under the Companies
Act, 1956, having its registered office at AAA, BBB, hereinafter called the
Licensee.
Whereas, the licensor holds a patent over a novel helmet and the
licensee approached the licensor for a licence over the patent. The
licensee submitted a written proposal to the licensor on 4th day of July,
1998.
Whereas, the licensor and the licensee met on the Ist day of August,
1999 to discuss the licensee’s proposal. After the discussion the Licensor
has agreed to licence the patent to the licensee in accordance with the
terms and conditions provided in this licence agreement.
The Recitals clause provided in the example not only gives the details
of the parties but also gives a short background of the transactions
between the licensor and the licensee before the date of the licence
agreement. It lays down the platform for the terms and conditions of the
agreement. The recitals clause may be used to interpret the meaning of
clauses in the agreement unless expressly provided otherwise.

7.3.2.2 Definitions
The Definitions clause, which is also called as the Interpretation clause
is a very important clause in the licence agreement. In the Definitions
clause, the licence drafter defines important terms and phrases that are
used consistently in the agreement. Wherever the defined terms and
phrases are used in the agreement, they will have the meaning attribut
ed
to them in the Definitions clause. The objective of the clause is
to avoid
ambiguity and uncertainty with regard to the meaning of
provisions in
the agreement where the defined terms and phrases are
used.
Example: (a) Licensed Patent shall mean the paten
t bearing the number,
25252, granted in India entitled, Helmet made of novel
metal.
(b) Technical Process shall mean the process
for manufacturing
the helmet, which is the proprietary information
of the licensor and is
described hereunder ...
Whenever the phrases Licensed Patent or Tech
nical Process are used in
the agreement, they will mean as provided in the
definitions.
 PATENT ASSIGNMENT AND LICENCES 187

7.3.2.3 Grant

The Grant clause is the most important clause of the licence agreement. It
defines the scope and extent of the licence granted by the licensor to the
licensee. The grant clause states the type of licence being granted, patent
right or rights that are being authorized, the territory in which the licence
is granted, and the term for which the licence is granted. Other issues,
such as sub-licensing rights, grant back, and so on, that are relevant to the
grant of licence may also be included in the grant clause.

Example: The licensor hereby grants to the licensee an exclusive licence

to make and sell the Licensed Patent within the territory of India for a
period of two years from the effective date.
The sample grant clause provides the following information:
1. Who is granting the licence to whom: licensor to licensee, which
terms have been defined in the recitals;
2. Type of licence: Exclusive licence;
3. What is being licensed: Licensed Patent, which was defined in the
definitions clause;
4. Territory of the licence: Indian territory; and
5. Term of the licence: Two years from the effective date.

7.3.2.4 Royalty
While the grant clause provides details of the licence granted by the
licensor to the licensee, the royalty clause provides the consideration paid
by the licensee to the licensor in return for the grant. The royalty paid by
the licensee to the licensor may either be lump sum, fixed, or running.
Royalty is said to be lump sum if it is paid at one instance, generally, on a
specified date. For example, if a licensee agrees to pay the licensor a sum
of Rs ten lakhs, which is to be paid on the effective date of the licence, it
is said to be a lump sum royalty.
Royalty is said to be fixed, if the licensee agrees to pay the licensor
a fixed amount of money at fixed intervals. For example, if the licensee
agrees to pay the licensor a sum of Rs one lakh on the first day of every
year for the term of the licence, then it is fixed royalty because the amount
is fixed, and time of payment is also fixed.
Running royalty is the royalty that is calculated and paid by the
is
licensee based on certain activities of the licensee. As the royalty
 188 INDIAN PATENT LAW AND PRACTICE

dependant on the licensee’s activities, the amount generally varies for

each payment by the licensee. For example, if the licensee agrees to pay
2 per cent of the sale price of every patented article sold on the first
day of every quarter, it will be a running royalty because the money to be
paid depends on the number of patented articles sold.
Most royalty clauses are a combination of two or more types of
royalties. Apart from stating the royalty to be paid by the licensee, the
royalty clause may also provide the time of payment, mode of payment,
consequences of late payment, applicable taxes, and so on. The clause
may also state the conditions for maintenance of royalty accounts.

Example: In consideration of the licence granted by the licensor, the

licensee hereby agrees to pay the licensor a lump sum royalty of Rs one
crore on the effective date. The licensee shall also pay the licensor two per
cent of the sale price of every licensed product sold. Such royalty shall be
paid on the first day of every calendar month starting from the month
that follows the effective date.
The royalty clause in the example is a hybrid clause having lump sum
and running royalty. It specifies the date on which the royalty must be
paid by the licensee, which is the effective date of the agreement for the
lump sum royalty, and the first day of the calendar month for the running
royalty.

7.3.2.5 Term and Termination

The term and termination clause is also an important clause in a licence
agreement. It defines the term of the agreement and generally provides
the start and end date of the agreement. The clause also provides the
circumstances under which an agreement may be terminated before the
expiry date and consequences of termination.

Example: The term of the licence agreement shall be

ten years from
the effective date unless terminated earlier as provided
herein. The
agreement may be terminated earlier on mutual conse
nt of the licensor
and licensee in writing. The agreement may also be termi
nated on default
of the licensor or licensee to fulfil obligations under
the agreement. On
termination of the agreement, the licensee shall pay
the royalty due to the
licensor until the date of termination.
The example provides the terms of the agreement
and circumstances
for earlier termination of the agreement. It also
provides a post-termina-
tion obligation to the fulfilled by the licensee.
 PATENT ASSIGNMENT AND LICENCES 189

7.3.2.6 Warranty, Indemnity, and Liability

Warranty, Indemnity, and Liability clauses, are also important clauses
and are generally the subject of every licence negotiation. In the warranty
clause, the licensor and/or the licensee, warrants certain elements that
form part of the licence agreement. The licensor generally warrants
aspects such as ownership of the patent, right to grant the licence, and
so on.
The licensor or the licensee agrees to make good or indemnify the loss
to the other party due to its act, omission, breach of covenants and so on
through an indemnity clause. The Indemnity clause generally focuses on
infringement of third party intellectual property, breach of obligations
under the agreement and so on. The liability clause generally defines the
scope and extent of liability of either party under certain circumstances
such as infringement, breach of covenants, and so on.

Example: With respect to warranty—The licensor hereby warrants that

the licensor is the owner of the patent being licensed under the agreement
and that the licensor has the right and ability to grant a licence over the
patent.
With respect to indemnity—The licensor hereby agrees to hold
harmless and indemnify the licensee, from and against all loss, damages,
and costs, incurred by the licensee from any infringement action relating
to the Licensed Patent brought by a third party against the licensee.
With respect to liability—The liability of the licensor, under the
agreement, shall not exceed the royalty paid by the licensee. If the
Licensed Patent is held to infringe a third party's patent by a competent
court, the licensor shall acquire a licence from the third party in order to
enable the licensee to continue the activities authorized under the licence
agreement.
A licence may be granted over an invention, patent application, or a
granted patent. All terms and conditions agreed by the parties must be
clearly incorporated in the licence agreement. Knowledge of the business
of the client will help the drafter in drafting a valid and enforceable
licence agreement that captures the business transaction clearly. A sample
licence agreement has been provided in the Appendix VB for the reader's
reference.
190 INDIAN PATENT LAW AND PRACTICE

7.3.3 Drafting a Patent Assignment

7.3.3.1 Important Clauses
An assignment of a patent transfers ownership in the patent from the
patent holder to another person. The assignment may either be a complete
or partial transfer of ownership. An invention, patent application, or a
granted patent, may be the subject matter of an assignment. The patent
holder, who transfers the patent, is called as Assignor and the person to
whom the ownership in the patent is transferred is called the Assignee.
Every assignment agreement must have the following clauses:
1. Recitals;
. Definitions;
. Assignment;
. Consideration; and
& . Term and Termination.
nN
bd
WwW

Recitals
The recitals of the agreement introduces the parties to the agreement and
provides the background to the transaction. The context to the agreement
is provided by the recitals and may be used to interpret clauses in the
agreement.

Example: This assignment agreement is entered on this 11th day of

December 2008 (effective date), by and between XYZ, a company
registered under the Companies Act, 1956, having its registered office at
XXX, Y YY, hereinafter called the assignor and ABC, a company registered
under the Companies Act, 1956, having its registered office at AAA, BBB,
hereinafter called assignee.
Whereas the assignee has approached the assignor for an assignment
of his patent relating to a novel projector and the assignor has agreed to
assign his patent for a consideration.

Definitions
As mentioned in the section on licence drafting, terms and phrases that
are used consistently and continuously in the assignment agreem
ent
may be defined in the definitions clause. Defining important terms
and
phrases will help in bringing about certainty to the agreement.

Example: The term Patent shall mean a patent granted in India

entitled
improved projector bearing patent number xxx.
 PATENT ASSIGNMENT AND LICENCES 191

Whenever the term ‘Patent’ defined in the example is used in the

agreement it will have the meaning attributed to it in the aforementioned
definition.

Assignment
The assignment clause is the most important clause in an assignment
agreement. It transfers the ownership of the patent from the assignor to
the assignee. Generally, the clause also provides the conditions of the
assignment and necessary steps to be taken in order to vest the rights in
the assignee.

Example: The assignor hereby assigns all rights, title, and interest in the
Patent to the assignee. The assignor shall take all steps and execute all
documents necessary to register the assignee’s name as the proprietor of
the Patent and to vest all rights in the Patent to the assignee.

Consideration
The consideration clause specifies the consideration given by the
assignee to the assignor in return for the assignment of the patent. It
generally contains the mode and manner of payment of consideration,
consequences of late payment, applicable taxes, and so on.

Example: The assignee hereby agrees to pay the assignor a consideration

of Rs 10 lakhs as consideration for assignment of the Patent. Such
consideration shall be paid by the assignee to the assignor on the date of
entry of the assignment in the patent registry.

Term and Termination

The term and termination clause specifies the term of assignment, if the
assignment is for a limited period of time. If the term is not specified, it
is generally considered to be an assignment in perpetuity. The clause also
provides the circumstances under which the assignment will terminate
and the consequences of such termination. Generally, the clause will also
list the post-termination obligations.

Example: The term of the assignment shall be for a period of ten years
from the effective date. The assignment of the Patent shall stand
terminated if the assignee fails to commercialize the Patent within a
period of two years from the effective date.
 192 INDIAN PATENT LAW AND PRACTICE

Other clauses such as warranty, indemnity, liability, applicable

law, and so on may be incorporated in the assignment agreement. An
assignment must be drafted to give effect to the terms and conditions
agreed by the parties. The drafter must ensure that the assignment is in
consonance with the contract laws and other laws in force in India. A
sample assignment agreement has been provided in the Appendices for
the reader’s reference.

NOTES
1. Section 70, The Patents Act, 1970.
2. Ibid.
3. Section 68, The Patents Act, 1970. Section 68 reads as follows: ‘An
assignment of a patent or of a share in a patent, a mortgage, licence or the creation
of any other interest in a patent shall not be valid unless the same were in writing
and the agreement between the parties concerned is reduced to the form of a
document embodying all the terms and conditions governing their rights and
obligations and duly executed.’
4. Ibid.
5. Section 69(1), The Patents Act, 1970.
6. Ibid.
7. Section 69 (1) and (2), The Patents Act, 1970 as amended in 1999, 2002,
and 2005 and Rule 90(1), The Patent Rules, 2003 as last amended in 2006.
8. Rule 91, The Patent Rules, 2003 as last amended in 2006.
9. Section 69(3), The Patents Act, 1970.
10. Ibid.
11. Section 69(4), The Patents Act, 1970.
12. Ibid.
13. Ibid.
14. Section 69(5), The Patents Act, 1970.
15. Ibid., at Para 2.
16. Ibid.
17. Ibid.
18. Ibid.
19. Ibid., at Para 3.
20. Ibid., at Para 10.
21. Ibid.
22. Ibid., at Para 11.
23. Ibid.
24. Section 83, The Patents Act, 1970.
25. Ibid
26. Ibid.
27. Section 84(1), The Patent Act, 1970. Section 84(1)
reads as follows: ‘At
any time after the expiration of three years from
the date of the grant of a patent,
 PATENT ASSIGNMENT AND LICENCES 193

any person interested may make an application to the Controller for grant of
compulsory licence on patent on any of the following grounds, namely:
(a) that the reasonable requirements of the public with respect to the patented
invention have not been satisfied, or
(b) that the patented invention is not available to the public at a reasonably
affordable price, or
(c) that the patented invention is not worked in the territory of India’
28. Section 84(7)(a)(i), The Patents Act, 1970.
29. Section 84(7)(a)(ii), The Patents Act, 1970.
30. Section 84(7)(a)(iii), The Patents Act, 1970.
31. Section 84(7)(a)(iv), The Patents Act, 1970.
32. Section 84(7)(b), The Patents Act, 1970.
33. Section 88(1), The Patents Act, 1970.
34. Section 84(7)(c), The Patents Act, 1970.
35. Ibid.
36. Section 84(7)(c), The Patents Act, 1970.
37. Section
84(7)(d), The Patents Act, 1970.
38. Section
84(7)(e), The Patents Act, 1970.
39. Section
84(1), The Patents Act, 1970.
40. Section
84(2), The Patents Act, 1970.
41. Section 84(3), The Patents Act, 1970 as amended in 1999, 2002, and 2005,
and Rule 96, The Patents Rules, 2003, as last amended in 2006.
42. Rule 96, The Patents Rules, 2003, as last amended in 2006.
43. Section 84(4), The Patents Act, 1970, as amended in 1999, 2002, and
2005, and Section 87(1), The Patents Act, 1970.
44. Section 87(1), The Patents Act, 1970.
45. Section 87(2), The Patents Act, 1970, as amended in 1999, 2002, and
2005, and Rule 98(1), The Patent Rules, 2003, as last amended in 2006.
46. Section 87(3), The Patents Act, 1970, as amended in 1999, 2002, and
2005, and Rule 98(2), The Patent Rules, 2003, as last amended in 2006.
47. Section 87(4), The Patents Act, 1970, as amended in 1999, 2002, and
2005, and Rule 98(3), The Patent Rules, 2003, as last amended in 2006.
48. Section 87(4), The Patents Act, 1970 as amended in 1999, 2002, and 2005,
and Rule 98(5), The Patent Rules, 2003, as last amended in 2006.
49. Rule 98(6), The Patent Rules, 2003, as last amended in 2006.
50. Rule 97(1), The Patents Rules, 2003 as last amended in 2006.
51. Ibid.
52. Rule 97(2), The Patents Rules, 2003, as last amended in 2006.
53. Section 84(5), The Patents Act, 1970.
54. Ibid.
55. Section 84(4), The Patents Act, 1970.
56. Section 89, The Patents Act, 1970.
57. Section 90(1), The Patents Act, 1970.
58. Section 90(2) and (3), The Patents Act, 1970.
 194 INDIAN PATENT LAW AND PRACTICE

59. Section 93, The Patents Act, 1970.

60. Section 84(7)(c), The Patents Act, 1970.
61. Ibid.
62. Section 88(3), The Patents Act, 1970. Section 88(3) reads as follows:
‘Where two or more patents are held by the same patentee and an applicant for
a compulsory licence establishes that the reasonable requirements of the public
have not been satisfied with respect to some only of the said patents, then, if
the Controller is satisfied that the applicant cannot efficiently or satisfactorily
work the licence granted to him under those patents without infringing the other
patents held by the patentee and if those patents involve important technical
advancement of considerable economic significance in relation to the other
patents, he may, by order, direct the grant of a licence in respect of the other
patents also to enable the licensee to work the patent or patents in regard to
which a licence is granted under section 84.’
63. Section 91(1), The Patents Act, 1970.
64. Section 91(2), The Patents Act, 1970.
65. Section 91(3), The Patents Act, 1970.
66. Ibid.
67. Section 91(4), The Patents Act, 1970.
68. Section 92(1), The Patents Act, 1970. Section 92(1) reads as follows: ‘If the
Central Government is satisfied, in respect of any patent in force in circumstances
of national emergency or in circumstances of extreme urgency or in case of public
non-commercial use, that it is necessary that compulsory licences should
be
granted at any time after the sealing thereof to work the invention, it
may make
a declaration to that effect by notification in the Official Gazette, and
thereupon
the following provisions shall have effect, that is to say, -
(i) the Controller shall, on application made at any time after the
notification
by any person interested, grant to the applicant a licence
under the patent on
such terms and conditions as he thinks fit;
(ii) in settling the terms and conditions ofa licence grante
d under this section,
the Controller shall endeavour to secure that the articles
manufactured under the
patent shall be available to the public at the lowest
prices consistent with the
patentees deriving a reasonable advantage from
their patent rights.’
69. Ibid.
70. Ibid.
71. Section 92(3), The Patents Act,
1970.
72. Section 92 A (1), The Patents Act, 1970.
Section 92 A (1) reads as follows:
‘Compulsory licence shall be available for manu
facture and export of patented
pharmaceutical products to any country havi
ng insufficient or no manufacturing
capacity in the pharmaceutical sector for the
concerned product to address public
health problems, provided compulsory licen
ce has been granted by such country
or such country has, by notification or other
wise, allowed importation of the
patented pharmaceutical products from India.’
 PATENT ASSIGNMENT AND LICENCES 195

73. Explanation to Section 92A(3), The Patents Act, 1970.

74. Para 6 of the Doha Declaration on the TRIPS Agreement and Public
Health. WTO Doc. WT/MIN(01)/DEC/2, 20 November 2001.
75. Ibid.
76. Section 92(A2), The Patents Act, 1970.
77. Draft Manual of Patent Practice and Procedure, 2008, at Para 18.4.
78. Ibid.
79. Ibid.
80. Section 88(4), The Patents Act, 1970.
81. Rule 100(1), The Patent Rules, 2003, as last amended in 2006.
82. Rule 100(2) and (3), The Patent Rules, 2003 as last amended in 2006.
83. Section 94(1), The Patents Act, 1970 as amended in 1999, 2002, and 2005,
and Rule 102(1) and (3), The Patent Rules, 2003, as last amended in 2006.
84. Ibid.
85. Rule 102(2) and (3), The Patent Rules, 2003, as last amended in 2006.
86. Ibid and Rule 102(3) and (3), The Patent Rules, 2003 as last amended in
2006.
87. Rule 102(5), The Patent Rules, 2003 as last amended in 2006.
88. Rule 102(7), The Patent Rules, 2003 as last amended in 2006.
89. Section 94(2), The Patents Act, 1970.
90. James Packard Love, Recent examples of the use of compulsory licences
on patents, Knowledge Ecology International, 8 March 2007, revised 31 March
2007, at http://www.keionline.org/misc-docs/recent_cls_8mar07.pdf (last
accessed on 9 April 2010).
91. Ibid.
92. Sara Germano, Compulsory Licensing of Pharmaceuticals in Southeast
Asia: Paving the Way for Greater Use of the TRIPS Flexibility in Low-and
Middle-Income Countries, 76 Umkclr 273 (Fall 2007) at Page 288.
93. James Packard Love, Recent examples of the use of compulsory licenses
on patents, Knowledge Ecology International, 8 March 2007, revised 31 March
2007, at http://www. keionline.org/misc-docs/recent_cls_8mar07.pdf (last
accessed on 9 April 2010).
94. Ibid.
95. Ibid.
96. Sara Germano, ‘Compulsory Licensing of Pharmaceuticals in Southeast
Low-and
Asia: Paving the Way for Greater Use of the TRIPS Flexibility in
Middle-Income Countries’, 76 Umkclr 273 (Fall 2007), p. 288.
97. Ibid.
98. Available at http://www. livemint.com/Articles/keywords.aspx?kw=
Natco% 20Pharma (last accessed on 9 April 2009).
 8
Infringement and Defences

8.1 PATENT RIGHTS

pee grant of a patent gives exclusive rights to the patent holder over
his
invention.' The patent holder can prevent or exclude any third party
from exercising any of the exclusive rights over the invention withou
t his
consent or permission. A product patent grants the follow
ing exclusive
rights:
1. Right to make;
2. Right to use;
3. Right to sell or offer the product for sale; and
4. Right to import the product into India.
For example, if X gets a patent over a Time Mach
ine, he will get the
right to exclude third parties from manufact
uring, using, selling, or
offering, the time machine for sale. X can
also prevent any third party
from importing the time machine into
India for purposes of using,
selling, or offering it for sale.
The holder of a process patent will get
the exclusive right to prevent
third parties from using the method or
process in India. Furthermore,
the patent holder will also have the exclusiv
e right to prohibit third parties
from making, using, selling, offering for
sale, or importing a product that
is obtained from the process in India4
For example, if X patents a process
of making a time machine, X will
get the right to prevent any person fro
m using the process in India. X will
 INFRINGEMENT AND DEFENCES 197

also get the right to prevent any person from making a time machine using
the process and using, selling, offering for sale in India, or importing into
India, a time machine that is made using the process.
The joint holders of a patent will get equal and undivided share in
the patent.° Each patent holder owns complete rights over the patent and
can exercise all the rights granted by the patent, independently. However,
a patent holder cannot assign or licence the patent without the consent
of the other patent holder.® For example, if X and Y are joint holders
of a patent relating to an automobile, both X an Y will own the patent
completely without any division. Either X or Y can manufacture, use, sell,
or offer the automobile for sale or import such an automobile into India,
independently without informing the other holder. However, if X wishes
to assign or licence the patent to a third party, then the consent of Y must
be taken.

8.2 TERM OF A PATENT

The term of every patent granted on or after 20 May 2003, is twenty years
from the date of filing of the patent.’ The term of every patent, which
has not expired and has not ceased to have effect on 20 May 2003, also
is twenty years from the date of filing of the application for the patent.’
For example, if X files for a patent on 1 January 1999, and the patent is
granted on | February 2009, the term of the patent will be twenty years
from 1 January 1999. If the application is an international application
filed under PCT, the term of the patent will be twenty years from the
filing date of the international application.’
The rights of a patent holder over the patented invention will be valid
only during the term of the patent. On expiry of the patent term, the
patent will enter the public domain and will be available to the general
public without limitations under the patent law. Any person, in such a
case, can exercise rights over the invention without liability.

8.3 TERRITORY OF VALIDITY

Rights granted to a patent holder are territorial. A patent granted in India
will be valid only in India and will not be valid in any other territory. In
the same way, a patent granted in another country will be valid only in
that country and no rights will exist with regard to such a patent in India.
So, a person exercising rights in India over an invention that is patented
a
in USA and not in India will not be liable for patent infringement. If
person wishes to have patent rights in different countries, he must acquire
patent grants in all such countries.
 198 INDIAN PATENT LAW AND PRACTICE

8.4 INFRINGEMENT OF A PATENT

A person will be liable for patent infringement, if he exercises any of the
exclusive rights over a patented invention without the patent holder's
permission within the territory of India. A product or process is said
to infringe a patent granted in India if the following conditions. are
satisfied:
1. The product or process in question falls within the scope of at least
one claim in the patent; and,
2. The person exercises the exclusive rights of the patent holder over
the product or process in India, without permission from the patent
holder.

8.4.1 Types of Infringement

Infringement of a patent may be either literal infringement or infringe-
ment by equivalence.

8.4.1.1 Literal Infringement

A product is said to be literally infringing if all elements of a patent claim
are present in the product, and a process is said to be literally infringing
if all steps in a claim are present in the process.

8.4.1.2 Infringement by Equivalence

Though a product or process is not literally infringing, it may be
liable for infringement by equivalence. A product is said to be liable
for infringement by equivalence, if elements in the product that differ
from the patent claim are in substance equivalent to the elements in the
patent claim. A process is said to be infringing by equivalence if the steps
differing from those in the patent claim are in substance equivale
nt to
those in the process claim in the patent. In other words, a product
or
process that includes the substance of the patented invention or
the pith
and marrow of the invention, would be infringing.'® A product
will be
considered to be equivalent of a patented invention, if
it is similar in
construction and function to the patented invention (Ravi
Kamal Bali v.
Kala Tech and Ors). Furthermore, if a product does the
same work in the
same way to produce the same result as the patented
invention, it would
be considered to be equivalent of the patented invention
.!!
8.4.2 Determination of Infringement
Determination of infringement is a mixed ques
tion of law and fact
(Farbewerke Hoechst Aktie ngesellschaft Vormals Meis
ter Lucius & Bruning
 INFRINGEMENT AND DEFENCES 199

a Corporation etc. v. Unichem Laboratories and Ors). To determine

whether the product or process falls within the scope of a patent claim,
the product or process has to be compared with the elements or steps in
each of the patent claims (Mariappan v. A.R. Safiullah). If all elements
or steps of a patent claim are present in the product or process, then the
product or process is said to be infringing, else it will not be infringing.
Determination of infringement is generally done by following the steps
laid down hereunder:

8.4.2.1 Step 1—Claim Construction

Claim construction is the first step in infringement determination. It
involves understanding of the meaning and scope of an invention in a
patent, based on the specification and claims (Raj Prakash v. Mangat
Ram Chowdhry and Ors). A claim may be understood by identifying the
elements or steps in the claim and then ascertaining the meaning and
scope of each element or step. Patent specification, prosecution history,
prior art in the field, scientific dictionaries, and other relevant sources, in
the specified order of priority may be used for understanding the meaning
and scope of each element or step in a patent claim. Prosecution History
or File Wrapper History is the interaction between the patent office and
the patent applicant during the examination process. It is to be noted that
the meaning and scope of claims is generally construed independently,
and written description or other sources would be referred only if there
is a difficulty or ambiguity in construing the claims (Farbewerke Hoechst
Aktiengesellschaft Vormals Meister Lucius & Bruning a Corporation etc. v.
Unichem Laboratories and Ors).
The pith and marrow of the invention must be construed for purposes
of ascertaining the scope of the claimed invention (Raj Prakash v. Mangat
Ram Chowdhry and Ors). While constructing the meaning and scope
of an invention, ordinary meaning in the field of the invention should
be given to words used in the specification and claims (Raj Prakash v.
Mangat Ram Chowdhry and Ors). The words in specification and claims
must be interpreted from the point of view of a person skilled in the art."”
The title of the patent may not be used for interpreting the scope of the
invention.'”

8.4.2.2 Step 2—Claim Comparison

After constructing all claims ina patent, the product or process in question
must be compared with the patent claims. The comparison must be done
of
claim by claim and element by element, or step by step. If all elements
200 INDIAN PATENT LAW AND PRACTICE

at least one claim in a patent are present in the product, literally, then the
product is said to be literally infringing. In the same way, if all steps in the
patented process are present in the process in question, literally, the said
process is said to be literally infringing.

8.4.2.3 Step 3—Equivalence analysis

Analysis of equivalence will be required only if the product or process is
not literally infringing. If literally differing claim elements in a product
or process are present in the product or process by equivalence, then
the product is said to be infringing by equivalence. There are no clear
guidelines for equivalence analysis under the Indian patent law. Courts
have held that a product or process would be infringing by equivalence
if it is in substance equivalent to the patented invention. As per the
courts, unessential variations in a product would not be considered for
determining infringement.

Example: X acquires a patent in India over a table, which is claimed as

follows:
I claim a Movable Table comprising: a flat rectangular piece of wood;
and four solid rods of equal length to support said flat rectangular piece
of wood, wherein, one end of each of said four solid rods is connected to
a corner of said rectangular piece of wood, and, wherein, each solid rod
is supported by a caster at the other end.
Y makes a table having a circular surface with long circular legs made
of wood and connected to wheel assembly and starts selling the table in
India. X files an infringement suit against Y.

Infringement Analysis
Step 1: Claim Construction
The elements of X’s table are as follows:
1. Flat rectangular piece of wood;
2. Four steel rods of equal length; and,
3. Casters.
Step 2: Claim Comparison
On comparing the elements of X’s claim with Y’s table, it
can be noted
that all elements of X’s claim are not present in Y’s table. While
X’s claim
has a rectangular surface, Y’s table has a circular surface.
The legs in
X's claim are made of steel but the legs in Y’s table are
made of wood.
However, both X’s claim and Y’s table have casters. As
all elements of
 INFRINGEMENT AND DEFENCES 201

the patent claim are not present in Y’s table, the product would not be
literally infringing.
Step 3: Equivalence Analysis
Though, two of the elements in the patent claim of X are not literally
present in the product, Y’s table may be liable for infringement if the
differing elements are in substance equivalent to X’s patent claim. An
element is said to be equivalent, if it does the same work in the same
way to produce the same result. Though Y’s table has a circular surface
as opposed to X’s rectangular surface, the function of both surfaces is
the same and such function is carried out in the same way to produce
similar result. Furthermore, though X’s claim has steel rods as legs and Y’s
claim has circular wooden legs, the function once again is in substance
the same, the manner in which the function is carried out is the same,
and the result is also similar. Thus, Y’s table can be said to be equivalent
to X's patented table.
Furthermore, Y in this instance took the pith and marrow of X’s
invention by incorporating the flat surface and legs of X’s invention and
made only unessential or insubstantial variations. Y just changed the
shape of the flat surface from rectangular to circular and used a well-
known alternative to steel, which is wood, to make legs for his table. As Y
made only insubstantial changes to his table, the table can be said to be in
substance equivalent to the patented table of X.
Therefore, as Y’s product is in substance the same as X’s claim in
construction and function, its elements are equivalent to those in X’s
claim and as Y took the pith and marrow of X’s invention, Y’s table can
be said to be infringing by equivalence. Having said that, equivalence
analysis is subjective and if it can be proved that Y’s table is in substance
different from X’s patent claim, it would not be infringing.

8.4.3 Infringement by a Patent Holder

A person may be liable for patent infringement even if he holds a patent
over his product or process, which infringes a patent of another person.
Such a situation will arise when both patents in question claim related
inventions but not the same invention. If both the patents claim the same
invention, the patent having later priority date will be revoked.
In a case involving a patent relating to a gravity fed water purification
system, the patent holder, Respondent, filed a suit against the Appellant
alleging that the Appellant's water purification system sold under the
mark Forbes Aquasure, infringes its patent (Hindustan Lever Limited
 202 INDIAN PATENT LAW AND PRACTICE

v. Mr Lalit Wadhwa and Anr.). The Appellant argued in the case that it
holds a patent on its product and that an infringement suit cannot lie
against another patentee.'* The court held in the case that Section 48,
which gives the right to a patentee to prevent other persons from making,
using, offering for sale, selling, and importing the patented product in
India, without consent can be enforced against any person.'® As per the
court, existence of a patent over a product cannot prohibit the holder of
a prior patent from taking infringement action against activities relating
to the product.'®
In other words, holding a patent does not absolve a person of liability
for patent infringement of another patent having an earlier priority date.
For example, if X holds a patent over a watch and, later, if Y acquires
a patent over a special watch with digital display. Y may be liable for
infringing X’s patent if his watch falls within the scope of X’s patent
claims. The fact that Y owns a patent on his watch does not release him
from infringement liability of X’s patent.

8.4.4 Infringement by Improved Product or Process

A person would be liable for patent infringement if he manufactures,
sells, or offers for sale, an improvement of a patented product or process.
In other words, improvement of a patented product or process will not
fall outside the scope of patent infringement if it falls within the scope of
patent claims. For example, if X has a patent over a cell phone and if Y
makes an improved cell phone with audio facilities for the blind and sells
the same, Y may be liable for patent infringement if Y’s cell phone falls
within the scope of patent claims of X.

8.4.5 Independent and Dependent Claims

A product or process liable for infringing an independent claim
may not
be liable for infringing all claims dependent on that indep
endent claim.
However, if a product or process does not infringe an
independent claim,
such a product or process would not infringe all claims
depending on such
a claim. For example, if Claim 1 is an independent claim,
and Claims 2 to
10 depend on Claim1, a product that infringes Claim
1 may not infringe
Claims 2 to 10. On the other hand, if a product does
not infringe Claim
1, it would not infringe Claims 2 to 10 also.

8.5 JURISDICTION
The district court will have jurisdiction over
a Suit relating to patent
infringement." If a defendant in an infringe
ment suit counter-claims
 INFRINGEMENT AND DEFENCES 203

for revocation of a patent, the case will then be transferred to the high
court.'* The decision of a district court is appealable to the high court.
An appeal from a decision of the high court may be filed before the
Supreme Court.

8.6 PERSONS ENTITLED TO SUE

An infringement suit may generally be filed by the holder ofa patent or his
assignee. The holder of an exclusive licence may also file an infringement
suit for acts committed by any person after the date of patent licence.”
Such a licensee will be eligible for costs, damages, and lost profits. If the
patent holder does not cooperate or join with the exclusive licensee as a
plaintiff in such an infringement suit, he will be added as a defendant in
the suit.” However, a patent holder added as a defendant will not be liable
for costs unless the patent holder takes part in the proceedings.”!
The holder of a compulsory licence also has the right to file an
infringement suit under the following conditions:
1. The compulsory licensee has called upon the patent holder to
prevent infringement of the patent and
2. The patent holder has not taken any action to prevent infringement
for a period of two (2) months of being informed by the licensee.”
Example: X acquires a compulsory licence over Ys’ patented drug for
treatment of malaria. After an year, X discovers that Z is manufacturing
the drug without a licence and requests Y to stop the infringement by Z.
Y does not take any action against Z for two months. X can now file an
infringement suit against Z.
8.7 BURDEN OF PROOF
The burden of proving infringement of a patent by a person is on the
patent holder (Farbewerke Hoechst Aktiengesellschaft Vormals Meister
Lucius & Bruning a Corporation etc. vy. Unichem Laboratories and Ors).
However, in case of infringement of a process patent to obtain a product,
burden of proof is on an alleged infringer to prove that the product was
not made by the patent holder's process.” It should be noted that the
burden will shift to the alleged infringer only if the patent holder proves
that the product being used, made, sold, offered for sale, or imported,
by the alleged infringer is identical to that made by the patented process
and if:
1. The patent is over a process to obtain a new product; or,
2. It is most likely that the product of the alleged infringer is made
using the patent holder's process; and,
204 INDIAN PATENT LAW AND PRACTICE

3. The patent holder is unable to determine the process used by the

alleged infringer to make the product through reasonable efforts.”
While determining whether the alleged infringer discharged his
burden, the court will not require him to disclose trade secrets if
disclosure of such information would be unreasonable to the alleged
infringer in the context.”

Example: X acquires a patent over a process for making a novel molecule

A. Y, a pharma company, sells compositions containing the molecule A.
X files an infringement suit against Y and proves that Y’s composition has
molecule A. In such a case, the burden is on Y to prove that the molecule
A being used in his composition is made by a process which does not
infringe on X’s patented process. |

8.7.1 Study of Relevant Cases

Lallubhai Chakubhai Jariwala v. Chimanlal Chunilal and Co.
In a case involving a patent relating to a process of treating dry fruits,
the patent holder filed a suit against an alleged infringer stating that his
process of treating dry fruits amounts to patent infringement.” The court
in the case compared the patented process and the alleged infringer’s
process and held that there was no infringement because a substantial
step in the patented process was not present in the alleged infringer’s
process.’ It stated that though the steps of:
1. Using a hot solution of washing soda instead of sulphuric acid in
the patent, which had similar effect of cleaning or removing the
dirt from the goods;
2. Using 4 and 2 per cent of bleaching solution instead of 3 per cent
used by the patent holder; and,
3. Using muriatic acid instead of acetic acid, as used by the patent
holder.
were equivalent, the alleged infringer’s process would not amount to
infringement because the alleged infringer’s process used sulphur dioxide
fumes without pressure, which was an essential step in the patent holder’s
process.” As the alleged infringer’s process had a step that was different
from that of the patent holder’s process, the court held that the alleged
infringer was not liable for infringement.”°

Laxmi Dutt Roop Chand v. Nankau and Ors

In this case, the Appellant, Laxmi Dutt Roop Chand, was the patent
holder of a patent relating to the process of manufacture of hollow
-ware,
 INFRINGEMENT AND DEFENCES 205

such as lotas, batwas, degchis, batlois, and so on.*° The Appellant filed a
patent infringement suit against the Respondents, Nankau and others,
claiming that their process of manufacturing hollow-ware violates the
patents held by the Appellant and prayed for a permanent injunction
restraining the Respondents from manufacturing the hollow-ware using
the process.*' In response to the infringement suit of the Appellants,
the Respondents claimed non-infringement and counter-claimed for
revocation of the patent.”
The court compared the claims of the patent with the process being
used by the Respondents and held that the Respondents were not liable for
patent infringement because their process does not fall within the scope
of patent claims. The court differentiated the process of the Respondents
from that claimed in the Appellant's patent in the following manner:
1. The darja of the Appellant, used in the process, was almost square
and had two lateral sides and the side of the ramming hole was
almost equal; but the side of the pouring basin was not flat. On the
other hand, the darjas which were seized from the Respondents’
place had a straight base in which the two lateral sides did not exist,
but only a semicircular frame with pouring basin existed;”
2. The system of clamping the two parts in the Respondents’ darja
was absolutely different from that of the Appellant’s darja. While
the Appellant’s darja had guide pins and sockets, such pins and
sockets were absent in the Respondents’ darja. The Respondent's
clamps were also of a different type from that of the Appellant;
3. While the right and left sides of the two halves of the mould box
had iron boards in the Appellant’s darja, the Respondents were
using wooden planks which were fixed to the iron darja by nuts
and bolts;
4. The Appellant had a core attached to the core supporting plate; but
the core (which had been described in the Appellant's evidence as a
neel (mathani) was totally missing in the Respondents darja;”°
5. Though the initial process demonstrated by the Respondents in
court for filling sand in the darja was almost identical with the
process of the Appellant, yet there being no core or mathani in
the Respondents’ darja, and the subsequent process given in the
description for fixing the core with the supporting plate inside the
mould was totally missing from the Respondents’ mould box;”
l core
6. According to the patented process, the making of the centra
ient in
with the aid of core supporting plate was an essential ingred
in the process
the Appellant's process; but there was nothing like it
 206 INDIAN PATENT LAW AND PRACTICE

demonstrated by the Respondents with the aid of the mould box;*

and,
7. In the process adopted by the Respondents for manufacture of
hollow-ware a solid sand model of the inner side of the hollow
was formed in the Respondents’ process while in the Appellant's
patented process there was a core embedded inside.*”
Based on the comparison and evidence submitted, the court held that the
process of the Respondents had different steps from that of the Appellant
and, therefore, was not infringing.“

Farbewerke Hoechst Aktiengesellschaft Vormals Meister Lucius & Bruning

a Corporation etc. v. Unichem Laboratories and Ors
The case related to a patent in respect of the manufacture of new
sulphonyl-ureas, salts of those compounds, and of anti-diabetic
preparation containing such compounds.*' One of the chemical
compounds comprised in the said patent was Tolbutamide, and since
1957 the patent holder had been marketing the same as an anti-diabetic
drug in India and all over the world under the trademark Rastinon.”
The patent holder filed an infringement suit against the Respondents
claiming that the manufacture, preparation, and sale of Uni-Tolbid
tablets or Tolbutamide by the Respondents infringes its patent.* In
response to the suit, the Respondents claimed that their activities were
based on a patent held by one of the Respondents for the preparation of
substituted benzonesulphonyl ureas from the corresponding substituted
benzonesulphonyI thioureas by desulphurization with hydrogen peroxide
and, therefore, they were not liable for infringement.“
The court construed the claims before deciding on infringement.
Claim 1 of the patent read as follows: ‘A process for the manufacture
of
sulphonylureas of the general formula R-SO,-NH-CO-NH-R, in
which
R represents a phenyl radical which may contain one or two
substitutes
selected from alkyl and alkoxy residues, the alkyl group
of which
containing at most 8 Carbon atoms, and halogen atoms,
or represents
an aliphatic or cycloaliphatic Hydro-Carbon radical
containing 3 to 8
Carbon atoms and R, represents an aliphatic or cycloal
iphatic Hydra-
Carbon radical containing 2 to 8 Carbon atoms, and
of the salts thereof,
where in compounds of the formula R-SO,-X
and Y-R, are reacted
together in which X and Y are groups which ion reactio
n together form
a urea linkage as defined above or a linkage readily
convertible thereto’
Furthermore, Claim 11 of the patent read as follows:
‘A process as claimed
in claim 1 wherein thioureas of the formula R-SO,
-NH-CS-NH-R, are
 INFRINGEMENT AND DEFENCES 207

treated with agents eliminating the sulphur, R and R, having the meanings
given above.’
The court stated that Claim No.1 was the main claim of the patent,
which covers compounds obtained by the chemical reaction specified in
it, either directly to form a urea linkage, or indirectly to form a linkage
readily convertible into a urea linkage.” As per the court, Claim No.11
falls within the scope of claim No.1, in so far as it deals with the processes
by which thioureas were converted to the corresponding urea linkage by
being treated with agents eliminating sulphur and the radicals R and R.1
had for the purpose of claim No.11, the same limitations in regard to the
number of carbon atoms as they were required to have for the purposes
of Claim No.1.“
As the Respondents were preparing the compound tolbutamide by
the process of desulphurization of benzene-sulphonyl thioureas with
hydrogen peroxide, the court stated that such a process falls within
the scope of Claim 11 because the claim includes desulphurization of
thioureas by any chemical substance, including hydrogen peroxide,
which was used by the Respondents.” The court stated that Claim
No. 11 was wide enough to cover all methods of eliminating sulphur
from thioureas, whether the desulphurization was effected, by means
of hydrogen peroxide, or by the use of any other substance.” As claim
11 depended on claim 1, the court held that claim 1 was also infringed
by the Respondents’ process.”' Though, one of the Respondents held
a patent for the preparation of substituted benzonesulphonyl ureas
from the corresponding substituted benzonesulphonyl thioureas by
desulphurization with hydrogen peroxide, the court stated that holding
a patent over a step in the process would not avoid liability for patent
infringement if the process falls within the scope of a patent claim.

Raj Prakash v. Mangat Ram Chowdhry and Ors

This case involved a patent relating to a process for printing picture
films for use in film-strip viewer and the films made by the process.”
The Appellant, patent holder, sued the Respondents, who were making
and selling similar film strip viewers for patent infringement.*’ The
court compared the product of the Respondents with the patent claims
and held them liable for infringement because Respondents were also
selling viewers with similar films as that of the patent holder. Though
the Respondents made certain variations in their film viewers, the court
stated that such changes were unessential to the invention and the viewers
of the patent holder and the Respondents were substantially the same.”
208 INDIAN PATENT LAW AND PRACTICE

While concluding on infringement, the court cited a case in which sale of

Betacillin was held to infringe a patent on Ampicillin because they were
medically equivalent.”

8.8 DEFENCES TO PATENT INFRINGEMENT

A person will not be liable for infringement of a patent under certain
circumstances. If activities of a person with regard to a patented product
or process fall within the scope of such circumstances, the person would
be exempt from infringement even if the product or process falls within
the scope of patent claims. Such circumstances are called defences to
patent infringement because they help in defending an infringement
action and exempt liability for infringement. Some of the important
defences are explained hereunder.

8.8.1 Government Use

Use ofa patented invention by the government for merely its own purposes
is exempted from patent infringement.* Under the exemption, the
government, or any person on behalf of the government, can manufacture
or import a patented product or a product made using a patented process
for use by the government without infringement liability.°” The meaning
of the term government has not been clearly defined under the Patents Act
and may be considered to include both the Central and State governments.
As per the Bombay High Court, the exemption is limited to mere use for
government's own purposes and it would extend to only use of a product
or process by a government department for carrying out its functions,
or by government officers and agents for performing their functions
and/or duties (Garware Wall Ropes Limited v. A.I. Chopra, Engineers and
Contractors, and Konkan Railway Corporation Limited). On the other
hand, the Delhi High Court interpreted the scope of Government
Use
exemption to also include manufacture or use by any person on behalf
of
the government under a government contract (Chemtura Corporation
v.
Union of India (UOI) and Ors).
For example, if the Police Department manufactures
patented electric
bikes for its officers in order to enable Surprise attack
s on criminals, the
manufacture of the bikes by the department would not
give rise to liability
for patent infringement because the purpose of such
a manufacture falls
within the scope of use by a government department,
which is the police
department. In such a scenario, if the police department
requests a third
party to manufacture the bikes, manufacture of
bikes by such a third
party, on behalf of the government, will amount
to patent infringement
 INFRINGEMENT AND DEFENCES 209

as per the interpretation of Bombay High Court but will not amount to
infringement according to Delhi High Court's interpretation.
The exemption does not apply to manufacture, use, or importation of
a patented invention by the government other then for its own use, even
if such use is authorized by the Central Government. Furthermore, the
sale of a patented invention by the government or the use of a patented
invention by a government undertaking is also not covered under the
scope of the exemption. Any use, sale, manufacture, and so on, of a
patented invention by a person authorized in writing by the Central
Government for purposes of government or government undertaking
must be done only on terms agreed by the patent holder or determined by
the High Court.** The patent holder must be paid adequate compensation
for such a use, based on the economic value of the patent.”

Example: If a patented invention is used by XYZ, a government under-

taking, after acquiring written authorization from the Central Govern-
ment, such use is not covered under the Government Use exemption.
If the Tourism Department of the Central Government sells patented
pens representing Indian tradition, such a sale would not be covered
under the scope of Government Use exemption because sale is not
covered under the exemption.
If the Central Government authorizes a contractor to make patented
taps for installation at Indian Oil Corporation Limited, a government
undertaking, such manufacture and installation by the contractor would
not be covered under the government use exemption. In such a case, the
contractor must agree on the terms and conditions of manufacture and
installation with the patent holder, and must pay adequate compensation
to the patent holder.

8.8.1.1 Government Use of Medicines or Drugs

t liability
The government can importa patented medicine or drug withou
for patent infringement for:
1. Purposes of its own use;
al institution of
2. Distribution to any dispensary, hospital, or medic
nt; or
the government, or being run on behalf of the governme
medical institution
3. Distribution to a dispensary, hospital, or
by the government
rendering public service and recognized as such
by notification in the official gazette. ©
patented drug from Japan
For example, if the government imports a
and distributes the drug to a
for treating influenza outbreak in India
 210 INDIAN PATENT LAW AND PRACTICE

government hospital for treating patients, the government would be

exempt from patent infringement.

8.8.2 Experimental Use or Educational Use

The use of a patented invention for experiment or research is exempted
from patent infringement. Any person may manufacture or use a patented
product, or use a patented process for the purpose of experiment or
research, without taking permission of the patent holder.*! The exemption
is called as Experimental Use exception or Research Exemption.
For example, if X, a scientist at National Institute of Science, uses a
patented robot for understanding the functioning of the robot under
controlled conditions, without taking permission of the patent holder, he
would not be liable for patent infringement because such use falls within
the scope of research exemption.
Furthermore, use of a patented invention for purposes of imparting
education to students is also exempted from patent infringement.”
A
professor can use a patented invention for teaching the functioning
of the
invention to his pupils without patent liability. For example, if a profess
or
at National Institute of Science uses a patented laser in a laborat
ory for
teaching its functioning to his students, he would not be liable
for patent
infringement.

8.8.3 Use for Government Approval

The use of a patented invention for the purpose of
acquiring government
approval is exempted from patent infringement.
A person would not be
liable for infringement if the patented invention
is used for purposes
of development and submission of informatio
n to a government
authority required under a law. The exemptio
n covers the manufacture,
construction, sale, use, and importation,
of a patented invention for
purposes of development of information
for submitting such information
to a regulatory authority.“ Such infor
mation is generally submitted
for getting approval of the government
for manufacture, use, sale, or
importation, of the patented product or
process. The exemption extends
to uses reasonably related to requirements
under either Indian or foreign
laws that regulate activities relating to
the patented invention.
For example, if a company X uses
a patented drug A, without
permission of the patent holder, for
purposes of developing clinical
information in order to submit to the Drug Cont
roller General of India
for getting approval to sell the drug
in India, such use of the drug would
be exempt from patent infringement.
 INFRINGEMENT AND DEFENCES 211

The exemption was enacted in the United States (US) in 1984 after
the decision of the Court in Roche Products, Inc. v. Bolar Pharmaceutical
Co. Inc. and is called the Bolar Exemption.® As per the enactment,
any company that manufactured, used, sold, offered for sale, or
imported, a patented drug or a biological material was exempt from
patent infringement if such an activity was meant for development
and submission of information to the Food and Drug Authority for
getting approval.® After the enactment in the US, the exemption was
incorporated into laws of many countries. As opposed to the scope of
the exemption in the US, the exemption in India is not limited to drug
approval. The broad language used in the Patents Act in India extends the
scope of the exemption beyond drug regulations and beyond regulatory
requirements under Indian law alone.
For example, use of a patented telecommunication device in India
without the patent holder’s permission may be exempt from liability
for infringement if such use is for submitting information to a telecom
regulatory authority in a foreign country.

8.8.4 Parallel Imports

Parallel import means the importation of a product from another coun-
try without the permission of the patent holder after legally purchasing
it from an authorized person in the other country. Parallel importing of
a patented product is exempt from patent infringement if the importa-
tion is done from a person in another country, who is authorized under
the law to produce and sell, or distribute the product in that country.”
The Parallel Import exemption is based on the doctrine of patent exhaus-
tion, which provides that a patent holder loses all rights over a patented
product once he sells it to another person. As per the doctrine, the patent
holder cannot have any control over the patented product once it is sold.
This is also called as the First Sale doctrine.
The import of a product, sold by a patent holder or his authorized
person in another country, will not amount to patent infringement
because once sold the rights of the patent holder over the product will
be exhausted. The exemption will not extend to products that have been
purchased from a person in a country where patent protection for the
product does not exist because the rights of the patent holder over the
product will not be exhausted by the sale.
X
Example: X holds a patent over a pen in India, USA, and Europe.
Z buys
authorizes Y to produce and sell the patented pens in the USA.
ation by Z
the pens from Y and imports them into India. Such import
 212 INDIAN PATENT LAW AND PRACTICE

will be exempt from liability for patent infringement. The exemption will
not apply if X does not hold a patent in USA because no authorization is
required for producing and selling the pen in USA and a sale in USA will
not exhaust X’s patent rights in India. Therefore, importation under such
circumstances will be considered as patent infringement.

8.8.5 Gillette Defence

A person would not be liable for patent infringement if a product or
process that is infringing was not novel on the filing date of the patent (/.
Mitra and Co. Private Limited v. Kesar Medicaments and Anr.). In other
words, if a product or process would not be novel in the light of prior
art or forms part of the prior art on the date of patent, such a product
or process would not be infringing. In such a case, if the patent holder
claims that the product or process falls within the scope of the patent and
is therefore infringing, the patent holder faces patent invalidation. On the
other hand, if the patent holder accepts that the product or process forms
part of the prior art on the date of patent, the product or process would
not be liable for infringement.
For example, if X proves in an infringement action that his product
forms part of a publication on or before the date of filing of the patent
in question, the product would be exempt from infringement. In such
a situation, if the patent holder asserts that the product of X falls within
the scope of claims, the patent will face risk of revocation due to lack
of novelty based on prior publication. On the other hand, if the patent
holder accepts that X’s product forms part of the publication and claims
do not include the elements of the publication, X will not be liable
for
infringement because his product will not fall within the scope of
patent
claims.

8.8.6 Other Defences

All grounds based on which a patent may be revoked
may be used as
defences in an infringement suit. A person would
not be liable for
infringement if the patented invention falls within
the scope of any of
the grounds for revocation. The grounds have been
listed in the next
chapter, which deals with revocation of a patent. In
addition to statutory
defences, an infringer may also plead equitable
defences such as laches,
acquiescence, and so on as defences for infringement
(Farbewerke Hoechst
Aktiengesellschaft Vormals Meister Lucius & Bruning
a Corporation etc. v.
Unichem Laboratories and Ors).
 INFRINGEMENT AND DEFENCES 213

NOTES
1. Section 48, The Patents Act, 1970.
Section 48 reads as follows: ‘Subject to the other provisions contained in this
Act and the conditions specified in Section 47, a patent granted under this Act
shall confer upon the patentee-
(a) where the subject matter of the patent is a product, the exclusive right to
prevent third parties, who do not have his consent, from the act of making, using,
offering for sale, selling or importing for those purposes that product in India;
(b) where the subject matter of the patent is a process, the exclusive right to
prevent third parties, who do not have his consent, from the act of using that
process, and from the act of using, offering for sale, selling or importing for those
purposes the product obtained directly by that process in India:
2. Section 48(a), The Patents Act, 1970.
. Section 48(b), The Patents Act, 1970.
Ibid.
. Section 50(1), The Patents Act, 1999, 2002, and 2005.
. Section 50(3), The Patents Act, 1999, 2002, and 2005.
. Section 53(1), The
WwW
We
ND Patents Act, 1970.
Section 53(1) reads as follows: ‘Subject to the provisions of this Act, the term
of every patent granted, after the commencement of the Patents (Amendment)
Act, 2002, and the term of every patent which has not expired and has not ceased
to have effect, on the date of such commencement, under this Act, shall be twenty
years from the date of filing of the application for the patent.
Explanation: For the purposes of this sub-section, the term of patent in case of
International applications filed under the Patent Cooperation Treaty designating
India, shall be twenty years from the international filing date accorded under the
Patent Cooperation Treaty:
8. Ibid.
9. Ibid.
10. Ibid., at Para 10.
11. Ibid., at Para 10.
12. Ibid., at Para 11 citing Electrical and Musical Industries, Ld. and Boonton
Research Corporation Ld. v. Lisson Ld. and another, 1937 (54) R.P.C. 307(1).
13. Ibid., at Para 13.
14. Ibid., at Para 13.
15. Ibid., at Para 16.
16. Ibid.
17. Section 104, The Patents Act, 1970.
ation under Section 105 or
Section 104 reads as follows: “No suit for a declar
nt of a patent shall be instituted
for any relief under S ection 106 or for infringeme
iction to try the suit: Provided
in any court inferior to a district court having jurisd
that where a counter-claim for revocation of the patent is made by the defendant,
 214 INDIAN PATENT LAW AND PRACTICE

the suit, along with the counter-claim, shall be transferred to the High Court for
decision?
18. Ibid.
19. Section 109(1), The Patents Act, 1970.
20. Section 109(2), The Patents Act, 1970.
21. Section 109(2), The Patents Act, 1970.
22. Section 110, The Patents Act, 1970.
23. Section 104A(1), The Patents Act, 1970. Section 104A (1) reads as follows:
‘In any suit for infringement of a patent, where the subject matter of patent is a
process for obtaining a product, the court may direct the defendant to prove that
the process used by him to obtain the product, identical to the product of the
patented process, is different from the patented process if,
(a) the subject matter of the patent is a process for obtaining a new product;
or
(b) there is a substantial likelihood that the identical product is made by
the process, and the patentee or a person deriving title or interest in the patent
from him, has been unable through reasonable efforts to determine the process
actually used:
Provided that the patentee or a person deriving title or interest in the
patent
from him, first proves that the product is identical to the product directly
obtained
by the patented process’
24. Ibid.
25. Section 104A(2), The Patents Act, 1970.
26. Ibid.
27. Ibid., at Para 19.
28. Ibid., at Para 18.
29. Ibid.
30. Ibid., at Para 2.
31. Ibid., at Para 4.
32. Ibid.
33. Ibid., at Para 13.
34. Ibid., at Para 14.
35. Ibid., at Para 15.
36. Ibid., at Para 16.
37. Ibid., at Para 17.
38. Ibid.
39. Ibid.
40. Ibid., at Para 26.
41. Ibid., at Para 1,
42. Ibid.
43. Ibid.
44. Ibid., at Para 2.
45. Ibid., at Para 10.
 INFRINGEMENT AND DEFENCES 215

46. Ibid.
47. Ibid.
48. Ibid.
49. Ibid.
50. Ibid., at Para 11.
51. Ibid.
52. Ibid.
53. Ibid., at Paras 2 and 6.
54. Ibid., at Para 21.
55. Ibid., at Para 25 citing Beecham Group Limited v. Bristol Laboratories
Limited and Anr, 1967 (16) R.P.C. 406.
56. Section 47(1), The Patents Act, 1970 as amended in 1999, 2002, and 2005.
Section 47(1) reads as follows: “The grant of patent under this Act shall be subject
to the condition that
(1) any machine, apparatus or other article in respect of which the patent is
granted or any article made by using a process in respect of which the patent is
granted, may be imported or made by or on behalf of the Government for the
purpose merely of its own use;...
57. Ibid.
58. Section 100(1), The Patents Act, 1970.
59. Ibid.
60. Section 47(4), The Patents Act, 1970.
61. Section 47(3), The Patents Act, 1970. Section 47(3) reads as follows: “The
grant of patent under this Act shall be subject to the condition that
... (3)any machine, apparatus or other article in respect of which the patent
is granted or any article made by the use of the process in respect of which the
patent is granted, may be made or used, and any process in respect of which
the patent is granted may be used, by any person, for the purpose merely of
experiment or research including the imparting of instructions to pupils; ...’
62. Ibid.
63. Section 107A(a), The Patents Act, 1970. Section 107A(a) reads as follows:
‘For the purposes of this Act,
(a) any act of making, constructing, using, selling or importing a patented
invention solely for uses reasonably relating to the development and submission
of information required under any law for the time being in force, in India, or
in a country other than India, that regulates the manufacture, construction, use,
sale or import of any product; ...’
64. Ibid.
65. Drug Price Competition and Patent Term Restoration Act of 1984 (1984
Act), 98 Stat 1585.
66. 35 USC § 271(e)(1) (20(3).
67. Section 107A(b), The Patents Act, 1970. Section 107A(b) reads as follows:
‘For the purposes of this Act,
216 INDIAN PATENT LAW AND PRACTICE

...(b) importation of patented products by any person from a person who is

duly authorised under the law to produce and sell or distribute the product, shall
not be considered as an infringement of patent rights.’
68. Section 107(1), The Patents Act, 1970.
 9
Patent Revocation and Surrender

9.1 REVOCATION OF A PATENT

ie; of the most common counter-claims in an infringement suit is
patent invalidity or revocation. A defendant in an infringement
suit generally counter-claims that he is not liable for patent infringement
because the patent is not valid and is liable to be revoked. A patent may be
revoked or invalidated at any time before the expiry of its term.
A patent may be revoked:
1. On petition of any person interested; '
. On petition of the Central Government; *
On acounter-claim in a suit for patent infringement;’
By the high court under certain circumstances;* or
N By the Controller after receiving directions from the Central
7
Government.’
The Appellate Board has the jurisdiction to revoke a patent based on a
petition by an interested person or the Central Government.° However,
if a counter-claim for revocation of a patent is filed in response to an
infringement suit then the patent may be revoked by the high court.’ The
burden of proving that a patent is invalid or liable to be revoked is on the
Hoechst
person filing a petition or counter-claim for revocation (Farbweke
etc. v.
Aktiengesellschaft Vormals Meister Lucius & Bruning a Corporation
Unichem Laboratories and Ors).
 218 INDIAN PATENT LAW AND PRACTICE

9.1.1 Grounds for Revocation

Revocation of a patent may be on any of the following grounds:

9.1.1.1 Invention does not satisfy any of the patentability

requirements®
A patent may be revoked if the petitioner or counter-claimant can prove
that the patented invention falls outside the scope of patentable subject
matter; lacks industrial applicability, novelty or inventive step, or does
not satisfy the specification requirement. This is the most common
ground cited by persons applying for or claiming for patent revocation.
For example, if X acquires a patent on a time machine and Y files a
petition for revocation of the patent and proves that the time machine
claimed in the patent forms part of a prior art publication or was not
clearly described, the patent may be revoked.

9.1.1.2 Patent was granted to a person not entitled under the

provisions of the Patents Act?
A patent may be revoked if the person to whom the patent was granted
was not eligible to get a patent under the law. For example, X comes up
with an invention and passes away before filing for a patent. Y, who is X’s
laboratory assistant, who knows about the invention acquires a patent
on the invention. On a petition by X’s successor Z, the patent may be
revoked because Y is not X’s successor or assignee, and is, therefore, not
entitled to file for a patent.

9.1.1.3 Patent was wrongfully obtained from the person applying

for revocation"
A patent may be revoked if a person wrongfully obtains the invent
ion
from another person. Wrongful obtainment is said to exist
if the patent
was acquired from the true and first inventor by wrongful
means, such
as, fraud, misappropriation, without consent, and so
on. In such a case,
the petition for revocation must be filed by the person
from whom
the patent has been wrongfully obtained. For exampl
e, If X comes up
with an invention and Y steals X’s invention inform
ation and acquires
a patent, the patent may be revoked on a petition
or counter-claim by X
for revocation. In such a case, the Appellate Board
or the high court may
permit the patent to be granted on the name of
the true and first inventor,
which is X in the example."!
 PATENT REVOCATION AND SURRENDER 219

9.1.1.4 Patent was obtained by the patent holder based on a false

suggestion or representation”
A patent can be revoked if the applicant acquires the patent by providing
false information to the patent office. For example, if X and Y acquire
a patent over an invention conceived by X by representing that the
invention was invented jointly by both X and Y, then the patent may be
revoked if it can be proved that Y was not truly an inventor.

9.1.1.5 Invention was secretly used in India before the priority date
of the patent claim’
A patent may be revoked if the invention was secretly used before the
priority date. Secret use of an invention will not be considered as a ground
for revocation if such use was:
1. For reasonable trial;'*
2. By government or government undertaking or a person authorized
by the government after receiving the invention details from the
patent holder;"* or,
3. Without consent of the patent holder.'®
For example, if X uses an invention secretly for a period of five years
before filing for a patent, the patent may be revoked based on such secret
use. However, if such use was for experimental purposes, such use would
not be a ground for revocation.
9.1.1.6 Patent holder while applying for a patent did not disclose
the necessary information or discloses information that in material
particular is false to his knowledge”
A patent may be revoked if the patent holder withholds material
information or discloses information that is false to the patent office.
This provision ensures true and complete disclosure of information
by a patent applicant to the patent office at the time of filing and
during prosecution. For example, if ‘X’ files a patent application over
a pharmaceutical composition and describes clinical studies in the
specification that were never performed in order to prove efficacy, the
patent on the composition may be revoked because the patent holder had
disclosed material information, which the patent holder knew was false
to the patent office.

9.1.1.7 Patent holder contravened secrecy directions or failed to take

foreign filing permit before filing for the patent"*
A patent may be revoked if the patent holder fails to abide by the secrecy
220 INDIAN PATENT LAW AND PRACTICE

directions issued by the Controller. It may also be revoked if the patent

holder files for a patent in a foreign country without taking a foreign
filing permit. For example, if X files for a patent in USA before filing for
a patent in India and does not take a foreign filing permit for the filing
in USA, the patent acquired in India may be revoked on a petition or
counter-claim for revocation.

9.1.1.8 Patent holder fraudulently obtained the leave to amend the

specification before the Controller or the Appellate Board’®
A patent may be revoked if the patent holder amends the patent by
fraudulently taking leave from the Controller or Appellate Board.
For example, if X obtains leave from the Controller to amend a patent
specification in order to include an explanation relating to certain
experiments that were never conducted stating that the experiments
were carried out before the filing date, the patent may be revoked on the
ground that the leave to amend the patent application was obtained by
fraud.

9.1.1.9 Patent holder did not disclose or wrongly mentions the

source or geographical origin of biological material used for the
invention™®
The patent holder must disclose the source of biological materials used
for the invention. The patent may be revoked if the patent holder does not
disclose the source of biological materials or makes a wrongful disclosure
of the biological resources. For example, if X makes a plant extract from a
plant found in Himalayas and discloses in the specification that the plant
can be found in Western Ghats, such wrongful disclosure of origin may
be a ground for revocation.

9.1.1.10 Patented invention is anticipated by oral or written

traditional knowledge available within any local or indigenous
community in India or elsewhere?!
A patent will be revoked if the patented invention forms part of tradit
ional
knowledge or is anticipated by traditional knowledge. For exampl
e, if X
acquires a patent over a mixture for increasing appetite, which is
well
known among the tribals in Nalamalai forests for the last 200
years, the
patent may be revoked because it would be anticipated by tradit
ional
knowledge among the tribal community.
 PATENT REVOCATION AND SURRENDER 221

9.1.2 Study of Relevant Cases

Laxmi Dutt Roop Chand v. Nankau and Ors
In this case, the Appellant, Laxmi Dutt Roop Chand, the patent holder
of a patent relating to the process of manufacture of hollow-ware filed a
patent infringement suit against the Respondents, Nankau and others.”
In response to the infringement suit of the Appellants, the Respondents
claimed non-infringement and counter-claimed for revocation of the
patent on the grounds of lack of novelty and inventive step.”
After reviewing and hearing the arguments of the parties and relevant
prior art, the court held that the patented invention lacked novelty and
inventive step. As hollow-ware was being prepared at Bandhua with the
aid of darjas for about 25 or 26 years before the date of the patent, the court
held that the invention lacked novelty.” It further held that the invention
on the date of the patent was not a manner of new manufacture, nor did
it involve any inventive step having regard to what was publicly known in
the field of manufacture of hollow-ware. *°

Farbewerke Hoechst Aktiengesellschaft Vormals Meister Lucius & Bruning

Corporation v. Unichem Laboratories and Ors
The case related to a patent in respect of the manufacture of new
sulphony] ureas, salts of those compounds, and of anti-diabetic prepara-
tion containing such compounds.” The patent holder filed an infringe-
ment suit against the Respondents claiming that the manufacture,
preparation, and sale of Uni-Tolbid tablets by Respondents infringes its
patent.” In response, the Respondents argued that the patent was liable
to be revoked due to insufficiency of disclosure and lack of novelty,
inventive step, and utility.
The court first reviewed the disclosure made by the patent holder
and concluded that the specification had sufficient disclosure. It stated
that a conventional manner of eliminating sulphur as specified in the
claims was well known and support in the written description was not
required for the same.” It further observed that the statement in the
body of the specification that the synthesis of the desired sulphony!
urea may be obtained by eliminating sulphur with a heavy metal oxide
or a salt thereof in an aqueous or alcoholic solution would not present
any difficulty to a person skilled in the art to carry out the invention.”
As per the court, the specification and claims were addressed to those
with a high degree of knowledge of the field of science to which they
relate, particularly when they relate to chemistry and allied subjects and,
therefore, it was not necessary to describe processes on the claims to a
222 INDIAN PATENT LAW AND PRACTICE

specification when they were part of the common knowledge available

to those skilled in the science who can, after reading them, refer to the
technical literature on the subject for the purpose of carrying them into
effect.3° As the embodiments of the invention were sufficiently described
in the specification with a number of examples that the invention could
be easily carried out into effect, the court concluded that the invention
was sufficiently described in the specification.”
The court then analysed the novelty and inventive step of the invention
in the light of prior art. Though it was known that amino-sulphonamides
had anti-diabetic properties and many sulphoyl ureas were also known,
the court observed that they were all with the wrong radicals at either
end and it was not known that they could have anti-diabetic properties
if they were activated by certain radicals.** As in the light of state of
knowledge, it was not possible for a skilled chemist to predict that anti-
diabetic preparation could be obtained by constructing a molecule with
a sulphonyl urea in the middle and carefully planting lumps of radicals
at either end, the court stated that the patented invention was novel and
inventive.*’ Furthermore, though Carbutamide and sulphanamides were
well known as hypoglycemic agents, the court stated that they could not
be used for prolonged periods of time as they gave rise to toxic effects.*
It pointed out that the difference in the respective chemical compositions
of Carbutamide and Tolbutamide of the patent holder was that the latter
had the methyl group (CH,) in place of the amino group (NH,) which
occurred in the former in the para position in the radical R.** The court
then concluded that the substitution of CH, in the para position for NH,
by the patent holder removed the toxic effects and was the inventive step
in the invention. As the compounds claimed in the patent had blood
sugar lowering properties without toxic effects, the court stated that the
patented invention possessed utility.”
In the light of its analysis, the court held that the patent was valid
and was not liable to be revoked because the invention possessed utility,
novelty, and inventive step, and was sufficiently disclosed.**

Shining Industries and Anr. v. Shri Krishna Industries

The patent holder, Respondent, holding a patent relating to a locking
mechanism filed a case against the Appellants claiming patent infringe-
ment and in response the Appellants counter-claimed for revoca
tion
of the patent based on lack of novelty and inventive step, among
other
grounds, *
 PATENT REVOCATION AND SURRENDER 223

The court compared the locking mechanism with prior art and
held that the patented invention lacked novelty and inventive step and
is, therefore, liable to be revoked.“ It stated that the mere fact that the
shackle of the old lock contained one groove and the shackle of new lock
contains three grooves, or that in the old lock one arm of the shackle
remained attached to the lock with a pin on opening it, while in the new
lock both the arms of the shackle come out, or that the old lock contained
an inner housing only on two sides, while the new lock contained an
inner housing on all the four sides, did not bring about any new change in
the lock.’ As per the court, the system remained the same as in the prior
art. Though the patented lock required 70-80 keys as opposed to seven to
eight keys required by the locks in the prior art, the court observed that
it was because of the increase in the grooves and that such a difference in
the working of the two locks could not amount to an improvement which
would constitute an inventive step.”
In the light of the two prior art patents cited in the case, the court
stated that the locking mechanism and the lock claimed in the Respon-
dent's patent were not different from the locks specified in the prior art
patents.* As the system and the mechanism in the patented lock were
the same as the cited patents, the court concluded that the invention
lacked novelty and inventive step and held that the patent was liable to
be revoked.

Bishwanath Prasad Radhey Shyam v. Hindustan Metal Industries

On a plea for revocation by the Appellant, the court in the case
revoked a patent held by Hindustan Metal Industries relating to a
means for holding utensils for turning purposes due to lack of novelty
and inventive step.“ The court reviewed the prior art and stated that
the subject of the invention. was known for decades before 1951, for the
traditional purpose of scraping and turning utensils with a slight change
in the mode of application.” It went on to state that the patented invention
was not a manner of new manufacture or improvement, nor did it involve
any inventive step having regard to what was known or used prior to the
date of patent.“* The court observed that the slight modification in the
patented invention would have been obvious to any skilled worker in the
field based on knowledge existing at the date of patent.” As the invention
lacked novelty and inventive step, the court held that the patented
invention was liable to be revoked.”
224 INDIAN PATENT LAW AND PRACTICE

Monsanto Company v. Coramandal Indag Products (P) Limited

Monsanto Company held a patent relating to a herbicide, commonly
called as Butachlor, and its emulsion and filed a patent infringement suit
against the Respondent, Coramandal Indag Products Private Limited.
In response, the Respondent claimed that the invention claimed in the
patent was not novel or inventive and, therefore, is liable to be revoked.
After reviewing the facts, the court stated that the formula and use of
Butachlor was published in the report of the International Rice Research
Institute for the year 1968.” It then pointed out that a person skilled in
the art was, before the date of patent, aware of the use of Butachlor for
destroying weeds without affecting rice.°* As Butachlor was well known
and the process of emulsification was well known based on publication
and knowledge in the field, the court stated that there was no novelty in
the process of emulsification or the emulsion as claimed by Monsanto.®*?
In the light of its analysis, the court held that the patented invention was
liable to be revoked.”

K. Manivannan v. Shri M. Mani, Proprietor Valasumani Lathe Works

A patent was granted to Valasumani Lathe Works (VLW) for an
invention titled Improved Threshing And Separating Machine.*? The
applicant in the case, Manivannan trading as Kumar Industries, filed
an application for revocation of the patent before the Appellate Board.™
The applicant contended that VLW’s invention was not patentable
in the light of the applicant’s patent application relating to a machine
for threshing of corn, which was abandoned and the machines of the
applicant, which were being used before the application date of VLW.
The applicant claimed that the invention was anticipated based on prior
claiming, prior publication, and public knowledge, in the light of the
abandoned patent application and the use of the threshing machines.**
VLW counter-claimed that the patented invention was not anticipated
because information relating to the applicant's abandoned application
was not available to the public before the priority date of VLW’s patent
application.” ,
After considering the arguments, the Appellate Board stated that the
abandoned application was not relevant for purposes of anticipation
by prior publication because the details relating to the abandoned
application were published after the priority date of VLW’s application.
It then pointed out that the invention claimed by VLW did not
form part
of common knowledge and, therefore, cannot be anticipated
by prior
knowledge. With regard to prior claiming, the Appellate Board
stated that
 PATENT REVOCATION AND SURRENDER 225

VLW’s patented invention was not anticipated by prior claiming because

the claims in the applicant's abandoned application and VLW’s patent
were different from each other.” It further stated that the specification of
the applicant either inherently or by implication did not anticipate VLW’s
patented invention.” The Appellate Board then observed that
a. Examination as to novelty should not be restricted to a purely formal
comparison with known prior art, but it must include the actual
information content which goes beyond the words used; and
b. Earlier applicants must be given reasonable scope to defend their
inventions.°!
It further stated that the prior art reference must be seen as a whole with
emphasis on both general and specific description of the prior art.’ As
the abandoned application of the applicant and the use of threshing
machines did not contain the specific elements of VLW’s invention and
as such specific elements amounted to technical advance, the Appellate
Board stated that VLW’s invention was not anticipated.®
After reviewing the newspaper advertisements provided by the
applicant as prior art, the Appellate Board stated that the advertisements
did not possess any constructional features relating to VLW’s invention
and, therefore, did not anticipate the invention. In the light of its analysis,
the Appellate Board dismissed the revocation application as the patented
invention was not anticipated by prior claiming, prior publication, or
prior knowledge.”

9.1.3 Revocation for Government Use

A patent may be revoked by the high court, if the patent holder fails to
allow the government to make, use, or exercise the patented invention for
purposes of the government. The Central Government has the power
under the Patents Act to authorize the use of a patented invention for
purposes of government or government undertaking and, in such a case,
the government will use the invention after the patent holder agrees on
the terms and conditions for such use.”
The high court will determine the compensation, if the patent holder
either party
and the government are unable to arrive at a consensus and
t from the
refers the dispute to the high court.” On receiving a reques
ion, if the patent
Central Government for use of the patented invent
the high court
holder fails to agree on reasonable terms and conditions,
holder has a reasonable
may revoke the patent. However, if the patent
Central Governments
cause, based on which he could not agree to the
request, the patent will not be revoked.”
 226 INDIAN PATENT LAW AND PRACTICE

9.1.4 Revocation of Patents on Atomic Energy

A patent may be revoked by the Controller if the invention relates to
atomic energy. The Central Government may direct the Controller to
revoke the patent if it is satisfied that the invention relates to atomic
energy and is not patentable under the Atomic Energy Act.” After
receiving the Central Government's directions, the Controller will give
notice of such directions to the patent holder and other interested persons
on the register.” Thereafter, the Controller will give an opportunity of
being heard to the patent holder and other interested persons.” After
the hearing, if the Controller is convinced that the invention relates to
atomic energy, the Controller will revoke the patent.” Alternatively, the
Controller may also allow the patent holder to amend the specification
in order to remove the subject matter relating to atomic energy from the
specification.”4

9.1.5 Revocation in Public Interest

A patented invention, which is against public interest, or whose use is
detrimental to public interest, maybe revoked by the Central Government.
If the Central Government is of opinion that a patent or the manner in
which it is used is harmful to the State or generally detrimental to
the
public, it will inform the patent holder regarding the same.”> Then,
if
the patent holder is desirous of a hearing, the Central Government
will
give the patent holder an opportunity of being heard.” After
hearing the
patent holder, if the Central Government is convinced that
the patent is
detrimental to public interest, it will revoke the patent
by publishing a
declaration in the Official Gazette.” On such a publicat
ion, the patent
will be deemed to be revoked.”
For example, if X acquires a patent over a Nigh
t Vision Binoculars
and starts selling the same to terrorists and
criminals, the Central
Government may revoke the patent because
the invention is being
used in a way that is detrimental to public interest.
In the year 1994,
the Government revoked a patent relating
to a process for producing
transformed cotton cells by tissue culture
because it was prejudicial to
public interest.” The Government stated that
the patent would impact
the export economy and would be detrimen
tal to farmer's interests, and
that products made from the cotton, using
the patented process, would
be harmful to people.* Therefore, the Gove
rnment concluded that the
patent would be detrimental to public interest
and revoked the patent.
 PATENT REVOCATION AND SURRENDER 227

9.1.6 Revocation for Non-working

A patent may be revoked if it is not worked in the territory of India after
the grant of a compulsory licence. An application for revocation of a
patent may be filed by any interested person or the Central Government
after two years from the date of grant of the compulsory license relating
to the patent.*' Such an application may be filed on any of the following
grounds:
¢ The patent does not meet reasonable requirements of the public;
¢ The patented invention is not available to the public at reasonably
affordable price; or,
¢ The patent is not worked in the territory of India.”
For example, if X acquires a patent over a car and the Controller grants
a compulsory licence over it to Y as it was not commercially worked
in India, the patent may be revoked after two years from the date of
compulsory licence, if the patented car is still not commercially worked
in India.
The application for revocation must contain the details regarding
the interest of the applicant and the facts in support of the plea for
revocation.” If the applicant is the Central Government, the details
relating to its interest may not be supplied.™ On receiving the application,
the Controller will revoke the patent, if he is satisfied that the applicant
has proved any of the grounds for revocation." The decision of the
Controller regarding revocation will be made within one year from the
date of the application and such a decision will be published.”

9.2 REVOCATION ON SURRENDER OF A PATENT

A patent holder may surrender his patent at any time before the patent
term expires by giving a notice to the Controller.” On receiving the notice
of offer to surrender the patent from the patent holder, the Controller will
publish the notice. The Controller will also inform every person having
an interest in the patent about the patent holder's intention to surrender
the patent.” After the publication of the patent holder’s offer to surrender,
the
any interested person, such as a licensee, may oppose the surrender of
date
patent by giving a notice in Form 14 within three months from the
of publication.”
holder
On receiving such a notice, the Controller will notify the patent
n statement in
about the notice, and the patent holder may file a writte
reply statement in
response to the notice.” The Opponent may file a
holder. Thereafter, if
response to the written statement of the patent
228 INDIAN PATENT LAW AND PRACTICE

a party or the parties request for a hearing, the Controller will give a
hearing.” The procedure for the hearing will be same as that of hearing
in an Opposition proceeding.” After reviewing the documents filed
and hearing the parties, if a hearing is requested, the Controller may
accept the surrender and decide to revoke the patent.** On acceptance
of the offer for surrender, the Controller may direct the patent holder to
return the patent.” In such a case, the Controller will revoke the patent
only on receiving the patent from the patent holder.* If the Controller
is convinced that the opponent has an interest in the patent, which will
be adversely affected due to the surrender, the Controller may reject the
offer to surrender the patent.

NOTES
. Section 64(1), The Patents Act, 1970.
Ibid.
Ibid.
. Section 64(4), The Patents Act, 1970.
. Section 65, The Patents Act, 1970.
Ibid.
Ibid.
. Section 64(1)(a, d-i and k), The Patents Act, 1970.
CONAN
AWDY Section 64(1)(b), The Patents Act, 1970.
. Section 64(1)(c), The Patents Act, 1970.
. Section 52(1), The Patents Act, 1970.
. Section 64(1)(j), The Patents Act, 1970.
SeO*
wnNre . Section 64(1)(1), The Patents Act, 1970.
. Section 64(3)(a), The Patents Act, 1970.
. Section 64(3)(b), The Patents Act, 1970.
ilNw . Section 64(3)(c), The Patents Act, 1970.
. Section 64(1)(m), The Patents Act, 1970.
. Section 64(1)(n), The Patents Act, 1970.
—Noo . Section 64(1)(0), The Patents Act, 1970.
. Section 64(1)(p), The Patents Act, 1970.
. Section 64(1)(q), The Patents Act,
1970.
. Ibid., at Para 2.
. Ibid.
. Ibid., at Para 29.
. Ibid.
. Ibid., at Para 1.
. Ibid.
. Ibid., at Para 14,
DAU
SO . Ibid.
SAN
PwWNHK
VMPNYN
LO
WN
ND
NNN
 PATENT REVOCATION AND SURRENDER 229

. Ibid.
. Ibid.
. Ibid., at Para 15.
. Ibid.
. Ibid., at Para 16.
. Ibid.
. Ibid.
. Ibid.
. Ibid., at Para 21.
. Ibid., at Para 1.
. Ibid., at Para 48.
. Ibid., at Para 33.
. Ibid.
. Ibid., at Para 34.
. Ibid., at Paras 39 and 41.
. Ibid., at 49.
. Ibid.
. Ibid.
. Ibid., at Para 55.
. Ibid., at Para 6.
. Ibid.
. Ibid.
. Ibid., at Para 7.
. Ibid., at Paras 1 and 2.
. Ibid., at Para 3.
. Ibid., at Para 3.
. Ibid., at Para 4.
. Ibid., at Para 5.
. Ibid., at Para 8.
. Ibid., at Para 8.
. Ibid., at Para 10.
. Ibid., at Para 10.
. Ibid., at Para 11.
. Ibid.
. Ibid., at Para 12.
. Ibid.
66. Section 64(4), The Patents Act, 1970. Section 64(4) reads as follows:
‘Without prejudice to the provisions contained in sub-Section (1) a patent may
be revoked by the High Court on the petition of the Central Government, if the
to
High Court is satisfied that the patentee has without reasonable cause failed
exercise
comply with the request of the Central Government to make, use or
the meaning of
the patented invention for the purposes of Government within
Section 99 upon reasonable terms.’
 230 INDIAN PATENT LAW AND PRACTICE

67. Sections 99 and 100, The Patents Act, 1970.

68. Ibid.
69. Ibid.
70. Section 65(2), The Patents Act, 1970. Section 65(2) reads as follows: ‘In
any proceedings under sub-Section (1), the Controller may allow the patentee
to amend the complete specification in such manner as he considers necessary
instead of revoking the patent.’
71. Ibid.
72. Ibid.
73. Ibid.
74. Section 65(2), The Patents Act, 1970.
75. Section 66, The Patents Act, 1970. Section 66 reads as follows: ‘Where
the Central Government is of opinion that a patent or the mode in which it is
exercised is mischievous to the State or generally prejudicial to the public, it may,
after giving the patentee an opportunity to be heard, make a declaration to that
effect in the Official Gazette and thereupon the patent shall be deemed to be
revoked.’
76. Ibid.
77. Ibid.
78. Ibid.
79. Case Comment, India: Patents: Revocation of Patent in Public Interest,
E.I.P.R. 1995, 17(2), D38.
80. Ibid.
81. Section 85(1), The Patents Act, 1970. Section 85(1) reads as follows:
‘Where, in respect of a patent, a compulsory licence has been granted, the Central
Government or any person interested may, after the expiration of two years
from
the date of the order granting the first compulsory licence, apply to the
Controller
for an order revoking the patent on the ground that the patented inventio
n has
not been worked in the territory of India or that reasonable
requirements of
the public with respect to the patented invention has not been
satisfied or that
the patented invention is not available to the public at
a reasonably affordable
price.’
82. Ibid.
83. Section 85(2), The Patents Act, 1970.
84. Ibid.
85. Section 85(3), The Patents Act, 1970.
86. Section 85(4), The Patents Act, 1970, as amended
in 1999, 2002, and
2005, and Rule 99, The Patents Rules, 1972, as last amended
in 2006.
87. Section 63(1), The Patents Act, 1970.
88. Section 63(2), The Patents Act, 1970.
89. Ibid.
90. Section 63(3), The Patents Act, 1970,
as amended in 1999, 2002, and
2005, and Rule 87(2), The Patent Rules, 1972, as
last amended in 2006.
 PATENT REVOCATION AND SURRENDER 231

91. Ibid.
92. Section 63(4), The Patents Act, 1970.
93. Rule 87(3), The Patent Rules, 2003 as last amended in 2006.
94. Ibid.
95. Rule 87(4), The Patent Rules, 2003 as last amended in 2006.
96. Ibid.
 10
Remedies

he reliefs granted to a person in an infringement suit are called as

remedies. The remedies granted by a court in an infringement suit
may be broadly classified as follows:
1. Injunction;
2. Damages and Account of profits'; and
3. Destruction, Seizure or Forfeiture.’

10.1 INJUNCTION
An injunction is an order given by the court against a party in an
infringement suit asking the party to act or to restrain from acting in
a particular manner. Injunctions are generally granted by courts based
on equitable principles. The court can grant either a temporary and/or a
permanent injunction in an infringement suit.

10.1.1 Temporary Injunction

A temporary or interim injunction is generally granted when an
infringement suit is pending before the court. The purpose of a temporary
injunction is to restrain the defendant in a suit from carrying out
allegedly infringing activities while the case is pending. It is granted to
mitigate the risk of injustice to the patent holder during the pendency of
the suit (Wockhardt Limited v. Hetero Drugs Limited and Ors). The
object
of the injunction is to protect the plaintiff against injury by violation
of
 REMEDIES ; 233

his right, for which he could not be adequately compensated in damages

recoverable in the action if the suit were resolved in his favour.’
The court would grant a temporary injunction in a patent infringe-
ment action if,
a. There is a prima facie case, that the patent is valid and infringed;
b. The patent holder will suffer an irreparable loss if injunction is not
granted; and,
c. The balance of convenience is in favour of the injunction being
granted (National Research Development Corporation of India v. The
Delhi Cloth & General Mills Co. Limited).

10.1.1.1 Prima Facie Case

The patent holder must prove that there is a strong prima facie case in
his favour for grant of an injunction. He must show to the court that
the patent is prima facie valid and infringed. No presumption of validity
would attach to a patent granted by the Controller, notwithstanding
examination and investigation made by him under the Act (Surendra Lal
Mahendra v. Jain Glazers and Ors). The mere fact of the granting of a
patent is not in itself an indication that the patent holder has established
to the satisfaction of any authority that he has the right to the monopoly
which he claims.‘ The validity of the patent and infringement must be
proved independently of the grant of the patent by the Controller.’
The patent holder will not have a prima facie case and an interim
injunction will generally not be granted if the patent is a recent one and
there is a serious controversy about the validity of the grant of the patent
itself (V. Manika Thevar v. Star Plough Works, Melur). Furthermore, if the
defendant, alleged infringer, in an infringement suit proves that a serious
controversy exists with regard to validity of the patent or, in other words,
if patent validity is disputed then the patent holder will not have a prima
facie case.° For a new patent, a mere challenge at the Bar would be quite
sufficient for refusal of a temporary injunction. However, if the patent is
sufficiently old and has been worked, the court will, for the purpose of
temporary injunction, presume the patent to be valid (National Research
Development Corporation of India v. The Delhi Cloth & General Mills Co.
Limited and Ors). As a general principle, the court will presume a patent
that is more than six years old to be valid.’ Furthermore, if the defendant
attempted to acquire a licence over the patent, the court will presume that
he accepted the validity of the patent.”
The patent holder will be considered to have a prima facie case, only
suit
if there is a strong possibility of the patent holder succeeding in the
234 INDIAN PATENT LAW AND PRACTICE

(Hindusthan Lever Limited v. Godrej Soaps Limited and Ors). In other

words, to prove prima facie case, the patent holder must prove that
the defendant’s product or process is infringing at the first instance or
based on preliminary analysis. The merits of the patent holder's case and
defences of the defendant will be considered for determining the prima
facie case (J. Mitra and Co. Privatea Limited v. Kesar Medicaments and
Anr.). Non-use of a patented invention by the patent holder in India will
not give rise to a prima facie case and a temporary injunction will not be
granted because the objective of the patent system is to promote progress
of science and technology, which would not be possible if the patented
invention is suppressed by non-working (Franz Xaver Huemer v. New
Yash Engineers). Furthermore, such suppression would also be counter
productive to the country’s economy because of lack of manufacture,
production, and utilization, of the patented invention.’ While appreciating
the question of prima facie case, the court would be governed by sound
principles of law, the facts on record, and whether the plaintiff has made
out a case for grant of injunction (Garware-Wall Ropes Limited v. Mr.
Anant Kanoi and Ors).

10.1.1.2 Irreparable Loss

A party is said to suffer irreparable injury if the party cannot be
compensated in money because of an injunction being granted or
denied." Holder of a patent will be said to suffer irreparable loss if
continuance of infringement by the alleged infringer results in injury
to the patent holder, and such injury cannot be compensated through
monetary damages. Irreparable loss will be determined by the court
based on whether damages would be an adequate remedy to the patent
holder on succeeding in an infringement suit. The patent holder will
not be considered to suffer irreparable loss, if damages are adequate to
compensate the patent holder for the loss caused to him until the suit is
decided and the defendant, alleged infringer, is in a position to pay such
damages (FE Hoffmann-La Roche Limited and Anr. v. Cipla Limited). In
such a situation, a temporary injunction will not be granted even if the
patent holder has a strong prima facie case.!!
After the patent holder proves that monetary damages would not be
adequate to compensate for the injury caused due to infringement by the
defendant, the court will verify if monetary damages would be adequate
remedy for injury caused to defendant due to grant of injunction.’
If
damages is an adequate remedy and the patent holder is in a financi
al
position to pay such damages, the defendant would not be put
under
 REMEDIES 235

irreparable loss." In a situation where damages is not an adequate remedy

for both the parties in an infringement suit, the court will decide on the
grant of injunction based on balance of convenience. On the other hand,
if damages are an adequate remedy for both parties, irreparable loss will
not be said to exist.

10.1.1.3 Balance of Convenience

Balance of convenience is considered by the court for deciding on
grant of temporary injunction to the patent holder when there is doubt
about the adequacy of compensation in the form of damages to either
or both parties in an infringement suit.'* The factors for determining
balance of convenience will vary from case to case and will depend on
circumstances of each case.'* One significant factor for determining
balance of convenience is the disadvantage suffered by each party due to
grant of temporary injunction and the extent to which the disadvantage
to each party cannot be compensated by damages in the event of success
in the suit.'* Other factors such as the nature of the patented invention,
use of the patented invention, the timing of the infringement action and
so on will also be considered for determining balance of convenience (FE
Hoffmann-La Roche Limited and Anr. v. Cipla Limited). Factors such as
expiry of the patent within a short period of time, equal size of parties
and so on may go in favour of patent holder for deciding balance of
convenience (Franz Xaver Huemer v. New Yash Engineers). On the other
hand, factors such as stultification of defendants investment, loss of
employment, public interest in the product (such as life saving drug),
or smaller size of the defendant, may go against the patent holder while
determining balance of convenience.” In a situation, where the balance
is approximately equal, the court may consider the relative strength
of each party’s case and grant or deny temporary injunction, if it is
apparent by undisputed evidence that the strength of one party’s case in
the infringement suit is disproportionate to that of the other party (F
Hoffmann-La Roche Limited and Anr. v. Cipla Limited).

10.1.2 Study of Relevant Cases

V. Manika Thevar v. Star Plough Works
The Appellant, who is the patent holder of a patent, relating to a
pattern of a plough having a twist, filed an infringement suit against the
Respondent alleging that sale of similar ploughs amounts to infringement
and applied for interim injunction against the Respondent during the
pendency of the proceedings.'* In response, the Respondent denied the
236 INDIAN PATENT LAW AND PRACTICE

allegation of the Appellant by stating that the plough patented by the

Appellant was not infringed because the patent was invalid as it was well
known and lacked inventive genius.
The court started its reasoning by expounding the principles regulating
the grant of an interim injunction in a suit of infringement of a patent.
It stated that the patent holder in an infringement suit must make out
a strong prima facie case for the issue of a temporary injunction.” The
court further stated that an interim injunction would not be granted if
the patent obtained by the patent holder was a recent one and there is a
serious controversy about the validity of the grant of the patent itself.”
If, from the objections raised by the defendant, it was clear that a serious
controversy existed as to whether or not the invention claimed by the
patent holder was a new one, or whether or not the invention involved
any new inventive skill having regard to what was known or used prior to
the date of the patent, the court stated that an interim injunction would
not be granted restraining the defendant from pursuing his normal
business activity.”!
Based on the facts of the case, the court stated that the Appellant
failed to show prima facie case by rebutting Respondent's plea of prior
knowledge and use, and by failing to submit data relating to production
and use of the patented product.” It further stated that patent validity
could not be attached because the patent was a very recent one, it being
less than six years old.”? Additionally, the court observed that there was a
serious controversy about the validity of the grant of the patent, touching
the originality or the inventive genius of the patent holder, or as to how far
the prior knowledge holding the field would disentitle the patent holder
to the grant of the patent based on prior knowledge and use.” In the light
of its analysis, as the Appellant failed to show a prima facie case regarding
patent validity, the court denied the grant of interim injunction.

Krone Aktingesellschaft and Anr. v. Kartik Telecomptrols

The Appellant in the case, who is the holder of a patent, over an
invention for a casing, particularly, a junction-box casing for tele-
communications engineering, filed an infringement suit and prayed for
an interim injunction during the pendency of the suit.?’ In response, the
Respondent counter-claimed that the patent was invalid and that the
injunction was not warranted.
As the patented product was on sale and on public display before
the patent filing date and as the patent was only two years old, the court
 REMEDIES 237

stated that the prima facie case was not in favour of the Appellant.’° With
regard to balance of convenience, the court stated that as the patented
products were sold only to government departments, which made it easy
to assess the damages and as the Respondent had already invested in the
products, the factor weighed against the patent holder.” In the light of its
analysis, as prima facie case and balance of convenience were against the
patent holder, the court denied the interim injunction.

Officine Lovato SPA v. Raajan Automobiles Pvt Limited and Ors

The patent holder of a patent relating to an Auto Gas Conversion Kit
filed an infringement suit against the Respondent alleging patent, design,
and trademark infringement, and prayed for an interim injunction during
the pendency of the suit.” After reviewing the facts and arguments, the
court stated that the product sold by the Respondent was identical to
that of the patent holder, and that it infringed the patent and design
rights of the patent holder.” Therefore, it stated that the patent holder
proved the prima facie case and that non-grant of the injunction would
cause irreparable loss.*° In the light of its reasoning, the court granted
the interim injunction. The court pointed out in the case that an interim
injunction may be granted in a case even if the patent or trademark was
pending grant or registration, if the patent holder can show prima facie
case through grant or registration in convention countries.”

J. Mitra v. Kesar Medicaments

The patent holder, Appellant, of a patent relating to a device for
detection of antibodies to Hepatitis C Virus, filed an infringement suit
against the Respondents and applied for an interim injunction during the
pendency of the suit.” The court first observed that it is well settled as
held in the decisions in Bishwanath Prasad Radhey Shyam and Standipack
Private Limited cases that the grant of a patent would not give rise to a
presumption of validity of the patent, notwithstanding, the examination
and inspection carried out by the Patent Controller and that the validity of
the patent could be challenged in infringement proceedings on the same
grounds on which revocation could be claimed under Section 64 of the
Patent Act.? The court then cited the decision in M/s National Research
Development Corporation of India case, which held that where a patent
had been in existence for sufficiently long and had been worked the court
could presume the same to be valid for purposes of grant of temporary
alone
injunction.” It then stated that the term of existence of the patent
238 INDIAN PATENT LAW AND PRACTICE

would not give rise to validity of a patent for grant of injunction and that
merits of the case of the patent holder and defences of the defendant must
be considered.”
After reviewing the facts of the case, the court considered various
aspects such as prior knowledge, prior working, anticipation, inventive
step, sufficiency of disclosure, and similarities between patented invention
and the product, and held that the patent holder had a prima facie case.
It stated that the patented invention was not known or worked before
the date of patent, the patent was not anticipated by the cited US patents
and that the patent possessed sufficient disclosure.** Then, the court
compared the patent to the product and pointed out that the product had
all features claimed in the patent.” In the light of its analysis, the court
held that the patent holder had made out a prima facie case by proving
that the patent was valid and infringed.**
As the use of patent was limited, the court observed that irretrievable
prejudice would be caused to the patent holder if interim orders were not
granted.” The court then stated that the balance of convenience was in
favour of the plaintiff as the plaintiff’s patent could not be permitted to be
infringed in the circumstances of the case.*° As the patent holder proved
prima facie case, irreparable harm would be caused to the patent holder in
the absence of an injunction and because the balance of convenience was
in favour of the patent holder, the court granted an interim injunction,
restraining the Respondents from manufacturing, selling, offering for
sale, or in any other manner dealing with the patented product.*!

Dhanpat Seth and Ors v. Nil Kamal Plastic Crates Limited

The Appellant, as patent holder, filed an infringement suit against
the Respondent alleging violation of its patent relating to a Kilta and
prayed for an interlocutory injunction during the pendency of the suit,
which was denied by the single judge of the high court. The Appellant,
therefore, filed an appeal before the Divisional Bench against the order of
the single judge. The court stated in the case that a mere grant of a patent
would not give rise to a presumption of validity because the patent may
be
challenged by any person before the patent expires.** As the Responde
nt
in the present case challenged the validity of the patent and the court
on
its preliminary analysis believed that the invention that was the
subject
of the patent lacked novelty and inventive step, the court said
that the
Appellant did not have a prima facie case for grant of injunction.“
The court then cited the decision of the House of Lords in Ameri
can
Cyanamid Co. v. Ethicon Limited,’ which clearly laid down that
if damages
 REMEDIES 239

in the measure recoverable at common law would be adequate remedy

and the defendant would be in a financial position to pay them on the
success of the patent holder in the suit, no interlocutory injunction would
normally be granted, however, strong the patent holder's claim appeared
to be at that stage.** The court then pointed out that the Appellant in the
present case could be adequately compensated by damages because the
loss to the Appellant could be ascertained.” As the Appellant’s patented
invention lacked novelty and inventive step and because the Appellant
could be adequately compensated on success in the suit, the court denied
the interlocutory injunction to the Respondent.** The court then directed
the Respondent to maintain accounts of the sales of Kiltas until the case
was decided and to submit such accounts to the court.”

Bajaj Auto v. TVS Motor Company

Bajaj Auto Limited (Bajaj) acquired a patent with regard to an
invention relating to the use of twin spark plugs for efficient combustion
of lean air fuel mixture in small bore, ranging from 45 mm to 70 mm,
internal combustion engine working on the 4-stroke principle.*° TVS
Motor Company Limited (TVS) launched motor bikes of 125cc under
the trademark FLAME, powered with a lean burn internal combustion
engine of bore size 54.5 mm with a twin spark plug configuration.”
Bajaj filed an infringement suit against TVS and applied for an interim
injunction during the pendency of the suit.
The court considered the existence of prima facie case, balance of
convenience, and inadequacy of compensation for making a decision on
grant of interim injunction. It stated that the invention was novel and
non-obvious because it was different from prior art, had been marketed
without objection for five years, and there was no proof that the invention
was obvious.” In such a situation, the court pointed out that Bajaj would
have a prima facie case of validity of the patent. It further stated that the
patented product's extensive use in the market proved that it was enabled.
As the grant of a patent creates a statutory monopoly, which protects the
patentee against any unlicensed user of the patented devise, enabling the
patentee to get an order of injunction, and considering that a patent had
been in existence for more than five years, the court stated that there was
a presumption of patent validity.” As the product of TVS was similar
to that of Bajaj, the court observed that there was a prima facie case of
infringement.”
Considering the fact that Bajaj was in the market and its patent was
the
for a limited period and it was in a crucial stage of development,
240 INDIAN PATENT LAW AND PRACTICE

court pointed out that TVS could not be permitted to interfere with
Bajaj’s business, especially as TVS was a strong competitor to Bajaj.”
Furthermore, considering the fact that Bajaj had come up in the world
market by sale of its product, and its period was only for twenty years,
and there was every possibility for a new invention in the field by bringing
the new product even before the time of expiry of patent granted to
Bajaj, and, as such, the invention might be brought by Bajaj itself, the
court stated that quantum of damages which Bajaj might suffer in not
granting injunction could not be ascertained in the monetary sense.”
Because, either party was in a position to pay damages if the other party
succeeded, the court held that balance of convenience weighed in favour of
Bajaj.” With regard to irreparable loss, the court pointed out that
damages could not be calculated because it was difficult to estimate the
loss on Bajaj due to sales of TVS and competition in the market, and,
therefore, Bajaj would be put under irreparable loss if injunction was not
granted.* The court granted injunction because Bajaj had a prima facie
case, the balance of convenience weighed in its favour, and as damages
was not an adequate remedy, and irreparable loss would be caused if
injunction was not granted.

TVS Motor Company Limited v. Bajaj Auto Limited

The case is a continuation of the patent litigation between TVS
Company Limited and Bajaj Auto Limited regarding the patent held
by Bajaj relating to the improved internal combustion engine based on
four stroke principle. Bajaj filed an infringement suit against TVS for
infringement of its patent and prayed for interim injunction during the
pendency of the suit. In furtherance, an interim injunction was granted
by the Madras High Court in favour of Bajaj, restraining TVS from selling
motor cycles having internal combustion (IC) engines with three valves
and two spark plugs. In this case, TVS filed an application challenging the
continuance of the interim injunction against it.°°
After hearing the parties and analysing the facts of the case, the
court discontinued the interim injunction granted against TVS.° The
court compared the technologies used by Bajaj and TVS in the light of
patents based on which such technologies had been implemented
by
the companies and held that the technologies were prima facie differe
nt
from each other.*' While Bajaj’s technology sparked the ignition
with
twin plugs in a four-stroke engine of a single cylinder with two valves,
in
order to produce improved internal combustion in a lean
burn mixture,
the court pointed out that TVS’s technology licensed from AVL
Austria
 REMEDIES 241

was valve centric as the two intake valves provided for combined air fuel
mixture of swirl and tumble action, with a separate exhaust valve in an
internal combustion engine of single cylinder with four stroke with the
aid of twin plug provision.” The court pointed out that the technologies
differed in the number of valves and positioning of the spark plugs.® As
both the technologies were patented in India, the court observed that
they were prima facie valid and deserved equal protection.”
Considering the fact that the technologies achieve the result using
different techniques, the court stated that TVS’s technology does not
prima facie infringe on Bajaj’s patent and, therefore, Bajaj does not have
a prima facie case of infringement.® The court further fortified its view,
stating that Bajaj does not have a prima facie case because the validity of
the patent was in question in a revocation proceeding before the Appellate
Board.® The court did not discuss about balance of convenience and
irreparable loss because Bajaj failed to show prima facie case.” In the
light of its analysis, the court discontinued the interim injunction granted
to Bajaj as it did not show a prima facie case of infringement by TVS.
In a special leave appeal, filed by Bajaj before the Supreme Court,
against the decision of the court, the Supreme Court affirmed the
decision and allowed TVS to sell its bikes, but asked it to maintain an
accurate records/accounts of its all India and export sales. The Supreme
Court also ordered for the appointment of a Receiver to whom the
records of such sale must be furnished every fortnight by TVS. ” Finally,
the Supreme Court asked the court to dispose the case by 30 November
2009.

Mariappan v. A.R. Safiullah

The holder of a patent, relating to food-grade laminated paper, and a
method and apparatus for manufacturing the laminated paper, filed an
infringement action against Mariappan and others and sought an interim
injunction to restrain infringing activities during the pendency of the
suit.”
on
The court started its analysis by observing that it was a settled positi
ing the
of law for granting an order of ad-interim injunction, includ
the applic ant/
infringement of Designs, Copyrights, and Patents, that
ience lay
plaintiff must prima facie establish that the balance of conven
to him on
clearly in his favour and irreparable loss might be caused
injunction.” It then
account of non-granting of an order of ad-interim
amendment would be
pointed out that a patent granted after the 2005
facie case and that the onus
given greater weight for ascertaining prima
 242 INDIAN PATENT LAW AND PRACTICE

of proving prima facie patent validity and infringement was on the patent
holder.”
Though the patent was examined and granted by the patent office,
the court observed that the existence of a granted patent would not
guarantee the validity of the patent.” It then stated that grant of a
patent itself could not be deemed to be prima facie case on the side of
the patent holder and that it was the duty of the patent holder to prove
prima facie case, as in any other case of application for injunction.” Since
applications for opposition of grant of patent were pending adjudication
before the appropriate authority, the court stated that prima facie case
weighed against the patent holder.”* Considering the fact that the art of
making laminate paper was well known and as there were patents and
publications that dealt with laminate paper, the court stated that the
patent prima facie lacked inventive step and was, therefore, not valid.”
As the patent holder failed to prove prima facie case, the court upheld the
denial of interim injunction. The court observed in the case that the rule,
which provides that presumption of validity would lie against a patent
that was less then six years old, was no longer a strict principle because
of the rapid pace at which technology was progressing, and the speed at
which products would today lose relevance.”®

Ravi Kamal Bali v. Kala Tech and Ors

The patent holder in the case sought an injunction restraining the
Respondents from making, using, selling, or distributing tamper proof
locks/seals that fall within the scope of the claims of the patent holder’s
patent bearing No. 162675 and patent of addition No. 178879, which
activities would infringe the patents. And, claimed for a tempor
ary
injunction during the pendency of the suit.”
Though the court agreed that the product in the case was
infringing,
it denied interim injunction as the patent holder made
an incorrect
representation regarding a material fact before the court.
*” The patent
holder in the case represented that it was not aware
of the infringing
activities of the Respondents until the date of appli
cation, which the
court based on its analysis concluded was not
true.*!

Garware-Wall Ropes v. Techfab India

The Appellant, who is the holder of a patent relat
ing to synthetic rope
gabio n, filed an infringement suit against the Resp
ondent, and applied for
an interim injunction during the pendency
of the suit.*? The trial court
granted interim injunction, which was inter
fered by the single judge of
 REMEDIES 243

the high court.*’ The Appellants challenged the decision of the single
judge before the Division Bench.
The court upheld the decision of the single judge because the
Appellant could not show prima facie case, and, because, damages
would be adequate remedy if the Appellant proves infringement by the
Respondent. As the patent was new, its validity was not upheld by any
court and as the Respondent raised a substantial controversy regarding
the validity of the patent, the high court stated that an interim injunction
was not warranted.™ In the light of its analysis, the court rejected the
grant of interim injunction and ordered for maintenance of accounts by
the Respondent as per the directions of the single judge.”

Garware Wall Ropes v. A.I. Chopra, Engineers and Contractors

The Appellant, who is the patent holder of a patent relating to GSWR
and Spiral Lock Systems, filed a suit for declaration that the Respondent
was not entitled to manufacture, sell, use, or offer for sale, the patented
invention and prayed for a permanent injunction and damages.** The
patent holder prayed for a temporary injunction during the pendency of
the suit.” In response, the Respondent claimed that the patented invention
was publicly known for two decades and was, therefore, not an invention,
and that the use of the patented invention for the Railways amounted
to government use, and that the patent holder delayed in approaching
the court and, therefore, that the temporary injunction should not be
granted.®
The court started its analysis by stating that the grant of a patent
must be given credibility while deciding on the grant of an injunction.”
Though the grant of a patent does not give rise to a presumption in
favour of the patent holder, the court stated that it would have value while
deciding on the issue of injunction.” After considering the articles cited
by the Respondents as prior art, the court stated that all the elements
and/or features of the GSWR System, claimed in the patent, were not
disclosed in a single document.” It further opined that any given single
document was silent on many aspects of the GSWR System and, further,
stated that the GSWR System was neither a workshop improvement nor
a cosmetic change to the existing methods for protection of rock-fall.””
In the light of its reasoning, the court held that respondents had failed
prima
to prove by adequate pleadings and by affirmative evidence even
used in India
facie that the patented products or process was known and
or elsewhere for two decades, as claimed by them.”
 244 INDIAN PATENT LAW AND PRACTICE

Furthermore, the court stated that the use by the Respondents was
not government use and that irreparable loss would not be caused to the
Respondents due to stoppage of the railway contract if injunction was
granted because a licence was available from the patent holder to carry
out its obligations for Indian Railways.” As the patent was in force, the
court held that allowing the Respondent to use the patented invention
would drain the profits of the patent holder and, therefore, the court held
that the balance of convenience was in favour of the patent holder.*° In
the light of its reasoning, the court granted the temporary injunction
because the patent holder proved prima facie case and that balance of
convenience was in its favour.

M.C. Jayasingh v. Mishra Dhatu Nigam Limited (MIDHANI), Apollo

Hospitals, Apollo Hospitals Enterprise Limited and Cancer Institute
(WIA), (Regional Cancer Centre)
The Appellant, Jayasingh, acquired a patent over a prosthesis made of
titanium alloy, which is used in bone salvage surgery.” On learning that
the Respondents were making, selling, distributing, and using prosthesis
that was covered by his patent, Jayasingh filed an infringement suit against
the Respondents and prayed for an injunction during the pendency of
the suit.”* After hearing the parties and reviewing the facts on record, the
court refused to grant temporary injunction to Jayasingh.
The court stated that the Hinge Knee Prosthesis of the Respondents
was different from the prosthesis claimed by Jayasingh because it did not
have the polymer, rotating hinge mechanism, extending mechanism,
and so on, that were present in the patented prosthesis.” Therefore, the
court pointed out that the prosthesis of the Respondent was not prima
facie similar, or deceptively similar to that of the Appellant.'® The court
further observed that mere functional similarity of the products
of the
patent holder and the alleged infringer would not warrant the grant
of a
temporary injunction.'”!
Considering the relevance of prosthesis to those who are in
need of the
same as a life-saving equipment, its cost effectiveness, and
the functional
advantage of a customized titanium prosthesis made
and used by the
Respondents, the court stated that the balance of conve
nience was not
in favour of Jayasingh.' Furthermore, the court
pointed out that there
was no proof of loss that would be suffered by Jayas
ingh if the injunction
was not granted.'"* Based on its analysis, the court reject
ed the temporary
injunction to Jayasingh and ordered the trial court
to complete the
infringement proceedings within four months.'"
 245
REMEDIES

Braun Melsungen AG and Ors v. Rishi Baid and Ors

The case related to a patent involving an invention concerning safety
intravenous catheters or cannulae held by the Appellant, Braun Melsungen
AG. The Appellants filed a patent infringement suit against Respondents,
who were contract manufacturers of the Appellants, alleging that the
Respondent’ safety catheter infringed the patented catheter.'° The
Appellants applied for an interim injunction during the pendency of the
suit.
After examining the arguments of the parties, the court held that
the Appellants were not eligible for an interim injunction because they
did not have a prima facie case.’ The court stated that the Appellants
did not have a prima facie case because the patent was a recent one and
because there was a serious challenge to its validity.’ It stated that the
validity of the patent was prima facie questionable because the field of
the patent was a crowded one, safety catheters were being used for a long
time and, because, there were close prior art patents relating to the safety
catheters.'* After comparing the Appellants’ catheter to the Respondents’
catheter, the court observed that they were prima facie different from
each other.” The court further pointed out that the Appellants did not
approach the court with clean hands because they withheld important
facts in the application for injunction.''® As the Appellants could not
show prima facie case and approached the court with unclean hands, the
court denied the temporary injunction to the Appellants.''' However, the
court directed the defendants to keep accounts of the manufacture and
sales of the safety intravenous cannulae in question during the pendency
of the suit, and to make the same available to the court as and when
directed by it.'”

E. Hoffmann-LA Roche Limited and Anr. v. Cipla Limited

The Appellants, F. Hoffmann-La Roche Limited (Roche), the Licensor
of a patent relating to the drug Erlotinib used for cancer treatment and
said
OSI Pharmaceuticals Inc. (OSI), the holder of the patent of the
Limited
drug, filed an infringement suit against the Respondent, Cipla
injunction
(Cipla).!"? The Appellants filed an application for temporary
single judge
during the pendency of the suit, which was rejected by the
and, therefore, filed this appeal.'"*
rejection of the
After hearing both the parties, the court upheld the
‘
temporary injunction based on the following reasons: ng
the compound comp risi
a. The patent granted to OSI related to
equently, OSI filed
combination of Polymorphs A and B.'" Subs
 246 INDIAN PATENT LAW AND PRACTICE

another application relating to the Polypmorph B form of the

compound but failed to disclose such information to the Controller.''*
Non-disclosure of such information regarding patent filings was not
in consonance with the requirements of the Patents Act.''”? As the
information relating to patent applications would have an impact
on the decision of the Controller to grant a patent, the Respondent's
challenge to patentability of OSI’s compound was credible.''*
Furthermore, non-disclosure of information relating to patent filings
before the court, while asking for an interim injunction, did not give
the court an opportunity to determine whether the drug sold by
Cipla fell within the scope of the patent in question, and, therefore,
the Appellants failed to show a prima facie case for grant of temporary
injunction.'”
b. The Respondent raised a serious question regarding the validity of
the patent in the light of Section 3(d) of the Patents Act by stating
that polymorphs of known substances were not patentable, and by
citing relevant prior art references.'”° As the validity of the patent is in
question, an interim injunction was not warranted.'?!
c. The general public access to life-saving drugs, such as the patented
drug in question, in the case assumes great significance and grant
of an injunction would have an adverse impact on such access.'”
Therefore, as stated by the single judge, the injunction might not
be granted because the public interest in greater public access to a
life saving drug would outweigh the public interest in granting an
injunction to the Appellants.'> The public interest favours denial
of
injunction in the light of the fact that the patented drug and the drug
sold by Cipla are different, and Cipla had challenged the validity
of
the patent.'”4
As the Appellant failed to show prima facie case and
as the grant of
injunction regarding a life saving drug was not in favou
r of public interest,
the court denied the temporary injunction to the Appel
lants.
10.1.3. Injunction Analysis
All three factors, prima facie case, irreparable
loss, and balance of
convenience, are considered by courts for deciding
on grant ofa temporary
injunction. Temporary injunction will be granted
only if the patent holder
proves that there is prima facie case, irreparable
loss will be caused if such
an injunction is not granted, and if balance
of convenience is not in his
favour. Though courts initially considered exist
ence of a patent for six or
 REMEDIES 247

more years to give rise to presumption of validity in order to prove prima

facie case, the term is not considered by courts as a strict rule. Public
interest may be a compelling factor based on which courts may deny a
temporary injunction to the patent holder even if prima facie case and
irreparable loss is proved.

10.1.4 Permanent Injunction

A permanent injunction is generally granted after the patent holder
succeeds in the infringement suit and the defendant is determined as
an infringer. On proving infringement of a patent, the patent holder
will be eligible for a permanent injunction as a final remedy (Rohtas
Industries Limited and Ors v. Indian Hume Pipe Co. Limited). Infringement
of a patent gives rise to a presumption of likelihood of infringement by
the infringer in the future and that justifies the grant of a permanent
injunction against the infringer.'* Unless there is a clear cut intention
that the infringer does not have the intention to infringe the patent in the
future, a permanent injunction will be granted to the patent holder.’ By
granting the permanent injunction, the court will restrain the infringer
from carrying out any infringing activities in the future. Any infringing
activity of the defendant, after grant of a permanent injunction against
such activity is directly enforceable in a court.

10.2 DAMAGES AND ACCOUNT OF PROFITS

The patent holder might choose any one among damages or account
of profits after succeeding in an infringement suit. Damage is the loss
sustained by the patent holder because of infringer’s activities and
account of profits includes the money made by the infringer through
infringement activities. The patent holder can claim either account of
profits or damages.
The principles relating to assessment of damages in case of patent
infringement have not been clearly laid down by courts. Courts,
generally, adopt a viable method in the light of the circumstances for
assessing damages and do not grant damages arbitrarily (Pillalamarri
Lakshmikantham and Ors v. Ramakrishna Pictures and Ors). The
damages may be calculated using methods such as money spent by the
patent holder on Research and Development, reasonable royalty based
on number of patented products sold by the infringer, and so on (The
Himalaya Drug Company v. Sumit and PN. Krishnamurthy v. Cooperative
generally
for American Relief Everywhere). The account of profits will
248 INDIAN PATENT LAW AND PRACTICE

be calculated by courts based on the rendition of accounts by the

infringer (Pepsico Inc. and Ors v. Sunrise Beverages). Account of profits
will be granted by a court to the patent holder only if the profits of the
infringer result from infringing activities.
In addition to damages and account of profits, the court may also
grant punitive or exemplary damages to the patent holder. Such damages
are granted to ensure that infringers are not allowed to take advantage of
the patent owner's rights, thinking that they will be required to pay only
compensatory damages (The Himalaya Drug Company v. Sumit). The
court will grant an amount of punitive damages, which it believes are
sufficient to deter an infringer from infringing the intellectual property
in question (Time Incorporated v. Lokesh Srivastava and Anr.).
Damages or account of profits will not be granted if infringement
of the patent occurs during the period of patent lapse.'?” Furthermore,
if a published specification is amended by a disclaimer, correction, or
explanation, damages or account of profits will not be granted by the
court for infringement before the date of such amendment.'* However, if
the patent holder can prove that the published specification was drafted
in good faith and with reasonable skill and knowledge, then the court
may grant damages or account of profits for infringement before the date
of allowance of the amendment.'”°
10.3. DESTRUCTION, SEIZURE, OR FORFEITURE
On succeeding in an infringement suit, the patent holder may plead for
seizure, destruction, or forfeiture of the infringing goods. On receiving
such a plea, the court may order for destruction, seizure, or forfeiture of
such goods or materials and/or implements used primarily for creating
infringing goods without paying any compensation to the infringer.'*°

10.4 INNOCENT INFRINGEMENT

The court will not grant damages or account of profits to an innocent
infringer.'’' An innocent infringer is a person who infringes a patent
having no knowledge of the existence of the patent, and having
no
reasonable grounds to believe that a patent existed.! Incorporation
of
a patent notice on the product, indicating the patent number, will
be
considered to be sufficient notice for proving that the infringement
was
not innocent.'* However, if the notice does not have the patent
number,
the infringer can claim that the infringement was innocent.'*
Though,
the court will not grant damages or account of profits to the patent
holder,
it may grant an injunction against an innocent infringer.'*
 REMEDIES 249

For example, X acquires a patent over a revolving table and starts

selling it in India without any patent notice. Y starts manufacturing and
selling the revolving tables in Bangalore. X files an infringement suit
against Y and the court holds that Y is liable for patent infringement.
In such a case, X will not be eligible for damages or account of profits
if Y can prove that he was not aware of the patent over the table. In the
absence of a patent notice, Y can easily prove his lack of awareness.

10.5 DECLARATION OF PATENT VALIDITY

The Appellate Board or the high court may grant a certificate of patent
validity after the patent holder successfully contests a plea for revocation.'”°
The specific claim in a patent specification that has been successfully
defended by the patent holder will be certified by the Appellate Board or
the high court as valid.'*” After the certificate of validity is granted, the
patent holder will be eligible for costs, expenses, and charges, if the patent
holder gets a favourable decision from the court in an infringement
suit or revocation proceeding based on the validity of the claim.'* To
get an order for such costs, expenses, and charges from the court, they
must be related to the proceeding concerning the claim directly or
indirectly.'”
The patent holder may not get such compensation, if the court trying
the suit or proceeding decides to the contrary.’ Furthermore, such
compensation will not be granted by the court, if the other party was
not aware of the certificate when he disputes the validity of the claim
or withdraws his plea as soon as he is made aware of the certificate."
Moreover, such costs may not be granted in case of an appeal from an
infringement suit or revocation proceeding.” The declaration of validity
of a patent by a court does not preclude a person from challenging the
patent’s validity or revoking the patent.
For example, if the Court holds, in an infringement suit or revocation
proceedings, that a patent held by X is valid and, therefore, cannot be
revoked, it will grant a certificate of validity. If X sues Y for infringement
and Y in response files a counter-claim for revocation with knowledge of
costs,
the certificate of validity, on succeeding in the suit, X can claim for
ement
charges, and expenses, incurred by him relating to the infring
suit.

10.6 DECLARATION OF NON-INFRINGEMENT

sale of a product, or use
The court may declare that manufacture, use or
application by a person
of a process does not infringe a patent claim on
 250 INDIAN PATENT LAW AND PRACTICE

for such declaration.'** A declaration of non-infringement will be issued

by the court only if:
1. The applicant for declaration made a written request to the patent
holder asking him to acknowledge that his product or process does
not infringe on the patent holder's patent. And the applicant had
provided details of his product or process to the patent holder
along with the written request in order to enable him to make a
decision; and,
2. The patent holder refused to give such an acknowledgement or did
not respond to the request.'“
The court will issue the declaration only if the patent holder does not
assert that the product or process for which the declaration has been
sought infringes his patent.'*°
For example, X holds a patent over a bicycle. Y a bicycle seller writes
a letter to X with details of his bicycles and requests X to acknowledge
that Y’s bicycles do not infringe on his patent. X refuses to give such an
acknowledgement. In such a case, on Y’s application, the court may issue
a declaration that Y’s bicycles do not infringe X’s patent. The court will do
its own analysis before making such a declaration.
Any person may file an application for declaration of non-infringement
after the grant of a patent is published by the patent office.'** The validity
of the patent cannot be questioned in an application for declaration of
non-infringement.'*” Furthermore, the decision of the court with regard
to the application for declaration will not have any implication on patent
validity.'“*

10.7 THREATS OF INFRINGEMENT

The court may grant relief to an aggrieved person based on ground
less
threats for infringement.’ Relief will be granted by the
court if the
patent holder or any interested person threatens anothe
r person with
proceedings for patent infringement by oral or written
communication,
including advertisements or circulars.'"’ A mere notifi
cation that a patent
exists will not amount to threat for patent infringeme
nt proceeding.'®!
The court may grant the following reliefs in case
of such threats:
1. A declaration that the threats are not justified;
'*
2. Injunction against the continuation of threa
ts;'*’ and
3. Damages for the loss incurred due to such
threats.'™
The court will not grant any relief, if the pate
nt holder proves that the
acts of the person to whom threats have been sent
amount to patent
infringement.'*® On the other hand, if the appl
icant for relief from threats
 REMEDIES 251

proves that the patent is invalid and, therefore, not infringing, the relief
will be granted by the court.'*
For example, X acquires a patent over a novel tyre. X sends a cease and
desist letter to Y, an established and renowned tyre manufacturer and
its dealers, stating that the tyres being made and sold by them amount
to patent infringement, and informing them that an infringement suit
will be filed against them if they don't stop selling tyres. In such a case,
Y can approach the court for an injunction against X. Y can also claim
damages for any loss caused due to stoppage of sale by a few dealers due
to the letter.

10.8 STUDY OF A RELEVANT CASE

S. Ram Kumar v. Micromax Informatics Limited
The case related to a patent held by Ram Kumar with respect to
technologies, including plurality of SIM cards as well as plurality of
blue tooth devices which work simultaneously.'” Ram Kumar sent
a representation, dated 18 July 2008, to the Chief Commissioner of
Customs, Chennai and on 8 December 2008 to the Chairperson of the
Central Board of Excise and Customs to take effective steps to seize
dual SIM card mobile phones which infringe his patent rights.'** Based
on the said communication, the Customs Authorities confiscated the
consignment of Samsung and Spice in Delhi, Mumbai, and Chennai.'”
At the same time, a notice dated 27 February 2009 was issued by the
Office of Commissioner of Customs, suspending the goods imported by
the Respondent, Micromax Informatics Limited (Micromax).'®
Alarmed by the notice issued by the Customs Authorities, Micromax
filed a suit for declaration of non-infringement of patent and for ground-
less threats before the District Court, Gurgaon.'*' After reviewing the
facts, the District Court passed interim orders dated 5 May 2009, restrain-
ing Ram Kumar or his agents from adopting any measure to prevent or
hinder the import, sale, and use of the dual SIM card phone models.'”
Ram Kumar and his agents were further restrained from threatening
Micromax circulars, advertisements, or by communications. Ram Kumar
filed this appeal against the decision of the District Court.'®
After hearing the arguments of the parties, the court upheld the
decision of the District Court.'“ The court pointed out that the features
of the products of Micromax are different from that patented by Ram
Kumar because Micromax’s product does not have the feature of
simultaneously two or more physical voice/audio paths and plurality of
blue tooth device, which were cited in Ram Kumar's patent.' Considering
252 INDIAN PATENT LAW AND PRACTICE

the fact that the issue relating to validity of Ram Kumar's patent was being
decided by the Appellate Board, the court stated that the reversal of the
order of the District Court would cause great damage to the Respondent,
and dismissed the appeal.’

NOTES
1. Section 108(1), The Patents Act, 1970. Section 108(1) reads as follows: ‘The
reliefs which a court may grant in any suit for infringement include an injunction
(subject to such terms, if any, as the court thinks fit) and, at the option of the
plaintiff, either damages or an account of profits.’
2. Section 108(2), The Patens Act, 1970. Section 108(2) reads as follows:
‘The court may also order that the goods which are found to be infringing and
materials and implement, the predominant use of which is in the creation of
infringing goods shall be seized, forfeited or destroyed, as the court deems fit
under the circumstances of the case without payment of any compensation.’
3. Ibid.
4. Ibid., at Para 7 citing Smith v. Grigg Limited, 41 R.P.C. 149(1).
5. Ibid., at Para 9.
6. Ibid.
7. Ibid., at Para 12.
8. Ibid., at Para 10.
9. Ibid.
10. Ibid.
11. Ibid.
12. Ibid.
13. Ibid.
14. Ibid.
15. Ibid.
16. Ibid.
17. Ibid.
18. Ibid., at Para 2.
19. Ibid., at Para 5.
20. Ibid.
21. Ibid.
22. Ibid.
23. Ibid., at Para 6.
24. Ibid.
25. Ibid., at Para 4.
26. Ibid., at Para 20.
27. Ibid., at Para 21.
28. Ibid., at Paras 1, 2, and 3.
29. Ibid., at Para 16 and 17.
30. Ibid., at Para 20.
 REMEDIES 253

. Ibid., at Para 19.

. Ibid., at Para 1.
. Ibid., at Para 49.
. Ibid., at Para 50.
. Ibid., at Para 51.
. Ibid., at Paras 70, 79, 95, 96, and 107.
. Ibid., at Para 119.
. Ibid.
. Ibid.
. Ibid.
. Ibid., at Para 120
. Ibid., at Para 1.
. Ibid., at Para 21.
. Ibid.
. All England Law Reports 504, (1975).
. Ibid., at Para 23.
. Ibid.
. Ibid., at Para 27.
. Ibid.
. Ibid., at Para 10.
. Ibid.
. Ibid., at Para 71.
. Ibid., at Para 50.
. Ibid., at Para 51.
. Ibid.,.at Para 61.
. Ibid., at Para 62.
. Ibid., at Para 65.
. Ibid., at Para 68.
. Ibid., at Para 1.
. Ibid., at Para 86.
. Ibid., at Para 71.
. Ibid.
. Ibid.
. Ibid., at Paras 74, 77 and 78.
. Ibid., at Para 84.
. Ibid., at Para 79.
. Ibid., at Para 85.
. Ibid., at Para 86.
. Ibid., at Para 13.
. Ibid.
. Ibid., at Para 1.
. Ibid., at Para 53.
. Ibid., at Para 55.
. Ibid., at Para 71.
254 INDIAN PATENT LAW AND PRACTICE

75. Ibid., at Para 71

76. Ibid.
77. Ibid., at Para 59.
78. Ibid., at Para 66.
79. Ibid., at Para 2.
80. Ibid., at Para 58.
81. Ibid.
82. Ibid., at Paras 2 and 4.
83. Ibid., at Paras 5 and 6.
84. Ibid., at Para 50.
85. Ibid.
86. Ibid., at Para 4.
87. Ibid.
88. Ibid.
89. Ibid., at Para 9.
90. Ibid.
91. Ibid., at Para 13.
92. Ibid.
93. Ibid., at Para 14.
94. Ibid., at Para 26.
95. Ibid.
96. Ibid., at Para 28.
97. Ibid., at Para 2.
98. Ibid., at Para 4.
99. Ibid., at Para 22.
100. Ibid.
101. Ibid., at Para 24.
102. Ibid., at Para 24.
103. Ibid.
104. Ibid., at Para 27.
105. Ibid., at Para 8.
106. Ibid., at Para 47.
107. Ibid.
108. Ibid.
109. Ibid.
110. Ibid., at Para 42.
111. Ibid., at Para 44.
112. Ibid.
113. Ibid., at Para 1.
114. Ibid..
115. Ibid., at Para 85.
116. Ibid.
117. Ibid.
118. Ibid.
 REMEDIES 255

119. Ibid.
120. Ibid.
121. Ibid.
122. Ibid.
123. Ibid.
124. Ibid.
125. Ibid., at Para 18.
126. Ibid.
127. Section 111(2), The Patents Act, 1970.
128. Section 111(3), The Patents Act, 1970.
129. Ibid.
130. Section 108(2), The Patents Act, 1970.
131. Section 111(1), The Patents Act, 1970. Section 111(1) reads as follow:
‘In a suit for infringement of patent, damages or an account of profits shall not
be granted against the defendant who proves that at the date of the infringement
he was not aware and had no reasonable grounds for believing that the patent
existed.
Explanation: A person shall not be deemed to have been aware or to have
had reasonable grounds for believing that a patent exists by reason only of the
application to an article of the word ‘patent’ ‘patented’ or any word or words
expressing or implying that a patent has been obtained for the article, unless the
number of the patent accompanies the word or words in question.’
132. Ibid.
133. Explanation to Section 111(1), The Patents Act, 1970. .
134. Ibid.
135. Section 111(4), The Patents Act, 1970.
136. Section 113(1), The Patents Act, 1970. Section 113(1) reads as follows: ‘If
in any proceedings before the Appellate Board or a High Court for the revocation
of a patent under Section 64 and Section 104, as the case may be, the validity of
any claim of a specification is contested and that claim is found by the Appellate
Board or the High Court to be valid, the Appellate Board or the High Court may
certify that the validity of that claim was contested in those proceedings and was
upheld.’
137. Ibid.
138. Section 113(2), The Patents Act, 1970.
139. Ibid.
140. Ibid.
141. Ibid.
142. Section 113(3), The Patents Act, 1970.
143. Section 105(1), The Patents Act, 1970. Section 105(1) reads as follows:
‘Notwithstanding anything contained in Section 34 of the Specific Relief Act,
1963 (47 of 1963), any person may institute a suit for a declaration that the use by
him of any process, or the making, use or sale of any article by him does not, or
would not, constitute an infringement of a claim of a patent against the patentee
256 INDIAN PATENT LAW AND PRACTICE

or the holder of an exclusive licence under the patent, notwithstanding that no

assertion to the contrary has been made by the patentee or the licensee, if it is
shown-
(a) that the plaintiff has applied in writing to the patentee or exclusive
licensee for a written acknowledgement to the effect of the declaration claimed
and has furnished him with full particulars in writing of the process or article in
question; and
(b) that the patentee or licensee has refused or neglected to give such an
acknowledgement.’
144. Ibid.
145. Ibid.
146. Section 105(4), The Patents Act, 1970.
147. Section 105(3), The Patents Act, 1970.
148. Ibid.
149. Section 106(1), The Patents Act, 1970. Section 106 (1) reads as follows:
‘Where any person (whether entitled to or interested in a patent or an application
for a patent or not) threatens any other person by circulars or advertisements or
by communications, oral or in writing addressed to that or any other person,
with proceedings for infringement of a patent, any person aggrieved thereby may
bring a suit against him praying for the following reliefs, that is to say -
(a) a declaration to the effect that the threats are unjustifiable;
(b) an injunction against the continuance of the threats; and
(c) such damages, if any, as he has sustained thereby.’
150. Ibid.
151. Explanation to Section 106, The Patents Act, 1970.
152. Section 106(1)(a), The Patents Act, 1970.
153. Section 106(1)(b), The Patents Act, 1970.
154. Section 106(1)(c), The Patents Act, 1970.
155. Section 106(2), The Patents Act, 1970.
156. Ibid.
157. Ibid.
158. Ibid.
159. Ibid.
160. Ibid.
161. Ibid.
162. Ibid.
163. Ibid.
164, Ibid., at Para 18.
165. Ibid., at Para 17.
166. Ibid., at Para 17.
 1]
PCT Applications

he Patent Cooperation Treaty (PCT) is a special treaty under the

Paris Convention.' The primary objective of PCT is to simplify and
make economical the filing of patent applications in multiple countries.”
Towards the said objective, the Treaty provides an international filing,
searching, and examination process for applicants seeking to acquire
international patent protection.’ It only provides an alternative to
applicants for filing patent applications directly in multiple countries
the
and does not grant patents. The authority to grant a patent rests with
country in which a patent application is filed after the PCT process.
of
The treaty was adopted in June 1970, by an initial membership
As of 19
eighteen countries and came into force on 24 January 1978.‘
a member of
March 2009, PCT had 141 member countries.’ India became
Treaty and the
the PCT in the year 1998.° The Regulations annexed to the
on of the
administrative instructions, provide the rules for implementati
ly constituted
Treaty.’ Such Regulations may be amended by the assemb
stered by the
under the Treaty from time to time.’ The PCT is admini
ty Organization
International Bureau of the World Intellectual Proper an
rland. WIPO publishes
(WIPO), head quartered at Geneva, Switze
provides comprehensive
Applicant’s guide for PCT applicants, which
be used by applicants and
guidelines on the PCT procedure, and may
process.”
patent practitioners for learning about the PCT
 258 INDIAN PATENT LAW AND PRACTICE

11.1 ADVANTAGES OF THE PCT SYSTEM

The PCT system provides certain benefits to an applicant from the cost,
time, and effort, perspective. By filing a PCT application, the applicant
can enter into various countries of interest by using such an application,
and need not draft and file an application in each country separately.
As a single application can be used for filing in multiple countries, the
effort and cost involved in drafting and filing an application separately
in each country may be saved by the applicant. For example, if X wishes
to acquire a patent in USA, UK, India, Japan, and Europe, X will have
the option of filing an application in each country separately, or entering
into each country by filing a PCT application. In such a situation, if X
files a PCT application, the cost, time, and effort, involved in drafting
multiple applications for each country, in compliance with the law, may
be saved. However, filing a PCT application will involve filing, searching,
and examination cost, which must be balanced with the savings from
avoidance of multiple drafts.
Furthermore, once an applicant files a PCT application, the applicant
gets a period of 30 months or more time from the date of priority in order
to enter into various countries. The applicant can use the said time to
decide on the business value of patent filing and the countries for such
filing. For example, if X files a PCT application, X will get 30 months or
more time to file the application in different countries. After filing the
PCT application, X can verify if his invention has business value during
those 30 months by taking steps for commercialization in his countries
of
interest and, thereafter, decide on filing for a patent in those countries
. By
doing so, X can make an informed decision on filing patents
in multiple
countries and, under certain circumstances, save cost,
effort, and time
by avoiding filing in countries where the invention
may not have any
business value.
On filing a PCT application, the applicant
gets a search and/or
examination report from a qualified patent office
, which provides inputs
to the applicant on patentability of the inven
tion. The applicant may
use such inputs in the reports on making a decis
ion on filing the patent
application and countries of such filing. For
example, if X files a PCT
application, X will get a search report along
with a written opinion on
patentability based on which X can decide on
moving forward with the
application. If the report indicates that the
invention is not patentable,
X can withdraw the application and save
the cost and effort for national
patent filings.
 PCT APPLICATIONS 259

11.2 PCT PROCEDURE

The process of acquiring a patent through the PCT system involves two
phases:
1. International Phase and
2. National Phase.
Every PCT application has to pass through the International Phase before
entering the national phase. The International Phase gives the applicant a
search report, examination report, and an opinion on patentability. After
the International Phase, the applicant has to file applications in each
country of interest in order to enter the National Phase. Each country’s
patent office will examine the patent application during the National
Phase and will grant a patent if the invention satisfies the patentability
requirements.

11.2.1 International Phase

The International Phase of the PCT procedure includes the following
stages:
1. Filing of international application;
2. International search;
3. Publication of the application; and
4. International preliminary examination.
The flow diagram provided hereunder shows the procedure during the
International Phase.

11.2.1.1 Filing of International Application

An application filed under the PCT is called as International Application."”
An international application may be filed for acquiring any kind of
patent, inventor certificate, utility model, utility certificate, and certificate
of addition.'! Such an application cannot be filed for acquiring design
patents, or industrial designs, or semi-conductor protection, or any other
type of intellectual property protection (Figure 11.1).

Applicant: A PCT application may be filed by any person who is a

national or resident of a country, which is a member of PCT." As India is
a member of PCT, a person who is a national or resident of India can file
a PCT application. A PCT application having two or more applicants may
a
be filed only if at least one of the applicants is a national or resident of
country which is a member of PCT.'’ For example, if X and Y, nationals
a PCT
of India and Argentina, are applicants in a patent application,
PCT member
application may be filed even though Argentina is not a
260 INDIAN PATENT LAW AND PRACTICE

Time Time
Line Process Process Line
(In Months) (In Months)

C, ; CT
Sees
Application
National / Regional
Application

Filing of application
with PCT
e
e
S
Oe

International Search Report Te

International Publication
Ye
9©
©
OO National Phase entry
in some Countries

International Preliminary
Examination

International Preliminary
; Report on Patentability

Entry into National Phase

for other countries <5.

Figure 11.1 Flow Diagram of the PCT Process, The International Phase
Note: The Time period has to counted from the Date of Priority or Filing,
whichever is
earlier.

because one of the applicants is a national of India, which is a

member
of PCT.
Any issue relating to nationality or residence shall be deter
mined in
accordance with the national law of the specific country.'* Genera
lly,
an established business corporation in a country is considered
to be a
resident of the country and a legally incorporated entity in
a country is
considered to be the national of the country.'° So, if a compa
ny has a
 PCT APPLICATIONS 261

business in India or is incorporated under the Indian Companies Act, it

can file a PCT application.
A PCT application may be filed by the applicant directly or through a
patent agent. Any patent agent, who is eligible to file patent applications
before the patent office of the country in which the applicant resides
or is a national, may be appointed as a patent agent for filing a PCT
application.'* Such a patent agent may act on behalf of the applicant
before the International Bureau, search authority, and/or examination
authority.'? Therefore, any person registered as a patent agent in India
can represent a PCT applicant, and can act on behalf of the applicant
before the PCT authorities.
Office of Filing: A PCT application may be filed at any office which is
a Receiving Office that is eligible to receive applications under the
Treaty. The Receiving Office may be the patent office of the member
country of PCT in which the applicant is a resident, or is a national,
or the International Bureau.'* As India is a PCT member, the Indian
Patent Office can be a Receiving Office for a PCT application. A PCT
application, having two or more applicants, may be filed at the patent
office of a country which is a member of PCT, and of which at least one
of the applicants is a national or is a resident.’ Such an application may
also be directly filed at the International Bureau.” For example, if X is a
citizen of India and is residing in USA, the PCT application may be filed
at the Indian Patent office, or US Patent Office, or at the International
Bureau. If X is a national of India and Y’ is a national of Taiwan, which
is not a PCT member country, the PCT application may be filed at the
Indian Patent Office or International Bureau as India is a member of
PCT, and one of the applicants, X, is an Indian national.
An applicant, who is a national or resident of a country, which is a
y
member of PCT and also the African Regional Intellectual Propert
tion,
Organisation (ARIPO) Harare Protocol, the Eurasian Patent Conven
African Intellec tual
the European Patent Convention, or the OAPI (The
at any of the
Property Organisation) Agreement, may file the application
In such a
patent offices established under the said regional agreements.
application.
case, the said offices will act as Receiving Offices of the PCT
member of EPC, he
For example, if X is a national of Germany, which is a
Office as the Receiving
can file a PCT application at the European Patent
Office.
ication must be accompa-
Form of the Application: An international appl
nied by the following documents:
 262 INDIAN PATENT LAW AND PRACTICE

. Request;
. Description;
. Claims;
. Drawings (where required); and
a . An abstract.”!
RN

Request: A request must accompany a PCT application. The Request

must be filed in form PCT/RO/101, which may be acquired from any of
the Receiving Offices or International Bureau.” The form is also available
online on the PCT website” and may also be generated from the PCT-
SAFE software.”
The Request must contain the following information:
1. A petition for processing the PCT application;
2. The title of the invention;
3. Information of the applicant and the agent, if an agent is involved;
and,
4. Inventor details, if at least one country requires such information
during national patent filing.”®
In addition, the Request must also have the following information,
whenever applicable:
1. Priority claim;
2. Information relating to an earlier search performed by an
international search authority or national patent office;
3. Reference to a parent application or parent patent; and,
4. Information relating to the applicant's choice of competent
International Searching Authority.”®
The Request will also have declarations and other entries that
may be
filled by the applicant. Filing of a request will automatically designate
all
member countries of the PCT for acquiring national patent
protection.””
Such designation also includes the regional agreements
for acquiring
patent protection. The offices that are designated in
a PCT application
are called Designated Offices.
Description: The PCT application must be filed with
a written description
of the invention. The Description of the invention
must enable a person
skilled in the art to carry out the invention on his
own.”* It has to start
with the title of the invention and must specify
the field to which the
invention belongs.” The Description should state
the background of the
invention and cite the prior art relevant to the invention.” The techn
ical
problem solve; d by the invention and advantages of the inven
tion must
also be provided in the description.”
 PCT APPLICATIONS 263

Furthermore, the Description must contain a brief explanation

of drawings and best mode of carrying out the invention.?? The best
mode of the invention need not be provided if the country in which the
applicant seeks to file the application does not require the explanation
of best mode.” The industrial applicability of the invention must also
be explained in the Description.“ If an application relates to gene
sequences, the requirements relating to description of such listings must
be followed.*°

Claims: A PCT application must have claims relating to the invention.

The Claims must define the invention that forms the subject matter of
the application.** Each claim must be clear and concise.” Everything
specified in a claim must be supported in the Description.** The Claims
in an application must relate to a single invention or inventive concept.”

Drawings: The Drawings will be required to be included in an application

when such drawings are required to understand the invention.” Flow
sheets and diagrams are considered to be drawings.*! When an invention
may be explained by description alone, the applicant may provide
drawings for illustrating the invention.” The Drawings may be requested
by a Designated Office while filing the patent application in that country
after the international phase.”

Abstract: An abstract must be filed along with a PCT application. The

Abstract is a brief description of the invention, which is provided for
only technical purposes.” It must provide the technical field to which the
invention pertains and has to be drafted in a way which allows the clear
understanding of the technical problem solved by the invention, the gist
of the solution of that problem through the invention, and the principal
use or uses of the invention.* The most important chemical formula or
drawing of the invention may also be provided in the Abstract.”

Language: A PCT application may be filed in any language permitted by

the Receiving Office.” The Indian Patent Office, as a Receiving Office,
accepts applications in English and Hindi.” If an application is filed in
any language accepted by the Receiving Office, which is not a publication
language, language accepted by the international search authority or a
language accepted by the international preliminary examination autho-
rity, a translation of the application in the accepted language must be
provided by the applicant for processing the application.” So, if an
264 INDIAN PATENT LAW AND PRACTICE

application is filed in Hindi with the Indian Patent Office as the Receiving
Office, the application must be translated into an acceptable language.
The Request, abstract, and text of drawings in a PCT application must
always be filed in one of the publication languages.” The publication
languages of PCT include Arabic, Chinese, English, French, German,
Japanese, Russian or Spanish.”!

Fee: Three types of Fees must be paid by an applicant while filing a PCT
application. They are:
1. Transmittal Fee, which is fixed by and paid to the Receiving
Office;
2. Search Fee, which is fixed by and paid to the international search
authority selected by the applicant;*’ and
3. International Filing Fee, which is fixed in the Schedule of Fees
appended to the PCT Regulations and is paid to the International
Bureau.”
The fee must be paid by the applicant at the time of filing or within one
month from the date of filing of the PCT application.** The fee payable
to the Indian Patent Office as the Receiving Office is provided in the
First Schedule of the Patents Act.*° Certain fee reductions are available
for applicants who are natural persons and nationals, or residents of
developing or least developed countries. Natural persons applying
from India will be eligible for such fee reduction. Fee reduction is also
applicable if the application is filed using the PCT-SAFE software.

Priority Date: A PCT application is considered equivalent to a national

application under the provisions of the Paris Convention and priority
can be claimed from such application.’ The date of filing of a patent
application in a country from a PCT application will be the date of
filing of the PCT application. A PCT application designating India will
be considered to be a national application filed in India, and the date of
filing of such application, when it is filed at the Indian Patent Office, will
be the date of filing of the PCT application. For example, if X files a
PCT application on 1 January 2009 and then files a national application
in India on 29 June 2011, the priority date of the application will be 1
January 2009.
If a PCT application claims priority of an application filed in India, the
priority of such application when it is filed in India after the PCT process
will be the date of filing of the first application in India. For example, if
X files a provisional application in India on 1 January 2007 and then files
 PCT APPLICATIONS 265

a PCT application on 22 October 2009, claiming the priority of the Indian

provisional, the priority date of the national phase application filed by the
applicant in India on | April 2009 will be 1 January 2007, which is the
filing date of the provisional application in India.
A PCT application can also claim priority of a national application
filed in a country, which is a member of the Paris Convention.” The
priority can be claimed even if the country in which the PCT application
is filed is not a member of PCT. For example, if X files a patent application
in Guyana on 1 January 2009 and files a PCT application over the same
invention on 1 March 2009, the priority date of the application will be
1 January 2009, because priority of the application in Guyana, which is
a member of Paris Convention can be claimed even if Guyana is not a
member of PCT.

11.2.1.2 International Search

An international search will be performed on every PCT application.”
The search will be performed by the International Searching Authority,
which is the national or regional patent office, or an inter-governmental
organization, that is recognized by the Receiving Office as the competent
office to perform an international search. After a PCT application is
filed, the Receiving Office will transmit a copy of the application to
the International Searching Authority chosen by the applicant in the
application for the search.
On receiving the application, the International Searching Authority
will perform an international search to identify the prior art relevant to the
invention that is the subject of the PCT application and will prepare the
international search report.” This will be prepared within three months
from the date of receipt of the copy of application or within nine months
from the priority date, whichever is later.°’ Along with the report, the
International Searching Authority will also prepare a written opinion on
industrial applicability, novelty, and inventive step, of the invention that
forms the subject matter of the application.” The international search
report and the written opinion will be transmitted by the International
Bureau.”
Searching Authority to the applicant and the International
by submitti ng
The applicant may respond to the report and opinion
comments.
claims, with
The international search will be performed based on the
The [International
due regard to the description in the application.”
if the subject matter of
Searching Authority will not perform a search
tion such as scientific
the invention relates to a non-patentable inven
266 INDIAN PATENT LAW AND PRACTICE

principle, mathematical algorithm, animal, or plant variety, presentation

of information, and so on.” The Authority may also refuse to perform
a search if the application does not satisfy the requirements relating
to description, drawings, or claims, under the Treaty and as a result a
meaningful search cannot be performed. Furthermore, the search may
also not be performed if the subject matter of the application claims more
than one invention or inventive concept.
Under certain circumstances, the International Searching Authority
may perform a search relating to only some of the claims in the application
that satisfy the PCT requirements.” In case of multiple inventions in a
single application, the International Searching Authority may require
payment of additional fee to search for all the inventions mentioned in
the application.”

Search Authorities Recognized by the Indian Patent Office

As a Receiving Office, the Indian Patent Office recognizes the following
patent offices as the International Searching Authorities:
e Austrian Patent Office; |
¢ Australian Patent Office;
¢ European Patent Office;
¢ China Intellectual Property Office;
¢ United States Patent & Trademark Office; and
¢ Swedish Patent Office.” wv"
A person filing a PCT application from India can choose any of the
aforementioned offices as the International Searching Authority.

11.2.1.3 Publication of Application

The PCT application will be published by the International Bureau after
the expiry of eighteen months from the priority date of the application.”
The application may be published earlier than eighteen months on a
request made by the applicant.” The International Search Report will
also be published along with the application.” It will not be published
if the International Searching Authority is unable to perform the search
due to valid reasons under the Treaty. In such a case, the fact that the
search was not performed will be specified in the publication.
Any statement filed with the amendments will be published along
with the application.”” The application will not be published if it is
withdrawn before the International Bureau completes the technical
preparations for publication, which is generally done before fifteen days
 PCT APPLICATIONS 267

of expiry of eighteen months from the priority date.” Certain statements,

drawings, or portions of the application, may be omitted from publication
if they are against morality, or public order, or are disparaging.”* The
publication of the PCT application will have the same effect as the
publication of the national application in the Designated Countries.”
However, certain countries may have translation requirements in order
to give effect to the publication.

11.2.1.4 International Preliminary Examination

Chapter II of the PCT provides for International Preliminary Examina-
tion of the application.® An applicant of an application, who is a resident
or national of a country, which has membership to Chapter II of the PCT
or is permitted by the assembly, may file a demand for International
Preliminary Examination.*' Such a demand must be filed within three
months from the date of transmittal of the International Search Report
and the written opinion, or within 22 months from the priority date of the
application, whichever is later.*” The applicant must pay the examination
and handling fee at the time of filing the demand, or within one month,
or before the expiry of 22 months from the priority date, whichever
is later.*
The demand must indicate the member countries of PCT (Elected
States) in which the applicant wishes to use the results of the International
Preliminary Examination.” The filing of a demand by the applicant will
automatically constitute the election of all the countries that are members
of Chapter II of the PCT.*
The demand for International Preliminary Examination must be
submitted to the competent International Preliminary Examining
Authority, which is the patent office recognized by the Receiving Office
or the assembly, as the office competent to carry out International
Preliminary Examination of the application. The International Search
Report along with the written opinion, provided by the International
Searching Authority and statement regarding any amendments made
to the application will be provided by the International Bureau to the
International Preliminary Examining Authority.”
The International Preliminary Examining Authority will carry out the
examination in accordance with the Treaty, Regulations, and any relevant
agreements. The International Preliminary Examination will include
formulation of preliminary and non-binding opinion on novelty, inven-
tive step, and industrial applicability of the invention that is the subject of
268 INDIAN PATENT LAW AND PRACTICE

ning Author-
the PCT application.” The International Preliminary Exami
on and
ity will consider the International Search Report, written opini
before
amendments, if any, while arriving at its opinion.” The prior art
be consi dered by the In-
the application date or the priority date, will
on on
ternational Preliminary Examining Authority for framing its opini
novelty and inventive step.”
On examining the application, the International Preliminary
Examining Authority will send a written opinion to the applicant.** Such
opinion will not be sent if the application meets all the requirements
under the Treaty.”? The applicant can respond to the written opinion by
amending the application in response to the written opinion or by arguing
against the written opinion.” On receiving the applicant's response to its
written opinion, the International Preliminary Examining Authority may
issue additional opinions and allow the applicant to make amendments
to the application, and/or respond to such opinions.” During the process
of examination, the applicant may communicate orally or in writing with
the International Preliminary Examining Authority.** The Authority may
communicate informally with the applicant orally, or in writing, or may
give personal hearings as and when required.”
The International Preliminary Examination Report will be established
by the International Preliminary Examining Authority within six months
from the start date of the examination or within 28 months from the
priority date, whichever is later.°* The Report will contain statements
and conclusion on novelty, inventive step, and industrial applicability of
the invention in the application.” The documents and other materials
that form the basis of the conclusion will be cited.'® It will not have any
statements regarding patentability of the invention in the light of any
national law.'®' The report is called as the International Preliminary
Report on Patentability.'°
The International Preliminary Examining Authority will not examine
the application if the invention relates to scientific principle, mathemati-
cal algorithm, plants, animals, and so on.'*’ The examination will also
not be conducted if the description, drawings, and claims are not clear
so that a meaningful examination is not possible.' In such a case, the
International Preliminary Examining Authority will issue a statement re-
garding the same.'® If the PCT application has more than one invention
or inventive concept, the International Preliminary Examining Authority
may require the applicant to restrict the application to one invention or to
pay additional fee." On non-compliance by the applicant, the Authority
may examine only the main invention in the application.”
 PCT APPLICATIONS 269

Confidentiality ofInternational Examination

The information relating to international examination will be maintained
confidential by the International Bureau and the International
Preliminary Examining Authority." The International Examination
Report will be provided only to the patent offices of the Elected States.'”
The International Preliminary Examination Report will be transmitted
by the International Preliminary Examining Authority to the applicant
and the International Bureau.'' The International Bureau will in turn
communicate the report to the patent offices of the Elected States."

Withdrawal
The applicant may withdraw the election of any or all of the countries
in the demand for international examination during the process of
examination.'!? Such a withdrawal of all Elected States will be considered
as withdrawal of the demand.'" Withdrawal of a country from the Elected
States will result in withdrawal of the international application for that
country, unless its national law provides otherwise.'"*

International Examination Authorities Recognized by the Indian Patent

Office: The Indian Patent Office as the Receiving Office recognizes
the following patent offices as International Preliminary Examining
Authorities:
- Austrian Patent Office;
« Australian Patent Office;
+ European Patent Office (only if International Searching Authority
was Austrian, European, or Swedish patent office);
¢ China Intellectual Property Office;
« United States Patent & Trademark Office; and,
« Swedish Patent Office (SE).'"
An applicant filing a PCT application from Indian patent office may
choose any of the aforementioned offices as the International Preliminary
Examining Authority.

Amendments to the Application

ation after
The applicant may amend the claims in the PCT applic
authority.''®
receiving the international search report from the search
u within two
Such amendments must be filed at the International Burea
Search Report or
months from the date of transmittal of the International
ever is later.''’ Along
within sixteen months from the priority date, which
t a statement explaining
with the amendments, the applicant may submi
270 INDIAN PATENT LAW AND PRACTICE

the amendments and impact of the amendments on the description or

drawings.''* The amendments to the claims must be within the scope of
the disclosure in the PCT application."’”
The applicant can also amend the description, drawing, and claims
during the examination process.’ Such amendment must be within the
scope of the disclosure of the PCT application at the time of filing.'** The
application may also be amended before it enters the National Phase.

11.2.2 National Phase

National phase is the phase before the national or regional patent offices
where a patent is granted to the applicant. In order to acquire a patent
over the invention that is subject of the PCT application, an applicant
must enter the national phase in all the countries he desires to acquire
the patent. While entry into certain countries can be done by filing the
application at the patent offices of the countries, entry into other countries
can be done only through the regional patent route. For example, an
applicant can enter the Indian national phase by filing an application
directly in India. However, he can enter into Cameroon only by filing an
application at the OAPI office.
An applicant can file an application only at the Designated Offices,
which are patent offices of the countries or regions designated while
filing a request, or Elected Offices, which are patent offices of countries or
regions elected in the demand for International Preliminary Examination
or later.
To enter the national phase in a country, the applicant must file the
PCT application at the national patent office and pay the requisite filing
fee.'” A copy of the application and/or translation of the application must
be provided if it is required by the national office.'” The applicant must
file the application at the national patent office before the expiry of 30
months from the priority date.'** Some countries such as India allow
extra time for filing the national application.’ In certain countries, the
national application must be filed before the expiry of twenty months
from the priority date.'?* The applicable time limits for each country are
provided on the website of WIPO.'”” The application will be considered
to be withdrawn if it is not filed at the said office before the specified
period.'* Generally, the national patent office will process the application
only after the expiry of the aforesaid period.'” The national patent office
may process the application earlier on special request by the applicant.'*
°
The fee to be paid to a country’s patent office while enter
ing the
national phase will be specified by such a patent office. Certain
patent
 PCT APPLICATIONS 271

offices provide reduction or refund of national fee under certain

circumstances. In addition to filing fee and translation, national patent
offices may have additional requirements for entering the national
phase such as inventor details, representation, priority documents, and
so on.'*' Such requirements must be complied with by the applicant on
invitation by the patent office. The applicant may amend the application
before entering the national phase and file the amended application.'”
On entering the national phase, the national patent office will treat the
application like any other patent application directly filed at the office,
and will grant a patent if the application satisfies all requirements under
the national patent law.

11.2.2.1 Indian National Phase

An applicant can enter the National Phase in India by filing the application
at the Indian Patent Office after the International Phase. The applicant
must file the application in the requisite form by paying the requisite
fee before the expiry of 31 months from the priority date.'*> When an
application is filed before the Indian Patent Office, the specification
filed with the PCT application by the applicant will be processed by the
patent office.'** If the application is not in English, a translation of the
application must be filed.'® The filing date for such application will be
the international filing date under the PCT.'**°
Any amendment to the application, made by the applicant during the
International Phase, will be considered by the Indian Patent Office as
an amendment made before the office.'*” On receiving the application,
the Indian Patent Office will process the application just like any other
national application and will grant the patent if all requirements under
the Patents Act are satisfied.

11.3 PCT STATISTICS

The current trends of patent filing through the PCT route show a steady
increase. Applicants filing for a patent in multiple countries prefer the
PCT route for its convenient and economic procedure.
Table 11.1 shows the number of patent applications filed every quarter
at the International Bureau from the year 2005 to 2008. The increasing
preference of the applicants to choose the PCT route for their inter-
national filings is evident from the increasing number of filings from the
year 2005 to 2008.
272 INDIAN PATENT LAW AND PRACTICE

Table 11.1 PCT Applications Published by the International Bureau

2005 2006 2007 2008

29,937 34,508 35,968 36,975

I quarter
II quarter 30,388 34,894 37,602 40,168

III quarter 31,365 33,278 36,239 39,070

IV quarter 33,601 36,060 40,266 44,815

Total 125,294 1,38,740 1,50,075 1,61,028

Source: http://www.wipo.int/ipstats/en/statistics/pct/ (last accessed on 26 May 2009).

The PCT route has gained popularity among the Indian applicants
also. Table 11.2 shows the increasing trends of PCT applications that
have opted for the Indian Patent Office as the receiving office and that
the filings have progressively increased from 461 applications in the year
2005 to 766 applications
Table 11.2 PCT Filings: Indian Patent Office as Receiving Office
2005 2006 2007 2008

461 505 621 766

Source: WIPO statistics database, April 2009, cited from http://www.wipo.int/export/sites/

www/ipstats/en/statistics/pct/xls/m_filing_ro.xls (last accessed on 26 May 2009).

Table 11.3 below provides the timeline for taking necessary actions for
the PCT Applications.

Table 11.3 Time Lines for PCT Process

Particulars Timeline

PCT Application Filing Within 12 months of first filing or priority in any

country
International Search Report Within 16 months of first filing or priority
International Publication Within 18 months of first filing or priority
Demand for International Within 22 months of first filing or priority
Preliminary Examination
Withdrawal Before the preparation for publication
(Preparation for publication is generally made in
the 15th month)
National Phase Entry into India Within 31 months of first filing or priority
Amendment before International Within 2 months from the date of transmittal
Examination of International Search Report from priority,
whichever time limit expires later.
 PCT APPLICATIONS 273

NOTES
1. Article 1(2), Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979, modified on 3 February 1984 and on
3 October 2001.
2. Preamble, Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979 modified on 3 February 1984, and
on 3 October 2001.
3. Article 1(1), Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979 modified on 3 February 1984 and on
3 October 2001.
4. Patent Cooperation Treaty (PCT) done at Washington on 19 June 1970,
amended on 28 September 1979, modified on 3 February 1984 and on 3 October
2001.
5. Available at http://www.wipo.int/pct/guide/en/gdvol1/annexes/annexa/
ax_a.pdf (last accessed on 9 April 2010).
6. Available at http://www.wipo.int/pct/guide/en/gdvol1/annexes/ annexa/
ax_a.pdf (last accessed on 9 April 2010).
7. Article 58, Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
8. Ibid.
9. www.wipo.int/pct/guide/en/ (last accessed on 27 March 2010).
Washington on
10. Article 2(vii), Patent Cooperation Treaty (PCT) done at
y 1984 and
19 June 1970, amended on 28 September 1979, modified on 3 Februar
on 3 October 2001.
on 19
11. Article 2(i), Patent Cooperation Treaty (PCT) done at Washington
1984 and on
June 1970, amended on 28 September 1979, modified on 3 February
3 October 2001.
at Washington on 19
12. Article 9, Patent Cooperation Treaty (PCT) done
3 February 1984 and
June 1970, amended on 28 September 1979, modified on
on 3 October 2001.
n Treaty (as in force
13. Rule 18.3, Regulations under the Patent Cooperatio
from 1 January 2009).
ion Treaty.
14. Rule 18.1, Regulations under the Patent Cooperat
15. Ibid.
done at Washington on 19
16. Article 49, Patent Cooperation Treaty (PCT)
ied on 3 February 1984 and on
June 1970, amended on 28 September 1979, modif
3 October 2001.
eration Treaty.
17. Rule 90.1, Regulations under the Patent Coop
(PCT) done at Washington 0 n 19
18. Article 10, Patent Cooperation Treaty
1979, modified on 3 February 1984 and
June 1970, amended on 28 September t Cooperation
lations under the Paten
on 3 October 2001, and Rule 19.1(a), Regu
Treaty.
 274 INDIAN PATENT LAW AND PRACTICE

19. Rule 19.2., Regulations under the Patent Cooperation Treaty.

20. Ibid.
21. Article 3(2), Patent Cooperation Treaty (PCT) done at Washington on 9
June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001, and Rule 12.1(a), Regulations under the Patent Cooperation
Treaty.
22. Rule 3.1 and 3.2, Regulations under the Patent Cooperation Treaty.
23. www.wipo.int/pct/en/forms/ (last accessed on 27 March 2010).
24. www.wipo.int/pct-safe/en/ (last accessed on 27 March 2010).
25. Article 4(1), Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001, and Rule 4.1(a), Regulations under the Patent Cooperation
Treaty.
26. Article 4(1), Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001, and Rule 4.1(b), Regulations under the Patent Cooperation
Treaty.
27. Rule 4.9(a), Regulations under the Patent Cooperation Treaty.
28. Article 5, Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
29. Rule 15(a), Regulations under the Patent Cooperation Treaty.
30. Ibid.
31. Ibid.
32. Ibid.
33. Ibid.
34. Ibid.
35. Rule 5.2, Regulations under the Patent Cooperation Treaty.
36. Article 6, Patent Cooperation Treaty (PCT) done at Washington on
19
June 1970, amended on 28 September 1979, modified on 3 February
1984 and
on 3 October 2001.
37. Ibid.
38. Ibid.
39. Article 3(4)(iii), Patent Cooperation Treaty (PCT) done
at Washington
on 19 June 1970, amended on 28 September 1979,
modified on 3 February 1984
and on 3 October 2001, and Rule 13, Regulations under the
Patent Cooperation
Treaty.
40. Article 7(1), Patent Cooperation Treaty (PCT) done
at Washington on 19
June 1970, amended on 28 September 1979, modified
on 3 February 1984 and on
3 October 2001.
41. Rule 7.1, Regulations under the Patent Cooperatio
n Treaty.
42. Article 7(2), Patent Cooperation Treaty (PCT)
done at Washington on 19
June 1970, amended on 28 September 1979, modif
ied on 3 February 1984 and on
3 Octob 2001.
er
 PCT APPLICATIONS 275

43. Ibid.
44. Article 3(3), Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979, modified on 3 February 1984 and on
3 October 2001.
45. Rule 8 and 8.21, Regulations under the Patent Cooperation Treaty.
46. Ibid.
47. Article 3(4)(i), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
48. Rule 19(1), The Patent Rules, 2003.
49. Rules 12 and 62, Regulations under the Patent Cooperation Treaty.
50. Rule 12.1(c), Regulations under the Patent Cooperation Treaty.
51. Annex C, PCT Applicant's Guide—International Phase Page 11 (17 July
2008).
52. Rule 14.1, Regulations under the Patent Cooperation Treaty.
53. Rule 16, Regulations under the Patent Cooperation Treaty.
54. Rule 15.1, Regulations under the Patent Cooperation Treaty.
55. Rules 14, 15, and 16, Regulations under the Patent Cooperation Treaty.
56. Rule 19(2), The Patent Rules, 2003 as last amended in 2006.
57. Article 11(4), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
58. Section 7(1A) and (1B), The Patents Act, 1970.
59. Section 135(3), The Patents Act, 1970.
60. Article 8(1), Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979, modified on 3 February 1984 and on
3 October 2001.
61. Article 15(1), Patent Cooperation Treaty (PCT) done at Washington on
June 19, 1970, amended on September 28, 1979, modified on 3 February 1984
and on October 3, 2001.
62. Article 15(2) and 18(1), Patent Cooperation Treaty (PCT) done at
Washington on 19 June 1970, amended on 28 September 1979, modified on 3
February 1984 and on 3 October 2001.
63. Rule 43.1, Regulations under the Patent Cooperation Treaty.
64. Rule 43bis.1, Regulations under the Patent Cooperation Treaty.
on
65. Article 18(2), Patent Cooperation Treaty (PCT) done at Washington
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
Washington on
66. Article 15(3), Patent Cooperation Treaty (PCT) done at
3 February 1984
June 19, 1970, amended on 28 September 1979, modified on
the Patent Cooperation
and on 3 October 2001, and Rule 39.1, Regulations under
|
Treaty.
done at Washington
67. Article 17(2)(a), Patent Cooperation Treaty (PCT)
276 INDIAN PATENT LAW AND PRACTICE

on 19 June 1970, amended on 28 September 1979, modified on 3 February 1984

and on 3 October 2001.
68. Article 17(2)(a), Patent Cooperation Treaty (PCT) done at Washington
on 19 June 1970, amended on 28 September 1979, modified on 3 February 1984
and on 3 October 2001.
69. Ibid.
70. Article 17(2), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
71. Article 17(3), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
72. http://ipindia.nic.in/ipr/patent/PCTApplication_April2009.pdf (last
accessed on 9 April 2010).
73. Article 21(1) and (2), Patent Cooperation Treaty (PCT) done at
Washington on 19 June 1970, amended on 28 September 1979, modified on 3
February 1984 and on 3 October 2001.
74. Article 21(3), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
75. Article 21(4), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
76. Rule 48.1, Regulations under the Patent Cooperation Treaty.
77. Article 21(5), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
78. Article 21(6), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
79. Article 29, Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979, modified on 3 February 1984 and on
3 October 2001.
80. Chapter II, Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979, modified on 3 February 1984 and on
3 October 2001.
81. Article 31(1), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
82. Rule 54bis.1, Regulations under the Patent Cooperation Treaty.
83. Rules 57 and 58, Regulations under the Patent Cooperation Treaty.
84. Article 31(4), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001. .
 PCT APPLICATIONS 277

85. Rule 53.7, Regulations under the Patent Cooperation Treaty.

86. Articles 31(6) and 32(1 and 2), Patent Cooperation Treaty (PCT) done
at Washington on 19 June 1970, amended on 28 September 1979, modified on 3
February 1984 and on 3 October 2001 and Rules 59.1 and 59.2, Regulations under
the Patent Cooperation Treaty.
87. Rule 62, Regulations under the Patent Cooperation Treaty.
88. Article 34(1), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
89. Article 33(1), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
90. Article 33(6), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
91. Rules 64 and 65, Regulations under the Patent Cooperation Treaty.
92. Article 34(2)(c), Patent Cooperation Treaty (PCT) done at Washington
on 19 June 1970, amended on 28 September 1979, modified on 3 February 1984
and on 3 October 2001.
93. Ibid.
ton
94. Article 34(2)(d), Patent Cooperation Treaty (PCT) done at Washing
1984
on 19 June 1970, amended on 28 September 1979, modified on 3 February
tion
and on 3 October 2001, and Rule 66.3, Regulations under the Patent Coopera
Treaty.
95. Rule 66.4, Regulations under the Patent Cooperation Treaty.
at Washington on
96. Article 34(2), Patent Cooperation Treaty (PCT) done
ry 1984 and
19 June 1970, amended on 28 September 1979, modified on 3 Februa
on 3 October 2001.
97. Rule 66.6, Regulations under the Patent Cooperation Treaty.
at Washington on
98 Article 35(1), Patent Cooperation Treaty (PCT) done
3 February 1984 and
19 June 1970, amended on 28 September 1979, modified on
Patent Cooperation
on 3 October 2001, and Rule 69.2, Regulations under the
Treaty.
(PCT) done at Washington on
99. Article 35(2), Patent Cooperation Treaty
ied on 3 February 1984 and
19 June 1970, amended on 28 September 1979, modif
on 3 October 2001.
100. Ibid.
101. Ibid.
Treaty.
102. Rule 70, Regulations under the Patent Cooperation
ty (PCT) done at Washington on
103. Article 34(4), Patent Cooperation Trea
1979, modified on 3 February 1984 and
19 June 1970, amended on 28 September
lations under the Patent Cooperation
on 3 October 2001, and Rule 67.1, Regu
Treaty.
278 INDIAN PATENT LAW AND PRACTICE

104. Article 34(4), Patent Cooperation Treaty (PCT) done at Washington on

19 June 1970, amended on 28 September 1979, modified on 3 February 1984, and
on 3 October 2001.
105. Article 35(3), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
106. Article 34(3), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
107. Ibid.
108. Article 38(1), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
109. Ibid.
110. Article 36(1), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
111. Article 36(3), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
112. Article 37(1), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
113. Article 37(2), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
114. Article 37(4), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February
1984 and
on 3 October 2001.
115. http://ipindia.nic.in/ipr/patent/PCTApplication_April2009.pdf (last ac-
cessed on 9 April 2010).
116. Article 19(1), Patent Cooperation Treaty (PCT) done
at Washington on
19 June 1970, amended on 28 September 1979, modifi
ed on 3 February 1984 and
on 3 October 2001.
117. Ibid.
118. Ibid.
119. Article 19(2), Patent Cooperation Treaty (PCT) done
at Washington on
19 June 1970, amended on 28 September 1979, modified
on 3 February 1984 and
on 3 October 2001.
120. Article 34(2)(b), Patent Coo peration Treaty
(PCT) done at Washington
on 19 June 1970, amended on 28 Se ptember
1979, modified on 3 February 1984
and on 3 October 2001.
121. Ibid.
 PCT APPLICATIONS 279

122. Article 22(1), Patent Cooperation Treaty (PCT) done at Washington on

19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001, and Article 39(1), Patent Cooperation Treaty (PCT) done at
Washington on 19 June 1970, amended on 28 September 1979, modified on 3
February 1984 and on 3 October 2001.
123. Ibid.
124. Ibid.
125. Article 22(3), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
126. Article 24(1), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001.
127. www.wipo.int/pct/en/texts/pdf/time_limits.pdf (last accessed on 27
March 2010).
128. Articles 24(1)(iii) and 39(2), Patent Cooperation Treaty (PCT) done at
Washington on 19 June 1970, amended on 28 September 1979, modified on 3
February 1984 and on 3 October 2001.
129. Article 23(1), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001 and Article 40(1), Patent Cooperation Treaty (PCT) done at
Washington on 19 June 1970, amended on 28 September 1979, modified on 3
February 1984 and on 3 October 2001.
130. Article 23(2), Patent Cooperation Treaty (PCT) done at Washington on
19 June 1970, amended on 28 September 1979, modified on 3 February 1984 and
on 3 October 2001 and Article 40(3), Patent Cooperation Treaty (PCT) done at
Washington on 19 June 1970, amended on 28 September 1979, modified on 3
February 1984 and on 3 October 2001.
131. Rule 51bis, Regulations under the Patent Cooperation Treaty.
132. Article 28, Patent Cooperation Treaty (PCT) done at Washington on 19
June 1970, amended on 28 September 1979, modified on 3 February 1984 and on
3 October 2001.
133. Rule 20(1), (3), and (4), The Patent Rules, 2003 as last amended in
2006.
134. Section 138(4), The Patents Act, 1970.
135. Rule 20(3), The Patent Rules, 2003 as last amended in 2006.
136. Section 138(5), The Patents Act, 1970.
137. Section 138(6), The Patents Act, 1970. Section 138(6) reads as follows:
Amendment, if any, proposed by the applicant for an international application
designating India or designating and electing India before international searching
desires,
authority or preliminary examination authority shall, if the applicant so
be taken as an amendment made before the patent office.
 12
Mining Patent Information

—,. and Inventive Step or non-obviousness, as it is referred to

in some jurisdictions, are two of the most important patentability
requirements. An invention will be eligible for a patent grant only if it is
novel and not obvious in the light of prior art. Prior art, also known as state
of the art, is the knowledge and information that is available to the public
on the filing or priority date of a patent application. Any information that
has been published, used, sold, documented, advertised, disclosed in the
absence of a secrecy contract, can be considered to be prior art. An article
in a world renowned scientific journal such as Nature, a process used by
a small scale industry in Tunisia, a master’s thesis report sitting in the
library shelf of a university in Cameron, or a patent application that was
published in the Portuguese language at the Portugal Patent Office, can
be prior art.
In order to ascertain novelty and inventive step of an invention,
all prior art relevant to the invention must, ideally, be identified. As
access to prior art is limited due to various barriers such as language,
documentation, and so on, and it is impossible to excavate all prior art
relevant to the invention, However, a considerable extent of the prior art
can be retrieved from the patent and literature databases by performing
a search. This chapter will give a primer on patent searching and various
search options. In addition to information with regard to performing a
patent search in India, the chapter will also give an overview of search
 MINING PATENT INFORMATION 281

options at US Patent and Trademark Office (USPTO), European Patent

Office (EPO), and WIPO-PCT database.

12.1 PATENT SEARCHING IN INDIA

Searching for patents in India is a challenging task due to lack of online
databases that provide complete patent documents and effective search
facilities. As a comprehensive official database is not yet provided by the
Indian patent office, multiple sources must be visited in order to perform
a search. Some of the important sources from which one can mine patent
data in India are the official gazettes, online sources, and patent registry.

12.1.1 Official Gazette

Patent filing information and accepted patent application details were
published in the Official Gazette of the Indian Patent Office. The Gazette
provides very limited information relating to filed applications. Details
such as application number, title, abstract, filing date, assignee details,
inventor details, priority information, claims, and so on, of accepted
applications are available in the Gazette. The official Gazette can be
manually reviewed at the library of the Patent Office.
Additionally, starting from 21 January 2005, the patent office has
started publishing official journals, which are available online on the
Patent Office website in pdf format.' Such journals are published every
Friday and hard copies may also be accessed at the Patent Office. The
journals provide bibliographic data relating to published applications
and granted patents.

12.1.2 Online Databases

As of today, no single online source can enable one to conduct a
comprehensive patent search for the applications filed and patents granted
at the Indian Patent Office. However, several private and public databases
are available which enable one to acquire Indian patent information.

12.1.2.1 Official Indian Patent Database

Indian patent office is in the process of making full text of Patent
applications available online through its official website.? The database
is referred to as iPairs and the system as a whole is referred to as IPIRS,
which stands for Indian Patent Information Retrieval System.
into
The patent data has been categorized based on their grant status
d patents’
two main categories. The first category comprises of grante
applications."
and the second category comprises of published patent
282 INDIAN PATENT LAW AND PRACTICE

The system also has provision to access Controller's decisions/orders and

track application status. °
The website provides for both quick search and advance search in the
database.° The quick search enables one to search by restriction fields and
has a single search box. On the other hand the Advanced Search enables
one to conduct a Boolean search and has two search boxes. The field
restrictions provided by the database includes Title, Abstract, Application
number, Applicant Name, Patent Number, Inventor Name, and IPC Class.’
Furthermore, patents can also be searched by date of priority, priority
country, date of filing, or date of grant. The database provides the full text
of the patent document along with documents generated during office
actions, if any.’ The system additionally provides guidelines for searching
which is aimed at enabling easy navigation through the system.* Readers
must be aware that this database is in its inchoate form and may not be
completely updated as it stands today.

12.1.2.2 Ekaswa
Ekaswa"’ is an initiative of the Technology Information, Forecasting and
Assessment Council (TIFAC), which is an autonomous organization
under the Department of Science and Technology. Ekaswa provides
patent information in the form of three databases, namely Ekaswa A,
Ekaswa B, and Ekaswa C."!
« Ekaswa A” provides bibliographic information pertaining to patent
applications filed and published from January 1995 to December
2004;
+ Ekaswa B" provides bibliographic information pertaining to
granted patents from January 1995 to December 2004; and
+ Ekaswa C" provides bibliographic information of patent applica-
tions filed and published from January 2005 onwards.

12.1.2.3 India Big Patents

The India Big Patents is a website that was launched with the objective
of making post-TRIPS Indian Patent applications and issued patents
available online.'® This database allows patent searching, using key
words from the title and the abstract, by applicant's name, patent
number, application number, and journal date. The database provid
es
details such as application number, title, abstract, filing date, assigne
e
details, inventor details, and priority information of the patents or
patent
applications.
 MINING PATENT INFORMATION 283

12.1.3 Patent Document Acquisition

The patent documents identified during the search on any of the databases
may be obtained by filing an application at the patent office. The process
for obtaining such documents has been provided in Chapter IV under
the title Patent Register.

12.2 PATENT SEARCHING IN USA

The patent search facility provided by the USPTO on its website is very
well structured and extremely user friendly.'° The search database has
been broadly classified into Issued Patents and Patent Applications.'”
The Issued patents database provides granted patent applications since
1790. However, patents granted before 1976 are available in the full page
image format. Full text of patents is available on this database since the
year 1976.
The patent applications database provides applications which have
been filed but have not been granted. These applications are available
since March 2001. It must be noted that this database may not provide
all patent applications that are filed at USPTO. Applications that are filed
only in the United States, where the applicant does not plan to pursue the
patent in any other country, are not published until grant on a request
by the applicant. Such applications do not form part of the applications
database.
USPTO provides for four search options namely Quick Search,
Advanced Search, Search by Patent Applications, and Classification
Search."®

12.2.1 Quick Search

The Quick Search feature on the website enables a person to search,
based on several fields such as Title, Abstract, Issue Date/Publication
date, Patent number/Document number, Assignee name, International
Classification, Current US Classification, and so on.'? Quick Search
enables a person to perform a Boolean search where the person can enter
a maximum of two terms and restrict the search to a maximum of two
fields. It provides three Boolean connectors, AND, OR, and AND NOT.
For example, to find the patents filed by Unilever Limited claiming
for a shampoo composition, a quick search can be performed for the
term shampoo in the claims and the term Unilever in the assignee name.
Both these terms can be connected with a Boolean connector, in this case
284 INDIAN PATENT LAW AND PRACTICE

AND. This search will retrieve all the patents filed by Unilever Limited
having the term Shampoo in the Claims.

12.2.2 Advanced Search

The Advanced Search feature on the USPTO website enables a search
using all the field restrictions available in the Quick search feature.”
The advanced search can be performed by creating a search query using
multiple terms and multiple field restrictions. The Advanced Search
page of the website provides acronyms for each of the fields that may be
incorporated in the search query. As an illustration, the acronym for title
is ‘ttl and the acronym for Issue date is ‘isd’
For example, if a person wishes to search for a drug composition with
atorvastatin used for treating angiosclerosis, the advanced search query
may include all the keywords relating to atorvastatin and angiosclerosis.
The query in such a case may be as follows: (Atorvastatin or statin or
‘HMG Co reductase’ or ‘hydroxy methylglutaryl’) and (angiosclerosis or
atherosclerosis or ‘cardio vascular’).
When the field restriction is not mentioned, the entire document will
be searched. However, if a person is looking for patents with Atorvastatin
or its synonymous term in the title, the field has to be mentioned
in the query. For example, a search query for terms in title may be as
follows: ttl/(Atorvastatin or statin or ‘HMG Co reductase’ or ‘hydroxy
methylglutaryl’)

12.2.3. Number Search

The Patent/Application number search enables a person to obtain a
desired patent or application document by simply entering the relevant
number.”' An issued application can be obtained by entering the Patent
number in the Issued patent database and a Patent Application can be
obtained by entering the published application or document number in
the published patent database.

12.2.4 Classification Search

USPTO follows a classification system to categorize the patents and
applications based on their field and sub-field.2 For example, all
patent applications relating to nanotechnology fall in Class 977 and all
applications relating to body treating compositions fall under Class 424.
Patent applications that pertain to more than one technical field may be
classified in more than one class. For example, an invention relating to a
 MINING PATENT INFORMATION 285

drug composition using nanoparticles will fall not only under Class 424
but also under Class 977. The classes are further divided into several sub
classes. Each class and subclass is defined to describe its scope, based
on which one can identify the class within which the relevant patent
application may be incorporated.
A classification search is considered to be the most systematic and
comprehensive search mechanism. On identifying the classes that are
relevant to an invention, a person may perform a comprehensive search
to identify all patents in the said classes that are relevant to the invention.
Using the classification search as the basis rather than using key words
for searching, enables a searcher to uncover most of the relevant patent
documents even if the specific key words have not been used.

12.3 SEARCHING PCT APPLICATIONS

The World Intellectual Property Organisation (WIPO) enables PCT
application search in the patent database on its website.” It enables a
person to conduct various types of searches including Simple Search,
Advanced Search, Structure Search, and Classification Search.”

12.3.1 Simple Search

Simple search enables a keyword search in the front page of the PCT
application, which has the bibliographic data.” The bibliographic data
comprises of the International Application number, publication number,
International filing date, and publication date, the International patent
classification (IPC), applicants, inventors, agents, priority date, title,
abstract, designated states, publication, and filing language. The simple
search can be narrowed or broadened by restricting the search to ‘all the
words; ‘any of the word; or ‘exact phrase’.

12.3.2 Advanced Search

The Advance Search feature enables a person to create a search query
using several field codes denoting the field restrictions.” For example,
WO corresponds to Publication Number and ET corresponds to English
title. An exhaustive list can be found on the Search page along with other
tips for navigating the page.

12.3.3 Structured Search

The Structured Search provides for searching multiple keywords in
multiple field restrictions which have been separated by Boolean
286 INDIAN PATENT LAW AND PRACTICE

characters like ‘and’ ‘and not ‘or, and ‘near’?” When rightly performed a
structured search enables one to acquire specific search results.

12.3.4 Classification Search

WIPO provides for the IPC System which was based on the international
multilateral treaty called the Strasbourg Agreement concerning the
International Patent classification.” The IPC divides technology into
eight sections and about 70,000 subdivisions.” The WIPO online patent
database allows a person to perform a systematic patent classification
search based on the IPC system. Other than the International Bureau
which handles PCT applications, many countries who are party to the
PCT including India have adopted the IPC classification system. The
guide to IPC provided on the WIPO website is an effective aid to enable
classification search in IPC.
The sections of the IPC are listed below. The section titles provide very
broadly the description of the contents.”
1. Human Necessities;
Performing Operations; Transporting;
Chemistry; Metallurgy;
Textiles; Paper ;
Fixed Constructions;
Mechanical Engineering; Lighting; Heating; Weapons; Blasting;
WN Physics;
NAAR
8. Electricity.
Each section has several subdivisions, which are further divided into
classes which comprise of the second hierarchy of the IPC. For example,
Section A which comprises of all patents relating to Human necessity
comprises of the following subdivisions:
1. Agriculture;
2. Foodstuffs; Tobacco;
3. Personal or Domestic Articles;
4. Health; Amusement.
The subdivision Agriculture has several classes for example:
AO1: Agriculture; Forestry; Animal Husbandry; Hunting; Trapping;
Fishing
Each of the subdivisions is further divided into multiple subclasses
which form the third hierarchy of the IPC. The sections and subclasses
are denoted by capital alphabets and the subdivisions are denoted by two
digit numbers.
 MINING PATENT INFORMATION 287

AOIB: Soil Working in Agriculture or Forestry; Parts, Details, or

Accessories of Agricultural Machines or Implements, in General
AO1C: Planting; Sowing; Fertilizing
Each of these subdivisions is further divided into main groups and
subgroups which form the lower hierarchy of the IPC. On identification
of the class a person seeks to search, the WIPO patent database enables
the person to access all the PCT patent applications that are published by
the International Bureau.

12.4 SEARCHING THE EUROPEAN PATENT OFFICE DATABASE

The European Patent database is available on the espacenet website!
Espacenet is an entry-level, internet-based patent document search
service offered by the European Patent Office (EPO). Espacenet provides
three patent databases, namely, Worldwide, EP espacenet, and WIPO
espacenet. The EP-espacenet and the WIPO- espacenet databases
provide patent documents which were published during the last two years
by the EPO and WIPO respectively.” Applications older than two years
will be found in the worldwide database.** The worldwide database is the
most comprehensive of the three databases as it comprises of published
patent documents for over 70 countries. In addition to English patent
documents, the database also enables searching of patent abstracts for
patents granted by the Japanese patent office published since 1976.
The database provides four types of searches, namely, quick search,
advanced search, number search, and classification search. Recently,
espacenet has launched beta version of a new search option called the
smart search, which provides for a single search field for keywords,
inventor or applicant names, and publication numbers.”

12.4.1 Quick Search”

This feature allows a simple keyword search either for words in the title
and abstract or for inventor or applicant. One can add multiple keywords
by separating them by ‘and’ or or.

12.4.2 Advanced Search”®

The advanced search feature allows a keyword search in multiple
fields, namely in title, title or abstract, publication number, application
number, priority number, publication date, applicant, inventor, European
classification, or IPC. It must be noted that the EP-espacenet and the
WIPO-espacenet database do not allow keyword search in the European
288 INDIAN PATENT LAW AND PRACTICE

classification field. Like in quick search, advance search also enables

addition of multiple keywords in the same search field separated by ‘and’
or ‘or.

12.4.3 Number Search”

The number search feature enables search by application, publication, or
priority number for all three databases.

12.4.4 Classification Search*

The European Patent Classification system is built on top of the IPC
system and comprises of nine sections (A to H and Y).” These nine
sections together hold 135,600 subdivisions based on the technical
domains, which makes it more extensive compared to the IPC.“
The sections of the European patent classification system are listed
below:
1. Human Necessities;
2. Performing Operations; Transporting;
3. Chemistry; Metallurgy;
4. Textiles; Paper;
5. Fixed Constructions;
6. Mechanical Engineering, Lighting, Heating, Weapons, Blasting
Engines, or Pumps;
7. Physics;
8. Electricity;
9. Y. General Tagging of New Technological Developments.
As in the IPC, these sections are also further subdivided into classes,
subclasses, groups, and subgroups.
Once the right class is identified and selected, the class gets auto-
matically entered into the structured search box. The search can be further
narrowed by using keywords and other field restrictions mentioned in
the structured search.

12.5 SEARCH STRATEGY

The strategy for performing a search depends on the objective of the
search and the circumstances in which the search is carried out. The
parameters used for searching such as field, date, and so on, have to be
varied based on the objective of the search. For example, the parameters
for performing a patentability search will be different from the para-
meters for performing patent mapping. Though, the technique for
 MINING PATENT INFORMATION 289

searching may vary from person to person, the classification search is

considered to yield the most comprehensive search results.
The USPTO recommends a seven-step strategy based on classification
search for performing a comprehensive search. Before performing a
search, a person must spend time on understanding the classification
system followed by the patent office and the organization of the data
in the database. Such knowledge will enable the person to perform an
informed search, which yields best results.

NOTES
1. http://ipindia.nic.in/ipirs/patentsearch.htm (last accessed on 9 April
2010).
2. Ibid.
3. Ibid.
4. Ibid.
5. Ibid.
6 Ibid.
7. Ibid.
8. Ibid.
9. http://124.124,220.66/patentpublishedsearch/ Guidelines.pdf (last accessed
on 9 April 2010).
10. http://www.indianpatents.org.in (last accessed on 9 April 2010).
1l. These databases can be accessed at www.indianpatents.org.in (last
accessed on 9 April 2010).
12. http://www.indianpatents.org.in/db/testmaina.asp (last accessed on 9
April 2010).
13. Ibid.
14. Ibid.
15. http://india.bigpatents.org/ (last accessed on 26 May 2009).
16. www.uspto.gov, (last accessed on 9 April 2010).
17. http://patft.uspto.gov/ (last accessed on 9 April 2010).
18. Ibid.
on
19. http://patft.uspto.gov/netahtml/PTO/search-bool.html (last accessed
9 April 2010).
(last accessed on 9
20. http://patft.uspto.gov/netahtml/PTO/search-adv.htm
April 2010).
(last accessed on 9
24. http://patft.uspto.gov/netahtml/PTO/srchnum.htm
April 2010).
9 April 2010).
22. http://www.uspto.gov/go/classification/ (last accesse don
23. www.wipo.int (last accessed on 26 May 2009). ;
9 April 2010).
24. http://www.wipo.int/pctdb/en/ (last accessed on 9 April
(last accessed on
25. http://www.wipo.int/pctdb/en/search-simp.)sp
2010).
 290 INDIAN PATENT LAW AND PRACTICE

26. http://www.wipo.int/pctdb/en/search-adv.jsp (last accessed on 9 April

2010).
M http://www.wipo.int/pctdb/en/search-struct.jsp (last accessed on 9 April
2010).
: http://www.wipo.int/classifications/ipc/en/general/preface.html (last
accessed on 26 May 2009).
29. Ibid.
30. http://www.wipo.int/classifications/ipc/ipc8/?lang=en (last accessed on 9
April 2010).
31. www.espacenet.com (last accessed on 26 May 2009).
32. http://ep.espacenet.com/help?locale=en_EP&method=handleHelpTopic
&topic=coverageep (last accessed on 9 April 2010).
33. http://ep.espacenet.com/help?locale=en_EP&method=handleHelpTopic
&topic=coverageww (last accessed on 9 April 2010).
34. http://www.patentbytes.com/component/content/article/1 -patents/11-
espacenet-smart-search (last accessed on 9 April 2010).
35. http://ep.espacenet.com/quickSearch?locale=en_EP (last accessed on 9
April 2010).
36. http://ep.espacenet.com/advancedSearch?locale=en_EP (last accessed on
9 April 2010).
37. http://ep.espacenet.com/numberSearch?locale=en_EP (last accessed on 9
April 2010).
38. http://v3.espacenet.com/eclasrch?locale=en_EP (last accessed on 9 April
2010).
39. http://v3.espacenet.com/eclasrch?locale=en_EP (last accessed on 9 April
2010).
40. http://ep.espacenet.com/help?locale=en_EP&method=handleHelp
Topic
&topic=ecla (last accessed on 9 April 2010).
 Appendix I
Chapter IV-A of the Patents (Amendment) Act, 1999

EXCLUSIVE MARKETING RIGHTS

24A. (1) Notwithstanding anything contained in sub-Section (1) of
Section 12, the Controller shall not, under that sub-Section, refer an
application in respect of a claim for a patent covered under sub-Section
(2) of Section 5 to an examiner for making a report till the 31st day of
December, 2004 and shall, where an application for grant of exclusive
right to sell or distribute the article or substance in India has been made
in the prescribed form and manner and on payment of prescribed fee,
refer the application for patent, to an examiner for making a report to
him as to whether the invention is not an invention within the meaning
of this Act in terms of Section 3 or the invention is an invention for which
no patent can be granted in terms of Section 4.
(1)
(2) Where the Controller, on receipt of a report under sub-Section
ed
and after such other investigation as he may deem necessary, is satisfi
Act in
that the invention is not an invention within the meaning of this
no patent
terms of Section 3 or the invention is an invention for which
tion for
can be granted in terms of Section 4, he shall reject the applica
exclusive right to sell or distribute the article or substance.
right to sell or distribute
(3) Inacase where an application for exclusive
oller on receipt of a
an article or a substance is not rejected by the Contr
other investigation, if any,
report under sub-Section (1) and after such
 292 APPENDICES

made by him, he may proceed to grant exclusive right to sell or distribute

the article or substance in the manner provided in Section 24B.
Explanation—It is hereby clarified that for the purposes of this section,
the exclusive right to sell or distribute any article or substance under this
section shall not include an article or substance based on the system of
Indian medicine as defined in clause (e) of sub-Section (1) of Section 2 of
the Indian Medicine Central Council Act, 1970 and where such article or
substance is already in the public domain.

24B. (1) Where a claim for patent covered under sub-Section (2) of
Section 5 has been made and the applicant has,—
(a) where an invention has been made whether in India or in a country
other than India and before filing such a claim, filed an application
for the same invention claiming identical article or substance in a
convention country on or after the Ist day of January, 1995 and the
patent and the approval to sell or distribute the article or substance
on the basis of appropriate tests conducted on or after the Ist day of
January, 1995, in that country has been granted on or after the date of
making a claim for patent covered under sub-Section (2) of Section 5;
or
(b) where an invention has been made in India and before filing such a
claim, made a claim for patent on or after the Ist day of January, 1995
for method or process of manufacture for that invention relating to
identical article or substance and has been granted in India the patent
therefore on or after the date of making a claim for patent covered
under sub-Section (2) of Section 5. and has received the approval
to
sell or distribute the article or substance from the authority specified
in this behalf by the Central Government, then, he shall have
the
exclusive right by himself, his agents or licensees to sell or distribut
e
in India the article or the substance on and from the date of approval
granted by the Controller in this behalf till a period of five
years or till
the date of grant of patent or the date of rejection of applicati
on for
the grant of patent, whichever is earlier.
(2) where the specifications of an invention
relatable to an article or
a: substance covered under sub-Section (2) of
Section 5 have been
recorded in a document or the invention has been
tried or used, or,
the article or the substance has been sold, by a perso
n, before a claim
for a patent of that invention is made in India
or in a convention
country, then, the sale or distribution of the articl
e or substance by
such person, after the claim referred to above
is made, shall not be
 APPENDICES 293

deemed to be an infringement of exclusive right to sell or distribute

under sub-Section (1): provided that nothing in this sub-section shall
apply in a case where a person makes or uses an article or a substance
with a view to sell or distribute the same, the details of invention
relatable thereto were given by a person who was holding an exclusive
right to sell or distribute the article or substance.

24C. The provisions in relation to compulsory licences in Chapter XVI

shall, subject to the necessary modifications, apply in relation to an
exclusive right to sell or distribute under Section 24B as they apply to,
and in relation to, a right under a patent to sell or distribute and for that
purpose the following modifications shall be deemed to have been made
to the provisions of that chapter and all their grammatical variations and
cognate expressions shall be construed accordingly, namely:-
(a) Throughout Chapter XVI, -
(i) working of the invention shall be deemed to be selling or
distributing of the article or substance;
(ii) references to ‘patents’ shall be deemed to be references to ‘right to
sell or distribute;
(iii) references to ‘patented article’ shall be deemed to be references to
‘an article for which exclusive right to sell or distribute has been
granted’:
(b) three years from the date of sealing of a patent in Section 84 shall be
deemed to be two years from the date of approval by the Controller
for exclusive right to sell or distribute under Section 24B:
(c) the time which has elapsed since the sealing of a patent under section
85 shall be deemed to be the time which has elapsed since the approval
by the Controller for exclusive right to sell or distribute under Section
24B;
(d) clauses (d) and (e) of Section 90 shall be omitted.

24D. (1) Without prejudice to the provisions of any other law for the
time being in force, where, at any time after an exclusive right to sell or
distribute any article or substance has been granted under sub-Section
y
(1) of Section 24B, the Central Government is satisfied that it is necessar
or expedient in public interest to sell or distribute the article or substance
granted
by a person other than a person to whom exclusive right has been
or through any
under sub-Section (1) of Section 24B, it may, by itself
or distribute the
person authorized in writing by it in this behalf, sell
article or substance.
294 APPENDICES

(2) The Central Government may by notification in the Official

Gazette and at any time after an exclusive right to sell or distribute an
article or a substance has been granted, direct, in the public interest and
for reasons to be stated, that the said article or substance shall be sold at a
price determined by an authority specified by it in this behalf.

24E. All suits relating to infringement of a right under Section 24B

shall be dealt with in the same manner as they were suits concerning
infringement of patents under Chapter XVIII.

24F. The examination and investigations required under this chapter

shall not be deemed in any way to warrant the validity of any grant of
exclusive right to sell or distribute, and no liability shall be incurred
by the Central Government or any officer thereof by reason of, or in
connection with, any such examination or investigation or any report or
other proceedings consequent thereon.
 Appendix IIA
Forms at the Indian Patent Office

FORM 1 (FOR OFFICE USE ONLY)

THE PATENTS Act, 1970 Application No.
(39 of
ay
1970)
Filing Date:

THE PATENTS RULES, 2003 Amount of Fee Paid:

CBR No.
APPLICATION FOR GRANT OF PATENT
[See Sections 7, 54, 135 and rule 20(1)] Signature:

1. APPLICANT(S):

2. INVENTOR(S):

=
3. TITLE OF THE INVENTION: “

4. ADDRESS FOR CORRESPONDENCE OF APPLICANT/ Telephone No. :

AUTHORIZED PATENT AGENT IN INDIA Fax No.
Mobile No.
E-Mail:
296 APPENDICES

5. PRIORITY PARTICULARS OF THE APPLICATION(S) FILED IN CONVENTION

COUNTRY
Country | Application | Filing Date |Name of the Applicant | Title of the Invention
Number

6. PARTICULARS FOR FILING PATENT COOPERATION TREATY (PCT) NATIONAL

PHASE APPLICATION
International application number | International filing date as allotted by the receiving
offices

7. PARTICULARS FOR FILING DIVISIONAL APPLICATION

Original (first) application number Date of filing of original (first) application

8. PARTICULARS FOR FILING PATENT OF ADDITION

Main application/Patent Number Date of filing of main application

9. DECLARATIONS:
(i) Declaration by the inventor(s)
We, the above-named inventors are the true and first inventors for this invention and
declare that the applicants herein are our assignee.

(ii) Declaration by the applicant(s) in the convention country

I, the applicant in the convention country declare that the applicants herein are our
assignee or legal representative.
CO) EC eee
(b) Name of the Applicant:
(c) Signature(s):
(d) Name(s) of the signatory:

(iii) Declaration by the applicant(s);

I/ We, the applicants hereby declare that:
* We are in possession of the above-mentioned invention.
* The Provisional Specification relating to the invention is filed with this application.
* There is no lawful ground of objection to the grant of the patent to us.
* The application or each of the applications, particulars of which are given in Para. 5 was
the first application in convention country/countries in respect of my/our invention.
* The priority from the above-mentioned application filed in convention country/countries
and state that no application for protection in respect of the invention had been made
in a
convention country before that date by us or by any person from which we derive the title.
* My application in India is based on international application under Patent Cooperati
on
 APPENDICES 297

Treaty (PCT) as mentioned in Para. 6.

* The application is divided out of our application particulars of which are given in Para 7 and
pray that this application may be treated as deemed to have been filed on......................
under Section 16 of the Act.
* The said invention is an improvement in or modification of the invention particulars of
which are given in Para. 8.

10. FOLLOWING ARE THE ATTACHMENTS WITH THE APPLICATION:

(a) Complete Specification
(b) Declaration of inventorship on Form 5
(c) Statement of Undertaking on Form 3
(d) Original Power of Attorney on Form 26
(e) FeeRs -/- in Cheque bearing no.__————sdDated__—saand
drawn on Bank in favour of Controller of Patents.

I/ We hereby declare that to the best of Our knowledge, information and belief the fact and
matters stated herein are correct and we request that a patent may be granted to us for the
said invention.

Dated this 2009

Signature:

Name:
To
The Collector of Patents
The Patent Office
at Chennai/DELHI/KOLKATTA/MUMBAI
 298 ; APPENDICES

FORM 2
The Patent Act 1970
(39 of 1970)
&
The Patent Rules, 2005

PROVISIONAL/COMPLETE SPECIFICATION
(SEE SECTION 10 AND RULE 13)

“TITLE OF THE INVENTION

- APPLICANTS:

Name .

Nationality

Address

The following specification particularly describes and ascertains the nature of

this
invention and the manner in which it is to be performed:-
 APPENDICES 299

FORM 3
THE PATENT ACT, 1970
(39 OF 1970)
&
THE PATENT RULES, 2005°
STATEMENT AND UNDERTAKING UNDER SECTION 8
(SEE SECTION 8, RULE 12) .
1. Name of the applicant : 1/We,

declare:
2. Name, address and nationality
of the joint applicant :
3. Name and address of the ennilgge
(i) that I have not made any application for the same/substantially the same
invention outside India.
(ii) That I who have made this application No.
dated alone/jointly with made for
the same/substantially same invention, application(s) for patent in the
other countries, the particulars of which are given below:
Date bag Application — wd nes “i Date of

ee eee
SE DEREE Si A
SE Wo, 0. Di,
(iii) That the rights in the application(s) has/have been assigned to
ee
ee el
undertake that upto the date of grant of the patent, by the controller, I/we
would keep him informed in writing the details regarding corresponding
applications for patents filed outside India within three months from the
date of filing of such application.
4. To be signed by the applicant or his authorized registered patent agent.
5. Name of the natural person who has signed:

Signature:

Dated this ~_ day of 2009

To
The Controller of Patents
The Patent Office, AtMumbai/Chennai/ Delhi
300 APPENDICES

FORM 5
The Patents Act, 1970
(39 of 1970)
&
The Patent Rules, 2005
Declaration as to inventorship
[see Section 10(6) and Rule 13(6)]

1. NAME OF THE APPLICANT(s) :

I/We

hereby declare that the true and first

inventor(s) of the invention disclosed
in the specification filed in pursuance of
our application numbered
cl
2. INVENTOR (S)

Dated this day of ___ 2009

Signatures:

Name of the Signatory:

3. DECLARATION TO BE GIVEN WHEN THE APPLICATION IN INDIA IS

FILED BY THE APPLICANT(S) IN THE CONVENTION COUNTRY:-
We the applicant(s) in the convention country herby declare that our right to
apply for a patent in India is by the way of assignment from the true and the first
inventor(s).

Dated this day of ___ 2009

Signatures:

Name of the Signatory:

To,
The Controller of Patent
The Patent Office, at Mumbai/ Chennai/Delhi
 APPENDICES 301

FORM 9
The Patents Act, 1970
(39 of 1970)
&
The Patents Rules, 2003
Request for Publication
[See Section 11A(2); Rule 24A)

I having place of business at

, Karnataka, India, hereby request for
early publication of our application for patent No.
dated under Section 11A(2) of the Act.

Dated this Day of 2007

Signature:

Patent Agent
302 APPENDICES

FORM 13
THE PATENT ACT , 1970
(39 OF 1970)

APPLICATION FOR AMENDMENT OF THE APPLICATION FOR PATENT/

COMPLETE SPECIFICATION

We request leave
to amend the application/complete specification with respect to application for
Patent No. dated as follows.

Brain League IP Services Pvt. Limited

No. 18, 2nd floor, 5th A Cross Road,
J.P. Nagar 2nd phase, Bangalore-560078.
Phone: 91-80-41489502
Fax:91-80-41489501

My/Our reasons for making this request are as follows:-

Change of address of Agent/Attorney

I/We declare that no action for infringement or for the revocation of the patent in
question is pending before a court.
I/We declare that the facts and matters stated herein are true to the best of my/
our knowledge and belief.

Dated this the day of. 2009.

Signature

Patent Agent

To
The Controller of Patents
The Patent Office,
At MUMBAI
 APPENDICES 303

FORM 18 (FOR OFFICE USE ONLY)

THE PATENTS ACT, 1970 RQ. NO:
(39 yi. Filing Date:
The Patents Rules, 2003 Amount of Fee Paid:
Request/Express Request for examination of application |CBR No:
for patent
[See Section 11B and rule 20(4)(ii), 24B(1)(i)] Signature:

Applicant(s)/ Other Interested Person

Name:
Nationality:
Address:

Statement in case of request for examination made by the applicant(s)

We hereby request that our application for Patent No. filed on
for the invention titled shall be
examined under Section 12 and 13 of the Act.

Statement in case of request for examination made by any other interested person
I/We the interested person request for the examination of the application no.
‘| dated filed by the applicant titled under Sections 12 and
13 of the Act. As an evidence of my/our interest in the application for patent following
documents are submitted. (a)

Address for service

Dr Kalyan Chakravarthy
M/s Brain League IP Services Pvt. Limited
No.18, (Old No.2), Second Floor,
5th A Cross Road 24th Main, Marenahalli, J.P. Nagar 2nd Phase
Bangalore-560 078. Tel: 91-80- 41489501/2/4
E-mail : [email protected]
Dated this day _. pe

Signature:
Name of the signatory: Dr Kalyan Chakravarthy
Patent Agent

To,
The Controller of Patent
The Patent Office at Chennai
304 APPENDICES

FORM 26
THE PATENTS ACT, 1970
(39 of 1970)
FORM OF AUTHORISATION OF A PATENT AGENT/OR ANY PERSON IN
A MATTER OR PROCEEDING UNDER THE ACT
[See Sections 127 and 132; rule 135]

I/We, resident of/having place of business

- ae
ee TE A

Hereby authorize

Dr Kalyan Chakravathy/Mr Arun Kishore Narasani/Mr Nishant Kewalramani

Patent Agents,
XY Street
Bangalore-560 078

To act on our behalf in connection with filing, and prosecuting application for the
Patent titled “ ” before the Controller of
Patents or the Government of India and to perform all such acts, deeds and things
(including appointment of substitute or substitutes) as may be deemed necessary
or expedient in connection therewith or incidental thereto

And request that all notices, requisitions and communication relating thereto
may be sent to such person at the above address unless otherwise specified.
We hereby revoke all previous authorisation, if any made, in respect of same mat-
ter or proceeding.

We hereby assent to the action already taken by the said person in the above-
matter.
Dated this ...... day of ..........2009.

To
The Controller of Patents
The Patent Office at Chennai/Kolkatta/Delhi/Mumbai
 APPENDICES 305

FORM 27
THE PATENT ACT, 1970
(39 OF 1970)
&
THE PATENT RULES, 2005
Statement regarding working of patented invention on commercial scale in India
[See Section 146(2) and rule 131(1)]

In Matter of Patent No. 12345 of 05/06/2008

I/We, ABCDEFG having place of business at HIJKLMOP

The Patentee (s) or the Licensee (s) under the Patent No. 12345 here by furnish
the following statement regarding the working of Patented Invention referred to
above on the commercial scale in India for the year 2008.

The Patented Invention: (*) worked

The quantum and value (in rupees) of the patented product:

(i) Manufactured in India:

unit
(iv) The public requirement has been met to the fullest extent as per
price of is reasonably afforda ble price as per market
standards.
and belief.
The facts and matters stated above are true to best of my knowledge

Dated
Signatures:

To,
The Controller of Patents
The Patent Office at Chennai.
 Appendix IIB
Schedule of Fees (2009)

Amount of Fees (in Rupees)

Application or Form Name Natural Person Legal Entity other
than natural
person(s).
Application for Grant of Patent 1,000 plus Multiple of 4,000 plus Multiple of
1,000 in case of every 4,000 in case of every
multiple priority, multiple priority.
100 for each sheet of 400 (each sheet of
specification in addition | specification -in
to 30 and 200 for each addition to 30) and
claim in addition to 10. 800 (for each claim
in addition to 10).
Provisional and Complete No fee. No fee.
Specification 100 for each sheet 400 for each sheet
(Section 10 Rule 13) of specification -in of specification -in
addition to 30 and | addition to 30 and
200 for each claim in 800 for each claim
addition to 10. in addition to 10.
Request for Extension of Time 300 per month 1,200 per month
Claim or Request Regarding Any 500
Change in Applicant for Patent
 APPENDICES 307

Request or Claim Regarding 500 2,000

Mention of Inventor as Such in a
Patent
Request for Publication 10,000
Application for Amendment of 1,500 6,000
Patent
Application for the Direction of the | 1,500 6,000
Controller
Request for Grant of Patent Under 6,000
Section 26(1) and 52(2)
Application for Amendment of the | 500
Application for Patent/Complete
Specification
Notice of Opposition to
Amendment/Restoration/Surrender
of Patent/Grant of Compulsory
License or Revision of Terms
Thereof or to Correction of Clerical
Errors.
Application for the Restoration of 1,500 6,000
Patent
Application for Registration of 4,000
Title/Interest in a Patent or Share in
it or Registration of any Document
Purporting to Affect Proprietorship
of the Patent
Application for Compulsory 1,500 6,000
Licence

Request/ Express Request for

Examination of Application for
Patent
Application for Revocation of a
Patent for Non Working
Application for Revision of Terms 1,500 000
and Conditions of Licence
Request for Termination of
Compulsory Licence
308 APPENDICES

Application for Registration of 2,000 No fee

Patent Agent
Application for the Restoration of No fee
the Name in the Register of Patent
Agents
Application for Review/Setting 4,000
Aside Controller’s Decision/Order
Request for Permission for Making 4,000
Patent Application Outside India
 Appendix IIC
Convention Countries

Serial | Name of country/group or union of Countries/intergovernmental

number | organization
bette—d
Algeria
Angola
poate] Antigua and Barbuda
Argentina

Bosnia and Herzegovina

310 APPENDICES

Re lL: Botswana
22: Brazil
3 Brunei Darussalam
24. Bulgaria
25: Burkina Faso
26
OME Cambodia
28. Cameroon
29 le
30. Central African Republic
31. Chad
32. Chile
33. China
34. Colombia
35. Congo
36. Costa Rica
a7. Cote d’lvoire
w co

Czech Republic
42. Democratic People’s Republic of Korea
> Bi Democratic Republic of the Congo
Denmark
45. | Djibouti

> “I Dominican Republic

50
51. Equatorial Guinea

Win
win

win
Hin

wn

59all:a.l
 APPENDICES 311

62. Grenada
Guatemala

o Guinea-Bissau

ay

Honduras
70. Hong Kong (China)

™ Nile

73 Indonesia
74. Iran (Islamic Republic of)
“IWw

76.
NN

“Iee

83.

Kyrgyz Republic
Lao People’s Democratic Republic
87. Latvia
88. Lebanon I
Lesotho
Liberia
Libyan Arab Jamahiriya
Liechtenstein
93. Lithuania
Luxembourg
Macao (China)

Mali
312 APPENDICES

102.
103.

105.
106.
107.
108.
109.

120. Panama
121. Papua New Guinea
122
i: oie aa" Toe =
124
125.
126.
CA TE ee |
128. Republic of Korea
129. Republic of Moldova
130. Romania

131,
132. Rwanda
133. Saint Kitts and Nevis
134.
155. Saint Vincent and the Grenadines

137. Sao Tome and Principe

138.
139. Separate Customs Territory of Taiwan, Penghu, Kinmen and Matsu
Serbia and Montenegro
 APPENDICES 313

Seychelles
142. Sierra Leone
143. 3 a
Slovak Republic
— - Ww

lomon Islands
147. glelelele
uth Africa

eS WI™

bes%
| > a S3 8 = goslav Republic of Macedonia
159. Togo
Tonga
Trinidad and Tobago
av

— ai; 5S

_ a Ns United Arab Emirates

ie} United Kingdom
|
169.| United Republic of Tanzania
United States of America

je: aad
“N —
——

175.
176. Zimbabwe
for the
M77. European Patent Office (EPO)—Where the applications are received
,
following countries: Austria, Belgium, Cyprus, Czech Republic, Denmark
, Ireland,
Finland, France, Germany, Hellenic Republic (Greece), Hungary
Portugal , Republic
Italy, Liechtenstein, Luxembourg, Monaco, Netherlands,
, Slovak
of Bulgaria, Republic of Estonia, Republic of Romania, Slovenia
Kingdom .
Republic, Spain, Sweden, Switzerland, Turkey, United
314 APPENDICES

African Regional Industrial Property Organisation (ARIPO)— Where the

applications are received for the following countries: Botswana, Gambia,
Ghana, Kenya, Lesotho, Malawi, Mozambique, Sierra Leone, Sudan,
Swaziland, Tanzania, Uganda, Zambia and Zimbabwe.
African Intellectual Property Organisation (OAPI)—Where the applications
are received for the following countries: Benin, Burkina Faso, Cameroon,
The Central African Republic, Chad, Congo, Equatorial Guinea, Gabon,
‘Guinea, Guinea Bissau, Ivory-Coast (Cote d’lvoire), Mali, Mauritania, Niger,
Senegal, Togo.
Eurasian Patent Office (EAPO)— Where the applications are received for
the following countries: Republic of Azerbaijan, Republic of Armenia,
Republic of Belarus, Georgia, Republic of Kazakhstan, Kyrgyz Republic,
Republic of Moldova, Russian Federation, Republic of Tajikistan, Ukraine,
Turkmenistan.

Ministry: Ministry of Commerce and Industry

Department: Industrial Policy and Promotion

Notification No: $0562(E)

Date: 20 May 2003

Source: Manupatra (www.manupatra.com), MANU/INDP/0026/2003.

 Appendix IIIA
PCT Forms

PCT filing and other forms may be downloaded at http://www.wipo.int/

pct/en/forms/
PCT Statutory Fee Schedule for the Indian applicants (2009)

PCT Statutory Fee Schedule for the Indian applicants

fi. |transmittalFee
Fee }Rs2,000
2,000 FRs8,000
8,000

International Filing Fee for

Specification up to 30 Pages

(IF PCT EASY USD $ 91 Reduction )

x Over And Above 30 Pages Per $12

Page

Search Fée
Austria (At) $ 257 $257
Australia (Au) $ 1,091 $ 1,091
China (Cn) $ 280 $ 280
Europe (Ep) $ 2,164 $ 2,164
Sweden (Se) $ 2,164 $ 2,164
United States Of America $ 2,080 $ 2,080
316 APPENDICES

Examination Fee
Austria (At) EUR 200 EUR 200
Australia (Au) AUD 550 AUD 550
China (Cn) CNY 1500 CNY 1500
Europe (Ep) EUR 1675 EUR 1256.25
Sweden (Se) SEK 5000 SEK 5000
United States Of America USD 600 USD 600

Handling Fee
Austria (At) EUR 121 EUR 121
Australia (Au) AUD 196 AUD 196
China (Cn) CNY 200 CNY 200
Europe (Ep) EUR 121 EUR 121
Sweden (Se) SEK 1,110 SEK 1,110
United States Of America USD 171 USD 171
 xtpuad
dl]dy
ayvjS saijav
0} g Yj Td PUY 9Y} siavg suoyupuv
aauoy sdaqu
fo ia—
ay]
PJAOM APVAT, UOl]VZ1IUVBIC)

27e\$ soled
0} 2} Lod pue eu) sued SUOT]U2SAU0
pue ') SIIQWIZ|
jo ey) PIZOM. opeil uoneziuesiQ
sTyRIg)
UO ¢] 1290190
600Z
SIOQUIaWWy/S23eIS
a)
a
FRENTE
aaenSer NaameSo comme
 (Od) BAtO€
(La

s =|
<=
x
({q) urueg
(Za) ez]
(aq) unidjeg
(dy) Bas0y Jo 211Qnday
sajdoag 2ne190WIEq (Aq) snsepeg
ee ie 3See ae (ad) sopequeg
APPENDICES

ae ae me ee
re ee
rae ae (Hq) ureryeg
siege gE Desenate gt actal (sa) seureqra
(ID) a0, P 2309 adios (ZY) uelteqiszy
| (4D) ean BOD |feasgor |
soya]
(Ly) eLysny
(Ny) eyeasny
(Wy) Sor0W07) ay
a aa
(Wy) erueuLy
(wy) eunuasiy
(Ov)
eongne por eanny
(NO) eurYyD =
| fee pe
318 7, a ic Co sraquiayy/saveis |(€ST)OLM |€Z1)sued | (I¥I)LOd s1aquIs|/S2€1S
 /S2}2]S SIIQUIA|] LOd (IPI) €Z1)su
| eg (ESTO
| LM STOQUISIAT/SAPIS
etusog
pure
eutAoSazi
(Wq)ay4
oe on
=
oe = [gq Jopeares
(AS)
teunig
(Nq@)
wreyessnieg Hs jeroyenby
eaumy(OD)

Puesing
(Dq) =
eunjing
Osey (dq) _ ae uradomy santunuwos
oF
tpuning
(1a) a
/ a
Brpoquie
(HX)y =—
Uoos2suTe>
(WD))
a=
epeuey(VO)
APPENDICES

erquiey(WD)

eIB10a5
(qD)
|.

Auewiay
(qq) sy Beqry(UT)
Pury (HD) ae:
adee15(YD)
an!
oa
AEE

epeuain
(dD) ied
319
 ai
fe

(VW) 029010W

x
Bee |}

x (AW) oadauajuopy
ae
(aD Ge
}

(NW) eto3u0jy syqnday srurejsy) Wel]

eee! =< —
x
X (QW) ooeu0]

x
x (XW) O2PeW a! (NI) BIPUI
om amirT

x
(AW) saniney
a i

sa >4
a
: (UN) erueyANeW
APPENDICES

a
7
(MH)
eulyD ‘Buoy Buoy

xX
(WA) 225 AJOH

oe
+b

xX
er
:}- rib
(LH) 88H

ie
x

<s:ee!
(KD) euedny
eo

xX
x
(DW) seosesepeyy =

ea
“a

xX

me
(ND) eeu

|
isa)

x
(LD) Prewayeny

x
OLM
320 s SIIQUIIW] /S2JEIS- (€STIOLM |ezi)surd | (11) LOd ; SIAQUIZWAl/S2}23S

A
O
 /S212}S SIAQUIA| (Tb1)LO
| d EL1)SUe
| q (ESIMO
| LM SiaquMIaW/SWIS

OLM
(11) [?e4s]

(LI) Aye Seeoe ct emt

ait

~
MON
4

(2N)

RZ
Be
ae

SS
Se
PURPA

as
od
szAB1Ay I

=
salad
APPENDICES

ory
oHeID0WIIC

sajdoag
(WT) 2NQnday
x

(AT) BAT
xX
»4
|

xX
RIUIND MaN endeg
(Dd)
321
 322
uapamg
(dS)
pueyieziimg
(HO)

sqnday
Jo ea10y
(uy)
s1gnday
Jo PAOPOW UJ, JIWIOJ AP[SOBNX
(aw) a1Iqnday
Jo Bruopasey
(IW)

x
x

|
|
APPENDICES

x
[x
ona}
(OL)

e8uo,

ueIssny

(Na)
_onmmrany
uonelapay
aa TO
ee eu
24) pue JUSIUTA JUTeS FEF ,, UPJSTUDUDIN]
(DA) seutTpeualy
(WS) OuleW ues
 SIAQWIAWAY/S2IL}S
ors swoypure
ediouig
(LS)
tpneg BIqery(VS)

BIques(Su) paruy HyqQndayJo

Pruezury,
(Z,L)

eats euoe7(7S)

x
(Am)
arodeBurg
(9s)

x
7
Aen8naq
BPPTRAO]S
(AS)

(ZA)
B[aNzaus,, UeLIRAT]OG)

x
Ha
snanday
(Jo (AA)

ueisryeqzy
Prusacys
(IS) Se Ge 18) o£: eman | or
APPENDICES

uouojosspueys]
(dS)
YNog POLY (WZ)
aon a es
323
 Appendix IVA
Invention Disclosure Form

Invention Disclosure
Please provide the following information:
1. INVENTOR(S) INFORMATION:-

Company’s address Residential address

a el | > alias
Email address i

Company's address Residential address

 APPENDICES 325

2. REFERENCES and BACKGROUND INFORMATION

a. Has a literature search or patent search been conducted? If yes, please
provide a list of relevant literature/patents that were found in the search.
b. Provide articles and/or internet links that provide information about the
field of your invention or which are relevant to your invention.
c. Provide brief description of the technical field to which the invention
belongs.
d. Provide a list of problems in the existing technology which are being
overcome by your invention.
3. INVENTION DETAILS
a. Provide the title of the invention
b. Please describe the invention in detail. Please include diagrams to assist in
the description
Directions for describing the invention:
» List down the elements/components/modules of your invention
and describe the functionality of each element/component/module.
Additionally, if the elements can be replaced by any equivalent element
(s), provide details of the same. .
* Provide details about how the elements/components of your invention
are mechanically/electrically connected to each other. Additionally,
please elaborate, if there is a specific reason for using a specific type of
connection. Further, if any alternate connections are possible, please
elaborate.
+ Provide details about how each element/component/module
mechanically/electrically/sequentially interact with each other to
achieve the objectives of your invention.
» If your invention involves a process, describe in detail the process/
method steps followed in your invention.
+ Describe how your invention solves the problems listed in the answer
to question 2(d).
c. Please provide a list of key features of your invention (key features are
features of your invention that differentiates your invention from existing
technology/products).
d. Please provide a list of key words that would define your invention.
4. DISCLOSURE INFORMATION
tial,
a. Has disclosure to any person been made, whether public or confiden
publicat ions,
e.g., discussions with collaborators, suppliers, abstracts, journal
grant
conference proceedings, seminars, (under)graduate project reports,
industr y meeting s, offers
applications, scientific conferences, poster sessions,
to sell, etc.? If so to whom, when and where?
d society or deadline
b. Is there, within the next six months, a meeting of a learne
make disclosure? If
for publication of a scientific journal to which you plan to
so, when and where?
326 APPENDICES

. Has there been any association with any research on the specific issue of the
invention or the development, during the course of your past employment. If
yes, provide a detailed description of what your achievements are in your past
employment in the same area.
5. SUPPORT INFORMATION
a. Has a proprietary material owned by a third party been used at any time
during the experimental process or development? If yes, has a Material
Transfer Agreement been executed? If yes, please provide us the agreement.
. Has a proprietary database been used at any time during the experimental
process or development? If yes, has a license to use the database been acquired?
If yes, please provide us the agreement.
6. APPLICATIONS and COMMERCIALIZATION
. Please describe where or how the apparatus, product, or process of the
invention may be used.
. Is there a direct contact with any commercial enterprise which might be
interested in pursuing commercialization of your invention? If yes, please
elaborate.
. Are there any commercial enterprises which might be interested in pursuing
commercialization of the invention? If yes, please elaborate.
7. FURTHER WORK
. Is continuation of work towards improving the apparatus, product, or process
of the invention expected? If yes, please elaborate.
 Appendix IVB
Sample Specification Draft

The sample specification provided hereunder illustrates all sections of

the specification.' The specification is a modification of a US Patent that
has been changed to suit the Indian patent specification requirements.
The specification must be used by the reader only to understand the
constitution of various sections in the specification and the sample may
not be considered as a standard or model specification.

' The sample specification is based on published US patent 4,997,226.

328 APPENDICES

Form 2

The Patent Act 1970

(39 of 1970)
&
The Patent Rules, 2005

COMPLETE SPECIFICATION

TITLE OF THE INVENTION

Automotive Sun Shade

APPLICANTS

Name: ABC Company Limited

Nationality : Indian

Address : XY Street, Bangalore 560 078.

The following specification particularly describes and ascertains the nature of
this invention and the manner in which it is to be performed:-

FIELD OF INVENTION

This invention relates to protecting and preserving portions of automotive and

other vehicle interiors from harmful sun rays, and more particularly to protecting
the rear window shelf and rear seat back areas without obstructing sound from
speakers or airflow from ventilation ducts mounted in the rear window shelf.

BACKGROUND OF INVENTION

Automotive interiors are susceptible to damage through exposure to sun rays.

The areas that are most susceptible include the front dash, rear window shelf, and
rear seat back areas. Sun damage can be severe, especially, in warmer regions.

Many solutions have been suggested to prevent sun damage. The solutions range
from chemical formulations to physical screening devices. Especially, long chain
chemical polymers have had some commercial success. However, such chemical
polymers have significant drawbacks. One of the drawbacks is that such a
polymer needs to be applied repeatedly, on a periodic basis. Another drawback
of such chemical polymers is that they are suitable for fabric lined portions of the
automotive interior.
 APPENDICES 329

Other solutions (refer to U.S. Pat. Nos. 4,458,738 to Wilson and 4,659,144 to
Reese) that have been proposed include physical screens made out of opaque
material that are to be placed on the front dashboard, and rear deck surfaces to
provide the necessary shielding from the Sun. However, placing such material on
the rear deck obstructs the utility of other systems that have outlets (like the stereo
fixtures and air ducts) on the front dash and rear deck like the sound system and
ventilation system of an automotive.
Thus there exists a substantial need for an improved method of protecting those
areas in vehicle interiors most vulnerable to damage by the sun without interfering
with the use of the vehicle's sound or airflow systems.

OBJECT OF INVENTION

The principal object of this invention is to provide a sun shade to protected

automotive interiors from harmful sun rays without obstructing the utility of
other systems in the automotive.

GENERAL STATEMENT OF INVENTION

Accordingly the invention provides a sun shade for protecting the rear window
shelf and upper portion of the rear seat back areas of an automotive partially
comprised of a material substantially transmissive to sound and airflow.

A preferred embodiment of the invention comprises a generally rectangular

sheet of material having a first relatively opaque sound and airflow transmissive
portion connected to a second fully opaque portion. The first portion is sized to
generally cover the rear window shelf area of the automotive. The second portion
is dimensioned to overlie the upper portion of the rear seat back. The first portion
of the material comprises a mesh or cloth fabric which provides a moderate
degree of shading and is capable of passing sound from speakers and air from
ventilation ducts mounted beneath the fabric without noticeable obstruction.
The sun shade is releasably mounted to the rear window shelf by cooperating
areas of hook and loop material, attached to the rear window shelf and the sound
and air transmissive portion of the shade.

The hook and loop material permit easy installation and effectively hold the
sun shade in place. The fully opaque portion of the shade is draped over the
upper portion of the rear seat back affording a neat appearance to the automotive
interior.

In another embodiment, the second opaque portion is dimensioned to overlie the

rear seat headrests and the upper portion of the rear seat back.
330 APPENDICES

appreciated and
These and other aspects of the embodiments herein will be better
tion and
understood when considered in conjunction with the following descrip
however , that the followi ng
the accompanying drawings. It should be understood,
specific
descriptions, while indicating preferred embodiments and numerous
details thereof, are given by way of illustration and not of limitation. Many
changes and modifications may be made within the scope of the embodiments
herein without departing from the spirit thereof, and the embodiments herein
include all such modifications.

BRIEF DESCRIPTION OF FIGURES

This invention is illustrated in the accompanying drawings, through out which

like reference letters indicate corresponding parts in the various figures. The
embodiments herein will be better understood from the following description
with reference to the drawings, in which:

Figure 1 is a schematic view of a rear interior portion of an automobile;

Figure 2 is a top plan view of a sun shade according to embodiments herein;

Figure 3 is a schematic view of the rear interior portion of the automobile depicted
in Figure 1, with the sun shade shown in Figure 2 in place protecting the rear
window shelf and the upper portion of the rear seat back areas of the interior
according to an embodiment herein; and

Figure 4 is a schematic view of the rear interior portion of an automobile, with sun
shade in place protecting the rear window shelf, rear seat headrests, and the upper
portion of the rear seat back areas of the interior according to an embodiment
herein.

DETAILED DESCRIPTION OF INVENTION

The embodiments herein and the various features and advantageous details
thereof are explained more fully with reference to the non-limiting embodiments
that are illustrated in the accompanying drawings and detailed in the following
description. Descriptions of well-known components and processing techniques
are omitted so as to not unnecessarily obscure the embodiments herein. The
examples used herein are intended merely to facilitate an understanding of ways
in which the embodiments herein may be practised and to further enable those
of skill in the art to practice the embodiments herein. Accordingly, the examples
should not be construed as limiting the scope of the embodiments herein.

The embodiments herein provide a sun shade for protecting the rear window shelf
and upper portion of the rear seat back areas of a automotive partially comprised
 APPENDICES 93)

ofamaterial substantially transmissive to sound and airflow. Referring now to the

drawings, and more particularly to Figures 1 through 4, where similar reference
characters denote corresponding features consistently throughout the figures,
there are shown preferred embodiments.

In a preferred embodiment, the invention provides an improved way to shade

the rear portion of automotive interiors. Referring to Figure 1 there is illustrated
a portion of the interior of a vehicle, such as an automobile, including a rear
window 1, a rear window shelf 3, a front seat 5 and a rear seat 7. The rear seat
7 is comprised of a seat back 9 and a seat cushion 11. Speakers 13, connected
to the automobile sound system, and air ducts 14, connected to the automobile
ventilation system, are located in or below the rear window shelf 3.

In a preferred embodiment of the invention, sun shade of the invention is

releasably secured to the interior of the automobile by the use of cooperating first
and second moieties of suitable releasable fastening or connecting arrangements.
One or more pieces of loop material 15 are attached, as by bonding or mechanically
securing, to the rear window shelf 3. The pieces of loop material 15 are preferably
placed along a line across the rear window shelf 3, adjacent to the interface of the
rear window shelf and the rear seat back 9. The pieces of loop material 15 can be
provided as part of a kit (a retrofit kit) which contains the sun shade and may be
attached by the user or owner of the vehicle.

Referring now to Figure 2, the sun shade comprises a flat, substantially rectangular
sheet of material having a partially opaque mesh shade or cloth fabric portion 17
and a fully opaque portion 19 attached to the mesh shade or cloth fabric portion.
The portions 17, 19 are comprised of thin flexible materials and may be compatible
in fabric, colour, and style to the interior of the automobile. For example, for a
vinyl covered interior, a vinyl covered mesh fabric is used. Upholstery grade vinyl
is used for the fully opaque portion 19. One or more pieces of hook material 16
are placed on the underside of the mesh portion 17 in a pattern to cooperate with
the pieces of loop material 15 affixed to the rear window shelf 3. Attachment of
the pieces of hook material 16 to the mesh portion 17 is preferably by stitching,
but can be accomplished by bonding as well. A skilled person would easily realize
that fabric made of other material may also be suitably used. Also, the manner in
which the hook material and fabric are attached may also be changed suitably. In
a preferred embodiment, the two portions 17, 19 are stitched together in a seam
21 along their long edges and the opaque portion 19 is trimmed or covered with
edging tape 23 around its exposed perimeter to ensure it does not fray or fall
apart when in use.

covering
Figure 3 illustrates the sun shade when placed within an automobile,
9. The mesh
the rear window shelf 3 and the upper portion of the rear seat back
the shape of, i.e.
portion 17 of the sun shade is trimmed to generally conform to
332 APPENDICES

fit, the rear window shelf 3 and is mounted on the shelf by means of the pieces of
the hook material 16 attached to its under surface.
The fully opaque portion 19 is extended over the upper portion of the rear seat
back 9 and may be styled to approximately fit the shape and design of the rear
seat back. When the rear seat back additionally includes headrests 25, as depicted
in Figure 4, the opaque portion 19 additionally includes pockets configured to
cover the headrests. As used herein, the term ‘rear seat back’ refers to a seat back
without headrests or a seat back with headrests.

A skilled person in the relevant arts will have no difficulties in making changes
and modifications in the different described elements of the invention in order
to meet their specific requirements or conditions. For example, when the rear
window shelf 3 is covered by a carpeting or other material comprising loop ends,
the pieces of loop material 15 may be omitted and the pieces of hook material
16 may be attached directly to the loops of the carpeting. The partially opaque
portion 17 may be substantially comprised of the same material as the opaque
portion 19, having mesh fabric inserts placed in only those locations where it
overlies the speakers 13 and the air ducts 14. The opaque portion 19 may be
attached to the mesh portion 17 by hook and loop material permitting its removal
when it is preferable to only use the mesh portion as a sun shade. The sun shade
may be adapted to be attached to the front dash of a vehicle, such as by hook and
loop fasteners, having its mesh portion overlying speakers and air ducts mounted
in the dash. Such changes and modifications may be made without departing
from the scope and spirit of the invention as set forth in the following claims.

It is to be understood that the phraseology or terminology employed herein

is for the purpose of description and not of limitation. Therefore, while the
embodiments herein have been described in terms of preferred embodiments,
those skilled in the art will recognize that the embodiments herein can be
practised with modification within the spirit and scope of the embodiments as
described herein.

STATEMENT OF CLAIMS
1. A sun shade for protecting the rear window shelf and the upper portion
of the rear seat back of a vehicle from harmful sun rays without noticeably
obstructing the sound from speakers or air flow from ventilation ducts
mounted in the rear window shelf, the sun shade comprising:
a. a first portion of mesh material, substantially rectangular in shape, having
at least two lateral edges and at least one of a first moiety of fastening
means spaced intermediate the lateral edges for cooperative engagement
with at least one of a second moiety of fastening means attached to the rear
window shelf at an appropriate location,
b. a second portion of opaque material attached to the first portion at a
stitched seam interface,
 APPENDICES 333

c. a border material attached to and surrounding the exposed perimeter of

the second portion to provide structural integrity to this portion,
d. the opaque portion suited for curvelinear coverage of the upper portion of
the rear seat back, and
e. mesh portion suited for placement over the speakers and ventilation ducts
mounted in the rear window shelf without noticeably obstructing the
sound from the speakers or the air flow from ventilating ducts.
2. A sun shade for protecting the rear window shelf, rear seat headrests and the
upper portion of the rear seat back of a vehicle from harmful sun rays without
noticeably obstructing the sound from speakers or air flow from ventilation
ducts mounted in the rear window shelf, the sun shade comprising:
a. a first portion of mesh material, substantially rectangular in shape, having
at least two lateral edges and at least one of a first moiety of fastening
means spaced intermediate the lateral edges for cooperative engagement
with at least one of a second moiety of fastening means attached to the rear
window shelf at an appropriate location,
b. a second portion of opaque material attached to the first portion at a
stitched seam interface,
c. a border material attached to and surrounding the exposed perimeter of
the second portion to provide structural integrity to this portion,
d. the opaque portion suited for curve-linear coverage of the rear seat
headrests and the upper portion of the rear seat back, and
e. mesh portion suited for placement over the speakers and ventilation ducts
mounted in the rear window shelf without noticeably obstructing the
sound from the speakers or the air flow from ventilating ducts.
3. A sun shade substantially as herein described and illustrated in the figures of
the accompanying drawings

ABSTRACT
Automotive sun shade
A sun shade is provided that protects the rear window shelf 3 and upper back seat
7 areas of an automotive from harmful sun rays without noticeably obstructing
sound from speakers 13 or airflow from ventilation ducts 14 mounted in the rear
window shelf 3. The sun shade is comprised of a relatively opaque sound and
air transmissive mesh material connected to a fully opaque material. The mesh
material 17 is releasibly mounted in the rear window shelf via cooperating pieces
of hook and loop material 15 respectively carried by the mesh material and the
shelf. The fully opaque material 19 extends over the upper portion of the back
seat and may be made to match the color, material and style of the interior of the
automobile.
334 APPENDICES

DRAWING FORMAT

NAME OF THE APPLICANT:

TOTAL NO. SHEET:
APPLICATION NUMBER: /2009
SHEET NO.: 1/

Figure 1

Signature of the Applicant/Agent

 APPENDICES 335

NAME OF THE APPLICANT:

TOTAL NO. SHEET:
APPLICATION NUMBER: /2009
SHEET NO.: 2/

Figure 2

Signature of the Applicant/Agent

336 APPENDICES

NAME OF THE APPLICANT:

TOTAL NO. SHEET:
APPLICATION NUMBER: /2009
SHEET NO.: 3/

Signature of the Applicant/Agent

 APPENDICES 337

NAME OF THE APPLICANT:

TOTAL NO. SHEET:
APPLICATION NUMBER: /2009
SHEET NO.: 4/

Figure 4

Signature of the Applicant/Agent

338 APPENDICES

Explanation of Sections in the Sample Specification

(The reader must read the explanation provided hereunder only after reading the
sample specification).

Title
The title ‘Automotive sun shade’ in the specification indicates the general art of
the invention or the industry to which the invention belongs.

Preamble
The preamble ‘The following specification particularly describes the invention
and the manner in which it is to be performed’ is provided according to the rules
in the first page of Form 2.

Field of Invention
The section indicates the field (protecting and preserving portions of automotive
and other vehicle interiors) to which the invention belongs and also indicates
how the invention is useful in vehicles by indicating that use of the invention
in vehicles results in non-obstruction of sound from speakers and airflow from
ventilation ducts.

Background of Invention
The background section of the specification brings out the current state of the
art of technology by referring to specific and general prior art in the field. This
section brings out the problems (of sound from speakers and air flow from
ventilation ducts being obstructed) with the existing solutions proposed in prior
art and suggests the need for a solution that solves the problems identified with
the existing solutions in prior art.

Object of Invention
This section clearly points out the need for the invention in terms of objects. The
object of the invention (to provide a solution that does not result in obstruction
of sound from speakers and air flow from ventilation ducts) in the sample
specification is done through a single statement. However, in many cases, it
might be necessary to include multiple objects (multiple needs) that result in the
invention,

General Statement of Invention

This section gives a brief summary of the invention and complements the
omnibus claim 3 that is included. In general, ‘general statement of invention’
covers the most essential aspects of the invention and, therefore, covers at least
 APPENDICES 339

the aspects covered in the Independent claims provided in the ‘statement of

claims’ section. As can be seen in the illustration, the general statement covers
the essential aspects covered in the two independent claims as well.

Detailed Description of Invention

The detailed description provides the details of working of the invention relating
to how the sun shade can be made (by providing at least one example of material
being used for various parts of the invention) and how the sun shade can be used
in a vehicle through clear illustrations. This should ‘enable’ a skilled person in the
art to recreate the invention. For example, if no examples were provided for the
material used to make the sun shade, the specification might not ‘enable’ a skilled
person in the art as the skilled person my have to do some research on his own to
figure out how such sun shades can be made.

Statement of Claims
The ‘statement of claims’ includes the claims. Claims define extent of protection
sought for the invention described. In the illustration, there are two embodiments
that are described in the specification. One embodiment is a sun shade for rear
seat without head rests and the second embodiment is a sun shade for rear seat
with head rests. Both embodiments are covered using independent claims.

The third claim in the ‘statement of claims’ is an omnibus claim. The omnibus
claim is complemented by the ‘general statement’ section. In case of an
infringement proceeding, everything that is covered as part of the ‘general
statement’ is be assumed to covered by the omnibus claim. Since the illustration
provides a simple invention, there is actually no need for an omnibus claim. All
that is covered in the specification is adequately covered by the two independent
claims themselves.

Abstract
As discussed earlier, the abstract starts with the ‘title of the invention’ and gives a
concise summary of the invention. The abstract in the illustration clearly suggests
the problem the invention solves by stating that the invention “... protects the rear
window shelf 3 and upper back seat 7 areas of an automotive from harmful sun
rays without noticeably obstructing sound from speakers 13 or airflow from
ventilation ducts 14 mounted in the rear window shelf 3. Further, reference to
the relevant figure has been made where necessary. An abstract must also be
preferably within 150 words.' Furthermore, abstract must start on a separate
that is
page. Below the abstract, the most relevant figure (Figure | in illustration)
referred to has been indicated to be included with the abstract.

2008.
| Section 5.6.1, Draft Manual of Patent Practice And Procedure,
e, 2008.
2 Section 5.6.1, Draft Manual of Patent Practice And Procedur
340 APPENDICES

Drawings
The drawings in the illustration adequately show the details of the invention to
assist in describing the invention. For example, each portion of the invention,
namely, a fully opaque portion, a partially opaque portion, hook portion,
loop portion, seam, edging tape are all clearly identified and referred to in the
description while describing the invention details. Also, all elements claimed in
the ‘statement of claims are illustrated in drawings.
 Appendix VA
Sample Assignment of Invention

The sample assignment agreement relates to assignment for an invention by

an employee to the company. The agreement is provided only for purposes of
illustration and may not be considered as a model or standard assignment.

THIS ASSIGNMENT OF invention (hereinafter called Assignment”) is made the

twenty second (22nd) day of October, 2008 (Effective Date) by and between

Vicha, son or Rama, having his permanent address at 112, R.R. Nagar, K Road,
Ongole—23 (hereinafter called the Assignor), which term shall include his heirs,
assigns, executors, and legal representatives
And
ABC Private Limited, a Assignee incorporated in India, having its registered
office at No.112, Tech Park, Chandigarh—22, (hereinafter called the Assignee),
which term shall mean and include its administrators, executors, successors-in-
interest, and legal representatives.

Whereas, the Assignor conceived an invention relating to transfer of voice

messages on cell phones during the course of employment with the Assignee.

And, whereas, the Assignor has agreed to assign all rights in the invention to the
Assignee under this agreement.

Now, therefore, it is hereby agreed as follows:

342 APPENDICES

1. Definitions:

1.1 ‘Invention’ shall mean an improved method to transfer voice messages in cell
phones, which is described in Schedule A of this agreement.
1.2. ‘Employment Agreement’ shall mean the agreement of employment signed
by the Assignor and Assignee on first (1st) September, 2007.

2. Assignment

2.1. In consideration of the salary paid to the Assignor under the Employment
Agreement, the Assignor hereby agrees to deliver, assign, and transfer to the
Assignee all of the right, title, and interest of the Assignor in the Invention.
2.2. The Assignor agrees to execute all documents, and take necessary steps that
are required to transfer the rights in the Invention to the Assignee. The Assignor
further agrees to co-operate with the Assignee and take necessary actions for
acquiring a patent over the Invention.

3. Confidential Information

The Assignor agrees to maintain confidentiality of information relating to the

Invention. The Assignor shall not publish or disclose any information relating to
the Invention without written permission of the Assignee.

4. Representations and Warranties

The Assignor represents and warrants to the Assignee that:

4.1. The Assignor generated, created, and developed the Invention during the
course of employment with the Assignee.
4.2. The Invention is not based on any intellectual property owned by any third
party.

5. Governing Law and Jurisdiction

5.1. This agreement shall be governed by the Indian Contract Act, 1872 and other
laws in force in India.
5.2. All disputes arising under this agreement shall fall within the jurisdiction of
the courts in Chandigarh.

IN Witness Whereof, the Assignor and Assignee have signed on this Agreement
on the Effective Date.
Assignor
Name:
Title:
 APPENDICES 343

For and on behalf of Assignee

Name:
Title:

WITNESSES:
I.
Name:
Address:
2:
Name:
Address:
Schedule A
Description of the Invention
 Appendix VB
Sample Licence Agreement

The agreement draft provided hereunder is a sample licence agreement relating

to a patent over an automatic car locking system. The agreement is provided as an
example and may not be used as a standard or model agreement. An agreement
must be drafted based on the terms and conditions agreed by the parties and
verbatim copying of clauses from existing agreements must be avoided.
This Licence Agreement is made and executed on this the fourteenth (14th) day
of March, 2009 (Effective Date) by and between:

ABC Private Limited, a company registered under the Companies Act, 1956,
having its place of business at X Street, Y Cross, Bangalore 560 076, hereinafter
called ‘Licensor’, which term shall mean and include its administrators, executors,
successors-in-interest, and legal representatives,
And
XYZ Private Limited, an automobile company registered under the Companies
Act, 1956, having its place of business at A Street, B Cross, New Delhi 110 001,
hereinafter called ‘Licensee’ which term shall mean and include its administrators,
executors, successors-in-interest and legal representatives,

Whereas, the Licensor has developed an automatic car locking system and has
acquired a patent on the system in India, USA, UK, Germany, and France.
Whereas the Licensee has approached the Licensor for a license of the patent and
the Licensor has agreed to grant a licence to the Licensee in accordance with the
terms and conditions of this agreement.
NOW, THEREFORE, the Licensor and the Licensee agree as follows:
 APPENDICES 345

1. DEFINITIONS
1.1 ‘Party’ shall mean either Licensor or Licensee based on the context and
‘Parties’ shall mean both Licensor and Licensee.
1.2 ‘Licensed Patent’ shall mean the patent held by the Licensor in India entitled,
‘An Automatic Car Locking System, bearing patent number, 234234.
1.3. “Technical Information’ shall mean information relating to the manufacture
of automatic car locking system and its installation in cars.
1.4 ‘Car Locking System’ shall mean the automatic car locking system claimed in
the Licensed Patent.

2. GRANT
2.1 Licensor hereby grants to Licensee a non-exclusive licence to make, use and
sell the Licensed Patent and to use the Technical Information for a period of five
years within the territory of India.
2.2 Licensor shall within fourteen days of the Effective Date of this Licence
Agreement make available to Licensee the Technical Information necessary to
make and use the Licensed Patent.
2.3 Licensee shall not have the right to grant a sub-licence over the Licenced Patent
and Technical Information to any third party without written authorization of the
Licensor.

3. ROYALTY
3.1 Licensee shall pay the Licensor a lump sum royalty of Rupees Ten (10) Lakhs
on or before first (1st) April, 2000.
3.2 Licensee shall pay the Licensor a running royalty of Rupees Five Thousand
(5,000/-) on every Car Locking System manufactured by the Licensor.
3.3. The running royalty shall be due for payment on the thirty-first (31st) of
March and on Thirtieth (30th) of September of every calendar year and shall be
paid by the Licensee on/or before the expiry of ten (10) days from the stipulated
dates.
3.3.1. In the event of default in the payment of royalty amount the Licensee shall
pay interest on the amount in default at the rate of fifteen per cent (15%) per
annum.
3.4 The Licensee shall within ten (10) days of the dates stipulated under clause.
3.3 Deliver to Licensor in a form provided by the Licensor, a true and complete
statement in writing of the number of Car Locking Systems manufactured, sold
and/or used by the Licensee during the preceding running royalty period.
|
4. CONFIDENTIALITY
4.1 Licensee shall maintain the Technical Information disclosed under this
Technical
agreement in confidence and shall protect the confidentiality of the
its own
Information with the same degree of care as Licensee uses to protect
confidential information.
employees, who are
4.2 Licensee may disclose the Technical Information to its
346 APPENDICES

required to access the information for the purpose of making Car Locking Systems
under this agreement. Such employees must be bound by stringent instruments
of confidentiality.
4.3 The Licensee shall return or destroy any drawings, documents, materials and
so on given by the Licensor under this agreement on expiry of the term of this
agreement. .
4.4. The obligations relating to confidentiality of Technical Information shall
survive the termination of this agreement.

5. TERM AND TERMINATION

5.1 Unless earlier terminated as hereinafter provided, this Agreement shall be
valid for a term of five (5) years from the Effective Date. The term of the agreement
may be extended by the Parties on terms mutually agreed by them.
5.2 The agreement may be terminated earlier by any Party In the event of default
or failure by the other Party to fulfil obligations under this agreement. On such
a termination, the Licensee shall be liable to pay any royalty due to the Licensor
within one (1) month from the termination date.
5.3 The obligations of the Parties relating to confidentiality under clause 4 shall
survive the termination of this agreement.

6. INDEMNITY
The Licensee hereby agrees to Indemnify and hold harmless the Licensor from
and against any and all claims, demands, actions, liabilities, Judgments, costs and
expenses of whatever kind, whether based on contract, negligence, strict liability,
or statutory liability, and without regard to any contributory negligence on the
part of Licensor including, without limitation, attorney's fees and cost of defence
arising out of activities of the Licensee relating to the Licensed Patent or Technical
Information,

7. LIABILITY
7.1 Licensor shall in no event be liable for damages, whether direct or otherwise,
arising out of the manufacture, use or sale of Car Locking Systems by the Licensee
under this agreement.
7.2 Licensor warrants that it is the owner of the Licensed Patent and
that it has
the right to grant the License under this agreement. Licensor makes
no other
warranties, express or implied, and shall not be liable hereunder
except for wilful
mis-performance or wilful neglect to perform its obligations.

8. LAW AND JURISDICTION

This Agreement shall be governed by and construed according to
the Laws in
force in the Union of India. Any dispute arising under this agreem
ent shall fall
within the jurisdiction of the courts at Bangalore.
 APPENDICES 347

This agreement is signed and executed by the Parties on the Effective Date in the
presence of witnesses.

On behalf of the Licensor On behalf of the Licensee

Name: Name:
Designation: Designation:

Witnesses

L 2.

Name: Name:
Address: Address:
 Appendix VI
Year Wise Renewal Fee Payable (2009)

On what payable Amount offees in Rs.

For natural persons | For other that
natural persons
Before the expiration of the 2nd year 500
from the date of patent in respect of
3rd year
Before the expiration of the 3rdyear 500 2,000
from the date of patent in respect of
4th year
3 Before the expiration of the 4th year
from the date of patent in respect of
5th year
inal eg
Before the expiration of the 5th year S
from the date of patent in respect of
6thyear
Before the expiration of the 6th year
from the date of patent in respect of
7th year
Before the expiration of the 7th year
from the date of patent in respect of
8th year
2
 APPENDICES 349

Before the expiration of the 8th year

from the date of patent in respect of
9th year %
Before the expiration of the 9th year 1,500 6,000
from the date of patent in respect of
10th year
Before the expiration of the 10th 3,000 12,000
year from the date of patent in
respect of 11th year
Before the expiration of the 11th 3,000 12,000
year from the date of patent in
respect of 12th year
Before the expiration of the 12th 3,000 12,000
year from the date of patent in
respect of 13th year
Before the expiration of the 13th 3,000 12,000
year from the date of patent in
respect of 14th year
Before the expiration of the 14th 3,000 12,000
year from the date of patent in
respect of 15th year
Before the expiration of the 15th 5,000 20,000
year from the date of patent in
respect of 16th year
Before the expiration of the 16th 5,000 20,000
year from the date of patent in
respect of 17th year
Before the expiration of the 17th 5,000 20,000
year from the date of patent in
respect of 18h year
Before the expiration of the 18th 5,000 20,000
year from the date of patent in
respect of 19th year
Before the expiration of the 19th 5,000 20,000
year from the date of patent in
respect of 20th year
 Glossary

Anticipation Lack of novelty in an invention.

Best Mode The best way of implementing the invention.
Bolar Exemption Exemption to patent infringement for using
a patented invention in order to collect
information for getting drug approval.
Claim A single sentence in a patent or application
defining the metes and bounds of an
invention.
Compulsory Licence A licence over a patent granted by the
government without authorization of the
patent holder.
Convention Application Application that is filed in India after being
filed in a convention country.
Convention Country A country that is part of an international
arrangement and affords the same rights
to Indian nationals as it affords to its own
nationals with respect to patents.
Defence Activity exempted from patent infringement.
Divisional Application An application that claims subject matter
disclosed in a patent application and,
generally, claims the priority date of the
parent application.
 GLOSSARY 351

Enablement Carrying out an invention to practise or

implementation of an invention.
Equivalent Element of a process or product that performs
substantially the same function, in the same
way, and produces the same result to an
element in a patent claim or is obvious in the
light of an element in a patent claim.
Examination Review of a patent application by the patent
office to determine patentability of an
invention.
Exclusive Marketing Rights granted to a product patent applicant,
Rights especially relating to drugs, during the
transition period provided for a country
under the Agreement on TRIPS. The rights
included the right to sell and distribute the
product.
Industrial Applicability Ability of an invention to be made and used
in an industry.
International Application An application filed through the PCT route.
International Preliminary Examination carried out by the international
Examination preliminary examining authority during the
international phase of PCT.
International Preliminary An authorized patent office that is chosen by
Examining Authority a PCT applicant for international preliminary
examination.
International Search The patent search carried out by an
international search authority during the
international phase of PCT process.
International Search An authorized patent office that is chosen by
Authority a PCT applicant for international search.
Inventive Step Technical advance or economic significance
and not obvious to a person skilled in the art.
Lapse Expiry of a patent due to non-payment of
renewal fee.
Mail Box Depository of product patent applications
concerning inventions relating to drugs and
so on during the transition period provided
under the Agreement on TRIPS.
National Phase An application filed in a country through the
Application PCT route.
352 GLOSSARY

National Treatment Nationals of a foreign country must be treated

at par with nationals of a country in which
a patent application is filed with respect to
patent protection and enforcement.
Novelty New in the light of state of art or not
anticipated by the prior art.
Opposition The act of opposing the grant of a patent.
Parallel Import The importation of a product from another
country without the permission of the patent
holder after legally purchasing it from an
authorized person in the other country.
Patent Applicant A person, who files a patent application.
Patent Assignment Transfer of ownership in a patent.
Patent Infringement Exercising rights of a patent holder without
authorization within the territory of patent
grant.
Patent Licence Authorjzation given by a patent holder to
exercise his patent right(s).
Patent of Addition Patent granted to improvement ofan invention
that is subject of a patent.
Patentable Subject Matter Any invention that is a product or process and
that does not fall within the list of inventions
not patentable.
Person Skilled in the Art A virtual person having expertise in the field
to which the invention belongs.
Prior Art _. Any information or knowledge available to
the public on the date of invention.
Priority Date The date of first filing of a patent application,
which is considered for determining novelty
and inventive step.
Prosecution The interaction between the patent agent
or applicant and the patent office during
examination of a patent application.
Prosecution History or Record of all communication between the
File Wrapper History patent applicant or patent agent and the
patent office during prosecution.
Publication Publication of a patent application in the
official gazette or journal of the patent office.
Receiving Office A patent office of a country that receives PCT
application.
 GLOSSARY

Renewal Fee Fee paid to the patent office for maintaining a

patent.
Revocation Invalidation of a patent.
Specification Techno-legal document disclosing details
of an invention and filed as part of a patent
application.
Unity of Invention The state of being part of a single invention or
an inventive concept.

qnapaeiven os — Pe eins

Purchased .
Ayoroval . wl
Gratis 4 Ay09
Ate MO. V4
PrICe :
Ni fs ‘ et gays? mit
4

eg es Te i ONTRRTY ;
Ma : H

ee
Sesar
o
a F ‘

AAO -
rn 2
Uaes ©hyn,
toa

|
ites ——
B.A TAMER ICR2 ite ts 930g se opbiag s . Saint i
Pn aN ' 7.
, - ; no 4A | ian i
Ty hase ewPencil
¥
i. Pee yh
os
oan pevoabeels Wrseesa ty sahil; Se Miiholiogh
we ee
- y

’ 7 ; * ‘ren
- 3 rai % oan pe baliP% ONE vl } hh bs ay -
jh
ws . “He A stete mart y
: ~
,) 1 ‘ ; 7 oe
cng : - 7
‘i WM eis ala &mtg a fs

: : b

a Inlay | F
. . y
few we Cogn: ;
Core NATIONAL LAW SCHOOL OF INDIA
UNIVERSITY LIBRARY
NAGARBHAVI, BANGALORE - 560 072.
= This book must be returned by the date stamped below

Aol
 Kalyan C. Kankanaila, eminent patent expert,
is the Chief Knowledge Officer and co-founder
of Brain League. He is a visiting/guest faculty
at National Law School, Bangalore and Indian
Institute of Management Bangalore.

Arun K. Narasani, leading patent agent, is the

CEO, and co-founder of Brain League. He heads
the patent division of the company.

Vinitae-"——sihnan, well-known patent

UL
3u b- ‘Ald ‘ads the Intellectual Property
a research-
L.A: *~ ©elences,
or
authe Kaineleune
:| e
ee
sse
|
Spans?
a?lad
K— g

ae
e
Title B
es

DIA SG5

e
Jacket visual: Shutterstock/indiaPictur
 A comprehensive and up-to-date reference on
Patent Law and Practice in india

Domains covered include chemistry, pharmaceuticals,

biotechnology, software, electronics, and manufacturing

The book discusses:

- patentability requirements
- patent specification and claim drafting
- patent procedure and opposition
- patent infringement and defences
- remedies and maintenance
- patent assignment and licence drafting
- PCT procedure
- mining patent information

e The text is supported by:

- case laws and illustrations
- process flow diagrams
- glossary
- illustrative patent office documents
- patent statistics

OXFORD
UNIVERSITY PRESS

- WWW.oUp.com