Journal of Bioscience and Environment Research 1 (1): 8-15

Content available at Genesis Publishing Consortium Limited

Journal of Bioscience and Environment Research

Journal homepage: www.genesispcl.com/journals/jber

Original Research

RT-PCR based detection and pathotypical characterization of Newcastle

disease virus isolated from layer chickens in Mymensingh, Bangladesh
Limon Biswas , Dula chakraborty , Najmun Nahar Popy , Mithun Talukder , Mohammad Habibur Rahman , Md.
Bahanur Rahman , Mohammad Ferdousur Rahman Khan*

Department of Microbiology and Hygiene, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh-2202, Bangladesh

Article info Abstract

Article history The Newcastle disease virus (NDV) poses a significant threat to commercial chicken operations and is prevalent in
Received: 12 May 2024 Bangladesh. This rapidly spreading viral illness has severe economic implications for the poultry industry globally. In
Revised: 17 July 2024 Bangladesh, the velogenic strain of NDV is particularly widespread. This study utilized primers from the Fusion (F) and
Accepted: 30 July 2024 Matrix (M) genes along with haemagglutination (HA) testing and reverse transcription-polymerase chain reaction (RT-
Published: 08 August 2024 PCR) to isolate and identify NDV. Post-mortem examinations provided 12 samples (from brain, trachea, and
proventriculus) taken from four birds suspected of having NDV from Trishal and Mymensingh Sadar. The samples were
injected into 10-day-old embryonated chicken eggs using the chorioallantoic membrane technique. Embryos and allantoic
Keywords fluid (AF) were collected at 48 and 96 hours post-infection. NDV-infected embryos showed edema and hemorrhage.
Velogenic strain Significant hemagglutination was observed in the allantoic fluid tested with HA. Through the HA test and lesion
Hemagglutination test observation, four NDV isolates were identified. Pathotypic characterization of the field isolates using the Intracerebral
Embryonated chicken eggs Pathogenicity Index (ICPI) and Mean Death Time (MDT) indicated velogenic strains (ICPI: 1.5–2.0, MDT: <60). RT-PCR
Poultry industry impact confirmed the NDV status of all four isolates using primers for partial amplification of the F gene (839 bp) and the common
Allantoic fluid sequence of the 'F-M' genes (970 bp). This study demonstrates that RT-PCR is an effective molecular technique for the
Endemic rapid and confirmatory identification of velogenic NDV strains, particularly prevalent in Mymensingh at the field level.

© 2024 Biswas et al. This is an open access article distributed under the Creative Commons Attribution 4.0 International License
(www.creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the
original work is properly cited.

1. Introduction
Newcastle disease (ND) is one of the most highly contagious and 3′-NP-P-M-F-HN-L-5′.
lethal viral diseases affecting poultry, posing a significant global The pathogenicity of NDV strains can vary significantly based on
concern (Suarez et al., 2020; Vanmechelen et al., 2022). the host species. Among poultry, chickens and turkeys are the most
Approximately 250 avian species across 27 of the 50 bird groups are susceptible to NDV, while ducks and geese are the least susceptible
known to be susceptible to natural or experimental infection with and are often considered carriers that are resistant to even the most
Newcastle disease virus (NDV). It is likely that many additional lethal strains for chickens (Rehan et al., 2019).
species are vulnerable but have not yet been identified (Suarez et al., The occurrence of NDV outbreaks in vaccinated flocks indicates
2020; Smietanka et al., 2014). The World Organization for Animal the emergence of more virulent strains, leading to high morbidity and
Health (OIE) designates Newcastle disease virus (NDV) infection as a mortality rates among the birds and causing significant economic
notifiable disease. The disease was first reported in poultry in 1926 losses. This underscores the importance of regularly assessing
in Java, Indonesia, and Newcastle upon Tyne, England, and has since circulating NDV strains to develop effective management measures
become widespread globally. NDV, formally known as avian to prevent such infections. NDV strains are categorized into five
paramyxovirus sero type-1 (APMV-1), belongs to the genus pathotypes: viscerotropic velogenic, neurotropic velogenic,
Avulavirus, within the family Paramyxoviridae and the order mesogenic, lentogenic, and asymptomatic. Depending on the specific
Mononegavirales (Li et al., 2019). NDV is an enveloped, linear, non- pathotype, as well as the host's physiology and immune status, the
segmented, negative-sense single-stranded RNA virus. Its genome virus can damage the gastrointestinal, pulmonary, and neurological
comprises six genes and spans 15,186 nucleotides (Maes et al., systems (Wiseman et al., 2018).
2019). These genes encode nucleoprotein (NP), phosphoprotein (P), Pathotypically, NDV strains can be classified into three groups
matrix protein (M), fusion protein (F), hemagglutinin-neuraminidase based on their pathogenicity: lentogenic, mesogenic, and velogenic
(HN) protein, and large protein (L), organized in the sequence (Dimitrov et al., 2016). Velogenic and mesogenic strains are
considered virulent NDVs, while lentogenic strains are characterized
Corresponding authors
*
by low virulence. Pathotyping of NDV strains involves assessing their
Email address: [email protected] (Mohammad Ferdousur virulence using methods such as the intracerebral pathogenicity index
Rahman Khan) (ICPI) in 1-day-old chicks, the intravenous pathogenicity index (IVPI)
in 6-week-old hens, and the mean death time (MDT) in embryonated
doi: https://doi.org/10.69517/jber.2024.01.01.0003 (registering) chicken eggs (ECE) (Mphuthi et al., 2018; Hossain et al., 2017).
Genetically, NDVs are divided into two classes: class I and class
II. Class II strains have been isolated from both wild and domestic
8
Biswas et al., 2024 Journal of Bioscience and Environment Research 1(1): 8-15

birds, encompassing both virulent and non-virulent variants, and (Figure 1). The study was conducted in three selected upazilas
include at least 18 genotypes (Absalón et al., 2019). Class I NDV (Jhenaidahsadar, Harinakunda, Kotchadpur) in Jhenaidah district of
strains are primarily found in wild birds and typically have low Bangladesh (Figure 1).
virulence. Previously, these strains were categorized into at least nine
genotypes. In the current classification system, they are grouped into
a single genotype with at least three sub-genotypes (Diel et al.,
2012). The molecular pathotyping of various strains, often achieved
through F gene analysis and reverse transcription PCR (RT-PCR), has
been instrumental in comprehending and categorizing NDV strains
based on their virulence into the aforementioned three categories (Liu
et al., 2016). Commonly employed methods for detecting and typing
NDV strains include virus isolation, immunohistochemistry, RT-PCR,
gene sequencing, and microarrays (Souf, 2016).
The primary preventive measures for Newcastle disease (ND)
include maintaining hygiene and implementing vaccination protocols.
Humans, like avian species, can also be affected by ND (Ali et al.,
2021; Ali et al., 2019). Exposure to high levels of Newcastle disease
virus (NDV) can lead to conjunctivitis in humans. Among infectious
diseases, ND is particularly notorious for causing significant economic
losses in poultry and related products (Ali et al., 2021; Yusoff and Figure 1. Study area of the Mymensingh district.
Tan, 2001).
Newcastle disease virus (NDV) can be confirmed using several 2.3 Experimental design
diagnostic tests including hemagglutination (HA) and The entire study was divided into three steps. For this purpose,
hemagglutination inhibition (HI) tests, virus neutralization tests, 12 samples consisting of brain, trachea, and proventriculus were
enzyme-linked immunosorbent assays (ELISA), plaque neutralization collected from different farms at Trishal and Sadar of Mymensingh,
tests, and reverse-transcriptase polymerase chain reaction (RT-PCR) showing positive signs and symptoms of ND virus. Following accurate
(Ali et al., 2021; Wajid et al., 2017). Currently, the most commonly labeling and aseptic preservation in a refrigerated box, the collecting
used method to assess the virulence of an NDV isolate involves RT- sample was promptly delivered to the Department of Microbiology
PCR combined with sequencing of the F cleavage site. Unlike and Hygiene laboratory at BAU, Mymensingh, and stored at -20°C
traditional laboratory diagnostic methods such as viral isolation, RT- until tested. The virus was isolated by propagation into embryonated
PCR is more sensitive, specific, and faster. Many laboratories utilize chicken eggs. A slide hemagglutination test identified the ND virus
real-time RT-PCR (rRT-PCR), initially employing a primer and probe primarily. Finally, RT-PCR was used to validate the virus identification,
set to detect NDV, followed by a second primer and probe set to and pathogenicity indices were used to determine the pathotype.
determine the virulence of the virus. This molecular approach forms 2.4 Fertile eggs of chicken
the basis for evaluating NDV virulence in various laboratories (Ali et Brown and white shelled NDV seronegative chicken eggs were
al., 2021). purchased from a healthy flock with a good hatching rate obtained
Despite widespread use of vaccination programs in Bangladesh to from the local rustic area in Mymensingh. The eggs were disinfected
prevent and control Newcastle disease (ND), the disease continues to with 70% ethanol then cleaned with tissue. The eggs were incubated
be endemic throughout the country, posing a persistent threat to at 37°C for 11 days, and turned manually twice daily. The Newcastle
commercial poultry. Severe outbreaks of ND occasionally occur disease virus (NDV) was propagated using well-developed, viable
despite routine immunization of chickens with live NDV vaccines embryos.
derived from mesogenic and lentogenic strains (Rahman et al., 2018). 2.5 Molecular analysis
Differences in biology, serology, and genetics between the current The Viral RNA extraction was conducted following the procedure
strains of NDV and vaccine viruses are considered significant factors of Liu et al. (2012) using Viral RNA extraction kit (Promega, USA). For
contributing to the frequent recurrence of the disease in vaccinated reverse transcription, we used the Viral GoScript™ Reverse
poultry flocks in Bangladesh. There has been limited research on the Transcriptase kit (Promega, USA) to efficiently synthesize first-strand
molecular and clinical characteristics of NDVs circulating in cDNA from RNA templates (Anisimova et al., 2024). Appropriate
Bangladesh (Khokon et al., 2017). primer sequences were selected for PCR to amplify the genes of the
This study was conducted to detect and characterize Newcastle ND virus. These primers targeted the gene of NDV and produced
Disease Virus (NDV) isolated from the brain, trachea, and 970bp and 839bp respectively fragment of Fusion-Matrix gene and
proventriculus of birds suspected to have died from ND, through post- Fusion gene (Liu et al., 2003) (Table 1).
mortem examinations conducted in Trishal and Mymensingh Sadars,
Table 1. The sequences of the primers used for the PCR of the gene of
Bangladesh. The primary objectives of this study include isolating and
NDV.
identifying NDV from infected layer chickens, confirming the isolated
virus using Hemagglutination (HA) test and Reverse Transcription Name of
Amplicon
the Primer Sequence Reference
Polymerase Chain Reaction (RT-PCR), and characterizing the size (bp)
Primer
pathotype of the NDV field isolate using Mean Death Time (MDT) and
5’-
Intracerebral Pathogenicity Index (ICPI) tests F GTGAAGCTTGAGTCTGTGA
(F-M) GTCGTAC-3’
2. Materials and Methods gene 3’- 970 (bp)
2.1 Ethical approval R GCCGAATTCCCGAATCATCA
No ethical approval is required for this study. CGACGCTTAA-5’
Liu et al.
2.2 Study area and periods 5’-
(2003)
The current study was conducted over a period of 20 months, F TTAAGCTTGTAGTGGCTCTC
spanning from July 2021 to March 2023, at the Laboratory of the ATCTGATC-3’
Fusion
3’- 839 (bp)
Department of Microbiology and Hygiene, Faculty of Veterinary gene (F)
R CACCGGTACCCCTATTCTGA
Science, Bangladesh Agricultural University (BAU), Mymensingh TCG-5’
9
Biswas et al., 2024 Journal of Bioscience and Environment Research 1(1): 8-15
Sum of the total
For virus isolation, 12 samples were collected from chickens exhibiting ICPI=
Number of the observations of the birds
symptoms suggestive of Newcastle Disease (ND) virus during the
study period. These samples were obtained from the brain, trachea, 3. Results
and proventriculus of clinically suspected deceased chickens through 3.1 Isolation and identification of Newcastle disease virus
post-mortem examinations conducted in Trishal and Mymensingh (NDV)
Sadar, Bangladesh (Table 2). 3.1.1 Clinical findings observed in NDV-infected chickens
Recorded clinical signs were watery greenish diarrheic feces, loss
Table 2. Number of collecting samples from different tissues of chickens.
of appetite, respiratory distress (gasping and coughing), nasal
Location and Types of No of Total discharge, dropping of legs and wings, tremors, high fever, severe
no of birds tissue samples samples depression and prostration followed by death which was recorded
through interview with farm owners (Figure 2).
Brain 2
A B
Trishal Trachea 2
(2 birds) 12 samples
Proventriculus 2
of 04 NDV
Brain 2 suspected
chickens
Mymensingh Trachea 2
Sadar
(2 birds) Proventriculus 2
Figure 2. Clinical signs and symptoms of ND infected chickens, (A) NDV suspected
layer; (B) Greenish watery diarrhea.
2.6 Measuring the cDNA concentration by NanoDrop
spectrophotometer 3.1.2 Gross lesions observed during post mortem
The NanoDrop spectrophotometer assesses DNA, RNA, and examination
protein concentrations using only a 2-µL sample on its pedestal. This Hemorrhage in the proventriculus, button like ulcer in the duodenum,
enables rapid measurement of multiple samples in under a minute, brush paint hemorrhage in the colon and congestion and hemorrhage
contrasting with conventional spectrophotometers that require a 1- in the trachea (Figure 3).
cm cuvette. DNA purity is evaluated by the ratio of absorbance at 260
nm and 280 nm, where a ratio around 1.8 indicates high purity. Ratios A B
below 1.6 may indicate the presence of proteins, phenol, or other
contaminants that absorb strongly at 280 nm.
2.7 Protocol used for PCR
The PCR master mixture, primer, Extracted DNA and Nuclease
free water was put into the PCR cooler box. Required numbers of PCR
tubes with labeling were also put into PCR cooler box. Then the
reaction mixture was prepared by adding Nuclease free water, PCR
master mixture, forward, and reverse primers in an Eppendorf tube
(Table 2). Next, the reaction mixture was dispensed into each PCR C D
tube. Subsequently, 5 µl of isolated DNA template was added to each
tube and thoroughly mixed using pipette tips. Finally, the PCR tubes
were placed into the thermocycler for amplification.
2.7.1 Electrophoresis of the PCR products
PCR product 5 µl, which contained loading dye, was loaded to the
appropriate well of the gel with a micropipette. DNA ladder was
loaded in one well. The electrophoresis was connected to the power
supply and was run at 100V for 20 min, and then the supply switched
off. The gel was placed on the ethidium bromide for 15 min and then Figure 3. Postmortem examination of ND suspected chickens and collected sample
put into water for 5 min. The image documentation system's dark (A) Postmortem examination; (B) Hemorrhagic treacha; (C) Brain
chamber is then illuminated by a UV transilluminator. Finally, the hemorrhage; (D) Hemorrhagic proventriculus
image was seen, focused, and stored into a pen drive.
2.8 Statistical analysis and pathotypical characterization of 3.2 Isolation of NDV in chicken embryos
isolated NDV A total of 12 (brain, trachea, and proventiculus) samples were
2.8.1 Determination of mean death time (MDT) in chicken obtained and implanted into chicken embryos for virus isolation,
embryo where NDV generated hemorrhagic lesion, encephalitis, and embryo
MDT was determined as per the method of El-Morshidy et al. mortality. Allantoic fluid (AF) from embryos that died within 48 hours
(2021). Mean Death Time (MDT) is calculated as the number of hours post-inoculation was collected. The presence of hemagglutinating
at which 100% mortality of embryos occurs in the highest dilution virus was confirmed using a direct plate hemagglutination (HA) test
divided by the number of dead embryos observed. The equation is as with 2% chicken red blood cells (cRBC) on an HA plate. Among the
follow, 12 post-mortem samples obtained from naturally infected layer
(No.of dead embryo at Y hrs XY hrs) + (No.of dead embryo at Z hrs XZ chickens, Newcastle Disease (ND) virus was detected in 4 samples
MDT =
Total no.of dead embroys using the HA test.
2.8.2 Determination of intracerebral pathogenicity index 3.2.1 Inoculum preparation from tissue samples
(ICPI) The collected brain, trachea, and proventriculus were chopped
ICPI was ascertained according to El-Morshidy et al. (2021). The into minute pieces with sterile scissors and forceps, and then ground
ICPI was derived using the mean score per bird observation over an with a sterile pestle and mortar with sea sand to make suspensions
8-day period. The equation is as follow, with sterile PBS. Tissue collected from chicken farms were put in a
10
Biswas et al., 2024 Journal of Bioscience and Environment Research 1(1): 8-15

Petridish plate, washed in PBS, and then taken into an eppendrof HA activity. A) HA positive (naked eye); B) Microscopic image of HA test
tube. Then samples were centrifuged at 2500-3000 RPM for 15 min (100X)
maintaining 4°C, and the supernatant was collected and then passed
3.3.1 Reverse transcription polymerase chain reaction (RT-
through in syringe filter and treated with an antibiotic (Streptopen)
PCR)
and stored at –20°C and -80°C for further use.
Oligo nucleotide primers were utilized to amplify 839 bp
3.2.2 Inoculation of preparaing inoculum into embryonated
amplicons of the 'F' gene and 970 bp amplicons of the 'M' gene of
eggs for virus propagation and allantoic fluid collection
NDV, which demonstrated equivalent sensitivity and specificity with
Ten-day-old embryonated eggs were selected by candling to
RNA recovered from the allantoic fluid as with conventional NDV
ensure viability. A point of inoculation was made on the side of each
genomic RNA.
egg at the embryo site identified during candling. The top of the air
3.3.1.1 The measuring cDNA concentration by NanoDrop
sac and the marked point of inoculation were disinfected using iodine
spectrophotometer
tincture. An electric dentist's drill machine was used to create a small
The ratio of absorbance at 260 nm and 280 nm is commonly used
hole near the top of the air sac. Approximately 0.1 ml of inoculum
to assess DNA purity. Typically, DNA is considered "pure" when this
was then introduced through the allantoic cavity route. The eggs were
ratio is around 1.8. A lower ratio, such as 1.6, may indicate the
then incubated at 37°C for 5 days and monitored twice daily. Any
presence of proteins, phenol, or other substances that absorb
embryos that died within 24 hours of inoculation were excluded from
strongly near 280 nm. In this case, an absorbance ratio of 1.75
the study. Only live embryos were kept for up to 5 days post-
suggests the purity of the cDNA (Figure 7).
inoculation, and allantoic fluid was collected from these embryos.
3.2.3 Observation of embryo lesions infected with NDV field
isolates
After virus inoculation into the embryonated chicken eggs, the
allantoic fluid (AF) collected from the embryos those were found dead
within 48 hours. Due to virus infection the embryonated chicken eggs OD260/280-
were died and the dead embryos were hemorrhagic and edematous 1.75
(Figure 4 and 5).

Figure 7. Purity of cDNA concentration (OD 260/280).

3.3.1.2 ‘F’ gene detection by RT-PCR

Figure 4. Collection and observation of NDV infected embryo.
The cDNA produced from the reverse transcription (RT) reaction
was utilized to amplify a specific, larger-sized fragment of the 'F' gene
through PCR, resulting in an amplicon of 839 base pairs. Fusion gene
is known as the main determinant of pathogenicity. All the isolates
were positive for ‘F’ gene (Figure 8).

A B 839 bp
800 bp
Figure 5. A. NDV infected embryo with hemorrhage; B. Healthy embryo.

3.3 Confirmation the isolated NDV virus 500 bp

For the propagation of the working virus, the collected samples were
inoculated into chicken embryos and confirmed as ND virus by various
tests and techniques. The virus was detected utilizing the slide HA
approach using 2% chicken RBCs. All the isolate were HA positive
Figure 8. PCR amplification of ‘F’ gene (839bp) of ND virus. M: 100 bp DNA ladder
(Figure 6). Positive (promega, USA); Lane 2: positive control; Lane 3-6: positive isolates;
result Lane 7: Negative control.
of test
sample 3.3.1.3 ‘F’ and ‘M’ gene detection by RT-PCR
Positive
The isolates’ cDNA from the RT reaction was once more utilized
control
to amplify the 'F' and 'M' protein genes (970 bp).Virus assembly uses
Negative the matrix gene. Every isolate displayed a successful detection of the
control ‘F’ and ‘M’ gene (Figure 9).
3.4 Pathotypical characterization of isolated NDV strains
A B 3.4.1 Determination of MDT and ICPI of NDV field isolates
In vivo testing for virus pathogenicity includes determining the
Mean Death Time (MDT) in chicken embryonated eggs and
calculating the Intracerebral Pathogenicity Index (ICPI) using one-
day-old chicks. Pathogenicity studies indicated that the Mean Death
Figure 6. Slide HA tests for detection of ND virus from allantoic fluid. Equal amount
of AF and RBC were taken in a glass slide, mixed well and observed for

11
Biswas et al., 2024 Journal of Bioscience and Environment Research 1(1): 8-15

Time (MDT) was 54.34 hours, and the Intracerebral Pathogenicity in countries that have been declared free of the disease (Mayers et
Index (ICPI) value was 1.55 (Table 3 and 4). al., 2017).
Newcastle disease is a disease of domesticated and wild birds that
causes considerable economic loss and hinders the development of
the poultry industry. This disease is an acute, with high mortality in
clinical cases. Infected birds are treated with a range of therapeutic
treatments, but there is no suitable drug to prevent this viral disease.
As a result, vaccination was the only effective method of disease
900 bp 970 bp control.
4.1 Isolation and identification of NDV
In the current study, samples were obtained from chickens
500 bp exhibiting two different syndromes: one characterized by neurological
signs including neck stretching, forward posture with legs backward,
leg and wing drooping, leg paralysis, tremors, high fever, severe
Figure 9. PCR amplification of common sequence of ‘F–M’ genes (970 bp) of ND depression, and prostration leading to death; the other characterized
virus. Lane-1: 100 bp DNA ladder (promega, USA); Lane-2: positive by respiratory distress such as gasping and coughing, along with
control; Lane 3-6: positive isolates; Lane 7: Negative control. symptoms of nasal discharge, watery greenish diarrheic feces, and
loss of appetite. These syndromes were also found by other
On the basis of pathogenicity indices (MDT and ICPI), one of the researchers (Ragab et al., 2022; Deka et al., 2022; Shanmuganathan
virus isolate (NDV-1) found as velogenic which was found in field level et al., 2017). A total of 12 post-mortem samples (4 brains, 4 tracheae
of from Mymensingh district (Table 5). and 4 proventriculus) were collected for the collection of ND virus in
avian embroys from Trishal and Mymensingh sadar in Bangladesh.
Table 3. Calculation of MDT of NDV field isolate-1.
Proventiculus samples were also found positive for NDV in the present
No of eggs infected on time study which also found by some workers (Balachandran et al., 2014;
Dilution (hours) MDT Pathotype Putri et al., 2022). All 04 isolates were confirmed as ND virus by HA
24 32 48 60 72 84 96 test and RT-PCR technique which related to the findings of Syamsiah
10-1 0 2 3 5 Aini et al. (2022); Ahmadi et al. (2021); and Orabi et al. (2017). In
10-2 0 1 3 5 Bangladesh, Hossain et al. (2017) assessed eleven NDV isolates
10-3 0 1 2 5 derived from 19 field samples. Initially, all hemagglutination (HA)-
10-4 0 1 3 5 positive allantoic fluid (AF) samples were collected and preliminarily
10-5 0 1 3 5 confirmed using hemagglutination inhibition (HI) tests with anti-Avian
10-6 0 0 2 4 5 54.34 Velogenic Paramyxovirus-1 (APMV-1) polyclonal serum. Subsequently, RT-PCR
10-7 0 1 2 4 5 with F gene-specific primers specific to NDV was employed for
10-8 0 0 1 2 3 3 4 definitive virus confirmation, mirroring the methodology employed in
10-9 0 0 0 1 1 1 2 the current study. The samples were collected in the same district but
in different localities. MDT, ICPI, and IVPI indices indicated that all
Table 4. Calculation of ICPI of NDV field isolate-1. NDV isolates from 2011 and 2012 were velogenic, consistent with
Isolate MDT ICPI Pathotypes findings from the current investigation. Hossain et al. (2017) studied
the prevalence of NDV across various poultry farms in nine localities
<60 60- >90 1.5- 1.0- 0.2- spanning five districts, reporting higher rates of positive isolates and
90 2.0 1.5 0.5 more severe pathogenicity outcomes compared to the present study.
NDV-1 + + Velogenic In this study, we collected samples only from the Mymensingh district.
This variation could be related with the regional variation of samples.
Table 5. Result of MDT and ICPI tests on NDV isolate-1. 4.2 Molecular characterization of NDV
RT-PCR is a speedy, strong, and highly specific molecular
Days post Criteria of birds ICPI Pathotype technology for confirmatory detection of several viruses, including
inoculation Normal Sick Dead Newcastle disease virus (Anjum et al., 2020). The development of
molecular technologies has paved the door for quick and specific
Day 1 8 0 0 identification of infectious organisms, hence RT-PCR was used for
Day 2 4 3 1 identification of the ND virus. During the present study, isolates of
Day 3 0 5 3 NDV exhibit specific amplified product of 839 bp and 970 bp size
1.55 Velogenic respectively using primers Fusion-Forward/Reverse and Matrix-
Day 4 0 0 8
Forward/Reverse. These findings were confirmed by some researches
Day 5 0 0 8 (Miller et al., 2010; Wise et al., 2004). Other researchers have verified
Day 6 0 0 8 the legitimacy of the PCR product based on the size of the amplicons
Day 7 0 0 8 (Fazel and Mehrabanpour, 2018; Singh et al., 2005). In the present
study for ‘F’ and ‘M” gene of NDV detection, primer designed by Liu
Day 8 0 0 8 et al. (2003) was used in this study and the amplicon size respectively
was 839 bp and 970 bp. The RT-PCR technique has been successfully
4. Discussion used by numerous researchers (Sajo et al., 2022; Mehmood et al.,
Newcastle Disease (ND) poses a significant threat to the health and 2019; Shofa et al., 2018; Ewies et al., 2017). Matrix gene detection
welfare of poultry globally. The OIE has classified it as a listed of NDV was also obtained by Ak et al. (2019); and Shah et al. (2019).
disease, mandating that outbreaks of mesogenic or velogenic ND be Utilizing the RT-PCR technique along with sequencing to classify NDV
reported Anjum et al. (2020). Despite extensive vaccination efforts, field isolates into velogenic, mesogenic, and lentogenic strains will
ND remains endemic in numerous regions worldwide, including provide valuable insights into the types of strains circulating in a
industrialized countries. Occasionally, outbreaks of NDV occur even specific geographical area. This approach will help gather
epidemiological data regarding changes in antigenicity and
12
Biswas et al., 2024 Journal of Bioscience and Environment Research 1(1): 8-15

pathogenicity of field isolates. Furthermore, it will aid in developing

vaccination strategies aimed at effectively controlling the disease in Conceptualization: Limon Biswas and Mohammad Ferdousur
field conditions. Rahman Khan; Data collection: Limon Biswas and Dula
4.3 Pathotypical characterization of NDV chakraborty; Data analysis: Limon Biswas and Najmun Nahar Popy;
Pathotyping of ND viruses hinges on their virulence rather than Conducted data analysis and interpretation of results: Limon
antigenic differences. NDV strains are classified as velogenic (highly Biswas and Mithun Talukder; Designed the experiment and
virulent), mesogenic (moderately virulent), or lentogenic (low edited the manuscript: Limon Biswas and Mohammad Habibur
virulent) based on specific pathogenicity indices. Velogenic strains Rahman; Figure preparation: Limon Biswas and Md. Bahanur
typically have an MDT of less than 60 hours, an ICPI greater than 1.4, Rahman; Reviewed it and revised the final version. All authors
and an IVPI ranging from 2 to 3. Mesogenic strains exhibit an MDT critically reviewed the manuscript and agreed to submit final version
of 60-90 hours, an ICPI between 1 and 1.4, and an IVPI around 0.5. of the article.
Lentogenic strains show an MDT over 90 hours, an ICPI of 0 to 0.2,
and an IVPI of 0. These indices are essential for categorizing NDV References
strains by their pathogenic characteristics, crucial for managing
outbreaks in poultry populations. In the current pathotypical Absalón AE, Cortés-Espinosa DV, Lucio E, Miller PJ and Afonso CL,
characterization investigation, the MDT and ICPI values were 54.34 2019. Epidemiology, control, and prevention of Newcastle
and 1.55, respectively. MDT of less than 60 hours and ICPI of greater disease in endemic regions: Latin America. Tropical Animal
than 1.5 meet all requirements for virulent strains. All isolates induced Health and Production, 51: 1033-1048.
the demise of inoculated embryonated chicken eggs after 72 hours https://doi.org/10.1007/s11250-019-01843-z
post-inoculation. Based on MDT and ICPI for one isolate, our result Ahmadi M, Ebrahimi MM, Shahsavand S, Ebrahimi S, Hamidi A and
indicated that all the local samples had virulent NDV strains Ghaemmaghami S, 2021. Identification and phylogenetic
(velogenic). These pathogenicity tests were performed by some analysis based on Newcastle disease virus gene F isolated from
workers Susta et al. (2011). Finally, we may be concluded that broiler poultry farms in Markazi province. Veterinary Researches
because of the RNA virus, it's showed more mutation and variation and Biological Products, 131(2): 20-31.
with other isolated samples. It will be clarified when the isolated https://doi.org/10.22092/vj.2020.124906.1551
samples shall be sequencing and investigating the homology with Ak MD, Setiyaningsih S and Sudirman I, 2019. Identification and
other isolates. We know the prevalence of ND virus and the virus's molecular characterization of Newcastle disease virus circulates
pathogenicity in this local area as a result of this study. in some districts in Aceh. Jurnal Kedokteran Hewan, 13: 10-14.
https://doi.org/10.21157/j.ked.hewan.v13i1.5832
5. Conclusions Ali MZ, Islam E and Giasuddin M, 2019. Outbreak investigation,
This study successfully identified four positive isolates from post- molecular detection, and characterization of foot and mouth
mortem samples of suspected birds. Initial screening through slide disease virus in the Southern part of Bangladesh. Journal of
hemagglutination tests and subsequent confirmation via RT-PCR Advanced Veterinary and Animal Research, 6(3): 346–354.
demonstrated the presence of Newcastle disease virus. The use of https://doi.org/10.5455%2Fjavar.2019.f353
fusion and matrix gene-specific primers in RT-PCR, followed by Ali MZ, Shaon MTW, Moula MM, Bary MA, Sabuj AAM, Khaled SA and
passage into chicken embryonated eggs, allowed for detailed Giasuddin M, 2021. First report on the seroprevalence of avian
observation and analysis. The slide HA test provided primary encephalomyelitis virus antibody in Sonali (cross-bred) chickens
identification, while further molecular confirmation was achieved in Bogura, Bangladesh. Journal of Advanced Veterinary and
through RNA extraction and conversion to cDNA. This comprehensive Animal Research, 8: 78-83.
approach validated the status of the Newcastle disease virus in all https://doi.org/10.5455/javar.2021.h488
isolates, with one field isolate classified as velogenic based on Anisimova OK, Shchennikova AV, Kochieva EZ and Filyushin MA,
pathotypical analysis. The findings underscore the effectiveness of 2024. Garlic (Allium sativum L.) invertase genes: genome-wide
the applied methodologies in diagnosing and characterizing virulent identification and expression in response to abiotic stresses and
strains of Newcastle disease virus, meeting all necessary criteria for phytohormones. Horticulturae, 10(6): 581.
virulence. https://doi.org/10.3390/horticulturae10060581
Anjum FR, Rahman SU, Aslam MA and Qureshi AS, 2020. Comparative
Acknowledgments study of protection against Newcastle disease in young broilers
administered natural chicken alpha interferon via oral and
The research was funded by the Bangladesh Agricultural University intramuscular routes. Msphere, 5(4): 10-1128.
Research System (BAURES), Bangladesh Agricultural University, https://doi.org/10.1128/msphere.00585-20
Mymensingh-2202, Bangladesh. Project title: Pathotypical and Balachandran P, Srinivasan P, Sivaseelan S, Balasubramaniam GA and
genotypical characterization of strains of Newcastle Disease virus Murthy TGK, 2014. Isolation and characterization of Newcastle
isolated from outbreak in chickens flocks in some regions of disease virus from vaccinated commercial layer chicken.
Bangladesh. Project No. : 2021/62/BAU. Veterinary World, 7(7): 457-462.
https://doi.org/10.14202/vetworld.2014.457-462
Data availability Deka p, Nath MK, Das S, Deka P, Hazarika R, Das G and Sarma M,
2022. Molecular Detection of Newcastle disease virus from field
The data generated from this study might be available on the valid
outbreaks in Assam, India. Indian Journal of Veterinary
request from the corresponding author.
Sciences and Biotechnology, 18(3): 97-99.
Informed consent statement https://doi.org/10.21887/ijvsbt.18.3.22
Diel DG, Da Silva LH, Liu H, Wang Z, Miller PJ and Afonso CL, 2012.
No informed consent was required to conduct the study. Genetic diversity of avian paramyxovirus type 1: proposal for a
unified nomenclature and classification system of Newcastle
Conflict of interest disease virus genotypes. Infection, Genetics and Evolution,
12(8): 1770-1779.
The authors declare no conflict of interest. https://doi.org/10.1016/j.meegid.2012.07.012
Authors’ contribution
13
Biswas et al., 2024 Journal of Bioscience and Environment Research 1(1): 8-15

Dimitrov KM, Ramey AM, Qiu X, Bahl J and Afonso CL, 2016. district Okara, Pakistan. Pakistan Veterinary Journal, 39(3):
Temporal, geographic, and host distribution of avian 353-358. http://dx.doi.org/10.29261/pakvetj/2019.035
paramyxovirus 1 (Newcastle disease virus). Infection, Genetics Miller PJ, Decanini EL and Afonso CL, 2010. Newcastle disease:
and Evolution, 39: 22-34. evolution of genotypes and the related diagnostic challenges.
https://doi.org/10.1016/j.meegid.2016.01.008 Infection, Genetics and Evolution, 10: 26-35.
El-Morshidy Y, Abdo W, Elmahallawy EK, Abd EL-Dayem GA, El-Sawak https://doi.org/10.1016/j.meegid.2009.09.012
A, El-Habashi N and Abou Asa S, 2021. Pathogenesis of Mphuthi MBN, 2018. Development of a real-time PCR assay to detect
velogenic genotype VII. 1.1 Newcastle disease virus isolated the fusion gene of the D26 strain of a commercial avian
from chicken in Egypt via different inoculation routes: avulavirus 1. MSc thesis, University of Pretoria.
molecular, histopathological, and immunohistochemical study. http://hdl.handle.net/2263/67823
Animals, 11(12): 3567. https://doi.org/10.3390/ani11123567 Orabi A, Hussein A, Saleh AA, El-Magd MA and Munir M, 2017.
Ewies SS, Ali A, Tamam SM and Madbouly HM, 2017. Molecular Evolutionary insights into the fusion protein of Newcastle
characterization of Newcastle disease virus (genotype VII) from disease virus isolated from vaccinated chickens in 2016 in
broiler chickens in Egypt. Beni-Suef University journal of basic Egypt. Archives of Virology, 162(10): 3069-3079.
and applied sciences, 6(3): 232-237. https://doi.org/10.1007/s00705-017-3483-1
https://doi.org/10.1016/j.bjbas.2017.04.004 Putri DD, Poetri ON, Candra AA and Soejoedono RD, 2022. Production
Fazel P and Mehrabanpour MJ, 2018. Evaluation of the viral of hyperimmune serum against genotype VII Newcastle disease
interference between lentogenic Newcastle disease virus virus in rabbits with several applications. Journal of Advanced
(Lasota) and avian influenza virus (H9N2) using real-time Veterinary and Animal Research, 9(2): 211-220.
reverse transcription polymerase chain reaction in SPF chicken. https://doi.org/10.5455/javar.2022.i586
Brazilian Journal of Poultry Science, 20(3): 537-546. Ragab ES, Moharam I, El-Naggar RF, Hussien EG, El-Kanawati ZR and
https://doi.org/10.1590/1806-9061-2017-0717 AboElkhair MA, 2022. Isolation and molecular characterization
Hossain MG, Saha S, Akter S, Islam MA and Amin MM, 2017. of Newcastle disease virus genotype vii circulating in Egypt
Molecular detection, biological characterization and evaluation (2017-2020). Journal of Current Veterinary Research, 4(2): 45-
of protective potentiality of a velogenic strain of Newcastle 55. https://doi.org/10.21608/jcvr.2022.267507
disease virus isolate of Bangladesh. Biotechnology Journal Rahman MM, Uddin MK, Hassan MZ, Rahman MM, Ali MZ, Rahman
International, 17(3): 1-9. ML and Rahman MM 2018. Seroprevalence study of infectious
https://doi.org/10.9734/BJI/2017/31123 laryngotracheitis virus antibody of commercial layer in Gazipur
Khokon MSI, Azizunnesa M, Islam MM, Chowdhury KB, Rahman ML Districts of Bangladesh. Asian Journal of Medical and Biological
and Ali MZ, 2017. Effect of mastitis on post-partum conception Research, 4: 1-6. https://doi.org/10.3329/ajmbr.v4i1.36814
of cross bred dairy cows in Chittagong district of Bangladesh. Rehan M, Aslam A, Khan MR, Abid M, Hussain S, Amber J and Hussain
Journal of Advanced Veterinary and Animal Research, 4(2): A, 2019. Potential economic impact of Newcastle disease virus
155-160. http://dx.doi.org/10.5455/javar.2017.d203 isolated from wild birds on commercial poultry industry of
Li SY, You GJ, Du LJ, Li WW, Liu YY, Du JT and Huang Y, 2019. Pakistan. A review. Hosts Viruses, 6: 1-15.
Complete genome sequence of a class I Newcastle disease virus https://doi.org/10.17582/journal.hv/2019/6.1.1.15
strain isolated a breeding chicken flock in Sichuan, China. Sajo MU, Sa'idu L, Souley MM and Fagbohun OA, 2022. Molecular
Microbiology Resource Announcements, 8(18): e00337-19. characterization of Newcastle disease virus vaccines in Nigeria.
https://doi.org/10.1128/mra.00337-19 Veterinary World, 15(12): 2816–2821.
Liu H, Gan Y, Yang B, Weng H, Huang C, Yang D, Lei P and Shen G, https://doi.org/10.14202/vetworld.2022.2816-2821
2012. Performance evaluation of the Maxwell 16 system for Shah M, Bharadwaj MSK, Gupta A, Kumar R and Kumar S, 2019.
extraction of influenza virus RNA from diverse samples. PLoS Chicken viperin inhibits Newcastle disease virus infection in
One, 7(10): e48094. vitro: a possible interaction with the viral matrix protein.
https://doi.org/10.1371/journal.pone.0048094 Cytokine, 120: 28-40.
Liu L, Benyeda Z, Zohari S, Yacoub A, Isaksson M, Leijon M and Belák https://doi.org/10.1016/j.cyto.2019.04.007
S, 2016. Assessment of preparation of samples under the field Shanmuganathan L, Anggoro D and Wibowo MH, 2017. Newcastle
conditions and a portable real‐time RT‐PCR assay for the rapid disease virus detection from chicken organ samples using
on‐site detection of Newcastle disease virus. Transboundary reverse transcriptase polymerase chain reaction. Jurnal Sain
and Emerging Diseases, 63(2): e245-e250. Veteriner, 35: 127-135. https://doi.org/10.22146/jsv.29300
https://doi.org/10.1111/tbed.12261 Shofa M, Wibawan IWT, Zarkasie K and Setiyaningsih S, 2018.
Liu XF, Wan HQ, Ni XX, Wu YT and Liu WB, 2003. Pathotypical and Molecular analysis of Newcastle disease virus isolated from a
genotypical characterization of strains of Newcastle disease vaccinated layer farm in Indonesia. IOP Conference Series:
virus isolated from outbreaks in chicken and goose flocks in Earth and Environmental Science, 197: 012044.
some regions of China during 1985–2001. Archives of Virology, https://doi.org/10.1088/1755-1315/197/1/012044
148(7): 1387-1403. https://doi.org/10.1007/s00705-003-0014- Singh K, Jindal N, Gupta SL, Gupta AK and Mittal D, 2005. Detection
z of Newcastle disease virus genome from the field outbreaks in
Maes P, Amarasinghe GK, Ayllon MA, Basler CF, Bavari S, Blasdell KR poultry by reverse transcription-polymerase chain reaction.
and Kuhn JH, 2019. Taxonomy of the order Mononegavirales, International Journal of Poultry Science, 4(7): 472-475.
second update 2018. Archives of Virology, 164(4): 1233-1244. https://doi.org/10.3923/ijps.2005.472.475
https://doi.org/10.1007/s00705-018-04126-4 Smietanka K, Olszewska M, Domanska-Blicharz K, Bocian L and Minta
Mayers J, Mansfield KL and Brown IH, 2017. The role of vaccination Z 2014. Experimental infection of different species of birds with
in risk mitigation and control of Newcastle disease in poultry. pigeon paramyxovirus type 1 Virus— Evaluation of clinical
Vaccine, 35(44): 5974-5980. outcomes, viral shedding, and distribution in tissues. Avian
https://doi.org/10.1016/j.vaccine.2017.09.008 Diseases, 58(4): 523-530. https://doi.org/10.1637/10769-
Mehmood A, Rasool MH, Anjum AA, Zahoor MA and Shafique M, 2019. 011514-reg.1
Pathotyping and Genetic characterization of a highly virulent Souf S, 2016. Recent advances in diagnostic testing for viral
Newcastle disease virus strain isolated from recent outbreak in infections. Bioscience Horizons: The International Journal of

14
Biswas et al., 2024 Journal of Bioscience and Environment Research 1(1): 8-15

Student Research, 9: hzw010.

https://doi.org/10.1093/biohorizons/hzw010
Suarez DL, Miller PJ, Koch G, Mundt E and Rautenschlein S, 2020.
Newcastle disease, other avian paramyxoviruses, and avian
metapneumovirus infections. In: Swayne DE, Boulianne M,
Logue CM, McDougald LR, Nair V, Suarez DL, de Wit S, Grimes
T, Johnson D, Kromm M, Prajitno TY, Rubinoff I and Zavala G
(Eds.), Diseases of Poultry (pp. 109-166). John Wiley & Sons,
Inc. https://doi.org/10.1002/9781119371199.ch3
Susta L, Miller PJ, Afonso CL and Brown CC, 2011. Clinicopathological
characterization in poultry of three strains of Newcastle disease
virus isolated from recent outbreaks. Veterinary Pathology,
48(2): 349-60. https://doi.org/10.1177/0300985810375806
Syamsiah Aini S, Leow BL, Faizul Fikri MY, Redzwan MS and Faizah
HMS, 2022. Identification of Newcastle disease virus sub-
genotype VII 1.1 isolated from chickens in Sabah, Malaysia.
Tropical Biomedicine, 39(4): 579-586.
https://doi.org/10.47665/tb.39.4.015
Vanmechelen B, Meurs S, Horemans M, Loosen A, Joly Maes T,
Laenen L and Maes P, 2022. The characterization of multiple
novel paramyxoviruses highlights the diverse nature of the
subfamily Orthoparamyxovirinae. Virus Evolution, 8(2):
veac061. https://doi.org/10.1093/ve/veac061
Wajid A, Basharat A, Khan TA, Wasim M and Rehmani SF, 2017.
Complete genome sequence of a velogenic Newcastle disease
virus strain isolated from a clinically healthy exotic parakeet
(Melopsittacus undulatus) in Pakistan. Genome
Announcements, 5(6): 01581-16.
https://doi.org/10.1128/genomea.01581-16
Wise MG, Suarez DL, Seal BS, Pedersen JC, Senne DA, King DJ and
Spackman E, 2004. Development of a real-time reverse-
transcription PCR for detection of Newcastle disease virus RNA
in clinical samples. Journal of Clinical Microbiology, 42: 329-338.
https://doi.org/10.1128/jcm.42.1.329-338.2004
Wiseman A, Berman EM and Klement E, 2018. Risk factors for
Newcastle disease in broiler farms in Israel. Preventive
Veterinary Medicine, 149: 92–97.
https://doi.org/10.1016/j.prevetmed.2017.11.009
Yusoff K and Tan WS, 2001. Newcastle disease virus: macromolecules
and opportunities. Avian Pathology, 30(5): 439-455.
https://doi.org/10.1080/03079450120078626

Publisher's note
Genesis Publishing Consortium Limited pledges to maintain a
neutral stance on jurisdictional claims shown in published maps
and institutional affiliations.

15