animals

Article
Phenotypic and Genotypic Characterization of
Virulence Factors and Susceptibility to Antibiotics in
Salmonella Infantis Strains Isolated from Chicken
Meat: First Findings in Chile
Lisette Lapierre 1, *, Javiera Cornejo 1 , Sebastián Zavala 1 , Nicolás Galarce 1 ,
Fernando Sánchez 1 , María Belén Benavides 1 , Miguel Guzmán 2 and Leonardo Sáenz 3
1 Department of Animal Preventive Medicine, Faculty of Veterinary and Animal Sciences,
Universidad de Chile, Santiago 8820808, Chile; [email protected] (J.C.); [email protected] (S.Z.);
[email protected] (N.G.); [email protected] (F.S.); [email protected] (M.B.B.)
2 Laboratory of Avian Pathology, Faculty of Veterinary and Animal Sciences, Universidad de Chile,
Santiago 8820808, Chile; [email protected]
3 Laboratory of Veterinary Vaccines, Department of Animal Biology, Faculty of Veterinary and Animal Science,
Universidad de Chile, Santiago 8820808, Chile; [email protected]
* Correspondence: [email protected]; Tel.: +56-229-785-615




Received: 16 April 2020; Accepted: 31 May 2020; Published: 18 June 2020


Simple Summary: Salmonella Infantis (S. Infantis) is a zoonotic pathogen that causes gastroenteritis
in humans and animals, with poultry being its main reservoir. This pathogen has emerged over
the last few decades in different countries, causing outbreaks in humans subsequent to foodborne
transmission. It is important to be able to characterize this pathogen in order to establish control
measures in the poultry industry. In this study, we investigated the presence of virulence genes,
biofilm formation abilities, antibiotic resistance genes, and antibiotic susceptibility in S. Infantis.
The results showed that the S. Infantis strains isolated from chicken meat for sale in supermarkets in
Santiago, Chile are multidrug-resistant (MDR) and contain virulence genes, making them pathogenic.
Thus, Salmonella Infantis should be under surveillance in the poultry food production chain with the
aim of protecting public health.

Abstract: Salmonella Infantis is a zoonotic pathogen that causes gastroenteritis in humans and animals,
with poultry being its main reservoir. In Chile, there are no data to characterize S. Infantis strains
in poultry production. In this study, 87 S. Infantis strains were isolated from chicken meat for sale
in supermarkets in Santiago, Chile, and characterized according to their virulence genes, biofilm
formation abilities, antibiotic susceptibility, and resistance genes. Through polymerase chain reaction
or PCR, the strains were analyzed to detect the presence of 11 virulence genes, 12 antibiotic resistance
genes, and integrase genes. Moreover, disc diffusion susceptibility to 18 antimicrobials and the ability
to form biofilm in vitro were evaluated. Results demonstrated six different virulence gene profiles.
Ninety-four percent of the strains were multi-resistant to antibiotics with weak biofilm formation
abilities, 63.2% of the strains were broad spectrum β- lactam resistant, and the bla CTX-M-65 gene was
amplified in 13 strains. Only 3.4% of the strains were fluoroquinolone resistant, and the qnrB gene was
amplified in two strains. Colistin resistance was exhibited in 28.7% of the strains, but mrc genes were
not amplified in any strain under study. The isolated S. Infantis strains are pathogenic and antibiotic
multi-resistant, and thus, this Salmonella serotype should be under surveillance in the poultry food
production chain with the aim of protecting public health.

Keywords: Salmonella Infantis; meat chicken; broiler; antimicrobial resistance; virulence genes

Animals 2020, 10, 1049; doi:10.3390/ani10061049 www.mdpi.com/journal/animals

Animals 2020, 10, 1049 2 of 15

1. Introduction
Salmonella is an important gastroenteric pathogen, and some serotypes of Salmonella enterica are
considered emerging zoonotic pathogens, generating outbreaks worldwide in the human population.
Animal food products, especially eggs and poultry meat, are the most common vehicles for Salmonella
infections. It is estimated that Salmonella enterica gastroenteritis is responsible for about 93.8 million
illness and 155,000 deaths worldwide each year, and, of these, 80.3 million cases are estimated to be
foodborne, with very high associated costs [1].
Due to the suspected high correlation between salmonellosis in poultry and the number of human
infections, Directive 2003/99/EC of the European Parliament and Council requires that the following
five serotypes of Salmonella are monitored in poultry flocks: Enteritidis, Typhimurium, Virchow, Hadar,
and Infantis. Salmonella Enterica subspecies enterica serovar Infantis (S. Infantis) is currently the
emerging nontyphoidal Salmonella worldwide and is of major public health concern due to its frequent
isolation in humans. Currently, it is ranked fourth among the top 10 human serovars. The EU ranked
S. Infantis as the fourth most common Salmonella serovar found in human cases, with 1846 confirmed
human cases in 2014 [2]. In Chile, the Public Health Institute published the Salmonella surveillance
report of human clinical cases between 2012–2016 confirming the detection of 11,181 strains, with 1.3%
of these corresponding to serovar S. Infantis [3]. This strain is frequently multidrug resistant (MDR)
and seems to be spread successfully from broilers to humans through certain clones [4].
A variety of virulence factors have been shown to play different roles in the pathogenesis of
Salmonella infections. These factors included flagella, capsule, plasmids, adhesion systems, and type
3 secretion systems (T3SS) encoded on the Salmonella pathogenicity islands SPI-1 and SPI-2 and other
SPIs. Salmonella spp. require multiple genes for full virulence. Many of these genes are found in
‘pathogenicity islands’ in the chromosome [3].
The increasing incidence of S. Infantis infections may be further complicated by the
development of resistance to medically important antimicrobials including penicillins, cephalosporins,
and fluoroquinolones [5–8]. Extended-spectrum cephalosporin or fluroquinolone-resistant Salmonella
have been isolated from food-producing animals and their products in many countries [8–10].
Many parts of the world have reported MDR S. Infantis strains from poultry and human sources,
indicating that S. Infantis may be an emerging international public health problem [11–14]. In Chile,
there are no data on the characterization of S. Infantis isolated from animal sources or from food.
The aim of this research was to characterize virulence factors, antibiotic resistance, and their
associations in strains of Salmonella Infantis isolated from fresh chicken meat for sale in various
supermarkets in Santiago, Chile.

2. Materials and Methods

2.1. Samples Procedures

Sample size: The minimum sample size was calculated to be 360 samples, and was obtained using
the following formula, designed to estimate a sample proportion [15]: n = Zα2pq/L2 where “n” is the
sampling size needed; “Zα” is the Z-value required for a confidence level = 1−α, where “α” is the
error; “p” is the expected prevalence; “q” is the complement of p; and “L” is the precision or absolute
accepted error. In this study, α was set at 5%. Therefore, the confidence level was 95%, and Zα was
1.96. As no information exists about the prevalence of Salmonella Infantis strains in chicken meat in
Santiago or Chile, the expected p was set at 50% and the precision L was set at 5%.
Sampling: In this study, a total of 361 samples were collected from 50 supermarkets in the city
of Santiago, Chile, over the course of 2016. Once a month, we randomly selected eight packaged
whole chicken carcasses without giblets, selecting at least one package from each of the eight different
chicken-producing companies present in Chile. All retail chicken meat samples were individually
and aseptically vacuum-packed. The chicken meat samples were transported to the laboratory at a
temperature between 4 ◦ C and 8 ◦ C and analyzed within 24 h after collection.
Animals 2020, 10, 1049 3 of 15

2.2. Isolation and Serotyping of Salmonella

A screening using VIDAS Salmonella (Biomeriux® , bioMérieux SA, F-69280 Marcy l’Etoile, France)
was initially performed. Afterward, only positive samples were analyzed according to ISO norm 6579:
2002 as it applies to Salmonella detection in food and animal feeding materials [16,17]. Two suspected
colonies from each positive sample, with black centers on Shigella and Salmonella agar and Xylose
Lysine Deoxycholate (SS and XLD) agar, were assumed to be Salmonella spp. The suspected Salmonella
colonies were initially subjected to traditional morphological and biochemical testing including Gram
staining, and the use of triple sugar iron agar slopes and API 20E strips (bioMérieux, Marcy l’Etoile,
France). If the two suspected colonies were confirmed as Salmonella spp, one of them was selected to
perform all subsequent phenotypic and genotypic analyses. After biochemical confirmation, Salmonella
isolates were sent to the Salmonella National Reference Laboratory (Institute Public Health, Santiago,
Chile) for serotype characterization using the Kauffman–White classification scheme [18].

2.3. Antimicrobial Susceptibility Testing

Resistance was assessed using the agar plate disk diffusion method (Kirby Bauer), which was
performed according to the Clinical and Laboratory Standards Institute (CLSI) M100-S23
(CLSI,2013) [19]. The bacteria inoculum was standardized to 0.5 McFarland units using a nephelometer.
The following antibiotics were used: Ampicillin (AMP), 10 µg; Amoxicillin–clavulanic acid (AMC),
20/10 µg; Ceftriaxone (CRO), 30 µg; Nalidixic acid (NA), 30 µg; Ciprofloxacin (CIP), 5 µg; Gentamicin
(CN), 10 µg; Sulfamethoxazole/trimethoprim (SXT), 23.75/1.25 µg; Tetracycline (TE), 30 µg; Ceftiofur
(EFT), 30 µg; Ceftazidime (CAZ), 30 µg; Cefadroxil (CFR), 30 µg; Streptomycin (S), 10 µg; Azithromycin
(AZM), 15 µg; Enrofloxacin (ENR), 5 µg; Trimethoprim (W), 5 µg; Sulfisoxazole (SF), 300 µg;
Chloramphenicol (C), 30 µg; and Fosfomycin (FOS), 200 µg. The disks were purchased from
Oxoid® , UK. Multidrug resistance (MDR) was defined as the resistance to three or more antimicrobial
classes. Strains were analyzed for critically important antimicrobials, as defined by the World Health
Organization (WHO) [20]. Interpretation of the results of the Salmonella isolates was performed
using the resistant breakpoints published by CLSI [19]. For enrofloxacin, ciprofloxacin breakpoints
were used, and the values for azithromycin were analyzed based on Parry, 2015 and Martínez,
2016 [21,22]. Isolates with intermediate resistance were labeled as resistant and were added to the
resistant count. The resistant isolates with a zone diameter less than or equal to the breakpoints for
cefotaxime, ceftazidime, or ceftiofur were also examined to identify extended spectrum β-lactamses or
ESBL production, using the phenotypic confirmatory test [23] with a cefotaxime (30 µg)-clavulanic
acid disk (10 µg) or a ceftazidime (30 µg)-clavulanic acid disk (10 µg). For colistin, minimum
inhibitory concentration (MIC) determination was performed in accordance with EUCAST/CLSI joint
guidelines [24]. Results were interpreted according to the EUCAST breakpoints [25] (i.e., isolates with
MICs of >2 mg/L were categorized as resistant). Escherichia coli ATCC 35218, E. coli 25922, E. coli NCTC
13846, and Klebsiella pneumoniae ATCC 700,603 were used as quality control strains.

2.4. Detection of Antimicrobial Resistance and Virulence Genes

The genomic DNA of S. Infantis was extracted using a commercial kit (Thermo Scientific,
Waltham, MA, USA, GeneJET Genomic DNA Purification Kit). Concentration and quality of the
extracted DNA was measured in a NANO-400 micro-spectrophotometer (Hangzhou Allsheng
Instruments Co, Hangzhou, China). Samples with an absorbance ratio closest to the optimal range
(1.8–2.0) were kept at −20 ◦ C for further analysis. The presence of resistance genes beta-lactams
(blaTEM , blaNDM1 , and blaCTX-M ), fluoroquinolons (qnrB), tetracycline (tet(A) and tet(B)), trimethoprim
(dfrA1), and colistin (mrc1, mrc2, mrc3, mrc4, and mrc5) was detected by PCR amplification following
previously described protocols [26–32], (Table 1). Additional antimicrobial resistance genes such
as blaCTX-M were sent to undergo gene sequencing using Macrogen® , Beotkkot-ro, Geumcheon-gu,
Seoul, South Korea, and this data were aligned and analyzed using the Basic Local Alignment Search
Animals 2020, 10, 1049 4 of 15

Tool (BLAST). Isolates were examined for the presence of class 1 and class 2 integrons using PCR
amplification as described by Mazel et al., [33]. For virulotyping, a PCR-based test was performed
for the identification of 11 virulence genes: invA, pagK, spvC, sirA, gipA, SEN1417, trhH, sipA, sipO,
sopD, and mgtC [34–38]. The PCR reactions were performed following previously described protocols,
as shown in Table 1. In general, the PCR was performed in a total volume of 25 µL containing 1 U
Taq Polymerase (Invitrogen® , ON, Canada), 1× Taq buffer (5 mM KCl Tris-HCl, pH 8.5), 1.5 mM
MgCl2 , 0.1 mM dNTPs (Promega® ), 1 µM forward and reverse primer (Promega® , Madison, WI,
USA), and 1 µL of DNA. Brief incubation at 95 ◦ C for 10 min was used as an initial denaturation step
followed by 35 cycles of amplification. Each cycle consisted of a denaturation step at 95 ◦ C for 1 min,
followed by annealing for 1 min at different temperatures according to the target gene (Table 1) and
elongation at 72 ◦ C for 1 min. The final elongation step was conducted at 72 ◦ C for 10 min. Control
strains present in the previously-sequenced key genes were used, with the exception of mcr genes,
which had to be sent for sequencing. In Table 1, primers, annealing temperatures, and the molecular
weight of amplicons are shown for each analyzed gene.

Table 1. Primers used to detect antimicrobial resistance and virulence genes.

Product Annealing
Gene Primers (50 -30 ) Reference
Size (pb) T◦
F: ATCAGCAATAAACCAGC
bla TEM 516 54 ◦ C Colom et al. (2004)
R: CCCCGAAGAACGTTTTC
F: ATGTGCAGYACCAGTAARGTKATGGC
bla CTX-M 592 58 ◦ C Mulvey et al. (2003)
R: TGGGTRAARTARGTSACCAGAAYSAGCGG
F: CTGAGCACCGCATTAGCC
bla NDM1 621 52 ◦ C Pfeifer et al. (2011)
R: GGGCCGTATGAGTGATTGC
F: GGTTCACTCGAACGACGTCA
qtetA 577 55 ◦ C Ng et al. (2001)
R: CTGTCCGACAAGTTGCATGA
F: CCTCAGCTTCTCAACGCGTG
tetB 634 55 ◦ C Ng et al. (2001)
R: GCACCTTGCTGATGACTCTT
F: GGAGTGCCAAAGGTGAACAGC
dfrA1 367 55 ◦ C Torkan et al. (2015)
R: GAGGCGAAGTCTTGGGTAAAAAC
F: GATCGTGAAAGCCAGAAAGG
qnrB 469 53 ◦ C Robicsek et al. (2006)
R: ACGATGCCTGGTAGTTGTCC
F: AGTCCGTTTGTTCTTGTGGC
mrc1 320 58 ◦ C Rebelo et al. (2018)
R: AGATCCTTGGTCTCGGCTTG
F: CAAGTGTGTTGGTCGCAGTT
mrc2 715 58 ◦ C Rebelo et al. (2018)
R: TCTAGCCCGACAAGCATACC
F: AAATAAAAATTGTTCCGCTTATG
mrc3 929 58 ◦ C Rebelo et al. (2018)
R: AATGGAGATCCCCGTTTTT
F: TCACTTTCATCACTGCGTTG
mrc4 1116 58 ◦ C Rebelo et al. (2018)
R: TTGGTCCATGACTACCAATG
F: ATGCGGTTGTCTGCATTTATC
mrc5 1644 58 ◦ C Rebelo et al. (2018)
R: TCATTGTGGTTGTCCTTTTCTG
F: GGGTCAAGGATCTGGATTTCG
int1 483 62 ◦ C Mazel et al. (2000)
R: ACATGGGTGTAAATCATCGTC
F: CACGGATATGCGACAAAAAGGT
int2 233 62 ◦ C Mazel et al. (2000)
R: GTAGCAAACGAGTGACGAAATG
F: ACGACTGAGCAGGCTGAG
gipA 518 58 ◦ C Huenh et al. (2010)
R: TTGGAAATGGTGACGGTAGAC
F: TGACTATCAATGCTCCAGTGAAT
mgtC 677 58 ◦ C Huenh et al. (2010)
R: ATTTACTGGCCGCTATGCTGTTG
F: AACTGGTGCCGTTGTCATTG
trhH 418 53 ◦ C Huenh et al. (2010)
R: GATGGTCTGTGCTTGCTGAG
F: CTCCTTGCACAACCAAATGCG
spvC 570 53 ◦ C Huenh et al. (2010)
R: TGTCTCTGCATTTCACCACCATC
F: TGCGCCTGGTGACAAAACTG
sirA 313 55 ◦ C Huenh et al. (2010)
R: ACTGACTTCCCAGGCTACAGCA
F: ACCATCTTCACTATATTCTGCTC
pagK 151 60 ◦ C Huenh et al. (2010)
R: ACCTCTACACATTTTAAACCAATC
F: GTGAAATTATCGCCACGTTCGGGCAA
invA 284 64 ◦ C Malorny et al. (2003)
R: TCATCGCACCGTCAAAGGAACC
Animals 2020, 10, 1049 5 of 15

Table 1. Cont.

Product Annealing
Gene Primers (50 -30 ) Reference
Size (pb) T◦
F: GATCGCTGGCTGGTC
SEN1417 670 58 ◦ C Pan et al. (2009)
R: CTGACCGTAATGGCGA
F: ATGGTTACAAGTGTAAGGACTCAG
sipA 2055 53 ◦ C Shah et al. (2011)
R: ACGCTGCATGTGCAAGCCATC
F: ATGCTTAATATTCAAAATTATTCCG
sipD 1029 53 ◦ C Shah et al. (2011)
R: TCCTTGCAGGAAGCTTTTG
F: GAGCTCACGACCATTTGCGGCG
sopD 1291 59 Raffatellu et al. (2005)
R: GAGCTCCGAGACACGCTTCTTCG

2.5. Gel Documentation

The gels were stained with Gel Red (Invitrogen® , Carlsbad, CA, USA), the amplicons were resolved
by agarose gel electrophoresis (1.5% or 2.0% agarose) at 120 V for one hour, and band visualization
was carried out with a UV-transilluminator (Vilber Lourmat, Collegien, France). The concentration of
agarose used was suitable for the expected band sizes. The stained gel was captured on a desktop
computer using the Infinity® software (Tallahassee, FL, USA).

2.6. Measurement of Biofilm Formation

Biofilm formation was measured using a semiquantitative adherence assay with 96-well tissue
culture plates [39]. Plates were inoculated with 200 µL of Muller Hinton medium of each strain at
a 109 CFU/mL concentration. Prior to this, a growth curve was generated from the plate count and
measurement of turbidity with a spectrophotometer at 550 nm. Plates were incubated at 25 ◦ C for
72 h. Eight wells were used per strain to determine the number of viable cells from the biofilms and
to measure the optical density from the formed biofilms. To do this, the biofilms were extracted by
scraping the surface of the wells with a sterile swab, resuspended in MH broth, and diluted in series.
Then, the samples were subjected to further 10-fold dilutions. Samples (0.1 mL) from each dilution
were subsequently plated on XLD plates and incubated at 37 ◦ C for 48 h before the former colonies
were counted and expressed as CFU/mL. To measure the optical density from the formed biofilms,
the culture medium was removed, and the wells were washed with phosphate buffer saline or PBS.
To remove adhered material from the well walls, 200 µL of 80% ethanol and 20% acetone solution was
added. Adhered bacteria were fixed with 150 µL of Bouin’s solution (7.5 mL picric acid; 2.5 mL 40%
formaldehyde; 0.5 mL acetic acid) for 15 min, and washed again with PBS. Plates were air-dried and
then stained with 150 µL of 0.1% (w/v) crystal violet for 5 min. Excess stain was removed, adhered
bacteria were air-dried, and spectrophotometric measurements were taken at OD 550 nm in a 96-well
plate reader and the average of at least three replicates was calculated.

2.7. Statistical Analysis

Antibiotic resistance was considered as a binary dependent variable (0 = nonresistant; 1 = resistant).
Two correlations were established, one between the resistance profile of each antimicrobial and the
virulence genes from the same strain, and another one between the resistance profiles of all antimicrobials
according to their strains. For this, the Spearman test was used. The null hypothesis is based on
a Spearman correlation, p(“rho”) of 0. The associations were considered significant when p < 0.05.
All of the analyses previously described were performed using the Infostat® software (Córdoba,
Argentina) [40]. Significant results were graphed using the statistical software R (R Core Team, 2017).
Animals 2020, 10, 1049 6 of 15

3. Results
Animals 2020, 10, x 6 of 15

3.1. Percentage of S. Infantis Isolated from Broiler Meat

From a total of 361 broiler meat samples, 87 strains of Salmonella Infantis were isolated,
From a totaltoof24%
corresponding 361 of
broiler meat samples,
the samples. Additionally, of Salmonella
87 strainsthree Infantis
strains (0.8%) ofwere isolated, corresponding
S. Enteritidis were isolated,
to 24% of the samples. Additionally, three
but they were not included in the research. strains (0.8%) of S. Enteritidis were isolated, but they were not
included in the research.
3.2. Antimicrobial Susceptibility Testing, Extended‐Spectrum β‐lactamase Phenotyping and Polymerase
3.2.
ChainAntimicrobial
Reaction PCR Susceptibility
Analysis ofTesting, Extended-Spectrum
Resistance Genes β-Lactamase Phenotyping and Polymerase Chain
Reaction PCR Analysis of Resistance Genes
The resistance percentages for each antibiotic are shown in Figure 1. High resistance rates were
The resistance percentages for each antibiotic are shown in Figure 1. High resistance rates
detected for tetracycline (95%), nalidix acid (97%), and sulfisozaxole (96%). However, sensitivity to
were detected for tetracycline (95%), nalidix acid (97%), and sulfisozaxole (96%). However,
streptomycin (0%), ceftazidime (1.1%), ciprofloxacin (2.3%), and azithromycin (2.3%) was observed.
sensitivity to streptomycin (0%), ceftazidime (1.1%), ciprofloxacin (2.3%), and azithromycin
Only one strain was found to be susceptible to all antibiotics and 94% of the strains were found to be
(2.3%) was observed. Only one strain was found to be susceptible to all antibiotics and 94%
MDR. The MDR S. Infantis was selected based on resistance to over three classes of antibiotics. MDR
of the strains were found to be MDR. The MDR S. Infantis was selected based on resistance
strains exhibited 31 different multi‐resistance profiles (Table 2). The most common MDR profiles
to over three classes of antibiotics. MDR strains exhibited 31 different multi-resistance profiles
were: tetracycline/nalidix acid/sulfisoxazole (12 isolates);
(Table 2). The most common MDR profiles were: tetracycline/nalidix acid/sulfisoxazole (12 isolates);
ampicillin/ceftiofur/ceftriaxone/cefadroxil/tetracycline/nalidix acid/sulfisoxazole/chloramphenicol
ampicillin/ceftiofur/ceftriaxone/cefadroxil/tetracycline/nalidix acid/sulfisoxazole/chloramphenicol
(15 isolates); and ampicillin/ceftiofur/ceftriaxone/cefadroxil/gentamicin/tetracycline/nalidix
(15 isolates); and ampicillin/ceftiofur/ceftriaxone/cefadroxil/gentamicin/tetracycline/nalidix
acid/sulfamethoxazole+ trimethoprim/trimethoprim/sulfisoxazole/chloramphenicol/fosfomycin (15
acid/sulfamethoxazole+ trimethoprim/trimethoprim/sulfisoxazole/chloramphenicol/fosfomycin
isolates). When analyzing whether or not ceftazidime, ceftriaxone, and/or ceftiofur were broad
(15 isolates). When analyzing whether or not ceftazidime, ceftriaxone, and/or ceftiofur were broad
spectrum β‐lactamase (ESBL) producers, it was found that out of 63 strains resistant to
spectrum β-lactamase (ESBL) producers, it was found that out of 63 strains resistant to cephalosporines,
cephalosporines, 55 were resistant to phenotypical testing (87.3%) and were classified as ESBL.
55 were resistant to phenotypical testing (87.3%) and were classified as ESBL. Regarding colistin
Regarding colistin susceptibility, the minimum inhibitory concentration (MIC) technique was
susceptibility, the minimum inhibitory concentration (MIC) technique was performed, where from a
performed, where from a total of 87 analyzed strains, 25 (28.7%) strains were found to be
total of 87 analyzed strains, 25 (28.7%) strains were found to be phenotypically resistant in ranges from
phenotypically resistant in ranges from 4 to 8 mg/L.
4 to 8 mg/L.

Figure 1. Percentages (%) of antimicrobial resistant Salmonella Enterica ser. Infantis. AMP, Ampicilin;
Figure 1. Percentages (%) of antimicrobial resistant Salmonella Enterica ser. Infantis. AMP, Ampicilin;
AMC, Amoxicilin + Clavulanic Acid; EFT, Ceftiofur; CAZ, Ceftazidime; CRO, Ceftriaxone; CFR, Cefadroxil;
AMC, Amoxicilin + Clavulanic Acid; EFT, Ceftiofur; CAZ, Ceftazidime; CRO, Ceftriaxone; CFR,
CN, Gentamicin; S, Streptomycin; AZM, Azithromycin; TE, Tetracycline; CIP, Ciprofloxacin; ENR,
Cefadroxil; CN, Gentamicin; S, Streptomycin; AZM, Azithromycin; TE, Tetracycline; CIP,
Enrofloxacin; NA, Nalidixic Acid; SXT, Sulfamethoxazole + Trimethoprim; W, Trimethoprim;
Ciprofloxacin; ENR, Enrofloxacin; NA, Nalidixic Acid; SXT, Sulfamethoxazole + Trimethoprim; W,
SF, Sulfisoxazole; C, Chloramphenicol; FOS, Fosfomycin; CAZ/CLA, Ceftazidime + Clavulanic Acid.
Trimethoprim; SF, Sulfisoxazole; C, Chloramphenicol; FOS, Fosfomycin; CAZ/CLA, Ceftazidime +
Clavulanic Acid.

Table 2. Phenotypic resistance profiles detected in Salmonella Infantis strains.

Resistance Phenotype No. Isolates

NA 4
ENR‐NA 1
TE‐NA‐SF 12
CRO‐TE‐NA‐SF 1
Animals 2020, 10, 1049 7 of 15

Table 2. Phenotypic resistance profiles detected in Salmonella Infantis strains.

Resistance Phenotype No. Isolates

NA 4
ENR-NA 1
TE-NA-SF 12
CRO-TE-NA-SF 1
CFR-TE-NA-SF-FOS 1
TE-NA-SXT-W-SF 3
TE-NA-SF-C-FOS 1
CFR-CIP-NA-SXT-W-SF 1
CN-TE-NA-SXT-W-SF 4
AMC-CFR-TE-NA-SXT-W-SF 1
EFT-CN-TE-NA-SXT-W-SF 1
CFR-CN-TE-NA-SXT-W-SF 1
AMP-EFT-CRO-CFR-TE-NA-SF-C 15
AMP-CN-TE-ENR-NA-SXT-W-SF 1
AMP-CRO-TE-NA-SXT-W-SF-C 1
AMP-EFT-CRO-CFR-TE-NA-SXT-SF-C 1
AMP-EFT-CRO-CFR-CN-TE-NA-SF-C 1
AMP-EFT-CRO-CFR-TE-NA-SXT-W-SF-C 1
AMP-EFT-CRO-CFR-CN-TE-ENR-NA-SF-C 3
AMP-EFT-CRO-CFR-CN-TE-NA-SF-C-FOS 1
AMP-EFT-CRO-CFR-TE-NA-SXT-W-SF-C 1
AMP-EFT-CRO-CFR-AZM-TE-NA-CIP-SXT-SF-FOS 1
AMP-EFT-CRO-CFR-CN-TE-ENR-NA-SF-C-FOS 3
AMP-EFT-CRO-CFR-CN-AZM-TE-ENR-NA-SF-C 1
AMC-EFT-CRO-CFR-TE-NA-SXT-W-SF-C-FOS 1
AMP-EFT-CRO-CFR-TE-NA-SXT-W-SF-C-FOS 3
AMP-EFT-CRO-CFR-CN-TE-NA-SXT-W-SF-FOS 1
AMP-EFT-CRO-CFR-CN-TE-NA-SXT-W-SF-C-FOS 15
AMP-AMC-EFT-CAZ-CRO-CFR-CN-TE-ENR-NA-SF-C-FOS 1
AMP-AMC-EFT-CRO-CFR-CN-TE-NA-SXT-W-SF-C-FOS 1
AMP-EFT-CRO-CFR-CN-AZM-TE-NA-SXT-W-SF-C-FOS 1
AMP-EFT-CRO-CFR-CN-TE-ENR-NA-SXT-W-SF-C-FOS 1
AMP-EFT-CRO-CFR-CN-TE-NA-ENR-SXT-W-SF-C-FOS 1
AMP Ampicilin; AMC, Amoxicilin + Clavulanic Acid; EFT, Ceftiofur; CAZ, Ceftazidime; CRO, Ceftriaxone;
CFR, Cefadroxil; CN, Gentamicin; S, Streptomycin; AZM, Azithromycin; TE, Tetracycline; CIP, Ciprofloxacin;
ENR, Enrofloxacin; NA, Nalidixic Acid; SXT, Sulfamethoxazole + Trimethoprim; W, Trimethoprim; SF, Sulfisoxazole;
C, Chloramphenicol; FOS, Fosfomycin.

Beyond the phenotypic determination, we tested for the presence of antibiotic resistance genes
that could have been mediators of antibiotic resistance in S. Infantis. Of the three cephalosporine
resistance genes, only one, blaCTX-M-65 , was amplified in 13 (23.6%) of the ESBL strains. The qnrB gene
was amplified in two (66,6%) of the three fluoroquinolone resistant strains. The tetA and tetB genes
were amplified in six (7%) and 22 (25.6%), respectively, of the 86 tetracycline resistant strains, and both
tetA and tetB were amplified in one (1.2%) of these strains. The dfrA1 gene was amplified in 27 (67.5%)
of the 40 trimethoprim resistant strains. The genes mrc1, mrc2, mrc3, mrc4, or mrc5 were not amplified
in any of the 25 colistin resistant strains. In terms of integrase genes int 1 and int 2, only gene class 1
was amplified and in low amounts, as it was found in only six (7%) of the S. Infantis strains analyzed.

3.3. Distribution of Virulence Genes among Salmonella Infantis

Six different virulotypes were found in the 87 analyzed strains of S. Infantis (Table 3). A total of
100% of the analyzed strains presented the genes: invA; sipA; sipD and sopD (invasion); SEN1417; mgtC
(intracellular survival); and pagK (biofilm formation), which might indicate the importance of these
seven genes as virulence factors for S. Infantis. All 11 virulence genes analyzed were amplified in one
strain, and 10 out of 11 virulence genes analyzed were amplified in four strains. The least-detected
gene in the isolates was trhH, which codes for the putative F pilus assembly protein. This gene was
amplified in only three strains.
Animals 2020, 10, 1049 8 of 15

AnimalsTable
2020, 10,
3. xVirulence gene combinations (virulotypes) and their frequency in the isolated strains. 8 of 15

ID1 1 Virulotypes:
ID Virulotypes: gipA-spvC-sirA-invA-SEN1417-pagK-sipA-sipO-sopD-mgtC-trhH
gipA‐spvC‐sirA‐invA‐SEN1417‐pagK‐sipA‐sipO‐sopD‐mgtC‐trhH No. of
No. of Strains
Strains
22 11011111110
11011111110 65
65
33 10011111110
10011111110 11
11
66 11111111110
11111111110 44
7 7 10111111110
10111111110 44
15 11111111111 1
15 11111111111 1
77 11011111111 2
77 11011111111 2
1 ID numbers were assigned according to the virulotype appearance in the strain list.
1 ID numbers were assigned according to the virulotype appearance in the strain list.

3.4. Biofilm
3.4. BiofilmFormation
Formation
When
Whenmeasuring
measuringthe theabsorbance
absorbance (OD550)
(OD550) of of the
thesolubilized
solubilizedbiofilms,
biofilms, values
values from
from 0.82
0.82 to to 2.145
2.145
were reported. The data were subsequently classified according to ODc (ODc is the
were reported. The data were subsequently classified according to ODc (ODc is the average optical average optical
density
densityachieved
achievedbybythethe
negative
negativecontrol wells
control of of
wells each reading
each plus
reading three
plus standard
three standarddeviations).
deviations). The
The ODc
value
ODcwas 0.790.
value was The strains
0.790. were grouped
The strains into two
were grouped intocategories according
two categories to the
according to OD cutoff
the OD value
cutoff (ODc)
value
obtained. Overall, Overall,
(ODc) obtained. most of most
the strains
of theexhibited low ODlow
strains exhibited slightly over theover
OD slightly threshold, and were
the threshold, andtherefore
were
therefore
classified asclassified as weak
weak biofilm biofilm Only
producers. producers. Onlyexhibited
one strain one strainanexhibited an OD
OD of 2.145, and ofwas
2.145, and wasas a
classified
classified
mild as abiofilm
to strong mild toproducer.
strong biofilm producer.

3.5.
3.5. StatisticalAnalysis
Statistical Analysis
Multipleanalyses
Multiple analyseswere
were carried
carried out for each
each Salmonella
Salmonellastrain
strainwith
withdata
dataabout
aboutthethe
presence
presenceor or
absence of virulence genes as well as for antibiotic resistance. In this regard, a Spearman
absence of virulence genes as well as for antibiotic resistance. In this regard, a Spearman correlation correlation
coefficient
coefficient greaterthan
greater thanororequal
equalto
to0.8
0.8or
or less
less than
than or
or equal
equalto
to−0.8
−0.8implies
impliesa strong association
a strong associationamong
among
the analyzed variables (Austin and Sutton, 2019). A positive association was found only
the analyzed variables (Austin and Sutton, 2019). A positive association was found only in antibiotic in antibiotic
resistance.InInthis
resistance. thisway,
way,the
thestrong
strong associations
associations found
found were:
were: trimethoprim
trimethoprimand andsulfamethoxazole
sulfamethoxazole + +
trimethoprim (0.9331); ampicillin and ceftriaxone (0.9259); ampicillin and chloramphenicol (0.8997);
trimethoprim (0.9331); ampicillin and ceftriaxone (0.9259); ampicillin and chloramphenicol (0.8997);
ampicillin and cefadroxil (0.8994); and ceftriaxone and chloramphenicol (0.8745). Results are shown
ampicillin and cefadroxil (0.8994); and ceftriaxone and chloramphenicol (0.8745). Results are shown in
in Figure 2. Correlations among the virulence genes and resistance profiles were weak, below 0.5 for
Figure 2. Correlations among the virulence genes and resistance profiles were weak, below 0.5 for all
all combinations of virulence genes and the analyzed resistance profiles. Thus, there was no
combinations of virulence genes and the analyzed resistance profiles. Thus, there was no association
association between the virulence genes and antibiotic resistance.
between the virulence genes and antibiotic resistance.

Figure 2. Spearman test correspondence map for phenotypic susceptibility antibiotic in strains of
Figure 2. Spearman test correspondence map for phenotypic susceptibility antibiotic in strains of S.
S. Infantis.
Infantis.
Animals 2020, 10, 1049 9 of 15

4. Discussion
Salmonellosis is one of the major zoonoses that impact human and animal health worldwide,
especially through global trade. In the current study, 24% of the analyzed chicken meat samples for
sale in supermarkets tested positive for Salmonella Infantis. Only three strains of S. Enteritidis were
isolated from the 361 samples of chicken meat, suggesting that the emergence of S. Infantis is replacing
S. Enteritidis in the chicken-producing chain in Chile. The emergence of the S. Infantis serotype has
been described in European countries and the United States [4,41–44]. In South America, it has also
been described in Ecuador [45] and Peru [46]. In Brazil, S. Infantis has been catalogued as the second
most prevalent serotype in broilers [47]. In Chile, no previous studies of S. Infantis in animals or in
food have been conducted, and this research is the first to characterize this serotype in chicken meat
for sale in supermarkets. The results suggest the presence and spread of S. Infantis along the food
chain. These data are important to substantiate a monitoring process of the emergence of this and
other serotypes of zoonotic Salmonella in food or food-producing animals over time.
In the Salmonella genus, changes in virulence gene acquisition could contribute to the increase
or decrease of their virulence in the future, with human health consequences [48]. Relatedly,
Brown et al. [49] characterized one S. Infantis strain with a multi-resistance plasmid in human
patients. This strain possesses clinically important resistance associated with higher hospitalization
rates. In Chile, few cases of human patients infected by S. Infantis have occurred [3]. However,
all the analyzed strains of S. Infantis amplified virulence genes that would permit the infection of
susceptible hosts, leading us to hypothesize that in the future, S. Infantis salmonellosis cases could
increase in Chile.
As mentioned by Karacan Sever and Akan [50], the strains in this study showed a high prevalence
of sipA, sipD, and sopD virulence genes, which facilitate the entry of Salmonella into the host cell through
the formation of “membrane ruffling” and actin structure disruption. Karacan Sever and Akan [50]
found 19 different patterns when amplifying 11 virulence genes from S. Infantis strains isolated from
chicken, turkey, and environmental samples. This difference in the number of virulotypes expressed
by S. Infantis (six versus 19) could be related to the diverse origin of the strains in both studies.
The detection of virulence gene combinations could be a predictor of the pathogenic potential of the
strain [50]. From this perspective, the bacteria analyzed in this study showed a high pathogenic potential.
When observing the Spearman correlations in the studied strains, with the aim of substantiating the
existence of an association between the presence of any of the virulence genes and the antibiotic
resistance profiles, none of the virulence genes exhibited an association with the profile of antibiotic
resistance. This could indicate that almost 100% of the strains from this study present a high number
of virulence genes, given that they are antibiotic resistant.
A virulence gene found in all strains was pagK, which participates in biofilm formation in the
Salmonella genus. In this regard, there are few studies about biofilm formation in S. Infantis strains
isolated from chicken and even fewer about S. Infantis isolated from chicken meat [4,51,52]. In the
current study, 99% of the strains were found to be weak biofilm-forming bacteria in vitro, similar to
other authors’ [4,52,53] observations of weak biofilm formation in S. Infantis strains isolated from
broiler chickens. Thus, S. Infantis persistence in chicken meat may not depend on a strain’s ability to
form strong biofilms. In this context, the acquisition of megaplasmid pESI may confer competitive
advantages in comparison to other Salmonella serotypes, promoting the formation of a strong biofilm [5].
Franco et al. [6] described the presence of plasmid pESI carrying the ESBL bla CTX-M resistance gene in
cefotaxime resistant S. Infantis strains isolated from chickens, chicken meat, and humans.
Salmonella resistance to β-lactams including cephalosporins due to the production of β-lactamases
is considered to be of critical importance by the WHO, since transfer of resistant strains to human
patients may occur through the food chain [20,54]. In Chile, the use of ceftiofur, a third-generation
cephalosporin, is permitted for use in poultry, which could explain the percentages observed for
cephalosporine resistance. The bla CTX-M 65 gene was amplified in 13 strains, indicating that these
strains are reservoirs of CTX-M ESBL genes.
Animals 2020, 10, 1049 10 of 15

The CTX-M β-lactamase lineage exhibits a striking plasticity, with many allelic variants belonging
to several sublineages. This characteristic can be associated with functional heterogeneity of clinical
relevance [55], indicating that further analysis of the strains that possess this gene should be carried
out. Nevertheless, the presence of this gene in S. Infantis is of great concern, since the gene could be
disseminated to other bacteria from the human intestinal microbiota. This is a worldwide problem since
cephalosporin-resistant isolates of S. Infantis in animals and humans have recently been described in
many countries [13]. All the strains in which the bla CTX-M gene was amplified were sent for sequencing,
which found bla CTX-M 65 to be the allelic variant. In 2014, the U.S. Food and Drug Administration
found bla CTX-M-65 ESBL-producing Salmonella Infantis in retail chicken meat [56]. Brown et al. [49]
examined 29 human isolates of S. Infantis that carried the bla CTX-M-65 gene. Of 19 patients with travel
information available, 12 (63%) reported recent travel to South America. Genetically, isolates from
travelers, nontravelers, and retail chicken meat were similar. This information suggests that it may be
possible for this gene to spread between countries.
Moreover, the 13 strains with the bla CTX-M 65 gene were MDR. One of these strains was also
positive for the qnrB gene, which confers fluoroquinolone resistance. Fluoroquinolone is used as a
second line treatment of invasive salmonellosis in humans and animals [57,58], and qnr genes have
been described in Chile, Peru, Bolivia, and Colombia [59–61], China [62], and the United States [63],
among others. Although in the current study only two strains of S. Infantis contained this gene, it is
important to actively monitor quinolone resistance mediated by these mobile elements, in order to
avoid their selection and spread. The low resistance levels to fluoroquinolones in this study could be
attributed to a decrease in their use in broilers over the last few years due to current Chilean legislation
that strongly discourages the use of fluoroquinolones as the first line treatment unless there is no
available therapeutic alternative [64].
One last option to treat MDR-Enterobacteria in humans is the use of colistin. Twenty-five of
our 87 strains were colistin resistant. Additionally, 10 colistin resistant strains also amplified the
bla CTX-M 65 gene. The coexistence of ESBL and colistin resistance, currently represents a threat for
public health, since both resistances could be codified in transferable plasmids [65]. None of the
colistin resistant strains in this study showed amplification of transferable genes containing colistin
resistance, suggesting that the determining factors for these strains could be chromosomal and
non-transferable. Nevertheless, surveillance of mcr-like genes in zoonotic pathogen populations is
necessary to understand their true impact on human health and to manage colistin use in order to
minimize selection, proliferation, and spread of drug-resistant bacteria.
It has been shown that Salmonella is widely drug resistant and commonly multidrug resistant [66],
especially with commonly used antibiotics such as tetracycline and trimethoprim. Tetracycline
resistance occurs most often by the acquisition of genes that encode efflux pumps such as tet genes [67].
Resistance to trimethoprim in Salmonella is conferred by mobile resistance dfr genes [68]. We could
not associate phenotypic resistance with resistance genes analyzed in all antibiotic resistant strains.
One reason for this could be the wide variety of genes that confer resistance to tetracycline and
trimethoprim, and we propose that further study is necessary.
Integrons are DNA elements that can transfer antibiotic resistance genes among bacteria, and one
of the aims of this study was to identify the prevalence of class 1 and 2 integrons in S. Infantis strains.
In our study, 7% of the strains tested positive for class 1 integrons, and 0% tested positive for class
2 integrons. This finding is in contrast to that of other authors, who have reported a higher prevalence
of integrons in S. Infantis strains. For example, Asgharpour et al. [11] reported a class 1 integron
prevalence of 36%, while Rahmani et al. [69] reported a class 1 integron prevalence of 100% in S. Infantis
(n = 27) isolated from broilers. Similar findings were reported by Shahada et al. [13] in 120 strains of
S. Infantis isolated from broiler chickens. Possibly, the strains used for the current study had other
elements that confer multi-resistance such as plasmids or transposons.
Regarding the associations between antibiotic resistance among the strains, our data indicated that
the resistance to certain antimicrobials was significantly associated. There were strong associations,
Animals 2020, 10, 1049 11 of 15

particularly for β-lactam antibiotics. However, there were also important associations between
antibiotics from different families such as sulfisoxazole and tetracycline or chloramphenicol and
cefadroxil (Figure 2). Overall, tetracycline resistance is one of the most prevalent ones in zoonotic
Salmonella due to its extended use in veterinary medicine [70], and this factor could influence
its association with sulfisoxazole. Chloramphenicol use is forbidden in food producing animals
in Chile, as well as in most other countries. Nevertheless, resistance to this antibiotic has been
observed in Enterobacteria isolated from broilers [71]. There could be several explanations for the
observed associations including the existence of linked genes within mobile elements such as plasmids,
and co-selection due to the use of one of these antimicrobials in animals. In addition to the use
of antibiotics in animal production, it is important to remember that environmental pollution with
antibiotic waste exists in water and soil, which has caused an environmental resistome that could
be transferred to zoonotic bacteria. This study highlights the possible emergence of MDR Salmonella
Infantis in chicken meat in Chile. The findings suggest that special efforts must be made for the effective
control of S. Infantis in food-processing environments.

5. Conclusions
In this study, a phenotypical and genotypical characterization of virulence factors and antibiotic
susceptibility in Salmonella Infantis strains isolated from chicken meat available in supermarkets was
carried out for the first time in Chile. Our study provides strong evidence of dissemination of virulent
and MDR S. Infantis in this chicken meat. The strains exhibited six virulotypes with several genes that
play a critical role in Salmonella infection pathogenesis. Moreover, these strains were also multi-resistant
to antibiotics considered of great importance for human and animal health. In the strains analyzed
in this study, resistance determiners associated with mobile elements such as the bla CTX-M 65 and
qnrB genes were amplified. Some strains were found to be resistant to colistin, but none of them
were positive for mrc genes. These findings suggest that it is important to monitor the emergence of
S. Infantis throughout the food chain process due to its importance for public health.

Author Contributions: Conceptualization, L.L. and L.S.; Formal analysis, J.C. and S.Z; Funding acquisition, L.L.
and L.S.; Investigation, N.G., F.S., M.B.B., and M.G.; Methodology, L.L. and L.S.; Writing—original draft, L.L.,
M.G., and N.G.; Writing—review & editing, L.L., J.C., S.Z., N.G., F.S., M.B.B., M.G., and L.S. All authors have read
and agreed to the published version of the manuscript.
Funding: This work was supported by the Fondo de Fomento al Desarrollo Científico y Tecnológico (FONDEF)
grant number ID18I10008.
Conflicts of Interest: The authors declare that the research was conducted in the absence of any commercial or
financial relationships that could be construed as potential conflicts of interest.

References
1. Majowicz, S.E.; Musto, J.; Scallan, E.; Angulo, F.J.; Kirk, M.; O’Brien, S.J.; Jones, T.F.; Fazil, A.; Hoekstra, R.M.
The Global Burden of Nontyphoidal Salmonella Gastroenteritis. Clin. Infect. Dis. 2010, 50, 882–889.
[CrossRef] [PubMed]
2. EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control).
The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic agents and Food-borne
Outbreaks in 2014. EFSA J. 2015, 13, 4329.
3. Instituto de Salud Pública de Chile. Boletín Vigilancia de Laboratorio: Salmonella spp. 2012–2016. Chile.
2017. Available online: http://www.ispch.cl/sites/default/files/BoletinSalmonella-23012017A.pdf (accessed on
15 March 2017).
4. Nógrády, N.; Kardos, G.; Bistyák, A.; Turcsányi, I.; Mészáros, J.; Galántai, Z.; Juhász, A.; Samu, P.;
Kaszanyitzky, J.E.; Pászti, J.; et al. Prevalence and characterization of Salmonella Infantis isolates originating
from different points of the broiler chicken-human food chain in Hungary. Int. J. Food Microbiol. 2008, 127,
162–167. [CrossRef] [PubMed]
Animals 2020, 10, 1049 12 of 15

5. Aviv, G.; Tsyba, K.; Steck, N.; Salmon-Divon, M.; Cornelius, A.; Rahav, G.; Grassl, G.A.; Gal-Mor, O. A unique
megaplasmid contributes to stress tolerance and pathogenicity of an emergent Salmonella enterica serovar
Infantis strain. Environ. Microbiol. 2014, 16, 977–994. [CrossRef] [PubMed]
6. Franco, A.; Leekitcharoenphon, P.; Feltrin, F.; Alba, P.; Cordaro, G.; Iurescia, M.; Tolli, R.; D’Incau, M.;
Staffolani, M.; Battisti, A.; et al. Emergence of a Clonal Lineage of Multidrug-Resistant ESBL-Producing
Salmonella Infantis Transmitted from Broilers and Broiler Meat to Humans in Italy between 2011 and 2014.
PLoS ONE 2015, 10, e0144802. [CrossRef] [PubMed]
7. Tate, H.; Folster, J.P.; Hsu, C.-H.; Chenb, J.; Hoffmann, M.; Li, C.; Morales, C.; Tyson, G.H.; Mukerjee, S.;
Zhaoa, S. Comparative Analysis of Extended Spectrum Beta- Lactamase CTX-M-65-Producing Salmonella
enterica Serovar Infantis Isolates from Humans, Food Animals, and Retail Chickens in the United States.
Antimicrob. Agents Chemother. 2017, 61, e00488-17. [CrossRef]
8. Nakatsuchi, A.; Inagaki, M.; Sugiyama, M.; Usui, M.; Asai, T. Association of Salmonella Serotypes with
Quinolone Resistance in Broilers. Food Saf. 2018, 6, 156–159. [CrossRef]
9. Rodrıíguez, I.; Barownick, W.; Helmuth, R.; Mendoza, C.; Rodicio, R.M.; Schroeter, A.; Guerra, B.
Extended-spectrum b-lactamases and AmpC b-lactamases in ceftiofur-resistant Salmonella enterica isolates
from food and livestock obtained in Germany during 2003–07. J. Antimicrob. Chemother. 2009, 64, 301–309.
[CrossRef]
10. Noda, T.; Murakami, K.; Etoh, Y.; Okamoto, F.; Yatsuyanagi, J.; Sera, N.; Furuta, M.; Onozuka, D.; Oda, T.;
Fujimoto, S.; et al. Increase in Resistance to Extended-Spectrum Cephalosporins in Salmonella Isolated from
Retail Chicken Products in Japan. PLoS ONE 2015, 10, e0116927. [CrossRef]
11. Asgharpour, F.; Rajabnia, R.; Shahandashti, E.F.; Marashi, M.A.; Khalilian, M.; Moulana, Z. Investigation of
Class I Integron in Salmonella infantis and Its Association With Drug Resistance. Jundishapur J. Microbiol.
2014, 7, e10019. [CrossRef]
12. Pessoa-Silva, C.L.; Toscano, C.M.; Moreira, B.M.; Santos, A.L.; Frota, A.C.; Solari, C.A.; Amorim, E.L.;
Carvalho Mda, G.; Teixeira, L.M.; Jarvis, W.R. Infection due to extended-spectrum beta-lactamase-producing
Salmonella enterica subsp. enterica serotype infantis in a neonatal unit. J. Pediatr. 2002, 141, 381–387.
[CrossRef] [PubMed]
13. Shahada, F.; Sugiyama, H.; Chuma, T.; Sueyoshi, M.; Okamoto, K. Genetic analysis of multi-drug resistance and
the clonal dissemination of beta-lactam resistance in Salmonella Infantis isolated from broilers. Vet. Microbiol.
2010, 6, 136–141.
14. Velhner, M.; Kozoderović, G.; Grego, E.; Galić, N.; Stojanov, I.; Jelesić, Z.; Kehrenberg, C. Clonal spread of
Salmonella enterica serovar Infantis in Serbia: Acquisition of mutations in the topoisomerase genes gyrA and
parC leads to increased resistance to fluoroquinolones. Zoonoses Public Health 2014, 61, 364–370. [CrossRef]
[PubMed]
15. Dohoo, I.R.; Martin, W.; Stryhn, H.E. Veterinary Epidemiologic Research; University of Prince Edward Island:
Charlottetown, PE, Canada, 2003.
16. ISO/TS 6579-2. Microbiology of Food and Animal Feed—Horizontal Method for the Detection, Enumeration and
Serotyping of Salmonella; ISO: Genève, Switzerland, 2012.
17. Anonymous. The new role of prekaging: Active, smart and intelligent. Ital. Food Bev. Technol. 2002, 27,
52–61.
18. Popoff, M.Y.; Le Minor, L. Antigenic Formulas of the Salmonella Serovars; 8th Revision; WHO Collaborating
Centre for Reference and Research on Salmonella, Institut Pasteur: Paris, France, 2001.
19. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing;
Twenty-fourth Informational Supplement. Document M100-S23; CLSI: Wayne, PA, USA, 2013.
20. World Health Organization (WHO). Critically Important Antimicrobials for Human Medicine. 2018.
Available online: https://apps.who.int/iris/bitstream/handle/10665/312266/9789241515528-eng.pdf (accessed
on 2 March 2019).
21. Parry, C.M.; Thieu, N.T.; Dolecek, C.; Karkey, A.; Gupta, R.; Turner, P.; Dance, D.; Maude, R.R.; Ha, V.;
Tran, C.N.; et al. Clinically and microbiologically derived azithromycin susceptibility breakpoints for
Salmonella enterica serovars Typhi and Paratyphi A. Antimicrob. Agents Chemother. 2015, 59, 2756–2764.
[CrossRef]
Animals 2020, 10, 1049 13 of 15

22. Martínez, I.; Gutierrez, L.; Tapia, G.; Ocampo, L.; Sumano, H. Serum and milk concentrations of enrofloxacin
in cows intramammarily treated with a new enrofloxacin-polymorph. Med. Weter 2016, 72, 686–692.
[CrossRef]
23. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing;
Twenty-fourth Informational Supplement. Document M100-S24; CLSI: Wayne, PA, USA, 2014.
24. Eucast European Committee on Antimicrobial Susceptibility Testing. Recommendations for MIC
determination of colistin (polymyxin E) as recommended by the joint CLSI-EUCAST Polymyxin Breakpoints
Working Group. 2016. Available online: http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/
General_documents/Recommendations_for_MIC_determination_of_colistin_March_2016.pdf (accessed on
2 March 2019).
25. European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and
Zone Diameters; Version 1.0; EUCAST: Basel, Switzerland, 2016.
26. Colom, K.; Perez, J.; Alonso, R.; Aranguiz, A.F.; Larino, E.; Cisterna, R. Simple and reliable multiplex PCR
assay for detection of blaTEM, blaSHV and blaOXA_1 genes in Enterobacteriaceae. FEMS Microbial. Lett.
2003, 223, 147–151. [CrossRef]
27. Pfeifer, Y.; Wilharm, G.; Zander, E.; Wichelhaus, T.A.; Gottig, S.; Hunfeld, K.; Seifert, H.; Witte, W.; Higgins, P.G.
Molecular characterization of blaNDM-1 in an Acinetobacter baumannii strain isolated in Germany in 2007.
J. Antimicrob. Chemother. 2011, 66, 1998–2001. [CrossRef]
28. Mulvey, M.R.; Soule, G.; Boyd, D.; Demczuk, W.; Ahmed, R. Characterization of the first extended-spectrum
-lactamase-producing Salmonella isolate identified in Canada. J. Clin. Microbiol. 2003, 41, 460–462. [CrossRef]
29. Robicsek, A.; Strahilevitz, J.; Jacoby, G.A.; Macielay, M.; Abbanat, D.; Park, C.H.; Bush, K.; Hooper, D.C.
Fluoroquinolonemodifying enzyme: A new adaptation of a common aminoglycoside acetyltransferase.
Nat. Med. 2006, 12, 83–88. [CrossRef]
30. Ng, L.K.; Martin, I.; Alfa, M.; Mulveyet, M. Multiplex PCR for the detection of tetracycline resistant genes.
Mol. Cell. Probes 2001, 15, 209–215. [CrossRef] [PubMed]
31. Torkan, S.; Bahadoranianb, M.A.; Khamesipourc, F.; Anyanwud, M.U. Detection of virulence and antibacterial
resistance genes in Salmonella isolates from diarrhoeic dogs in Iran. Revue. Méd. Vét. 2015, 166, 221–228.
32. Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerr, B.;
Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for detection of plasmid-mediated colistin
resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance
2018, 23, 17-00672. [CrossRef] [PubMed]
33. Mazel, D.; Dychinco, B.; Webb, V.A.; Davies, J. Antibiotic resistance in the ECOR collection: Integrons and
identification of a novel aad gene. Antimicrob. Agents Chemother. 2000, 44, 1568–1574. [CrossRef]
34. Malorny, B.; Hoorfar, J.; Bunge, C.; Helmuth, R. Multicenter validation of the analytical accuracy of Salmonella
PCR: Towards an international standard. Appl. Environ. Microbiol. 2003, 69, 290–296. [CrossRef]
35. Huehn, S.; La Ragione, R.M.; Anjum, M.; Saunders, M.; Woodward, M.J.; Bunge, C.; Helmuth, R.; Hause, E.;
Malorny, B. Virulotyping and Antimicrobial Resistance Typing of Salmonella enterica Serovars Relevant to
Human Health in Europe. Foodborne Pathog. Dis. 2010, 7, 523–535. [CrossRef]
36. Pan, Z.; Carter, B.; Núñez-García, J.; Abuoun, M.; Fookes, M.; Ivens, A.; Woodward, M.J.; Anjum, M.F.
Identification of genetic and phenotypic differences associated with prevalent and non-prevalent Salmonella
Enteritidis phage types: Analysis of variation in amino acid transport. Microbiology 2009, 155, 3200–3213.
[CrossRef]
37. Shah, D.H.; Zhou, X.; Addwebi, T.; Davis, M.A.; Orfe, L.; Call, D.R.; Besser, T.E. Cell invasion of
poultry-associated Salmonella enterica serovar Enteritidis isolates is associated with pathogenicity, motility
and proteins secreted by the type III secretion system. Microbiology 2011, 157, 1428–1445. [CrossRef]
38. Raffatellu, M.; Wilson, R.P.; Chessa, D.; Andrews-Polymenis, H.; Tran, Q.T.; Lawhon, S.; Khare, S.; Adams, L.G.;
Baumler, A.J. SipA, SopA, SopB, SopD, and SopE2 contribute to Salmonella enterica serotype Typhimurium
invasion of epithelial cells. Infect. Immun. 2005, 73, 146–154. [CrossRef]
39. Pascoe, B.; Méric, G.; Murray, S.; Yahara, K.; Mageiros, L.; Bowen, R.; Jones, N.H.; Jeeves, R.E.;
Lappin-Scott, H.M.; Sheppard, S.K.; et al. Enhanced biofilm formation and multi-host transmission
evolve from divergent genetic backgrounds in Campylobacter jejuni. Environ. Microbiol. 2015, 17, 4779–4789.
[CrossRef]
Animals 2020, 10, 1049 14 of 15

40. Di Rienzo, J.A.; Casanoves, F.; Balzarini, M.; Gonzalez, L.A.; Tablada, M.; Robledo, C.W. “InfoStat versión
2011.” Grupo InfoStat, FCA, Universidad Nacional de Córdoba, Argentina. Available online: http://www.
infostat.com.ar (accessed on 2 March 2019).
41. Wajid, M.; Saleemi, M.K.; Sarwar, Y.; Ali, A. Detection and characterization of multidrug-resistant Salmonella
enterica serovar Infantis as an emerging threat in poultry farms of Faisalabad, Pakistan. J. Appl. Microbiol.
2019, 147, 248–261. [CrossRef] [PubMed]
42. Erickson, A.K.; Murray, D.L.; Ruesch, L.A.; Thomas, M.; Lau, Z.; Scaria, J. Genotypic and Phenotypic
Characterization of Salmonella Isolated from Fresh Ground Meats Obtained from Retail Grocery Stores in
the Brookings, South Dakota, Area. J. Food Prot. 2018, 81, 1526–1534. [CrossRef] [PubMed]
43. Mancin, M.; Barco, L.; Losasso, C.; Belluco, S.; Cibin, V.; Mazzucato, M.; Bilei, S.; Carullo, M.R.; Decastelli, L.;
Ricci, A.; et al. Salmonella serovar distribution from non-human sources in Italy; results from the IT-Enter-Vet
network. Vet. Rec. 2018, 183, 69. [CrossRef] [PubMed]
44. Hindermann, D.; Gopinath, G.; Chase, H.; Negrete, F.; Althaus, D.; Zurfluh, K.; Tall, B.D.; Stephan, R.;
Nüesch-Inderbinen, M. Salmonella enterica serovar Infantis from Food and Human Infections, Switzerland,
2010–2015: Poultry-Related Multidrug Resistant Clones and an Emerging ESBL Producing Clonal Lineage.
Front. Microbiol. 2017, 8, 1322. [CrossRef] [PubMed]
45. Vinueza-Burgos, C.; Baquero, M.; Medina, J.; De Zutter, L. Occurrence, genotypes and antimicrobial
susceptibility of Salmonella collected from the broiler production chain within an integrated poultry
company. Int. J. Food Microbiol. 2019, 299, 1–7. [CrossRef] [PubMed]
46. SENASA. Estudio de Prevalencia de Serotipos de Salmonella en Granjas Avícolas Tecnificadas en el Perú; SENASA:
Lima, Peru, 2015.
47. Medeiros, M.A.N.; de Oliveira, D.C.N.; Rodrigues, D.D.P.; de Freitas, D.R.C. Prevalence and antimicrobial
resistance of Salmonella in chicken carcasses at retail in 15 Brazilian cities. Rev. Panam. Salud Publica 2011, 30,
555–560. [CrossRef] [PubMed]
48. van Asten, A.J.A.M.; van Dijk, J.E. Distribution of “classic” virulence factors among Salmonella spp.
FEMS Immunol. Med. Microbiol. 2005, 44, 251–259. [CrossRef]
49. Brown, A.C.; Chen, J.C.; Francois Watkins, L.K.; Campbell, D.; Folster, J.P.; Tate, H.; Wasilenko, J.; Van
Tubbergen, C.; Friedman, C.R. CTX-M-65 extended-Spectrum β-actamase–producing Salmonella enterica
Serotype Infantis, United States. Emerg. Infect. Dis. 2018, 24, 2284–2291. [CrossRef]
50. Karacan Sever, N.; Akan, M. Molecular analysis of virulence genes of Salmonella Infantis isolated from
chickens and turkeys. Microb. Pathog. 2019, 126, 199–204. [CrossRef]
51. Marin, C.; Hernandiz, A.; Lainez, M. Biofilm development capacity of Salmonella strains isolated in poultry
risk factors and their resistance against disinfectants. Poult. Sci. 2009, 88, 424–431. [CrossRef]
52. Díez-García, M.; Capita, R.; Alonso-Calleja, C. Influence of serotype on the growth kinetics and the ability to
form biofilms of Salmonella isolates from poultry. Food Microbiol. 2012, 31, 173–180. [CrossRef] [PubMed]
53. Schonewille, E.; Nesse, L.L.; Hauck, R.; Windhorst, D.; Hafez, H.M.; Vestby, L.K. Biofilm building capacity of
Salmonella enterica strains from the poultry farm environment. FEMS Immunol. Med. Microbiol. 2012, 65,
360–365. [CrossRef] [PubMed]
54. World Health Organization (WHO). 19th WHO ModelList of Essential Medicines; World Health Organization
Essentialmedicines and Health Products: Geneva, Switzerland, 2015.
55. D’Andrea, M.M.; Arena, F.; Pallecchi, L.; Rossolini, G.M. CTX-M-type β-lactamases: A successful story of
antibiotic resistance. Int. J. Med. Microbiol. 2013, 303, 305–317. [CrossRef] [PubMed]
56. Centers for Disease Control and Prevention (CDC). National Antimicrobial Resistance Monitoring System for
Enteric Bacteria (NARMS): Human Isolates Surveillance Report for 2015 (Final Report); The Centers: Atlanta, GA,
USA, 2016; pp. 22–25.
57. Dimitrov, T.; Udo, E.E.; Albaksami, O.; Kilani, A.A.; Shehab, E.M.R. Ciprofloxacin treatment failure in a
case of typhoid fever caused by Salmonella enterica serotype Paratyphi A with reduced susceptibility to
ciprofloxacin. J. Med. Microbiol. 2007, 56, 277–279. [CrossRef]
58. World Organization for Animal Health (OIE). OIE List of Antimicrobial Agents of Veterinary Importance.
2019. Available online: https://www.oie.int/fileadmin/Home/esp/Our_scientific_expertise/docs/pdf/AMR/E_
OIE_Lista_antimicrobianos_Julio2019.pdf (accessed on 2 March 2020).
Animals 2020, 10, 1049 15 of 15

59. Tran, T.; Andres, P.; Petroni, A.; Soler-Bistué, A.; Albornoz, E.; Zorreguieta, A.; Reyes-Lamothe, R.;
Sherratt, D.J.; Corso, A.; Tolmaskya, M.E.; et al. Small plasmids harboring qnrB19: A model for plasmid
evolution mediated by site-specific recombination at oriT and Xer sites. Antimicrob. Agents Chemother. 2012,
56, 1821–1827. [CrossRef]
60. Moreno-Switt, A.I.; Pezoa, D.; Sepúlveda, V.; González, I.; Rivera, D.; Retamal, P.; Navarrete, P.; Reyes-Jara, A.;
Toro, M. Transduction as a potential dissemination mechanism of a clonal qnrB19-carrying plasmid isolated
from Salmonella of multiple serotypes and isolation Sources. Front. Microbiol. 2019, 10, 2503. [CrossRef]
61. Pallecchi, L.; Riccobono, E.; Sennati, S.; Mantella, A.; Bartalesi, F.; Trigoso, C.; Gotuzzo, F.; Bartolon, A.;
Rossolini, G.M. Characterization of small ColE-like plasmids mediating widespread dissemination of the
qnrB19 gene in commensal enterobacteria. Antimicrob. Agents Chemother. 2010, 54, 678–682. [CrossRef]
62. Yue, L.; Jiang, H.X.; Liao, X.P.; Liu, J.H.; Li, S.J.; Chen, X.Y.; Chen, C.X.; Lü, D.H.; Liu, Y.H. Prevalence of
plasmid-mediated quinolone resistance qnr genes in poultry and swine clinical isolates of Escherichia coli.
Vet. Microbiol. 2018, 132, 414–420. [CrossRef]
63. Tyson, G.H.; McDermott, P.F.; Li, C.; Chen, Y.; Tadesse, D.A.; Mukherjee, S.; Bodeis-Jones, S.; Kabera, C.;
Gaines, S.A.; Zhao, S.; et al. WGS accurately predicts antimicrobial resistance in Escherichia coli.
J. Antimicrob. Chemother. 2015, 70, 2763–2769. [CrossRef]
64. SAG, Servicio Agrícola y Ganadero de Chile. Resolución Exenta Nº:4579/2018. 2018. Available online:
https://www.sag.gob.cl/sites/default/files/resol_4.579-2018.pdf (accessed on 2 March 2019).
65. Liu, G.; Ali, T.; Gao, J.; Ur Rahman, S.; Yu, D.; Barkema, H.W.; Huo, W.; Xu, S.; Shi, Y.; Han, B.; et al.
Co-occurrence of Plasmid-Mediated Colistin Resistance (mcr-1) and Extended-Spectrum β-Lactamase
Encoding Genes in Escherichia coli from Bovine Mastitic Milk in China. Microb. Drug Resist. 2019, 22.
[Epub ahead of print]. [CrossRef]
66. Li, Q.; Yin, J.; Li, Z.; Li, Z.; Du, Y.; Guo, W.; Bellefleur, M.; Wang, S.; Shi, H. Serotype distribution,
antimicrobial susceptibility, antimicrobial resistance genes and virulence genes of Salmonella isolated from a
pig slaughterhouse in Yangzhou, China. AMB Express 2019, 9, 210. [CrossRef] [PubMed]
67. Nguyen, F.; Starosta, A.L.; Arenz, S.; Sohmen, D.; Dönhöfer, A.; Wilson, D.N. Tetracycline antibiotics and
resistance mechanisms. Biol. Chem. 2014, 395, 559–575. [CrossRef] [PubMed]
68. Michael, G.B.; Butaye, P.; Cloeckaert, A.; Schwarz, S. Genes and mutations conferring antimicrobial resistance
in Salmonella: An update. Microbes Infect. 2006, 8, 1898–1914. [CrossRef] [PubMed]
69. Rahmani, M.; Peighambari, S.M.; Svendsen, C.A.; Cavaco, L.M.; Agersø, Y.; Hendriksen, R.S. Molecular
clonality and antimicrobial resistance in Salmonella enterica serovars Enteritidis and Infantis from broilers in
three Northern regions of Iran. BMC Vet. Res. 2013, 9, 66. [CrossRef]
70. Jajere, S.M. A review of Salmonella enterica with particular focus on the pathogenicity and virulence factors,
host specificity and antimicrobial resistance including multidrug resistance. Vet. World 2019, 12, 504–521.
[CrossRef]
71. Mainali, C.; McFall, M.; King, R.; Irwin, R. Evaluation of antimicrobial resistance profiles of Escherichia coli
isolates of broiler chickens at slaughter in Alberta, Canada. J. Food Prot. 2013, 76, 2045–2051. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).