Journal of Polymer Research (2018) 25: 23

https://doi.org/10.1007/s10965-017-1403-4

ORIGINAL PAPER

A novel and wide substrate specific polyhydroxyalkanoate (PHA)

synthase from unculturable bacteria found in mangrove soil
Choon Pin Foong 1 & Manoj Lakshmanan 1,2 & Hideki Abe 2,3 & Todd D. Taylor 2,4 & Swee Yeok Foong 1 & Kumar Sudesh 1,2

Received: 31 July 2017 / Accepted: 27 November 2017 / Published online: 18 December 2017
# Springer Science+Business Media B.V., part of Springer Nature 2017

Abstract
This study reports the discovery of a polyhydroxyalkanoate (PHA) synthase (PhaC) possessing very wide substrate specificity
from a mangrove soil metagenome. For the first time, putative PhaCs were identified from a metagenome using next-generation
sequencing (NGS) and bioinformatic approaches. High-throughput shotgun metagenomic sequencing was conducted using the
Illumina HiSeq 2000 platform. Sequence annotation and bioinformatic analyses were performed using the MG-RAST
metagenomic pipeline. Reads annotated as PhaC against the NCBI RefSeq database were retrieved using the MG-RAST
RESTful API (Application Programming Interface). PhaC gene sequence assembly was accomplished using the SPAdes assem-
bler. A total of two de novo assembled contigs were subjected to sequence verification. A putative PhaC sequence, BBP-M-
CPF4^, was selected for functional assessment by in vivo PHA biosynthesis in a PHA-negative mutant. An artificial stop codon
was added at the 3′-end of the incomplete coding gene sequence. This novel PhaC showed very broad substrate specificity with
the ability to incorporate six types of PHA monomers, 3-hydroxybutyrate (3HB), 3-hydroxyvalerate (3HV), 4-hydroxybutyrate
(4HB), 3-hydroxy-4-methylvalerate (3H4MV), 5-hydroxyvalerate (5HV) and 3-hydroxyhexanoate (3HHx) in the presence of
suitable precursors. This PHA synthase is suitable for the biosynthesis of PHAs that can be used in various biomedical appli-
cations due to its ability to incorporate the lipase-degradable monomer sequences of 4HB and 5HV. This study demonstrates that
a functional metagenomic approach using next-generation sequencing can be used to mine novel PHA synthases with interesting
substrate specificities from unculturable microorganisms.

Keywords Functional metagenomics . Mangrove soil . MG-RAST . Cupriavidus necator

Introduction

Polyhydroxyalkanoates (PHAs) are biopolymers produced

This article is part of the Topical Collection on Bio-Based Polymers
from microorganisms (bacteria and archaea) under unfavor-
Electronic supplementary material The online version of this article able growth and stress conditions to act as storage compounds
(https://doi.org/10.1007/s10965-017-1403-4) contains supplementary
(carbon reserve), redox regulators, as well as potent chemical
material, which is available to authorized users.
chaperons and cryoprotectants [1–4]. The major advantages of
* Kumar Sudesh
PHA compared to petrochemical-based plastics are its biode-
[email protected] gradability, biocompatibility and sustainability [5–7]. The key
enzyme that is involved in the polymerization of PHA is PHA
1
School of Biological Sciences, Universiti Sains Malaysia, 11800 synthase (PhaC). PhaC is an intriguing enzyme because it can
USM, Penang, Malaysia polymerize high molecular weight hydrophobic PHA chains
2
USM-RIKEN Centre for Aging Sciences (URICAS), Universiti in the hydrophilic environment of the cell cytoplasm.
Sains Malaysia, 11800 USM, Penang, Malaysia Recently, the crystal structures of PhaC from two bacteria
3
Bioplastic Research Team, Biomass Engineering Research Division, (Cupriavidus necator/Ralstonia eutropha H16 and
RIKEN Center for Sustainable Resource Science, 2-1, Hirosawa, Chromobacterium sp. USM2) were published, where the
Wako, Saitama 351-0198, Japan
mechanisms of PHA polymerization were revealed, along
4
Laboratory for Integrated Bioinformatics, Core for Precise with a molecular docking simulation on the 3-
Measuring and Modeling, RIKEN Center for Integrative Medical
Sciences, Tsurumi, Yokohama, Kanagawa 230-0045, Japan
hydroxybutyryl-CoA binding pocket and substrate-binding
23 Page 2 of 9 J Polym Res (2018) 25: 23

tunnels [8–11]. In addition to the polymerizing activity of biomedical applications due to its ability to incorporate
PhaC, one study demonstrated that PhaC of Bacillus lipase-hydrolyzable monomer sequences of 4HB and
megaterium confers depolymerase activity via alcoholytic 5HV.
cleavage of PHA chains [12]. There are three major factors
that determine the types of PHA polymer that can be produced
in a microorganism: (1) substrate specificity of the PhaC, (2) Materials and methods
metabolic pathways in the microbial host, and (3) types of
carbon sources provided. Soil sampling, total DNA extraction
Current knowledge on the diversity of PHA, PHA pro- and high-throughput shotgun metagenomic
ducers and PhaC comes mostly from studies on pure mi- sequencing
crobial isolates using culture-dependent approaches. A to-
tal of four classes of PhaC and 167 PHA producers (based The soil sample was collected in the mangrove forest at Balik
on genus, Appendix Table 1) have been reported from the Pulau, Penang, Malaysia. Metagenomic DNA was extracted
existing cultivable soil microorganisms which are be- from the soil directly using the MoBio PowerSoil DNA iso-
lieved to be not more than 15% of the total soil microor- lation kit (MoBio, USA). Shotgun metagenomic sequencing
ganisms [13, 14]. Microbiologists generally accept that at was performed using 125 bp paired-end sequencing with the
least 85% of the microorganisms in the environment have Illumina HiSeq 2000 platform.
not been cultured due to unsuitable in vitro conditions in
the laboratory [15, 16]. Therefore, there is a huge knowl- Bioinformatic analyses for the mining of PHA
edge gap in PhaC diversity from the under-discovered synthase genes
microbial world. Culture-independent or metagenomic ap-
proaches have become the only tools that can directly The raw sequences (unfiltered) were submitted to the
access this untapped and practically unlimited microbial metagenomics RAST server (MG-RAST) for automated se-
genomic information. quence pre-processing (quality checking) and gene annotation
Previous studies on PhaC discovery using culture- (Meyer et al., 2008). The metagenomic data was deposited in
independent techniques include (i) the function-based clone the MG-RAST database under the ID: mgm4512801.3
library approach in soil [17]; (ii) the sequence-based clone (BalikPulau_mangrove). For in silico gene mining of PHA
library approach in pond water [18], oil-contaminated soil synthases, all the sequences or reads (~ 120 to 260 bp) anno-
[19] and soil [20]; (iii) and the sequence-based PCR approach tated as BPHA synthase^ against the NCBI Reference
in inactivated-sludge [21, 22], seawater [23, 24] and limestone Sequence (RefSeq) database were retrieved from the MG-
soil [25]. This is the first study on PhaC discovery using the RAST server version 3 using five consensus keywords:
sequence-based next-generation sequencing shotgun hydroxybutyrate, hydroxyalkanoate, hydroxyalkanoic, PHA
metagenomic approach. Bioinformatic tools and high- and PHB. All the annotation and sequence information were
performance computing are required to process such huge retrieved from the MG-RAST database via the MG-RAST
amount of NGS data in order to extract meaningful biological RESTful API (Application Programming Interface) [34].
information [26, 27]. Complete or nearly full-length PHA synthase genes from
The mangrove soil biome contains high microbial diversity the mangrove soil metagenomic data were obtained by
and is continuously exposed to various abiotic stresses such as conducting de novo DNA sequence assembly using SPAdes
saline and anoxic conditions [28–30]. A few studies have 3.5.0-Darwin (St. Petersburg genome assembler) on the subset
reported PHA producers from mangrove soil through the cul- of sequences that were previously annotated as PHA synthase
tivation approach [31–33]. However, no study on PhaC from [35]. Assembled contigs with sizes more than 1 kb were se-
mangrove soil metagenomes has been reported. Therefore, lected for subsequent analyses. BLASTX was carried out
there is a strong chance to discover large numbers of novel against the GenBank non-redundant protein sequences data-
PhaCs from new microbial genera in the mangrove soil base [36] to search for similar sequences and determine the
metagenome, particularly from the anaerobic microorgan- correct reading frames for the partial or complete PHA
isms. In this study, a novel PhaC with extremely wide synthases.
substrate specificity was discovered from the Balik
Pulau (Penang, Malaysia) mangrove soil. It could produce Targeted gene amplification from the mangrove soil
short-chain-length (SCL)-PHA copolymers, P(3HB-co- metagenome
3HV), P (3HB -co-4HB), P(3HB-co-3H4MV) and
P(3HB-co-5HV), and medium-chain-length (MCL)-PHA A full-length PHA synthase gene was amplified from the
copolymer P(3HB-co-3HHx). This PhaC is suitable to mangrove soil metagenomic DNA. Primers were designed
produce PHAs that are particularly important for using ApE (A plasmid Editor) v2.0.50 and AutoDimer [37]
J Polym Res (2018) 25: 23 Page 3 of 9 23

Table 1 List of primers used for

amplification of the BP-M-CPF4 Primer name Sequence (5′ to 3′)
PHA synthase sequence
HindIII_RBS_ AGT AAGCTT CAAAGGAGGGAAAGT ATGGCGTCAAAGGATAGCTTCG
PhaC-CPF-Fwd
ApaI_PhaC-CPF-Rev ATT GGGCCC TTCGCTCATCAGTCTACTTCTCC

The ribosomal binding site (RBS) ‘CAAAGGAGGGAAAGT’ was designed using the RBS calculator
Bold letters indicate the restriction enzyme recognition sites; 'CTA' is an artificial stop codon 'TAG' added at the 3'-
end of the PHA synthase sequence

(Table 1). The PCR mix contained 1× HF Reaction Buffer, and 10 g/L peptone. The bacterial culture was incubated at
200 μM dNTPs, 0.25 μM of each primer, and 1 U of Accura 30 °C, 200 rpm until OD600nm reached 4.0. Then, 3% (v/v)
High-Fidelity Polymerase (Lucigen, USA). The PCR condi- of the bacterial culture was transferred to 50 mL mineral salts
tions were as follow: 94 °C for 3 min; 30 cycles of 94 °C for medium (MM) in 250 mL Erlenmeyer flasks supplemented
30 s, 57 °C for 30 s, and 72 °C for 2 min; and a final step at with fructose or crude palm kernel oil (CPKO) as the sole
72 °C for 10 min. The PCR product was purified using the carbon source. For C. necator transformants, 50 μg/mL of
QIAquick PCR Purification Kit (Qiagen, Germany), and kanamycin was added into MM for plasmid maintenance.
inserted into the pCR®4-TOPO® vector (Invitrogen, USA). Precursors such as sodium valerate (2 g/L), sodium 5-
The vector was transformed into E. cloni® 10G Chemically hydroxyvalerate (2 g/L), sodium 4-hydroxybutyrate (2 g/L),
Competent Cells (Lucigen, USA) and selected on Lysogeny- gamma butyrolactone (2 g/L), isocaproic acid (1 g/L) and
Broth (LB) plates containing 50 μg/mL kanamycin. Plasmids sodium hexanoate (2 g/L) were co-supplemented with 10 g/
from the positive clones were isolated using the QIAprep Spin L of fructose to examine the substrate specificity of the PHA
Miniprep Kit (Qiagen, Germany) and DNA sequencing was synthase. The bacterial culture was incubated at 30 °C,
carried by a commercial laboratory (MyTACG Bioscience 200 rpm for 48 h. The precursors were prepared according
Enterprise, Malaysia). The sequences were assembled and an- to the methods described by C’hng and colleagues [42] for
alyzed using SeqMan and MegAlign (DNASTAR, USA). The sodium 3-hydroxyvalerate and sodium 4-hydroxybutyrate and
nucleotide sequence was submitted to the NCBI GenBank Chuah and colleagues [43] for sodium 5-hydroxyvalerate.
nucleotide database under accession number MF431721. Sodium hexanoate was prepared by adding 187 mL of
hexanoic acid (Acros Organiccs, Belgium) into 1.5 M sodium
hydroxide (QReC, New Zealand) dissolved in absolute etha-
Heterologous expression of mangrove PHA synthase nol (Fisher Scientific, USA).
for PHA biosynthesis

A ribosome binding sequence (RBS), which is 6 base pairs

Gas chromatography (GC) analysis for PHAs
upstream of the putative start codon was designed and opti-
The cells were harvested by centrifugation (9000 g for 10 min)
mized for Cupriavidus necator as the host via the RBS calcu-
and kept at −20 °C for 24 h before lyophilization.
lator [38]. The gene construct was assembled in the following
Approximately 15 mg of lyophilized cells were subjected to
order with appropriate restriction sites: phaC1 promoter from
methanolysis in the presence of 15% (v/v) sulfuric acid and
C. necator, optimized RBS sequence, and complete CDS of the
85% (v/v) methanol at 100 °C for 140 min. The PHA content
phaC gene. Restriction digestion was performed using
was determined by gas chromatography (GC) using the
FastDigest enzymes (Thermo Scientific, USA). Then, the gene
Shimadzu GC-2010 system equipped with an SPB-1 column
construct was inserted into a modified broad host range plasmid
(Supelco, USA). The column temperature was initiated at
(pBBR1MCS-2) [39], pBBR1-I-GG18 [23] in reverse orienta-
70 °C and then increased to 280 °C in continuous steps of
tion to the lac promoter to ensure that expression was solely
10 °C/min. The PHA content and composition were quantified
controlled by the C. necator phaC1 promoter. DNA ligation
with caprylic acid methyl ester (CME) as an internal standard.
was performed using the DNA Ligation Kit Ver1.2 (TaKaRa,
Japan). The constructed recombinant plasmid was transformed
into chemically competent E. coli S17–1 [40]. Bacterial trans- PHA polymer extraction
conjugation between E. coli S17–1 (donor) harbouring recom-
binant plasmid with C. necator PHB−4 (recipient) was per- Approximately one gram of lyophilized cells were mixed with
formed as described by Friedrich and colleagues [41]. 50 mL of chloroform and stirred at room temperature for three
PHA biosynthesis was initiated with a starter culture of days. The mixture was filtered using Whatman No. 1 filter
50 mL nutrient rich (NR) medium in 250 mL Erlenmeyer papers to remove cell debris. The resulting clear solution
flasks containing 10 g/L meat extract, 2 g/L yeast extract was then added dropwise into vigorously stirring ice-cold
23 Page 4 of 9 J Polym Res (2018) 25: 23

methanol to precipitate the PHA polymers. The precipitated Alphaproteobacteria was the most dominant (~50%) followed
polymers were separated from the methanol solution using by Gammaproteobacteria (~18%) and Betaproteobacteria
vacuum filtration and then dried overnight at room tempera- (~16%) (Fig. 1a and b). The summaries of read abundance
ture. Solvent extraction of PHA from the bacterial cells was and genus diversity of PhaC were based on the closest hitting
usually able to produce the highest purity (95 to 100%) of organism from the RefSeq database and there was no specified
PHA polymers [44, 45]. sequence identity cut-off at the genus level. Various PhaC
sequence identities and their relative abundance were calculat-
Thermal analysis ed and shown in Fig. 1c.

Differential scanning calorimetry (DSC) (DSC-60, Shimadzu Novel mangrove PHA synthase with full-length
Corporation, Japan) was used to characterize the crystalliza- coding sequence
tion temperature (Tc), melting temperature (Tm) and glass tran-
sition temperature (Tg) for all PHA polymers. The temperature A novel putative PHA synthase, BBP-M-CPF4^, was identi-
range for DSC varied from 50 °C to 200 °C at a heating rate of fied from the mangrove soil metagenome and assembled into
10 °C/min and a cooling rate of 5 °C/min. a full-length protein coding sequence (CDS). This in silico
assembled contig was successfully amplified from the original
Molecular mass determination mangrove soil metagenomic DNA by PCR (in vitro). The
BLAST2seq (pairwise sequence similarity comparison) result
Both number average molecular weight (Mn) and weight av- between the in silico assembled contig and its corresponding
erage molecular weight (Mw) were determined by gel perme- in vitro verified DNA sequence was 91% (not identical, but
ation chromatography (GPC) using Agilent Technologies highly similar). The closest PhaC match from BLASTX anal-
1200 Series GPC (USA) equipped with Shodex K806-M ysis (date: 4th June 2017) was with the class I poly(R)-
and K802 columns (Japan). Chloroform was used as the sol- hydroxyalkanoic acid synthase of Fodinicurvata
vent for the mobile phase with a flow rate of 0.8 mL/min at f e n g g a n g e n s i s ( P h y l u m : P ro t e o b a c t e r i a ; C l a s s :
40 °C. PHA polymers were dissolved in chloroform to a final Alphaproteobacteria; Order: Rhodospirillales; Family:
concentration of approximately 1.0 mg/mL and filtered (PTFE Rhodospirillaceae; Genus: Fodinicurvata) with 47% identity.
membrane, 0.22 μm) before analysis. BP-M-CPF4 PhaC is not a complete protein CDS, as no stop
codon was detected in the in silico assembled contig. A total
Nuclear magnetic resonance spectroscopy analysis of five amino acids were missing at the C-terminal compared
to the PhaC of Fodinicurvata fenggangensis
PHA polymers were analyzed by 1H NMR spectroscopy (WP_026986267). Pairwise comparison (BLAST2seq) of
using a Bruker AVANCE 500 (USA) operating at 500 MHz. BP-M-CPF4 PhaC against different classes of PhaC
Samples were prepared for analysis by dissolving PHA poly- (prototypes) showed that it was a class I PhaC based on the
mers in deuterated chloroform [1% (w/v)]. relatively higher coverage and identity scores (Table 2).

PHA biosynthesis result

Results
Heterologous expression of putative BP-M-CPF4 PhaC in
Statistics for the PHA synthase gene found C. necator PHB−4 (a PHB-negative mutant) was successful,
in the Balik Pulau mangrove soil metagenome where the synthase showed extremely wide substrate specific-
ity, which has not been reported before. This transformant was
A total of 33,632 putative PHA synthase gene DNA fragments able to accumulate PHA homopolymers and copolymers in-
derived from 8 phyla (6 bacteria and 2 archaea) were obtained cluding poly(3-hydroxybutyrate) [P(3HB)], poly(3-
from the Balik Pulau (BP) mangrove soil metagenome. About hydroxybutyrate-co-3-hydroxyvalerate) [P(3HB-co-3HV)],
87% of the putative phaC DNA fragments were derived from poly(3-hydroxybutyrate-co-5-hydroxyvalerate) [P(3HB-co-
the phylum Proteobacteria, followed by Cyanobacteria, 5HV)], poly(3-hydroxybutyrate-co-4-hydroxybutyrate)
F i r m i c u t e s , Ve r r u c o m i c ro b i a , A c t i n o b a c t e r i a , [P(3HB-co-4HB)], poly(3-hydroxybutyrate-co-3-hydroxy-4-
Euryarchaeota, Bacteroidetes and Thaumarchaeota. In terms methylvalerate) [P(3HB-co-3H4MV)] and poly(3-
of PHA synthase genus diversity, a total of 125 microbial (both hydroxybutyrate-co-3-hydroxyhexanoate)[P(3HB-co-
bacteria and archaea) genera were identified from the BP man- 3HHx)], when suitable precursors were provided (Table 3).
grove soil metagenome. About 86% of the putative PHA pro- Overall, the mol percent of the second monomers in the
ducing genera were derived from the phylum Proteobacteria. PHA copolymers were ≥ 10% in the presence of 1 to 2 g/L
In both statistical analyses (relative abundance and diversity), of precursors. However, the addition of precursors such as
J Polym Res (2018) 25: 23 Page 5 of 9 23

Fig. 1 Statistics for PHA synthase sequences identified in the Balik Pulau mangrove soil metagenome. Top panel: Relative abundance of reads (%)
annotated as PHA synthase (PhaC). Left panel: PhaC genus diversity. Right panel: PhaC sequence identity and relative abundance (%)

isocaproic acid and sodium hexanoate have introduced ad- were in the range of 70,000 to 260,000 Da, while the polydis-
verse effects on the bacterial growth (dry cell weight < 2 g/ persity index (PDI/Ð) were 2.7 to 4.0. P(3HB-co-23 mol%
L). PHA copolymer P(3HB-co-4HB) was not produced by the 5HV) has the lowest number-average molecular weight
transformant strain when gamma-butyrolactone was supplied (Table 4).
instead of sodium 4-hydroxybutyrate.

Characterization of PHAs Discussion

The chemical structures of PHA copolymers were further con- Many bacteria or microorganisms are able to accumulate PHA
firmed by 1H NMR. Characteristic peaks for 3HB, 4HB, and as a strategy to survive through various environmental stresses
3HHx were detected in the 1H NMR spectra of the corre- and nutrient-limited conditions. However, there are very few
sponding PHA copolymers (Fig. 2). In terms of thermal prop- reviews on the existing PHA producers and PHA synthases
erties, the incorporation of second monomers (PHA copoly- (PhaC) [2, 14, 46–48]. More importantly, all the models or
mers) has contributed lower melting (Tm) and glass transition prototypes of PhaC are derived from culturable bacteria
(Tg) temperatures compared to the P(3HB) homopolymer. The (representing about 10–20% of total soil microbial diversity)
number-average molecular weights of the PHA copolymers which may underestimate the true diversity of this enzyme.

Table 2 Pairwise comparison

(BLAST2seq) of BP-M- Class Host (Accession no.) Coverage (%) Identity (%)
CPF4 PHA synthase sequence
(amino acids) against different I Fodinicurvata fenggangensis (WP_026986267) *the closest match 97 47
classes of PhaC (prototypes) Chromobacterium sp. (USM2 ADL70203) 88 45
Burkholderia sp. (USM AEJ83999) 88 44
Aeromonas caviae (BAA21815) 94 42
Cupriavidus necator (WP_011615085) 96 41
Delftia acidovorans (BAA33155) 89 39
II Pseudomonas fluorescens PhaC1 (ACK57560) 90 37
Pseudomonas fluorescens PhaC2 (ACK57562) 97 38
Pseudomonas mandelii PhaC1 (WP_010464456) 90 38
Pseudomonas mandelii PhaC2 (WP_010464460) 97 37
III Allochromatium vinosum DSM180 (AAA23320) 57 26
Synechocystis sp. PCC 6803 (BAA17430) 55 25
IV Bacillus cereus (BAI68395) 60 26
Bacillus megaterium (AAD05260) 74 27
23 Page 6 of 9 J Polym Res (2018) 25: 23

Table 3 PHA production of transformant Cupriavidus necator PHB¯4 harbouring PHA synthase BP-M-CPF4 using fructose or crude palm kernel oil
with different added precursor carbon sources

Carbon source Dry cell weight (g/L) PHA content (wt%) Monomer composition (mol%)

3HB 3HV 5HV 4HB 3H4MV 3HHx

Fructose (10 g/L) 3.7 ± 0.1 75 ± 9 100 – – – – –

Crude palm kernel oil (5 g/L) 2.8 ± 0.2 62 ± 5 93 ± 0 – – – – 7±0
Fructose (10 g/L) + sodium valerate (2 g/L) 2.5 ± 0.1 58 ± 7 87 ± 1 13 ± 1 – – – –
Fructose (10 g/L) + sodium 5-hydroxyvalerate (2 g/L) 3.8 ± 0.9 67 ± 8 77 ± 0 – 23 ± 0 – – –
Fructose (10 g/L) + sodium 4-hydroxybutyrate (2 g/L) 2.8 ± 0.1 58 ± 1 86 ± 1 – – 14 ± 1 – –
Fructose (10 g/L) + gamma-butyrolactone (2 g/L) 3.7 ± 0.1 66 ± 2 100 – – – – –
Fructose (10 g/L) + isocaproic acid (1 g/L) 1.6 ± 0.0 45 ± 5 90 ± 1 – – – 10 ± 1 –
Fructose (10 g/L) + sodium hexanoate (2 g/L) 1.9 ± 0.1 44 ± 1 82 ± 2 – – – – 18 ± 2

3% inoculum from starter cultures (O.D = ~4.5) was transferred into 50 mL MM in 250 mL conical flask and incubated at 30 °C, 48 h, 200 rpm
Abbreviations: 3HB = 3-hydroxybutyrate; 3HV = 3-hydroxyvalerate; 5HV = 5-hydroxyvalerate; 4HB = 4-hydroxybutyrate; 3H4MV = 3-hydroxy-4-
methylvalerate; 3HHx = 3-hydroxyhexanoate

Thus, there is a strong chance to discover novel characteristics unknown PHA producing ability. Overall, we have summa-
or possibly new classes of PhaC as has been successfully rized 380 bacteria and 27 archaea microbial PHA producing
reported in a few recent studies on other enzymes [49–51]. genera that could either produce PHA or contain PhaC
The latest report by Koller and co-workers [14] summa- (Appendix Table 1).
rized a total of 167 microbial PHA producing genera (150 In this study, a putative PhaC from a mangrove soil
bacteria and 17 archaea), while our study detected 336 metagenome was identified using an in silico approach.
PhaC (317 bacteria and 19 archaea, including putative pro- Thus, underestimation of PhaC abundance and genus diversi-
teins) from the NCBI RefSeq protein database (11th ty was expected where positive hits were limited by the
July 2015). Some of the PHA producers have no PhaC se- screening parameters. In general, the PhaC abundance was
quences deposited in the RefSeq protein database. Besides, mainly restricted by (i) the 60% minimum sequence identity
there are also quite a large number of putative PhaCs that were cutoff (default setting) in the BLAST search against the NCBI
annotated from bacterial whole genome sequences but with RefSeq database in the MG-RAST server; and (ii) the

Fig. 2 1H NMR spectra of PHA polymers (a) P(3HB-co-4HB) and (b) P(3HB-co-3HHx) produced by transformant Cupriavidus necator PHB¯4
harbouring PHA synthase BP-M-CPF4
J Polym Res (2018) 25: 23 Page 7 of 9 23

Table 4 Molecular weights and

thermal properties of PHA PHA polymers Mw (× 105 Da) Mn (× 105 Da) Ð Tm (°C) Tg (°C) Tc (°C)
polymers produced by
transformant Cupriavidus necator P(3HB) 8.3 2.1 4.0 171 3 45
PHB¯4 harbouring PHA synthase P(3HB-co-13 mol% 3HV) 8.2 2.4 3.4 171 3 58
BP-M-CPF4 P(3HB-co- 23 mol% 5HV) 1.7 0.7 2.7 133 −12 n/d
P(3HB-co-14 mol% 4HB) 3.8 1.4 2.7 140 −6 61
P(3HB-co-10 mol% 3H4MV) n/d n/d n/d n/d n/d n/d
P(3HB-co-7 mol% 3HHx) 4.5 1.7 2.7 132 −1 n/d
P(3HB-co-18 mol% 3HHx) 8.6 2.6 3.3 167 −22 n/d

n/d: not determined

sequence annotation consensus keywords (hydroxybutyrate, medium-chain-length (MCL) PHA copolymers. To the best
hydroxyalkanoate, hydroxyalkanoic, PHA and PHB). As re- of our knowledge, BP-M-CPF4 is the first reported PhaC that
ported by Rehm [13], PhaC shows wide variation in amino could polymerize six types of PHA monomers, 3HB, 3HV,
acid sequence similarity ranging from 8 to 96%, and there is 4HB, 5HV, 3H4MV and 3HHx. This variation of PhaC has an
no standardization in annotation or gene/protein nomenclature attractive advantage in that it could extend the thermal and
of PhaC. In terms of PhaC genus diversity, it solely depends mechanical properties of PHA. Thus, PHA polymers with
on the cut-off value in sequence identity for a protein to define favourable and customized properties can be easily generated
a new microbial genus. Some previous studies used an 80% by using wide substrate specificity PhaC.
identity cut-off of amino acid sequence to define a new genus
[52, 53]. Recently, a study on 410 fully-sequenced bacte- Acknowledgements This study was supported by the Long-Term
Research Grant Scheme (USM) and the USM-RIKEN Centre of Aging
rial genomes showed that an average amino acid identity
Sciences (URICAS). We are also grateful to Dr. Kovach ME for his kind
(AAI) at the genus level ranged from 60 to 80% [54]. For gift of the pBBR1MCS broad-host-range vector derivatives used in this
instance, if a 70% AAI cut-off (mid-point) was chosen in study. CPF gratefully acknowledges the MyPhD scholarship program
this study, there would be around 37% potential new and from the Ministry of Higher Education Malaysia.
uncultivable PHA producers (genus level) in the BP man-
Compliance with ethical standards
grove soil metagenome (Fig. 1c).
Our other aim in this study was to search for novel PhaCs
Conflict of interest The authors declare that they have no conflict of
with interesting properties, and we have successfully discovered interest.
one (BP-M-CPF4 PhaC) with extremely wide substrate speci-
ficity from mangrove soil, which is predominantly inhabited by Ethical approval This article does not contain any studies with human
anaerobic microorganisms. In the Balik Pulau mangrove soil, participants or animals performed by any of the authors.
the most dominant class was Deltaproteobacteria (ratio of
anaerobic:aerobic bacteria was approximately 3:1), and
Anaerolinea, Geobacter, Syntrophobacter, Desulfovibrio, References
Desulfatibacillum and Desulfobacterium are anaerobic bacterial
genera that were among the top 10 most abundant (unpublished 1. Anderson AJ, Dawes EA (1990) Occurrence, metabolism, metabol-
data). Based on sequence similarity and phylogenetic analysis, ic role, and industrial uses of bacterial polyhydroxyalkanoates.
(Appendix Fig. 3) BP-M-CPF4 PhaC is a class I PhaC where its Microbiol Rev 54(4):450–472
closest host match is Fodinicurvata fenggangensis (47% pro- 2. Madison LL, Huisman GW (1999) Metabolic engineering of
poly(3-hydroxyalkanoates): from DNA to plastic. Microbiol Mol
tein sequence identity), which is a facultative anaerobic bacte- Biol Rev 63(1):21–53
rium [55]. However, nucleotide sequence identity and coverage 3. Ayub ND, Tribelli PM, Lopez NI (2009) Polyhydroxyalkanoates
of BP-M-CPF4 phaC were approximately 70% and 60%, re- are essential for maintenance of redox state in the Antarctic bacte-
spectively, which strongly suggests that BP-M-CPF4 phaC be- rium Pseudomonas sp 14-3 during low temperature adaptation.
Extremophiles 13(1):59–66. https://doi.org/10.1007/s00792-008-
longs to an uncultured bacterium. Nevertheless, there is also the
0197-z
possibility that the host has already been cultivated but the 4. Obruca S, Sedlacek P, Krzyzanek V, Mravec F, Hrubanova K,
phaC nucleotide sequence data is not yet available in the Samek O, Kucera D, Benesova P, Marova I (2016) Accumulation
GenBank database. of poly(3-hydroxybutyrate) helps bacterial cells to survive freezing.
There are a few wide substrate specificity PhaCs from PLoS One 11(6):e0157778. https://doi.org/10.1371/journal.pone.
0157778
Aeromonas caviae [56], Chromobacterium sp. USM2 [57]
5. Zinn M, Witholt B, Egli T (2001) Occurrence, synthesis and med-
and Pseudomonas stutzeri 1317 [58], which could produce ical application of bacterial polyhydroxyalkanoate. Adv Drug Deliv
various combinations of short-chain-length (SCL) and Rev 53(1):5–21. https://doi.org/10.1016/S0169-409X(01)00218-6
23 Page 8 of 9 J Polym Res (2018) 25: 23

6. Jendrossek D, Handrick R (2002) Microbial degradation of Biotechnol Bioeng 96(5):871–880. https://doi.org/10.1002/bit.

polyhydroxyalkanoates. Annu Rev Microbiol 56:403–432. https:// 21085
doi.org/10.1146/annurev.micro.56.012302.160838 22. Ciesielski S, Pokoj T, Klimiuk E (2008) Molecular insight into
7. Sudesh K, Iwata T (2008) Sustainability of biobased and biodegrad- activated sludge producing polyhydroxyalkanoates under aerobic–
able plastics. Clean (Weinh) 36(5–6):433–442. https://doi.org/10. anaerobic conditions. J Ind Microbiol Biotechnol 35(8):805–814.
1002/clen.200700183 https://doi.org/10.1007/s10295-008-0352-7
8. Wittenborn EC, Jost M, Wei Y, Stubbe J, Drennan CL (2016) 23. Foong CP, Lau NS, Deguchi S, Toyofuku T, Taylor TD, Sudesh K,
Structure of the catalytic domain of the class I polyhydroxybutyrate Matsui M (2014) Whole genome amplification approach reveals
synthase from Cupriavidus necator. J Biol Chem 291(48):25264– novel polyhydroxyalkanoate synthases (PhaCs) from Japan trench
25277 and Nankai trough seawater. BMC Microbiol 14. https://doi.org/10.
9. Kim YJ, Choi SY, Kim J, Jin KS, Lee SY, Kim KJ (2017) Structure 1186/s12866-014-0318-z
and function of the N-terminal domain of Ralstonia eutropha 24. Parnanen K, Karkman A, Virta M, Eronen-Rasimus E, Kaartokallio
polyhydroxyalkanoate synthase, and the proposed structure and H (2015) Discovery of bacterial polyhydroxyalkanoate synthase
mechanisms of the whole enzyme. Biotechnol J 12 (1):1600649. (PhaC)-encoding genes from seasonal Baltic Sea ice and cold estu-
https://doi.org/10.1002/biot.201600649 arine waters. Extremophiles 19(1):197–206. https://doi.org/10.
10. Kim J, Kim YJ, Choi SY, Lee SY, Kim KJ (2017) Crystal structure 1007/s00792-014-0699-9
of Ralstonia eutropha polyhydroxyalkanoate synthase C-terminal 25. Tai YT, Foong CP, Najimudin N, Sudesh K (2016) Discovery of a
domain and reaction mechanisms. Biotechnol J 12 (1):1600648. new polyhydroxyalkanoate synthase from limestone soil through
https://doi.org/10.1002/biot.201600648 metagenomic approach. J Biosci Bioeng 121(4):355–364. https://
11. Chek MF, Kim S-Y, Mori T, Arsad H, Samian MR, Sudesh K, doi.org/10.1016/j.jbiosc.2015.08.008
Hakoshima T (2017) Structure of polyhydroxyalkanoate (PHA) 26. Meyer F, Paarmann D, D'Souza M, Olson R, Glass EM, Kubal M,
synthase PhaC from Chromobacterium sp. USM2, producing bio- Paczian T, Rodriguez A, Stevens R, Wilke A, Wilkening J, Edwards
degradable plastics. Sci Rep 7:5312. https://doi.org/10.1038/ RA (2008) The metagenomics RAST server - a public resource for
s41598-017-05509-4 the automatic phylogenetic and functional analysis of
12. Hyakutake M, Tomizawa S, Mizuno K, Hisano T, Abe H, Tsuge T metagenomes. BMC Bioinformatics 9:386. https://doi.org/10.
(2014) A common active site of polyhydroxyalkanoate synthase 1186/1471-2105-9-386
from Bacillus cereus YB-4 is involved in polymerization and 27. Scholz MB, Lo CC, Chain PSG (2012) Next generation sequencing
alcoholysis reactions. Appl Microbiol Biotechnol 99(11):4701– and bioinformatic bottlenecks: the current state of metagenomic
4711. https://doi.org/10.1007/s00253-014-6276-4 data analysis. Curr Opin Biotechnol 23(1):9–15. https://doi.org/
10.1016/j.copbio.2011.11.013
13. Rehm BH (2003) Polyester synthases: natural catalysts for plastics.
28. Sahoo K, Dhal N (2009) Potential microbial diversity in mangrove
Biochem J 376(Pt 1):15–33. https://doi.org/10.1042/BJ20031254
ecosystems: a review. Indian. J Mar Sci 38(2):249–256
14. Koller M, Salerno A, Braunegg G (2013) Polyhydroxyalkanoates:
29. Holguin G, Vazquez P, Bashan Y (2001) The role of sediment
basics, production and applications of microbial biopolyesters. In:
microorganisms in the productivity, conservation, and rehabilitation
Kabasci S (ed) Bio-based plastics: materials and applications.
of mangrove ecosystems: an overview. Biol Fertil Soils 33(4):265–
Wiley, Chichester, pp 137–170. https://doi.org/10.1002/
278
9781118676646.ch7
30. Gomes NC, Cleary DF, Calado R, Costa R (2011) Mangrove bac-
15. Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic identifi- terial richness. Commun Integr Biol 4(4):419–423
cation and in situ detection of individual microbial cells without 31. Rawte T, Padte M, Mavinkurve S (2002) Incidence of marine and
cultivation. Microbiol Rev 59(1):143–169 mangrove bacteria accumulating polyhydroxyalkanoates on the
16. Lok C (2015) Mining the microbial dark matter. Nature 522(7556): mid-west coast of India. World J Microbiol Biotechnol 18(7):
270–273. https://doi.org/10.1038/522270a 655–659. https://doi.org/10.1023/A:1016872631403
17. Schallmey M, Ly A, Wang C, Meglei G, Voget S, Streit WR, 32. Doan TV, Nguyen BT (2012) Polyhydroxyalkanoates production
Driscoll BT, Charles TC (2011) Harvesting of novel by a bacterium isolated from mangrove soil samples collected from
polyhydroxyalkanaote (PHA) synthase encoding genes from a soil Quang Ninh province. J Viet Env 3(2):4
metagenome library using phenotypic screening. FEMS Microbiol 33. Lau NS, Sam KK, Amirul AA (2017) Genome features of moder-
Lett 321(2):150–156. https://doi.org/10.1111/j.1574-6968.2011. ately halophilic polyhydroxyalkanoate-producing Yangia sp. CCB-
02324.x MM3. Stand Genomic Sci 12:12. https://doi.org/10.1186/s40793-
18. Kapardar RK, Ranjan R, Grover A, Puri M, Sharma R (2010) 017-0232-8
Identification and characterization of genes conferring salt tolerance 34. Wilke A, Bischof J, Harrison T, Brettin T, D'Souza M, Gerlach W,
to Escherichia coli from pond water metagenome. Bioresour Matthews H, Paczian T, Wilkening J, Glass EM, Desai N, Meyer F
Technol 101(11):3917–3924. https://doi.org/10.1016/j.biortech. (2015) A RESTful API for accessing microbial community data for
2010.01.017 MG-RAST. PLoS Comput Biol 11(1):e1004008. https://doi.org/10.
19. Cheema S, Bassas-Galia M, Sarma PM, Lal B, Arias S (2012) 1371/journal.pcbi.1004008
Exploiting metagenomic diversity for novel polyhydroxyalkanoate 35. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M,
synthases: production of a terpolymer poly(3-hydroxybutyrate-co- Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD,
3-hydroxyhexanoate-co-3-hydroxyoctanoate) with a recombinant Pyshkin AV, Sirotkin AV, Vyahhi N, Tesler G, Alekseyev MA,
Pseudomonas putida strain. Bioresour Technol 103(1):322–328. Pevzner PA (2012) SPAdes: a new genome assembly algorithm
https://doi.org/10.1016/j.biortech.2011.09.098 and its applications to single-cell sequencing. J Comput Biol
20. Cheng JJ, Charles TC (2016) Novel polyhydroxyalkanoate copol- 19(5):455–477. https://doi.org/10.1089/cmb.2012.0021
ymers produced in Pseudomonas putida by metagenomic 36. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller
polyhydroxyalkanoate synthases. Appl Microbiol Biotechnol W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new
100(17):7611–7627. https://doi.org/10.1007/s00253-016-7666-6 generation of protein database search programs. Nucleic Acids
21. Michinaka A, Arou J, Onuki M, Satoh H, Mino T (2007) Analysis Res 25(17):3389–3402
of polyhydroxyalkanoate (PHA) synthase gene in activated sludge 37. Vallone PM, Butler JM (2004) AutoDimer: a screening tool for
that produces PHA containing 3-hydroxy-2-methylvalerate. primer-dimer and hairpin structures. BioTechniques 37(2):226–231
J Polym Res (2018) 25: 23 Page 9 of 9 23

38. Espah Borujeni A, Channarasappa AS, Salis HM (2013) 50. Zarafeta D, Moschidi D, Ladoukakis E, Gavrilov S, Chrysina ED,
Translation rate is controlled by coupled trade-offs between site Chatziioannou A, Kublanov I, Skretas G, Kolisis FN (2016)
accessibility, selective RNA unfolding and sliding at upstream Metagenomic mining for thermostable esterolytic enzymes un-
standby sites. Nucleic Acids Res 42(4):2646–2659 covers a new family of bacterial esterases. Sci Rep 6:38886.
39. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop https://doi.org/10.1038/srep38886
RM, Peterson KM (1995) Four new derivatives of the broad-host- 51. Baud D, Jeffries JWE, Moody TS, Ward JM, Hailes HC (2017) A
range cloning vector pBBR1MCS, carrying different antibiotic- metagenomics approach for new biocatalyst discovery: application
resistance cassettes. Gene 166(1):175–176. https://doi.org/10. to transaminases and the synthesis of allylic amines. Green Chem
1016/0378-1119(95)00584-1 19(4):1134–1143. https://doi.org/10.1039/c6gc02769e
40. Simon R, Priefer U, Pühler A (1983) A broad host range mobiliza- 52. Beck DA, Kalyuzhnaya MG, Malfatti S, Tringe SG, Glavina Del
tion system for in vivo genetic engineering: transposon mutagenesis Rio T, Ivanova N, Lidstrom ME, Chistoserdova L (2013) A
in gram negative bacteria. Nat Biotechnol 1(9):784–791 metagenomic insight into freshwater methane-utilizing communi-
41. Friedrich B, Hogrefe C, Schlegel HG (1981) Naturally occurring ties and evidence for cooperation between the Methylococcaceae
genetic transfer of hydrogen-oxidizing ability between strains of and the Methylophilaceae. PeerJ 1:e23. https://doi.org/10.7717/
Alcaligenes eutrophus. J Bacteriol 147(1):198–205 peerj.23
42. Ch’ng DH-E, Lee W-H, Sudesh K (2012) Biosynthesis and lipase- 53. Ying J, Wang H, Bao B, Zhang Y, Zhang J, Zhang C, Li A, Lu J, Li
catalysed hydrolysis of 4-hydroxybutyrate-containing P, Ying J, Liu Q, Xu T, Yi H, Li J, Zhou L, Zhou T, Xu Z, Ni L, Bao
polyhydroxyalkanoates from Delftia acidovorans. Malays J Q (2015) Molecular variation and horizontal gene transfer of the
Microbiol 9(1):33–42 homocysteine methyltransferase gene mmuM and its distribution in
43. Chuah J-A, Yamada M, Taguchi S, Sudesh K, Doi Y, Numata K clinical pathogens. Int J Biol Sci 11(1):11–21. https://doi.org/10.
(2013) Biosynthesis and characterization of polyhydroxyalkanoate 7150/ijbs.10320
containing 5-hydroxyvalerate units: effects of 5HV units on biode- 54. Luo C, Rodriguez RL, Konstantinidis KT (2014) MyTaxa: an ad-
gradability, cytotoxicity, mechanical and thermal properties. Polym vanced taxonomic classifier for genomic and metagenomic se-
Degrad Stab 98(1):331–338. https://doi.org/10.1016/j. quences. Nucleic Acids Res 42(8):e73. https://doi.org/10.1093/
polymdegradstab.2012.09.008 nar/gku169
44. Kunasundari B, Sudesh K (2011) Isolation and recovery of micro-
55. Wang YX, Liu JH, Zhang XX, Chen YG, Wang ZG, Chen Y, Li
bial polyhydroxyalkanoates. Express Polym Lett 5(7):620–634.
QY, Peng Q, Cui XL (2009) Fodinicurvata sediminis gen. nov., sp.
https://doi.org/10.3144/expresspolymlett.2011.60
nov. and Fodinicurvata fenggangensis sp. nov., poly-ß-
45. Murugan P, Han L, Gan CY, Maurer FH, Sudesh K (2016) A new
hydroxybutyrate-producing bacteria in the family
biological recovery approach for PHA using mealworm, Tenebrio
Rhodospirillaceae. Int J Syst Evol Microbiol 59(Pt 10):2575–
Molitor. J Biotechnol 239:98–105. https://doi.org/10.1016/j.jbiotec.
2581. https://doi.org/10.1099/ijs.0.009340-0
2016.10.012
46. Rehm BHA, Steinbüchel A (1999) Biochemical and genetic anal- 56. Fukui T, Kichise T, Yoshida Y, Doi Y (1997) Biosynthesis of
ysis of PHA synthases and other proteins required for PHA synthe- poly(3-hydroxybutyrate-co-3-hydroxyvalerate-co-3-hydroxy-
sis. Int J Biol Macromol 25(1–3):3–19. https://doi.org/10.1016/ heptanoate) terpolymers by recombinant Alcaligenes eutrophus.
s0141-8130(99)00010-0 Biotechnol Lett 19(11):1093–1097. https://doi.org/10.1023/a:
47. Reddy CSK, Ghai R, Rashmi KVC (2003) Polyhydroxyalkanoates: 1018436426032
an overview. Bioresour Technol 87(2):137–146. https://doi.org/10. 57. Bhubalan K, Kam YC, Yong KH, Sudesh K (2010) Cloning and
1016/s0960-8524(02)00212-2 expression of the PHA synthase gene from a locally isolated
48. Verlinden RA, Hill DJ, Kenward MA, Williams CD, Radecka I Chromobacterium sp. USM2. Malays. J Microbiol 6(1):81–90.
(2007) Bacterial synthesis of biodegradable 10.21161/mjm.21809
polyhydroxyalkanoates. J Appl Microbiol 102(6):1437–1449. 58. Chen JY, Song G, Chen GQ (2006) A lower specificity PhaC2
https://doi.org/10.1111/j.1365-2672.2007.03335.x synthase from Pseudomonas stutzeri catalyses the production of
49. Alma'abadi AD, Gojobori T, Mineta K (2015) Marine metagenome as copolyesters consisting of short-chain-length and medium-chain-
a resource for novel enzymes. Genomics Proteomics Bioinformatics length 3-hydroxyalkanoates. Anton Leeuw Int J G 89(1):157–
13(5):290–295. https://doi.org/10.1016/j.gpb.2015.10.001 167. https://doi.org/10.1007/s10482-005-9019-9