JJBS

Volume 15, Number 2,June 2022

ISSN 1995-6673
Pages 239 – 247
https://doi.org/10.54319/jjbs/150211
Jordan Journal of Biological Sciences

Prevalence of Some Pathogenic Bacteria in Caged- Nile Tilapia

(Oreochromis Niloticus) and their Possible Treatment
Ahmed Hammad Sherif 1,* and Rasmia Hanafy AbuLeila2
1
Fish Disease Department, Animal Health Research Institute AHRI, Agriculture Research Center ARC, Kafrelsheikh, Egypt, 2 Fish Diseases
Department, Animal Health Research Institute AHRI Agriculture Research Center ARC, Egypt
Received: February 25, 2021; Revised: June 5, 2021; Accepted: June 26, 2021

Abstract

Bacteria are the primary cause of fatal disease outbreaks in aquaculture. Nine fish cages located at three different sites (3
cages/site) in the north Rosetta branch of the Nile River have exhibited high mortality rates. A total of 220 moribund
Oreochromis niloticus and fish feed and water samples were examined for pathogenic bacteria in this study. Fish infected
with Vibrio parahaemolyticus were located at only site 1 (62.5% infection rate), and Streptococcus agalactiae was isolated
from fish at sites 1 and 3 (25% and 37.5% infection rates, respectively). Fish infected with V. parahaemolyticus or S.
agalactiae were coinfected with Aeromonas hydrophila. Further investigation revealed that V. parahaemolyticus infection at
site 1 may occur via a fish feed that was contaminated with V. parahaemolyticus (the fish feed was containing improperly
manufactured marine fish meal). The median lethal dose (LD50) 96h of A. hydrophila, V. parahaemolyticus, and S.
agalactiae was 2.4 × 105, 1.9 × 105, and 5.2 ×103 colony-forming unit / ml, respectively for O. niloticus (50 ± 2.5 g b.w.) at a
water temperature of 25.1 °C ± 1.5 °C. In an indoor experiment, O. niloticus were injected with the LD50 of the isolated
bacteria. Florfenicol was found to be superior to ciprofloxacin in treating A. hydrophila and V. parahaemolyticus infection
(mortality 13.3 % and 16.7 %, respectively), and ciprofloxacin was found to be more efficient in treating S. agalactiae
infection (mortality 13.3%). In conclusion, inappropriately manufactured marine fishmeal was the source of V.
parahaemolyticus infection in caged fish. V. parahaemolyticus or S. agalactiae infection co-occurred with A. hydrophila in
fish cages containing low-quality water (high unionized ammonia content).

Keywords: Aeromonas hydrophila; Vibrio parahaemolyticus; Streptococcus agalactiae; fish cages; Oreochromis niloticus.

most important pathogen in the aquatic environment that

1. Introduction results in significant economic losses. This bacterium
could be considered as a specific primary pathogen in
Tilapia species come after carp species as the second freshwater, and it also acts as a secondary opportunistic
major cultured fish around the world. In 2018, the pathogen attacking immunocompromised or stressed
production of O. niloticus in Egypt was 1.2 million tonnes, freshwater fish where it normally inhabits in the gut of O.
which, formed 65.15%, of total production which was 1.5 niloticus (Sherif et al., 2020). Vibrio spp. are bacteria that
million tonnes (FAO, 2020). High market demands have are ubiquitous in marine and brackish waters and are
led to intensive fish culture, wherein fish are exposed to typical examples of opportunistic bacteria that cause
infectious diseases, which have been considered one of the diseases. These bacteria cause disease not only in fish but
main obstacles facing aquaculture industries due to severe also in humans and shrimp. Vibriosis, a disease caused by
economic losses (Plant and LaPatra, 2011; Hamidan and Vibrio spp., is highly dependent on water quality
Shobrak, 2019). In recent years in Egypt, the high deterioration, which results in severe immunosuppression
mortality and morbidity rates recorded in freshwater fish and initiates bacterial infection outbreaks (Amal et al.,
farms were due to the prevalence of bacterial diseases that 2015). Streptococcus spp. are gram-positive bacteria that
are concomitant with water temperature in summer (Enany normally present in the aquatic environment causing a
et al., 2019). In Egypt, Osman et al. (2021) reported that haemorrhagic disease in fish (Chang and Plumb, 1996).
Pseudomonas sp. Isolated from Nile tilapia farmed or wild They caused a condition called by streptocococcosis
captured (River Nile) were carried antibiotic resistance, predominantly in O. niloticus. This disease is considered
Quorum sensing, and virulence genes. In Bangladesh, one of the worst diseases in O. niloticus worldwide (Yang
Hamom et al. (2020) found that farmed diseased tilapia et al., 2018).
harboured Edwardsiella tarda Streptococcus agalactiae, Several fish cages in the Nile River exhibit severe
and Flavobacterium columnare while live fish carried mortalities due to common bacteria that infect freshwater
Streptococcus iniae and Aeromonas salmonicida. They fish, and no uncommon species have been observed
also added that columnare and E. tarda caused a through classic bacterial investigation. Coinfection in fish
coinfection status in tilapia. Aeromonas is considered the is common, as indicated by the fact that a single fish could

*
Corresponding author e-mail: [email protected].
240 © 2022 Jordan Journal of Biological Sciences. All rights reserved - Volume 15, Number 2

harbour more than one species of bacteria; such Samples of fish feed (3 replicate/site) were randomly and
coinfection could be explained by the kind of the fish diet, aseptically collected in sterile plastic bags at different cage
sampling sites, human activities and water parameters at sites, each sample of 1 g aseptically dissolved in 9 ml
the fish culture sites (Abdelsalam et al., 2017). distilled water. The tubes containing tryptic soy broth
Comparison of 16S rRNA sequences is a reliable approach (TSB) were inoculated with samples of fish tissue, water,
to distinguish between the different species of pathogenic and dissolved fish feed then the tubes were incubated for
bacteria (Woo and Bruno, 2014). 24 h at 26 ± 1 °C. In addition, samples were inoculated
One of the common ways to control bacterial infections into TSB with 1.5% NaCl then incubated for 24 h at 26 °C
in fish culture is through the use of antibiotics. A bacterial ± 1 °C.
outbreak is considered as a major threat for farming, due to 2.2.2. Biochemical profiles
which a large number of antibiotics are used not only for
treatment but also for prophylaxis (Noga, 2010). In the Phenotypic characterization of the bacterial isolates
Vietnam aquaculture sector, 82% of lobster farmers and was demonstrated according to (Madigan and Martinko,
28% of fish farmers used antibiotics at an average rate of 5 2005). Biochemical analyses (in triplicates) were
and 0.6 kg per produced ton of lobster and fish conducted using API20 E following guidelines of
respectively (Hedberg et al., 2018). In the United States of (BioMerieux, Marcy l' Etoile, France).
America (USA), fish treatment with florfenicol and 2.2.3. Selective isolation of bacterial strains
ciprofloxacin was recommended by the food and drug For Aeromonas hydrophila isolation, the inoculum was
administration (FDA) under the veterinary feed directive spread onto Rimler-Shotts agar then incubated for 24 h at
and the investigational new animal drug (INAD) to combat 26 °C ± 1 °C. For Streptococcus agalactiae isolation, the
fish diseases in aquaculture (Noga, 2010). Some inoculum was streaked onto tryptic soy agar (TSA) with
antibiotics were approved for aquacultures such as 5% sterile sheep blood then incubated for 72 h at 26 °C ± 1
florfenicol, ciprofloxacin, enrofloxacin, difloxacin, °C, according to previously described methods (Facklam
sarafloxacin, chlortetracycline, oxytetracycline, and Carey, 1985), and then spread onto brain heart
doxycycline, and erythromycin by the authority of infusion (BHI) agar then incubated for 24 h at 26 °C ± 1
veterinarian pharmaceuticals in highly producing countries °C. For Vibrio parahaemolyticus isolation, inoculates were
(Noga, 2010). streaked onto thiosulfate citrate bile salt (TCBS) agar (to
Therefore, the aim of this investigation was to highlight produce green colonies) and incubated at 26 °C ± 1 °C for
the possible treatment and to enhance the understanding of 24 h.
the circumstances of the massive mortality of fish reared in
cages. Therefore, we conducted this study to investigate 2.2.4. Determination of bacterial strains and their
virulence genes
the bacteria associated with caged fish mortality outbreaks
in the northern Nile River and the treatment prospects. Further identification of the recovered bacteria was
done using the technique of polymerase chain reaction
2. Materials and Methods (PCR), the bacterial DNA was extracted by means of a
QIAamp DNA Mini Kits (Qiagen GmbH, Germany)
2.1. The sites of the investigated Cages following to the manufacturer’s guidelines, then the
products of PCR were analyzed using gel electrophoresis
This study focused on nine fish cages located at three (AppliChem GmbH, Germany) and a documentation
different sites (3 cages/site) north of the Edfina Barrage in system (Alpha Innotech, Biometra), and then the results
the Rosetta branch of the Nile River, Egypt. The fish cages were evaluated using the Chip PCR computer software
(3 × 2 × 2 m) were stocked with the freshwater fish O. (Rodiger and Burdukiewicz, 2013).
niloticus. A total of 220 moribund O. niloticus (80, 60, and Molecular identification (sequencing) of the isolated
80 fish at sites 1–3, respectively) were collected along with strains was performed using a universal primer specific for
fish feed and water samples. The moribund O. niloticus 16S rRNA (F: AGA GTT TGA TCC TGG CTC AG and
were immediately transported alive to the Animal Health R: GGT TAC CTT GTT ACG ACT T) with a PCR
Research Institute (AHRI), Fish Diseases Department, product size of 1500 bp (Weisburg et al., 1991). The
Kafrelsheikh Provincial Laboratory, Egypt, in the summer sequencing process was conducted using ABI 3730xl
of 2017. All applicable international, national, and/or DNA sequencer. To identify the bacterial strains, the
institutional guidelines for the care and use of animals obtained sequences were matched with the other related
were followed by the authors. ones that were registered in GenBank by using the Blastn
2.2. Bacterial Analyses program.
In Table 1, the primers of virulence genes were
2.2.1. Primary bacterial isolation cytotoxic enterotoxin (act and alt) for A. hydrophila;
The O. niloticus, feed, and water samples were regulatory gene of toxin (toxR) and haemolysin genes (tdh
examined for the presence of bacteria. Bacterial culture and trh) for V. parahaemolyticus; and a CAMP factor (cfb)
was attempted from hepatopancreas, spleen and kidney that enhances the haemolysis processes and C-b protein
tissues according to previously described methods (Woo (bac), a protein serving as an IgA-binding protein for S.
and Bruno, 2014). Water samples (3 replicate/site) were agalactiae. All primers were manufactured by Metabion,
aseptically collected at 0.5 m depth in glass containers. Germany.
 © 2022 Jordan Journal of Biological Sciences. All rights reserved - Volume 15, Number 2 241
Table 1. The sequences of primers, virulence genes, sizes and annealing temperature.
Gene name Sequences 5'-3' Size (bp) Annealing temperature References
A.hydrophila
act F:AGAAGGTGACCACCACCAAGAACA 232 55°C Nawaz et al., 2010
R:AACTGACATCGGCCTTGAACTC

alt F:TGACCCAGTCCTGGCACGGC 442 55°C Nawaz et al., 2010

R:GGTGATCGATCACCACCAGC
V. parahaemolyticus 368 57 °C Kim et al., 1999
toxR F:GTCTTCTGACGCAATCGTTG
R:ATACGAGTGGTTGCTGT CATG
tdh F:CCATTCTGGCAAAGTTATT 534 48 Cai et al., 2007
R:TTCATATGCTTCTACATTAAC

trh F:TTGGCTTCGATATTTTCAGTATCT 500 52 Cai et al., 2007

R:CATAACAAACATATGCCCATTTCCG
S. agalactiae
cfb F:GGATTCAACTGAACTCCAAC 600 72°C Kannika et al., 2017
R:GACAACTCCACAAGTGGTAA

bac F:CTCCAAGCTCTCACTCATAG 750 47°C Kannika et al., 2017

R:GAAACATCTGCCACTGATAC

2.3. Antimicrobial Sensitivity Analyses to the laboratory to analyze the total ammonia nitrogen
(TAN), unionized ammonia (NH3), nitrite (NO2), and
The activity of different antimicrobial drugs against the nitrate (NO3) using a UV/Visible spectrophotometer
isolated bacteria was analyzed following the procedures (Thermo-Spectronic 300) as described by Rice and
described by Finegold and Martin (1982). Pure cultures of Bridgewater (2012).
the strains were cultivated in TSB (Oxoid) then incubated
for 24 h at 26 °C ± 1 °C. Subcultures were spread with a 2.6. Median Lethal Dose (LD50)
sterile cotton stick onto Mueller–Hinton agar plates The LD50 values of A. hydrophila, V.
(Oxoid). Results were recorded after incubation at 26 °C ± parahaemolyticus, and S. agalactiae in O. niloticus (mean
1 °C for 24 h, by disc diffusion including florfenicol (KF body weight = 50±2.5 g) were estimated following the
10 µg), ciprofloxacin (CIP 5 µg), clindamycin (DA 2 µg), method described by (Reed and Muench, 1938). Fish were
amoxy+clavulinic AMC (30 µg), amoxicillin AML (10 acclimated in indoor tanks for 2 weeks at a water
µg), doxycycline (DO 30 µg), sterptomicin (S 10 µg), temperature of 25°C ±1.5 °C. Serial 10-fold dilutions were
spiramycin (SP 100 µg), sulpamethazol +trimethoprim made of the bacteria cultured in BHI broth for 24 h at 30
(SXT 25 µg), lincomycin (MY 10 µg), cefotaxime (CTX °C and then adjusted to 1× 102, 1 × 103, 1 × 104, 1 ×105, 1
30 µg), and cepharadin (CE 30 µg) manufactured by ×106 or 1 × 107 (CFU/ml) in normal saline. Then, 100 µl
Oxoid, Waltham, MA, USA. According to the standards of the bacterial suspension was intraperitoneally injected
provided by the manufacturer and guidelines of NCCLS into duplicate groups of five O. niloticus. Each bacterial
(1999), the isolated bacteria could be classified into three dose (CFU/ml) was based on a standard curve generated
categories: resistant, intermediate, and sensitive depending by performing plate counts. Mortality rates were recorded
on the diameters of inhibition zones. for 96 h; however, accidental mortalities occurring in the
2.4. Antibiotics Treatment Trial first 24 h were excluded. All bacterial strains were re-
isolated from the dead fish (liver, spleen, and kidneys) and
Florfenicol: Floricol® 100 mg/g reg. No. 2533/2015 confirmed by PCR using specific primers (Table 1).
(Pharma Swede Company, Egypt) and ciprofloxacin:
Ciprofar® (tablet) 500 mg/g reg. No. 21515/2012 (Pharco 2.7. Treatment Trial with Antibiotics
Pharmaceutical Company, Egypt) were used. Antibiotics A total of 360 healthy O. niloticus fish with a mean
were coated onto the surface of the pellets using capelin oil body weight of 40 ±0.5 g were collected from a local fish
to prevent antibiotic dissociation, heat oil to 40 °C and farm and acclimated for 2 weeks at a water temperature of
antibiotics were added then mixtures of oil-antibiotic were 25°C ±1.5 °C. O. niloticus were subdivided into four
evenly spread on the fish feed. The dosages of antibiotics groups G1-4 (90 fish/ group) and then infected with A.
were 10 mg/kg b.w./day for 10 successive days and hydrophila (G1), V. parahaemolyticus (G2), and S.
capelin oil was 20 g/kg fish feed. The dosages and agalactiae (G3), whereas un-challenged (G4) fish were
application methods of the antibiotics were implemented considered as the control negative group. Each group was
according to the methods described by (Noga, 2010). subdivided into three treatments, viz., T1–3, each
2.5. Examination of Water Parameters consisting of three replicates (10 fish/replicate) as follows:
control-untreated (T1), ciprofloxacin-treated (T2), and
The water samples were analyzed at cages sites for florfenicol -treated (T3). The antibiotics were applied for
temperature and salinity, (model YSI environmental, 10 days before and after bacterial infection. O. niloticus
EC300) as well as dissolved oxygen (DO) (Aqualytic, OX were injected i.p. with the LD50 of bacteria as described by
24) and pH (Thermo Orion, model 420A). Samples of 1 L Alcaide et al., (1999). A. hydrophila, and S. agalactiae
were placed in a polyethylene bottle and transferred on ice isolates were grown overnight on TSA and TSA
242 © 2022 Jordan Journal of Biological Sciences. All rights reserved - Volume 15, Number 2

containing 3% NaCl for V. parahaemolyticus at 30 °C, one

of each resulted colonies was subcultured TSB for another
16 h. The mortality rate (MR %) was calculated as
follows:

2.8. Statistical Analyses

Data analyses were performed by determining the
variance (ANOVA) using the SPSS software for windows,
SPSS Inc., Chicago, IL, USA (SPSS, 2004). The obtained
data are presented as mean ± SE (standard error). The
significant difference among treatments is determined at a
level of 0.05 using Duncan’s multiple range test (Duncan,
1955).

3. Results

3.1. Clinical Signs and Gross Lesions

Moribund O. niloticus exhibited a lack of appetite,
lethargy, skin petechiae, detached scales and exophthalmia Figure 2. (1) O. niloticus experimentally infected with
(Figure. 1). Postmortem examination of the fish revealed Aeromonas hydrophila suffered from pectoral haemorrhages (A),
site of injection (B), and protruded inflamed-intestine (C). (2) O.
intestinal inflammation, visceral adhesion, hepatomegaly,
niloticus experimentally infected with A. hydrophila with
splenomegaly, and gall bladder distension (Figure. 2). haemorrhages on hepatopancreatic tissue (A), splenomegaly (B),
distended gall bladder (C).

3.2. Microbiological Examination

Bacteriological analyses (Table 2) using classical
methods and PCR technique showed that the moribund O.
niloticus were mostly infected with virulent strains of
Aeromonas hydrophila (78.18%), followed by Vibrio
parahaemolyticus, and S. agalactiae (22.73% each). The
identification numbers obtained with API20 E were
107126, 4046107, and 1463410 for A. hydrophila, V.
parahaemolyticus, and S. agalactiae, respectively. The
blast results of the obtained isolates revealed 100%
homology with A. hydrophila, V. parahaemolyticus, and S.
agalactiae, in the GenBank database. The isolated strains
(A. hydrophila AHRAS2, V. parahaemolyticus AHRAS44,
and S. agalactiae AHRAS33) were deposited to the
GenBank under the accession numbers of MW092007,
MW092008, and MW092091, respectively. Phylogenetic
trees were generated for the three strains (Figures. 3, 4,
and 5). No other bacterial species were isolated from the
collected samples.

Figure 1. (1) O. niloticus collected from fish cages suffered from

exophthalmia (A), haemorrhages on base of pectoral fine (B) and
tail (C), and slightly distended abdomen. (2) O. niloticus collected
from fish cages suffered from splenomegaly (A) and distended
gallbladder (B).
 © 2022 Jordan Journal of Biological Sciences. All rights reserved - Volume 15, Number 2 243

Figure 3. Phylogenetic analyses of Aeromonas hydrophila;

Figure 5. Phylogenetic analyses of Streptococcus agalactiae
At site 1, only V. parahaemolyticus infection occurred
concurrently with A. hydrophila infection, with an
infection rate of 62.5% (Table 2), whereas at site 3, all the
S. agalactiae isolates were concurrently present with A.
hydrophila and V. parahaemolyticus. Although V.
parahaemolyticus is a classic pathogen of marine and
brackish water fish, it was isolated from caged O. niloticus
at site 1. V. parahaemolyticus was isolated only from
caged fish that were fed a diet formulated with locally
produced fish meal. The caged O. niloticus exhibited
obvious infection through contaminated feed as V.
parahaemolyticus was isolated from water and feed in site
1. The infection rates of S. agalactiae in O. niloticus 25%
and 37.5% at sites 1 and 3, respectively, and the infection
occurred concurrently only with A. hydrophila infection.
A. hydrophila and S. agalactiae were isolated from water
samples at (all three sites, and sites 1 and 3, respectively,
and both organisms were not isolated from fish feed.

Figure 4. Phylogenetic analyses of Vibrio parahaemolyticus;

Table 2. Infection rates by bacterial isolate in O. niloticus collected from fish cages.
Items No. A. hydrophila V. parahaemolyticus S. agalactiae Co-infection

No. % No. % No. % No. %

Site 1 80 70 87.5 50 62.5 20 25 50 62.5

Site 2 60 52 86.7 0 0 0 0 0 0
Site 3 80 50 62.5 0 0 30 37.5 30 37.5
Overall 220 172 78.18 50 22.73 50 22.73 100 45.45
No.= number of fish.

3.3. Water Parameters of the Examined Cages The water parameters were suitable range for O. niloticus
culture; however, NH3 content was high at 0.2 mg/l,
The physicochemical parameters of the water (Table 3), resulting in stress conditions.
including temperature, DO, salinity, pH, TAN, NH3, NO2
and NO3, were insignificantly differed in the three sites.
244 © 2022 Jordan Journal of Biological Sciences. All rights reserved - Volume 15, Number 2
Table 3. Physicochemical parameters and ammonia compounds
80
of the water samples. control
florfenicol
Item* S1 S2 S3 60
a a

%
a ciprofloxacin
Temperature (°C) 27±0.5 28±1.5 28±1.5 b

mortality
40 b
DO (mg/l), mid-day 5.4±0.5 5.3±0.7 5.13±0.3 b
b
Salinity (ppt) 1.5±0.05 1.6±0.1 1.5±0.2 20 c c

pH 7.9±0.2 8±0.2 8.2±0.1 d d d

0
TAN (mg/l) 2.1±0.5 2.4±0.25 2.5±0.4

ed
us

e
ila

tia

ng
ic
ph

ac
yt

le
ro
NH3 (mg/l) 0.3±0.1 0.28±0.12 0.27±0.1

al
ol

al
yd

ag
em

ch
.h

S.
ha

n-
A
NO2 (mg/l) 0.01±0.0 0.01±0.0 0.01±0.0

U
ra
pa
V.
NO3 (mg/l) 1.65±0.2 1.6±0.1 1.7±0.2

S, cage site; water DO, dissolved oxygen; pH, hydrogen ions; Figure 6. Mortality percentages of the different groups of O.
TAN, total ammonia nitrogen; NH3; unionized ammonia; NO2, niloticus experimentally infected with the three bacterial isolates
nitrite; NO3, nitrate. * Significant difference (P ≤ 0.05) indicates and unchallenged group. Significant difference (P ≤ 0.05)
by different letters in the same row. indicates by different letters.

3.4. LD50 of the Isolated Bacteria 4. Discussion

The LD50 96h of values A. hydrophila, V.
parahaemolyticus, and S. agalactiae were 2.4 ×105, 1.9 Aeromonas hydrophila, Vibrio parahaemolyticus, and
×105, and 5.2 ×103 CFU/ml, respectively, for O. niloticus Streptococcus agalactiae produced common symptoms of
with a body weight of 50 ±2.5 g at a water temperature of bacterial diseases. Similar to the clinical sings observed in
25°C ±1.5 °C. this study, previous researchers have also reported the
3.5. Antibacterial Profile most common clinical and postmortem signs of V.
parahaemolyticus infection as external haemorrhages,
The bacterial isolates were highly sensitive to white nodular skin lesions, necrotic eyes, sudden death
ciprofloxacin and florfenicol, confirming that these with haemorrhages in the skeletal muscles, deep ulcers,
antibiotics would be suitable for treatment, whereas the liver haemorrhage, pale kidneys and splenomegaly in
bacteria exhibited intermediate resistance to clindamycin, studies on Dicentrarchus labrax (Rahman et al., 2010),
amoxicillin clavulanate, and sulfamethoxazole- Iberian toothcarp (Aphanius iberus) (Alcaide et al., 1999),
trimethoprim and full resistance to amoxicillin, and Amphiprion sebae (Marudhupandi et al., 2017).
lincomycin, cefotaxime, streptomycin, doxycycline, Similarly, Streptococcus infection in Oreochromis
spiramycin, and cephradin. niloticus was manifested by behavioural disorders, pop
3.6. Treatment Trial eye, and haemorrhagic dots on the body surface and bases
of the fins in naturally infected tilapias (Figueiredo et al.,
The three groups of O. niloticus injected with the LD50
2006). Consistently, the post mortem investigation of O.
of the isolated bacteria exhibited mortality, and gross
niloticus, experimentally infected with A. hydrophila,
lesions were eye opacity, haemorrhages at the base of the
showed hepatomegaly and splenomegaly (Sherif et al.,
pectoral fin, inflamed intestines, haemorrhages on
2015) and S. agalactiae in red tilapia (Abdelsalam et al.,
hepatopancrease, splenomegaly and gall-bladder
2017).
distension (Figure. 5). The two different treatment
To confirm the identification of Aeromonas spp., some
regimens decreased the mortality compared with the
genes such as gyrB, rpoD, dnaJ, gyrA, dnaX, recA, and
control regimen. The florfenicol -treated (T2) group had
atpD are commonly used (Zhou et al., 2019). Moreover, V.
the lowest mortality rates (13.3 % and 16.7 %) among
parahaemolyticus strains have been previously identified
groups challenged with A. hydrophila (G1) and V.
through PCR-based methods similar to those in our study
parahaemolyticus (G2), respectively, whereas the
(Kim et al., 1999). The 16S rRNA sequencing approach
ciprofloxacin-treated (T3) group showed 13.3 % mortality
(Figures. 3, 4, and 5) along with virulence genes (Table 1)
among fish challenged with S. agalactiae (G3) compared
were used to confirm the accuracy of bacterial
with the control positive treatment (T1) group (Figure. 6).
identification of the isolated bacteria. Several researchers
The antibiotic treatments had no effect on the mortality
have identified bacterial species using PCR (16S-23S
rate (3.33 %) in the unchallenged O. niloticus (G4) group.
rDNA intergenic spacers) such as Aeromonas spp., and
Streptococcus spp. (Sebastiao et al., 2015).
 © 2022 Jordan Journal of Biological Sciences. All rights reserved - Volume 15, Number 2 245

In the examined cages, A. hydrophila was the most erratically for treating bacterial fish diseases) and
prevalent bacterium at a rate of 78.18% irrespective of the florfenicol are the optimal antibacterial substances for
site. The most important diseases affecting fish in Egypt bacterial isolates. As shown in Figure. 6, the mortality
are A. hydrophila infection, Saprolegniasis, Aflatoxicosis, rates of fish infected with A. hydrophila (G1) and V.
Icthyophonus infection, Trichodina infestation, Costiasis, parahaemolyticus (G2) and then treated with florfenicol
and A. hydrophila and Saprolegnia coinfection (Aly, were significantly lower (13.3% and 16.7, respectively)
2013). In the Nile River, A. hydrophila and Pseudomonas than those of control fish (56.7 and 53.3 %, respectively).
fluorescens have been isolated from both O. niloticus and In S. agalactiae infection (G3), ciprofloxacin-treatment
Clarias gariepinus (Mohamed et al., 2006). V. (T3) resulted in significantly lowest mortality (13.3%)
parahaemolyticus is a classic pathogen of marine and compared with florfenicol-treatment (T2) (40%) and
brackish water fish; however, it was isolated from caged control (47 %). Similarly, Ashiru et al., (2011) found that
O. niloticus (62.5% infection rate). At site 1, V. pefloxacin, ofloxacin, and ciprofloxacin are suitable drugs
parahaemolyticus infection co-occurred with Aeromonas for controlling Aeromonas infection, although,
spp infection in caged O. niloticus (infection rate: 62.5%) oxytetracycline, nitrofurans, potentiated sulfonamides, and
and the fish feed and water samples were contaminated oxolinic acid have been successfully used, bacteria,
with V. parahaemolyticus. Supporting the obtained especially V. anguillarum and V. salmonicida, can exhibit
findings, V. parahaemolyticus has been isolated from resistance to these drugs. Despite the alleviated mortality
tilapia cultured in freshwater cages (Amal et al., 2010) and (14.4%) resulting from ciprofloxacin treatment,
fish cultured in low-salinity water (5~30 ppt NaCl) immunosuppression has been detected in A. sebae infected
(Iwamoto et al., 2010). Moreover, infection rates of with V. parahaemolyticus (Marudhupandi et al., 2017),
52.11%, 29.5%, and 18.4% have been recorded in the whereas S. agalactia, which was isolated from cultured
Terengganu River, Pedu Lake, and Kenyir Lake, yellowtail (Seriola quinqueradiata) in Japan, was resistant
respectively (Ismail et al., 2016). S. agalactiae was to these antibiotics (Kitao and Aoki, 1979).
concurrently isolated from caged-O. niloticus with A.
hydrophila at sites 1 and 3 with infection rates of 25% and 5. Conclusion
37.5%, respectively. S. agalactiae has been reported to
cause large-scale outbreaks in cultured tilapia Thailand This study highlighted the presence of unusual
and Latin America (Marcusso et al., 2015). Furthermore, pathogens that cause mortality in caged fish in the north
similar to the obtained findings regarding coinfection, Rosetta branch of the Nile River. V. parahaemolyticus or
Abdelsalam et al., (2017) reported that S. agalactiae S. agalactiae infection co-occurred with A. hydrophila
concurrently infected red hybrid tilapia reared in cement infection. The source of V. parahaemolyticus infection in
ponds in north coast, Egypt. cage-cultured O. niloticus would be fish feeds containing
Conversely, Aeromonas spp., Streptococcus spp., inappropriately manufactured marine fishmeal so that this
Vibrio spp., and Flavobacterium spp., coinfected cultured classical marine bacterial pathogen causes fish mortality in
O. niloticus, water, and sediment (Al-Harbi and Uddin, the freshwater environment. The infections caused by the
2006). Moreover, A. hydrophila, A. sobria, P. fluorescens bacteria A. hydrophila, S. agalactiae, and V.
and P. aeruginosa were concurrently isolated from O. parahaemolyticus correlated with high unionized ammonia
niloticus (Sherif et al., 2015). In our findings, A. content in cage-water. In such cases, florfenicol was the
hydrophila, V. parahaemolyticus, and S. agalactiae were most effective antibacterial agent along with the
isolated from water samples. Supporting this finding, it has maintenance of water quality.
been reported that infected fish released bacteria through
feces, which survive in water and spread infection (Apun Conflicts of interest
et al., 1999).
None of the authors has any conflict of interests to
The suitable water parameters are an important part of
declare.
aquaculture systems. The parameters of water samples
(temperature, DO, salinity, and pH) in the fish cages were References
suitable for fish culture (Table.3). Maintaining optimal
water quality conditions or parameters is a vital part of fish Abdelsalam M, Shaalan M and Moustafa M. 2017. Rapid
for optimal performance (FAO, 2020). Caged-O. niloticus identification of pathogenic streptococci isolated from moribund
suffer from stressful conditions that predispose them to red tilapia (Oreochromis spp.). Acta Vet Hun, 65: 50-59.
bacterial infection. Although most of the water parameters Alcaide E, Amaro C, Todoli R and Oltra R. 1999. Isolation and
in this study were suitable for fish culture, high levels of characterization of Vibrio parahaemolyticus causing infection in
ammonia were observed with the levels of TAN and NH3 Iberian tooth carp Aphanius iberus. Dis Aquat Org, 35: 77-
being 2.1, 2.4 and 2.5; 0.3, 0.28, and 0.27 mg/l, 80.
respectively. Accordingly, Noga (2010) mentioned that Al-Harbi AH and Uddin MN. 2006. Seasonal changes in bacterial
NH3 level > 1.00 mg/l are lethal whereas those > 0.05 mg/l flora of fish pond sediments in Saudi Arabia. J Appl aquac, 18:
are sublethal concentrations for freshwater fish. The 35-45.
outbreaks of Aeromonas infection in fish farms were due Aly SM. 2013. A Review of fish diseases in the Egyptian
to the limited knowledge and awareness of fish farmers aquaculture sector. Working report. Research program on
regarding appropriate management (Sherif et al., 2015; livestock and fish. CGIAR, pp. 1-41.
Mzula et al., 2019).
Amal MNA, Zamri-Saad M, Siti-Zahrah S and Zulkafli AR. 2015.
Based on antibiogram findings, ciprofloxacin (despite Water quality influences the presence of Streptococcus agalactiae
being illegal for veterinary use in Egypt, some farmers and in cage cultured red hybrid tilapia, Oreochromis niloticus ×
paramedics use ciprofloxacin unintentionally and Oreochromis mossambicus. Aquac Res, 46: 313-323.
246 © 2022 Jordan Journal of Biological Sciences. All rights reserved - Volume 15, Number 2
Amal, MNA, Zamri-Saad, M., Siti-Zahrah, A, Zulkafli, R, Misri, by multiplex PCR. J Appl Microbiol, 122: 1497-1507.
S, Nur-Nazifah, M and Shahidan, H. 2010. Prevalence of https://doi.org/10.1111/jam.13447
Streptococcus agalactiae in tilapia kept indifferent water bodies.
Kim YB, Okuda J, Matsumoto C, Takahashi N, Hashimoto S and
Online J Vet Res, 14: 153-162. Nishibuchi M. 1999. Identification of Vibrio parahaemolyticus
Apun K, Yusof AM and Jugang K. 1999. Distribution of bacteria strains at the species level by PCR targeted to the toxR gene. J
in tropical freshwater fish and ponds. Int J Environ Health Res, 9: Clin Microbiol., 37:1173-1177.
285-292. https://doi.org/10.1080/09603129973083
Kitao T and Aoki Τ. 1979. Therapeutic studies of doxycycline of
Ashiru AW, Uaboi-Egbeni PO, Oguntowo JE and Idika CN. 2011. Streptococcosis of cultured yellow tail (Seriola Quinqueradiata).
Isolation and antibiotic profile of Aeromonas species from tilapia Bull Fac Agric Univ Miyazaki, 26: 357-63.
fish (Tilapia nilotica) and catfish (Clarias betrachus). Pak J Nutr,
Madigan MT and Martinko J. 2005. Brock Biology of
10: 982-986. Microorganisms, 11th Ed. Prentice Hall.
Cai SH, Wu ZH, Jian JC and Lu YS. 2007. Cloning and
Marcusso PF, Eto SF, Claudiano GD, Vieira FC, Salvador R,
expression of the gene encoding an extracellular alkaline serine Moraes JR and Moraes FR. 2015. Isolamento de Streptococcus
protease from Vibrio alginolyticus strain hy9901, the causative
agalactiae em diferentes órgãos de tilápias do nilo (Oreochromis
agent of Vibriosis in Lutjanus erythopterus (Bloch). J Fish Dis,
niloticus) criadas em tanques-rede. Biosci J, 549-554.
30: 493–500. https://doi.org/10.1111/j.1365-2761.2007.00835.x
Marudhupandi T, Kumar TTA, Prakash S, Balamurugan J and
Chang PA and Plumb JA. 1996. Histopathology of experimental
Dhayanithi NB. 2017. Vibrio parahaemolyticus a causative
Streptococcus sp. infection in tilapia, Orochromis niloticus (L.), bacterium for tail rot disease in ornamental fish, Amphiprion
and channel catfish, Ictafurus punctatus (Ratinesque). J Fish Dis,
sebae. Aquacult Rep, 8: 39-44.
19: 235-241. https://doi.org/10.1111/j.1365-2761.1996.tb00130.x
https://doi.org/10.1016/j.aqrep.2017.09.004
Duncan DB. 1955. Multiple ranges and multiple “F” test.
Mohamed LA, Osman KM, El-Seedy S and Soliman W. 2006.
Biometrics, pp10–11
Isolation and characterization of Aeromonas species and
Enany M, Eidaroos N and Eltamimy N. 2019. Microbial causes of Pseudomonas fluorescens from freshwater fishes. International
summer mortality in farmed fish in Egypt. SCVMJ, 24: 45-56. Conference, Research Division, NRC, 219-229.
https://doi.org/10.21608/scvmj.2019.59198.
Mzula A, Wambura PN, Mdegela RH and Shirima GM. 2019.
Facklam RR and Carey RB. 1985. Streptococci and Aerococi. In Phenotypic and molecular detection of Aeromonads infection in
"Manual of clinical microbiology" 4th Ed. Lennette, Hauser, farmed Nile tilapia in Southern highland and Northern Tanzania.
Shadomy (Eds). American Society for Microbiology, Washington Heliyon, 5: e02220. https://doi.org/10.1016/j.heliyon.2019.e02220
DC, pp. 154-175.
Nawaz M, Khan SA, Khan AA, Sung, K, Tran Q, Kerdahi K and
FAO. (2020). Fishery and aquaculture statistics. Global Steele R. 2010. Detection and characterization of virulence genes
production by production source 1950–2018 (FishstatJ). Retrieved and integrons in Aeromonas veronii isolated from catfish. Food
from FAO Fisheries and Aquaculture Department [online] Microbiol, 27: 327-331. https://doi.org/10.1016/j.fm.2009.11.007
website: www.fao.org/fishery/statistics/software/fishstatj/en.
NCCLS (National Committee for Clinical Laboratory Standards).
Figueiredo HC, Carneiro DO, Faria FC and Costa GM. 2006. 1999. Performance standard for antimicrobial disk and dilution
Streptococcus agalactiae associado à meningoencefalite e susceptibility tests for bacteria isolated from animals. Approved
infecção sistêmica em tilápia-do-nilo (Oreochromis niloticus) no Standard M 31A19 (11). NCCLS, Wayne, Pennsylvania.
Brasil. Arq Bras Med Vet Zoo, 58: 678-680. Noga EJ. 2010. Fish diseases: Diagnosis and treatment 2nd Ed,
https://doi.org/10.1590/S0102-09352006000400036
Wiley-Blackwell
Finegold, SM and Martin WJ. 1982. Bailey and Scott’s Diagnostic Osman KM, da Silva Pires Á, Franco OL, Saad A, Hamed M,
microbiology. (Eds.) Mosby, Philadelphia.
Naim H, Ali AH and Elbehiry A. 2021. Nile tilapia (Oreochromis
Hamidan NAF and Shobrak M. 2019. An Update on Freshwater niloticus) as an aquatic vector for Pseudomonas species of
Fishes of Saudi Arabia. Jordan J Biol Sci, 12: 495-502. medical importance: Antibiotic Resistance Association with
Biofilm Formation, Quorum Sensing and Virulence. Aquaculture,
Hamom A, Alam MM, Iqbal MM, Khalil SM, Parven M, Sumon
TA and Mamun MA. 2020. Identification of pathogenic bacteria 532:736068. https://doi.org/10.1016/j.aquaculture.2020.736068
from diseased Nile tilapia Oreochromis niloticus with their Plant KP and LaPatra SE. 2011. Advances in fish vaccine
sensitivity to antibiotics. Int J Curr Microbiol Appl Sci, 9: 716– delivery. Dev Comp Immunol, 35: 1256-1262.
1738. https://doi.org/10.20546/ijcmas.2020.903.200 https://doi.org/10.1016/j.dci.2011.03.007
Hedberg N, Stenson I, Nitz Pettersson M, Warshan D, Nguyen- Rahman MM, Ferdowsy H, Kashem MA and Foysal MJ. 2010.
Kim H, Tedengren M and Kautsky N. 2018. Antibiotic use in Tail and fin rot disease of Indian major carp and climbing perch in
Vietnamese fish and lobster sea cage farms; implications for coral Bangladesh. J Biol Sci, 10: 800-804.
reefs and human health. Aquaculture, 495: 366-375. https://scialert.net/abstract/?doi=jbs.2010.800.804
Ismail NIA, Amal MNA, Shohaimi S, Saad MZ and Abdullah SZ. Reed LJ and Muench H. 1938. A simple method of estimating
2016. Associations of water quality and bacteria presence in cage fifty percent endpoints. Am J Epidemiol, 27: 493-497.
cultured red hybrid tilapia, Oreochromis niloticus × O. https://doi.org/10.1093/oxfordjournals.aje.a118408
mossambicus. Aquacult Rep, 8: 39-44.
Rice EW and Bridgewater L. 2012. A.P.H. Association, standard
https://doi.org/10.1016/j.aqrep.2016.06.004 methods for the examination of water and wastewater, American
Iwamoto M, Ayers T, Mahon BE and Swerdlow DL. 2010. public health association, Washington, DC.
Epidemiology of seafood-associated infections in the United
Rodiger S and Burdukiewicz M. 2013. ChipPCR: toolkit of helper
States. Clin Microbiol Rev, 23: 399-411.
functions to pre-process amplification data Available from:
Kannika K, Pisuttharachai D, Srisapoome P, Wongtavatchai J, https://github.com/michbur/chipPCR
Kondo H, Hirono I, Unajak S and Areechon N. 2017. Molecular
Sebastiao FD, Lemos EG and Pilarski F. 2015. Validation of
serotyping, virulence gene profiling and pathogenicity of
absolute quantitative real-time PCR for the diagnosis of
Streptococcus agalactiae isolated from tilapia farms in Thailand
 © 2022 Jordan Journal of Biological Sciences. All rights reserved - Volume 15, Number 2 247
Streptococcus agalactiae in fish. J Microbiol Methods, 119: 168- Weisburg WG, Barns SM, Pelleitier DA and Lane DJ. 1991. 16S
175. https://doi.org/10.1016/j.mimet.2015.10.021 Ribosomal DNA Amplification for Phylogenetic study. J
Bacteriol, 173: 697-703.
Sherif AH, Elgamel A and Amin HA. 2015. Investigation of mass
mortality of some fresh water fish in late summer in some fish Woo P and Bruno D. 2014. Diseases and Disorders of Finfish in
farms at Kafr El Shiekh governorate. J Arabaqs, 10: 33-44. Cage Culture. 2nd Ed. CABI Pub, pp. 159-160.
https://doi.org/ 10.12816/0026660
Yang Q, Liu JX, Wang KY, Liu T, Zhu L, He SY, Geng Y, Chen
Sherif AH, Gouda MY, Naena NA and Ali AH. 2020. Alternate DF, Huang XL, and Ouyang P. 2018. Evaluation of
weekly exchanges of feeding regime affect the diversity of immunogenicity and protective efficacy of the elongation factor
intestinal microbiota and immune status of Nile tilapia Tu against Streptococcus agalactiae in tilapia. Aquaculture, 492:
Oreochromis niloticus. Aquac Res, 51: 4327-4339. 184-189. https://doi.org/10.1016/j.aquaculture.2018.03.056
https://doi.org/10.1111/are.14778 Zhou Y, Yu L, Nan Z, Zhang P, Kan B, Yan D and Su J. 2019.
SPSS 2004. "Statistical and package for social science, SPSS for Taxonomy, virulence genes and antimicrobial resistance of
windows release14.0.0, 19 June, 2004." Standard version, Aeromonas isolated from extra-intestinal and intestinal infections.
copyright SPSS Inc., 1989- 2004. BMC Infect Dis, 19: 158.