Hindawi Publishing Corporation

Evidence-Based Complementary and Alternative Medicine

Volume 2011, Article ID 952031, 10 pages
doi:10.1093/ecam/nep241

Original Article
Anti-Obesity and Anti-Diabetic Effects of Acacia Polyphenol in
Obese Diabetic KKAy Mice Fed High-Fat Diet

Nobutomo Ikarashi, Takahiro Toda, Takehiro Okaniwa, Kiyomi Ito, Wataru Ochiai,
and Kiyoshi Sugiyama
Department of Clinical Pharmacokinetics, Hoshi University, Tokyo, Japan

Correspondence should be addressed to Kiyoshi Sugiyama, [email protected]

Received 13 October 2009; Accepted 12 December 2009

Copyright © 2011 Nobutomo Ikarashi et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.

Acacia polyphenol (AP) extracted from the bark of the black wattle tree (Acacia meansii) is rich in unique catechin-like flavan-
3-ols, such as robinetinidol and fisetinidol. The present study investigated the anti-obesity/anti-diabetic effects of AP using obese
diabetic KKAy mice. KKAy mice received either normal diet, high-fat diet or high-fat diet with additional AP for 7 weeks. After the
end of administration, body weight, plasma glucose and insulin were measured. Furthermore, mRNA and protein expression of
obesity/diabetic suppression-related genes were measured in skeletal muscle, liver and white adipose tissue. As a result, compared
to the high-fat diet group, increases in body weight, plasma glucose and insulin were significantly suppressed for AP groups.
Furthermore, compared to the high-fat diet group, mRNA expression of energy expenditure-related genes (PPARα, PPARδ, CPT1,
ACO and UCP3) was significantly higher for AP groups in skeletal muscle. Protein expressions of CPT1, ACO and UCP3 for AP
groups were also significantly higher when compared to the high-fat diet group. Moreover, AP lowered the expression of fat acid
synthesis-related genes (SREBP-1c, ACC and FAS) in the liver. AP also increased mRNA expression of adiponectin and decreased
expression of TNF-α in white adipose tissue. In conclusion, the anti-obesity actions of AP are considered attributable to increased
expression of energy expenditure-related genes in skeletal muscle, and decreased fatty acid synthesis and fat intake in the liver.
These results suggest that AP is expected to be a useful plant extract for alleviating metabolic syndrome.

1. Introduction actions [10–12], anti-cancer actions [13, 14] and anti-allergic

actions [15]. While polyphenol-rich AP may possess various
Acacia is an evergreen tree belonging to the genus Acacia in pharmacological actions like other polyphenols, no studies
the family legume, and is widely found in the Australian and have yet clarified the pharmacological actions of AP.
African continents. The extract of Acacia catechu duramen In the present study, to investigate the anti-obesity and
is called gambir, and has long been used as an astringent anti-diabetic actions of AP, a high-fat diet was administered
and anti-bacterial to treat stomatitis and diarrhea in Japan to KKAy mice, an obese type-II diabetes model, to induce
and China. Studies have also reported that the powdered severe obesity and diabetes. The effects of AP on obesity
seeds of Acacia catechu and Acacia milanoxylon exhibit and diabetes were then studied. To elucidate the mechanisms
hypoglycemic actions by increasing insulin secretion in non- underlying the suppression of obesity and diabetes, the
diabetic rats and rabbits [1, 2]. Furthermore, in Europe, effects of AP on the expression of genes related to obesity
acacia polyphenol (AP) extracted from the bark of the black and diabetes suppression in skeletal muscle, liver and white
wattle tree (Acacia meansii) has been used to eliminate wine adipose tissue were investigated.
sediment. Australian aborigines also eat the young leaves and
beans of Acacia mollissima.
AP is rich in unique catechin-like flavan-3-ols, such as 2. Materials and Methods
robinetinidol and fisetinidol [3–6]. In recent years, polyphe-
nols have been reported to possess various pharmacological 2.1. Hot Water Extraction from Acacia Bark. AP was donated
actions, including anti-obesity actions [7–9], anti-diabetic by Mimozax Co., Ltd. (Hiroshima, Japan), and was prepared
2 Evidence-Based Complementary and Alternative Medicine

according to the methods reported by Cutting [16]. Briefly, 2.5. Homeostasis Model Assessment of Insulin Resistance
the powdered bark of South African A. mollissima was Index. Homeostasis model assessment of insulin resistance
pulverized and extracted for 30 min in a 10-fold volume of (HOMA-IR), an index of insulin resistance, was calculated
hot water (100◦ C) and then dried using a spray drier. The according to the following equation using fasting insulin and
polyphenol content of the present product as measured by glucose concentrations [22]:
the Stiasny reaction was 79.0% [17–19]. Average molecular  
weight of AP is 1250 (300–3000) [20, 21], and robinetinidol HOMA-IR = fasting insulin μU ml−1
and fisetinidol are the major ingredients [3–6]. (1)
 
−1
× fasting glucose mmol l /22.5.
2.2. Materials. Powdered regular low-fat diet (LF) (10%
lard, D12450B) and powdered high-fat diet (HF) (60% 2.6. Measurement of Liver Triglyceride/Cholesterol Content.
lard, D12492) were purchased from Research Diets (New Liver triglyceride and cholesterol content were measured as
Brunswick, NJ, USA). Primers were purchased from Invitro- described previously [23, 24]. Briefly, a portion (100 mg)
gen (Tokyo, Japan). The ECL Plus Western Blotting Detec- of liver tissue was homogenized in phosphate buffer saline
tion System was purchased from GE Healthcare (Chalfont (pH 7.4, 1 ml). The homogenate (0.2 ml) was extracted
St Giles, UK). Anti-rabbit ACO antibody and anti-rabbit with isopropyl alcohol (1 ml), and the extract was analyzed
UCP3 antibody were purchased from Abcam (Cambridge, using a Triglyceride E-Test (Wako Pure Chemical Industries)
UK). Anti-rabbit CPT1 antibody was purchased from Santa to determine liver triglyceride content. The homogenate
Cruz Biotechnology (Santa Cruz, CA, USA). Anti-rabbit β- (0.2 ml) was extracted with chloroform-methanol (2 : 1,
actin antibody was purchased from BioLegend (San Diego, 1 ml), and the extract was concentrated under a nitrogen
CA, USA). Anti-rabbit IgG (whole molecule) peroxidase stream. The residue was dissolved in isopropyl alcohol and
conjugate was purchased from Sigma-Aldrich (St Louis, MO, analyzed using a Cholesterol E-Test (Wako Pure Chemical
USA). All other reagents were of the highest commercially Industries).
available grade.
2.7. Preparation of Slide for Histopathology
2.3. Animals, Diets and Treatment. Male KKAy mice (5-
weeks old) were purchased from Clea Japan (Tokyo, Japan). 2.7.1. Hematoxylin—Eosin Staining. Liver and epididymal
Each mouse was caged separately and kept at room tem- fat were fixed in 10% neutral-buffered formalin. After
perature (22 ± 1◦ C) and 55 ± 10% humidity with 12 h of trimming the tissues, liver and epididymal fat were embed-
light (artificial illumination: 08 : 00–20 : 00). Mice that had ded in paraffin using a tissue processor. Sections were
been acclimatized for 1 week were divided into four groups. taken in 3-4 μm thicknesses, and stained with HE solution
Each group was provided with ad libitum access to either for microscopy. Average surface area for epididymal white
LF, HF, HF containing 2.5% (w/w) AP (HF/AP 2.5%) adipocytes was measured using Image J software (National
or HF containing 5.0% (w/w) AP (HF/AP 5.0%) for 7 Institute of Mental Health, Bethesda, MD, USA) [25, 26].
weeks. Food intake was measured once weekly. Following
this feeding period, after 17 h of fasting, a blood sample 2.7.2. Oil red O Staining. After frozen liver sections about
was collected using heparin from the abdominal vena cava 7 μm thick were prepared using a cryostat apparatus, oil red
under diethyl ether-induced anesthesia. The liver, white O staining was conducted for microscopy.
adipose tissue (around the testes, retroperitoneum and
kidney) and skeletal muscle were also removed and placed 2.8. RNA Preparation from Tissue Samples. RNA was
in either neutral-buffered formalin or liquid nitrogen. The extracted from about 50 mg of frozen skeletal muscle using
present study was conducted in accordance with the Guiding TRI reagent. RNA was extracted from about 15 mg of frozen
Principles for the Care and Use of Laboratory Animal, as liver using the RNeasy Mini Kit. RNA was extracted from
adopted by the Committee on Animal Research at Hoshi about 75 mg of frozen epididymal white adipose tissue using
University. the RNeasy Lipid Tissue Mini Kit. RNA extraction was
performed according to the protocol for the TRI Reagent,
2.4. Blood Analysis. Blood samples were centrifuged (1000 g RNeasy Mini Kit and RNeasy Lipid Tissue Mini Kit. The
for 15 min at 4◦ C), and plasma stored at −80◦ C until resulting solution was diluted 50-fold using TE buffer, and
assay. Plasma glucose concentrations were enzymatically purity was confirmed and RNA concentration (μg ml−1 ) was
quantified using a Glucose CII Test (Wako Pure Chemical calculated by measuring absorbance at 260 and 280 nm using
Industries, Osaka, Japan). Plasma insulin concentrations a U-2800 spectrophotometer (Hitachi High Technologies,
were measured according to the protocol described by the Tokyo, Japan).
manufacturer of the Mouse Insulin ELISA Kit (Shibayagi,
Gunma, Japan). Plasma glutamate oxalacetate transaminase 2.9. Real-time RT-PCR. A high-capacity cDNA synthesis
(GOT) and glutamate pyruvate transaminase (GPT) concen- kit was used to synthesize cDNA from 1 μg of RNA. TE
trations were quantified using Transaminase CII Test (Wako buffer was used to dilute the cDNA 20-fold to prepare
Pure Chemical Industries). cDNA TE buffer solution. The expression of target genes
Evidence-Based Complementary and Alternative Medicine 3

Table 1: Primer sequences of mouse mRNA.

Target Accession number Forward primer (5 –3 ) Reverse primer (5 –3 ) Amplicon size (bp)
PPARα NM 011144 GTACGGTGTGTATGAAGCCATCTT GCCGTACGCGATCAGCAT 76
PPARδ NM 011145 GCCATATTCCCAGGCTGTC CAGCACAAGGGTCATCTGTG 102
CPT1 NM 013495 GTGACTGGTGGGAGGAATAC GAGCATCTCCATGGCGTAG 83
ACO NM 015729 GTGCAGCTCAGAGTCTGTCCAA TACTGCTGCGTCTGAAAATCCA 112
UCP3 NM 009464 CCAGAGCATGGTGCCTTCGCT CTCGTGTCAGCAGCAGTG 84
GLUT4 NM 009204 GGAAGGAAAAGGGCTATGCTG TGAGGAACCGTCCAAGAATGA 115
SREBP-1c NM 011480 ACGGAGCCATGGATTGCACA AAGGGTGCAGGTGTCACCTT 278
ACC NM 133360 ATGGGCGGAATGGTCTCTTTC TGGGGACCTTGTCTTCATCAT 148
FAS NM 007988 TGCTCCCAGCTGCAGGC GCCCGGTAGCTCTGGGTGTA 107
PPARγ NM 011146 CCAGAGCATGGTGCCTTCGCT CAGCAACCATTGGGTCAGCTC 241
LPL NM 008509 CCACAGCAGCAAGACCTTC AGGGCGGCCACAAGTTTG 87
Adiponectin NM 009605 GAGATGCAGGTCTTCTTGGTC GCTCTCCTTTCCTGCCAG 105
TNF-α NM 013693 AAGCCTGTAGCCCACGTCGTA GGCACCACTAGTTGGTTGTCTTTG 122
β-Actin NM 007393 GAGCGCAAGTACTCTGTGTG CGGACTCATCGTACTCCTG 97
PPARα, peroxisome proliferator-activated receptor α; PPARδ, peroxisome proliferator-activated receptor δ; CPT1, carnitine palmitoyl-transferase1; ACO,
acyl CoA oxidase; UCP3, uncoupling protein3; GLUT4, glucose transporter4; SREBP-1c, sterol regulatory element-binding protein-1c; ACC, acetyl-CoA
carboxylase; FAS, fatty acid synthase; PPARγ, peroxisome proliferator-activated receptor γ; LPL, lipoprotein lipase; TNF-α, tumor necrosis factor-α.

was detected by preparing primers listed in Table 1 and (AE-7500, ATTO Corp.). After blocking for 1 h using 1.0%
performing real-time RT-PCR. To each well of a Multiplate skim milk, the resulting membrane was reacted for 1 h at
PCR Plates 96-well clear (Bio-Rad Laboratories), 25 μl of room temperature with anti-rabbit CPT1 antibody (1 : 100),
iQ SYBR Green Supermix, 3 μl of forward primer of target ACO antibody (1 : 200), UCP3 antibody (1 : 1,000) or β-
gene (5 pmol μl−1 ), 3 μl of reverse primer (5 pmol μl−1 ), 4 μl actin antibody (1 : 200). After washing the membrane using
of cDNA TE buffer solution and 15 μl of RNase-free water TBS-TWEEN (Tris-HCl 20 mM, NaCl 137 mM and Tween
were added. With regard to β-actin, a housekeeping gene, 20 0.1%, pH 7.6), the resulting membrane was reacted for
4 μl of a cDNA TE buffer solution that was prepared by 1 h at room temperature with anti-rabbit IgG peroxidase
diluting above-mentioned solution 20-fold using TE buffer conjugate. After washing, the membrane was reacted with
was used. Denaturation temperature was set at 95◦ C for the ECLplus detection reagent and visualized with an
15 s, annealing temperature at 56◦ C for 30 s and elongation LAS-3000 mini luminoimage analyzer (Fuji Film, Tokyo,
temperature at 72◦ C for 30 s. Fluorescence intensity of the Japan). Protein levels were normalized against β-actin. All
amplification process was monitored using the My iQTM protein expressions are given as percentages compared to the
Single Color Real-time RT-PCR Detection System (Bio-Rad LF group (100%).
Laboratories). mRNA expressions were normalized using β-
actin. All mRNA expressions were expressed in relation to the 2.11. Statistical Analysis. Numerical data are expressed as
average expression of the LF group (100%). means ± standard deviation. The significance of differences
was examined using ANOVA, followed by Tukey’s test. Values
2.10. Western Blotting Analysis. Leg muscle (100 mg) was of P < .05 were considered significant.
homogenized using dissecting buffer (0.3 M sucrose, 25 mM
imidazole, 1 mM EDTA, pH 7.2, containing 8.5 μM leu- 3. Results
peptin, and 1 mM phenylmethylsulfonyl fluoride), and the
homogenates were centrifuged at 500 g for 10 min at 4◦ C 3.1. Body Weight and Visceral Fat Accumulation. During the
[27, 28]. Total protein content in the supernatants was 7-week experimental period, food intake was measured once
determined by the Lowry method [29] using bovine serum weekly. Mean energy intake was significantly higher for the
albumin as a standard. HF group than for the LF group. No significant difference
Electrophoresis was performed using the method existed in energy intake between the HF, HF/AP 2.5% and
described by Laemmli [30]. Using the loading buffer (84 HF/AP 5.0% groups (Table 2).
mM Tris, 20% glycerol, 0.004% bromophenol blue, pH At the end of administration, body weight was signifi-
6.3, 4.6% SDS and 10% 2-mercaptoethanol), protein was cantly higher for the HF group than for the LF group. AP
diluted 2-fold, boiled for 5 min and applied to 12.5% administration significantly suppressed HF-induced body
polyacrylamide gel (ATTO Corp., Tokyo, Japan). After weight increases. In particular, the degree of body weight
electrophoresis, the isolated proteins were transferred to increase was comparable between the HF/AP 5.0% and LF
a PVDF membrane (ATTO Corp.) using CompactBLOT groups (Table 2).
4 Evidence-Based Complementary and Alternative Medicine

Table 2: Body weight gain, and plasma and hepatic biochemistry of mice fed on the experimental diets for 7 weeks.

LF HF HF/AP 2.5% HF/AP 5.0%

Food intake (g/mouse/day) 5.1 ± 0.9 4.5 ± 0.6 4.6 ± 0.5 4.4 ± 0.5
Energy intake (kcal/mouse/day) 19.4 ± 3.6 23.3 ± 3.2∗ 23.5 ± 2.8∗ 22.0 ± 2.9∗
Pre-diet body weight (g) 31.3 ± 1.2 30.9 ± 1.1 31.5 ± 1.6 31.1 ± 1.0
Post-diet body weight (g) 39.7 ± 2.4 51.4 ± 2.5∗∗ 45.7 ± 4.7∗∗,## 39.5 ± 1.6##
Body weight gain (g) 8.4 ± 1.9 20.5 ± 2.0∗∗ 14.2 ± 4.3∗∗,## 8.4 ± 1.9##
Whole WAT (g) 3.14 ± 0.60 4.66 ± 0.34∗∗ 4.00 ± 0.35∗∗,## 3.37 ± 0.54##
Epididymal WAT (g) 1.63 ± 0.23 1.97 ± 0.21∗ 1.77 ± 0.22# 1.70 ± 0.22#
Retroperitoneal WAT (g) 0.96 ± 0.28 1.57 ± 0.21∗∗ 1.31 ± 0.19∗∗ 0.94 ± 0.19##
Perirenal WAT (g) 0.66 ± 0.14 1.35 ± 0.19∗∗ 0.91 ± 0.19∗,## 0.76 ± 0.23##
Liver weight (g) 1.85 ± 0.22 3.27 ± 0.44∗∗ 1.83 ± 0.40## 1.26 ± 0.13∗∗,##
Liver triglyceride (mg g−1 liver) 78.0 ± 13.8 156.5 ± 11.9∗∗ 82.2 ± 4.5## 39.5 ± 6.1∗∗,##
Liver cholesterol (mg g−1 liver) 2.3 ± 0.4 4.4 ± 0.7∗∗ 1.0 ± 0.6∗∗,## 0.9 ± 0.4∗∗,##
Glucose concentration (mmol l−1 ) 6.7 ± 2.1 20.8 ± 4.4∗∗ 8.4 ± 3.2## 5.6 ± 1.5##
Insulin concentration (μU ml−1 ) 22.7 ± 16.5 171.5 ± 120.9∗∗ 42.7 ± 33.4## 28.8 ± 13.0##
HOMA-IR 7.5 ± 3.9 139.9 ± 81.6∗∗ 20.6 ± 17.3## 7.7 ± 5.4##
GOT concentration (U l−1 ) 42.7 ± 14.8 176.3 ± 77.9∗∗ 82.2 ± 59.5# 64.8 ± 29.6#
GPT concentration (U l−1 ) 16.8 ± 5.0 56.7 ± 14.0∗∗ 12.2 ± 3.0## 19.8 ± 7.8##
KKAy mice were given a low-fat diet (LF), a high-fat diet (HF), HF containing 2.5% AP (HF/AP 2.5%) or HF containing 5.0% AP (HF/AP 5.0%) for 7 weeks.
After measuring body weight, white adipose tissue and liver were removed and weighed, and levels of liver triglyceride and cholesterol were measured. Blood
samples were also collected to measure glucose, insulin, GOT and GPT levels. HOMA-IR was calculated from glucose and insulin levels after overnight fasting.
Food intake was measured once weekly. Details of the diets are given in the “Materials and Methods” section. Data represent means ± SDs of 10 mice per group.
Tukey’s test: ∗ P < .05 versus LF; ∗∗ P < .01 versus LF; # P < .05 versus HF; ## P < .01 versus HF.

Furthermore, visceral white adipose tissue weight was and GPT. Plasma glucose and plasma insulin levels were
significantly higher for the HF group than for the LF group. significantly higher for the HF group than for the LF group.
AP significantly suppressed this increase in a dose-dependent Conversely, plasma glucose and insulin levels for the AP
manner (Table 2). groups decreased to levels similar to those for the LF group,
HE staining of epididymal white adipose tissue showed and HOMA-IR index in the HF/AP 2.5% and HF/AP 5.0%
that mature adipocytes for the HF group were hypertro- groups was significantly decreased compared to the HF
phied, with numerous immature adipocytes in the stroma. group. Plasma GOT and GPT, indicators of hepatopathy,
Conversely, HF-induced hypertrophy of mature adipocytes were significantly higher for the HF group than for the LF
was not seen for the HF/AP 5.0% group, and the size group. AP administration significantly suppressed increases
of adipocytes and number of immature adipocytes were in GOT and GPT.
comparable to those for the LF group (Figure 1).
3.4. mRNA and Protein Expression in the Skeletal Muscle.
3.2. Liver Lipid Accumulation. Table 2 shows liver weight Real-time RT-PCR was performed to measure the mRNA
and liver lipid content. At the end of administration, liver expression of energy expenditure-related genes (peroxisome
weight was about 1.8 times greater for the HF group than for proliferator-activated receptor (PPAR)α, PPARδ, carnitine
the LF group. In addition, liver triglyceride and cholesterol palmitoyl-transferase 1 (CPT1), acyl CoA oxidase (ACO) and
levels were significantly higher for the HF group when uncoupling protein 3 (UCP3)) and glucose transporter 4
compared to the LF group. For both HF/AP 2.5% and HF/AP (GLUT4) in skeletal muscle, an important organ for energy
5.0% groups, increased liver weight and triglyceride and expenditure (Figure 3). No significant difference existed in
cholesterol accumulation were significantly suppressed. all genes between LF and HF groups. The mRNA expression
The liver was subjected to HE staining and oil red O of PPARα for the HF/AP 5.0% group was significantly
staining, and the HF group displayed large fat droplets higher (1.5 times) than that for the HF group. In addition,
throughout liver lobules. However, HF/AP 2.5% and HF/AP mRNA expression of PPARδ for the HF/AP 2.5% and HF/AP
5.0% groups showed smaller fat droplets in individual 5.0% groups was 1.8 and 2.0 times higher when compared
hepatocyte and fewer fat droplets throughout liver lobules, to the HF group. Moreover, AP significantly increased
thus indicating suppression of fatty liver (Figure 2). mRNA expression of CPT1, ACO and UCP3. In particular,
compared to the HF group, mRNA expression of UCP3 for
the HF/AP 2.5% and HF/AP 5.0% groups was about 2 and
3.3. Plasma Glucose, Insulin, GOT and GPT Concentration. 3 times greater, respectively. AP administration increased
Table 2 shows fasting plasma glucose, plasma insulin, GOT mRNA expression of GLUT4 (abundantly expressed in
Evidence-Based Complementary and Alternative Medicine 5

LF 12000
HF ∗∗

10000

Mean adipocyte surface area (μm2 )

##
8000

##
6000
HF/AP 2.5% HF/AP 5.0%

4000

2000

0
LF HF AP 2.5% AP 5.0%
HF
(a) HE Staining (b) Adipocyte area

Figure 1: Histology of epididymal adipose tissue (a) and mean adipocyte surface area (b). KKAy mice were given a LF, a HF, HF containing
2.5% AP (HF/AP 2.5%) or HF containing 5.0% AP (HF/AP 5.0%) for 7 weeks. White adipose tissue around the testis was removed, fixed
in 10% neutral-buffered formalin, paraffinized and stained using HE (a). Mean surface area for epididymal white adipocytes was measured
using Image J software (b). Details of the diets are given in the “Materials and Methods” section. Data represent means ± SDs for seven
sections per group. Tukey’s test: ∗∗ P < .01 versus LF; ## P < .01 versus HF.

LF LF skeletal muscle), and mRNA expression of GLUT4 for the

HF/AP 5.0% group was about double that for the HF group.
Protein expressions of CPT1, ACO and UCP3 were
quantified by western blotting, and AP administration
significantly increased the expression of all proteins (Figure
4). These increases also correlated to increased mRNA
HF HF expressions.

3.5. mRNA Expression in the Liver. In the liver, expressions of

fatty acid synthesis-related genes (sterol regulatory element-
binding protein (SREBP)-1c, acetyl-CoA carboxylase (ACC)
HF/AP 2.5% HF/AP 2.5% and fatty acid synthase (FAS)), a fatty acid decomposition-
related gene (PPARα) and fat intake-related genes (PPARγ
and lipoprotein lipase (LPL)) were measured by real-time
RT-PCR (Figure 5). The mRNA expressions of SREBP-1c,
ACC and FAS were significantly lower for HF/AP 2.5% and
HF/AP 5.0% groups than for the HF group. In addition,
HF/AP 5.0% HF/AP 5.0%
mRNA expression of PPARα was significantly higher for the
HF/AP 2.5% and HF/AP 5.0% groups than for the HF group.
Furthermore, mRNA expressions of PPARγ and LPL, which
are related to liver fat accumulation, were significantly lower
when compared to the HF group.
(a) HE Staining (b) Oil red O staining
3.6. mRNA Expression in White Adipose Tissue. The mRNA
Figure 2: Representative histological sections of liver stained with
expressions of adipocytokines (adiponectin and tumor
HE (a) or oil red O (b). KKAy mice were given a LF, a HF, HF
containing 2.5% AP (HF/AP 2.5%) or HF containing 5.0% AP necrosis factor (TNF)-α), which are produced in white adi-
(HF/AP 5.0%) for 7 weeks. The liver was removed, fixed in 10% pose tissue and play important roles in obesity and diabetes,
neutral-buffered formalin, paraffinized and stained using HE (a). A and PPARγ were measured by real-time RT-PCR (Figure 6).
cryostat was also used to prepare tissue sections for staining with The results showed that mRNA expression of adiponectin
oil red O (b). Details of the diets are given in the “Materials and was significantly lower for the HF group than for the LF
Methods” section. group, while mRNA expression of TNF-α was significantly
6 Evidence-Based Complementary and Alternative Medicine

PPARδ
PPARα CPT1
∗∗.## ∗∗.##
Relative mRNA expression

Relative mRNA expression

Relative mRNA expression

∗∗.#
200 200 200 ∗.##
150 150 150
(% of LF)

(% of LF)

(% of LF)
100 100 100

50 50 50

0 0 0
LF HF AP 2.5%AP 5.0% LF HF AP 2.5%AP 5.0% LF HF AP 2.5%AP 5.0%
HF HF HF
(a) (b) (c)

UCP3 ∗∗.##
ACO Relative mRNA expression 250 GLUT4 ∗∗.##
Relative mRNA expression

Relative mRNA expression

∗∗.##
200 ∗∗.## 200
200 ∗.## #
150 150
(% of LF)
(% of LF)

(% of LF)
150
100 100
100
50 50 50

0 0 0
LF HF AP 2.5%AP 5.0% LF HF AP 2.5%AP 5.0% LF HF AP 2.5%AP 5.0%
HF HF HF
(d) (e) (f)

Figure 3: Effect of acacia polyphenol on mRNA expression in skeletal muscle. KKAy mice were given a LF, HF, HF containing 2.5% AP
(HF/AP 2.5%) or HF containing 5.0% AP (HF/AP 5.0%) for 7 weeks. Skeletal muscle was removed, and mRNA expressions were measured
using real-time RT-PCR, using β-actin as a housekeeping gene. All mRNA expressions are given as percentages compared to the LF group
(100%). Details of the diets are given in the “Materials and Methods” section. Data represent means ± SDs for six mice per group. Tukey’s
test: ∗ P <.05 versus LF; ∗∗ P < .01 versus LF; # P < .05 versus HF; ## P < .01 versus HF.

CPT1

ACO

UCP3

β-actin

LF HF HF/AP 2.5% HF/AP 5.0%

(a)
CPT1 ACO UCP3
250 ∗∗.#
250 400
Relative protein expression

Relative protein expression

Relative protein expression

∗∗.##
∗∗.#
200 200
300
(% of LF)

(% of LF)

(% of LF)

150 150 ∗∗.##

200
100 100
100
50 50

0 0 0
LF HF AP 2.5%AP 5.0% LF HF AP 2.5%AP 5.0% LF HF AP 2.5%AP 5.0%
HF HF HF
(b) (c) (d)

Figure 4: Effect of acacia polyphenol on protein expression of CPT1, ACO and UCP3 in skeletal muscle. KKAy mice were given a LF, a
HF, HF containing 2.5% AP (HF/AP 2.5%) or HF containing 5.0% AP (HF/AP 5.0%) for 7 weeks. The skeletal muscle was removed, and
protein expression was measured by western blotting, using β-actin as a housekeeping gene. All protein expressions are given as percentages
compared to the LF group (100%). Details of the diets are given in the “Materials and Methods” section. Data represent means ± SDs for six
mice per group. Tukey’s test: ∗∗ P < .01 versus LF; # P < .05 versus HF; ## P < .01 versus HF.
Evidence-Based Complementary and Alternative Medicine 7

SREBP-1c ACC FAS

Relative mRNA expression

Relative mRNA expression

Relative mRNA expression

140 120 120
120 100 100
100 ∗∗

(% of LF)
(% of LF)

80 80

(% of LF)
80 ∗
60 ∗∗.## ∗∗.## 60 ∗∗.#
60 ∗∗.## ∗∗.##
40 40 40
20 20 20
0 0 0
LF HF AP 2.5% AP 5.0% LF HF AP 2.5% AP 5.0% LF HF AP 2.5% AP 5.0%
HF HF HF
(a) (b) (c)

PPARα PPARγ LPL

Relative mRNA expression

Relative mRNA expression

700 Relative mRNA expression 300 ∗∗ 140
600 ∗∗.## 120
250
500 100
(% of LF)

(% of LF)
(% of LF)
200
400 ∗∗ ∗∗ 80
150
300 60 ∗∗.## ∗∗.##
100 40
200
100 50 ∗.## ∗.## 20
0 0 0
LF HF AP 2.5% AP 5.0% LF HF AP 2.5% AP 5.0% LF HF AP 2.5% AP 5.0%
HF HF HF
(d) (e) (f)

Figure 5: Effect of acacia polyphenol on mRNA expression in the liver. KKAy mice were given a LF, a HF, HF containing 2.5% AP (HF/AP
2.5%) or HF containing 5.0% AP (HF/AP 5.0%) for 7 weeks. The liver was removed and mRNA expression was measured by real-time
RT-PCR using β-actin as a housekeeping gene. All mRNA expressions are given as percentages compared to the LF group (100%). Details of
the diets are given in the “Materials and Methods” section. Data represent means ± SDs for six mice per group. Tukey’s test: ∗ P < .05 versus
LF; ∗∗ P < .01 versus LF; # P < .05 versus HF; ## P < .01 versus HF.

Adiponectin TNF-α PPARγ

Relative mRNA expression
Relative mRNA expression

Relative mRNA expression

250 250 ∗ 120

## 100
200 200
(% of LF)

80
(% of LF)

(% of LF)

150 150 ## 60
100 100 ∗∗.##
∗∗ ## 40
50 ∗∗ 50 20 ∗∗
∗∗
0 0 0
LF HF AP 2.5% AP 5.0% LF HF AP 2.5% AP 5.0% LF HF AP 2.5% AP 5.0%
HF HF HF
(a) (b) (c)

Figure 6: Effect of acacia polyphenol on mRNA expression in epididymal white adipose tissue. KKAy mice were given a LF, HF, HF containing
2.5% AP (HF/AP 2.5%) or HF containing 5.0% AP (HF/AP 5.0%) for 7 weeks. White adipose tissue around the testis was removed, and
mRNA expression was measured by real-time RT-PCR, using β-actin as a housekeeping gene. All mRNA expressions are given as percentages
compared to the LF group (100%). Details of diets are given in the “Materials and Methods” section. Data represent means ± SDs for six
mice per group. Tukey’s test: ∗ P < .05 versus LF; ∗∗ P < .01 versus LF; ## P < .01 versus HF.

higher. Conversely, mRNA expression of adiponectin was 4. Discussion

significantly higher for the HF/AP 2.5% and HF/AP 5.0%
groups in a dose-dependent manner when compared to the The anti-obesity effects of AP, a new polyphenol, were
HF group, but mRNA expression of TNF-α was significantly investigated using KKAy mice as a model of obese type-II
lower. In particular, expression of TNF-α was significantly diabetes. When fed a normal diet, KKAy mice develop obesity
lower for the HF/AP 5.0% group when compared to the LF and type-II diabetes by 12-weeks old [31], and these mice
group. The mRNA expression of PPARγ for the HF group are thus widely used for research into obesity and diabetes
was significantly lower (about 90% lower) compared to the [32, 33]. In the present study, lard was administered to 6-
LF group. AP administration significantly accentuated this week-old KKAy mice for 7 weeks to induce severe obesity and
decrease in mRNA expression in a dose-dependent manner. diabetes and the effects of AP were evaluated. Lard is widely
8 Evidence-Based Complementary and Alternative Medicine

Acacia
polyphenol

Skeletal muscle White adipose tissue Liver

Energy expenditure
Energy expenditure Adiponectine
Fatty acid synthesis
Glucose intake TNF-α
Fat intake

Anti-obesity action
Anti-diabetic action

Figure 7: Hypothetical mechanisms of anti-obesity/diabetic actions of acacia polyphenol.

used in studies on obesity and diabetes [34, 35]. AP was anti-obesity actions [37–40]. This suggests that AP acts on
found to significantly suppress increases in body weight and skeletal muscle and liver to increase energy expenditure.
white adipose tissue weight, showing anti-obesity actions Furthermore, AP decreased mRNA expression of ACC and
(Table 2, Figure 1). HF also increased liver fat accumulation FAS, the rate-limiting enzymes of fatty acid synthesis in the
and induced fatty liver, but AP administration lowered liver, and mRNA expression of SREBP-1c, which controls the
fat accumulation, clarifying that AP suppresses fatty liver expression of these enzymes [41]. Furthermore, AP lowered
(Table 2, Figure 2). Furthermore, measurements of plasma the mRNA expression of PPARγ and LPL, which are related
GOT and GPT clarified that AP suppressed fatty liver- to fat intake by the liver (Figure 5). Reduced expressions of
induced hepatopathy (Table 2). Plasma glucose and insulin fatty acid synthetase [9], PPARγ [42, 43] and LPL [44] in
levels were significantly higher for the HF group than for the the liver suppress the onset of obesity and fatty liver. These
LF group, and severe type II diabetes was induced. AP sup- findings indicate that the anti-obesity actions of AP are due
pressed these increases in plasma glucose and insulin levels. to increased expression of energy expenditure-related genes
The HOMA-IR index, a simpler method to measure insulin in skeletal muscle and liver and decreased fatty acid synthesis
sensitivity usually used in clinical and animal studies [22, 36], and fat intake in the liver.
was significantly decreased in AP-treated groups compared Insulin resistance can be generated by decreased
to the HF group, indicating that AP reduced hyperglycemia adiponectin secretion and increased TNF-α secretion [45,
and hyperinsulinemia (Table 2). These findings clarify that 46]. AP increased mRNA expression of adiponectin and
AP suppresses obesity and diabetes caused by a high-fat diet. decreased mRNA expression of TNF-α in white adipose
Obesity is caused by low energy expenditure and tissue (Figure 6). In white adipose tissue, AP administra-
increased fatty acid synthesis from carbohydrates and fat tion significantly increased (by about 5-fold) the mRNA
intake by organs. Therefore, as well as the effects of AP expression of PPARγ, which facilitates the expression of
on the expression of energy expenditure-related genes in adiponectin [47]. Furthermore, AP significantly increased
skeletal muscle and liver, effects on the expression of genes the mRNA expression of GLUT4 in skeletal muscle
related to fatty acid synthesis and fat intake in the liver were (Figure 3). GLUT4 is one of the glucose transporters that
investigated. are frequently expressed in skeletal muscle, and an increase
In skeletal muscle, 7 weeks of AP administration in GLUT4 expression has been known to reduce insulin
significantly increased mRNA and protein expressions of resistance [48]. AP thus reduces hyperglycemia and hyper-
ACO, CPT1 (β-oxidation enzymes) and UCP3 (uncoupling insulinemia, not simply through alleviated obesity, but
protein) compared to the HF group (Figures 3 and 4). AP through increased adiponectin secretion and suppressed
administration also increased mRNA expression of PPARα TNF-α secretion in white adipose tissue, and increased
and PPARδ (nuclear receptors). The mRNA expression of GLUT4 expression in skeletal muscle.
PPARα increased not only in skeletal muscle, but also in liver. Various pharmacological actions of polyphenols have
Activation and elevation of PPARα and PPARδ expression been reported. The AP used in the present study acted on
is known to increase expression of CPT1, ACO and UCP3 skeletal muscle, liver and white adipose tissue and was shown
to elevate energy expenditure, subsequently resulting in to possess anti-obesity and anti-diabetic actions (Figure 7).
Evidence-Based Complementary and Alternative Medicine 9

While many studies have described plant extracts exhibiting [10] A. Ruzaidi, I. Amin, A. G. Nawalyah, M. Hamid, and
anti-obesity and anti-diabetic actions, to the best of our H. A. Faizul, “The effect of Malaysian cocoa extract on
knowledge, none have demonstrated anti-obesity and anti- glucose levels and lipid profiles in diabetic rats,” Journal of
diabetic actions via the modification of energy expenditure- Ethnopharmacology, vol. 98, no. 1-2, pp. 55–60, 2005.
related genes in skeletal muscle. In recent years, selective [11] G. Klein, J. Kim, K. Himmeldirk, Y. Cao, and X. Chen, “Antidi-
PPARδ agonists, such as synthetic GW501516, have been abetes and anti-obesity activity of Lagerstroemia speciosa,”
shown to suppress body weight increase and reduce insulin Evidence-Based Complementary and Alternative Medicine, vol.
resistance in obese diabetic mice [37, 38]. The present study 4, no. 4, pp. 401–407, 2007.
suggests that AP is a plant extract with a novel mechanism of [12] T. Akase, T. Shimada, Y. Harasawa et al., “Preventive effects
action with skeletal muscle as an active site. of Salacia reticulate on obesity and metabolic dixorders in
TSOD mice,” Evidence-Based Complementary and Alternative
Medicine, 2009.
5. Conclusion [13] S. E. Chuang, M. L. Kuo, C. H. Hsu et al., “Curcumin-
containing diet inhibits diethylnitrosamine-induced murine
In KKAy mice with high-fat diet-induced obesity, the anti- hepatocarcinogenesis,” Carcinogenesis, vol. 21, no. 2, pp. 331–
obesity actions of AP appear attributable to increased 335, 2000.
expression of energy expenditure-related genes in skeletal [14] G. Peng, D. A. Dixon, S. J. Muga, T. J. Smith, and M. J. War-
muscle and liver, and decreased fatty acid synthesis and govich, “Green tea polyphenol (-)-epigallocatechin-3-gallate
fat intake in the liver. AP also reduced hyperglycemia inhibits cyclooxygenase-2 expression in colon carcinogenesis,”
and hyperinsulinemia by increasing adiponectin secretion Molecular Carcinogenesis, vol. 45, no. 5, pp. 309–319, 2006.
and suppressing TNF-α secretion by white adipocytes, and [15] T. Enomoto, Y. Nagasako-Akazome, T. Kanda, M. Ikeda, and Y.
elevating the expression of GLUT4 in skeletal muscle in Dake, “Clinical effects of apple polyphenols on persistent aller-
addition to reducing obesity. In the future, AP seems to gic rhinitis: a randomized double-blind placebo-controlled
offer potential as a plant extract that is useful for alleviating parallel arm study,” Journal of Investigational Allergology and
metabolic syndrome. Clinical Immunology, vol. 16, no. 5, pp. 283–289, 2006.
[16] N. J. Cutting, “The development and application of speciality
wattle extracts,” Journal of the Society of Leather Technologies
References and Chemists, vol. 81, no. 3, pp. 89–93, 1997.
[17] E. Stiasny, “Die einwiirkung von formaldehyde auf gerbstoffe,”
[1] K. N. Singh, R. K. Mittal, and K. C. Barthwal, “Hypoglycaemic Der Gerber, vol. 740, pp. 186–188, 1905.
activity of Acacia catechu, Acacia suma, and Albizzia odor-
atissima seed diets in normal albino rats,” Indian Journal of [18] Y. Yazaki, Z. Guangcheng, and S. D. Searle, “Extractives
Medical Research, vol. 64, no. 5, pp. 754–757, 1976. Yields and polyflavanoid contents of Acacia mearnsii Barks in
[2] A. Wadood, N. Wadood, and S. A. W. Shah, “Effects of Acacia Australia,” Australian Forestry, vol. 53, pp. 148–53, 1990.
arabica and caralluma edulis on blood glucose levels of normal [19] Y. Yazaki, R. Gu, Y. Lin, W. Chen, and N. K. Nguyen, “Analyses
and alloxan diabetic rabbits,” Journal of the Pakistan Medical of black wattle (Acacia mearnsii) tannins-relationships among
Association, vol. 39, no. 8, pp. 208–212, 1989. the hide-powder, the Stiasny and the ultra-violet (UV)
[3] D. G. Roux and E. A. Maihs, “Condensed tannins. 3. methods,” Holzforschung, vol. 47, pp. 57–61, 1993.
Isolation and estimation of (-)-7:3 :4 :5 -tetrahydroxyflavan- [20] D. G. Roux and S. R. Evelyn, “Condensed tannins. I. A study
3-ol, (+)-catechin and (+)-gallocatechin from black-wattle- of complex leucoanthocyanins present in condensed tannins,”
bark extract,” Biochemical Journal, vol. 74, pp. 44–49, 1960. Biochemical Journal, vol. 69, pp. 530–538, 1958.
[4] D. G. Roux and E. Paulus, “Condensed tannins. 7. Isolation of [21] D. G. Roux and S. R. Evelyn, “The correlation between struc-
(-)-7:3 :4 -trihydroxyflavan-3-ol [(-)-fisetinidol], a naturally ture and paper chromatographic behaviour of some flavonoid
occurring catechin from black-wattle heartwood,” Biochemical compounds and tannins,” Journal of Chromatography A, vol. 1,
Journal, vol. 78, pp. 120–123, 1961. pp. 537–544, 1958.
[5] D. G. Roux, E. A. Maihs, and E. Paulus, “Condensed tannins. 9. [22] D. R. Matthews, J. P. Hosker, A. S. Rudenski, B. A. Naylor, D. F.
Distribution of flavonoid compounds in the heartwoods and Treacher, and R. C. Turner, “Homeostasis model assessment:
barks of some interrelated wattles,” Biochemical Journal, vol. insulin resistance and beta-cell function from fasting plasma
78, pp. 834–839, 1961. glucose and insulin concentrations in man,” Diabetologia, vol.
[6] S. E. Drewes and D. G. Roux, “Condensed tannins. 15. 28, pp. 412–419, 1985.
Interrelationships of flavonoid components in wattle-bark
extract,” Biochemical Journal, vol. 87, pp. 167–172, 1963. [23] L.-K. Han, Y. Kimura, and H. Okuda, “Reduction in fat storage
[7] L.-K. Han, T. Takaku, J. Li, Y. Kimura, and H. Okuda, “Anti- during chitin-chitosan treatment in mice fed a high-fat diet,”
obesity action of oolong tea,” International Journal of Obesity, International Journal of Obesity, vol. 23, no. 2, pp. 174–179,
vol. 23, no. 1, pp. 98–105, 1999. 1999.
[8] T. Murase, A. Nagasawa, J. Suzuki, T. Hase, and I. Tokimitsu, [24] S. H. Park, S. K. Ko, and S. H. Chung, “Euonymus alatus
“Beneficial effects of tea catechins on diet-induced obesity: prevents the hyperglycemia and hyperlipidemia induced by
stimulation of lipid catabolism in the liver,” International high-fat diet in ICR mice,” Journal of Ethnopharmacology, vol.
Journal of Obesity, vol. 26, no. 11, pp. 1459–1464, 2002. 102, no. 3, pp. 326–335, 2005.
[9] Y. Ohta, M. Sami, T. Kanda, K. Saito, K. Osada, and H. Kata, [25] K. Tsuchiya, H. Sakai, N. Suzuki et al., “Chronic blockade of
“Gene expression analysis of the anti-obesity effect by apple nitric oxide synthesis reduces adiposity and improves insulin
polyphenols in rats fed a high fat diet or a normal diet,” Journal resistance in high fat-induced obese mice,” Endocrinology, vol.
of Oleo Science, vol. 55, pp. 305–314, 2006. 148, no. 10, pp. 4548–4556, 2007.
10 Evidence-Based Complementary and Alternative Medicine

[26] N. H. Rogers, J. W. P. Li, K. J. Strissel, M. S. Obin, [40] M. J. Yoon, G. Y. Lee, J.-J. Chung, Y. H. Ahn, S. H. Hong, and J.
and A. S. Greenberg, “Reduced energy expenditure and B. Kim, “Adiponectin increases fatty acid oxidation in skeletal
increased inflammation are early events in the development muscle cells by sequential activation of AMP-activated protein
of ovariectomy-induced obesity,” Endocrinology, vol. 150, no. kinase, p38 mitogen-activated protein kinase, and peroxisome
5, pp. 2161–2168, 2009. proliferator-activated receptoralpha,” Diabetes, vol. 55, no. 9,
[27] F. Felipe, M. L. Bonet, J. Ribot, and A. Palou, “Up-regulation pp. 2562–2570, 2006.
of muscle uncoupling protein 3 gene expression in mice [41] H. Guillou, P. G. Martin, and T. Pineau, “Transcriptional
following high fat diet, dietary vitamin A supplementation regulation of hepatic fatty acid metabolism,” Sub-Cellular
and acute retinoic acid-treatment,” International Journal of Biochemistry, vol. 49, pp. 3–47, 2008.
Obesity, vol. 27, no. 1, pp. 60–69, 2003. [42] M. Inoue, T. Ohtake, W. Motomura et al., “Increased expres-
[28] S. H. Cha, Z. Hu, S. Chohnan, and M. D. Lane, “Inhibition sion of PPARγ in high fat diet-induced liver steatosis in mice,”
of hypothalamic fatty acid synthase triggers rapid activation Biochemical and Biophysical Research Communications, vol.
of fatty acid oxidation in skeletal muscle,” Proceedings of the 336, no. 1, pp. 215–222, 2005.
National Academy of Sciences of the United States of America, [43] T. Tanaka, H. Masuzaki, K. Ebihara et al., “Transgenic expres-
vol. 102, no. 41, pp. 14557–14562, 2005. sion of mutant peroxisome proliferator-activated receptor γ in
[29] O. H. Lowry, N. J. Rosebrough, A. L. Farr, and R. J. Randall, liver precipitates fasting-induced steatosis but protects against
“Protein measurement with the Folin phenol reagent,” The high-fat diet-induced steatosis in mice,” Metabolism, vol. 54,
Journal of Biological Chemistry, vol. 193, pp. 265–275, 1951. no. 11, pp. 1490–1498, 2005.
[30] U. K. Laemmli, “Cleavage of structural proteins during the [44] J. K. Kim, J. J. Fillmore, Y. Chen et al., “Tissue-specific
assembly of the head of bacteriophage T4,” Nature, vol. 227, overexpression of lipoprotein lipase causes tissue-specific
no. 5259, pp. 680–685, 1970. insulin resistance,” Proceedings of the National Academy of
[31] K. Hayashi and M. Ito, “Antidiabetic action of low molecular Sciences of the United States of America, vol. 98, no. 13, pp.
weight chitosan in genetically obese diabetic KK-Ay mice,” 7522–7527, 2001.
Biological and Pharmaceutical Bulletin, vol. 25, no. 2, pp. 188– [45] T. Kadowaki, T. Yamauchi, N. Kubota, K. Hara, K. Ueki, and
192, 2002. K. Tobe, “Adiponectin and adiponectin receptors in insulin
[32] A. Tsuchida, T. Yamauchi, S. Takekawa et al., “Peroxisome resistance, diabetes, and the metabolic syndrome,” Journal of
proliferator-activated receptor (PPAR)± activation increases Clinical Investigation, vol. 116, no. 7, pp. 1784–1792, 2006.
adiponectin receptors and reduces obesity-related inflamma- [46] S. E. Borst, “The role of TNF-α in insulin resistance,”
tion in adipose tissue: comparison of activation of PPAR±, Endocrine, vol. 23, no. 2-3, pp. 177–182, 2004.
PPAR3 , and their combination,” Diabetes, vol. 54, no. 12, pp. [47] M. Iwaki, M. Matsuda, N. Maeda et al., “Induction of
3358–3370, 2005. adiponectin, a fat-derived antidiabetic and antiatherogenic
[33] R. Vianna, A. Brault, L. C. Martineau, R. Couture, J. T. factor, by nuclear receptors,” Diabetes, vol. 52, no. 7, pp. 1655–
Arnason, and P. S. Haddad, “In vivo anti-diabetic activity of 1663, 2003.
the ethanolic crude extract of Sorbus decora C.K.Schneid. [48] A. Zorzano, M. Palacı́n, and A. Gumà, “Mechanisms reg-
(Rosacea): a medical plant used by Canadian james bay cree ulating GLUT4 glucose transporter expression and glucose
nations to treat symptoms related to diabetes,” Evidence-Based transport in skeletal muscle,” Acta Physiologica Scandinavica,
Complementary and Alternative Medicine, 2009. vol. 183, no. 1, pp. 43–58, 2005.
[34] M. G. Dube, E. Beretta, H. Dhillon, N. Ueno, P. S. Kalra, and
S. P. Kalra, “Central leptin gene therapy blocks high-fat diet-
induced weight gain, hyperleptinemia, and hyperinsulinemia:
increase in serum ghrelin levels,” Diabetes, vol. 51, no. 6, pp.
1729–1736, 2002.
[35] A. L. Hildebrandt, D. M. Kelly-Sullivan, and S. C. Black,
“Antiobesity effects of chronic cannabinoid CB1 receptor
antagonist treatment in diet-induced obese mice,” European
Journal of Pharmacology, vol. 462, no. 1–3, pp. 125–132, 2003.
[36] Y. Sasaki, W. Suzuki, T. Shimada et al., “Dose dependent devel-
opment of diabetes mellitus and non-alcoholic steatohepatitis
in monosodium glutamate-induced obese mice,” Life Sciences,
vol. 85, no. 13-14, pp. 490–498, 2009.
[37] T. Tanaka, J. Yamamoto, S. Iwasaki et al., “Activation of
peroxisome proliferator-activated receptor δ induces fatty
acid β-oxidation in skeletal muscle and attenuates metabolic
syndrome,” Proceedings of the National Academy of Sciences of
the United States of America, vol. 100, no. 26, pp. 15924–15929,
2003.
[38] Y.-X. Wang, C.-L. Zhang, R. T. Yu et al., “Regulation of muscle
fiber type and running endurance by PPARδ,” PLoS Biology,
vol. 2, no. 10, article e294, 2004.
[39] F. Villarroya, R. Iglesias, and M. Giralt, “PPARs in the control
of uncoupling proteins gene expression,” PPAR Research, vol.
2007, Article ID 74364, 12 pages, 2007.
Copyright of Evidence-based Complementary & Alternative Medicine (eCAM) is the property of Hindawi
Publishing Corporation and its content may not be copied or emailed to multiple sites or posted to a listserv
without the copyright holder's express written permission. However, users may print, download, or email
articles for individual use.