1

NEET 2024 Solved Paper

This sample is taken from the book “19 Previous Years NTA
NEET (UG) Year-wise Solved Papers (2024 - 2006) with 8
Reheld Papers & Value Added Notes 6th Edition,”

ISBN - 978-9362254108
 NEET-2024
Solved Paper

Time : 3 hrs, 20 Min. MM : 720

PHYSICS
Section-A

1. In a vernier callipers, (N + 1) divisions of vernier scale 5. In a uniform magnetic field of 0.049 T, a magnetic needle
coincide with N divisions of main scale. If 1 MSD performs 20 complete oscillations in 5 seconds as shown.
represents 0.1 mm, the vernier constant (in cm) is: The moment of inertia of the needle is 9.8 × 10–6 kg m2.
1 If the magnitude of magnetic moment of the needle is
(a)
10N x × 10–5 Am2, then the value of ‘x’ is :
1
(b) N
100 N + 1)
(
B
(c) 100 N S
(d) 10 (N + 1)
2. If the monochromatic source in Young’s double slit (a) 5π2 (b) 128π2
experiment is replaced by white light, then (c) 50π 2 (d) 1280π2
(a) Interference pattern will disappear. 6. A wire of length ‘l’ and resistance 100 Ω is divided into
(b) There will be a central dark fringe surrounded by a 10 equal parts. The first 5 parts are connected in series
few coloured fringes. while the next 5 parts are connected in parallel. The
(c) There will be a central bright white fringe surrounded two combinations are again connected in series. The
by a few coloured fringes. resistance of this final combination is:
(d) All bright fringes will be of equal width. (a) 26 Ω (b) 52 Ω
3. A logic circuit provides the output Y as per the following (c) 55 Ω (d) 60 Ω
truth table : 7. A horizontal force 10 N is applied to a block A as shown
A B Y in figure. The mass of blocks A and B are 2 kg and 3 kg
0 0 1 respectively. The blocks slide over a frictionless surface.
The force exerted by block A on block B is :
0 1 0
F = 10 N B
1 0 1 A 3 kg
1 1 0 2 kg

The expression for the output Y is :

(a) A. B + A (b) A. B + A (a) Zero (b) 4 N
(c) 6 N (d) 10 N
(c) B (d) B
8. A tightly wound 100 turns coil of radius 10 cm carries a
4. The terminal voltage of the battery, whose emf is 10 V current of 7A. The magnitude of the magnetic field at the
and internal resistance 1 Ω, when connected through an centre of the coil is (Take permeability of free space as 4π
external resistance of 4 Ω as shown in the figure is: × 10–7 SI units):
4 (a) 44 mT (b) 4.4 T
(c) 4.4 mT (d) 44 T
9. In an ideal transformer, the turns ratio is N P = 1 . The
1 NS 2
10 V ratio VS : VP is equal to (the symbols carry their usual
meaning) :
(a) 4 V (b) 6 V
(a) 1 : 2 (b) 2 : 1
(c) 8 V (d) 10 V
(c) 1 : 1 (d) 1 : 4
 2024-2 NEET Solved Paper

 1  (a) Zero
10. The graph which shows the variation of  2  and its (b) 30 J
λ 
(c) –90 J
kinetic energy, E is (where λ is de Broglie wavelength of (d) –60 J
a free particle): 15. A thin spherical shell is charged by some source. The
(a) (b) potential difference between the two points C and P (in V)
1 1 shown in the figure is:
2 2
(Take 1 = 9 × 109 SI units)
O E O E 4πε 0
(c) (d)
1 1
2 2 P
C
O E O E
11. Given below are two statements: R = 3 cm
Statement I: Atoms are electrically neutral as they
contain equal number of positive and negative charges.
Statement II: Atoms of each element are stable and emit q = 1 µC
their characteristic spectrum. (a) 3 × 105 (b) 1 × 105
In the light of the above statements, choose the most (c) 0.5 × 10 5 (d) Zero
appropriate answer from the options given below. 16. The moment of inertia of a thin rod about an axis passing
(a) Both Statement I and Statement II are correct through its mid point and perpendicular to the rod is
(b) Both Statement I and Statement II are incorrect 2400 g cm2. The length of the 400 g rod is nearly:
(c) Statement I is correct but Statement II is incorrect (a) 8.5 cm (b) 17.5 cm
(d) Statement I is incorrect but Statement II is correct
(c) 20.7 cm (d) 72.0 cm
12. A bob is whirled in a horizontal plane by means of a string
with an initial speed of ω rpm. The tension in the string 17. A particle moving with uniform speed in a circular path
is T. If speed becomes 2ω while keeping the same radius, maintains:
the tension in the string becomes: (a) Constant velocity
(a) T (b) 4T (b) Constant acceleration
T (c) Constant velocity but varying acceleration
(c) (d) 2T
4 (d) Varying velocity and varying acceleration
18. If c is the velocity of light in free space, the correct
13. Consider the following statements A and B and identify
the correct answer: statements about photon among the following are:
I A. The energy of a photon is E = hν.
B. The velocity of a photon is c.
(II) (I)
hv
(III) (IV)
V C. The momentum of a photon, p = .
c
D. In a photon-electron collision, both total energy and
A. For a solar-cell, the I-V characteristics lies in the IV total momentum are conserved.
quadrant of the given graph. E. Photon possesses positive charge.
B. In a reverse biased pn junction diode, the current Choose the correct answer from the options given below:
measured in (μA), is due to majority charge carriers. (a) A and B only
(a) A is correct but B is incorrect (b) A, B, C and D only
(b) A is incorrect but B is correct (c) A, C and D only
(c) Both A and B are correct (d) A, B, D and E only
(d) Both A and B are incorrect
19. At any instant of time t, the displacement of any particle
14. A thermodynamic system is taken through the cycle
is given by 2t – 1 (SI unit) under the influence of force of
abcda. The work done by the gas along the path bc is:
P 5N. The value of instantaneous power is (in SI unit):
(a) 10 (b) 5
d c (c) 7 (d) 6
300 kPa
20. A light ray enters through a right angled prism at point
P with the angle of incidence 30° as shown in figure.
100 kPa a b
It travels through the prism parallel to its base BC and
emerges along the face AC. The refractive index of the
100 cm3 400 cm3 prism is :
V
NEET Solved Paper 2024-3
A 26. Match List I with List II.
List I List II
P
(Spectral Lines of (Wavelengths (nm))
30° Hydrogen for
transitions from)
C A. n2 = 3 to n1 = 2 I. 410.2
B
B. n2 = 4 to n1 = 2 II. 434.1
(a) 5 (b) 5 C. n2 = 5 to n1 = 2 III. 656.3
4 2 D. n2 = 6 to n1 = 2 IV. 486.1
Choose the correct answer from the options given below:
(c) 3 (d) 3 (a) A-II, B-I, C-IV, D-III
4 2 (b) A-III, B-IV, C-II, D-I
21. In the following circuit, the equivalent capacitance (c) A-IV, B-III, C-I, D-II
between terminal A and terminal B is : (d) A-I, B-II, C-III, D-IV
27. An unpolarised light beam strikes a glass surface at
2µF 2µF
Brewster’s angle. Then
(a) The reflected light will be partially polarised.
A 2µF B (b) The refracted light will be completely polarised.
(c) Both the reflected and refracted light will be
completely polarised.
2µF 2µF (d) The reflected light will be completely polarised but
(a) 2 μF (b) 1 μF the refracted light will be partially polarised.
(c) 0.5 μF (d) 4 μF 28. Match List-I with List-II.
22. The quantities which have the same dimensions as those List-I List-II
of solid angle are : (Material) (Susceptibility (χ))
(a) strain and angle A. Diamagnetic I. χ = 0
(b) stress and angle B. Ferromagnetic II. 0 > χ ≥ –1
(c) strain and arc C. Paramagnetic III. χ >> 1
(d) angular speed and stress D. Non-magnetic IV. 0 < χ < ε (a small
23. The maximum elongation of a steel wire of 1 m positive number)
length if the elastic limit of steel and its Young’s Choose the correct answer from the options given below
modulus, respectively, are 8 × 108 N m–2 and (a) A-II, B-III, C-IV, D-I
2 × 1011 N m–2, is: (b) A-II, B-I, C-III, D-IV
(a) 4 mm (b) 0.4 mm (c) A-III, B-II, C-I, D-IV
(c) 40 mm (d) 8 mm (d) A-IV, B-III, C-II, D-I
24. 29. Two bodies A and B of same mass undergo completely
v inelastic one dimensional collision. The body A moves
N S with velocity v1 while body B is at rest before collision.
The velocity of the system after collision is v2. The ratio
A B C D v1 : v2 is
Solenoid-1 Solenoid-2 (a) 1 : 2 (b) 2 : 1
In the above diagram, a strong bar magnet is moving (c) 4 : 1 (d) 1 : 4
towards solenoid-2 from solenoid-1. The direction of 30. 290 X  α e+ β− e−
82 → Y → Z → P → Q
induced current in solenoid-1 and that in solenoid-2,
respectively, are through the directions: In the nuclear emission stated above, the mass number
(a) AB and DC (b) BA and CD and atomic number of the product Q respectively, are
(c) AB and CD (d) BA and DC (a) 280, 81 (b) 286, 80
1 (c) 288, 82 (d) 286, 81
25. The mass of a planet is th that of the earth  π 
10 31. If = x 5sin  πt +  m represents the motion
 3
and its diameter is half that of the earth. The acceleration
due to gravity on that planet is: of a particle executing simple harmonic motion, the
(a) 19.6 m s–2 amplitude and time period of motion, respectively, are
(b) 9.8 m s–2 (a) 5 cm, 2 s (b) 5 m, 2 s
(c) 4.9 m s–2 (c) 5 cm, 1 s (d) 5 m, 1 s
(d) 3.92 m s–2
 2024-4 NEET Solved Paper
32. A thin flat circular disc of radius 4.5 cm is placed gently axial point, situated at 2 m from the centre of the dipole.
over the surface of water. If surface tension of water is In the light of the above statements, choose the correct
0.07 Nm–1, then the excess force required to take it away answer from the options given below:
from the surface is (a) Both A and R are true and R is the correct explanation
(a) 19.8 mN (b) 198 N of A.
(c) 1.98 mN (d) 99 N (b) Both A and R are true and R is NOT the correct
33. The output (Y) of the given logic gate is similar to the explanation of A.
output of an/a (c) A is true but R is false.
A
(d) A is false but R is true.
Y 35. A wheel of a bullock cart is rolling on a level road as shown in
the figure below. If its linear speed is ν in the direction shown,
B which one of the following options is correct (P and Q are any
highest and lowest points on the wheel, respectively)?
P
(a) NAND gate (b) NOR gate
(c) OR gate (d) AND gate
34. Given below are two statements: one is labelled as v
Assertion A and the other is labelled as Reason R.
Assertion A: The potential (V) at any axial point, at 2
m distance (r) from the centre of the dipole of dipole

moment vector P of magnitude, 4 × 10–6 C m, is ± 9 × Q

103 V. (a) Point P moves slower than point Q

(b) Point P moves faster than point Q
(Take 1 = 9 × 109 SI units)
4πε 0 (c) Both the points P and Q move with equal speed
(d) Point P has zero speed
Reason R: V = ± 2P , where r is the distance of any
4πε 0 r 2

Section-B
36. A parallel plate capacitor is charged by connecting it to a (a) 1 : 1 (b) 2 : 9
battery through a resistor. If I is the current in the circuit, (c) 1 : 2 (d) 2 : 3
then in the gap between the plates: 40. The following graph represents the T-V curves of an
(a) There is no current ideal gas (where T is the temperature and V the volume)
(b) Displacement current of magnitude equal to I flows at three pressures P1, P2 and P3 compared with those of
in the same direction as I Charles’s law represented as dotted lines.
(c) Displacement current of magnitude equal to I flows P1
in a direction opposite to that of I P2
(d) Displacement current of magnitude greater than I flows
but can be in any direction P3
37. The property which is not of an electromagnetic wave T
travelling in free space is that:
(a) They are transverse in nature
(b) The energy density in electric field is equal to energy 0 V
density magnetic field Then the correct relation is:
1 (a) P3 > P2 > P1 (b) P1 > P3 > P2
(c) They travel with a speed equal to
µ0 ε0 (c) P2 > P1 > P3 (d) P1 > P2 > P3
41. The velocity (v) – time (t) plot of the motion of a body is
(d) They originate from charges moving with uniform
shown below:
speed
38. A small telescope has an objective of focal length 140 cm
v(ms –1)

and an eye piece of focal length 5.0 cm. The magnifying

power of telescope for viewing a distant object is:
(a) 34 (b) 28
(c) 17 (d) 32 0
t(s)
39. Two heaters A and B have power rating of 1 kW and 2
The acceleration (a) – time (t) graph that best suits this
kW, respectively. Those two are first connected in series
motion is :
and then in parallel to a fixed power source. The ratio of
power outputs for these two cases is:
NEET Solved Paper 2024-5
(a) 43. If the mass of the bob in a simple pendulum is increased to
a(ms–2)
thrice its original mass and its length is made half its original
length, then the new time period of oscillation is x times its
0 2
t(s)
original time period. Then the value of x is:
(a) 3 (b) 2
(b)
a(ms–2)

(c) 2 3 (d) 4
44. The minimum energy required to launch a satellite of
0
t(s) mass m from the surface of earth of mass M and radius R
in a circular orbit at an altitude of 2R from the surface of
(c) the earth is:
a(ms–2)

(a) 5GmM (b) 2GmM

6R 3R
0 GmM
t(s) GmM
(c) (d)
2R 3R
(d) 45. A sheet is placed on a horizontal surface in front of a
a(ms–2)

strong magnetic pole. A force is needed to:

A. hold the sheet there if it is magnetic.
0 B. hold the sheet there if it is non-magnetic.
t(s) C. move the sheet away from the pole with uniform
velocity if it is conducting.
42. Choose the correct circuit which can achieve the bridge D. move the sheet away from the pole with uniform
balance. velocity if it is both, non-conducting and non-polar.
(a) Choose the correct statement(s) from the options given below:
10


(a) B and D only (b) A and C only

10

G (c) A, C and D only (d) C only

D
15 46. A 10 μF capacitor is connected to a 210 V, 50 Hz source
 5 as shown in figure. The peak current in the circuit is
nearly (π = 3.14):
E K
(b)
10


C = 10 µF

10

G
D
15

5
210V
E K (a) 0.58 A (b) 0.93 A
(c) (c) 1.20 A (d) 0.35 A
10

A metallic bar of Young’s modulus, 0.5 × 1011 Nm–2 and



47.

10

G coefficient of linear thermal expansion 10–5 °C–1, length

15
D
1 m and area of cross-section 10–3 m2 is heated from 0°C

to 100°C without expansion or bending. The compressive
5
force developed in it is :
E K (a) 5 × 103 N (b) 50 × 103 N
(d) (c) 100 × 10 N 3 (d) 2 × 103 N
10


48. An iron bar of length L has magnetic moment M. It is bent


10

G at the middle of its length such that the two arms make an
D
15 angle 60° with each other. The magnetic moment of this

5 new magnet is :
(a) M (b) M
E K 2
M
(c) 2M (d)
3
 2024-6 NEET Solved Paper
49. If the plates of a parallel plate capacitor connected to a (a) A, B and E only (b) A, C and E only
battery are moved close to each other, then (c) B, D and E only (d) A, B and C only
A. the charge stored in it, increases. 50. A force defined by F = αt2 + βt acts on a particle at a given
B. the energy stored in it, decreases. time t. The factor which is dimensionless, if α and β are
C. its capacitance increases. constants, is:
D. the ratio of charge to its potential remains the same. (a) βt (b) αt
E. the product of charge and voltage increases. α β
Choose the most appropriate answer from the options (c) abt (d) αβ
given below: t

CHEMISTRY
Section-A
51. Match List I with List II. NO2
List I List II
(c)
(Molecule) (Number and types
of bond/s between
two carbon atoms) OH
A. ethane I. one s-bond and (d) HF
two p-bonds 55. Given below are two statements:
B. ethene II. two p-bonds Statement I : The boiling point of three isomeric pentanes
C. carbon molecule, III. one s-bonds follows the order n-pentane > isopentane > neopentane
C2 Statement II : When branching increases, the molecule
D. ethyne IV. one s-bond and attains a shape of sphere. This results in smaller surface
one p-bond area for contact, due to which the intermolecular forces
Choose the correct answer from the options given below between the spherical molecules are weak, thereby
(a) A-I, B-IV, C-II, D-III lowering the boiling point.
(b) A-IV, B-III, C-II, D-I In the light of the above statements, choose the most
appropriate answer from the options given below:
(c) A-III, B-IV, C-II, D-I
(a) Both Statement I and Statement II are correct.
(d) A-III, B-IV, C-I, D-II
(b) Both Statement I and Statement II are incorrect.
52. The Henry’s law constant (KH) values of three gases
(c) Statement I is correct but Statement II is incorrect.
(A, B, C) in water are 145, 2 × 10–5 and 35 kbar, respectively.
(d) Statement I is incorrect but Statement II is correct.
The solubility of these gases in water follow the order:
56. The compound that will undergo SN1 reaction with the
(a) B > A > C (b) B > C > A
fastest rate is
(c) A > C > B (d) A > B > C
53. Given below are two statements:
(a) Br
Statement I: The boiling point of hydrides of Group 16
elements follow the order
H2O > H2Te > H2Se > H2S. (b) Br
Statement II: On the basis of molecular mass, H2O
is expected to have lower boiling point than the other Br
members of the group but due to the presence of extensive
(c)
H-bonding in H2O, it has higher boiling point.
In the light of the above statements, choose the correct CH3
answer from the options given below:
(a) Both Statement I and Statement II are true
Br
(b) Both Statement I and Statement II are false (d)
(c) Statement I is true but Statement II is false
(d) Statement I is false but Statement II is true 57. Which one of the following alcohols reacts instantaneously
54. Intramolecular hydrogen bonding is present in with Lucas reagent?
NO2
(a) CH3 – CH2 – CH2 – CH2OH
(a) (b) CH3 − CH 2 − CH − OH
OH |
NO2 CH3
(b)
OH
NEET Solved Paper 2024-7
(c) CH3 − CH − CH 2 OH 63. Arrange the following elements in increasing order of
| electronegativity:
CH3 N, O, F, C, Si
CH3 Choose the correct answer from the options given below:
| (a) Si < C < N < O < F
(d) CH3 − C − OH (b) Si < C < O < N < F
| (c) O < F < N < C < Si
CH3 (d) F < O < N < C < Si
58. 1 gram of sodium hydroxide was treated with 25 mL of 64. Match List I with List II.
0.75 M HCl solution, the mass of sodium hydroxide left List I List II
unreacted is equal to (Conversion) (Number of Faraday
(a) 750 mg required)
(b) 250 mg A. 1 mol of H2O I. 3F
(c) Zero mg to O2
(d) 200 mg B. 1 mol of II. 2F
59. Arrange the following elements in increasing order of −
MnO 4 to Mn2+
first ionization enthalpy: C. 1.5 mol of Ca III. 1F
Li, Be, B, C, N from molten
Chose the correct answer from the options given below:
CaCl2
(a) Li < Be < B < C < N
D. 1 mol of FeO to IV. 5F
(b) Li < B < Be < C < N
Fe2O3
(c) Li < Be < C < B < N
Choose the correct answer from the options given below:
(d) Li < Be < N < B < C
60. The most stable carbocation among the following is : (a) A-II, B-IV, C-I, D-III
CH3 (b) A-III, B-IV, C-I, D-II
(c) A-II, B-III, C-I, D-IV
(a) H3C CH (d) A-III, B-IV, C-II, D-I
 CH3
65. Match List I with List II.
CH3
List I List II
 (Complex) (Type of isomerism)
C CH
(b) CH3 H CH2 A. [Co(NH3)5(NO2)] Cl2 I. Solvate isomerism
CH3 B. [Co(NH3)5(SO4)] Br II. Linkage isomerism
 C. [Co(NH3)6] [Cr(CN)6] III. Ionization isomerism
(c) CH2 D. [Co(H2O)6]Cl3 IV. Coordination isomerism
Choose the correct answer from the options given below:
CH3
(a) A-II, B-III, C-IV, D-I
 (b) A-I, B-III, C-IV, D-II
(d) (c) A-I, B-IV, C-III, D-II
(d) A-II, B-IV, C-III, D-I
61. Activation energy of any chemical reaction can be 66. Match List I with List II.
calculated if one knows the value of List I List II
(a) rate constant at standard temperature (Compound) (Shape/ geometry)
(b) probability of collision A. NH3 I. Trigonal Pyramidal
(c) orientation of reactant molecules during collision B. BrF5 II. Square Planar
(d) rate constant at two different temperatures C. XeF4 III. Octahedral
62. Given below are two statements: D. SF6 IV. Square Pyramidal
Statement I : Aniline does not undergo Friedel-Crafts Choose the correct answer from the options given below:
alkylation reaction. (a) A-I, B-IV, C-II, D-III
Statement II : Aniline cannot be prepared through
(b) A-II, B-IV, C-III, D-I
Gabriel synthesis .
(c) A-III, B-IV, C-I, D-II
In the light of the above statements, choose the correct
answer from the options given below: (d) A-II, B-III, C-IV, D-I
(a) Both statement I and Statement II are true 67. Which plot of ln k vs 1 is consistent with Arrhenius
(b) Both Statement I and Statement II are false T
(c) Statement I is correct but Statement II is false equation?
(d) Statement I is incorrect but Statement II is true
 2024-8 NEET Solved Paper
72. ‘Spin only’ magnetic moment is same for which of the
following ions?
ln k A. Ti3+ B. Cr2+
(a) C. Mn2+ D. Fe2+
1 E. Sc3+
T Choose the most appropriate answer from the options
given below.
(a) B and D only (b) A and E only
ln k

(c) B and C only (d) A and D only

(b) 73. The highest number of helium atoms is in
1
T (a) 4 mol of helium
(b) 4 u of helium
(c) 4 g of helium
(c) (d) 2.271098 L of helium at STP
ln k

74. Among Group 16 elements, which one does NOT show

1 –2 oxidation state?
T (a) O (b) Se
(c) Te (d) Po
75. The E° value for the Mn3+/Mn2+ couple is more positive
(d) than that of Cr3+/Cr2+ or Fe3+/Fe2+ due to change of
ln k

1 (a) d5 to d4 configuration
T (b) d5 to d2 configuration
68. The energy of an electron in the ground state (n = 1) for (c) d4 to d5 configuration
He+ ion is –x J, then that for an electron in n = 2 state for (d) d3 to d5 configuration
Be3+ ion in J is 76. The reagents with which glucose does NOT react to give the
corresponding tests/products are
(a) –x (b) − x A. Tollen’s reagent
9 B. Schiff’s reagent
(c) –4x (d) − x 4 C. HCN
9 D. NH2OH
69. In which of the following processes entropy increases? E. NaHSO3
A. A liquid evaporates to vapour. Choose the correct options from the given below:
B. Temperature of a crystalline solid lowered from 130 (a) B and C (b) A and D
K to 0 K. (c) B and E (d) E and D
C. 2NaHCO3(s) → Na2CO3(s) + CO2(g) + H2O(g) 77. Identify the correct reagents that would bring about the
D. Cl2(g) → 2Cl(g) following transformation.
Choose the correct answer from the options given below:
(a) A and C (b) A, B and D CH2 – CH = CH2 
(c) A, C and D (d) C and D
CH2 – CH2 – CHO
70. Which reaction is NOT a redox reaction?
(a) Zn + CuSO4 → ZnSO4 + Cu
(a) (i) H2O/H+ (b) (i) BH3
(b) 2KClO3 + I2 → 2KIO3 + Cl2 
(c) H2 + Cl2 → 2HCl (ii) CrO3 (ii) H 2 O 2 / O H
(d) BaCl2 + Na2SO4 → BaSO4 + 2NaCl (iii) PCC
71. Match List I with List II (c) (i) BH3 (d) (i) H2O/H+
List I List II 
(Quantum Number) (Information provided) (ii) H 2 O 2 / O H (ii) PCC
A. ml I. Shape of orbital
(iii) alk.KMnO4
B. ms II. Size of orbital
C. l III. Orientation of orbital (iv) H3O⊕
D. n IV. Orientation of spin of 78. In which of the following equilibria, Kp and Kc are NOT
electron equal?
Choose the correct answer from the options given below: (a) PCl5(g) PCl3(g) + Cl2(g)
(a) A-I, B-III, C-II, D-IV (b) H2(g) + I2(g)  2HI(g)
(b) A-III, B-IV, C-I, D-II (c) CO(g) + H2O(g)  CO2(g) + H2(g)
(c) A-III, B-IV, C-II, D-I
(d) 2BrCl(g)  Br2(g) + Cl2(g)
(d) A-II, B-I, C-IV, D-III
NEET Solved Paper 2024-9
79. A compound with a molecular formula of C6H14 has two (a) Crystallization (b) Sublimation
tertiary carbons. Its IUPAC name is: (c) Distillation (d) Chromatography
(a) n-hexane 84. Match List I with List II.
(b) 2-methylpentane List I
(c) 2,3-dimethylbutane (Reaction)
(d) 2,2-dimethylbutane
A.  2 O
80. Fehling’s solution ‘A’ is
(a) aqueous copper sulphate O
(b) alkaline copper sulphate
(c) alkaline solution of sodium potassium tartrate
(Rochelle’s salt) B. 
(d) aqueous sodium citrate
81. Match List I with List II. OH O
List-I List-II C. 
(Process) (Conditions)
A. Isothermal process I. No heat exchange CH2CH3 COOK
B. Isochoric process II. Carried out at constant D. 
temperature
C. Isobaric process III. Carried out at constant List II
volume (Reagents/Condition)
D. Adiabatic process IV. Carried out at constant O
pressure
Choose the correct answer from the options given below: Cl/Anhyd, AlCl3
I.
(a) A-IV, B-III, C-II, D-I
(b) A-IV, B-II, C-III, D-I II. CrO3
(c) A-I, B-II, C-III, D-IV III. KMnO4/KOH, D
(d) A-II, B-III, C-IV, D-I IV. (i) O3
82. Given below are two statements : (ii) Zn-H2O
Statement I: Both [Co(NH3)6]3+ and [CoF6]3– complexes Choose the correct answer from the options given below:
are octahedral but differ in their magnetic behaviour. (a) A-IV, B-I, C-III, D-II
Statement II: [Co(NH3)6]3+ is diamagnetic whereas (b) A-III, B-I, C-II, D-IV
[CoF6]3– is paramagnetic. (c) A-IV, B-I, C-II, D-III
In the light of the above statements, choose the correct (d) A-I, B-IV, C-II, D-III
answer from the options given below: 85. For the reaction 2A  B + C, KC = 4 × 10–3. At a given
(a) Both Statement I and Statement II are true time, the composition of reaction mixture is:
(b) Both Statement I and Statement II are false [A] = [B] = [C] = 2 × 10–3 M.
(c) Statement I is true but Statement II is false Then, which of the following is correct?
(d) Statement I is false but Statement II is true (a) Reaction is at equilibrium.
83. On heating, some solid substances change from solid (b) Reaction has a tendency to go in forward direction.
to vapour state without passing through liquid state. (c) Reaction has a tendency to go in backward direction.
The technique used for the purification of such solid (d) Reaction has gone to completion in forward
substances based on the above principle is known as direction.

Section-B
86. The pair of lanthanoid ions which are diamagnetic is (a) Both Statement I and Statement II are true
(a) Ce4+ and Yb2+ (b) Ce3+ and Eu2+ (b) Both Statement I and Statement II are false
3+
(c) Gd and Eu 3+ (d) Pm3+ and Sm3+ (c) Statement I is true but Statement II is false
87. Given below are two statements : (d) Statement I is false but Statement II is true
Statement I : [Co(NH3)6]3+ is a homoleptic complex 88. Mass in grams of copper deposited by passing 9.6487 A
whereas [Co(NH3)4Cl2]+ is a heteroleptic complex. current through a voltmeter containing copper sulphate
Statement II : Complex [Co(NH3)6]3+ has only one kind solution for 100 seconds is (Given : Molar mass of Cu :
of ligands but [Co(NH3)4Cl2]+ has more than one kind of 63 g mol–1, 1 F = 96487 C)
ligands. (a) 3.15 g (b) 0.315 g
In the light of the above statements, choose the correct (c) 31.5 g (d) 0.0315 g
answer from the options given below.
 2024-10 NEET Solved Paper
89. For the given reaction: OH O
+
KMnO4/H
C = CH  'P' H3C Br H3C
(major (d) A = ;B=
H product)

‘P’ is 94. The plot of osmotic pressure (p) vs concentration (mol

L–1) for a solution gives a straight line with slope 25.73 L
(a) CHO bar mol–1. The temperature at which the osmotic pressure
measurement is done is
(Use R = 0.083 L bar mol–1 K–1)
(b) COOH (a) 37°C (b) 310°C
(c) 25.73°C (d) 12.05°C
OH OH
95. Identify the correct answer.
(c) CH – CH (a) Three resonance structures can be drawn for ozone
(b) BF3 has non-zero dipole moment
O O (c) Dipole moment of NF3 is greater than that of NH3
(d) Three canonical forms can be drawn for CO32 − ion
(d) C–C
96. Identify the major product C formed in the following
reaction sequence:
90. The products A and B obtained in the following reactions, NaCN
respectively, are CH3 − CH 2 − CH 2 − I 
→A
3ROH + PCl3 → RCl + A OH − NaOH
ROH + PCl5 → RCl + HCl + B 
→ B 
→ C
Partial hydrolysis Br2 ( major )
(a) POCl3 and H3PO3 (b) POCl3 and H3PO4
(c) H3PO4 and POCl3 (d) H3PO3 and POCl3 (a) propylamine
91. The rate of a reaction quadruples when temperature changes (b) butylamine
from 27°C to 57°C. Calculate the energy of activation. (c) butanamide
Given R = 8.314 J K–1 mol–1, log4 = 0.6021 (d) a–bromobutanoic acid
(a) 38.04 kJ/mol (b) 380.4 kJ/mol 97. Given below are certain cations. Using inorganic
(c) 3.80 kJ/mol (d) 3804 kJ/mol qualitative analysis, arrange them in increasing group
92. During the preparation of Mohr’s salt solution (Ferrous number from 0 to VI.
ammonium sulphate), which of the following acid is A. Al3+ B. Cu2+
2+ D. Co2+
added to prevent hydrolysis of Fe2+ ion? C. Ba
E. Mg 2+
(a) dilute hydrochloric acid
(b) concentrated sulphuric acid Choose the correct answer from the options given below.
(c) dilute nitric acid (a) B, A, D, C, E (b) B, C, A, D, E
(d) dilute sulphuric acid (c) E, C, D, B, A (d) E, A, B, C, D
93. Major products A and B formed in the following reaction 98. The work done during reversible isothermal expansion
sequence, are of one mole of hydrogen gas at 25°C from pressure of 20
OH atmosphere to 10 atmosphere is
H3C (Given R = 2.0 cal K–1 mol–1)
PBr
3 A  B
alc. KOH (a) 0 calorie (b) –413.14 calories
 (c) 413.14 calories (d) 100 calories
(major) (major)
Br 99. Consider the following reaction in a sealed vessel at
H3C equilibrium with concentrations of N2 = 3.0 × 10–3 M,
H3C
O2 = 4.2 × 10–3 M and NO = 2.8 × 10–3 M.
(a) A = ;B= 2NO(g)  N2(g) + O2(g)
If 0.1 mol L–1 of NO(g) is taken in a closed vessel, what
Br
will be degree of dissociation (a) of NO(g) at equilibrium?
H3C H3C
(a) 0.00889 (b) 0.0889
(b) A = ;B= (c) 0.8889 (d) 0.717
100. A compound X contains 32% of A, 20% of B and remaining
OH OH percentage of C. Then, the empirical formula of X is :
Br H3C (Given atomic masses of A = 64; B = 40; C = 32 u)
H3C
(a) A2BC2 (b) ABC3
(c) A = ;B= (c) AB2C2 (d) ABC4
NEET Solved Paper 2024-11

BOTANY
Section-A
101. Lecithin, a small molecular weight organic compound found in 109. Which of the following is an example of actinomorphic
living tissues, is an example of: flower?
(a) Amino acids (b) Phospholipids (a) Datura (b) Cassia
(c) Glycerides (d) Carbohydrates (c) Pisum (d) Sesbania
102. How many molecules of ATP and NADPH are required 110. The type of conservation in which the threatened species
for every molecule of CO2 fixed in the Calvin cycle? are taken out from their natural habitat and placed in
(a) 2 molecules of ATP and 3 molecules of NADPH special setting where they can be protected and given
(b) 2 molecules of ATP and 2 molecules of NADPH special care is called;
(c) 3 molecules of ATP and 3 molecules of NADPH (a) in-situ conservation
(d) 3 molecules of ATP and 2 molecules of NADPH (b) Biodiversity conservation
103. Hind II always cuts DNA molecules at a particular point (c) Semi-conservative method
called recognition sequence and it consists of: (d) Sustainable development
(a) 8 bp (b) 6 bp 111.Identify the set of correct statement:
(c) 4 bp (d) 10 bp A. The flowers of Vallisneria are colourful and produce
104. In the given figure, which component has thin outer walls nectar.
and highly thickened inner walls? B. The flowers of waterlily are not pollinated by water.
C. In most of water-pollinated species, the pollen grains
are protected from wetting.
D. Pollen grains of some hydrophytes are long and
ribbon like.
E. In some hydrophytes, the pollen grains are carried
(a) C (b) D passively inside water.
(c) A (d) B Choose the correct answer from the options given below.
105. The cofactor of the enzyme carboxypeptidase is: (a) C, D and E only
(a) Zinc (b) Niacin (b) A, B, C and D only
(c) Flavin (d) Haem (c) A, C, D and E only
106. The capacity to generate a whole plant from any cell of (d) B, C, D and E only
the plant is called: 112. The lactose present in the growth medium of bacteria is
(a) Totipotency (b) Micropropagation transported to the cell by the action of
(c) Differentiation (d) Somatic hybridization (a) Beta-galactosidase (b) Acetylase
107. Match List I with List II (c) Permease (d) Polymerase
List-I List-II 113. Match List I with List II
A. Rhizopus I. Mushroom List I List II
B. Ustilago II. Smut fungus A. Clostridium I. Ethanol
C. Puccinia III. Bread mould butylicum
D. Agaricus IV. Rust fungus B. Saccharomyces II. Streptokinase
Choose the correct answer from the options given below: cerevisiae
(a) A-III, B-II, C-IV, D-I C. Trichoderma III. Butyric acid
(b) A-I, B-III, C-II, D-IV polysporum
(c) A-III, B-II, C-I, D-IV D. Streptococcus sp. IV. Cyclosporin-A
(d) A-IV, B-III, C-II, D-I Choose the correct answer from the options given below:
108. Given below are two statements: (a) A-III, B-I, C-II, D-IV
Statement I : Bt toxins are insect group specific and (b) A-II, B-IV, C-III, D-I
coded by a gene cry IAc. (c) A-III, B-I, C-IV, D-II
Statement II : Bt toxin exists as inactive protoxin in B. (d) A-IV, B-I, C-III, D-II
thuringiensis. However, after ingestion by the insect the 114. The equation of Verhulst-Pearl logistic growth is
inactive protoxin gets converted into active form due to dN K − N
acidic pH of the insect gut. = rN  .
dt  K 
In the light of the above statements, choose the correct
answer from the options given below: From this equation, K indicates:
(a) Both Statement I and Statement II are true (a) Intrinsic rate of natural increase
(b) Both Statement I and Statement II are false (b) Biotic potential
(c) Statement I is true but Statement II is false (c) Carrying capacity
(d) Statement I is false but Statement II is true (d) Population density
 2024-12 NEET Solved Paper
115. Auxin is used by gardeners to prepare weed-free lawns. (a) (a) Epigynous; (b) Hypogynous
But no damage is caused to grass as auxin (b) (a) Hypogynous; (b) Epigynous
(a) promotes apical dominance. (c) (a) Perigynous; (b) Epigynous
(b) promotes abscission of mature leaves only. (d) (a) Perigynous; (b) Perigynous
(c) does not affect mature monocotyledonous plants. 121. List of endangered species was released by-
(d) can help in cell division in grasses, to produce (a) GEAC (b) WWF
growth. (c) FOAM (d) IUCN
116. Identify the part of the seed from the given figure which is 122. What is the fate of a piece of DNA carrying only gene of
destined to form root when the seed germinates. interest which is transferred into an alien organism?
A. The piece of DNA would be able to multiply itself
independently in the progeny cells of the organism.
B. It may get integrated into the genome of the recipient.
C. It may multiply and be inherited along with the host
DNA.
D. The alien piece of DNA is not an integral part of
chromosome.
(a) A (b) B
E. It shows ability to replicate.
(c) C (d) D
Choose the correct answer from the options given below:
117. Given below are two statements:
(a) A and B only (b) D and E only
Statement I : Parenchyma is living but collenchyma is
(c) B and C only (d) A and E only
dead tissue.
123. Which one of the following can be explained on the basis
Statement II : Gymnosperms lack xylem vessels
of Mendel’s Law of Dominance?
but presence of xylem vessels is the characteristic of
A. Out of one pair of factors one is dominant and the
angiosperms.
other is recessive.
In the light of the above statements, choose the correct
B. Alleles do not show any expression and both the
answer from the options given below:
characters appear as such in F2 generation.
(a) Both Statement I and Statement II are true
C. Factors occur in pairs in normal diploid plants.
(b) Both Statement I and Statement II are false D. The discrete unit controlling a particular character is
(c) Statement I is true but Statement II is false called factor.
(d) Statement I is false but Statement II is true E. The expression of only one of the parental characters
118. These are regarded as major causes of biodiversity loss: is found in a monohybrid cross.
A. Over exploitation Choose the correct answer from the options given below:
B. Co-extinction (a) A, B and C only
C. Mutation (b) A, C, D and E only
D. Habitat loss and fragmentation (c) B, C and D only
E. Migration (d) A, B, C, D and E
Choose the correct option: 124. Inhibition of Succinic dehydrogenase enzyme by malonate
(a) A, C and D only (b) A, B, C and D only is a classical example of:
(c) A, B and E only (d) A, B and D only (a) Cofactor inhibition
119. Which one of the following is not a criterion for (b) Feedback inhibition
classification of fungi? (c) Competitive inhibition
(a) Morphology of mycelium (d) Enzyme activation
(b) Mode of nutrition 125. Formation of interfascicular cambium from fully
(c) Mode of spore formation developed parenchyma cells is an example for
(d) Fruiting body (a) Differentiation (b) Redifferentiation
120. Identify the type of flowers based on the position of calyx, (c) Dedifferentiation (d) Maturation
corolla and androecium with respect to the ovary from the 126. Spindle fibers attach to kinetochores of chromosomes
given figures (a) and (b) during
(a) Prophase (b) Metaphase
(c) Anaphase (d) Telophase
127. Tropical regions show greatest level of species richness
because
A. Tropical latitudes have remained relatively
undisturbed for millions of years, hence more time
was available for species diversification.
B. Tropical environments are more seasonal.
NEET Solved Paper 2024-13
C. More solar energy is available in tropics. 132. A transcription unit in DNA is defined primarily by
D. Constant environments promote niche specialization. the three regions in DNA and these are with respect to
E. Tropical environments are constant and predictable. upstream and down stream end;
Choose the correct answer from the options given below. (a) Repressor, Operator gene, Structural gene
(a) A, C, D and E only (b) A and B only (b) Structural gene, Transposons, Operator gene
(c) A, B and E only (d) A, B and D only (c) Inducer, Repressor, Structural gene
128. Given below are two statements: (d) Promotor, Structural gene, Terminator
Statement I : Chromosomes become gradually visible 133. In a plant, black seed color (BB/Bb) is dominant over white
under light microscope during leptotene stage. seed color (bb). In order to find out the genotype of the black
Statement II : The beginning of diplotene stage is seed plant, with which of the following genotype will be
recognized by dissolution of synaptonemal complex. cross it?
In the light of the above statements, choose the correct (a) BB (b) bb
answer from the options given below: (c) Bb (d) BB/Bb
(a) Both Statement I and Statement II are true 134. Which of the following are required for the dark reaction
(b) Both Statement I and Statement II are false of photosynthesis?
(c) Statement I is true but Statement II is false A. Light
(d) Statement I is false but Statement II is true B. Chlorophyll
129. Match List I with List II C. CO2
List-I List-II D. ATP
A. Nucleolus I. Site of formation E. NADPH
of glycolipid Choose the correct answer from the options given below:
B. Centriole II. Organization like (a) A, B and C only (b) B, C and D only
the cartwheel (c) C, D and E only (d) D and E only
C. Leucoplasts III. Site for active 135. Match List I with List II
ribosomal RNA List I List II
synthesis A. Two or more I. Back cross
D. Golgi apparatus IV. For storing alternative forms
nutrients of a gene
Choose the correct answer from the options given below: B. Cross of F1 II. Ploidy
(a) A-III, B-II, C-IV, D-I progeny with
(b) A-II, B-III, C-I, D-IV homozygous
(c) A-III, B-IV, C-II, D-I recessive parent
(d) A-I, B-II, C-III, D-IV C. Cross of F1 III. Allele
130. Bulliform cells are responsible for progeny with
(a) Inward curling of leaves in monocots. any of the parents
(b) Protecting the plant from salt stress. D. Number of IV. Test cross
(c) Increased photosynthesis in monocots. chromosome
(d) Providing large spaces for storage of sugars. sets in plant
131. A pink flowered Snapdragon plant was crossed with a red Choose the correct answer from the options given below:
flowered Snapdragon plant. What type of phenotype/s is/are (a) A-I, B-II, C-III, D-IV
expected in the progeny? (b) A-II, B-I, C-III, D-IV
(a) Only red flowered plants (c) A-III, B-IV, C-I, D-II
(b) Red flowered as well as pink flowered plants (d) A-IV, B-III, C-II, D-I
(c) Only pink flowered plants
(d) Red, Pink as well as white flowered plants

Section-B
136. The DNA present in chloroplast is: B.
Alexander von II. Long term
(a) Linear, double stranded Humboldt ecosystem
(b) Circular, double stranded experiment using
(c) Linear, single stranded out door plots
(d) Circular, single stranded C. Paul Ehrlich III. Global species
137. Match List I with List II diversity at about
List I List II 7 million
A. Robert May I. Species-Area D. David Tilman IV. Rivet popper
relationship hypothesis
 2024-14 NEET Solved Paper
Choose the correct answer from the options given below: (b) A-II, B-I, C-IV, D-III
(a) A-II, B-III, C-I, D-IV (c) A-III, B-IV, C-I, D-II
(b) A-III, B-I, C-IV, D-II (d) A-IV, B-III, C-II, D-I
(c) A-I, B-III, C-II, D-IV 142. Read the following statements and choose the set of
(d) A-III, B-IV, C-II, D-I correct statements:
138. Match List I with List II In the members of Phaeophyceae,
List I List II A. Asexual reproduction occurs usually by biflagellate
A. Rose I. Twisted aestivation zoospores.
B. Pea II. Perigynous flower B. Sexual reproduction is by oogamous method only.
C. Cotton III. Drupe C. Stored food is in the form of carbohydrates which is
D. Mango IV. Marginal either mannitol or laminarin.
placentation D. The major pigments found are chlorophyll a, c and
Choose the correct answer from the options given below: carotenoids and xanthophyll.
(a) A-II, B-IV, C-I, D-III E. Vegetative cells have a cellulosic wall, usually
(b) A-I, B-II, C-III, D-IV covered on the outside by gelatinous coating of
(c) A-IV, B-III, C-II, D-I algin.
(d) A-II, B-III, C-IV, D-I Choose the correct answer from the options given below:
139. Which of the following statement is correct regarding the (a) A, B, C and D only (b) B, C, D and E only
process of replication in E.coli? (c) A, C, D and E only (d) A, B, C and E only
(a) The DNA dependent DNA polymerase catalyses 143. In an ecosystem if the Net Primary Productivity (NPP) of
polymerization in one direction that is 3’ → 5’ first trophic level is 100x (kcal m–2) yr–1, what would be
(b) The DNA dependent RNA polymerase catalyses the GPP (Gross Primary Productivity) of the third trophic
polymerization in one direction, that is 5’ → 3’ level of the same ecosystem?
( )
(c) The DNA dependent DNA polymerase catalyses
(a) x kcal m −2 yr −1
polymerization in 5’ → 3’ as well as 3’ → 5’ direction 10
(d) The DNA dependent DNA polymerase catalyses
(b) x(kcal m–2)yr–1
polymerization in 5’ → 3’ direction
(c) 10x(kcal m–2)yr–1
140. Identify the correct description about the given figure:
(d)
100x
3x
( )
kcal m −2 yr −1

144. Match List-I with List-II

List-I List-II
A. GLUT-4 I. Hormone
B. Insulin II. Enzyme
C. Trypsin III. Intercellular
ground substance
D. Collagen IV. Enables glucose
transport into cells
(a) Wind pollinated plant inflorescence showing flowers Choose the correct answer from the options given below.
with well exposed stamens.
(a) A-IV, B-I, C-II, D-III
(b) Water pollinated flowers showing stamens with
(b) A-I, B-II, C-III, D-IV
mucilaginous covering.
(c) A-II, B-III, C-IV, D-I
(c) Cleistogamous flowers showing autogamy.
(d) A-III, B-IV, C-I, D-II
(d) Compact inflorescence showing complete autogamy
145. Identify the step in tricarboxylic acid cycle, which does
141. Match List I with List II
List I List II not involve oxidation of substrate.
A. Citric acid cycle I. Cytoplasm (a) Malic acid → Oxaloacetic acid
B. Glycolysis II. Mitochondrial (b) Succinic acid → Malic acid
matrix (c) Succinyl-CoA → Succinic acid
C. Electron III. Intermembrane (d) Isocitrate → a-ketoglutaric acid
transport system space of 146. Given below are two statements:
mitochondria Statement I: In C3 plants, some O2 binds to RuBisCO,
D. Proton gradient IV. Inner hence CO2 fixation is decreased.
mitochondrial Statement II: In C4 plants, mesophyll cells show very
membrane little photorespiration while bundle sheath cells do not
Choose the correct answer from the options given below: show photorespiration.
(a) A-I, B-II, C-III, D-IV
NEET Solved Paper 2024-15
In the light of the above statements, choose the correct 148. Match List I with List II
answer from the options given below: List I List II
(a) Both Statement I and Statement II are true A. Frederick Griffith I. Genetic code
(b) Both Statement I and Statement II are false B. Francois Jacob II. Semi-conservative & Jacque
(c) Statement I is true but Statement II is false mode of DNA replication
(d) Statement I is false but Statement II is true C. Har Gobind III. Transformation
147. Match List I with List II Khorana
D. Meselson & Stahl IV. Lac operon
List I List II
Choose the correct answer from the options given below:
(Types of Stamens) (Example) (a) A-III, B-II, C-I, D-IV
A. Monoadelphous I. Citrus (b) A-III, B-IV, C-I, D-II
B. Diadelphous II. Pea (c) A-II, B-III, C-IV, D-I
C. Polyadelphous III. Lily (d) A-IV, B-I, C-II, D-III
D. Epiphyllous IV. China-rose 149. Which of the following are fused in somatic hybridization
Choose the correct answer from the options given below: involving two varieties of plants?
(a) A-IV, B-II, C-I, D-III (a) Callus (b) Somatic embryos
(b) A-IV, B-I, C-II, D-III (c) Protoplasts (d) Pollens
(c) A-I, B-II, C-IV, D-III 150. Spraying sugarcane crop with which of the following
(d) A-III, B-I, C-IV, D-II plant growth regulators, increases the length of stem,
thus, increasing the yield?
(a) Auxin (b) Gibberellin
(c) Cytokinin (d) Abscisic acid

ZOOLOGY
Section-A
151. Following are the stages of pathway for conduction of an (a) D-A-C-B (b) B-A-D-C
action potential through the heart (c) C-B-D-A (d) A-D-C-B
A. AV bundle B. Purkinje fibres 156. Which of the following is not a steroid hormone?
C. AV node D. Bundle branches (a) Cortisol (b) Testosterone
E. SA node (c) Progesterone (d) Glucagon
Choose the correct sequence of pathway from the options 157. Match List I with List II :
given below List I List II
(a) E-C-A-D-B (b) A-E-C-B-D A. a –I antitrypsin I. Cotton bollworm
(c) B-D-E-C-A (d) E-A-D-B-C B. Cry IAb II. ADA deficiency
152. In both sexes of cockroach, a pair of jointed filamentous C. Cry IAc III. Emphysema
structures called anal cerci are present on D Enzyme IV Corn borer
(a) 5th segment (b) 10th segment replacement therapy
(c) 8 and 9 segment (d) 11th segment
th th Choose the correct answer form the options given below:
153. The flippers of the Penguins and Dolphins are the example (a) A-II, B-I, C-IV, D-III
of the (b) A-III, B-I, C-II, D-IV
(a) Adaptive radiation (c) A-III, B-IV, C-I, D-II
(b) Natural selection (d) A-II, B-IV, C-I, D-III
(c) Convergent evolution 158. Following are the stages of cell division :
(d) Divergent evolution A. Gap 2 phase B. Cytokinesis
154. Which of the following is not a component of Fallopian C. Synthesis phase D. Karyokinesis
tube? E. Gap 1 phase
(a) Uterine fundus (b) Isthmus Choose the correct sequence of stages from the options
(c) Infundibulum (d) Ampulla given below :
155. Given below are some stages of human evolution. (a) C-E-D-A-B (b) E-B-D-A-C
Arrange them in correct sequence. (Past to Recent) (c) B-D-E-A-C (d) E-C-A-D-B
A. Homo habilis 159. Which one of the following factors will not affect the
B. Homo sapiens Hardy-Weinberg equilibrium?
C. Homo neanderthalensis (a) Genetic recombination
D. Homo erectus (b) Genetic drift
Choose the correct sequence of human evolution from the (c) Gene migration
options given below: (d) Constant gene pool
 2024-16 NEET Solved Paper
160. Which of the following are Autoimmune disorders? In the light of the above statements, choose the correct
A. Myasthenia gravis B. Rheumatoid arthritis answer from the options given below :
C. Gout D. Muscular dystrophy (a) Both A and R are true and R is the correct explanation of A
E. Systemic Lupus Erythematosus (SLE) (b) Both A and R are true but R is NOT the correct
Choose the most appropriate answer from the options explanation of A
given below: (c) A is true but R is false
(a) A, B & D only (b) B & E only (d) A is false but R is true
(c) B, C & E only (d) C, D & E only 165. Match List I with List II :
161. Match List I with List II : List I List II
List I List II A. Pleurobrachia I. Mollusca
A. Typhoid I. Fungus B. Radula II. Ctenophora
B. Leishmaniasis II. Nematode C. Stomochord III. Osteichthyes
C. Ringworm III. Protozoa D. Air bladder IV. Hemichordata
D. Filariasis IV. Bacteria Choose the correct answer from the options given below
Choose the correct answer from the options given below: (a) A-IV, B-II, C-III, D-I
(a) A-I, B-III, C-II, D-IV (b) A-II, B-I, C-IV, D-III
(b) A-IV, B-III, C-I, D-II (c) A-II, B-IV, C-I, D-III
(c) A-III, B-I, C-IV, D-II (d) A-IV, B-III, C-II, D-I
(d) A-II, B-IV, C-III, D-I 166. Match List I with List II
162. Match List I with List II List I List II
List I List II (Sub Phases of (Specific characters)
A. Expiratory I. Expiratory Prophase I)
capacity reserve volume + Tidal A. Diakinesis I. Synaptonemal
volume + Inspiratory complex
reserve volume formation
B. Pachytene II. Completion of
B. Functional II. Tidal volume +Expiratory
terminalisation of
residual capacity reserve volume
chiasmata
C. Vital capacity III. Tidal volume + Inspiratory
C. Zygotene III. Chromosomes
reserve volume
look like thin
D. Inspiratory IV. Expiratory reserve
threads
capacity volume + Residual volume
D. Leptotene IV. Appearance
Choose the correct answer from the options given below:
of recombination
(a) A-II, B-IV, C-I, D-III
nodules
(b) A-III, B-II, C-IV, D-I
Choose the correct answer from the options given below
(c) A-II, B-I, C-IV, D-III
(a) A-IV, B-II, C-III, D-I
(d) A-I, B-III, C-II, D-IV (b) A-I, B-II, C-IV, D-III
163. Match List I with List II (c) A-II, B-IV, C-I, D-III
List I List II (d) A-IV, B-III, C-II, D-I
A. Down’s syndrome I. 11th chormosome 167. The “Ti plasmid” of Agrobacterium tumefaciens stands for
B. a-Thalassemia II. ‘X’ chromosome (a) Tumour inhibiting plasmid
C. b-Thalassemia III. 21st chromosome (b) Tumor independent plasmid
D. Klinefelter’s IV. 16th chromosome (c) Tumor inducing plasmid
syndrome (d) Temperature independent plasmid
Choose the correct answer from the options given below: 168. Match List I with List II :
(a) A-I, B-II, C-III, D-IV List I List II
(b) A-II, B-III, C-IV, D-I A. Cocaine I. Effective sedative in surgery
(c) A-III, B-IV, C-I, D-II B. Heroin II. Connabis sativa
(d) A-IV, B-I, C-II, D-III C. Morphine III. Erythroxylum
164. Given below are two statements : one is labelled as D. Marijuana IV. Papaver somniferum
Assertion A and the other is labelled as Reason R : Choose the correct answer from the options given below:
Assertion A : FSH acts upon ovarian follicles in female (a) A-IV, B-III, C-I, D-II
and Leydig cells in male. (b) A-I, B-III, C-II, D-IV
Reason R : Growing ovarian follicles secrete estrogen (c) A-II, B-I, C-III, D-IV
in female while interstitial cells secrete androgen in male (d) A-III, B-IV, C-I, D-II
human being.
NEET Solved Paper 2024-17
169. Which one is the correct product of DNA dependent RNA (d) (a) Involuntary – Nose tip
polymerase to the given template? (b) Skeletal – Bone
3’TACATGGCAAATATCCATTCA5’ (c) Cardiac – Heart
(a) 5’AUGUACCGUUUAUAGGUAAGU3’ 174. Which of the following statements is incorrect?
(b) 5’AUGUAAAGUUUAUAGGUAAGU3’ (a) A bio-reactor provides optimal growth conditions
(c) 5’AUGUACCGUUUAUAGGGAAGU3’ for achieving the desired product
(d) 5’ATGTACCGTTTATAGGTAAGT3’ (b) Most commonly used bio-reactors are of stirring type
170. Match List I with List II : (c) Bio-reactors are used to produce small scale bacterial
List-I List-II cultures
A. Pons I. Provides additional space (d) Bio-reactors have an agitator system, an oxygen
for Neurons, regulates delivery system foam control system
posture and balance. 175. Given below are two statements: One is labelled as
B. Hypothalamus II. Controls respiration and Assertion A and the other is labelled as Reason R:
gastric secretions. Assertion A : Breast-feeding during initial period of
C. Medulla III. Connects different regions infant growth is recommended by doctors for bringing a
of the brain. healthy baby.
D. Cerebellum IV Neurosecretory cells Reason R : Colostrum contains several antibodies absolutely
Choose the correct answer from the options given below: essential to develop resistance for the new born baby.
In the light of the above statements, choose the most
(a) A-II, B-III, C-I, D-IV
appropriate answer from the options given below:
(b) A-III, B-IV, C-II, D-I
(a) Both A and R are correct and R is the correct
(c) A-I, B-III, C-II, D-IV explanation of A
(d) A-II, B-I, C-III, D-IV (b) Both A and R are correct but R is NOT the correct
171. Match List I with List II : explanation of A
List-I List-II (c) A is correct but R is not correct
A. Lipase I. Peptide bond (d) A is not correct but R is correct
B. Nuclease II. Ester bond 176. Which of the following factors are favourable for the
C. Protease III. Glycosidic bond formation of oxyhaemoglobin in alveoli?
D. Amylase IV Phosphodiester bond (a) High pO2 and High pCO2
Choose the correct answer from the options given below: (b) High pO2 and Lesser H+ concentration
(a) A-IV, B-II, C-III, D-I (c) Low pCO2 and High H+ concentration
(b) A-III, B-II, C-I, D-IV (d) Low pCO2 and High temperature
(c) A-II, B-IV, C-I, D-III 177. Match List I with List II :
(d) A-IV, B-I, C-III, D-II List I List II
172. Which of the following is not a natural/traditional A. Common cold I. Plasmodium
contraceptive method? B. Haemozoin II. Typhoid
(a) Coitus interruptus C. Widal test III. Rhinoviruses
(b) Periodic abstinence D. Allergy IV. Dust mites
(c) Lactational amenorrhea Choose the correct answer from the options given below:
(d) Vaults (a) A-II, B-IV, C-III, D-I
173. Three types of muscles are given as a, b and c. Identify (b) A-I, B-III, C-II, D-IV
(c) A-III, B-I, C-II, D-IV
the correct matching pair along with their location in
(d) A-IV, B-II, C-III, D-I
human body:
178. Consider the following statements :
A. Annelids are true coelomates
B. Poriferans are pseudocoelomates
C. Aschelminthes are acoelomates
D. Platyhelminthes are pseudocoelomates
Choose the correct answer from the options given below:
(a) B only (b) A only
Name of muscle/location (c) C only (d) D only
(a) (a) Smooth - Toes 179. Match List I with List II
(b) Skeletal – Legs List I List -II
(c) Cardiac – Heart A. Non-medicated I. Multiload 375
(b) (a) Skeletal - Triceps IUD
(b) Smooth – Stomach B. Copper releasing II. Progestogens
(c) Cardiac – Heart IUD
(c) (a) Skeletal - Biceps C. Hormone releasing III. Lipper loop
(b) Involuntary – Intestine IUD
(c) Smooth – Heart D. Implants V. LNG-20
 2024-18 NEET Solved Paper
Choose the correct answer from the option given below: Choose the correct answer from the options given below:
(a) A-III, B-I, C-II, D-IV (a) A-IV, B-III, C-II, D-I
(b) A-I, B-III, C-IV, D-II (b) A-IV, B-II, C-III, D-I
(c) A-IV, B-I, C-II, D-III (c) A-II, B-IV, C-I, D-III
(d) A-III, B-I, C-IV, D-II (d) A-II, B-I, C-IV, D-III
180. Given below are two statements :
183. Match List I with List II :
Statement I : In the nephron, the descending limb of loop of
Henle is impermeable to water and permeable to electrolytes. List I List II
Statement II : The proximal convoluted tubule is lined by A. Pterophyllum I. Hag fish
simple columnar brush border epithelium and increases B. Myxine II. Saw fish
the surface area for reabsorption. C. Pristis III. Angel fish
In the light of the above statements, choose the correct D. Exocoetus IV. Flying fish
answer from the option given below : Choose the correct answer from the options given below:
(a) Both statement I and Statement II are true (a) A-II, B-I, C-IIII, D-IV
(b) Both statement I and Statement II are false (b) A-III, B-I, C-II, D-IV
(c) Statement I is true but Statement II is false (c) A-IV, B-I, C-II, D-III
(d) Statement I is false but Statement II is true (d) A-III, B-II, C-I, D-IV
181. The following diagram shown restriction sites in E. coli 184. Match List I with List II :
cloning vector pBR322. Find the role of ‘X’ and ‘Y’ gens: List I List II
EcoR I Cla I Hind III A. Fibrous joints I. Adjacent vertebrae, limited
Pvu I
Pst I
movement
BamH I
B. Cartilaginous II. Humerus and
pBR322
Sal I
joints Pectoral girdle, rotational
X Y
movement
C. Hinge joints III. Skull, don’t allow
any movement
Pvu II
D. Ball and socket IV. Knee, help in
(a) The gene ‘X’ is responsible for resistance to antibiotics
joints locomotion
and ‘Y’ for protein involved in the replication of
Plasmid. Choose the correct answer from the options given below:
(b) The gene ‘X’ is responsible for controlling the (a) A-IV, B-II, C-III, D-I
copy number of the linked DNA and ‘Y’ for protein (b) A-I, B-III, C-II, D-IV
involved in the replication of Plasmid. (c) A-II, B-III, C-I, D-IV
(c) The gene ‘X’ is for protein involved in replication of (d) A-III, B-I, C-IV, D-II
185. Given below are two statements:
Plasmid and ‘Y’ for resistance to antibiotics.
Statement I: The presence or absence of hymen is not a
(d) Gene ’X’ is responsible for recognitions sites and
reliable indicator of virginity.
‘Y’ is responsible for antibiotic resistance Statement II: The hymen is torn during the first coitus only.
182. Match List I with List II : In the light of the above above statements, choose the
List I List II correct answer from the options given below :
A. Axoneme I. Centriole (a) Both Statement I and Statement II are true
B. Cartwheel pattern II. Cilia and flagella (b) Both Statement I and Statement II are false
C. Crista III. Chromosome (c) Statement I is true but Statement II is false
D. Satellite IV. Mitochondria (d) Statement I is false but Statement II is true
Section-B
186. Given below are two statements: 187. Match List I with List II related to digestive system of cockroach.
Statement I: Gause’s competitive exclusion principle List-I List-II
states that two closely related species competing for A. The structures I. Gizzard
different resources cannot exist indefinitely. used for storing
Statement II: According to Gause’s principle, during of food.
competition, the inferior will be eliminated. This may be B. Ring of 6-8 blind II. Gastric Caeca
true if resources are limiting. tubules at junction
of foregut and
In the light of the above statements, choose the correct
midgut.
answer from the options given below :
C. Ring of 100-150 III. Malpighian
(a) Both Statement I and Statement II are true. yellow coloured tubules
(b) Both Statement I and Statement II are false. thin filaments at
(c) Statement I is true but Statement II is false. junction of midgut
(d) Statement I is false but Statement II is true. and hindgut.
NEET Solved Paper 2024-19
D. The structures IV. Crop C. Release of products.
used for D. Chemical bonds of the substrate broken.
grinding the food. E. Substrate binding to active site.
Choose the correct answer from the options given below: Choose the correct answer from the options given below:
(a) A-IV, B-II, C-III, D-I (a) E, A, D, C, B
(b) A-I, B-II, C-III, D-IV (b) A, E, B, D, C
(c) A-IV, B-III, C-II, D-I (c) B, A, C, D, E
(d) A-III, B-II, C-IV, D-I (d) E, D, C, B, A
188. The following are the statements about non-chordates: 193. Identify the correct option (A), (B), (C), (D) with respect
A. Pharynx is perforated by gill slits. to spermatogenesis.
B. Notochord is absent. GnRH
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post anal tail is absent. LH (A)
Choose the most appropriate answer from the options
given below:
 
(a) A & C only (b) A, B & D only (B) (C)
(c) B, D & E only (d) B, C & D only  
189. Choose the correct statement given below regarding juxta Androgens Factors
medullary nephron.  
(a) Juxta medullary nephrons are located in the columns Formation of spermatids (D)
of Bertini.
(b) Renal corpuscle of juxta medullary nephron lies in (a) FSH, Leydig cells, Sertoli cells, Spermiogenesis.
the outer portion of the renal medulla. (b) ICSH, Interstitial cells, Leydig cells, spermiogenesis.
(c) Loop of Henle of juxta medullary nephron runs deep (c) FSH, Sertoli cells, Leydig cells, spermatogenesis.
into medulla. (d) ICSH, Leydig cells, Sertoli cells, spermatogenesis.
(d) Juxta medullary nephrons outnumber the cortical 194. Match List I with List II:
nephrons. List I List II
190. Given below are two statements: A. Mesozoic Era I. Lower
Statement I: The cerebral hemispheres are connected by invertebrates
nerve tract known as corpus callosum. B. Proterozoic Era II. Fish & Amphibia
Statement II: The brain stem consists of the medulla C. Cenozoic Era III. Birds & Reptiles
oblongata, pons and cerebrum. D. Paleozoic Era IV. Mammals
In the light of the above statements, choose the most Choose the correct answer from the options given below:
appropriate answer from the options given below: (a) A-II, B-I, C-III, D-IV
(a) Both Statement I and Statement II are correct. (b) A-III, B-I, C-II, D-IV
(b) Both Statement I and Statement II are incorrect. (c) A-I, B-II, C-IV, D-III
(c) Statement I is correct but Statement II is incorrect. (d) A-III, B-I, C-IV, D-II
(d) Statement I is incorrect but Statement II is correct. 195. Match List I with List II:
191. Given below are two statements : List I List II
A. Unicellular I. Salivary glands
Statement I : Bone marrow is the main lymphoid
glandular
organ where all blood cells including lymphocytes are
epithelium
produced.
B. Compound II. Pancreas
Statement II : Both bone marrow and thymus provide
epithelium
micro environments for the development and maturation
C. Multicellular III. Goblet cells of
of T-lymphocytes.
glandular alimentary canal
In the light of above statements, choose the most
epithelium
appropriate answer from the options given below :
D. Endocrine IV. Moist surface of
(a) Both Statement I and Statement II are correct.
glandular buccal cavity
(b) Both Statement I and Statement II are incorrect.
epithelium
(c) Statement I is correct but Statement II is incorrect. Choose the correct answer from the options given below:
(d) Statement I is incorrect but Statement II is correct. (a) A-II, B-I, C-III, D-IV
192. Regarding catalytic cycle of an enzyme action, select the (b) A-IV, B-III, C-I, D-II
correct sequential steps : (c) A-III, B-IV, C-I, D-II
A. Substrate enzyme complex formation. (d) A-II, B-I, C-IV, D-III
B. Free enzyme ready to bind with another substrate.
 2024-20 NEET Solved Paper
196. Match List I with List II: (a) Both Statement I and Statement II are correct.
List I List II (b) Both Statement I and Statement II are incorrect.
A. RNA polymerase I. snRNPs (c) Statement I is correct but Statement Il is incorrect.
III (d) Statement I is incorrect but Statement Il is correct.
B. Termination of II. Promotor 199. Given below are two statements:
transcription Statement I: Mitochondria and chloroplasts both double
C. Splicing of Exons III. Rho factor membranes bound organelles.
D. TATA box IV. SnRNAs, tRNA Statement II: Inner membrane of mitochondria is
Choose the correct answer from the options given below: relatively less permeable, as compared chloroplast.
(a) A-II, B-IV, C-I, D-III In the light of the above statements, choose the mis
(b) A-III, B-II, C-IV, D-I appropriate answer from the options given below
(c) A-III, B-IV, C-I, D-II (a) Both Statement I and Statement II are correct.
(d) A-IV, B-III, C-I, D-II (b) Both Statement I and Statement II are incorrect.
197. As per ABO blood grouping system, the blood group of (c) Statement I is correct but Statement Il is incorrect.
father is B+, mother is A+ and child is O+. Their respective (d) Statement I is incorrect but Statement Il is correct.
genotype can be 200. Match List I with List II :
A. IBi/IAi/ii List - I List - II
B. IBIB/IAIA/ii A. Exophthalmic I. Excess secretion
C. IAIB/iIA/IBi goiter of cortisol, moon face &
D. IAi/IBi/IAi hypergylcemia.
E. iIB/iIA/IAIB B. Acromegaly II. Hypo-secretion of thyroid
Choose the most appropriate answer from the options hormone and stunted
given below : growth.
(a) A only C. Cushing’s III. Hyper secretion of thyroid
(b) B only syndrome hormone & protruding eye
(c) C & B only balls.
(d) D & E only D. Cretinism IV. Excessive secretion of
198. Given below are two statements: growth hormone.
Statement I: Mitochondria and chloroplasts both double Choose the correct answer from the options given below
membranes bound organelles. (a) A-I, B-III, C-II, D-IV
Statement II: Inner membrane of mitochondria is (b) A-IV, B-II, C-I, D-III
relatively less permeable, as compared chloroplast. (c) A-III, B-IV, C-II, D-I
In the light of the above statements, choose the mis (d) A-III, B-IV, C-I, D-II
appropriate answer from the options given below

NEET Rank Predictor 2024

Marks Scored All India Rank Marks Scored All India Rank
720 – 691 1 – 15 610 – 591 4601 – 9000
690 – 671 16 – 175 590 – 571 9001 – 12000
670 – 651 176 –850 570 – 551 12001 – 18000
650 – 631 851 – 2400 550 – 531 18001 – 26000
630 – 611 2401 – 4600 530 – 500 26001 – 40000
NEET Solved Paper 2024-21

HINTS & SOLUTIONS

PHYSICS
1. (b) Vernier Constant V. C. = MSD –VSD ... (i) Divided into 10 parts
where MSD = Main scale division and VSD = Vernier \ resistance of each part = 5W
scale division Resistance in series Rs = 5 × 10 = 50W
Given : (N + 1) VSD = N MSD 10
Resistance in parallel, Rp = = 2Ω
 N  5
VSD = 
 N + 1
MSD  ... (ii)
\ Req = RS + RP = 52 W
From eq. (i) and (ii) A wire of resistance R is cut into n equal part and all parts
N are connected in parallel then Req = R/n2
V.C. = (MSD) − ( MSD )
N +1
F
 N  MSD 7. (c) Force F = (M1 + M2)a ⇒ a =
= MSD 1 − = M1 + M 2
 N + 1 N + 1
10
0.01 1 =
or, a = 2 ms −2
= = 2+3
N + 1 100 N + 1)
(
2. (c) Central bright fringe is white as at central point on \ Force exerted by block A on block B
screen, path difference is zero for all wavelength. Other F′ = M2(2) = 3 × 2 = 6 N
λD Force acting on a body depends on its current situation,
fringes depend on wavelength as β = so other
d not its past motion. It is not carried from earlier motion.
fringes will be coloured.
3. (c) As per given truth table, output is independent of 8. (c) The magnitude of magnetic field due to circular coil
input A of N turns
\ Output Y = B µ 0iN 4π × 10 −7 × 7 × 100
=
BC =
4. =
(c) Current in circuit i
E
= = 2A
10 2R 2 × 0.1
R + r 4 +1 = 4.4 × 10–3 T = 4.4 mT
Terminal voltage V = E – iR 9. (b) Transformer ratio,
= 10 – 2 × 1 = 8 V N P VP 1
= =
I NS VS 2
5. (d) Time period of oscillation, T = 2π
MB
1 9.8 × 10 −6 \ VS : V P = 2 : 1
⇒ =
2π When VS > VP step-up transformer and when VS < VP
4 M × 0.049
step-down transformer.
1 9.8 × 10 −6
⇒ = 4π 2 × h h
16 M × 49 × 10 −3 (d) de-Broglie wavelength l= =
10.
P mv
4π 2 × 9.8 × 10 −6 = =
h
where E
1
mv 2
=
⇒ M × 16 2
49 × 10 −3
2mE
Squaring both sides,
4π 2 × 9.8 × 16 × 10 −3
= h2 1
49 λ2 = 2 ⇒ ∝E
4m E λ2
= ×
12.8p2 10–3
× 10–2
× 102
= 1280p2 × 10–5 Am2 Hence
1
versus E graph is a straight line
\ x = 1280 p2 λ2
ρ
6. (b) Resistance R = passes through the origin.
A 11. (c) Statement I is correct as atoms are electrically
l neutral as they contain equal number of positive and
negative charges.
Divided into
Divided into 10
10parts
parts
 2024-22 NEET Solved Paper
Statement II is incorrect as atom of most of the elements (D) In photon-electron collision both total energy and
but not every atom are stable and emit characteristic total momentum are conserved.
spectrum. This statement is not true for every atom. 19. (a) Given, displacement x = 2t –1
12. (b) Tension, T = mlw2 dx
 \ velocity =
v = 2ms −1
T m dt
 Therefore power P = F. v = 2 × 5 = 10 W
When speed becomes 2w 20. (b) In prism, r1 + c = A
2 ⇒ r1 = 90° – c ... (i)
T m
 1 µ2 − 1
sin c =⇒ cos c =
Tension, T′ = ml(2w)2 µ µ
\ T′ = 4T A
13. (a) In reverse biased pn junction diode, the current
measured in (mA), is due to minority charge carrier. Solar 30°
r1 c
cell I - V characteristics is as shown in figure.
ID
B C
VOC From Snell’s law, on incidence surface
VD 1
1 sin 30° = msin (r1) ⇒ 1 × = µ × sin ( 90° − c )
2
ISC
µ2 − 1
or, 1 = µ × ... (ii)
14. (a) Path bc is an isochoric process i.e., volume is 2 µ
constant i.e., DV = 0 On squaring eq. (ii)
\ Work done by gas along path bc,
1 5 5
Wbc = P. DV = 0 =µ 2 − 1 ⇒ µ 2= ∴ µ=
4 4 2
In Isobaric process, pressure is kept constant, in isochoric
process volume is kept constant and in adiabatic process no The angle of deviation depends on the angle of incidence.
exchange of heat DQ = 0 At the minimum deviation dm, the refracted ray inside the
prism becomes parallel to its base.
15. (d) For uniformly charged spherical shell,
kq 21. (a) Given circuit is balanced Wheatstone bridge so
Potential V = (For r ≤ R) equivalent circuit is as shown
R
2µF 2µF
\ V C = VP
or, VC – VP = 0
A B
m 2 2µF 2µF
16. (a) Moment of inertia of rod = I =
12
\ Equivalent capacitance
2  1 1  1 1
⇒ 2400 =
400 CAB = +  +  +  =µ 2 F
12  2 2  2 2
⇒ 72 = l2 dA
∴ = 72= 8.48 cm  8.5 cm 22. (a) Solid angle dΩ = 2 has dimensions [M0L0T0]
∆ r
17. (d) When a particle is moving with uniform speed in a Strain = has dimensions [M0L0T0]

circular path then direction changes continuously. Therefore
particle maintains varying velocity and varying acceleration. 
Angle measured in radians θ = is also dimensionless
18. (b) r
[M0L0T0]
(A) The energy of a photon E = hn Solid angle, strain and angle are dimensionless.
(B) Velocity of photon is equal to velocity of light i.e. c. Angle, trigonometric function, (cos q, sin q, tan q) Logarithmic
h h hν function (log x), exponential function (ex), Ratio, Pure
(C) Since λ = ⇒ p = ⇒ p =
p λ c number are dimensionless.
NEET Solved Paper 2024-23
23. (a) For maximum elongation, When an unpolarised light beam is incident at angle
Stress = Elastic limit of incidence equal to Brewster’s angle, then the angle
Maximum elongation between reflected and refracted ray will be 90°.
σelastic × L 8 × 108 × 1
= = = 4 ×10–3 28. (a) The susceptibility of different magnetic materials
Young's modulus 2 × 1011 are given below
= 4 mm Material Susceptibility
24. (a) North of magnet is moving away from solenoid 1 so Diamagnetic (II) 0 > c ≥ –1
end B of solenoid 1 is South and as south of magnet Ferromagnetic (III) c > > 1
is approaching solenoid 2 so end C of solenoid 2 is Paramagnetic (IV) 0 < c < e
South. Non-magnetic (I) c = 0
N S v S 29. (b)  A B  v2
A  v1 B
N N (Before collision) rest (After collision)
S
By conservation of linear momentum,
A B C D Pi = Pf
Solenoid-1 Solenoid-2 ⇒ mv1 = mv2 + mv2 ⇒ mv1 = 2 mv2
GM v 2
25. (d) Acceleration due to gravity g = 2 ∴ 1 =
R v2 1
286
So acceleration due to gravity on the surface of the α 286 e+ β−
82 X →80 Y →79 Z →
30. (d) 290
GM ′ GM
=
planet g′ =
R′ 2
 R
2 286
10   286
P → Q
 2 80 81

4 GM For the product Q, A → 286 and Z = 81.

or, g ′ = = 0.4 × g = 0.4 × 9.8  π
10 R 2 31. (b) =x 5sin  πt +  m
 3
\ g′ = 3.92 ms–2
hc Amplitude, A = 5m
26. (b) Energy of transition, DE = 2π 2π
λ Time period, =
T = = 2s
∴ λ∝
1 ω π
∆E 32. (a)
As, (DE)6–2 > (DE)5 –2 > (DE)4 – 2 > (DE)3 – 2
⇒ l6–2 < l5–2 < l4–2 < l3–2 T
A – III, B – IV, C – II, D – I
27. (d) Incident rays
Reflected rays
(completely polarised) Excess force = T × length = T × 2pR
7 4.5 = 19.8 mN
iB i = × 2 × 3.14 ×
B 100 100
33. (d)
Y1
r A
Y

B
Y2

Refracted rays Y1 = A ⋅ A = A
(Partially polarised)
According to Brewster’s law when an unpolarised light Y2 = B + B = B
beam strikes a glass at Brewster’s angle, then reflected rays
are completely polarized and refracted rays are partially \ Output, Y = Y1 + Y2 = A + B = A ⋅ B
polarized.
= A·B
\ The given logic gate is similar to AND gate.
 2024-24 NEET Solved Paper
34. (c) The potential V at any point, at distance r from 2
(b) Rated power, P= V ⇒ P ∝ 1
centre of dipole = 1 . P cos θ
39.
R R
4πε 0 r2
PA R B
At axial point where θ = 0°, V =
1 P = ⇒ R A = 2R B
. PB R A
4πε 0 r 2
For Series Combination,
9 × 109 × 4 × 10 −6
= = 9 × 103 V V2 V2
22 =PS =
R A + R B 3R B
1 P
V =− . =−9 × 103 V
4πε0 r 2 For Parallel Combination,
At axial point where q = 180°,
V ( R A + R B ) 3V
2
PS 2
2
1= PP =
For point charges, V ∝ 1 and for electric dipole, V ∝ R A .R B 2R B ∴ P =9
r r2 P

40. (d) Using Charle’s law, T ∝V

35. (b) In the case of pure rolling, v = wR \ T = Slope × V ... (i)
\ vP = v + wR = 2v From ideal gas equation,
vQ = v – wR = 0
P v R PV = nRT ⇒ T =  P 
 V ... (ii)
nR 
R From eqs (i) and (ii), we get, slope ∝ P
v  As, (slope)1 > (slope)2 > (slope)3
⇒ P 1 > P2 > P3
Q 41. (c) As, acceleration = slope of v-t curve
\ Initially, a = 0
Hence, point P moves faster than point Q. After sometime, a = constant (+ve)
36. (b) L1 L2 Again, a = 0
IC Again, a = constant (–ve)
ID
\ The corresponding a - t graph is
a

According to modified Ampere’s law,

 
µ 0 ( IC + I D )
∫ B. d = t
0
For Loop L1, IC ≠ 0 and ID = 0
 
⇒  ∫ B.dl =µ 0 IC ... (i) The area under velocity-time curve given displacement,
not distance.
For Loop L2, IC = 0 and ID ≠ 0 t2
  
 
⇒  ∫ B.dl =µ 0 I D ... (ii) i.e. Area = ∫ v dt= x 2 − x1 = Displacement
t1
From eqs (i) and (ii), we get
IC = ID 42. (a) For bridge balance,
37. (d) The accelerating charge radiates EM waves and R1 R 3 10 10
= ⇒ =
charge moving with uniform velocity produces steady R2 R4 15 R 4
state magnetic field.
\ R4 = 15W
38. (b) f0 = 140 cm and fe = 5 cm
As, R4 is a combination of 5W resistance and diode
For distant object, the magnifying power is given by resistance.
f 0 140 \ The diode should be in forward biased and connected
= =
m = 28
fe 5 in series with 5W resistance.
NEET Solved Paper 2024-25
43. (b) Time period of simple pendulum is •m m•
48. (b)
 l
T =2π ⇒T∝  M = ml
g

T 2 1   
⇒ 2= = ∵ 2 = 1  m
T1 1 2  2 /2

1 x eff
⇒ T2 = T1= T1 ( given )
2 2
60°
∴ x=2 m

The time period of simple pendulum is independent of /2

 
mass of the bob. =
Effective length, leff 2 =sin 30°
2 2
44. (a) Apply energy conservation, \ New magnetic moment, M′ = mleff = ml/2 = M/2
Ui + Ki = Uf + Kf When a magnet is cut along perpendicular to its length,
GMm GMm 1 2 then its pole strength remains unchanged, whereas by
⇒ − + Ki =− + mv0 cutting it along its axis, its pole strength becomes half.
R 3R 2
GMm GMm 1 GM 49. (b) When the plates of a parallel plate capacitor is
⇒ − + K i =− + ×m×
R 3R 2 3R connected to a battery, then potential difference remains
constant.
 GM 
=
∵ ν 0 = and r 3R  i.e., V′ = V = Constant
 r  ε0 A ε0 A
=
(i) C′ = ,C
1 GMm GMm d′ d
⇒ Ki =
− +
6 R R d′ < d ⇒ C′ > C
\
Minimum energy required, Hence, final capacitance is greater than initial capacitance,
5 GMm 1 1
K i= ⋅ (ii) U′ =
= C′V 2 and U CV 2
6 R 2 2
45. (b) ⇒ U′ > U [QC′ > C]
A. A magnetic pole will repel or attract magnetic sheet, Hence, final energy is greater than initial energy
so force is need to hold the sheet. Q′ Q Q′ Q
(iii) =C ′ and =C ⇒ ≠
B. If sheet is non-magnetic, then magnetic pole will not V′ V V′ V
exert force on it.
C. If it is conducting, then there will be eddy current (iv) Product of charge and voltage
in sheet, which opposes the motion. So forces is X′ = Q′ V = C′ V2 and X = QV = CV2
needed to move sheet with uniform speed. ⇒ X′ > X [QC′ > C]
D. The non-conducting and non-polar sheet do not For an isolated parallel plate capacitor i.e. the plates of the
capacitor is disconnected from a battery, charge remains constant.
interact with magnetic poles of magnet.
1 1
46. (b) Capacitive Reactance, X =C = 50. (b) From principle of homogeneity
ωC 2πfC
[F] = [at2] = [bt]
1 1000
= [ F] [ F]
2 × 3.14 × 50 × 10 × 10 −6 3.14 ⇒ [ αt ] = and [ β ] =[ t ]
[t]
Vrms
2i rms = 2. [ αt ]
Peak current, i0 =
XC ∴ [ F0 t 0 ]
=
[ ]
β
210
= 2× × 3.14 =
0.932  0.93A αt
1000 ∴ =
dimensionless
β
47. (b) The compressive force developed in the metallic bar
is F = YA a DT
= 0.5 × 1011 × 10–3 × 10–5 × 100 = 50 × 103 N
 2024-26 NEET Solved Paper

CHEMISTRY
51. (c) CH3–CH3 : 1s, CH2 = CH2 : 1s, 1p 59. (b) Ionization enthalpy increases in a period from left
C2 : 2p, CH ≡ CH: 1s, 2p. to right due to an increase in the effective nuclear charge
52. (b) According to Henry’s Law: P = KH x and also depends on the electronic configuration of the
Thus, a lower value of KH indicates higher value of x species.
(mole fraction/concentration) for a given pressure and The configurations of the given species are:
therefore higher solubility. Li = 1s2 2s1, Be = 1s2 2s2, B = 1s2 2s2 2p1.
Since, KH: B < C < A; Solubility : B > C > A. C = 1s2 2s2 2p2, N = 1s2 2s22p3.
The values of KH are constant at a specific temperature Thus, it is easier to remove first electron from Li and B
and are characteristics of gases. but difficult from C and N - (due to attainment of stable
configuration in Li and B and disturbance of it in N)
53. (a) H2O has the highest boiling point due to extensive  CH3
intermolecular H-bonding and H2Te comes next due to highest 60. (d)
molecular mass. Thus, both, statement I and II are correct.
54. (a) o-Nitrophenol ⇒ intramolecular H-bonding. is most stable as it is a tertiary carbocation stabilized by
p-Nitrophenol, m-nitrophenol, HF⇒ intermolecular H-bonding three + I groups.
55. (a) The boiling point of isomeric alkanes decreases with The stability follows the order: 1° < 2° < 3°.
branching due to a decrease in the exposed surface area 61. (d) We can use Arrhenius equation to calculate the
that decrease the strength of the intermolecular faces. activation energy:-
Thus, boiling point order for isomers of pentane is: K Ea  1 1 
n-pentane > iso-pentane > neo-pentane = log 2  − 
K1 2.303R  T1 T2 
Thus, both statement I and II are correct.
CH3 62. (a) Aniline does not undergo Friedel-Crafts reactions as
the –NH2 group reacts with acidic groups to form salts
CH +
56. (d) The compound Br will react instead. The NH3 group acts as a strong de-activating
group. Thus, statement I is true.
towards SN1 the fastest as it will form a secondary Aromatic primary amines (aniline here) cannot be
carbocation which will also be stabilized by resonance of prepared by Gabriel - phthalimide synthesis as aryl
the aromatic ring attached to the a-carbon. halides do not undergo nucleophilic substitution with the
57. (d) Reaction of alcohols with Lucas reagent (Anhydrous anion formed by phthalimide. Thus, statement II is true.
ZnCl2 + conc. HCl) follows SN1 mechanism so a 3° 63. (a) Electronegativity increases from left to right in a
alcohol which will form the most stable carbocation, will period and decreases down the group.
react instantaneously with Lucas reagent. +1 0 1
64. (a) H O  → H 2 + O2 ,
Lucas test allows us to differentiate between 1°, 2° 2
2
and 3° alcohols based on the rates with which they 2 moles of e– required
react or show turbidity. = 2 F electricity (For two H+ ions)
1° alcohols shows no turbidity while 3° shows immediately. +7 +2 2 +
Mn O 4− 
→ Mn ;
58. (b) NaOH + HCl → NaCl + H2O
Thus, 1 mole o f NaOH reacts with 1 mole of HCl. 2 moles of e– required = 5 F
2e−
Now, Number of moles present are:- → Ca 2+ + 2Cl− 
CaCl2  → Ca
1g
= NaOH = 0.025 mol
40g mol−1 Thus, 3 Ca 2+  3
→ Ca
2 2
HCl = 0.025L × 0.75 M = 0.01875 mol. which requires 3 moles of e– = 3F of electricity
⇒ Number of moles of NaOH left = Number of moles +3 +2
Fe2O3 
→ Fe O; requires 1 mole of e– = 1F
of NaOH present - Number of moles of HCl present
(limiting reagent) 65. (a) [Co(NH3)5(NO2)]Cl2 and
= 0.025 – 0.01875 = 0.00625 mol [Co(NH3)5 (ONO)]Cl2 → Linkage isomerism.
⇒ Mass of NaOH left = 0.00625 × 40 [Co(NH3)5(SO4)]Br and
= 0.25g = 250 mg [Co(NH3)5Br]SO4 → Ionization isomerism.
NEET Solved Paper 2024-27
[Co(NH3)6] [Cr(CN)6] and 71. (b) n = principal quantum number → size of orbital/
[Cr(NH3)6] [Co(CN)6] → Coordination isomerism. shell.
[Co(H2O)6] Cl3 and l = Azimuthal quantum number → shape of orbital
[Co(H2O)5Cl]Cl2H2O → Solvate (Hydrate) isomerism. ml = Magnetic orbital quantum number → orientation
66. (a) NH3 (1 lp, 3 bp) → Trigonal pyramidal (shape) of orbital.
BrF5 (1 lp, 5 bp) → square pyramidal (shape) ms = Magnetic spin quantum number → spin of
XeF4 (2 lp, 4 bp) → square planar (shape) electron.
SF6 (0 lp, 6 bp) → octahedral (shape/geometry) 72. (a)= µ n ( n + 2 ) B.M., where n = number of unpaired
67. (d) Arrhenius equation: electrons.
ln k =
E
− a + ln A Ti3+ = [Ar] 3d1 ⇒ n = 1, Cr2+ = [Ar] 3d4 ⇒ n = 4
RT Mn2+ = [Ar] 3d5 ⇒ n = 5, Fe2+ = [Ar] 3d6 ⇒ n = 4
(equivalent to y = mx + c) SC3+ = [Ar] 3d0 ⇒ n = 0
Thus, the representative graph will be: Thus, Cr2+ and Fe2+ will have the same µ. (magnetic
Intercept = lnA moment)
4g
Ea 73. (a) 4= gof He = 1 mol,
Slope = –
R 4g mol−1
ln k

2.271
2.271 L of=
He = 0.1 mol
22.7
O 1
T Thus, 4 mol of He has the highest number of atoms.
74. (d) Polonium (Po) does not show-2 oxidation state due
68. (a) For H-like species:
to low electron affinity and large atomic size.
 Z2 
E= −2.18 × 10−18  J 75. (c) Mn3+ = [Ar]3d4 → Mn2+ = [Ar] 3d5 (more stable
 n2 
  configuration)
For n = 1 of He+: 76. (c) Glucose does not give Schiff’s test and it does not
form the hydrogen sulphite addition product with NaHSO3
 22 
−2.18 × 10−18 
E=  due to its cyclic structure (absence of free –CHO grop).
 12 
  Glucose does reacts with NH2OH but its pentaacetate
= –2.18 × 10–18 × 4 does not react with NH2OH due to absence of free –CHO
= –x (Given) group.
 42  77. (b) Hydroboration - oxidation gives Anti-Markovnikoff
−18
For n = 2 of Be3+: E =
−2.18 × 10  2
2


product (alcohol) which is then oxidized to aldehyde by a
  mild oxidizing agent, which is Pyridinium chlorochromate
= 2.18 × 10–18 × 4 = –x (PCC) here.
Thus, Energy of Be3+ for n = 2 would be –x Joules. CH2 – CH = CH2 
3 (i) BH
–
69. (c) Entropy represents degree of Randomness. H2O2/OH
Thus, it increases for those processes that involve a
decrease in the order of arrangement or stability of the CH2 – CH – CH
system.
H OH
Process A involves change of state from liquid to gas
(ii) PCC
which is less ordered, so entropy increases.
CH2 – CH2 – CHO
Process B involves lowering of T which makes the system
more stable so entropy decreases. ∆n g
Process C involves formation of gaseous products from 78. (a) K P = K C ( RT ) . Thus, KP and KC will not be
∆n g
solid reactant, so entropy increases. equal if (RT) ≠1
Process D involves an increase in the number of gaseous ⇒ Dng ≠ 0
moles so disorderliness or entropy increases. For PCl5 (g)  (g) PCl3(g) + Cl2(g),
70. (d) Dng = (1 + 1) – 1 = 2 – 1 = 1
+2 −1 +1 +6 − 2 +2 +6 − 2 +1 −1
Ba Cl2 + Na 2 SO 4 
→ Ba SO 4 + 2 Na Cl Dng = number of moles of gaseous products – number of
moles of gaseous reactants
(No change in oxidation states)
 2024-28 NEET Solved Paper
H CH3 CH3 H 87. (a) Homoleptic complex ⇒ has only one type of ligand
4 3 2 1 [Co(NH3)6]3+.
79. (c) H – C – C – C – C – H
Heteroleptic complex ⇒ has different types of ligands.
H H H H [Co(NH3)4Cl2]+.
2, 3-dimethylbutane Thus, Statement I and II, both are correct.
80. (a) Fehling solution ‘A’ = Aqueous CuSO4 solution. 88. (b) t = 100 seconds, I = 9.6487 A.
Fehling solution ‘B’ = Alkaline sodium potassium
Charge (Q) = I × t = 9.6487 × 100 = 964. 87C
Tartarate (Rochelle salt).
81. (d) Isothermal ⇒ Constant T, Isochoric Now, Cu2+ (aq.) + 2e– → Cu(s)
⇒ Constant V, Isobaric ⇒ Constant P, Adiabatic ⇒ Thus, 2 moles or 2F = 2 × 96487 C of electricity gives 1
Constant heat/No exchange of heat. mol or 63g of = Cu.
3+
82. (a) [Co(NH3)6] ⇒ Co = [Ar]3d3+ 6
Therefore, 964. 87 C of electricity will give:
Due to strong field NH3 ligand, all six electrons are paired 63 × 964.87
and the complex is diamagnetic. = M = 0.315g of Cu.
2 × 96487
In case of [CoF6]3– weak held F– ligand is present and there are
four unpaired electrons making the complex paramagnetic. 89. (b) Acidic KMnO4 oxidizes alkenes, that are substituted
Due to both complexes having the same number of to carboxylic acids or Ketones.
ligands and the hybridizations of d2 sp3 and sp3 and sp3 Both doubly-bonded carbon atoms have one H-atom that
d2 respectively, they are both octahedral. will also get oxidized to –OH.
Thus, both statement I and II are true. Thus,
Strong-field ligands pair up the electrons while weak - field ligands +
KMnO /H
are unable to counter the pairing energy and the D < P. CH= CH 
4

83. (b) The process of directly changing into a gas from

2 C=O
solid state is called sublimation. Thus, such substances
can be separated from other substances by sublimation. OH
(P)
84. (c) Reaction ‘A’ represents ozonolysis of an alkene
which will required O3 and Zn – H2O. 90. (d) 3 ROH + PCl3 →3 RCl + H3PO3
Reaction ‘B’ represents Friedel-Crafts Acylation of (A)
benzene which requires ArCOCl in Anhydrous AlCl3. ROH + PCl5 → RCl + HCl + POCl3
Reaction ‘C’ represents oxidation of an alcohol to ketone (B)
which neeeds CrO3 agent. 91. (a) Using Arrhenius equation:
Reaction ‘D’ represents side-chain oxidation of ethyl
k2 E a  T2 − T1 
benzene which requires KMnO4 in KOH and heating. log =
k1 2.303R  T1T2 
[=
B][ C] ( 2 ×10−3 )( 2 ×=
10−3 )
 330 − 300 
85. (c)=
QC 1
=
4k1
= ( 4)
Ea
[ A ]2 ( 2 ×10−3 )
2 log log
k1 2.303 ( 8.314 )  300 × 330 
⇒ Q C > KC 0.6021 = Ea × (1.582 × 10–5)
Thus, reaction will process in the backward direction, ⇒ Ea = 38040 J = 38.04kJ
towards the reactants to reach equilibrium (KC). 92. (d) Dilute Sulphuric acid (H2SO4) is added to aqueous
QC is called reaction quotient which represents relative solutions of Mohr’s salt to prevent the hydrolysis of
concentrations of reactants and products at any time. ferrous sulphate.
This is in accordance with Le-Chatelier’s principle according
86. (a) Ce4+ = [Xe] 4f0 , Yb2+ = [Xe] 4f14, Ce3+ = [Xe] 4f1 to which addition of more SO42– ions in the solution will
Eu2+ = [Xe] 4f7, Gd3+ = [Xe] 4f7, E43+ = [Xe] 4f6 favour the formation of more of FeSO4 to decrease the
Pm3+ = [Xe] 4f4, Sm3+ = [Xe] 4f5 concentration of SO42– ions and prevent the hydrolysis.
Thus, Ce4+ and Yb2+ are diamagnetic due to all electrons Concentrated H2SO4 is not added because it is a stronger
being paired. oxidizing agent and might oxidize Fe2+ to Fe3+ and will
also not dissociate completely.
NEET Solved Paper 2024-29
93. (a) Co2+ = Group IV, Mg2+ = Group VI
OH Br Thus, the correct increasing order is
H3C
PBr
H3C B →A → D → C → E
3 98. (b) For Reversible isothermal process:
Nucleophilic
Substitution
(A) P 
W = –2.303 n RT log  1 
 P2 
H3C
alc. KOH
 = –2.303 (1) (2.0) (298) log  20 
Elimination  
 10
(B) = – 413. 14 cal.
99. (d) K = [ N 2 ][ O 2 ]
(major)

94. (a) Osmotic pressure (p) = CRT C

⇒ Slope = RT = 25.73 L bar mol–1 [ NO]2
25.73 25.73 L bar mol −1 ( 3.0 × 10−3 )( 4.2 × 10−3 )
⇒ T= =
R 0.083 L bar mol −1K −1 = = 1.607
( 2.8 × 10−3 )2
= 310 K = 37°C Now,
95. (d) Ozone has only two resonance structures.
BF3 is a non-polar molecule due to zero dipole moment. 2NO  N2 + O2
Dipole moment of NF3 is less than that of NH3 due Initial 0.1 0 0

to F being more electronegative than H and N pulling at equilibrium 0.1 – 0.1 a 0.05 a 0.05a
electrons towards itself and resulting in cancellation of
( 0.05α ) 2
bond dipoles. ⇒=
KC = 1.607
Carbonate ion CO32– has three canonical structures with 0.01(1 − α ) 2

1.607 × ( 0.1)
each oxygen atom forming a double bond with carbon 2
α2
96. (a) ⇒ =
CH3 – CH2 – CH2 – I 
NaCN (1 − α)2 ( 0.05 )2
Nu - Substitution
α 1.27 × 0.1
–
OH , Partial ⇒ =
hydrolysis 1− α 0.05
CH3 – CH2 – CH2 – CN 
2.54
(A) ⇒ a = 2.54 – 2.54 a ⇒ =
α = 0.717
NaOH 3.54
CH3 – CH2 – CH2 – C – NH2 
Br2 100. (b) Let’s take 100g of this compound.
(Hoffmann-
O Bromamide ⇒ Masses present : A = 32g, B = 20g, C = 48g.
amide (B) degradation ⇒ Number of moles :
32 20 48
CH3 – CH2 – CH2 – NH2 A == 0.5, = B = 0.5, = C = 1.5
(C) 64 40 32
Propylamine Dividing these moles by smallest mole value:
97. (a) Al3+ = Group III, Cu2+ = Group II, A:B:C=1:1:3
Ba2+ = Group V, ⇒ Empirical Formula = ABC3

BOTANY
101. (b) Lecithin is a low molecular weight phospholipid 102. (d) Three molecules of ATP and two molecules NADPH
found in living tissues. are required for fixing one molecule of carbon dioxide.
Glycerides, are esters formed from glycerol and fatty 103. (b) Hind II was the first restriction endonuclease
acids, and are generally very hydrophobic.
discovered.
Amino acids and carbohydrates belongs to separate
classes of biomolecules. The functioning of restriction endonuclease depends on
Phospholipids are the main constituents of cell membranes. a specific DNA nucleotide sequence that was isolated.
They resemble the triglycerides in being ester or amide Hind II is a 6 base pair cutter.
derivatives of glycerol or sphingosine with fatty acids and Hence Option (a), (c) and (d) are incorrect .
phosphoric acid. The phosphate moiety of the resulting
phosphatidic acid is further esterified with ethanolamine,
choline or serine in the phospholipid itself..
 2024-30 NEET Solved Paper
104. (a) C represents the Guard cells of stomata that have 119. (b) Mode of nutrition is not considered for classifying
thin outer wall and highly thickened inner walls. These fungi as they are classified on the basis of
are the structural modification to facilitate opening and 1. Morphology of mycelium
closing of stomata. 2. Mode of spore formation
105. (a) Zinc is the cofactor of enzyme carboxypeptidase. 3. Fruiting Body
Niacin is related with coenzyme NAD and NADP.
Kingdom Fungi is a part of the five kingdom classifications
Haem represents the prosthetic group of enzymes
given by R.H Whittaker. Kingdom Fungi characteristics
peroxidase and catalase.
include a chitinous cell wall, heterotrophic nutrition, and
106. (a) Totipotency is the ability of plants to generate whole
a filamentous body structure known as mycelium. Fungi
plant body from any cell of the plant.
are eukaryotic, heterotrophic organisms. Kingdom fungi
107. (a) A-III, B-II, C-IV, D-I
classification is constantly evolving but currently includes
108. (c) Sol. Bt toxin exists as inactive protoxins in B.
major phyla like Ascomycota (sac fungi), Basidiomycota
thuringiensis. However, after ingestion by the insect the
(club fungi), and Chytridiomycota (chytrids).
inactive protoxin gets converted into active form due to
alkaline pH of the insect gut. 120. (d) Both diagram a and b shows perigynous condition.
Bt toxins are not activated when eaten by people, and no If gynoecium and other parts of the flower are almost at
harm occurs. However, some products that contain Bt may the same level then it is called perigynous condition ..
cause eye and skin irritation. Some signs and symptoms of
121. (d) IUCN (International Union for Conservation of
exposure to Bt include:
Inhaling Bt, Eating Bt, Skin irritation, Eye irritation,
Nature) is the organisation that releases list of endangered
Burning, Itchy eyes, Red skin rash, Laryngitis, Watery eyes, species.
and Breathing problems. 122. (c) The DNA carrying only gene of interest which may
get integrated into the genome of the recipient, hence
109. (a) Actinomorphic condition is observed in flowers
multiply and be inherited along with the host DNA .
of Datura. Rest plants given in option b, c and d have,
zygomorphic flowers . The piece of DNA not be able to multiply itself in the
110. (b) Ex-situ conservation is the type of conservation in progeny cells of the organism independently. It needs to
which threatened species are taken out from their natural be integrated into the genome of the recipient.
habitat and placed in special setting where they can be 123. (b) Alleles do not show any expression and both
protected and given special care . Although from the point the characters appear as such in F2 generation can be
of conservation in-situ conservation is more favourable. explained on the basis of Law of Segregation.
111. (d) As flowers of Vallisneria are pollinated by water so Mendel made two innovations to the science of genetics:
they are not colourful and do not produce nectar. 1. developed pure lines
112. (c) The permease enzyme is responsible for the 2. counted his results and kept statistical notes
permeability of cell to lactoses. So, the lactose present in Pure Line - a population that breeds true for a particular
the growth medium of bacteria is transported into the cell trait [this was an important innovation because any non-
by the action of permease. pure (segregating) generation would and did confuse the
113. (c) A-III, B-I, C-IV, D-II results of genetic experiments]
114. (c) In the given equation K denotes the carrying capacity.
115. (c) Auxins have no effect on mature monocotyledonous 124. (c) Malonate shows structural similarity with the
plants as they show very limited translocation and they substrate Succinic Dehydrogenase and it competes with
degrade the auxins that are applied externally. the substrate for the active site of the enzyme succinic
Auxin is a plant hormone that can be used as a herbicide to dehydrogenase.
destroy weeds. When present at low concentrations, auxin Hence option (a), (b) and (d) are incorrect.
herbicides stimulate growth and developmental processes 125. (c) When parenchyma cells that are fully differentiated
in plants. However, as the concentration of auxin increases,
forms interfascicular cambium, they represents the
it can disturb growth and damage the plant. Gardeners with
large lawns use auxins to prepare weed-free lawns phenomenon of dedifferentiation.
126. (b) Attachment of spindle fibres to kinetochores of
116. (c) C represents the radicle that is destined to form root. chromosomes is observed in Metaphase stage,.
117. (d) Collenchyma is also a living tissue. 127. (a) Tropical environment are less seasonal, and
118. (d) Habitat loss and fragmentation , Over-exploitation ,
relatively more constant and predictable when compared
Alien species invasions ,and Co-extinctions are the major
to temperate or other environments.
causes of biodiversity losses.
So, correct options are A, B and D only.
NEET Solved Paper 2024-31

The tropics are regions of Earth that lie roughly in the 137. (b) A-III, B-I, C-IV, D-II
middle of the globe. The tropics between the latitude lines 138. (a) A-II, B-IV, C-I, D-III
of the Tropic of Cancer and the Tropic of Capricorn. The 139. (d) In replication in Prokaryotes, like E.coli, DNA
tropics include the Equator and parts of North America, dependent DNA polymerase catalyse polymerization
South America, Africa, Asia, and Australia. The tropics only in one direction, that is 5’ → 3’
account for 36 percent of Earth’s landmass and are home 140. (a) The depicted diagram shows a wind pollinated plant
to about a third of the world’s people. showing flowers with well exposed stamens. Stamens are
128. (a) Both the statement I and II are true.. exposed to assist pollination by wind.
129. (a) A-III, B-II, C-IV, D-I Wind pollination, also known as anemophily, is a process
130. (a) In monocots, some particular epidermal cells present that uses wind to transfer pollen from a flower’s male
reproductive organ to the female organ, fertilizing the
adaxially modify themselves into large, empty, colourless
flower. Wind pollination is less complex than animal
cells. These are called bulliform cells. When these cells in
pollination and is most effective when a species grows in
the leaves have absorbed water and becomes turgid, the high densities. It’s most common in grasses, sedges, rushes,
leaf surface is exposed. When Bulliform Cells are flaccid and forest trees in temperate climates.
due to water stress, they make the leaves curl inwards to
minimise transpiritaional loss. 141. (b) A-II, B-I, C-IV, D-III
131. (b) Both red as well as pink flowered plants are expected 142. (c) In Phaeophyceae sexual reproduction can occur by
in the progeny as per the below cross: oogamy, isogamy or anisogamy .
Pink colour flower in snapdragon : Rr Hence correct statements are A, C, D and E.
Red flowered snapdragon : RR 143. (c) NPP of first trophic level can act as GPP for second
when both pink and red are crossed trophic level and NPP of second trophic level can act as
Phenotype GPP for third trophic level.
Red : Pink : White So, 100x (kcal/m2/yr) would be GPP of second trophic
2 2 0 level and 100x × 10% (kcal/m2/yr) i.e., 10x (kcal/m2/yr)
So the progeny that we get are red and pink flowered energy would be GPP of third trophic level.
plants only. 144. (a) A-IV, B-I, C-II, D-III
132. (d) A transcription unit consists of three regions in the 145. (c) Oxidation refers to the loss of electrons from a
DNA: molecule resulting in increase in its oxidation state. So
(i) A promoter the electron is transferred to an electron acceptor which
(ii) The structural gene is reduced in the process.
(iii) A terminator During formation of succinic acid from succinyl CoA
Transcription, as related to genomics, is the process of does not involve oxidation of substrate.
making an RNA copy of a gene’s DNA sequence. This The tricarboxylic acid (TCA) cycle, also known as the
copy, called messenger RNA (mRNA), carries the gene’s Krebs cycle or citric acid cycle, is an important cell’s
protein information encoded in DNA. In humans and other metabolic hub. It is composed of eight enzymes, all of
complex organisms, mRNA moves from the cell nucleus which are within the mitochondrial matrix except the outlier
to the cell cytoplasm (watery interior), where it is used for succinate dehydrogenase, which is related to the respiratory
synthesizing the encoded protein. chain on the inner mitochondrial membrane. The cycle
serves as a gateway for aerobic metabolism for molecules
133. (b) To determine the genotype of the black seed plant, that can convert to an acetyl group or dicarboxylic acid.
test cross is performed . Regulation of the TCA cycle occurs at three distinct
So the given black seed plant is crossed with white seed points that include the three following enzymes: citrate
plant (recessive parent) having genotype bb. synthase, isocitrate dehydrogenase, and alpha-ketoglutarate
134. (c) Light and chlorophyll are required in light reaction dehydrogenase. The cycle also plays a role in replenishing
precursors for the storage form of fuels such as amino acids
not in dark reaction.
and cholesterol.
135. (c) A-III, B-IV, C-I, D-II
136. (b) Double stranded circular DNA is present in 146. (c) In C4 plants photorespiration does not occur
chloroplast. 147. (a) A-IV, B-II, C-I, D-III
Chloroplast DNA (cpDNA) is the DNA found in 148. (b) A-III, B-IV, C-I, D-II
chloroplasts, which are photosynthetic organelles in some 149. (c) Somatic hybridization involves the fusion of
eukaryotic organisms. Chloroplasts have a separate genome protoplasts isolated from two varieties of plants.
from the cell nucleus, and cpDNA is highly conserved
between species in terms of gene content and organization.
 2024-32 NEET Solved Paper

Somatic hybridization in higher plants has come into focus since methods have been established for protoplast fusion and
uptake of foreign DNA and organelles by protoplasts. Polyethylene glycol (PEG) was effective agent for inducing fusion.
Treatment of protoplasts with PEG resulted in 5 to 30% heterospecific fusion products. Protoplasts of different species,
genera and even families were compatible when fused. A number of protoplast combinations (soybean + corn, soybean +
pea, soybean + tobacco, carrot + barley, etc.) provided fusion products which underwent cell division and callus formation.

150. (b) Gibberellin helps in increasing the lengths of internode, hence increasing the yield of sugarcane crops as they store
carbohydrates in stem.
ZOOLOGY
151. (a) The pathway that action potential follows when Depending on the type of cell, there are two ways cells
generated in heart is divide—mitosis and meiosis. Each of these methods of
Sino Atrial Node->Atrio Ventricular Node->Atrio cell division has special characteristics. One of the key
Ventricular Bundle-> Bundle Branches->Purkinje Fibres differences in mitosis is a single cell divides into two cells
152. (b) The 10th segment present in abdomen region have that are replicas of each other and have the same number of
anal cerci that represents a pair of jointed filamentous chromosomes. This type of cell division is good for basic
structures in both sexes of cockroach. growth, repair, and maintenance. In meiosis a cell divides
153. (c) Similar function is performed by the flippers of the into four cells that have half the number of chromosomes.
Penguins and Dolphins perform but structurally they are Reducing the number of chromosomes by half is important
not similar. Hence these structures represents convergent for sexual reproduction and provides for genetic diversity.
evolution. 159. (d) The following factors affects the Hardy-Weinberg
Adaptive radiation occurs when different species in a equilibrium:
given geographical area starting from a point and literally 1. Genetic recombination
radiating to the other areas of geography in terms of 2. Genetic Drift
evolution. 3. Gene Migration
According to natural selection is the key mechanism 4. Mutation
behind evolution. 5. Natural Selection
Divergent evolution represents homology. 160. (b) Myasthenia gravis, Rheumatoid arthritis and
154. (a) Uterine fundus is the part of the uterus, Systemic Lupus Erythematosus (SLE) are the examples
Isthmus, Infundibulum and Ampulla are the different of auto immune disorders.
Muscular dystrophy is a genetic disorder which
components of fallopian tube.
progressively affects the skeletal muscles.
The fallopian tubes are bilateral conduits between the
Gout is the inflammation of joints due to deposition of
ovaries and the uterus in the female pelvis. They function
uric acid crystals.
as channels for oocyte transport and fertilization. Given this
161. (b) A-IV, B-III, C-I, D-II
role, the fallopian tubes are a common etiology of infertility 162. (a) A-II, B-IV, C-I, D-III
as well as the target of purposeful surgical sterilization. 163. (c) A-III, B-IV, C-I, D-II
They can also be sites of ascending infection or neoplasms. 164. (d) FSH acts on ovarian follicles in females and
155. (d) The sequence of Human Evolution from past to stimulating the growth of follicles. In males LH affects
recent is as follows: Leydig cells leading to secretion of androgens.
Homo habilis → Homo erectus → Homo neanderthalensis Regulation of the reproductive system is a process that
requires the action of hormones from the pituitary gland,
→ Homo sapiens
the adrenal cortex, and the gonads. During puberty, in
156. (d) Glucagon belongs to class of proteinaceous hormone
both males and females, the hypothalamus produces
and it is secreted from pancreas. Cortisol, Testosterone
gonadotropin-releasing hormone (GnRH), which stimulates
and Progesterone are the steroidal hormone.
the production and release of follicle stimulating hormone
157. (c) A-III, B-IV, C-I, D-II (FSH) and luteinizing hormone (LH) from the anterior
158. (d) The following sequence represents the stages of cell pituitary gland. These hormones regulate the gonads
division in correct order: (testes in males and ovaries in females); they are called
Gap 1 phase->Synthesis phase->Gap 2 phase->Karyokinesis->Cytokinesis
gonadotropins. In both males and females, FSH stimulates
(E) (C) (A) (D) (B) gamete production and LH stimulates production of
hormones by the gonads. An increase in gonad hormone
levels inhibits GnRH production through a negative
feedback loop.
NEET Solved Paper 2024-33
165. (b) A-II, B-I, C-IV, D-III Hemoglobin (Hgb or Hb) is the primary carrier of
166. (c) A-II, B-IV, C-I, D-III oxygen in humans. Approximately 98% of total oxygen
167. (c) The Ti plasmid stands for Tumor inducing plasmid. transported in the blood is bound to hemoglobin, while
Hence option a, b and d are incorrect. only 2% is dissolved directly in plasma. Hemoglobin is
168. (d) A-III, B-IV, C-I, D-II a metalloprotein with four subunits composed of an iron-
169. (a) The mRNA synthesised from the given DNA containing heme group attached to a globin polypeptide
template is chain.One molecule of oxygen can bind to the iron atom
5’AUGUACCGUUUAUAGGUAAGU3’ of a heme group, giving each hemoglobin the ability to
170. (b) A-III, B-IV, C-II, D-I transport four oxygen molecules. One molecule of oxygen
171. (c) A-II, B-IV, C-I, D-III can bind to the iron atom of a heme group, giving each
172. (d) Vault belongs to the category of barrier method of hemoglobin the maximum capacity to transport four oxygen
contraception. Vault is made of rubber that is inserted molecules. This ability to sequentially bind oxygen to
into the female reproductive tract to cover the cervix each subunit results in the unique sigmoidal shape of the
during the coitus. oxyhemoglobin dissociation curve. Various defects in the
The traditional methods of contraception includes: synthesis or structure of erythrocytes, hemoglobin, or the
1. Coitus interruptus globin polypeptide chain can impair the oxygen-carrying
2. Periodic abstinence capacity of the blood and lead to hypoxia.
3. Lactational amenorrhoea 177. (c) A-III, B-I, C-II, D-IV
Methods of contraception include oral contraceptive pills, 178. (b) Poriferans are the acoelomates.
implants, injectables, patches, vaginal rings, intra uterine
Aschelminths are pseudocoelomates.
devices, condoms, male and female sterilization, lactational
Platyhelminths are acoelomates.
amenorrhea methods, withdrawal and fertility awareness-
based methods. These methods have different mechanisms
179. (d) A-III, B-I, C-IV, D-II.
of action and effectiveness in preventing unintended 180. (b) Descending limb of loop of Henle is impermeable to
pregnancy. Effectiveness of methods is measured by the electrolytes and permeable to water.
number of pregnancies per 100 women using the method Simple cuboidal brush border epithelium lines the
per year. Methods are classified by their effectiveness as proximal convoluted tubule and increases the surface area
commonly used into: for reabsorption.
• very effective (0–0.9 pregnancies per 100 women) Saving body water by optimal reabsorption of water
• effective (1–9 pregnancies per 100 women) filtered by the kidney leading to excretion of urine with
concentrations of solutes largely above that of plasma
• moderately effective (10–19 pregnancies per 100 allowed vertebrate species to leave the aquatic environment
women) to live on solid ground. Filtered water is reabsorbed for
70% and 20% by proximal tubules and thin descending
• less effective (20 or more pregnancies per 100 women).
limbs of Henle, respectively. These two nephron segments
express the water channel aquaporin-1 located along both
173. (b) Figure (a) depicts skeletal muscle fibres .These
apical and basolateral membranes. In the proximal tubule,
muscles are closely attached to skeletal bones.They are the paracellular pathway accounts for at least 30% of water
found in voluntary organs like triceps muscles .Figure (b) reabsorption.
depicts smooth muscle fibres .They are found in walls
181. (b)^T‘X’ in the given diagram represents the ori region
of internal organs such as the blood vessels, stomach and
which controls the copy number of plasmid and hence the
intestine.Figure (c) depicts cardiac muscle fibres ,they are
copy number of linked DNA. ‘Y’ is rop region that codes
only found in heart.
for protein involved in replication of plasmid.
174. (c) Bioreactors are used for large scale production i.e,
182. (d) A-II, B-I, C-IV, D-III
processing of large volumes (100 – 1000 litres) of culture.
183. (b) A-III, B-I, C-II, D-IV
175. (a) Both A and R are correct and R is the correct
184. (d) A-III, B-I, C-IV, D-II.
explanation of A.
A joint is a point where two bones make contact. Joints can
176. (b) High partial pressure of oxygen, Less H+ be classified either histologically or functionally. Histological
concentration, low partial pressure of carbon dioxide and classification is based on the dominant type of connective tissue,
low temperature are the favourable conditions required and functional classification is based on the amount of movement
permitted. Histologically the three joints in the body are fibrous,
for the formation of oxyhaemoglobin. cartilaginous, and synovial. Functionally the three types of joints
are synarthrosis (immovable), amphiarthrosis (slightly moveable),
and diarthrosis (freely moveable). The two classification schemes
can be correlated: synarthroses are fibrous, amphiarthroses are
cartilaginous, and diarthroses are synovial.
 2024-34 NEET Solved Paper
185. (c) It is not necessary that hymen is torn during the first Characteristics of Non-Chordates
coitus only it can be torn due to sudden jolt, insertion of Enzymes are mostly proteins. They have a primary structure
a vaginal tampon, active participation in some sports and i.e. linear chain of amino acids, which eventually form a
in some women the hymen persists even after coitus. three-dimensional shape. An enzyme like any protein has
186. (d) Gause’s competitive exclusion principle states secondary and tertiary structures. In tertiary structure,
that two closely related species competing for the same the protein chains fold upon themselves, and the chain
resources cannot exist indefinitely. Due to the competition crisscrosses upon itself which creates many pockets or
the superior species will outnumber the inferior one crevices. One such pocket is known as the ‘active site’ or
leading to their elimination. the substrate-binding site. The substrate fits into a pocket
187. (a) A-IV, B-II, C-III, D-I or crevice which is the active site of an enzyme. Thus, the
188. (c) Perforated pharyngeal gill slits and dorsal central active site of an enzyme catalyzes the biochemical reactions
nervous system are the characteristics of chordates. at a high rate. The enzymes are able to break the bigger
Characteristics of Non-Chordates molecule into simpler molecules or vice versa. Enzymes
Non-chordates exhibit a wider range of body symmetries get damaged at high temperatures (above 40oc) and high
compared to chordates: pressure, resulting in loss of enzyme activity. Thermal
• They are cold-blooded.
• They can be acoelomates, pseudocoelomates, and stability is thus an important factor of such enzymes.
coelomates. 193. (a)
• Also, their germ layer can be diploblastic or
triploblastic. (A) represents FSH (Follicle stimulating hormone) acts
• Post-anal tail is absent. on sertoli cells in males.
• Exoskeleton is present while the endoskeleton is absent. (B) represents Leydig cells involved in synthesis of
• The regeneration power of non-chordates is good.
• They have a protoplasmic to organ system level of
androgens.
organization. (C) represents Sertoli cells plays vital role in secretion
• The gut is present dorsal to the nerve cord. of factors inovolved in spermiogenesis.
• Anus is generally absent. If present, it opens on the
(D) represents Spermiogenesis, the process of formation
last segment.
• Respiration in non-chordates occurs through diffusion of sperms from spermatozoa.
across the body surface. 194. (d) A-III, B-I, C-IV, D-II
• Gill slits are absent. 195. (c) A-III, B-IV, C-I, D-II
189. (c) Juxta medullary nephrons have Renal corpuscle in 196. (d) A-IV, B-III, C-I, D-II
inner cortical region. Their loop of Henle lies deep in 197. (a) Genotype of child with blood group O+ = ii
medulla and they are fewer in number as compared to So, genotype of father with blood group B+ will be =
cortical nephrons. IBi and genotype of mother with blood group A+ will be
190. (c) Mid brain, pons and medulla oblongata forms the =IAi
brain stem. So only ‘A’ is correct.
191. (a) Both statement I and II are correct. 198. (b) A-III, B-II, C-IV, D-I
192. (a) The correct sequence of catalytic cycle of an enzyme An electrocardiogram (ECG or EKG) is one of the simplest
action is: and fastest tests used to evaluate the heart. Electrodes
(small, plastic patches that stick to the skin) are placed at
(1) The substrate binds to the active site of the enzyme. certain spots on the chest, arms, and legs. The electrodes are
(2) The binding of the substrate causes the change in connected to an ECG machine by lead wires. The electrical
shape of the enzyme to alter its shape. activity of the heart is then measured, interpreted, and
printed out. No electricity is sent into the body.
(3) Chemical bonds break and Enzyme Product complex
is formed. 199. (c) The inner membrane of mitochondria is relatively
(4) Product is released by enzyme and enzyme becomes more permeable, as compared to chloroplast.
ready for the next substrate. 200. (d) A-III, B-IV, C-I, D-II