APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Aug. 2008, p. 4853–4866 Vol. 74, No.

15
0099-2240/08/$08.00⫹0 doi:10.1128/AEM.02756-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

SEL, a Selective Enrichment Broth for Simultaneous Growth of

Salmonella enterica, Escherichia coli O157:H7, and
Listeria monocytogenes䌤†
Hyochin Kim and Arun K. Bhunia*
Molecular Food Microbiology Laboratory, Department of Food Science, Purdue University, West Lafayette, Indiana

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

Received 6 December 2007/Accepted 28 May 2008

Multipathogen detection on a single-assay platform not only reduces the cost for testing but also provides
data on the presence of pathogens in a single experiment. To achieve this detection, a multipathogen selective
enrichment medium is essential to allow the concurrent growth of pathogens. SEL broth was formulated to
allow the simultaneous growth of Salmonella enterica, Escherichia coli O157:H7, and Listeria monocytogenes. The
results were compared to those obtained with the respective individual selective enrichment broths, Rappaport-
Vassiliadis (RV) for S. enterica, modified E. coli broth with 20 mg of novobiocin/liter for E. coli O157:H7, and
Fraser broth for L. monocytogenes, and a currently used universal preenrichment broth (UPB). The growth of
each pathogen in SEL inoculated at 101 or 103 CFU/ml was superior to that in the respective individual
enrichment broth, except in the case of RV, in which Salmonella cells inoculated at both concentrations grew
equally well. In mixed-culture experiments with cells of the three species present in equal concentrations or at
a 1:10:1,000 ratio, the overall growth was proportional to the initial inoculation levels; however, the growth of
L. monocytogenes was markedly suppressed when cells of this species were present at lower concentrations than
those of the other two species. Further, SEL was able to resuscitate acid- and cold-stressed cells, and recovery
was comparable to that in nonselective tryptic soy broth containing 6% yeast extract but superior to that in the
respective individual selective broths. SEL promoted the growth of all three pathogens in a mixture in
ready-to-eat salami and in turkey meat samples. Moreover, each pathogen was readily detected by a
pathogen-specific immunochromatographic lateral-flow or multiplex PCR assay. Even though the growth
of each pathogen in SEL was comparable to that in UPB, SEL inhibited greater numbers of nontarget
organisms than did UPB. In summary, SEL was demonstrated to be a promising new multiplex selective
enrichment broth for the detection of the three most prominent food-borne pathogens by antibody- or
nucleic acid-based methods.

Every year, up to 81 million people in the United States suffer increase the target-pathogen concentration in a sample but
from food-borne diseases, and food-borne pathogens continue to also to resuscitate physiologically stressed or injured cells. Se-
be a major public health concern (37, 40). Among the known lective enrichment is also necessary to suppress the natural
food-borne pathogens, Salmonella enterica, Listeria monocyto- background microorganisms so as to improve detection effi-
genes, and Escherichia coli O157:H7 are of major concern because ciency and to avoid false results. However, the drawbacks of
of their continued association with highly popular foods such as some of the selective enrichment broths are that the selective
poultry products, ready-to-eat meats, dairy products, and fruits agents can be inhibitory or can delay the recovery and growth
and vegetables. Above all, these pathogens have very high inci- of healthy or stressed target pathogens (26) and may also down
dence and mortality rates and have been involved in several re- regulate antigen expression, thus affecting the detection of
cent outbreaks (37). Therefore, the control and prevention of pathogens (21, 24, 34).
these pathogens are of high priority to improve the safety of the Current research trends emphasize the development of
U.S. food supply. The accurate and rapid detection of these three multipathogen platforms in a single-assay format. For ex-
pathogens is essential, and testing is sometimes mandatory before ample, multiplex PCR assays (5, 20, 30, 42), protein/anti-
certain food items can be distributed for retail sale for human body microarray biosensors (35, 50), array-based immu-
consumption.
nosorbent assays (14), and DNA microarray methods (15)
Though the sensitivities of many of the modern detection
continue to be developed. The multipathogen detection ap-
methods, such as antibody-, nucleic acid-, and biosensor-based
proach is attractive and economically favorable since it can
methods, have improved significantly (6, 23, 38, 46), an enrich-
reduce the total space requirement for handling a large
ment step is still needed. This step is required not only to
number of samples, as well as the bench space, supplies,
reagents, and labor needed, thus reducing the overall cost of
* Corresponding author. Mailing address: Department of Food Sci- testing per pathogen. Furthermore, multiplex detection is a
ence, 745 Agriculture Mall Dr., Purdue University, West Lafayette, IN rational approach since many foods, such as milk and dairy
47907-2009. Phone: (765) 494-5443. Fax: (765) 494-7953. E-mail: products (1), meat and poultry (16, 45), and fruits and
[email protected].
vegetables (4, 10), are common carriers of S. enterica, E. coli
† Supplemental material for this article may be found at http://aem
.asm.org/. O157:H7, and L. monocytogenes. Moreover, multipathogen
䌤
Published ahead of print on 6 June 2008. detection can mitigate the industry and regulatory needs for

4853
4854 KIM AND BHUNIA APPL. ENVIRON. MICROBIOL.

the testing of foods that have a high risk of contamination cytogenes samples were dispensed into the sample ports of the ICLFA strips, and
with these pathogens. the strips were incubated at room temperature for 15 to 20 min. Positive antibody
reactions (indicated by the appearance of a dark band in the viewing window)
To facilitate multipathogen detection in a single-assay were recorded by capturing digital images, and the reaction intensities were
format, a suitable enrichment medium is urgently needed. A quantified by using a densitometer software program (Scion Corp., Frederick,
universal preenrichment broth (UPB) for multipathogen en- MD). As controls, the procedures recommended by the manufacturer (Neogen
richment (2) is commercially available from Difco Lab, Corp.) for each pathogen were used.
Sparks, MD; however, this medium lacks inhibitory agents Multiplex PCR. Multiplex PCR assays were employed to verify whether
SEL could be used as an enrichment broth for PCR-based detection of
to provide selectivity for target pathogens and, thus, may not pathogens. DNA was extracted from 1 ml of each culture by using DNA
be suitable for samples with high levels of background mi- extraction kits (DNeasy tissue kits; catalog no. 69506) per the instructions of
croflora, such as raw or unprocessed samples from animal the manufacturer (Qiagen, Valencia, CA). The primer sequences and the

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

and plant origins. Thus, the objectives of this study were to putative product sizes for each amplicon are listed in Table 3. The PuReTaq
formulate a single medium that can support the simulta- ready-to-go PCR beads (GE Healthcare, Piscataway, NJ) were used for PCR
amplification (39). PCR mixtures (25 ␮l) each contained 1 ␮g of each DNA
neous growth primarily of three food-borne pathogens, S. template, 15 pmol of each primer, and one PuReTaq PCR bead containing
enterica, E. coli O157:H7, and L. monocytogenes, if present 2.5 U of PuReTaq polymerase, 200 ␮mol of each deoxynucleoside triphos-
in a single sample and to demonstrate the performance of phate, 10 mM Tris-HCl, 50 mM KCl, and 1.5 nM MgCl2. After the initial
the medium by employing an antibody-based immunochro- DNA denaturation at 94°C for 3 min, 40 amplification cycles consisting of 1
matographic lateral-flow assay (ICLFA) and a multiplex min of denaturation at 94°C, 1.5 min of annealing at 60°C, and 1.5 min of
elongation at 72°C were done in a thermal cycler (MJ Research, Watertown,
PCR assay. The multipathogen medium, designated SEL MA). Amplified DNA products were detected in agarose gel (1.5%, wt/vol)
(for Salmonella, Escherichia, and Listeria), was developed in containing 1 ␮g of ethidium bromide/ml.
this study, and its performance as an enrichment broth was Growth kinetics of individual target pathogens in SEL. To examine the growth
verified by growing three pathogens in various proportions of target pathogens in SEL, two inoculation levels, 101 and 103 CFU/ml, were
and detecting the bacteria by using ICLFA and multiplex chosen. Volumes of 100 ml of SEL were inoculated with freshly grown Salmo-
nella serovar Enteritidis, E. coli O157:H7, and L. monocytogenes and incubated
PCR. The spectra of growth of target and nontarget bacteria at 37°C in a shaking incubator (Edison, New Brunswick, NJ) set at 150 rpm. The
obtained from our collection, as well as natural isolates from growth rates were determined by enumerating bacterial cells at every 2-h interval
food, in SEL were also determined. Next, the ability of SEL by plating the cells onto BHI agar plates. At the same time, the growth of target
to resuscitate acid- or cold-stressed bacteria was investi- pathogens in the respective specific selective enrichment broths, RV broth for
gated. Finally, the performance of SEL was examined and Salmonella serovar Enteritidis, mEC⫹n for E. coli O157:H7, and FB for L.
monocytogenes, was also evaluated. The Gompertz equation (47) was used to
compared with that of UPB by testing pathogen-inoculated compare the growth kinetics of the different pathogens in SEL. ICLFA and PCR
meat samples. assays were used to evaluate the medium performance. These experiments were
repeated twice.
MATERIALS AND METHODS Growth kinetics of target pathogens in a mixture. Four different combinations
of initial cell numbers were used to examine the growth kinetics of each pathogen
Bacterial cultures and growth conditions. E. coli O157:H7 EDL 933, L. mono-
in SEL. In experiment I, equal concentrations of Salmonella serovar Enteritidis,
cytogenes V7 (serotype 1/2a), and S. enterica serovar Enteritidis phage type 1
E. coli O157:H7, and L. monocytogenes cultures (ca. 3 ⫻ 102 CFU of each
(PT1) cultures were used as standard reference cultures in all the studies and
pathogen/ml) were inoculated into 100 ml of SEL. In experiments II through IV,
were maintained on brain heart infusion (BHI; Accumedia, Lansing, MI) agar
the ratio of the cultures used as inocula was set at 1:10:1,000, with the proportion
plates at 4°C. Fresh cultures were prepared by inoculating tryptic soy broth
of each culture varying in order throughout the different experiments. In exper-
containing 0.6% yeast extract (TSBYE; Difco Lab, Sparks, MD) at 37°C. The
iment II, the inocula contained Salmonella serovar Enteritidis cells at a mean
other organisms used in this study are listed in Table 1 and were maintained
concentration ⫾ a standard deviation (SD) of 13.5 ⫾ 1.1 CFU/ml, E. coli at
similarly, except for lactic acid bacteria, which were grown and maintained in
1,327 ⫾ 166 CFU/ml, and L. monocytogenes at 1.3 ⫾ 0.6 CFU/ml. In experiment
deMann Rogosa Sharpe (MRS) broth and on MRS agar (both from Difco).
III, the mixture consisted of Salmonella serovar Enteritidis at 1.4 ⫾ 0.1 CFU/ml,
The individual selective enrichment broths and plating agars (all purchased
E. coli at 14.6 ⫾ 1.6 CFU/ml, and L. monocytogenes at 1,180 ⫾ 125 CFU/ml, and
from Difco) used in this study included modified E. coli broth with 20 mg of
novobiocin/liter (mEC⫹n) and sorbitol MacConkey agar with cefixime-tellurite in experiment IV, Salmonella serovar Enteritidis at 1,178 ⫾ 124 CFU/ml, E. coli
(CT-SMAC) for E. coli O157:H7, Rappaport-Vassiliadis (RV) broth and xylose- at 1.3 ⫾ 0.1 CFU/ml, and L. monocytogenes at 11.5 ⫾ 1.9 CFU/ml were used. The
lysine-deoxycholate (XLD) agar for Salmonella serovars Enteritidis and Typhi- inoculated SEL broths (100 ml each) were incubated at 37°C for 24 h in a shaking
murium, and Fraser broth (FB) and modified Oxford agar (MOX) for L. mono- incubator, and samples were withdrawn every 2 h. The cell counts for each
cytogenes. The cefixime-tellurite supplement was purchased from BioMerieux pathogen were determined by plating the cells onto plates with the appropriate
(Hazelwood, MO), and UPB was purchased from Difco Lab. selective agar: XLD agar for Salmonella serovar Enteritidis, CT-SMAC for E.
Formulation of multipathogen selective enrichment broth SEL. Commercially coli O157:H7, and MOX for L. monocytogenes. The lateral-flow immunoassay
available buffered Listeria enrichment broth base (BLEB; Difco Laboratories) and multiplex PCR assays were performed with culture samples taken at 16 to
without an antibiotic supplement was used as a base medium for the develop- 18 h of growth to determine if a pathogen-specific detection assay could be
ment of the multipathogen enrichment broth SEL. Four antimicrobial agents, employed for the detection of individual pathogens from a mixed culture. These
acriflavine (ICN Biomedical Inc., Aurora, OH) and cycloheximide, fosfomycin, experiments were repeated three times with two replicates per trial.
and nalidixic acid (all purchased from Sigma, St. Louis, MO), were used as In a separate experiment, several samples of ready-to-eat sliced turkey meat
selective agents. The concentration of each to be used for SEL formulation was (25 g each; see below for details on meat sample procurement and the prepa-
optimized by growing all three pathogens separately in a series of growth curve ration procedure) were inoculated with bacterial mixtures as listed above for
experiments (31). The final composition of the SEL medium is presented in experiments I to IV, enriched with 225 ml of SEL for 24 h, and analyzed by
Table 2. multiplex PCR as described above.
Antibody-based ICFLA. Widely used antibody-based ICLFA kits were em- Isolation of resident bacteria from food. Bacterial isolates were obtained from
ployed to verify the antibody-based detection of target pathogens following ready-to-eat meats. A total of two pieces of roasted turkey breast and three
enrichment in SEL. Reveal kits (Neogen Corp., Lansing, MI) for Salmonella, E. Genoa salamis (218 g each) were procured from several different local grocery
coli O157:H7, and Listeria were used for verification. The Reveal kits for E. coli stores (West Lafayette, IN). Each meat sample (25 g) was homogenized in 225
O157:H7 and Salmonella allow the testing of samples without heat treatments, ml of 20 mM phosphate-buffered saline (pH 7.0), dilutions were plated onto BHI
while the Reveal kit for Listeria recommends a heat treatment (80°C for 20 min) or MRS agar plates, and the plates were incubated at 37°C. Colonies were
prior to testing. Briefly, following the growth of test organisms in SEL, 120-␮l randomly picked and identified by metabolic fingerprinting using the BioLog
aliquots of E. coli and Salmonella samples and 135-␮l heat-inactivated L. mono- culture identification system (Hayward, CA) or by ribotyping (27) employing an
VOL. 74, 2008 MULTIPATHOGEN SELECTIVE ENRICHMENT BROTH 4855

TABLE 1. Growth spectra of food-borne bacteria in multipathogen enrichment broth SEL

Ribotyping Growth in SEL (mean OD595 ⫾ SD) at: Growth in UPB (mean OD595 ⫾ SD) at:
Organism Sourcea
result 12 h 16 hc 24 h 12 h 16 hc 24 h

Target pathogens
S. enterica
Serovar Enteritidis PT1 Our collection DUP-2035 1.05 ⫾ 0.02 1.09 ⫾ 0.03 A 1.09 ⫾ 0.03 0.62 ⫾ 0.02 0.80 ⫾ 0.07 B 0.93 ⫾ 0.07
Serovar Kentucky 1271-94 Our collection NTb 0.95 ⫾ 0.04 1.05 ⫾ 0.02 A 1.07 ⫾ 0.01 0.50 ⫾ 0.04 0.70 ⫾ 0.07 B 0.85 ⫾ 0.11
Serovar Tennessee 825-94 Our collection NT 0.99 ⫾ 0.01 1.12 ⫾ 0.01 A 1.19 ⫾ 0.03 0.47 ⫾ 0.05 0.73 ⫾ 0.05 B 0.88 ⫾ 0.05
Serovar Typhimurium Our collection DUP-1167 1.01 ⫾ 0.03 1.10 ⫾ 0.01 A 1.15 ⫾ 0.01 0.72 ⫾ 0.02 0.84 ⫾ 0.04 B 1.00 ⫾ 0.06

E. coli

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

O157:H7 G5303 (EHEC) CDC NT 0.98 ⫾ 0.04 1.01 ⫾ 0.04 A 0.96 ⫾ 0.03 0.61 ⫾ 0.00 0.80 ⫾ 0.02 B 0.86 ⫾ 0.06
O157:H7 G5324 (EHEC) CDC NT 0.98 ⫾ 0.09 1.08 ⫾ 0.04 A 0.97 ⫾ 0.09 0.65 ⫾ 0.05 0.77 ⫾ 0.05 B 0.95 ⫾ 0.02
O157:H7 C7927 (EHEC) Apple cider NT 1.03 ⫾ 0.04 1.04 ⫾ 0.06 A 1.03 ⫾ 0.06 0.63 ⫾ 0.01 0.76 ⫾ 0.06 B 0.89 ⫾ 0.02
O25:K98:NM (ETEC) M. Donnenberg DUP-18656 0.04 ⫾ 0.02 0.37 ⫾ 0.04 B 0.52 ⫾ 0.06 0.62 ⫾ 0.06 0.77 ⫾ 0.08 A 0.88 ⫾ 0.13
O78:H11 (ETEC) M. Donnenberg DUP-19199 0 0B 0 0.63 ⫾ 0.06 0.82 ⫾ 0.00 A 0.94 ⫾ 0.12
O127:H6 ATCC 35401 (EPEC) ATCC DUP-3017 0.96 ⫾ 0.09 1.03 ⫾ 0.06 A 1.00 ⫾ 0.10 0.67 ⫾ 0.06 0.75 ⫾ 0.09 B 0.87 ⫾ 0.06
O142:H6 ATCC 43886 (EPEC) ATCC NT 0.09 ⫾ 0.02 0.29 ⫾ 0.13 B 0.40 ⫾ 0.06 0.63 ⫾ 0.00 0.71 ⫾ 0.00 A 0.87 ⫾ 0.00
K-12 (nonpathogenic) Our collection NT 1.05 ⫾ 0.07 1.13 ⫾ 0.05 A 1.11 ⫾ 0.09 0.63 ⫾ 0.10 0.80 ⫾ 0.08 B 0.86 ⫾ 0.09

L. monocytogenes
V7 (1/2a) FDA (dairy) DUP-1039 0.09 ⫾ 0.02 0.69 ⫾ 0.05 A 0.91 ⫾ 0.01 0.13 ⫾ 0.01 0.47 ⫾ 0.01 B 0.42 ⫾ 0.01
Scott A (4b) FDA (human) DUP-1042 0.07 ⫾ 0.00 0.73 ⫾ 0.01 A 1.03 ⫾ 0.00 0.40 ⫾ 0.02 0.46 ⫾ 0.01 B 0.44 ⫾ 0.01
F4244 (4b) CDC (human) DUP-1044 0.03 ⫾ 0.00 0.59 ⫾ 0.01 A 0.94 ⫾ 0.05 0.36 ⫾ 0.08 0.36 ⫾ 0.05 B 0.31 ⫾ 0.05
F4260 (1/2b) CDC (human) DUP-1042 0.13 ⫾ 0.00 0.94 ⫾ 0.01 A 1.09 ⫾ 0.02 0.43 ⫾ 0.00 0.42 ⫾ 0.01 B 0.41 ⫾ 0.00

Listeria innocua F4248 CDC DUP-1006 0.19 ⫾ 0.02 0.97 ⫾ 0.02 A 1.19 ⫾ 0.02 0.43 ⫾ 0.00 0.43 ⫾ 0.00 B 0.42 ⫾ 0.00

Nontarget bacteria
Bacillus cereus MS1-9 J. Handelsman DUP-12561 0 0 0 0.40 ⫾ 0.01 0.43 ⫾ 0.00 A 0.48 ⫾ 0.00
Bacillus megaterium ATCC 6633 ATCC DUP-12551 0 0 0 0.39 ⫾ 0..00 0.47 ⫾ 0.00 A 0.57 ⫾ 0.01
Bacillus subtilis ATCC 9885 ATCC DUP-16973 0 0 0 0.21 ⫾ 0.02 0.18 ⫾ 0.00 A 0.18 ⫾ 0.00
Enterobacter aerogenes Our collection DUP-14591 1.11 ⫾ 0.04 1.17 ⫾ 0.03 A 1.23 ⫾ 0.01 0.82 ⫾ 0.03 0.93 ⫾ 0.01 B 1.14 ⫾ 0.10
Enterococcus faecalis ATCC 344 ATCC NT 0 0.03 ⫾ 0.01 B 0.03 ⫾ 0.01 0.45 ⫾ 0.01 0.54 ⫾ 0.01 A 0.48 ⫾ 0.00
Hafnia alvei Our collection DUP-18066 0.57 ⫾ 0.11 0.09 ⫾ 0.06 B 0.80 ⫾ 0.07 0.62 ⫾ 0.06 0.74 ⫾ 0.06 A 0.86 ⫾ 0.08
Streptococcus mutans ATCC ATCC NT 0.32 ⫾ 0.01 0.89 ⫾ 0.10 A 0.84 ⫾ 0.07 0.51 ⫾ 0.01 0.66 ⫾ 0.01 B 0.80 ⫾ 0.01
25175
Pseudomonas aeruginosa ATCC ATCC DUP-11042 0.15 ⫾ 0.04 0.29 ⫾ 0.02 A 0.37 ⫾ 0.06 0.09 ⫾ 0.05 0.28 ⫾ 0.01 A 0.56 ⫾ 0.01
10145
Proteus vulgaris Our collection DUP-10074 0 0B 0 0.34 ⫾ 0.00 0.54 ⫾ 0.04 A 0.65 ⫾ 0.03
Brochothrix thermosphacta Our collection NT 0 0 0 0 0 0
Serratia marcescens Our collection NT 0.03 ⫾ 0.02 0.21 ⫾ 0.06 B 0.83 ⫾ 0.06 0.51 ⫾ 0.01 0.70 ⫾ 0.07 A 0.71 ⫾ 0.05
Lactobacillus acidophilus ATCC ATCC NT NT NT 0 NT NT 0
4356
Lactobacillus casei KCTC 3109 KCTC NT NT NT 0 NT NT 0.068 ⫾ 0.00
Lactobacillus rhamnosus GG ATCC NT NT NT 0 NT NT 0.07 ⫾ 0.00
ATCC 53103
Lactobacillus plantarum NCDO NT NT NT 0 NT NT 0.07 ⫾ 0.00
NCDO955
Lactococcus lactis subsp. lactis ATCC NT NT NT 0 NT NT 0.14 ⫾ 0.00
ATCC 11454
Pediococcus sp. Our collection NT NT NT 0 NT NT 0.00 ⫾ 0.00
Leuconostoc mesenteroides Our collection NT NT NT 0 NT NT 0.03 ⫾ 0.00

Natural food isolates

Bacillus megaterium HK1 This study DUP-6058 0 0B 0 0.40 ⫾ 0.00 0.50 ⫾ 0.04 A 0.59 ⫾ 0.06
Staphylococcus epidermidis HK7 This study DUP-4123 0.21 ⫾ 0.04 0.74 ⫾ 0.04 A 0.65 ⫾ 0.00 0.48 ⫾ 0.09 0.69 ⫾ 0.00 A 0.82 ⫾ 0.02
Enterobacter cloacae HK8 This study DUP-15301 1.06 ⫾ 0.04 1.15 ⫾ 0.05 A 1.13 ⫾ 0.07 0.75 ⫾ 0.01 0.85 ⫾ 0.00 B 0.98 ⫾ 0.00
Lactococcus lactis subsp. lactis This study DUP-12773 0 0B 0 0.36 ⫾ 0.00 0.33 ⫾ 0.00 A 0.32 ⫾ 0.00
HK21
Pediococcus acidilactici HK32 This study DUP-5600 0 0B 0 0.11 ⫾ 0.01 0.10 ⫾ 0.00 A 0.21 ⫾ 0.00
a
FDA, Food and Drug Administration; CDC, Centers for Disease Control and Prevention; ATCC, American Type Culture Collection; KCTC, Korean Culture Type
Collection; NCDO, National Collection of Dairy Organisms; J. Handelsman, University of Wisconsin, Madison; M. Donnenberg, University of Maryland, Baltimore.
b
NT, not tested.
c
OD595 readings for growth in SEL and UPB at the 16-h time point that are in the same row and labeled with the same letter (A or B) are not significantly different
at P of ⬍0.05.

automated RiboPrinter (Qualicon, Wilmington, DE). Five selected isolates were Coulter). This experiment was performed three times with six replicates per
used in this study (Table 1). trial. At the same time, bacterial growth in UPB and the respective specific
Growth profiles of food-borne microorganisms in SEL. To investigate the selective enrichment broths, RV broth, mEC⫹n, and FB, under similar con-
spectra of bacterial growth in SEL, several found food-borne pathogens and ditions was examined.
spoilage and resident bacterial isolates (Table 1) were inoculated (ca. 103 Recovery of cold- or acid-stressed bacteria in SEL. The abilities of SEL to
CFU/ml) into 10 ml of SEL and incubated at 30 or 37°C with agitation (100 resuscitate stress-exposed bacterial cells and enrich samples were investigated.
rpm). Aliquots of 1.0 ml of each culture were withdrawn at 12, 16, and 24 h The two most common stress conditions, exposure to acid (pH 4.5 and 5.5) and
into polystyrene disposable cuvettes, and the growth was monitored by mea- cold (4°C) (24), were examined. Each freshly grown culture of Salmonella serovar
suring the absorbance at 595 nm in a DU-640 spectrophotometer (Beckman- Enteritidis, E. coli O157:H7, and L. monocytogenes was inoculated into 30 ml of
4856 KIM AND BHUNIA APPL. ENVIRON. MICROBIOL.

TABLE 2. Composition of SEL (Salmonella, Escherichia, Listeria) broth son, WI]). The meat samples were inoculated with approximately 3 ⫻ 102 CFU
of each culture/g and held at room temperature for 15 min to allow bacterial
Amt adsorption. Then, a 225-ml volume of SEL or UPB was added to each bag, and
Ingredient Comment
(g per liter) the samples were blended for 2 min by using a Stomacher 400 (Seward, Norfolk,
Pancreatic digest of 17 Same as in BLEB United Kingdom). The homogenized meat samples were incubated at 37°C for
casein 24 h. Uninoculated meat samples (25 g of meat in 225 ml of SEL) served as
Yeast extract 6 Same as in BLEB negative controls. After 8, 10, 12, 16, and 24 h of incubation, 5-ml aliquots were
Dextrose 2.5 Same as in BLEB collected from each bag, serially diluted in 0.1% sterile peptone water, and
Soytone 3 Same as in BLEB analyzed for microbial counts by being plated onto the corresponding selective
Sodium chloride 5 Same as in BLEB agar plates. Samples were also tested by PCR and lateral-flow immunoassay as
Monopotassium 1.35 Same as in BLEB described above. In a separate experiment, the influence of different meat sam-
ples (two different brands of salami and two brands of turkey) on pathogen

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

phosphate
Dipotassium phosphate 2.5 Same as in BLEB enrichment in SEL was evaluated as described above.
Disodium phosphate 9.6 Same as in BLEB Gompertz equation and statistical analyses. To determine the exponential
Sodium pyruvate 1.1 Same as in BLEB growth rate (EGR), generation time (GT), lag-phase duration (LPD), and max-
Acriflavine 0.01 Modification of BLEB recipe imum population density (MPD), the growth of each bacterium in SEL was
Cycloheximide 0.05 Modification of BLEB recipe modeled with the Gompertz equation (47) by using a nonlinear mixed model
Fosfomycin 0.05 Newly added (not in BLEB) with PROC NLMIXED in software version 9.1 for Windows (SAS Institute Inc.,
Nalidixic acid 0.002 Modification of BLEB recipe Cary, NC). To test for differences among the broths in the comparison experi-
ments, the statistical significance was assessed by a t test; a P value of ⬍0.05 was
considered significant.

TSBYE (1%, vol/vol) and then incubated at 37°C in a shaker incubator (150 rpm) RESULTS
to mid-log phase (see Fig. 1): 2 h for E. coli O157:H7, 4 h for L. monocytogenes,
and 2.5 h for Salmonella serovar Enteritidis. Aliquots (5 ml each) were centri- Growth kinetics of individual target pathogens in SEL. (i)
fuged (5,000 ⫻ g for 10 min) and washed once with 30 ml of phosphate-buffered Salmonella serovar Enteritidis. The growth of Salmonella se-
saline, and the cell pellets were resuspended and held for 3 h in 5 ml of TSBYE
rovar Enteritidis in SEL was compared with that in RV broth.
with the appropriate stressors: (i) TSBYE adjusted to pH 4.5 and (ii) TSBYE
adjusted to pH 5.5 by using 1 M lactic acid and (iii) TSBYE at 4°C (precooled Both media were inoculated with 101 and 103 CFU/ml. Data
TSBYE was used). The cells exposed to acid stress were incubated at 37°C, and extrapolated from the fitted Gompertz curves indicated that
cold-stressed cells were incubated at 4°C. Each stress-exposed culture (1%, the average EGRs, GTs, LPDs, and MPDs for the two broths
vol/vol) was transferred into SEL, TSBYE, or the corresponding individual at the two inoculation levels were comparable (Fig. 1A; see
selective enrichment broth and incubated for 3 h (short recovery) and 6 h (long
recovery) at 37°C in a shaking incubator. Bacterial cell counts immediately after
Table S1 in the supplemental material), suggesting that the
the exposure to stress and after 3 and 6 h of recovery in different media were performance of SEL was equivalent to that of RV broth.
determined by surface plating of cells onto BHI agar plates (1, 29). (ii) E. coli O157:H7. The E. coli O157:H7 growth rate in SEL
Comparative enrichment of artificially inoculated meat samples with patho- was also examined and compared with that in mEC⫹n after
gens in SEL and UPB broth and subsequent detection by ICLFA and PCR.
both media were inoculated with 101 and 103 CFU/ml. The first
Several 218-g portions of ready-to-eat deli meats (roasted turkey breast and
Genoa salami) were purchased from local grocery stores in West Lafayette, IN. distinguishable result was that no growth of E. coli O157:H7
The turkey breast samples had 5% fat and 15 g of protein per 56-g serving, and inoculated at 101 CFU/ml into mEC⫹n was observed, whereas
the salami samples had 28% fat and 21 g of protein per 56-g serving. The absence SEL supported growth at that inoculation level (Fig. 1B). Data
of Salmonella serovar Enteritidis, E. coli O157:H7, and L. monocytogenes in each extrapolated from the fitted Gompertz curves indicated that
meat sample was confirmed by using standard procedures as outlined in the
Bacteriological Analytical Manual (18) before the initiation of the challenge study.
the average EGR in SEL inoculated with 103 CFU/ml (0.89
Twenty-five grams of each meat sample was placed into a stomacher bag con- log10 CFU/ml/h) was significantly (P ⬍ 0.05) higher than that
taining an inner filter lining (Whirl-Pak [catalog no. B01318; Nasco Fort Atkin- in mEC⫹n inoculated with the same concentration (0.73 log10

TABLE 3. Oligonucleotide primers used in the multiplex PCR

Target Product
Pathogen Target virulence factor Primerb Sequence (5⬘ to 3⬘) Reference
gene size (bp)

Salmonella serovar Salmonella serovar Enteritidis sefA F GCAGCGGTTACTATTGCAGC 310 53

Enteritidis fimbrial antigen R TGTGACAGGGACATTTAGCG
Salmonella plasmid virulence spva F GCCGTACACGAGCTTATAGA 250 48
factor R ACCTACAGGGGCACAATAAC

E. coli O157:H7 Attachment and effacement eaeA F TCAATGCAGTTCCGTTATCAGTT 482 52

R GTAAAGTCCGTTACCCCAACCTG
Shiga-like toxin 1 stx1 F CAGTTAATGTGGTGGCGAAGG 348 13
R CACCAGACAATGTAACCGCTG
Shiga-like toxin 2 stx2 F ATCCTATTCCCGGGAGTTTACG 584 13
R GCGTCATCGTATACACAGGAGC

L. monocytogenes Actin polymerization protein actA F GACGAAAATCCCGAAGTGAA 385 27

R CTAGCGAAGGTGCTGTTTCC
Internalin B inlB F AAAGCACGATTTCATGGGAG 146 17
R ACATAGCCTTGTTTGGTCGG
a
spv-specific primer sets are designated S1 and S4 in reference 50.
b
F, forward; R, reverse.
VOL. 74, 2008 MULTIPATHOGEN SELECTIVE ENRICHMENT BROTH 4857

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

FIG. 1. Growth curves for the individual pathogens Salmonella serovar Enteritidis (A), E. coli O157:H7 (B), and L. monocytogenes (C) in SEL
inoculated at two different concentrations (10 and 1,000 CFU/ml). The growth of each pathogen in SEL was compared with that in the respective
individual selective enrichment broth: RV broth for Salmonella, mEC⫹n for E. coli, and FB for Listeria. The broths were inoculated at the
indicated concentrations, and the cultures were incubated at 37°C in a shaker incubator. The top panels show the actual growth curves, and the
plots in the bottom panels are corresponding Gompertz fitted curves.

CFU/ml/h) and that the GT and LPD in SEL were shorter than (ii) Experiment II: Salmonella serovar Enteritidis/E. coli
those in mEC⫹n. However, the MPD in mEC⫹n was greater O157:H7/L. monocytogenes culture ratio, 10:1,000:1. The over-
than that in SEL (see Table S1 in the supplemental material). all growth profiles of the three cultures were highly propor-
Overall, these data indicate that E. coli O157:H7 had a higher tional to their initial inoculation levels (Salmonella serovar
growth rate but reached a lower maximum cell population in Enteritidis at 13.5 ⫾ 1.1 CFU/ml, E. coli at 1,327 ⫾ 166
SEL than in mEC⫹n. CFU/ml, and L. monocytogenes at 1.3 ⫾ 0.6 CFU/ml). The
(iii) L. monocytogenes. At both inoculation levels (101 and growth rate and the MPD of Salmonella serovar Enteritidis
3
10 CFU/ml), L. monocytogenes growth in SEL was signifi- cells were the highest of those of the pathogens in SEL (Fig.
cantly better than that in FB (Fig. 1C). Though the EGRs and 2B). In this mixture, L. monocytogenes, inoculated at the
MPDs in the two media were comparable, the GT and LPD in lowest concentration (1 CFU/ml), grew in the presence of
SEL were significantly shorter than those in FB (see Table S1 two other bacterial species inoculated at higher initial cell
in the supplemental material). concentrations. The GT of L. monocytogenes was the longest
Growth of the three target pathogens in a mixture in SEL. of those of the three pathogens, and the EGR of L. mono-
(i) Experiment I: Salmonella serovar Enteritidis/E. coli O157: cytogenes was the lowest. Furthermore, the MPD of L.
H7/L. monocytogenes culture ratio, 1:1:1. In a mixture (con- monocytogenes cells was 4.28 log10 CFU/ml, while E. coli
taining ca. 3 ⫻ 102 CFU of each pathogen/ml), the three O157:H7 and Salmonella serovar Enteritidis reached 8.58
pathogens grew well and showed similar growth patterns and 7.11 log10 CFU/ml, respectively (Table 4). This result
(Fig. 2A). The values extrapolated from Gompertz fitted indicates that the fast-growing Salmonella and E. coli pos-
curves indicated that the EGR of L. monocytogenes (0.72 sibly utilized the most nutrients and that, thus, the depleted
CFU/ml/h) was the lowest, followed by those of Salmonella nutrient levels probably resulted in a lower growth rate for
serovar Enteritidis (0.82 CFU/ml/h) and E. coli O157:H7 Listeria, normally a slow-growing bacterium.
(1.10 CFU/ml/h). Of the three pathogens, E. coli O157:H7 (iii) Experiment III: Salmonella serovar Enteritidis/E. coli
exhibited the shortest GT and LPD, 0.68 and 3.21 h, com- O157:H7/L. monocytogenes culture ratio, 1:10:1,000. When the
pared to 0.84 and 3.64 h for Salmonella serovar Enteritidis inoculation level of L. monocytogenes cells (1,180 ⫾ 125 CFU/
and 0.96 and 3.48 h for L. monocytogenes, respectively (Ta- ml) was greater than those of Salmonella serovar Enteritidis
ble 4). Furthermore, E. coli cells had a higher MPD than (1.4 ⫾ 0.1 CFU/ml) and E. coli (14.6 ⫾ 1.6 CFU/ml) cells, L.
Salmonella serovar Enteritidis and L. monocytogenes cells monocytogenes showed better growth than the other two patho-
(Table 4). In summary, these data indicate that SEL is gens (Fig. 2C). Interestingly, Salmonella serovar Enteritidis
capable of supporting the concurrent growth of Salmonella cells exhibited a shorter LPD and a higher MPD than E. coli
serovar Enteritidis, E. coli O157:H7, and L. monocytogenes O157:H7 cells, although the initial number of Salmonella se-
but with a lower growth rate for L. monocytogenes than for rovar Enteritidis cells was lower than that of E. coli O157:H7
the other species when cells of the three species are present cells (Table 4). Additionally, the MPDs of Salmonella serovar
at equal initial concentrations. Enteritidis and E. coli O157:H7 cells approached barely 5 to 6
4858 KIM AND BHUNIA APPL. ENVIRON. MICROBIOL.

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

FIG. 2. (A to D) Growth curves for the three pathogens Salmonella serovar Enteritidis, E. coli O157:H7, and L. monocytogenes (L. mono) mixed
at various ratios in SEL: Salmonella CFU/E. coli CFU/L. monocytogenes culture ratios, 1:1:1 (A), 10:1,000:1 (B), and 1:10:1,000 (C), and Salmonella
CFU/L. monocytogenes culture ratio, 1,000:10 (D). (E) Growth curve for E. coli O157:H7 alone after inoculation at ⬃1 CFU/ml.

log10 CFU/ml, while that of L. monocytogenes cells reached E. coli) on the CT-SMAC plate, which hindered the E. coli
about 8.5 log10 CFU/ml. colonies. E. coli growth in this mixture was further confirmed
(iv) Experiment IV: Salmonella serovar Enteritidis/E. coli by obtaining positive reactions in the ICLFA (data not shown)
O157:H7/L. monocytogenes culture ratio, 1,000:1:10. In exper- and PCR assay (see Fig. 4C). In a separate experiment, we
iment IV, the inoculation level for Salmonella serovar Enteri- demonstrated that E. coli inoculated at 1 CFU/ml was indeed
tidis was 1,178 ⫾ 124 CFU/ml, that for E. coli was 1.3 ⫾ 0.1 capable of growing in SEL (Fig. 2E). Though CT-SMAC is a
CFU/ml, and that for L. monocytogenes was 11.5 ⫾ 1.9 CFU/ selective medium for E. coli O157:H7, Salmonella was able to
ml. We were able to determine the growth curves for Salmo- grow on CT-SMAC, producing opaque pink colonies, while E.
nella and Listeria but not for E. coli (Fig. 2D). As expected, coli O157:H7 produced colorless gray-white colonies because
Salmonella cells had a significantly higher growth rate than of its inability to ferment sorbitol. This result indicates that
Listeria cells, with a shorter GT (0.88 versus 1.46 h) and a improvement in differential plating media is necessary for sep-
higher MPD (9.33 versus 6.0 log10 CFU/ml) (Table 4). E. coli arations of E. coli O157:H7 and Salmonella serovar Enteritidis
O157:H7 cells could not be enumerated after inoculation at 1 from the same sample during the plating procedure.
CFU/ml because of the overgrowth of Salmonella (for which Growth patterns of food-borne bacteria in SEL. The growth
the initial inoculation level was 1,000 times higher than that for patterns of different microorganisms that are commonly as-

TABLE 4. Growth kinetics valuesa for Salmonella serovar Enteritidis, E. coli O157:H7, and L. monocytogenes in mixed cultures set up in SEL
Expt Organism (CFU/ml)b EGR (log10 CFU/ml/h) GT (h) LPD (h) MPD (log10 CFU/ml)

I Salmonella serovar Enteritidis (1) 0.82 ⫾ 0.10 0.84 ⫾ 0.10 3.64 ⫾ 0.58 7.66 ⫾ 0.08
E. coli O157:H7 (1) 1.10 ⫾ 0.11 0.68 ⫾ 0.07 3.21 ⫾ 0.42 8.01 ⫾ 0.10
L. monocytogenes (1) 0.72 ⫾ 0.06 0.96 ⫾ 0.08 3.48 ⫾ 0.33 6.89 ⫾ 0.05
II Salmonella serovar Enteritidis (10) 1.04 ⫾ 0.06 0.67 ⫾ 0.04 2.70 ⫾ 0.24 7.11 ⫾ 0.09
E. coli O157:H7 (1,000) 0.96 ⫾ 0.09 0.72 ⫾ 0.07 3.02 ⫾ 0.41 8.58 ⫾ 0.14
L. monocytogenes (1) 0.71 ⫾ 0.07 0.98 ⫾ 0.10 3.70 ⫾ 0.38 4.28 ⫾ 0.09
III Salmonella serovar Enteritidis (1) 0.65 ⫾ 0.05 1.07 ⫾ 0.08 2.67 ⫾ 0.53 6.25 ⫾ 0.19
E. coli O157:H7 (10) 1.00 ⫾ 0.09 0.69 ⫾ 0.06 3.56 ⫾ 0.24 5.71 ⫾ 0.09
L. monocytogenes (1,000) 0.52 ⫾ 0.04 1.33 ⫾ 0.10 3.01 ⫾ 0.61 8.44 ⫾ 0.09
IV Salmonella serovar Enteritidis (1,000) 0.79 ⫾ 0.07 0.88 ⫾ 0.08 2.17 ⫾ 0.54 9.33 ⫾ 0.18
E. coli O157:H7 (1) NDc NAd NA NA
L. monocytogenes (10) 0.47 ⫾ 0.02 1.46 ⫾ 0.08 1.75 ⫾ 0.49 6.00 ⫾ 0.06
a
The growth kinetics values for the three pathogens in mixtures were extrapolated from data from Fig. 2 by using the Gompertz equation (47). Values are expressed
as means ⫾ SDs.
b
The numbers in parentheses indicate the initial inoculation levels for the given experiment.
c
ND, not determined. Counts of E. coli CFU in the mixture could not be determined because of the overgrowth of Salmonella on E. coli-selective CT-SMAC plates
(see the text for a detailed explanation).
d
NA, not applicable.
VOL. 74, 2008 MULTIPATHOGEN SELECTIVE ENRICHMENT BROTH 4859

TABLE 5. Comparisons of recovery rates for stress-exposed Salmonella serovar Enteritidis, E. coli O157:H7, and L. monocytogenes cells in
TSBYE, SEL, and the respective individual selective enrichment brothsa
Log10 CFU/ml (mean ⫾ SD) at 3 h in: Log10 CFU/ml (mean ⫾ SD) at 6 h in:
Log10 CFU/ml
Stress or
Organism (mean ⫾ SD) Selective Selective
condition TSBYE enrichment SEL TSBYE enrichment SEL
at 0 h
brothb brothb

Temp (°C) Salmonella serovar

37 Enteritidis 7.27 ⫾ 0.24 8.81 ⫾ 0.20* 8.35 ⫾ 0.15 8.29 ⫾ 0.28 9.23 ⫾ 0.10* 8.41 ⫾ 0.29 9.27 ⫾ 0.14
4 6.25 ⫾ 0.14 8.31 ⫾ 0.34* 7.35 ⫾ 0.48* 7.66 ⫾ 0.22* 9.10 ⫾ 0.05* 8.40 ⫾ 0.05* 9.21 ⫾ 0.14*

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

pH
4.5 5.20 ⫾ 0.54 7.22 ⫾ 0.02* 5.39 ⫾ 0.68 5.07 ⫾ 0.00 7.33 ⫾ 0.07* 5.83 ⫾ 1.05 4.89 ⫾ 1.06
5.5 6.69 ⫾ 0.02 8.71 ⫾ 0.26* 8.25 ⫾ 0.36* 8.28 ⫾ 0.28* 9.05 ⫾ 0.06* 8.53 ⫾ 0.09* 9.35 ⫾ 0.17*

Temp (°C) E. coli O157:H7

37 7.16. ⫾ 0.11 8.63 ⫾ 0.11* 7.53 ⫾ 0.10 7.84 ⫾ 0.07 9.02 ⫾ 0.11* 8.08 ⫾ 0.18 8.73 ⫾ 0.17
4 5.57 ⫾ 0.09 8.02 ⫾ 0.14* 5.02 ⫾ 0.73 5.77 ⫾ 0.91 8.86 ⫾ 0.07* 4.90 ⫾ 0.49 7.80 ⫾ 0.23*

pH
4.5 5.08 ⫾ 0.36 6.43 ⫾ 0.11* 3.21 ⫾ 0.28 3.54 ⫾ 0.28 8.56 ⫾ 0.49* 3.66 ⫾ 0.68 5.24 ⫾ 0.37
5.5 6.69 ⫾ 0.15 8.43 ⫾ 0.11* 6.89 ⫾ 0.13 7.43 ⫾ 0.21 9.02 ⫾ 0.13* 6.99 ⫾ 0.60 8.66 ⫾ 0.20*

Temp (°C) L. monocytogenes

37 7.56 ⫾ 0.04 8.72 ⫾ 0.03* 8.20 ⫾ 0.10 8.38 ⫾ 0.12 9.60 ⫾ 0.10* 8.78 ⫾ 0.10 9.17 ⫾ 0.16
4 6.57 ⫾ 0.08 8.04 ⫾ 0.08* 7.28 ⫾ 0.10 7.67 ⫾ 0.08* 9.06 ⫾ 0.10* 8.36 ⫾ 0.07* 8.88 ⫾ 0.09*

pH
4.5 6.42 ⫾ 0.17 7.60 ⫾ 0.18* 6.74 ⫾ 0.08 7.33 ⫾ 0.11* 9.22 ⫾ 0.49* 7.75 ⫾ 0.09* 8.06 ⫾ 0.64*
5.5 6.71 ⫾ 0.04 8.23 ⫾ 0.10* 7.46 ⫾ 0.10 7.91 ⫾ 0.16* 9.56 ⫾ 0.03* 8.41 ⫾ 0.06* 8.99 ⫾ 0.09*
a
Each culture was inoculated at 3 ⫻ 102 CFU/ml. Values marked with ⴱ indicate the recovery of stressed cells as defined by an increase in cell numbers of ⱖ1 log
in the given medium compared to the initial numbers after stress.
b
The selective enrichment broths were RV broth for Salmonella serovar Enteritidis, mEC⫹n for E. coli, and FB for L. monocytogenes.

sociated with food, along with those of additional species epidermidis, Pseudomonas aeruginosa, Serratia marcescens,
and other strains or serovars of the three target pathogens, Enterobacter aerogenes, Enterobacter cloacae, and Hafnia
in SEL were investigated and compared with those in UPB alvei, showed good growth in SEL and that these organisms
(Table 1) and mEC⫹n, RV broth, and FB (see Table S2 in also grew well in UPB and certain selective media (Table 1;
the supplemental material) by measuring optical densities at see also Table S2 in the supplemental material). Overall,
595 nm (OD595) at 12, 16, and 24 h. Seven enterohemor- these data indicate that the levels of growth of most desir-
rhagic E. coli (EHEC) strains, two enteropathogenic E. coli able target pathogens in SEL were higher than those in UPB
(EPEC) strains, and one enterotoxigenic E. coli (ETEC) and that SEL was more inhibitory to several food-borne
strain showed significantly higher levels of growth (P ⬍ 0.05; organisms than UPB (Table 1).
16 h of growth) in SEL than in UPB; another strain of ETEC Furthermore, bacterial growth in SEL was superior to that in
(O78:H11) failed to grow in SEL but showed good growth in individual selective enrichment broths for the respective target
UPB. Four strains of L. monocytogenes belonging to sero- pathogens, such as RV broth for Salmonella, mEC⫹n for E.
vars 1/2a, 1/2b, and 4b and a strain of Listeria innocua coli, and FB for Listeria, when analyzed after 24 h of enrich-
exhibited better growth in SEL than in UPB. Likewise, four ment (see Table S2 in the supplemental material).
serovars of S. enterica showed improved growth in SEL Recovery of acid- and cold-stressed cells in SEL. The ability
compared to that in UPB. Among the nontarget bacteria, of SEL to resuscitate acid- and cold-injured cells was eval-
three Bacillus species, three Lactobacillus species, and one uated and compared with the recovery ability of TSBYE, a
strain each of Enterococcus faecalis, Proteus vulgaris, Lacto- commonly used nonselective enrichment broth, as well as
coccus lactis, and Leuconostoc mesenteroides did not show those of the respective individual selective enrichment
any growth in SEL but did grow in UPB. Among the five broths. As expected, the stress conditions caused the inhi-
natural food isolates (obtained in this study), Bacillus mega- bition of cell growth (Table 5), resulting in 0.5- to ⬃2.1-log
terium HK1, Lactococcus lactis HK21, and Pediococcus aci- reductions in cell counts for target pathogens compared
dilactici HK32 did not grow in SEL but showed some growth with those in the control (incubated at 37°C). The pH 4.5
in UPB (Table 1). Among the test organisms, only three stress caused the highest numbers of cell deaths among all
(Brochothrix thermosphacta, Lactobacillus acidophilus, and three pathogens, reducing populations by more than 2 logs
Pediococcus sp.) did not show any detectable growth in (2.07 and 2.08 logs) for Salmonella serovar Enteritidis and
either medium. We also observed that several nontarget E. coli O157:H7, respectively, and 1.15 logs for L. monocy-
bacteria, including Streptococcus mutans, Staphylococcus togenes. Cold stress resulted in moderate cell injury: a re-
4860 KIM AND BHUNIA APPL. ENVIRON. MICROBIOL.

duction in the bacterial population of about 1.6 logs for E. detection of Salmonella serovar Typhimurium; however, we
coli O157:H7, 1 log for Salmonella serovar Enteritidis, and used Salmonella serovar Enteritidis as the test organism, thus
0.99 log for L. monocytogenes. Finally, cultures under the pH obtaining a weaker reaction. Altogether, ICLFA data demon-
5.5 stress condition showed the least cell injury (population strated that SEL is suitable for enrichment with the three
reductions of less than 1 log for all three pathogens) among pathogens individually or in a mixture for subsequent detection
those exposed to the three stress conditions (Table 5). by the antibody-based ICLFA method.
Stress-exposed cells were allowed to recover in TSBYE, (ii) Multiplex PCR. Salmonella serovar Enteritidis, E. coli
SEL, and their respective selective enrichment broths for 3 O157:H7, and L. monocytogenes grown individually or in mix-
and 6 h. Data for each pathogen are presented below. An tures (experiments I to IV) were also tested in a multiplex PCR
increase in bacterial cell counts of ⱖ1 log was considered to assay. As expected, E. coli grown individually or in a mixture in

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

indicate significant recovery in the corresponding medium SEL alone or in the presence of meat (ready-to-eat turkey)
(Table 5). showed three amplified products, those for stx2 (584 bp), eaeA
(i) Salmonella serovar Enteritidis. All three media (TSBYE, (482 bp), and stx1 (348 bp) (Fig. 4). Similarly, Salmonella se-
SEL, and RV broth) resuscitated cold (4°C)- and pH 5.5- rovar Enteritidis gave amplified products for sefA (310 bp)
stressed Salmonella serovar Enteritidis; however, RV broth and/or spv (250 bp) and L. monocytogenes gave products for
and SEL failed to resuscitate pH 4.5-stressed cells after 3 and actA (385 bp) and inlB (146 bp) without any nonspecific am-
6 h of recovery (Table 5). Overall, TSBYE yielded the best plification when grown individually or in a mixture (Fig. 4).
recovery at 3 h, while SEL supported the best recovery at 6 h. PCR analysis of uninoculated control meat did not yield any
RV broth showed the lowest recovery rates for all stress con- DNA amplification with species-specific primers, thus confirm-
ditions at both time points. ing the absence of background target pathogens in the product
(ii) E. coli O157:H7. SEL and TSBYE allowed injured E. coli (Fig. 4B). When Salmonella, E. coli O157:H7, and L. monocy-
O157:H7 cells to recover; however, mEC⫹n failed to allow togenes cells were inoculated in equal (Fig. 4B) or variable (Fig.
recovery (Table 5). Stress-exposed E. coli O157:H7 grown in 4C) proportions into turkey meat, all gave positive amplified
TSBYE showed recovery at both time points (3 and 6 h); PCR products, except in experiment II, in which L. monocyto-
however, SEL helped to resuscitate cold (4°C)- and pH 5.5- genes was undetectable. In experiment II, L. monocytogenes
stressed cells only after 6 h. SEL was unable to show any cells were inoculated at about 1.5 CFU/g together with Salmo-
resuscitation of pH 4.5-stressed cells. nella (⬃13 CFU/g) and E. coli (⬃1,300 CFU/g) cells (Fig. 4C).
(iii) L. monocytogenes. SEL and TSBYE resuscitated injured The lack of amplification is attributed to the poor growth of L.
L. monocytogenes after 3 and 6 h of recovery, while FB did so monocytogenes in the mixture compared to that of the other
only after 6 h (Table 5). The recovery rates in order from two organisms (Fig. 2B). Nevertheless, these data demonstrate
highest to lowest were those for TSBYE, SEL, and FB. that all three pathogens could be readily detected when grown
In summary, the stress recovery studies indicate that SEL in SEL individually or in a mixture in a meat sample by using
supported the recovery of stress-exposed cells and that its species-specific PCR primer sets, suggesting that SEL is a
performance was equivalent to that of TSBYE when a 6-h suitable enrichment broth for PCR-based detection. However,
recovery period was allowed, with the exception of pH 4.5- some situations in which L. monocytogenes cells are present in
induced stress for E. coli O157:H7 and Salmonella serovar low numbers (⬃1 CFU/g) along with a large number of other
Enteritidis. As a selective enrichment broth, SEL demon- microbes, as described above, may yield negative PCR results.
strated performance superior to that of the respective indi- Selective enrichment of artificially inoculated meat samples
vidual selective enrichment broths, RV broth, mEC⫹n, with pathogens in SEL broth and subsequent detection using
and FB. viable-cell counting lateral-flow and PCR assays. In artificially
Detection of pathogens by antibody-based ICLFA and mul- inoculated ready-to-eat turkey and salami samples, the detec-
tiplex PCR. (i) ICLFA. Salmonella serovar Enteritidis, E. coli tion of three target pathogens grown in SEL after 12 and 24 h
O157:H7, and L. monocytogenes grown in SEL gave positive of enrichment was demonstrated. The growth patterns of Sal-
reactions in the ICFLA, and the reaction intensities for Sal- monella serovar Enteritidis and E. coli O157:H7 were similar,
monella serovar Enteritidis and L. monocytogenes grown in and cell numbers in all meat samples reached 8 to 9 log10
SEL were significantly higher (P ⬍ 0.05) than those for the CFU/ml at 12 and 24 h (see Table S3 in the supplemental
same pathogens grown in their respective individual selective material). The level of growth of L. monocytogenes (which
enrichment broths, RV broth and FB (Fig. 3A and C). The reached 5 to 7 log10 CFU/ml) was lower than those of the other
antibody reaction intensity for E. coli grown in SEL was slightly two target pathogens. Numbers of Salmonella serovar Enteri-
higher than but comparable to that for mEC⫹n-grown cells tidis and L. monocytogenes cells in turkey samples were higher
(Fig. 3B). When all three pathogens grown in SEL were inoc- than those in salami samples. The growth of E. coli O157:H7
ulated at equal cell concentrations as a mixture, they all gave was not affected by the food type. Although growth behaviors
positive reactions with their respective Reveal kits; however, varied among the target pathogens, SEL supported the growth
the band intensity for L. monocytogenes was the strongest, of these pathogens concurrently in the artificially inoculated
followed by those for E. coli O157:H7 and Salmonella serovar meat samples.
Enteritidis (Fig. 3D). The overall reaction of Salmonella sero- In the lateral-flow immunoassay, E. coli O157:H7 gave
var Enteritidis grown either in SEL or RV broth with the strong positive reactions after both 12 and 24 h of enrichment
Salmonella Reveal kit was relatively weaker than those of the (see Fig. S1 in the supplemental material). After 12 h of en-
other two pathogens with their kits. It was later confirmed that richment in SEL, Salmonella serovar Enteritidis showed a
the ICLFA kit (Neogen Corp.) is intended primarily for the weak positive reaction, but the reaction was slightly improved
VOL. 74, 2008 MULTIPATHOGEN SELECTIVE ENRICHMENT BROTH 4861

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

FIG. 3. Results from ICLFA showing the reaction patterns of cells of the pathogens Salmonella serovar Enteritidis (SE) (A and D), E. coli
O157:H7 (EC) (B and D), and L. monocytogenes (LM) (C and D) grown individually (with each pathogen inoculated at 103 CFU/ml) (A to C) or
in mixed cultures (with each pathogen inoculated at ca. 3 ⫻ 102 CFU/ml) set up in SEL (D). The ICLFA reaction patterns were also compared
with those of cells grown in the respective selective enrichment broths (RV broth, mEC⫹n, and FB). Cultures were incubated at 37°C for 16 to
18 h in a shaker incubator. The lateral-flow strips were loaded with 120-␮l samples of Salmonella serovar Enteritidis and E. coli O157:H7 live
cultures or 135 ␮l of heat-killed L. monocytogenes cells, and the antibody reaction intensities (band densities in pixels) were quantified by using
software (Scion Crop., Frederick, MD) and presented as bar graphs.

after 24 h of enrichment in the salami sample. No reaction was enrichment (8 to 10 h), the numbers of cells of the three
observed for L. monocytogenes in salami after 12 h of enrich- pathogens grown in UPB were higher than those grown in
ment, but the reaction intensities were high after 24 h of SEL. However, 12 h postenrichment, sharply accelerated
incubation. These data indicate that SEL could be used as an growth in SEL was observed. In the lateral-flow immunoassay,
enrichment broth for antibody-based detection by ICLFA; there were no differences between the two broths in the reac-
however, the duration of enrichment time is critical to obtain tion intensities for Salmonella serovar Enteritidis or E. coli
a strong reaction. PCR assays of the same inoculated turkey O157:H7; however, L. monocytogenes was detected after as
and salami samples after 12 and 24 h of enrichment showed little as 8 h of growth in SEL compared to 10 h of growth in
positive PCR-amplified products for the target pathogens (Fig. UPB (see Table S3 in the supplemental material). PCR
5), confirming that SEL could potentially be used as an enrich- showed positive amplifications for the three pathogens at all
ment broth for PCR-based detection. incubation time points and in both media (see Fig. S2 in the
Comparison of SEL performance with UPB performance for supplemental material).
sample enrichment and detection of three pathogens in arti- In salami samples, generally, bacterial counts were lower
ficially inoculated meat samples. Turkey and salami samples than those in turkey samples, due possibly to the presence of
were inoculated with three pathogens at equal cell concentra- preservatives and bacterial inhibitors. The growth of L. mono-
tions and subjected to enrichment in SEL and UPB for up to cytogenes in salami in SEL, in particular, was reduced by almost
24 h. The performance of SEL was compared with that of UPB 2 logs compared to that in turkey in SEL (Table 6). Similarly,
by determining bacterial cell counts in each medium and by the growth of Salmonella serovar Enteritidis in salami in UPB
performing ICLFA and PCR assays. showed a l-log reduction compared to that in turkey in UPB.
In turkey samples, the overall growth of E. coli O157:H7 in Overall, the levels of growth of all three pathogens in salami in
UPB was better than that in SEL, while the growth of Salmo- SEL were comparable to those in salami in UPB. Lateral-flow
nella serovar Enteritidis and that of L. monocytogenes were immunoassay results for each pathogen in SEL and UPB were
better in SEL (Table 6). During the early periods of meat similar; however, L. monocytogenes was detected after as little
4862 KIM AND BHUNIA APPL. ENVIRON. MICROBIOL.

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

FIG. 4. Results from multiplex PCR assays for the detection of Salmonella serovar Enteritidis, E. coli O157:H7, and L. monocytogenes bacteria
grown individually (ca. 3 ⫻ 102 CFU/ml) in SEL broth (A) or in mixtures in meat (B and C). (A) Cultures were incubated at 37°C for 16 to 18 h
in a shaker incubator and analyzed by PCR assays using species-specific primer sets: primers targeting sefA (310 bp) and spv (250 bp) for Salmonella
serovar Enteritidis (S. Ent, or Sal. Ent), actA (395 bp) and inlB (146 bp) for L. monocytogenes (L. mono), and stx2 (584 bp), eaeA (482 bp), and
stx1 (348 bp) for E. coli O157:H7. (B) Ready-to-eat sliced turkey meat samples were inoculated with Salmonella serovar Enteritidis (SE), E. coli
O157:H7 (EC), and L. monocytogenes (LM) cultures at equal concentrations (ca. 3 ⫻ 102 CFU/ml) and analyzed by PCR after 18 h of enrichment
in SEL broth. (C) Meat samples were inoculated with three mixtures of Salmonella serovar Enteritidis, E. coli, and L. monocytogenes CFU prepared
with the bacteria at various ratios as indicated, enriched for 18 h, and assayed by multiplex PCR using Salmonella serovar Enteritidis-, E. coli-, or
L. monocytogenes-specific primers. No temp, no-template DNA control.

as 12 h when subjected to enrichment in SEL, compared to the DISCUSSION

16 h of incubation needed in UPB. PCR analysis showed un-
ambiguous positive amplified bands for the three target patho- Current industry trends emphasize the need for the detec-
gens at all time points, except for L. monocytogenes, which tion of multiple pathogens on a single-assay platform to reduce
produced very faint amplified bands in SEL after 8 h of en- the cost of testing per pathogen. Moreover, a multipathogen
richment (see Fig. S2 in the supplemental material). detection scheme could mitigate the industry and regulatory
VOL. 74, 2008 MULTIPATHOGEN SELECTIVE ENRICHMENT BROTH 4863

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

FIG. 5. Results from PCR assays of Salmonella serovar Enteritidis-, L. monocytogenes-, and E. coli O157:H7-inoculated ready-to-eat turkey and
salami samples. The meat samples (25 g each) were inoculated (ca. 3 ⫻ 102 CFU of each pathogen/g), mixed with 225 ml of SEL, and incubated
for 12 and 24 h with agitation. In panel A, PCR lanes are as follows, from left to right: M, 100-bp ladder DNA marker; L, Listeria primers targeting
genes actA (395 bp) and inlB (146 bp); E, E. coli O157:H7 primers targeting genes stx2 (584 bp), eaeA (482 bp), and stx1 (348 bp); and S, Salmonella
primers targeting genes sefA (310 bp) and spv (250 bp). An ICLFA also showed positive reactions with Salmonella serovar Enteritidis, E. coli
O157:H7, and L. monocytogenes antigens for corresponding samples (see Fig. S1 in the supplemental material).

needs in the mandatory testing of food products for multiple growth of the three target pathogens and competition among
pathogens prior to retail distribution. To aid in multipathogen the pathogens and their initial levels were determinants of
detection, a suitable selective enrichment medium is necessary their growth kinetics. When the pathogens were mixed in equal
to improve detection utilizing methods such as multiplex PCR proportions, E. coli O157:H7 showed the shortest LPD and the
(5, 20, 42, 46), DNA array hybridization (15), array-based highest maximum cell density, while L. monocytogenes showed
immunosorbent assays (14), and antibody-based array biosen- the lowest maximum cell density and Salmonella growth was
sor techniques (35, 50). intermediate (Table 4). Lower cell numbers for L. monocyto-
In this study, a selective enrichment broth, SEL, was devel- genes were expected because this pathogen is a slow-growing
oped and evaluated for its ability to enrich a test sample with and poor competitor (2). When the bacteria were mixed at
multiple pathogens concurrently if or when the pathogens were various ratios, the growth pattern of each pathogen was pro-
present in the same sample. SEL was formulated by modifying portional to the initial cell number. This detailed growth ki-
the recipe for BLEB and contains four different antimicrobial netics profile of each pathogen in a mixture in SEL would aid
agents, acriflavine, cycloheximide, fosfomycin, and nalidixic in the selection of a suitable method for the accurate detection
acid (Table 2), along with tryptic soy broth, yeast extract, so- of these three pathogens if present in the same sample.
dium pyruvate, and sodium phosphate, which are proven to The application of SEL as an enrichment medium for the
support the growth of healthy and injured food-borne patho- detection of three target pathogens in inoculated meat samples
gens (9, 11). Sodium pyruvate and sodium phosphates protect by antibody-based lateral-flow immunoassays and nucleic acid-
bacteria from pH changes and reactive oxygen atoms (32), and based PCR assays was investigated. As expected, individual-
the selective antibiotics inhibit the growth of background res- pathogen-specific ICLFA strips gave positive reactions when
ident microorganisms (31). bacteria were grown in SEL, suggesting that all three patho-
Overall, the individual growth patterns of the three target gens can be detected using antibody-based methods. More-
pathogens in SEL were satisfactory, and the performance of over, the ICLFA reaction intensities in SEL were stronger than
SEL as a selective enrichment broth was superior to those of those in the respective individual selective enrichment broths
mEC⫹n for E. coli and FB for Listeria and equivalent to that (Fig. 3). This result suggests that SEL promoted increased
of RV broth for Salmonella. For E. coli O157:H7, SEL was able expression of antibody-reactive antigens compared to the ex-
to support growth after inoculation with 10 and 1,000 CFU/ml, pression of these antigens in its counterparts. A selective- or
while mEC⫹n failed to support growth after inoculation with nonselective-medium-mediated reduction in the expression of
10 CFU/ml. The inability of mEC⫹n to support growth at this antigen or in an antigen-antibody reaction has been demon-
inoculation level was in agreement with the findings in a pre- strated previously for Salmonella, E. coli O157:H7, and L.
vious report (25). The lack of growth may be due to the strain monocytogenes (7, 21, 22, 24). Pathogen-specific multiplex PCR
used or the incubation temperature or agitation conditions assays were also successful in detecting each pathogen from the
employed in this study. Moreover, bile salts and novobiocin mixture without producing any nonspecific amplification (Fig.
present in mEC⫹n most likely exerted inhibitory effects cul- 4 and 5). Furthermore, the growth of two nontarget bacteria,
minating in reduced or no growth at lower cell numbers (28, Enterobacter aerogenes and Streptococcus mutans, in SEL (Ta-
49). The inability of mEC⫹n to support growth at 10 CFU/ml ble 1) did not interfere with the PCR amplification of the
or lower is unacceptable, since an infectious dose of E. coli specific target genes of the three pathogens (data not shown).
O157:H7 is in the range of 10 to 100 CFU (25). The growth In the inoculated-meat experiments, both ICLFA and PCR
rate of L. monocytogenes in SEL was superior to that in FB assays were performed with SEL-enriched samples at various
(47). In addition, other bacteria, Bacillus, Enterococcus, and time intervals. In most cases, positive ICLFA reactions were
Streptococcus spp., which showed poor or no growth in SEL obtained after 12 h of enrichment, with approximate cell pop-
(Table 1) can grow in FB (12). ulations of 6 to 8.2 log CFU/ml, while positive PCR results
In a mixed-culture experiment, SEL allowed the concurrent were obtained after 8 h of growth, with cell counts of 4.48 to 5.7
4864 KIM AND BHUNIA APPL. ENVIRON. MICROBIOL.

log CFU/ml, irrespective of the type of meat sample (see Fig.

Counts in the same row labeled with the same letter (A or B) and corresponding to growth in UPB and SEL at a given time point are not significantly different at P of ⬍0.05. Meat samples (25 g/225 ml of SEL)
were inoculated with Salmonella, E. coli, and Listeria (ca. 3 ⫻ 102 CFU of each pathogen/ml) and assayed at 8, 10, 12, 16, and 24 h. Bacterial cell counts were determined by plating Salmonella cells onto XLD agar, E.
7.73 ⫾ 0.05 A
7.47 ⫾ 0.04 A

8.47 ⫾ 0.98 A

8.90 ⫾ 0.05 A
5.88 ⫾ 0.03 B
6.40 ⫾ 0.17 B
S2 in the supplemental material), confirming that PCR is more

SEL
sensitive than the ICLFA. (Note that 8 h is the earliest time
point at which we tested.) In general, these limits of detection
for ICLFA and PCR are in agreement with the data in previ-
24 h

ous reports (8, 19, 44).

8.05 ⫾ 0.13 A

8.78 ⫾ 0.16 A
6.67 ⫾ 0.06 A
6.06 ⫾ 0.20 B
6.83 ⫾ 0.13 B

7.28 ⫾ 0.07 B
TABLE 6. Comparison of viable-cell counts for pathogens inoculated concurrently into turkey or salami and subjected to enrichment in UPB and SEL

The ability of selective enrichment broth to resuscitate tem-

UPB

perature-, preservative-, salt-, and acid-stressed cells (1, 3, 33,

36) encountered during food processing, storage, or sanitiza-

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

tion is critical for detection. It is also well known that injured
cells can cause an improper estimation of the decimal reduc-
8.57 ⫾ 0.06 A

7.24 ⫾ 0.06 A

7.56 ⫾ 0.04 A

9.20 ⫾ 0.18 A
5.95 ⫾ 0.10 A
7.19 ⫾ 0.06 B

tion time (D value) and z value (temperature required to

SEL

change the D value to transverse by 1 log) during thermal

processing (41) and, most importantly, that the injured patho-
gens can revive and grow under favorable conditions (9). We
16 h

have demonstrated that SEL allowed the recovery of acid (pH

7.76 ⫾ 0.21 A

6.10 ⫾ 0.05 A
7.50 ⫾ 0.15 B

6.14 ⫾ 0.17 B

7.02 ⫾ 0.06 B

8.77 ⫾ 0.01 B

5.5)- and temperature (4°C)-stressed cells and that, overall, the

UPB

recovery rates were comparable to those in nonselective

TSBYE broth (Table 5). However, the recovery rates for pH
4.5-stressed cells were variable; SEL successfully resuscitated
Listeria cells but failed to resuscitate E. coli O157:H7 and
8.81 ⫾ 0.02 A

7.30 ⫾ 0.04 A

7.04 ⫾ 0.17 A

8.70 ⫾ 0.07 A
7.15 ⫾ 0.09 B

4.52 ⫾ 0.07 B
Mean log10 CFU/ml ⫾ SDa at:

Salmonella cells.
SEL

In this study, the performance of SEL was compared with

that of UPB (2), a currently known universal enrichment broth
for Salmonella, Listeria, E. coli O157:H7, and Yersinia spp. (43,
12 h

51, 54). Overall, SEL supported improved growth of all three

8.20 ⫾ 0.03 A

8.70 ⫾ 0.02 A
5.65 ⫾ 0.03 A
7.24 ⫾ 0.12 B

6.02 ⫾ 0.06 B

6.62 ⫾ 0.15 B

target pathogens compared to that in UPB and the individual

UPB

selective enrichment broths RV, mEC⫹n, and FB. In addition,

SEL inhibited greater numbers of natural food-borne bacteria,
including some nascent food isolates, than UPB (Table 1; see
Table S2 in the supplemental material). Of the two ETEC
6.95 ⫾ 0.08 A

6.21 ⫾ 0.16 A
5.56 ⫾ 0.07 B

5.70 ⫾ 0.07 B

7.09 ⫾ 0.13 B
4.55 ⫾ 0.12 B

strains tested, the O78:H11 strain did not grow in SEL, while
the O25:K98:NM strain did. The lack of growth of O78:H11
SEL

was determined to be due to the presence of nalidixic acid and

acriflavine (data not shown). Further research on the types and
10 h

concentrations of antibiotics needed for all ETEC strains to

6.98 ⫾ 0.07 A

8.48 ⫾ 0.04 A
6.05 ⫾ 0.08 A

5.95 ⫾ 0.07 A

8.39 ⫾ 0.07 A
5.49 ⫾ 0.08 A

grow in SEL is warranted.

When both SEL and UPB were used as enrichment broths
UPB

with spiked meat samples, the overall bacterial cell counts in

UPB were slightly better than those in SEL, but the differences
were not statistically significant. Though PCR and ICLFA re-
5.59 ⫾ 0.32 A

5.75 ⫾ 0.05 A
4.74 ⫾ 0.23 B
5.08 ⫾ 0.15 B

4.84 ⫾ 0.06 B

4.02 ⫾ 0.21 B

sults for the two media were comparable, the PCR with UPB-
enriched samples yielded slightly improved detection of L.
SEL

coli cells onto CT-SMAC, and Listeria cells onto MOX.

monocytogenes at 8 h compared to that with SEL-enriched

samples (see Fig. S2 in the supplemental material).
In summary, SEL, a selective enrichment broth, promoted
8h

5.52 ⫾ 0.07 A

6.56 ⫾ 0.04 A
5.46 ⫾ 0.03 A

5.76 ⫾ 0.15 A
4.48 ⫾ 0.06 A

the concurrent growth of three major food-borne pathogens, S.

4.63 ⫾ 0.06 B

enterica, E. coli O157:H7, and L. monocytogenes, present at

UPB

various cell numbers in cultures and meat samples. The per-

formance of SEL was superior to that of UPB and the respec-
tive individual selective enrichment broths. Based on the data
presented in this study, SEL can be considered a selective
Salmonella serovar

Salmonella serovar
L. monocytogenes

L. monocytogenes
Meat and organism

E. coli O157:H7

E. coli O157:H7

enrichment broth for the detection of three major food-borne

Enteritidis

Enteritidis

pathogens by antibody- or nucleic acid-based assays. Currently,

SEL is being evaluated for the detection of pathogens in nat-
urally or artificially contaminated meat samples by biosensor-
Turkey

Salami

based assays, including light scattering and the use of fiber

a

optic sensors.
VOL. 74, 2008 MULTIPATHOGEN SELECTIVE ENRICHMENT BROTH 4865

ACKNOWLEDGMENTS acid-, salt- or temperature-induced stress environments. J. Appl. Microbiol.

95:762–772.
This research was supported through a cooperative agreement with 23. Gracias, K. S., and J. L. McKillip. 2004. A review of conventional detection
the Agricultural Research Service of the U.S. Department of Agricul- and enumeration methods for pathogenic bacteria in food. Can. J. Microbiol.
ture, project number 1935-42000-035, and the Center for Food Safety 50:883–890.
Engineering at Purdue University. 24. Hahm, B. K., and A. K. Bhunia. 2006. Effect of environmental stresses on
Sincere thanks to B. K. Hahm for technical assistance and Heather antibody-based detection of Escherichia coli O157:H7, Salmonella enterica
serotype Enteritidis and Listeria monocytogenes. J. Appl. Microbiol. 100:
Day, Seung Ohk, and Amornrat Aroonnual for critical review of the
1017–1027.
manuscript. 25. Hepburn, N. F., M. MacRae, M. Johnston, J. Mooney, and I. D. Ogden. 2002.
Optimizing enrichment conditions for the isolation of Escherichia coli O157
REFERENCES in soils by immunomagnetic separation. Lett. Appl. Microbiol. 34:365–369.
26. Jacobsen, C. N. 1999. The influence of commonly used selective agents on

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS

1. Abdul-Raouf, U. M., L. R. Beuchat, and M. S. Ammar. 1993. Survival and the growth of Listeria monocytogenes. Int. J. Food Microbiol. 50:221–226.
growth of Escherichia coli O157:H7 in ground, roasted beef as affected by 27. Jaradat, Z. W., G. E. Schutze, and A. K. Bhunia. 2002. Genetic homogeneity
pH, acidulants, and temperature. Appl. Environ. Microbiol. 59:2364–2368. among Listeria monocytogenes strains from infected patients and meat prod-
2. Bailey, J. S., and N. A. Cox. 1992. Universal preenrichment broth for the ucts from two geographic locations determined by phenotyping, ribotyping
simultaneous detection of Salmonella and Listeria in foods. J. Food Prot. and PCR analysis of virulence genes. Int. J. Food Microbiol. 76:1–10.
55:256–259. 28. Jeffries, L. 1959. Novobiocin-tetrathionate broth: a medium of improved
3. Benjamin, M. M., and A. R. Datta. 1995. Acid tolerance of enterohemor- selectivity for the isolation of salmonellae from faeces. J. Clin. Pathol. 12:
rhagic Escherichia coli. Appl. Environ. Microbiol. 61:1669–1672. 568–571.
4. Bhagwat, A. A. 2006. Microbiological safety of fresh-cut produce: where are 29. Jiang, J., E. Larkin, M. Steele, C. Poppe, and J. A. Odumeru. 1998. Evalu-
we now?, p. 121–165. In K. R. Mathews (ed.), Microbiology of fresh produce. ation of universal preenrichment broth for the recovery of foodborne patho-
ASM Press, Washington, DC. gens from milk and cheese. J. Dairy Sci. 81:2798–2803.
5. Bhagwat, A. A. 2003. Simultaneous detection of Escherichia coli O157:H7, 30. Kawasaki, S., N. Horikoshi, Y. Okada, K. Takeshita, T. Sameshima, and S.
Listeria monocytogenes and Salmonella strains by real-time PCR. Int. J. Food Kawamoto. 2005. Multiplex PCR for simultaneous detection of Salmonella
Microbiol. 84:217–224. spp., Listeria monocytogenes, and Escherichia coli O157:H7 in meat samples.
6. Bhunia, A. K. 2008. Biosensors and bio-based methods for the separation J. Food Prot. 68:551–556.
and detection of foodborne pathogens, p. 1–44. In S. Taylor (ed.), Advances 31. Kim, H. 2006. A selective enrichment medium for simultaneous growth and
in food and nutrition research, vol. 54. Academic Press, San Diego, CA. detection of Escherichia coli O157:H7, Listeria monocytogenes and Salmo-
7. Bird, C. B., R. J. Hoerner, and L. Restaino. 2001. Comparison of Reveal nella Enteritidis from food. Purdue University, West Lafayette, IN.
20-hours method and BAM culture method for detection of Escherichia coli 32. Knabel, S. J., and S. A Thielen. 1994. Enhanced recovery of severely heat-
O157:H7 in selected food and environment swabs: collaborative study. J. injured, thermotolerant Listeria monocytogenes from USDA and FDA pri-
AOAC Int. 84:737–751. mary enrichment media using a novel, simple, strictly anaerobic method. J.
8. Bird, C. B., R. L. Miller, M. M. Miller, K. Schniederm, and G. Rodvich. Food Prot. 58:29–34.
1999. Reveal for Salmonella test system. J. AOAC Int. 82:625–633. 33. Koutsoumanis, K. P., and J. N. Sofos. 2004. Comparative acid stress re-
9. Buduamoako, E., S. Toora, R. F. Ablett, and J. Smith. 1992. Evaluation of sponse of Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella
the ability of primary selective enrichment to resuscitate heat-injured and Typhimurium after habituation at different pH conditions. Lett. Appl. Mi-
freeze-injured Listeria monocytogenes cells. Appl. Environ. Microbiol. 58: crobiol. 38:321–326.
3177–3179. 34. Lathrop, A. A., P. P. Banada, and A. K. Bhunia. 2008. Differential expression
10. Burnett, S. L., and L. R. Beuchat. 2000. Human pathogens associated with of InlB and ActA in Listeria monocytogenes in selective and nonselective
raw produce and unpasteurized juices, and difficulties in decontamination. enrichment broths. J. Appl. Microbiol. 104:627–639.
J. Ind. Microbiol. Biotechnol. 25:281–287. 35. Ligler, F. S., C. R. Taitt, L. C. Shriver-Lake, K. E. Sapsford, Y. S. Shubin,
11. Busch, S. V., and C. W. Donnelly. 1992. Development of a repair-enrichment and J. P. Golden. 2003. Array biosensor for detection of toxins. Anal. Bio-
broth for resuscitation of heat-injured Listeria monocytogenes and Listeria anal. Chem. 377:469–477.
innocua. Appl. Environ. Microbiol. 58:14–20. 36. Lioa, C. H., and W. F. Fett. 2005. Resuscitation of acid-injured Salmonella in
12. Capita, R., C. Alonso-Calleja, B. Moreno, and M. C. Garcia-Fernandez. enrichment broth in apple juice and on the surface of fresh-cut cucumber
2001. Occurrence of Listeria species in retail poultry meat and comparison of and apple. Lett. Appl. Microbiol. 41:487–492.
a cultural/immunoassay for their detection. Int. J. Food Microbiol. 65:75–82. 37. Lynch, M., J. Painter, R. Woodruff, and C. Braden. 2006. Surveillance for
13. Cebula, T. A., W. L. Payne, and P. Feng. 1995. Simultaneous identification of foodborne-disease outbreaks—United States, 1998–2002. MMWR Surveill.
strains of Escherichia coli serotype O157:H7 and their Shiga-like toxin type Summ. 55:1–42.
by mismatch amplification mutation assay-multiplex PCR. J. Clin. Microbiol. 38. Maciorowski, K. G., P. Herrera, F. T. Jones, S. D. Pillai, and S. C. Ricke.
33:248–250. (Erratum, 33:1048.) 2006. Cultural and immunological detection methods for Salmonella spp. in
14. Chen, C. S., and R. A. Durst. 2006. Simultaneous detection of Escherichia coli animal feeds: a review. Vet. Res. Commun. 30:127–137.
O157:H7, Salmonella spp. and Listeria monocytogenes with an array-based im- 39. Maldonado, Y., J. C. Fiser, C. H. Nakatsu, and A. K. Bhunia. 2005. Cyto-
munosorbent assay using universal protein G-liposomal nanovesicles. Talanta toxicity potential and genotypic characterization of Escherichia coli isolates
69:232–238. from environmental and food sources. Appl. Environ. Microbiol. 71:1890–
15. Chiang, Y.-C., C.-Y. Yang, C. Li, Y.-C. Ho, C.-K. Lin, and H.-Y. Tsen. 2006. 1898.
Identification of Bacillus spp., Escherichia coli, Salmonella spp., Staphylococ- 40. Mead, P. S., L. Slutsker, V. Dietz, L. F. McCaig, J. S. Bresee, C. Shapiro,
cus spp. and Vibrio spp. with 16S ribosomal DNA-based oligonucleotide P. M. Griffin, and R. V. Tauxe. 1999. Food-related illness and death in the
array hybridization. Int. J. Food Microbiol. 107:131–137. United States. Emerg. Infect. Dis. 5:607–625.
16. Doyle, M. P., and J. L. Schoeni. 1987. Isolation of Escherichia coli O157:H7 41. Miller, F. A., T. R. S. Brandao, P. Teixeira, and C. L. M. Silva. 2006.
from retail fresh meats and poultry. Appl. Environ. Microbiol. 53:2394–2396. Recovery of heat-injured Listeria innocua. Int. J. Food Microbiol. 112:261–
17. Ericsson, H., H. Unnerstad, J. G. Mattsson, M. L. Danielsson-Tham, and W. 265.
Tham. 2000. Molecular grouping of Listeria monocytogenes based on the 42. Mukhopadhyay, A., and U. K. Mukhopadhyay. 2007. Novel multiplex PCR
sequence of the inlB gene. J. Med. Microbiol. 49:73–80. approaches for the simultaneous detection of human pathogens: Escherichia
18. FDA. 5 March 2001, revision date. Bacteriological analytical manual, 8th ed. coli O157:H7 and Listeria monocytogenes. J. Microbiol. Methods 68:193–200.
AOAC International, Arlington, VA. http://www.cfsan.fda.gov/⬃ebam/bam 43. Nam, H. M., S. E. Murinda, L. T. Nguyen, and S. P. Oliver. 2004. Evaluation
-mm.html. of universal pre-enrichment broth for isolation of Salmonella spp., Esche-
19. Fratamico, P. M., L. K. Bagi, and T. Pepe. 2000. A multiplex polymerase richia coli O157:H7 and Listeria monocytogenes from dairy farm environmen-
chain reaction assay for detection and identification of Escherichia coli tal samples. Foodborne Pathog. Dis. 1:37–44.
O157:H7 in food and bovine feed. J. Food Prot. 63:1032–1037. 44. Oberst, R. D., M. P. Hays, L. K. Bohra, R. K. Phebus, C. T. Yamashiro, C.
20. Fratamico, P. M., and T. P. Strobaugh. 1998. Simultaneous detection of Paszko-Kolva, S. J. Flood, J. M. Sargeant, and J. R. Gillespie. 1998. PCR-
Salmonella spp. and Escherichia coli O157:H7 by multiplex PCR. J. Ind. based DNA amplification and presumptive detection of Escherichia coli
Microbiol. Biotechnol. 21:92–98. O157:H7 with an internal fluorogenic probe and the 5⬘ nuclease (TaqMan)
21. Geng, T., B. K. Hahm, and A. K. Bhunia. 2006. Selective enrichment media assay. Appl. Environ. Microbiol. 64:3389–3396.
affect the antibody-based detection of stress-exposed Listeria monocytogenes 45. Oktay, H. I., and D. Heperkan. 2006. Evaluation of ISO method and Vidas
due to differential expression of antibody-reactive antigens identified by automated system for identifying Listeria and Salmonella in selected food. J.
protein sequencing. J. Food Prot. 69:1879–1886. Rapid Methods Autom. Microbiol. 14:133–135.
22. Geng, T., K. P. Kim, R. Gomez, D. M. Sherman, R. Bashir, M. R. Ladisch, 46. Settanni, L., and A. Corsetti. 2007. The use of multiplex PCR to detect and
and A. K. Bhunia. 2003. Expression of cellular antigens of Listeria monocy- differentiate food- and beverage-associated microorganisms: a review. J.
togenes that react with monoclonal antibodies C11E9 and EM-7G1 under Microbiol. Methods 69:1–22.
4866 KIM AND BHUNIA APPL. ENVIRON. MICROBIOL.

47. Silk, T. M., T. M. T. Roth, and C. W. Donnelly. 2002. Comparison of growth pathogens with a multi-channel SPR sensor. Biosens. Bioelectron. 22:
kinetics for healthy and heat-injured Listeria monocytogenes in eight enrich- 752–758.
ment broths. J. Food Prot. 65:1333–1337. 51. Thippareddi, H., R. K. Phebus, D. Y. C. Fung, and C. L. Kastner. 1995. Use
48. Soumet, C., G. Ermel, N. Rose, V. Rose, P. Drouin, G. Salvalt, and P. of universal pro-enrichment medium supplemented with oxyrase for the
Coulin. 1999. Evaluation of multiplex PCR assay for simultaneous iden- simultaneous recovery of Escherichia coli O157:H7 and Yersinia enteroco-
tification of Salmonella spp., Salmonella Enteritidis and Salmonella Ty- litica. J. Rapid Methods Autom. Microbiol. 4:37–50.
phimurium from environmental swabs of poultry houses. Lett. Appl. 52. Vidal, R., M. Vidal, R. Lagos, M. Levine, and V. Prado. 2004. Multiplex PCR
Microbiol. 28:113–117. for diagnosis of enteric infections associated with diarrheagenic Escherichia
49. Stephens, P. J., and J. A. Joynson. 1998. Direct inoculation into media coli. J. Clin. Microbiol. 42:1787–1789.
containing bile salts and antibiotics is unsuitable for the detection of acid/salt 53. Woodward, M. J., and S. E. Kirwan. 1996. Detection of Salmonella Enteri-
stressed Escherichia coli O157:H7. Lett. Appl. Microbiol. 27:147–151. tidis in eggs by the polymerase chain reaction. Vet. Rec. 138:411–413.
50. Taylor, A. D., J. Ladd, Q. Yu, S. Chen, J. Homola, and S. Jiang. 2006. 54. Zhao, T., and M. P. Doyle. 2001. Evaluation of universal preenrichment
Quantitative and simultaneous detection of four foodborne bacterial broth for growth of heat-injured pathogens. J. Food Prot. 64:1751–1755.

Downloaded from http://aem.asm.org/ on March 10, 2015 by University of Pittsburgh HSLS