International Journal of Food Microbiology 259 (2017) 43–51

Contents lists available at ScienceDirect

International Journal of Food Microbiology

journal homepage: www.elsevier.com/locate/ijfoodmicro

Antimicrobial resistance and resistance genes in Salmonella strains isolated MARK

from broiler chickens along the slaughtering process in China
Yuanting Zhua,1, Haimei Laia,1, Likou Zoub,1, Sheng Yinc, Chengtao Wangc, Xinfeng Hand,
Xiaolong Xiaa, Kaidi Hua, Li Hea, Kang Zhoua,e, Shujuan Chena, Xiaolin Aoa,e, Shuliang Liua,e,⁎
a
College of Food Science, Sichuan Agricultural University, Ya'an, Sichuan 625014, PR China
b
College of Resources, Sichuan Agricultural University, Chengdu, Sichuan 611130, PR China
c
Beijing Laboratory for Food Quality and Safety, Beijing Technology and Business University, Beijing 100048, PR China
d
College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan 611130, PR China
e
Institute of Food Processing and Safety, Sichuan Agricultural University, Ya'an, Sichuan 625014, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of
Salmonella broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the
Antimicrobial resistance slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to
Resistance gene antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby–Bauer disk diffusion
Broiler chicken
method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the
Slaughter
Multidrug resistant (MDR)
presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC
genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken
carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were
S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were ob-
served: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/
sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of
isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering
line. 94.6% (n = 157) of beta-lactam-resistant isolates harbored at least one resistance gene of blaTEM or blaCTX-
M. The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was
found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet
(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) an-
tibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1
integron was detected in 37.4% (n = 43) of the MDR isolates. Two different gene cassettes, blaOXA-30-aadA1 (19
isolates) and blaOXA-30-aadA1/drfA1-orfC (2 isolates), were identified in class 1 integron-positive isolates. 97.9%
(184/188) of quinolone-resistant isolates had at least one mutation within gyrA or parC. Overall, antimicrobial
resistance showed an increasing trend along the slaughtering process. The results showed that broiler chicken
products in the slaughterhouse were contaminated with MDR Salmonella, which might originate from food
producing animals to some extent, and cross-contamination during slaughter, and facilitate the dissemination of
the resistance genes to consumers along the production chain, which suggests importance of controlling
Salmonella during slaughter for public health, underlying strict hygiene method and HACCP management to
reduce cross-contamination.

1. Introduction syndromes in humans including typhoid fever, diarrhoeal disease, and

may have a dramatically more severe systemic disease in the im-
Salmonella is one of the most common foodborne pathogens, causing munocompromised people (Gordon, 2008). Animal food products
outbreaks of foodborne disease worldwide (Newell et al., 2010). especially eggs and poultry meats, have been the most common vehicles
Foodborne Salmonella infection typically causes a range of clinical of the Salmonella infections (Greig and Ravel, 2009). With the

⁎
Corresponding author at: Shuliang Liu, College of Food Science, Sichuan Agricultural University, Ya'an 625014, PR China.
E-mail address: [email protected] (S. Liu).
1
These authors contributed equally to this article.

http://dx.doi.org/10.1016/j.ijfoodmicro.2017.07.023
Received 30 October 2016; Received in revised form 15 June 2017; Accepted 31 July 2017
Available online 01 August 2017
0168-1605/ © 2017 Elsevier B.V. All rights reserved.
Y. Zhu et al. International Journal of Food Microbiology 259 (2017) 43–51

increasing consumption of poultry meat globally, bacterial pathogen Salmonella isolates were collected at the four processing points in a
Salmonella, as an important factor for affecting the safety of poultry and broiler slaughter and processing chain during a three-year period of
raw meat, will continue to receive growing attention (Henchion et al., 2012–2014, in Sichuan province of China. We investigated the pre-
2014; Sofos, 2008). valence, serotypes, antimicrobial resistance of Salmonella isolates to ten
Recently, there has been an increasing trend of antimicrobial re- categories of common antimicrobial agents, the presence of several
sistance on a worldwide scale, especially for multidrug-resistant (MDR) kinds of antimicrobial resistance genes associated with β-lactams,
Salmonella strains from food animals (Hur et al., 2012). In China, the aminoglycosides, tetracycline, florfenicol, and sulfonamide, and class 1
usage of antimicrobial agents is greater than in most other countries; in integron, gyrA and parC mutations of quinolone-resistant isolates. On
a 2007 survey, nearly half of the 210, 000 tons of antibiotics produced the basis of these results, we analyzed the correlation between the
in China, were used in livestock as therapeutic drugs and feed additives antibiotics-resistant phenotypes, serotypes, and resistance genes of
(Hvistendahl, 2012). Abuse of antimicrobial agents in food animal Salmonella isolated from different stages of the poultry meat production
production is regarded as one of the important reasons for emergence of chain, and identified possible routes of Salmonella transmission.
antimicrobial resistance in Salmonella; this resistance can be trans-
mitted to the human population through the animal foodstuffs, which 2. Material and methods
poses a serious threat to public health. Multidrug-resistant phenotypes
in Salmonella of animal origin have been increasingly observed in China 2.1. Sample collection
(Lai et al., 2014; Yang et al., 2013).
Various factors from farm to fork along the food chain heavily in- From March 2012 to October 2014, a total of 627 samples were
fluence the microbiological safety of food (Newell et al., 2010). Suc- collected from four processing points (cecal content of broiler chicken,
cessful prevention of foodborne salmonellosis originating from animal n = 196; chicken carcasses, n = 181; chicken meat after cutting step,
production comprise three lines of defence against Salmonella: a) con- n = 150; frozen chicken meat products, n = 100) during slaughter and
trolling Salmonella in the food-producing animal at farms (pre-harvest processing at a local broiler chicken slaughtering plant in Sichuan
control); b) improving hygiene during the slaughter and further pro- province of China where about 30,000,000 broiler chickens are pro-
cessing of the meat (harvest control); c) the final food preparation by cessed each year. All these samples were stored on ice during trans-
underlying good hygiene practices (post-harvest control) (Forshell and portation to our laboratory, and analyzed within 3 h.
Wierup, 2006). Therefore, slaughter is the most appropriate stage of The main slaughter process in this slaughterhouse and four sam-
food chain for the evaluation on the carriage of zoonotic agents by farm pling points were given in Fig. S1 in Supplementary materials. Fresh
animals, the level of Salmonella infection in animal carcasses and sub- broiler chicken cecal contents (point 1), representing samples of broiler
sequently meat products in the finishing poultry population, and the at the farm level, were obtained after evisceration, and collected in
proportions of self- and cross-contamination during slaughter and sterile plastic stomacher bags in accordance with previously described
processing (Bonardi et al., 2013). method (Allen et al., 2007). Chicken carcasses (point 2) were sampled
Most studies about the prevalence and antimicrobial resistance of after evisceration and before chilling by using a whole-carcass swab
Salmonella in either animals (Ahmed and Shimamoto, 2012; Lai et al., method (McEvoy et al., 2005). Each swab was placed inside a sterile
2014; Mainali et al., 2014; Pan et al., 2010) at chicken farms or in retail stomacher bag and pre-moistened immediately before use with 25 mL
poultry meats of marketplace (Chen et al., 2004; Kim et al., 2012; Yan of buffered peptone water (BPW). The swabs after sampling were re-
et al., 2010; Yang et al., 2013; Yang et al., 2010; Yang et al., 2011), or turned to its original bag, and transported on ice to lab. For sampling
in partial processing stages in the slaughtering line (Akbarmehr, 2012; points 3 (chicken meat after cutting step) and 4 (frozen chicken meat
Bai et al., 2015; Olsen et al., 2003; Rivera-Pérez et al., 2014; Ziech products), 25 g of each sample was incised, and collected in a sterile
et al., 2016) have been separately performed. Additionally, several plastic stomacher bag according to the methods described in the ISO
surveys have been carried out at the molecular level to monitor the 17604:2003 standard (International Organization for Standardization,
distribution of resistance genes in Salmonella from broiler chickens and Geneva, Switzerland). For sampling point 4, chicken meat products in
chicken meat (Asai et al., 2006; Gong et al., 2014; Li et al., 2013). To this slaughterhouse were packaged after quick-freezing, and then the
date, some research on prevalence of Salmonella from animals to packaged quicken-frozen chicken meat products were directly collected
chicken meat products along the slaughtering process (Choi et al., 2014; without being stored by using our sampling method.
Cui et al., 2016; Li et al., 2013; Van der Fels-Klerx et al., 2008), and the
potential role of the food production chain in the dissemination of 2.2. Salmonella isolation and serotyping
antimicrobial resistance and resistance genes of Salmonella (Cui et al.,
2016; Li et al., 2013) have been presented. However, the present studies All of the samples were subjected to Salmonella isolation in ac-
have reported β-lactamase genes and class 1 integron of Salmonella cordance with national food safety standard of China-Food micro-
isolates from the broiler chicken supply chain in China, while other biological inspection: Salmonella (GB 4789. 4-2010), with some mod-
kinds of resistance genes in Salmonella along the slaughtering process ifications for samples obtained at point 2. For samples obtained at point
were still almost not reported. In addition, the poultry sector in China 2, they were stomached, incubated at 37 °C for 18 h (bacteria pre-en-
has experienced vigorous growth over the past two decades. Chicken richment), and then subjected to centrifugation (12,000 rpm, 4 °C,
production is the predominant subsector, accounting for 70% of poultry 10 min). Finally, the BPW supernatant was removed and discarded, and
meat production. The poultry sector is no longer dominated by hun- about 4 mL of the pre-enrichment culture containing bacterial pre-
dreds of millions of smallholders. Instead, the number of large produ- cipitate was obtained. Then, aliquots of 1.0 mL were transferred into
cers in poultry and broiler chickens production increased substantially 10 mL of tetrathionate broth (TTB) and selenite cysteine (SC) broth,
(Bingsheng and Yijun, 2007). Therefore, taking into account the im- respectively. The subsequent procedure was carried out in accordance
portant role of large-scale slaughterhouse and poultry farm, and the with GB 4789.4-2010.
high consumption of chicken meat in China, more comprehensive in- Suspected Salmonella colonies from each sample were further
vestigations at the molecular level to monitor the distribution and identified on the basis of biochemical characterization and specific
dissemination of antimicrobial resistance during slaughter were genes of Salmonella using duplex PCR assays (Cohen et al., 1993; Rahn
needed. et al., 1992). A single confirmed Salmonella isolate from each positive
Therefore, in this study, four processing points along the slaugh- sample was serotyped by slide agglutination test for O and H antigens
tering process were selected to monitor the prevalence, antimicrobial using commercially available antiserum (Tianrun Bio-Pharmaceutical,
resistance, and resistance gene dissemination of Salmonella. In detail, Ningbo, China) following manufacturer's instructions.

44
Y. Zhu et al. International Journal of Food Microbiology 259 (2017) 43–51

2.3. Antimicrobial susceptibility testing amplification. The primer sequences and predicted sizes for PCR am-
plification of different resistance genes from Salmonella are listed in
Antimicrobial susceptibility testing of the Salmonella isolates to 10 Table 1. PCR amplification was performed using a DNA thermal cycler
categories of antimicrobials was carried out in accordance with the (Bio-Rad, CA, USA) as (1) 95 °C for 10 min; (2) 35 cycles of 94 °C for
standard Kirby–Bauer disk diffusion method recommended by the 45 s, 55–70 °C for 50 s, 72 °C for 50 s; (3) 72 °C for 10 min. The PCR
Clinical and Laboratory Standards Institute (CLSI, 2010) (Cockerill, products were analyzed through 1.5% (w/v) agarose gel electrophoresis
2011). All the antimicrobial disks were obtained from Oxoid (Thermo and sequenced by Takara biotechnology Co., Ltd. (Dalian, China). Re-
Fisher Scientific, Basingstoke, England). Escherichia coli ATCC 25922 sulting DNA sequence data were compared with data in the GenBank
was used as the control organism. The concentrations of the anti- database using the BLAST tool available at the National Center for
microbials and abbreviation of these antimicrobial agents are: ampi- Biotechnology Information website (http://www.ncbi.nlm.nih.gov).
cillin (AMP, 10 μg), amoxicillin/clavulanic acid (AMC, 20/10 μg), cef-
triaxone (CRO, 30 μg), gentamycin (GEN, 10 μg), spectinomycin (SPE,
100 μg), tetracycline (TET, 30 μg), florfenicol (FLO, 75 μg), trimetho- 2.5. Detection and characterization of class 1 integron
prim/sulfamethoxazole (SXT, 1.25/23.75 μg), nalidixic acid (NAL,
30 μg), and ciprofloxacin (CIP, 5 μg). The isolates were classified as Multidrug-resistant isolates (n = 117) were examined for the pre-
susceptible, intermediate, or resistant according to the CLSI (2010) sence of the class 1 integron using specific primers for intI 1 gene (en-
guidelines. Salmonella isolates resistant to three or more antimicrobials coding the specific integrase) by PCR. The variable region of class 1
were defined as MDR isolates (Li et al., 2013; Pokharel et al., 2006). integron in all intI 1-postive isolates was also characterized by PCR and
sequencing. The size of inserted resistance gene cassettes of the in-
tegrase-positive isolates was detected by PCR using primers for the
2.4. PCR amplification of antimicrobial resistance genes conserved segment regions (CS-PCR) (Table 1). The PCR system (25 μL)
contained 2 μL of template DNA, 0.5 μL of each primer (10 μmol/L),
Template DNA of Salmonella isolates for PCR was prepared by the 12.5 μL of 2 × PCR Mix, 5.5 μL of deionized water. PCR amplification
heat lysis method (Pitout et al., 1998), except that bacteria were di- was performed using a DNA thermal cycler (Bio-Rad, CA, USA) as (1)
rectly inoculated into 3.0 mL of nutrient broth in Eppendorf tubes for 95 °C for 5 min; (2) 35 cycles of 95 °C for 45 s, 70 °C for 50 s (intI 1) (intI
overnight culture. Finally, the template for amplification was obtained, 1 variable region, 55 °C for 50 s), 72 °C for 50 s; (3) 72 °C for 10 min.
and stored at − 20 °C for use. The PCR products were analyzed through 1.5% (w/v) agarose gel
Salmonella isolates, which showed resistance to each category of electrophoresis and sent for sequencing by Takara biotechnology Co.,
antimicrobial agent, were examined for the presence of resistance Ltd. (Dalian, China). The DNA sequence data were compared with data
genes. The presence of genes associated with beta-lactams (blaTEM, in the GenBank database using the BLAST tool available at the National
blaSHV, and blaCTX-M), aminoglycosides (aac(3)-II, aac(3)-IV, and ant Center for Biotechnology Information website (http://www.ncbi.nlm.
(2″)-I), tetracycline (tet(A), tet(B), tet(C), and tet(G)), florfenicol (floR), nih.gov).
and sulfonamide (sul1, sul2, and sul3) was detected by PCR

Table 1
Primers used for detection of genes encoding resistance to different antimicrobials.

Antimicrobial(s) Target gene Nucleotide sequences Size (bp) Reference

β-Lactams blaTEM F: GAGTACTCACCA TCACAGAA AAGC 489 (Lu et al., 2010)

R: GACTTCCCGTCGTGTAGATAAC
blaSHV F: TTA TCT CCC TGT TAG CCA CC 797 (Poirel et al., 1999)
R: GATTTGCTGATTTCGCGCCG
blaCTX-M F: TTTGCGATGTGCAGTACCAGTAA 544 (Edelstein et al., 2003)
R: CGATATCGTTGGTGGTGCCATA
Aminoglycosides aac(3)-II F: TGAAACGCTGACGGAGCCTC 369 (Jensen et al., 2006)
R: GTCGAACAGGTAGCACTGAG
aac(3)-IV F: GTGTGCTGCTGGTCCACAGC 627 (Jensen et al., 2006)
R: AGTTGACCCAGGGCTGTCGC
ant(2″)-I F: GGGCGCGTCATGGAGGAGTT 328 (Jensen et al., 2006)
R: TATCGCGACCTGAAAGCGGC
Tetracycline Tet(A) F: GTAATTCTGAGCACTGTCGC 956 (Aarestrup et al., 2003)
R: GAGACGCAATCGAATTCGG
Tet(B) F: GAGACGCAATCGAATTCGG 228 (Jiang and Shi, 2013)
R: TTTAGTGGCTATTCTTCCTGCC
Tet(C) F: CTTGAGAGCCTTCAACCCAG 418 (Fan et al., 2007)
R: ATGGTCGTCATCTACCTGCC
tet(G) F: GCTCGGTGGTATCTCTGCTC 468 (Fan et al., 2007)
R: AGCAACAGAATCGGGAACAC
Florfenicol floR F: AACCCGCCCTCTGGATCAAGTCAA 549 (Ghoddusi et al., 2015)
R: CAAATCACGGGCCACGCTGTATC
Sulfonamide sul1 F: CTTCGATGAGAGCCGGCGGC 437 (Aarestrup et al., 2003)
R: GCAAGGCGGAAACCCGCGCC
sul2 F: GCGCTCAAGGCAGATGGCATT 285 (Aarestrup et al., 2003)
R: GCGTTTGATACCGGCACCCGT
sul3 F: AGATGTGATTGATTTGGGAGC 443 (Zhang et al., 2009)
R: TAGTTGTTTCTGGATTAGAGCCT
intI 1 F: TCTCGGGTA ACATCA AGG 242 (Vo et al., 2006)
R: AGGAGATCCGAAGACCTC
a
Conserved segment CS-F: GGCATCCAAGCATCCTCG
a
Conserved segment CS-R: GGCATCCAAGCAGCAAG

a
Size depends on the gene cassette(s) inserted.

45
Y. Zhu et al. International Journal of Food Microbiology 259 (2017) 43–51

Table 2 Table 3
Primer sequences of gyrA and parC genes by MAMA PCR (Qiang et al., 2002). Occurrence and serotypes of Salmonella isolates from four points in the slaughter chain.

Primers DNA sequence (5′ → 3′) Size (bp) Amino acid Sources % (No.) of isolates
positions
Total S. enterica Ser. S. enterica Ser. Untypable
WPgyrA GACCTTGCGAGAGAAATTACAC 540 7–28 Enteritidis Typhimurium
ControlgyrA GATGTTGGTTGCCATACCTACG 540 546–525
MAMAgyrA83 TCGTGTCATAGACCGGGC 259 Ser-83 Point 1 47.96% 40.31% 0b 7.65%
MAMAgyrA87 GCGCCATGCGGACGATCGTTTC 274 Asp-87 (94/196)a (79/196)b (15/196)b
WPparC CGGAAAACGCCTACTTAAACTA 446 41–62 Point 2 17.98% 13.81% 3.31% 1.66%
ControlparC GTGCCGTTAAGCAAAATGT 446 506–488 (34/181)a (25/181)b (6/181)b (3/181)b
MAMAparC80 ATCGCTTCATAACAGGCTCT 217 Ser-80 Point 3 31.33% 14.00% 10.67% 6.67%
MAMAparC84 CCATCAGGACCATCGCCTC 238 Glu-84 (47/150)a (21/150)b (16/150)b (10/150)b
Point 4 14.00% 7.00% 7.00% 0b
(14/100)a (7/100)b (7/100)b
Total 30.14% 21.05% 4.62% 4.46%
2.6. Detection of the gyrA and parC mutations by MAMA-PCR of (189/627) (132/627)c (29/627)c (28/627)c
quinolone-resistant isolates of Salmonella a
Represents the prevalence rate of Salmonella isolates from different sampling points.
b
Represents the prevalence rate of Salmonella with different serotypes from different
The most common mechanisms of resistance to quinolones are sampling points.
c
mutations in DNA gyrase (topoisomerase II, in gyrA and gyrB genes) and Represents the overall percentage of Salmonella with different serotypes.
topoisomerase IV (in parC and parE). These mutations are primarily
located in the quinolone resistance-determining region (QRDR) of the
gyrA gene and its homologous region of the parC gene (Qiang et al., represented the contamination level of food-producing animals. The
2002). Four amino acid substitutions, two in gyrA and two in parC result was also significantly higher than previously reported 19.84% of
subunits of DNA gyrase and topoisomerase IV, are commonly re- positive samples for chickens in Shandong province of China,
sponsible for fluoroquinolone resistance. 2009–2012 (Lai et al., 2014). Broilers are widely considered to be an
Mismatch amplification mutation (MAMA) PCR assay was used to important reservoir for Salmonella transmission, due to the ability of
detect mutations within both DNA gyrase (gyrA) and topoisomerase IV Salmonella to proliferate in the gastrointestinal tract of the chickens and
(parC) gene using primers listed in Table 2. PCR was carried out ac- subsequently contaminate processed broiler carcasses in the slaughter
cording to the reference (Qiang et al., 2002). The PCR products were and processing chain (Todd, 1980). Therefore, high prevalence in food-
analyzed through 1.5% (w/v) agarose gel electrophoresis and se- producing animals in this commercial processing plant increases the
quenced by Takara biotechnology Co., Ltd. (Dalian, China). The nu- risk of carcass contamination and the human salmonellosis.
cleotide sequences were analyzed using the BLAST tool available from Compared with the occurrence at point 1 (47.96%), the con-
the National Center for Biotechnology Information website (http:// tamination level of chicken carcasses decreased significantly at point 2
www.ncbi.nlm.nih.gov). (18.78%) (P < 0.01), which may be attributed to hygiene manage-
ment in the slaughterhouse and rinse treatment on the chicken car-
2.7. Statistical data analysis casses after evisceration. However, the broiler chicken meat at point 3
presented much higher prevalence rate (31.33%) of Salmonella spp.
Confidence intervals of proportions were calculated with EPi tools than 18.78% at point 2 (P < 0.01). It could be explained by cross-
(http://epitools.ausvet.com.au) using the binomial exact method. contamination occurring at the several stages between points 2 and 3
Statistical significance of differences between proportions was eval- during slaughter. Between the points 2 and 3, there are several main
uated by Chi-square (χ2) test. stages including chilling of chicken carcasses, carcasses hanging, and
segmentation. In this processing plant, immersion chilling of chicken
3. Results and discussion carcasses is performed in pre-chillers with two tanks in series con-
taining sodium hypochlorite. By chilling, the carcasses would be re-
3.1. Prevalence and serotyping of Salmonella isolates duced to a temperature of 7–10 °C that is generally regarded as the
maximum temperature for preventing the proliferation of mesophilic,
A total of 189 Salmonella isolates (2012, n = 84; 2013, n = 72; enteric pathogens (Sofos, 2005). However, several studies have been
2014, n = 33) were recovered from 627 samples collected from four conducted to evaluate the effect of chilling on numbers and prevalence
processing points along the slaughtering process. All the isolates were of Salmonella. Immersion chilling has a minimal effect on the pre-
identified by biochemical characterization and further confirmed by valence of Salmonella on poultry carcasses. Other researchers also have
detecting one genus-specific gene and one virulence gene (invA) using suggested that the washing effect during immersion chilling physically
duplex PCR amplification. The gel image of PCR products of partial removes bacterial cells and thus reduces bacterial recovery, but this
strains was shown in Fig. S2 in the Supplementary materials. The effect is likely offset by carcass cross-contamination (Thomson et al.,
overall prevalence of Salmonella was 30.14% (95% C.I. 1979). In addition, other processing stages like carcasses hanging and
26.57%–33.90%). The isolation rate of Salmonella spp. was 47.96% segmentation may also lead to the cross-contamination via external
(95% C.I. 40.79%–55.19%) for broiler chicken cecal samples (point 1). animal surfaces, workers' clothes, hands or equipment, other carcasses,
18.78% (95% C.I. 13.37%–25.25%) of samples from carcasses surface plant equipment, and plant environment, etc. Therefore, all these fac-
after evisceration (point 2) were positive. The occurrence of Salmonella tors might lead to the increasing prevalence of Salmonella from samples
at sampling points 3 and 4 were 31.33% (95% C.I. 24.02%–39.41%) at sampling point 3. A significant decrease in the prevalence of Sal-
and 14.00% (95% C.I. 7.87%–22.37%) respectively (Table 3). monella was detected at sampling point 4 (14.00%), which could be
In the present study, the prevalence of Salmonella isolates from explained by that the quick-freezing procedure makes Salmonella in-
samples collected along the slaughter process (30.14%) is higher than activation, thus reducing the risk of human infection.
14.98% in Qingdao City, China (Cui et al., 2016), and 16.06% (195/ Apart from 28 untypable strains, the remaining 85.18% of the
1214) in Korea (Choi et al., 2014) in one vertically-integrated com- Salmonella strains were identified into 2 serovar groups, including S.
mercial broiler chicken supply chain. The isolation rate of Salmonella Enteritidis (n = 132, 69.84%) and S. Typhimurium (n = 29, 15.34%)
spp. was 47.96% for broiler chicken cecal samples (point 1), which (Table 3). The serotyping results indicated that S. Enteritidis and S.

46
Y. Zhu et al. International Journal of Food Microbiology 259 (2017) 43–51

Typhimurium were the dominant serovars in this slaughter and pro- resistance rates were observed against nalidixic acid (99.5%), ampi-
cessing chain. S. Enteritidis isolates were detected in all sampling cillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimetho-
points, from which 79 isolates at point 1 (40.31%) (95% C.I. prim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Lower
33.38%–47.53%), 25 at point 2 (13.81%) (95% C.I. 9.14%–19.71%), 21 levels of resistance were found for florfenicol (25.4%), gentamycin
at point 3 (14.00%) (95% C.I. 8.88%–20.60%) and 7 at point 4 (7.00%) (10.3%), amoxicillin/clavulanic acid (8.5%). Most of the isolates were
(95% C.I. 2.86%–13.89%). In addition, 29 S. Typhimurium isolates susceptible to ceftriaxone.
were from the latter three processing stages, and S. Typhimurium was When antimicrobial resistance was analyzed by sampling points
not detected from fresh broiler cecal samples (point 1), which indicated (Fig. 1b), higher resistance rates to CRO, TET, SXT, AMC, CIP, GEN, and
that there might be cross-contamination between chicken carcasses and SPE were observed in isolates from points 3 and 4 in comparison with
processing environment or workers during slaughter. The serotypes of points 1 and 2, with the exception of FLO, AMP and NAL, which showed
S. Enteritidis and S. Typhimurium are two common types isolated from roughly consistent resistance rate in these four sampling points.
broiler carcasses in slaughter and humans infected by food borne dis- Overall, higher resistance rates were found in the latter stages of
eases (de Oliveira et al., 2005; Rabsch et al., 2001), which could cause a slaughter.
range of clinical syndromes, including diarrhoeal disease. A survey Salmonella isolates with different serotypes showed difference in the
conducted by Wang et al. (2013) in China isolated and identified 23 resistance to 10 antimicrobial agents (Fig. 1c). Resistance of S. En-
isolates from the slaughterhouse, and these isolates belonged to six teritidis to FLO, SXT, NAL, and GEN was slightly higher than, or almost
different serotypes, including S. Indiana, S. Infantis, S. Derby, S. Hei- equal to those of S. Typhimurium, while S. Typhimurium showed
delberg, S. Agona and S. Typhimurium. Li et al. (2013) identified higher resistance to CRO, TET, AMP, AMC, CIP, and SPE than S. En-
fourteen serotypes among 129 Salmonella isolates from pigs, ducks and teritidis.
chickens in one food production chain in Sichuan province, China, and The antimicrobial resistance of Salmonella isolates from samples in
the top three serotypes were S. Derby (n = 76), S. Typhimurium different years also showed the difference (Fig. 1d). It could be seen
(n = 16), and S. Potsdam (n = 9). By contrast, Salmonella isolates from that antimicrobial resistance of Salmonella isolates to CRO, TET, SXT
the present slaughterhouse showed less variety in serotype. Further- and SPE increased gradually from the year 2012 to 2014. Additionally,
more, it could be found that although samples were collected from the the resistance of Salmonella strains in 2014 to FLO, AMC and CIP was
same region, there also existed considerable difference in serotypes of much higher than those in 2012. There was almost no difference in
Salmonella isolates in different slaughterhouses. resistance to AMP, NAL, and GEN in the three-year period. Overall,
there was an increasing trend in antimicrobial resistance with time.
Totally, 45 resistance patterns of these isolates to 10 categories of
3.2. Antimicrobial resistance of Salmonella isolates antimicrobials were found (Table 4). 60.8% (n = 115) of isolates were
MDR strains. 19.6% (n = 37) of isolates were resistant to seven or more
Fig. 1a shows the antimicrobial resistance of 189 Salmonella isolates antimicrobials and 3.2% (n = 6) of isolates were resistant to up to nine
to ten categories of antimicrobial agents, which showed that all Sal- antimicrobials. The dominant resistance pattern was NAL-AMP (28.6%,
monella isolates were resistant to at least one antimicrobial agent. High

100 100

a b
80 80
Resistance/%

Resistance/%

60 60
Point 1
Point 2
40 40
Point 3
Point 4
20 20

0 0
CRO FLO TET SXT AMP AMC NAL GEN CIP SPE CRO FLO TET SXT AMP AMC NAL CIP GEN SPE
Categories of Antimicrobials Categories of Antimicrobials

100 S. Enteritidis 100

S. Typhimurium
80
c Untypable 80
d
Resistance/%

Resistance/%

60 60
2012
40 40 2013
2014
20 20

0 0
CRO FLO TET SXT AMP AMC NAL CIP GEN SPE CRO FLO TET SXT AMP AMC NAL GEN CIP SPE
Categories of Antimicrobials Categories of Antimicrobials

Fig. 1. Antimicrobial resistance patterns of Salmonella isolates from slaughter line. (a) Antimicrobial resistance patterns of Salmonella isolates to 10 antimicrobial agents. (b) resistance
patterns of Salmonella from different sampling points, (c) resistance patterns of Salmonella with different serotypes, (d) resistance patterns of Salmonella isolates from the year 2012 to
2014.

47
Y. Zhu et al. International Journal of Food Microbiology 259 (2017) 43–51

Table 4 Table 5
Antimicrobial resistance profiles of Salmonella isolates from four sampling points. Multi-drug resistance of Salmonella with different serovars from different sampling points
in three years.
Resistant phenotypes Point 1 Point 2 Point 3 Point 4 Total
Serovars Numbers of antimicrobials/No. (%)
NAL 3 3
NAL-AMP 33 10 10 1 54 1–3 4–6 7–8 9
SXT-NAL 7 3 4 2 16
AMP-NAL-CIP 4 4 S. Enteritidis (n = 132) 88 (66.7%) 26 (19.7%) 16 (12.1%) 2 (1.5%)
NAL-AMP-TET 4 2 6 S. Typhimurium (n = 29) 0 26 (89.7%) 1 (3.6%) 2 (6.9%)
NAL-AMP-SPE 2 1 3 Untyped (n = 28) 0 11 (39.3%) 15 (53.6%) 2 (7.1%)
SPE-SXT-NAL 1 1 Point 1 (n = 94) 52 (55.4%) 21 (22.3%) 21 (22.3%) 0
NAL-AMP-AMC 1 1 Point 1 (S. Enteritidis, 52 (65.8%) 14 (17.7%) 13 (16.5%) 0
AMP-NAL-GEN-SPE 1 1 n = 79)
TET-SXT-AMP-NAL 3 4 1 8 Point 1 (S. Typhimurium, 0 0 0 0
TET-SXT-CIP-NAL 1 1 n = 0)
NAL-CIP-AMP-AMC 1 1 Point 1 (Untyped, n = 15) 0 7 (46.7%) 8 (53.3%) 0
NAL-CIP-AMP-SPE 1 1 Point 2 (n = 34) 17 (50.0%) 14 (41.2%) 2 (5.9%) 1 (2.9%)
NAL-CIP-AMP-FLO-SXT 1 1 Point 2 (S. Enteritidis, 17 (68.0%) 5 (20.0%) 2 (8.0%) 1 (4.0%)
NAL-CIP-AMP-SPE-SXT 1 1 n = 25)
FLO-TET-AMP-NAL-CIP 1 1 Point 2 (S. Typhimurium, 0 6 (100%) 0 0
TET-SXT-AMP-NAL-CIP 1 2 2 5 n = 6)
FLO-TET-SXT-CIP-NAL 1 1 Point 2 (Untyped, n = 3) 0 3 (100%) 0 0
AMP-AMC-SXT-TET-NAL 1 1 Point 3 (n = 47) 16 (34.0%) 24 (51.1%) 4 (8.5%) 3 (6.4%)
AMP-AMC-CIP-TET-NAL 4 4 Point 3 (S. Enteritidis, 16 (76.2%) 4 (19.0%) 1 (4.8%) 0
AMP-CIP-TET-SPE-NAL 12 3 15 n = 21)
NAL-CIP-AMP-FLO-SPE-SXT 1 1 2 Point 3 (S. Typhimurium, 0 16 (100%) 0 0
NAL-CIP-AMP-FLO-SPE-TET 1 1 n = 16)
NAL-CIP-AMP-FLO-TET-SXT 6 6 Point 3 (Untyped, n = 10) 0 4 (40.0%) 3 (30.0%) 3 (30.0%)
NAL-CIP-AMP-SPE-TET-SXT 4 1 2 7 Point 4 (n = 14) 3 (21.4%) 7 (50.0%) 1 (7.1%) 3 (21.4%)
NAL-CIP-AMP-GEN-TET-SXT 1 1 Point 4 (S. Enteritidis, 3 (42.8%) 3 (42.8%) 0 1 (14.3%)
AMP-CRO-TET-SXT-SPE-NAL 1 1 n = 7)
TET-SXT-AMP-AMC-NAL-CIP 1 1 Point 4 (S. Typhimurium, 0 4 (57.1%) 1 (14.3%) 2 (28.6%)
AMP-AMC- CIP-TET-SPE-NAL 2 2 n = 7)
AMP-SXT-TET-SPE-NAL-FLO 1 1 Point 4 (Untyped, n = 0) 0 0 0 0
NAL-CIP-AMP-AMC-FLO-TET-SXT 1 1 2012 (n = 84) 51 (60.7%) 15 (17.8%) 16 (19.0%) 2 (2.4%)
NAL-CIP-AMP-FLO-GEN-TET-SXT 5 1 6 2013 (n = 72) 37 (51.4%) 31 (43.0%) 2 (2.8%) 2 (2.8%)
TET-SXT-AMP-NAL-GEN-CIP-SPE 1 1 2014 (n = 33) 0 17 (51.5%) 13 (39.4%) 3 (9.1%)
TET-SXT-AMP-NAL-CIP-SPE-AMC 1 1
AMP-SXT-TET-CRO-SPE-NAL-FLO- 1 1 2
CIP resistance rates to up to 9 categories of antimicrobials were found in
AMP-CIP-SXT-TET-GEN-CRO-NAL 1 1
isolates from point 4 (21.4%). Therefore, it could be concluded that the
AMP-AMC-CIP-SXT-SPE-NAL-FLO 1 1
AMP-CIP-SXT-TET-SPE-NAL-FLO 10 2 12 multidrug resistance became more serious along the slaughtering pro-
NAL-CIP-AMP-AMC-SPE-GEN-TET- 1 1 cess. S. Typhimurium isolates were mainly resistant to four to six ca-
SXT tegories of antimicrobials (89.7%, n = 26), including 6 isolates from
NAL-CIP-AMP-FLO-SPE-GEN-TET- 2 1 1 4
point 2, 16 isolates from point 3, 4 isolates from point 4; in addition,
SXT
AMP-AMC-CIP-SXT-TET-SPE-NAL- 1 1
two S. Typhimurium isolates from point 4 were resistant to up to nine
FLO categories of antimicrobials. Additionally, as described above, 29 of S.
NAL-CIP-AMP-AMC-FLO-SPE-GEN- 1 1 Typhimurium strains were isolated from the latter three processing
TET-SXT stages, and not detected in fresh broiler cecal samples (point 1).
NAL-CIP-AMP-CRO-FLO-SPE-GEN- 1 2 3
Therefore, it could be concluded that there might be cross-contamina-
TET-SXT
AMP-AMC-CIP-SXT-TET-GEN-CRO- 1 1 tion between chicken carcasses and processing environment or workers
SPE-NAL in this processing plant, especially locating between the points 2 and 3,
FLO-TET-SXT-AMP-AMC-NAL- 1 1 2 which leads to the increase of percentage of MDR strains in the latter
GEN-CIP-SPE
processing stages, and facilitates the dissemination of the multi-drug
Total strains/sample groups 94 34 47 14 189
resistance to consumers.
In addition, we can see from the Table 5, there was a decreasing
54/189), followed by NAL-SXT (8.5%, 16/189), AMP-CIP-TET-SPE- trend in multi-drug resistance in S. Enteritidis from point 1 (34.2%) to
NAL (7.9%, 15/189) and AMP-CIP-SXT-TET-SH-NAL-FLO (6.3%, 12/ point 3 (23.8%), while 57.2% of S. Enteritidis isolates at point 4 were
189). Along the slaughtering process, there was a descending trend for MDR strains. Therefore, it might be concluded that the Salmonella iso-
the numbers of resistance patterns (point 1, n = 25; point 2, n = 16; lates due to cross-contamination between point 3 and point 4, instead of
point 3, n = 17; point 4, n = 9). raw broiler chicken, increase the risk of MDR strains in finishing
The results showed that 66.7% (n = 88) of S. Enteritidis isolates chicken meat products. For untyped serotypes, all strains isolated from
were resistant to one to three categories of antimicrobial agents, while point 1 (n = 15), point 2 (n = 3), and point 3 (n = 10) were MDR
S. Typhimurium isolates were mainly resistant to four to six categories strains, which indicated that due to rinse treatment on chicken car-
of antimicrobials (89.7%, n = 26), which indicated that MDR pheno- casses, the prevalence of Salmonella and MDR strains decreased sig-
types in Salmonella are strongly associated with serotype (Cui et al., nificantly; there might exist cross-contamination between points 2 and
2016). Salmonella isolates from different sampling points also showed 3. However, there were no isolates from finishing frozen chicken meat
different multidrug resistance (Table 5). Isolates from point 1 (55.4%) products (point 4), which terminates the transmission of MDR strains to
and point 2 (50.0%) were mainly resistant to one to three classes of consumers.
antimicrobials, while isolates from point 3 (51.1%) and point 4 (50.0%) In terms of sampling time, isolates recovered in 2012 were mainly
were mainly resistant to four to six kinds of antimicrobials. Higher resistant to one to three categories of antimicrobials (60.7%), while
51.4% and 43.0% of isolates from 2013 were resistant to one to three

48
Y. Zhu et al. International Journal of Food Microbiology 259 (2017) 43–51

antimicrobials and four to six categories of antimicrobials respectively. aac(3)-II and aac(3)-IV genes. We found that 21 of 22 gentamicin-re-
By contrast, more serious multi-drug resistance occurred in 2014, when sistant isolates gave a positive signal for aac(3)-II (72.7%) or aac(3)-IV
all the isolates were resistant to at least four to six categories of anti- gene (81.8%). 53.8% (35/65) of spectinomycin-resistant isolates car-
microbials, which indicated that multi-drug resistance also exhibited an ried aac(3)-II, aac(3)-IV, or ant(2″)-I gene, which indicated the rela-
increasing trend over the three-year period. Antibiotics are commonly tively low consistency between antimicrobial resistance phenotype and
used in concentrated animal feeding operations worldwide to treat genotypes. This might be explained by other resistance mechanisms or
animal diseases and promote animal growth (Sarmah et al., 2006). In antimicrobial resistance genes which mediate the resistance to specti-
the slaughterhouse we chose, these broiler chickens are from one nomycin.
poultry farm where the workers at the farm also continuously used the
common antibiotics categories in alternation in the long term for 3.4. Prevalence and characteristics of class 1 integron
treating and preventing bacterial infections, thus improving growth and
production, which necessarily results in the increasing antibiotic re- Of the 115 MDR Salmonella strains which were screened for the
sistance. Veterinary drug residues including tetracyclines, beta-lactam presence of class 1 integron, 43 isolates (37.4%, 43/115) harbored class
antibiotics and quinolones, etc. have been detected in poultry meat and 1 integron. Among them, 21 strains were positive for resistant gene
animal feedingstuffs (Al-Ghamdi et al., 2000; De Wasch et al., 1998; cassettes containing two distinct patterns, including blaOXA-30-aadA1
Kabir et al., 2004; McEvoy, 2002; Okerman et al., 2001). Figuring out (19 isolates), blaOXA-30-aadA1/drfA1-orfC (2 isolates). In the present
the correlation between the antibiotics used in the animal feed and the study, 72.4% (n = 21) of S. Typhimurium and 31.7% (n = 19) of S.
antibiotic resistance profile presented in this slaughterhouse is quite Enteritidis harbored the intI 1 gene respectively. The highest prevalence
necessary, and requires further investigation in future. of class 1 integron was found in isolates from point 4 (72.7%, n = 8),
Therefore, in this slaughterhouse, efficient measures to facilitate the followed by isolates recovered from point 2 (38.9%, n = 7). The results
reasonable use of antimicrobials in animal husbandry must be taken indicated that the carriage of class 1 integron was related to serotype,
(McEwen and Fedorka-Cray, 2002). Also, more importantly, strict hy- source, and other factors (Hur et al., 2011; Wannaprasat et al., 2011). In
giene method and HACCP (Hazard Analysis and Critical Control Points) addition, 48.8% of intI 1-positive strains were found to carry gene
management during slaughter are vital for preventing food infection cassettes in our study, which is similar to the prevalence of 61.5%
caused by Salmonella (Harris et al., 1995). (Molla et al., 2007) and 61.1% (Khemtong and Chuanchuen, 2008). In
2013, 57.8% of isolates harbored class 1 integron in contrast to 44.7%
3.3. Antimicrobial resistance genotypes of Salmonella isolates in 2012 and 0 in 2014, respectively.
Twenty-one of S. Typhimurium isolates were positive for gene cas-
Among 166 beta-lactam-resistant isolates, 94.6% (n = 157) har- settes, while no gene cassette was detected in S. Enteritidis and un-
bored at least one resistance gene of blaTEM or blaCTX-M. The blaSHV gene typable strains. Higher prevalence of resistant gene cassettes was found
was not detected in any of the isolates. The PCR results were in ac- in isolates from point 2 (n = 6), point 3 (n = 8) and point 4 (n = 7),
cordance with those of antimicrobial susceptibility tests. The blaTEM compared with isolates from point 1 (n = 0). The results indicated that
gene (93.4%, n = 155) was the most prevalent in beta-lactam-resistant cross-contamination between chicken carcasses and processing en-
isolates, followed by blaCTX-M gene (12.7%, n = 21). Both blaTEM and vironment or workers during slaughter might play an important role in
blaCTX-M genes were simultaneously detected in 11.4% (n = 19) of the transmission of multi-drug resistance and resistance genes to con-
isolates. sumers. All intI 1-positive S. Typhimurium harbored gene cassettes in
Higher frequency of blaCTX-M gene was found in isolates from point 4 our study, which is consistent with previous studies that 78% to 100%
(16.7%) compared with isolates from other points. In terms of serovars, of S. Typhimurium strains were positive for the intI 1 gene harboring
the prevalence of blaTEM for S. Enteritidis and S. Typhimurium was gene cassettes (Antunes et al., 2006). In the present study, the gene
97.3% and 93.1%, respectively. The blaCTX-M gene was found in 46.9% cassettes blaOXA-30-aadA1and drfA1-orfC were detected in S. Typhi-
(n = 15) of isolates in 2014, compared with only 6.0% (n = 3) and murium, which have been identified previously (Khan et al., 2009;
only 3.4% (n = 3) of isolates in 2013 and 2012, respectively. Weill et al., 2006). The presence of class 1 integrons on plasmids is
Among 91 sulfonamide-resistant isolates, 97.8% (n = 89) harbored considered to be the main mechanism for the rapid spread of multidrug-
at least one gene of sul1, sul2 or sul3. The sul2 gene had the highest resistant phenotypes among gram-negative bacteria (Rowe-Magnus
occurrence (97.8%, n = 89), followed by sul3 (50.5%, n = 46) and sul1 et al., 2002). Other gene cassettes, such as dhfr7, aacA4, dfrA5, addA2-
(50.5%, n = 46). The co-occurrence of sul1-sul2-sul3 was most pre- blaPSE-1, and blaOXA-1 in S. Typhimurium, have also been reported in
valent (28.6%, n = 26), followed by sul2-sul3 (22.0%, n = 20) and previous studies (Eguale et al., 2014; Lee et al., 2004).
sul1-sul2 (22.0%, n = 20).
Among 98 tetracycline-resistant isolates, 85.7% (n = 84) harbored 3.5. Mutations within gyrA and parC
at least one tet gene. The tet(C) gene (71.4%, n = 70) was the most
prevalent, followed by tet(B) (50%, n = 49) and tet(A) (23.5%, n = 23). One hundred and eighty-eight quinolone-resistant isolates were
The most popular co-occurrence was tet(B)-tet(C) (20.4%, n = 20), analyzed by MAMA PCR. The results defined fifteen groups according to
followed by tet(A)-tet(B)-tet(C) (17.3%, n = 17), tet(A)-tet(C) (5.1%, mutations in gyrA and parC (Table 6). Except for four strains which had
n = 5) and tet(A)-tet(B) (1.0%, n = 1). None of the isolates was positive no mutations in gyrA and parC, the remaining 184 quinolone-resistant
for tet(G). Isolates from point 1 (85.7%, n = 36) and point 2 (85.7%, isolates had at least one mutation within gyrA or parC (alone or in
n = 12) carried the tet(C) gene, while the tet(B) gene was the main combination with other mutations in gyrA or parC), which indicated
tetracycline-resistant gene among isolates from point 3 (58.1%, n = 18) that resistance phenotype was considerably associated with the occur-
and point 4 (81.8%, n = 9). rence of resistance gene.
Except for one S. Typhimurium strain, the floR gene was identified Mutations were found in gyrA (Ser-83, n = 144; Asp87, n = 152)
in 97.8% (n = 44) of florfenicol-resistant Salmonella strains (n = 45). and parC (Ser-80, n = 140; Glu-84, n = 145). A total of 64 isolates had
The antimicrobial resistance genotypes were highly in accordance with a single mutation in either Ser-83 or Asp-87 of gyrA, while 55 isolates
the phenotypes. had one mutation either in Ser-80 or Glu-84 of parC. Moreover, 32
For 74 aminoglycosides-resistant isolates, 49 Salmonella strains isolates had double mutations in gyrA, one mutation in parC (Glu-84 or
(66.2%) carried aac(3)-II or aac(3)-IV, and none of the isolates har- Ser-80), and 34 isolates had a single mutation in gyrA (Ser-83 or Asp-
bored ant(2″)-I gene. The occurrence of aac(3)-II and aac(3)-IV was 87) and double mutations in parC. Additionally, 79 isolates had double
35.4% and 53.2%, respectively. Additionally, 21 strains carried both mutations in both gyrA and parC. High prevalence of mutations in Ser-

49
Y. Zhu et al. International Journal of Food Microbiology 259 (2017) 43–51

Table 6 Asai, T., Itagaki, M., Shiroki, Y., Yamada, M., Tokoro, M., Kojima, A., Ishihara, K., Esaki,
Substitution mutations within gyrA and parC genes. H., Tamura, Y., Takahashi, T., 2006. Antimicrobial resistance types and genes in
Salmonella enterica Infantis isolates from retail raw chicken meat and broiler chickens
on farms. J. Food Prot. 69, 214–216.
Mutation groups No. of isolates gyrA87 gyrA83 parC80 parC84
Bai, L., Lan, R., Zhang, X., Cui, S., Xu, J., Guo, Y., Li, F., Zhang, D., 2015. Prevalence of
Salmonella isolates from chicken and pig slaughterhouses and emergence of cipro-
I 8 Asp-87
floxacin and cefotaxime co-resistant S. enterica serovar Indiana in Henan, China. PLoS
II 1 Ser-83 One 10, e0144532.
III 1 Ser-80 Bingsheng, K., Yijun, H., 2007. Poultry sector in China: structural changes during the past
IV 1 Glu-84 decade and future trends, poultry in the 21st century: avian influenza and beyond. In:
V 8 Asp-87 Ser-80 Proceedings of the International Poultry Conference, Bangkok, pp. 25–26.
VI 5 Asp-87 Ser-83 Bonardi, S., Bassi, L., Brindani, F., D'Incau, M., Barco, L., Carra, E., Pongolini, S., 2013.
VII 5 Asp-87 Glu-84 Prevalence, characterization and antimicrobial susceptibility of Salmonella enterica
VIII 6 Ser-83 Ser-80 and Yersinia enterocolitica in pigs at slaughter in Italy. Int. J. Food Microbiol. 163,
IX 2 Ser-80 Glu-84 248–257.
X 2 Ser-83 Glu-84 Chen, S., Zhao, S., White, D.G., Schroeder, C.M., Lu, R., Yang, H., McDermott, P.F., Ayers,
XI 10 Asp-87 Ser-83 Ser-80 S., Meng, J., 2004. Characterization of multiple-antimicrobial-resistant Salmonella
serovars isolated from retail meats. Appl. Environ. Microbiol. 70, 1–7.
XII 15 Asp-87 Ser-80 Glu-84
Choi, S.-W., Ha, J.-S., Kim, B.-Y., Lee, D.-H., Park, J.-K., Youn, H.-N., Hong, Y.-H., Lee, S.-
XIII 22 Asp-87 Ser-83 Glu-84
B., Lee, J.-B., Park, S.-Y., 2014. Prevalence and characterization of Salmonella species
XIV 19 Ser-83 Ser-80 Glu-84
in entire steps of a single integrated broiler supply chain in Korea. Poult. Sci. 93,
XV 79 Asp-87 Ser-83 Ser-80 Glu-84 1251–1257.
Cockerill, F.R., 2011. Performance Standards for Antimicrobial Susceptibility Testing:
Twenty-first Informational Supplement. Clinical and Laboratory Standards Institute
(CLSI).
83 (100%, n = 14) and Asp-87 (100%, n = 14) of gyrA and Glu-84 Cohen, N.D., Neibergs, H.L., McGruder, E.D., Whitford, H.W., Behle, R.W., Ray, P.M.,
Hargis, B., 1993. Genus-specific detection of Salmonellae using the polymerase chain
(85.7%, n = 12) of parC was found from frozen meat samples. Lower reaction (PCR). J. Vet. Diagn. Investig. 5, 368–371.
frequency of mutations in gyrA and parC was found among isolates from Cui, M., Xie, M., Qu, Z., Zhao, S., Wang, J., Wang, Y., He, T., Wang, H., Zuo, Z., Wu, C.,
2014 (Ser-83, 21.9%; Asp-87, 65.5%; Ser-80, 40.6%; Glu-84, 46.9%). 2016. Prevalence and antimicrobial resistance of Salmonella isolated from an in-
tegrated broiler chicken supply chain in Qingdao, China. Food Control 62, 270–276.
In conclusion, overall, antimicrobial resistance presented an in-
De Wasch, K., Okerman, L., De Brabander, H., Van Hoof, J., Croubels, S., De Backer, P.,
creasing trend along the slaughtering process. The result suggests that 1998. Detection of residues of tetracycline antibiotics in pork and chicken meat:
raw broiler chicken might act as the reservoir for MDR Salmonella to correlation between results of screening and confirmatory tests. Analyst 123,
2737–2741.
some extent, and cross-contamination between chicken carcasses and
Edelstein, M., Pimkin, M., Palagin, I., Edelstein, I., Stratchounski, L., 2003. Prevalence
processing environment or workers in this processing plant occurs, and molecular epidemiology of CTX-M extended-spectrum β-lactamase-producing
which leads to the increase of percentage of MDR strains in the latter Escherichia coli and Klebsiella pneumoniae in Russian hospitals. Antimicrob. Agents
processing stages and may facilitate the dissemination of the resistance Chemother. 47, 3724–3732.
Eguale, T., Marshall, J., Molla, B., Bhatiya, A., Gebreyes, W.A., Engidawork, E., Asrat, D.,
genes to consumers along the slaughter and processing chain. Gunn, J.S., 2014. Association of multicellular behaviour and drug resistance in
Therefore, efficient measures to facilitate the reasonable use of anti- Salmonella enterica serovars isolated from animals and humans in Ethiopia. J. Appl.
microbials in animal husbandry must be taken. Also, more importantly, Microbiol. 117, 961–971.
Fan, W., Hamilton, T., Webster-Sesay, S., Nikolich, M.P., Lindler, L.E., 2007. Multiplex
strict hygiene method and HACCP management during slaughter are real-time SYBR green I PCR assay for detection of tetracycline efflux genes of gram-
vital for preventing food infection caused by Salmonella. negative bacteria. Mol. Cell. Probes 21, 245–256.
Forshell, L.P., Wierup, M., 2006. Salmonella contamination: a significant challenge to the
global marketing of animal food products. Rev. Sci. Tech. 25, 541–554.
Acknowledgements Ghoddusi, A., Nayeri Fasaei, B., Karimi, V., Ashrafi Tamai, I., Moulana, Z., Zahraei Salehi,
T., 2015. Molecular identification of Salmonella Infantis isolated from backyard
This work was supported by the Special Public Welfare Industry chickens and detection of their resistance genes by PCR. Iran. J. Vet. Res. 16,
293–297.
(Agriculture) of China (No. 200903055), the National Natural Science Gong, J., Zhang, J., Xu, M., Zhu, C., Yu, Y., Liu, X., Kelly, P., Xu, B., Wang, C., 2014.
Foundation of China (No. 31671954), and the fund of the Beijing Prevalence and fimbrial genotype distribution of poultry Salmonella isolates in China
Laboratory for Food Quality and Safety, Beijing Technology and (2006 to 2012). Appl. Environ. Microbiol. 80, 687–693.
Gordon, M.A., 2008. Salmonella infections in immunocompromised adults. J. Inf. Secur.
Business University (No. 00520801).
56, 413–422.
Greig, J., Ravel, A., 2009. Analysis of foodborne outbreak data reported internationally
Appendix A. Supplementary data for source attribution. Int. J. Food Microbiol. 130, 77–87.
Harris, K., Cross, H., Acuff, G., Webb, N., 1995. Risk analysis, HACCP and microbial
criteria in meat and poultry systems. In: HACCP in Meat, Poultry, and Fish
Supplementary data to this article can be found online at http://dx. Processing. Springer, pp. 134–155.
doi.org/10.1016/j.ijfoodmicro.2017.07.023. Henchion, M., McCarthy, M., Resconi, V.C., Troy, D., 2014. Meat consumption: trends and
quality matters. Meat Sci. 98, 561–568.
Hur, J., Kim, J.H., Park, J.H., Lee, Y.-J., Lee, J.H., 2011. Molecular and virulence char-
References acteristics of multi-drug resistant Salmonella Enteritidis strains isolated from poultry.
Vet. J. 189, 306–311.
Aarestrup, F.M., Lertworapreecha, M., Evans, M.C., Bangtrakulnonth, A., Chalermchaikit, Hur, J., Jawale, C., Lee, J.H., 2012. Antimicrobial resistance of Salmonella isolated from
T., Hendriksen, R.S., Wegener, H.C., 2003. Antimicrobial susceptibility and occur- food animals: a review. Food Res. Int. 45, 819–830.
rence of resistance genes among Salmonella enterica serovar Weltevreden from dif- Hvistendahl, M., 2012. China takes aim at rampant antibiotic resistance. Science 336,
ferent countries. J. Antimicrob. Chemother. 52, 715–718. 795.
Ahmed, A.M., Shimamoto, T., 2012. Genetic analysis of multiple antimicrobial resistance Jensen, V.F., Jakobsen, L., Emborg, H.-D., Seyfarth, A.M., Hammerum, A.M., 2006.
in Salmonella isolated from diseased broilers in Egypt. Microbiol. Immunol. 56, Correlation between apramycin and gentamicin use in pigs and an increasing re-
254–261. servoir of gentamicin-resistant Escherichia coli. J. Antimicrob. Chemother. 58,
Akbarmehr, J., 2012. Antimicrobial resistance in Salmonella isolated from broiler chicken 101–107.
carcasses. Afr. J. Microbiol. Res. 6, 1485–1488. Jiang, X., Shi, L., 2013. Distribution of tetracycline and trimethoprim/sulfamethoxazole
Al-Ghamdi, M., Al-Mustafa, Z., El-Morsy, F., Al-Faky, A., Haider, I., Essa, H., 2000. resistance genes in aerobic bacteria isolated from cooked meat products in
Residues of tetracycline compounds in poultry products in the eastern province of Guangzhou, China. Food Control 30, 30–34.
Saudi Arabia. Public Health 114, 300–304. Kabir, J., Umoh, V., Audu-Okoh, E., Umoh, J., Kwaga, J., 2004. Veterinary drug use in
Allen, V., Bull, S., Corry, J., Domingue, G., Jørgensen, F., Frost, J., Whyte, R., Gonzalez, poultry farms and determination of antimicrobial drug residues in commercial eggs
A., Elviss, N., Humphrey, T., 2007. Campylobacter spp. contamination of chicken and slaughtered chicken in Kaduna State, Nigeria. Food Control 15, 99–105.
carcasses during processing in relation to flock colonisation. Int. J. Food Microbiol. Khan, A.A., Ponce, E., Nawaz, M., Cheng, C.-M., Khan, J.A., West, C.S., 2009.
113, 54–61. Identification and characterization of class 1 integron resistance gene cassettes
Antunes, P., Machado, J., Peixe, L., 2006. Characterization of antimicrobial resistance and among Salmonella strains isolated from imported seafood. Appl. Environ. Microbiol.
class 1 and 2 integrons in Salmonella enterica isolates from different sources in 75, 1192–1196.
Portugal. J. Antimicrob. Chemother. 58, 297–304. Khemtong, S., Chuanchuen, R., 2008. Class 1 integrons and Salmonella genomic island 1

50
Y. Zhu et al. International Journal of Food Microbiology 259 (2017) 43–51

among Salmonella enterica isolated from poultry and swine. Microb. Drug Resist. 14, PCR method to detect gyrA and parC mutations in ciprofloxacin-resistant clinical
65–70. isolates of Escherichia coli. J. Antimicrob. Chemother. 49, 549–552.
Kim, M.-S., Lim, T.-H., Jang, J.-H., Lee, D.-H., Kim, B.-Y., Kwon, J.-H., Choi, S.-W., Noh, Rabsch, W., Tschäpe, H., Bäumler, A.J., 2001. Non-typhoidal salmonellosis: emerging
J.-Y., Hong, Y.-H., Lee, S.-B., 2012. Prevalence and antimicrobial resistance of problems. Microbes Infect. 3, 237–247.
Salmonella species isolated from chicken meats produced by different integrated Rahn, K., De Grandis, S., Clarke, R., McEwen, S., Galan, J., Ginocchio, C., Curtiss, R.,
broiler operations in Korea. Poult. Sci. 91, 2370–2375. Gyles, C., 1992. Amplification of an invA gene sequence of Salmonella typhimurium by
Lai, J., Wu, C., Wu, C., Qi, J., Wang, Y., Wang, H., Liu, Y., Shen, J., 2014. Serotype polymerase chain reaction as a specific method of detection of Salmonella. Mol. Cell.
distribution and antibiotic resistance of Salmonella in food-producing animals in Probes 6, 271–279.
Shandong province of China, 2009 and 2012. Int. J. Food Microbiol. 180, 30–38. Rivera-Pérez, W., Barquero-Calvo, E., Zamora-Sanabria, R., 2014. Salmonella con-
Lee, K., Yong, D., Yum, J.H., Lim, Y.S., Kim, H.S., Lee, B.K., Chong, Y., 2004. Emergence tamination risk points in broiler carcasses during slaughter line processing. J. Food
of multidrug-resistant Salmonella enterica serovar typhi in Korea. Antimicrob. Agents Prot. 77, 2031–2034.
Chemother. 48, 4130–4135. Rowe-Magnus, D.A., Guerout, A.M., Mazel, D., 2002. Bacterial resistance evolution by
Li, R., Lai, J., Wang, Y., Liu, S., Li, Y., Liu, K., Shen, J., Wu, C., 2013. Prevalence and recruitment of super-integron gene cassettes. Mol. Microbiol. 43, 1657–1669.
characterization of Salmonella species isolated from pigs, ducks and chickens in Sarmah, A.K., Meyer, M.T., Boxall, A.B., 2006. A global perspective on the use, sales,
Sichuan Province, China. Int. J. Food Microbiol. 163, 14–18. exposure pathways, occurrence, fate and effects of veterinary antibiotics (VAs) in the
Lu, H., Wang, X., Lang, X., Wang, Y., Dang, Y., Zhang, F., Tang, J., Li, X., Feng, X., 2010. environment. Chemosphere 65, 725–759.
Preparation and application of microarrays for the detection of antibiotic resistance Sofos, J., 2005. Improving the Safety of Fresh Meat. CRC Press, New York.
genes in samples isolated from Changchun, China. Mol. Biol. Rep. 37, 1857–1865. Sofos, J.N., 2008. Challenges to meat safety in the 21st century. Meat Sci. 78, 3–13.
Mainali, C., McFall, M., King, R., Irwin, R., 2014. Evaluation of antimicrobial resistance Thomson, J., Bailey, J., Cox, N., Posey, D., Carson, M., 1979. Salmonella on broiler car-
profiles of Salmonella isolates from broiler chickens at slaughter in Alberta, Canada. J. casses as affected by fresh water input rate and chlorination of chiller water. J. Food
Food Prot. 77, 485–492. Prot. 42, 954–955.
McEvoy, J., 2002. Contamination of animal feedingstuffs as a cause of residues in food: a Todd, E.C., 1980. Poultry-associated foodborne disease—its occurrence, cost, sources and
review of regulatory aspects, incidence and control. Anal. Chim. Acta 473, 3–26. prevention. J. Food Prot. 43, 129–139.
McEvoy, J., Nde, C., Sherwood, J., Logue, C., 2005. An evaluation of sampling methods Van der Fels-Klerx, H., Tromp, S., Rijgersberg, H., Van Asselt, E., 2008. Application of a
for the detection of Escherichia coli and Salmonella on turkey carcasses. J. Food Prot. transmission model to estimate performance objectives for Salmonella in the broiler
68, 34–39. supply chain. Int. J. Food Microbiol. 128, 22–27.
McEwen, S.A., Fedorka-Cray, P.J., 2002. Antimicrobial use and resistance in animals. Vo, A.T., Van Duijkeren, E., Fluit, A.C., Wannet, W.J., Verbruggen, A.J., Maas, H.M.,
Clin. Infect. Dis. 34, S93–S106. Gaastra, W., 2006. Antibiotic resistance, integrons and Salmonella genomic island 1
Molla, B., Miko, A., Pries, K., Hildebrandt, G., Kleer, J., Schroeter, A., Helmuth, R., 2007. among non-typhoidal Salmonella serovars in the Netherlands. Int. J. Antimicrob.
Class 1 integrons and resistance gene cassettes among multidrug resistant Salmonella Agents 28, 172–179.
serovars isolated from slaughter animals and foods of animal origin in Ethiopia. Acta Wang, H., Ye, K., Wei, X., Cao, J., Xu, X., Zhou, G., 2013. Occurrence, antimicrobial
Trop. 103, 142–149. resistance and biofilm formation of Salmonella isolates from a chicken slaughter plant
Newell, D.G., Koopmans, M., Verhoef, L., Duizer, E., Aidara-Kane, A., Sprong, H., in China. Food Control 33, 378–384.
Opsteegh, M., Langelaar, M., Threfall, J., Scheutz, F., 2010. Food-borne diseases—the Wannaprasat, W., Padungtod, P., Chuanchuen, R., 2011. Class 1 integrons and virulence
challenges of 20 years ago still persist while new ones continue to emerge. Int. J. genes in Salmonella enterica isolates from pork and humans. Int. J. Antimicrob. Agents
Food Microbiol. 139, S3–S15. 37, 457–461.
Okerman, L., Croubels, S., De Baere, S., Hoof, J.V., De Backer, P., De Brabander, H., 2001. Weill, F.-X., Guesnier, F., Guibert, V., Timinouni, M., Demartin, M., Polomack, L.,
Inhibition tests for detection and presumptive identification of tetracyclines, beta- Grimont, P.A., 2006. Multidrug resistance in Salmonella enterica serotype typhi-
lactam antibiotics and quinolones in poultry meat. Food Addit. Contam. 18, 385–393. murium from humans in France (1993 to 2003). J. Clin. Microbiol. 44, 700–708.
de Oliveira, S.I.D., Flores, F.S., dos Santos, L.R., Brandelli, A., 2005. Antimicrobial re- Yan, H., Li, L., Alam, M.J., Shinoda, S., Miyoshi, S.-i., Shi, L., 2010. Prevalence and an-
sistance in Salmonella enteritidis strains isolated from broiler carcasses, food, human timicrobial resistance of Salmonella in retail foods in northern China. Int. J. Food
and poultry-related samples. Int. J. Food Microbiol. 97, 297–305. Microbiol. 143, 230–234.
Olsen, J., Brown, D., Madsen, M., Bisgaard, M., 2003. Cross-contamination with Yang, B., Qu, D., Zhang, X., Shen, J., Cui, S., Shi, Y., Xi, M., Sheng, M., Zhi, S., Meng, J.,
Salmonella on a broiler slaughterhouse line demonstrated by use of epidemiological 2010. Prevalence and characterization of Salmonella serovars in retail meats of
markers. J. Appl. Microbiol. 94, 826–835. marketplace in Shaanxi, China. Int. J. Food Microbiol. 141, 63–72.
Pan, Z., Geng, S., Zhou, Y., Liu, Z., Fang, Q., Liu, B., Jiao, X., 2010. Prevalence and Yang, B., Xi, M., Wang, X., Cui, S., Yue, T., Hao, H., Wang, Y., Cui, Y., Alali, W., Meng, J.,
antimicrobial resistance of Salmonella sp. isolated from domestic animals in Eastern 2011. Prevalence of Salmonella on raw poultry at retail markets in China. J. Food
China. J. Anim. Vet. Adv. 9, 2290–2294. Prot. 74, 1724–1728.
Pitout, J.D., Thomson, K.S., Hanson, N.D., Ehrhardt, A.F., Coudron, P., Sanders, C.C., Yang, B., Qiao, L., Zhang, X., Cui, Y., Xia, X., Cui, S., Wang, X., Meng, X., Ge, W., Shi, X.,
1998. Plasmid-mediated resistance to expanded-spectrum cephalosporins among 2013. Serotyping, antimicrobial susceptibility, pulse field gel electrophoresis analysis
Enterobacter aerogenes strains. Antimicrob. Agents Chemother. 42, 596–600. of Salmonella isolates from retail foods in Henan Province, China. Food Control 32,
Poirel, L., Karim, A., Mercat, A., Le Thomas, I., Vahaboglu, H., Richard, C., Nordmann, P., 228–235.
1999. Extended-spectrum β-lactamase-producing strain of Acinetobacter baumannii Zhang, A.-Y., Wang, H.-N., Tian, G.-B., Zhang, Y., Yang, X., Xia, Q.-Q., Tang, J.-N., Zou, L.-
isolated from a patient in France. J. Antimicrob. Chemother. 43, 157–158. K., 2009. Phenotypic and genotypic characterisation of antimicrobial resistance in
Pokharel, B.M., Koirala, J., Dahal, R.K., Mishra, S.K., Khadga, P.K., Tuladhar, N., 2006. faecal bacteria from 30 Giant pandas. Int. J. Antimicrob. Agents 33, 456–460.
Multidrug-resistant and extended-spectrum beta-lactamase (ESBL)-producing Ziech, R.E., Lampugnani, C., Perin, A.P., Sereno, M.J., Sfaciotte, R.A.P., Viana, C., Soares,
Salmonella enterica (serotypes Typhi and Paratyphi A) from blood isolates in Nepal: V.M., Pinto, J.P.d.A.N., dos Santos Bersot, L., 2016. Multidrug resistance and ESBL-
surveillance of resistance and a search for newer alternatives. Int. J. Infect. Dis. 10, producing Salmonella spp. isolated from broiler processing plants. Braz. J. Microbiol.
434–438. 47, 191–195.
Qiang, Y.Z., Qin, T., Fu, W., Cheng, W.P., Li, Y.S., Yi, G., 2002. Use of a rapid mismatch

51