ORIGINAL RESEARCH

Antimicrobial-resistant genes associated with Salmonella

spp. isolated from human, poultry, and seafood sources
Yemisi O. Adesiji1,2, Vijaya Kumar Deekshit1 & Indrani Karunasagar1
1
Department of Fisheries Microbiology, Karnataka Veterinary Animal and Fisheries Sciences University, College of Fisheries, Mangalore 575002,
India

Keywords Abstract
Antimicrobial resistance, India, Nigeria,
resistant genes, Salmonella Antimicrobial-resistant salmonellosis is a significant public health concern glob-
ally. A study was conducted to screen for Salmonella species from a total of 120
Correspondence samples, of which 50 were retail meat samples purchased from five randomly
Yemisi O. Adesiji, Department of Fisheries selected sales outlets in the city of Mangalore, India. Twenty poultry fecal mate-
Microbiology, Karnataka Veterinary, Animal rials freshly voided before slaughter were obtained with sterile spatula and
and Fisheries Sciences University, College of
placed in sterile sealable polythene envelopes, and 20 clams were purchased
Fisheries, Mangalore 575002, India.
Tel: +2348032948270; Fax: 038-720225;
from the estuaries of Nethravathi and Kankarnady market. In addition, 30 clini-
E-mail: [email protected] cal isolates from Nigeria suspected to be Salmonella by only cultural character-
ization were also included in the study. In all, 30 samples—6 poultry, 8
Present address seafood, and 16 Salmonella isolates from clinical samples—were confirmed
Yemisi O. Adesiji, Department of Medical positive by PCR and used in this study. The disk-diffusion test was performed
Microbiology and Parasitology, College of to determine the zone of inhibition, and detection of resistance genes was tested
Health Sciences, LadokeAkintola University of
by PCR targeting various antimicrobial genes. Resistance to tetracycline (TET),
Technology, PMB 4000, Nigeria
cotrimoxazole, nalidixic acid, nitrofurantion, and piperacillin/tazobactin was
found in 66.7%, 60%, 53.3%, 50% and 50% of the isolates, respectively. About
Funding Information 60–100% of MDR isolates possessed antibiotic-resistant genes, of the tetracy-
Laboratory support and mentorship from Prof. clines resistant isolates, 20 (100%) 6 (30%), 7 (35%), and 10 (50%) carried
Indrani Karunasagar of College of Fisheries, tetA, tetB, tetC, and tetG genes, respectively. Of 18 cotrimoxazole-resistant
Karnataka Veterinary, Animal And Fisheries strains, 18 (100%), 14 (77.7%), and 4 (22.2%) had sul1, sul2, and sul3 genes,
Sciences University, Mangalore, India, is respectively. Of the 14 multidrug-resistant isolates tested, 8 (61%) and 9 (69%)
appreciated. One-year Research Training
were positive for cmlA and cmlB genes, respectively, 10 (1.4%) tested positive
Fellowship for Developing Country Scientists
support was provided by CICS, India.
for aph(3)11a genes, 8 (57%) tested positive for aac(3)lla, while none was posi-
tive for the aac6 gene. The results show the presence of antibiotic-resistant Sal-
Received: 27 December 2013; Revised: 31 monella spp. in food samples from India and in human samples from Nigeria.
March 2014; Accepted: 6 April 2014

Food Science & Nutrition 2014; 2(4): 436–

442

doi: 10.1002/fsn3.119

The extensive use of antimicrobials in humans and ani-

Introduction
mals has led to an increase in multidrug resistance among
Salmonellosis encompasses a wide spectrum of diseases in several bacterial strains. Multidrug-resistant (MDR) Sal-
humans and animals which may manifest as acute gastro- monella strains have been among the major public health
enteritis, bacteremia, and extraintestinally localized infec- concerns worldwide, while sea food, chickens, and fish
tions involving many organs. Although intestinal infection are known to be important reservoirs of Salmonella spp.
caused by nontyphoid Salmonella serotypes is usually self- (Bhowmick et al. 2009).
limiting, effective antimicrobial therapy is essential if The incidence of resistance to antibiotics of bacteria
spread beyond the intestine occurs (Dione et al. 2011). originating from food animals or retail meat is on the

436 ª 2014 The Authors. Food Science & Nutrition published by Wiley Periodicals, Inc. This is an open access article under the terms of
the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium,
provided the original work is properly cited.
 20487177, 2014, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/fsn3.119 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [27/01/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Y. O. Adesiji et al. Antimicrobial-Resistant Genes in Salmonella

rise in developing countries (Van et al. 2007), possibly

Bacterial isolation
as a result of the inappropriate or uncontrolled use of
antibiotics in farming practices. Subsequent transmission Salmonella was isolated by the conventional method as
of antimicrobial resistance to humans can be in the per the protocols recommended by FDA and Andrew
form of either resistant pathogens or commensal organ- (1996). A sample weight of 25 g was homogenized with
isms carrying transferable resistance genes. However, a 225 mL of lactose broth for 2 min. The mixture was then
number of studies have investigated the assertion that incubated at 37°C for 24 h. One milliliter each of pre-
the use of antimicrobial agents in animal production enriched sample was added to 10 mL each of selenite cys-
systems might lead to either a sustained increase in tine broth (SCB). The inoculated SCB was incubated at
antimicrobial resistance among animal pathogens or the 37°C for 24 h. Subsequently a loop full of culture from
occurrence of drug-resistant pathogens in people (Heid- each of these broths was streaked on Hektoen enteric agar
er et al. 2009; Mann et al. 2011; Morley et al. 2011). (HEA) and xylose lysine deoxycholate agar (XLD) and
Antibiotic resistance, especially to the most commonly incubated at 37°C for 24 h. Suspected colonies of Salmo-
used antimicrobials in humans and in animal production nella (minimum of five colonies) from each selective agar
systems, is of critical concern in Nigeria where MDR Sal- were subjected to a series of biochemical tests which
monella strains are among the most frequent causes of include oxidase, catalase, IMViC (Indole, Methylred, Vo-
bacteremia in children (Fashae et al. 2010). Salmonella ges-Proskauer, and Citrate), TSIA (triple sugar iron agar
serotypes with reduced fluoroquinolone susceptibility test), LIA (lysine iron agar test), and urease test.
from human have been documented (Akinyemi et al.
2007). A previous study which screened Salmonella spe-
Extraction of template DNA for PCR assay
cies from food handler and animal isolates showed that
the fingerprinting observed shared the same RAPD pat- One milliliter of bacteria grown overnight at 37°C in
terns, which is indicative of the fact that the food han- 5 mL of Luria–Bertani broth was dispensed aseptically in
dlers could have been infected from the animal sources as an Eppendorf tube. Bacterial genomic DNA was extracted
samples were collected from sites used by food handlers using the cetyl trimethyl ammonium bromide (CTAB)
(Smith et al. 2011). method as described previously by Ausubel et al. (1992).
Thus, assessing the distribution of resistance genes in The DNA quantity and quality was determined using a
bacterial population represents a more detailed and NanoDrop ND-1000 spectrophotometer (NanoDrop
potentially useful additional tool for improving our Technologies, Thermo Scientific, Pittsburgh, PA) by mea-
understanding of Antimicrobial resistance epidemiology, suring the absorbance at 260 nm and the ratio of A260/
particularly in southwestern Nigeria where such informa- A280, respectively.
tion is limited. Therefore, this study intends to docu- PCR was performed using genus-specific primers hns
ment the frequency and trends of antimicrobial (Jones et al. 1993) and invA (Rahn et al. 1992). Briefly,
resistance present in the Salmonella isolates from Nigeria the reaction was performed in 30 lL volumes containing
and India. 3 lL of 109 buffer (100 mmol/L Tris-HCl [pH 9],
1.5 mmol/L MgCl2, 50 mol/L KCl, and 1% gelatin),
50 lmol/L of each of the four deoxyribonucleotide tri-
Methods
phosphates (dATP, dGTP, dCTP, and dTTP), 10 pmol of
each primer pair, and 1.0 U of Taq DNA polymerase with
Sample collection
2 lL of template DNA. The optimized PCR conditions
A total of 120 samples were screened. Of these, 50 consisted of an initial denaturation at 95°C for 5 min fol-
were retail meat samples purchased from five ran- lowed by 35 cycles of denaturation at 95°C for 1 min,
domly selected sales outlets in the city of Mangalore. annealing at 55°C for 1 min, extension at 72°C for
Twenty poultry fecal materials freshly voided before 1 min, and a final extension at 72°C for 10 min. The
slaughter were obtained with sterile spatula and placed amplified products were resolved by electrophoresis on
in sterile sealable polythene envelopes, and 20 clams 2.5% agarose gel, stained with ethidium bromide, and
purchased from the estuaries of Nethravathi and the visualized under UV light using a gel documentation sys-
Kankarnady market, Mangalore, were placed in a ster- tem (Herolab, Wiesloch, Germany).
ile bottle. In addition, 30 isolates of suspected Salmo-
nella cultures (not previously confirmed by PCR) from
Antimicrobial susceptibility testing
collection in the Department of Medical Microbiology,
University of Ilorin Teaching Hospital, Nigeria, were The antimicrobial susceptibility test was performed using
also screened. the disk diffusion method as described by Bauer et al.

ª 2014 The Authors. Food Science & Nutrition published by Wiley Periodicals, Inc. 437
 20487177, 2014, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/fsn3.119 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [27/01/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Antimicrobial-Resistant Genes in Salmonella Y. O. Adesiji et al.

(1966). Overnight-grown cultures in Luria–Bertani broth carried tetA gene and 30% (6), 35% (7), and 50% (10) of
(HiMedia Laboratories Pvt. Ltd., Mumbai, India) were the isolates carried tetB, tetC, and tetG genes, respectively.
prepared in a lawn on Mueller Hinton agar. The antibiot- Figs 3 and 4 shows the plate of representative sample of
ics disks were placed aseptically on it and incubated at tetA and tetB genes recovered from the isolates. Of 18 co-
37°C for 16–18 h. Clinical and Laboratory Standards trimoxazole-resistant strains, 18(100%), 14 (77.8%), 4
Institute (CLSI) guidelines were used to interpret results (22.2%) had sul1, sul2, and sul3 genes, respectively.
(CLSI 2010). The following antimicrobials were used: Table 2 shows the summary of resistant pattern and genes
ampicillin (AMP, 20 lg), cefotaxime (CTX, 300 lg), chl- from all isolates. Six isolates were resistant to chloram-
oramphenicol (C, 30 lg), tetracycline (TET, 30 lg), cip- phenicol, but more isolates (10 of 14 multidrug resistant)
rofloxacin (CIP, 5 lg), gentamicin (GEN, 10 lg), were positive for floR and cat 2 genes, while 2 (30%) was
nalidixic acid (NA, 30 lg), cotrimazole (COT, 25 lg), positive for cat 3 genes. Of 14 multidrug-resistant isolates
tetracycline (TET), nitrofurantion (NIT, 30 lg), imepe- tested 8 (61%) and 9 (69%) were positive for cmlA and
nem (IPM, 10 lg), meropanem (MRP, 10 lg), piperaci- cmlB genes, respectively.
lin/tazobactin (PIT, 100/10). Antibiotics were
manufactured by Himedia (Mumbai, India).
Discussion
Monitoring antimicrobial resistance trends among bacte-
Antimicrobial resistance gene detection
ria isolated from food, animals, and humans is necessary
For detecting antimicrobial-resistant genes in 30 Salmo- to inform public policy regarding the appropriate use of
nella isolates, target genes conferring resistance to tetracy- antimicrobial agents in veterinary and human medicine
clines (tetA, tetB, tetC, tetD, tetE, and tetG), sulfonamides (Cummings et al. 2013). Some studies conducted in Nige-
(sul1, sul2, and sul3), chloramphenicol (cat1, cat2, and ria also indicated considerable prevalence of Salmonella
cat3, cmlA, cmlB, floR) and aminoglycosides (aph(3)11a, both in veterinary and clinical samples (Fasure et al.
aac(3)11a and aac6) were screened by PCR with their 2012; Ogunleye et al. 2013).
respective primers. The cycling conditions and primer In this study, high levels of resistance were found to
sequences were as described by Ma et al. (2007). The trimethoprim-sulfamethoxazole, TET, and GEN; 66.7%,
PCR was performed in 30 lL volumes containing 3 lL of 60%, 53.3%, and 50%, respectively. A comparative study
109 buffer (100 mmol/L Tris-HCl [pH 9], 1.5 mmol/L in Ibadan, Nigeria, reported a high frequency (87%) of
MgCl2, 500 mmol/L KCl, 0.1% gelatin), 100 lmol/L con- reduced susceptibility to CIP among the chicken isolates
centrations each of dATP, dTTP, dGTP, and dCTP, and a high frequency of resistance to TET (93%), NA
10 pmol of each primer, and 0.9 U of Taq DNA polymer- (81%), and sulfamethoxazole (87%), while resistance to
ase (Bangalore Genei, Bangalore, India), with 2.0 lL of chloramphenicol, sulfamethoxazole, trimethoprim, and
template DNA. The reactions were carried out using a AMP ranged from 36% to 59% for the human isolates
thermal cycler (MJ Research, Bio-Rad, Hercules, CA). Pri- (Fashae et al. 2010). In another study, 100% resistance to
mer sequence and cycling conditions are summarized in fluoroquinolones from clinical isolates from northern
Table 1. part of Nigeria was reported (Akyala et al. 2013). Only
one poultry isolate from chicken was resistant to CIP in
the present study, but reduced susceptibility was observed
Results
for clinical isolates; and all clam isolates from India were
All the isolates used in the study were confirmed as Sal- resistant to NA while in contrast Fashae et al. (2010) in
monella by PCR amplification of the hns and invA genes, his previous study reported that four Salmonella Derby
which generated amplicons of 152 and 284 bp, respec- isolates from their chickens showed reduced susceptibility
tively (Figs. 1 and 2). A total of 30 samples were con- to CIP and high susceptibility to NA. High level of resis-
firmed positive for Salmonella by conventional as well as tance to NA 16 (53%) as observed in this study particu-
by molecular methods. Six Salmonella isolates from poul- larly from food animal reaffirms the importance of the
try, eight from seafood, and 16 from clinical samples were need for strengthening collaboration between veterinary
used in this study. Resistance to TET, cotrimoxazole, NA, and public health sectors on appropriate detection and
NIT, and piperacillin/tazobactin was found in 20 (66.7%), reporting of zoonotic foodborne pathogens (Adesiji and
18 (60%), 16 (53.3%), 15 (50%) and 15 (50%) of the iso- Fagbami 2006). In addition, the result obtained from this
lates, respectively. Resistance to chloramphenicol, CTX, study is of high significance because treatment with anti-
AMP, and GEN was also detected in 20–10% of the iso- microbials is crucial for the proper management of severe
lates. About half (50.5%) of the isolates were resistant to or invasive human salmonellosis. Fluoroquinolones and
at least one antibiotic. All of the 20 TET-resistant isolates third-generation cephalosporins are now commonly used

438 ª 2014 The Authors. Food Science & Nutrition published by Wiley Periodicals, Inc.
 20487177, 2014, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/fsn3.119 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [27/01/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Y. O. Adesiji et al. Antimicrobial-Resistant Genes in Salmonella

Table 1. Primer sequences and their annealing temperatures used in this study.

Resistance Product Annealing Code of

gene Primer Nucleotide sequence 50 –30 size (bp) temperature (°C) antibiotics References

tetA F TTGGCATTCTGCATTCACTC 494 55 TET Ma et al. (2007)

R GTATAGCTTGCCGGAAGTCG
tetB F CAGTGCTGTTGTGTCATTAA 571 55 TET Ma et al. (2007)
R GCTTGGAATACTGAGTGTAA
tetC F CTTGAGAGCCTTCAACCCAG 418 55 TET Ma et al. (2007)
R ATGGTCGTCATCTACCTGCC
tetD F GCTCGGTGGTATCTCTGCTC 546 55 TET Ma et al. (2007)
R AGCAACAGAATCGGGAACAC
tetE F TATTAACGGGCTGGCATTTC 544 55 TET Ma et al. (2007)
R AGCTGTCAGGTGGGTCAAAC
tetG F GCTCGGTGGTATCTCTGCTC 550 55 TET Ma et al. (2007)
R CAAAGCCCCTTGCTTGTTAC
Sul1 F TTTCCTGACCCTGCGCTCTAT 793 55 COT Ma et al. (2007)
R GTGCGGACGTAGTCAGCGCCA
Sul2 F CCTGTTTCGTCCGACACAGA 667 55 COT Ma et al. (2007)
R GAAGCGCAGCCGCAATTCAT
Sul3 F ATGAGCAAGATTTTTGGAATCGTAA 792 55 COT Ma et al. (2007)
R CTAACCTAGGGCTTTGGTATTT
cat1 F AACCAGACCGTTCAGCTGGAT 549 55 CHL Zhao et al. (2001)
R CCTGCCACTCATCGCAGTAC
cat2 F AACGGCATGAACCTGAA 547 55 CHL Ma et al. (2007)
R ATCCCAATGGCATCGTAAAG
cat3 F ATCGGCATCGGTTACCATGT 310 55 CHL Ma et al. (2007)
R ATCCCCTTCTTGCTGATATT
cmlA F GGCCTCGCTCTTACGTCATC 662 55 CHL Ma et al. (2007)
R GCGACACCAATACCCACTAGC
cmlB F ACTCGGCATGGACATGTACT 840 55 CHL Ma et al. (2007)
R ACGGACTGCGGAATCCATAG
floR F ATGACCACCACACGCCCCG 198 55 CHL Ma et al. (2007)
R AGACGACTGGCGACTTCTTCG
aac(3)11a, F CGGCCTGCTGAATCAGTTTC 439 55 GEN Ma et al. (2007)
R AAAGCCCACGACACCTTCTC
aph(3)11a F TCTGAAACATGGCAAAGGTAG 582 55 GEN Ma et al. (2007)
R AGCCGTTTCTGTAATGAAGGA
aac6 F TTGGACGCTGAGATATATGA 476 55 GEN Ma et al. (2007)
R GCTCCTTTTCCAGAATACTT
blaTEM-1 F CAGCGGTAAGATCCTTGAGA 643 55 Control Ma et al. (2007)
R ACTCCCCGTCGTGTAGATAA
16S rDNA F AGAGTTTGATCMTGGCTCAG 907 55 Control Ma et al. (2007)
R CCGTCAATTCMTTTRAGTTT

TET, tetracycline; GEN, gentamicin; COT, cotrimazole.

in adults for treatment due to widespread resistance to limitation of this study was its inability to compare
chloramphenicol, AMP, and cotrimoxazole. Fluoroquinol- human and clinical isolates from the same country set-
ones are often the last resort for treatment of children ting due to the fact that all veterinary samples suspected
and are listed by the World Health Organization as criti- to be Salmonella were not confirmed positive by PCR.
cally important antimicrobials for human health (Colli- Resistance to traditional antibiotics (AMP, TET, and
gnon et al. 2009). Prescription pattern, availability, and SUL) was high in Salmonella isolates from animals and
cost-effectiveness of quinolones as drugs that are usually foods of animals as observed in this study, previously
prescribed in the management of most resistant bacterial reported by Deekshit et al. (2012). It is apparent that
infections were suggested as factors that could be respon- resistance to traditional antibiotics such as TETs, AMPs,
sible for continued rapid evolution of fluoroquinolone- and cotrimoxazole and detection of their genes in micro-
resistant bacteria in Nigeria (Lamikanra et al. 2011). The bial populations of both countries constitute a public

ª 2014 The Authors. Food Science & Nutrition published by Wiley Periodicals, Inc. 439
 20487177, 2014, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/fsn3.119 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [27/01/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Antimicrobial-Resistant Genes in Salmonella Y. O. Adesiji et al.

M 1 2 3 4 5 M 1 2 3 4 5 6 7 8 9 10 11 12

Figure 3. Showing representative Tet A gene from Salmonella. Lane

Figure 1. PCR amplification of invA gene. Lane M: 100 bp DNA M- 100bp marker, Lane 2: Positive control, Lanes 3-11: test samples
Ladder (Genei TM, Merck Bangalore) Lane 1: Positive control (ATCC and Lane 12: negative control.
14028) Lane 2: Negative control Lanes 3-5: Samples positive for
Salmonella spp.
use (Yaqoob et al. 2007). The present study showed
detection of cat 1 gene in all the six resistant genes and
health concern by limiting the therapeutic choices for in all 14 multiresistant isolates as well as most susceptible
treating salmonellosis in animals and humans. More so, isolates. Five human isolates harbored catA genes while 8
in most developing countries such as Nigeria and India, of 10 that harbored cat gene from animal samples were
many of these antibiotics are also used commonly in susceptible to chloramphenicol in vitro. In addition, cat
human therapy due to their low cost and ready availabil- 2 was detected in all the raw food isolates, floR was
ity (Wannaprasat et al. 2011). TET-resistant genes occur detected in all 13 florfenicol-resistant Salmonella isolates,
most frequently in our study, all of the 20 TET-resistant and floR was detected in all 6 florfenicol-resistant Salmo-
isolates carried tetA gene and 30% (6), 35% (7), and nella isolates. Chloramphenicol used to be the drug of
50% (10) of the isolates carried tet B, tet C, and tet G, choice in the treatment of Salmonella-related infections
genes, respectively. TET-resistant genes were also detected in Nigeria after which a survey revealed 72.4–89.2%
in most TET-susceptible and resistant isolates. Thus the increase from 1997 to 2007, thus limiting its therapeutic
present results and those of Deekshit et al. (2012) agree value (Akinyemi et al. 2006). Aminoglycoside-resistant
that some antimicrobial-resistant genes are “silent” in isolates from clinical specimens and food of animal ori-
bacteria in vitro; it further provides an indication that gin is of public health importance in developing coun-
these silent genes can spread to other bacteria or turn on tries because they are used to treat a wide variety of
in vivo, especially under selection pressure of antibiotic infections Davis et al. (2002). The two aminoglycoside-
resistant genes aph(3)-IIa and aac311a were detected in

M 1 2 3 4 5
M 1 2 3 4 5 6 7 8

Figure 2. PCR amplification of hns gene. Lane M: 100 bp DNA

Ladder (Genei TM, Bangalore) Lane 1: Positive control (ATCC 14028) Figure 4. Showing representative tetB gene from Salmonella. Lane
Lane 2: Negative control Lanes 3-5: Samples positive for Salmonella M: 100bp marker, Lane 2: Positive control Lanes 3-7: test samples,
spp. Lane 8: Negative control.

440 ª 2014 The Authors. Food Science & Nutrition published by Wiley Periodicals, Inc.
 20487177, 2014, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/fsn3.119 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [27/01/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Y. O. Adesiji et al. Antimicrobial-Resistant Genes in Salmonella

Table 2. Antimicrobial resistance and resistant gene profiles of Salmonella isolates from retail raw food obtained from India and clinical isolates
from Nigeria.

Sample
Isolates Antimicrobial resistance profile Antimicrobial-resistant gene(s) source Country

Sal 6 TET-PIT-NIT tet A, tetD, tetG, sul 1, cat2, cat 3, cmlB Clinical Nigeria
Sal 8 TET-COT-C-CTX-AMP Tet A, tetB, tetC, tet G, Sul1, sul2, Cat1, Cat2, Cat 3, floR, aac(3)11a, aph(3)11a Clinical Nigeria
Sal 10 TET-COT-C-AMP tet A, tet B, tet C, tet C, sul1, sul2, cat1, cat2, floR, aac(3)11a, aph(3)11a Clinical Nigeria
Sal 14 TET-COT-C-CTX-AMP Tet A, tet B, tet C, sul1, cat1, cat 2, cmlA, cmlB, floR, aac(3)11a, aph(3)11a Clinical Nigeria
Sal 15 TET-COT-GEN-NA-C-CTX-AMP tet A, tet B, sul1 cat1, cat2, cmlA, cmlB, floR, aac(3)11a, aph(3)11a Clinical Nigeria
Sal 16 TET-COT-GEN-CTX-AMP tet A, tet B, tet C, Sul 1, Sul2, Cat2, cmlA, cmlB, floR, aac(3)11a, aph(3)11a Clinical Nigeria
Sal 17 TET-NA-NIT tet A, TetD, floR Poultry India
Sal 18 MRP-TET-COT-NA-NIT tet A, Tet C, sul1, Cat2 cmlA, floR, aac(3)11a, aph(3)11a Poultry India
Sal 19 TET-COT-NIT tet A, Tet C, tetD, Sul1, floR Cat2 Poultry India
Sal 20 TET-COT-NA-NIT tet A, tetD, tetG, sul 1, Sul2, cat2, cmlB Poultry India
Sal 21 MRP-TET-CIP-PIT-GEN-NA, tet A, tet C, Tet D, Sul 1, cat1, cat3, aac(3)11a, aph(3)11a Poultry India
CTX-AMP-NIT
Sal 22 MRP-TET-NA-CTX-AMP-NIT tet A, sul1, cat1, cat3, aac(3)11a, aph(3)11a Poultry India
Sal 25 TET-COT, PIT, NA, NIT tet A, sul1, sul2, sul3, cat1, cmlA, cmlB, floR Clam India
Sal 30 TET, COT, PIT, NA, NIT tet A, Sul 1, sul2, cat1, cmlA, cmlB, floR Clam India

Amp, ampicillin; CTX, cefotaxime; TET, tetracycline; CIP, ciprofloxacin; GEN, gentamicin; NA, nalidixic acid; COT, cotrimazole; NIT, nitrofurantion;
IPM, imepenem; MRP, meropanem; PIT, piperacilin/tazobactin.

all the three aminoglycoside-resistant isolates in the pres-

References
ent study. Of the 14 multiresistant genes, 10 (71.4%)
aminoglycoside-resistant genes aph(3)11a tested positive Adesiji, Y. O., and A. H. Fagbami. 2006. Epidemiology of
and eight tested positive for the aac311a gene. Chicken bacterial zoonosis in Nigeria. Niger. J. Health Biomed. Sci.
and clinical isolates were only positive for aminoglyco- 5:20–25.
side-resistant genes and none from the clam isolates. The Akinyemi, O. K., S. I. Smith, A. O. Oyefolu, K. A. Fasure, and
fact that only three isolates were resistant in vitro (one A. O. Coker. 2006. Trends of multiple drug resistance in
clinical and two from chicken) and susceptible aminogly- Salmonella enterica serovar typhi in Lagos, Nigeria. East
coside isolates tested positive to aminoglycoside-resistant Cent. Afr. J. Surg. 12:83–88.
genes is noteworthy. Thus, the present results and those Akinyemi, K. O., W. Phillip, W. Beyer, and R. Bohm. 2007. In
of Maynard et al. (2003) indicate that some antimicrobial vitro antimicrobial susceptibility patterns of Salmonella
resistance genes are “silent” in bacteria in vitro; however, enterica serovars and emergence of Salmonella phage type
these silent genes can spread to other bacteria or turn on DT071 in a suspected community associated outbreak in
in vivo, especially under antimicrobial pressure. The Lagos, Nigeria. J. Infect. Dev. Ctries. 1:48–54.
results show antibiotic resistance in Salmonella spp. found Akyala, A. I., M. Katsa, T. H. Yakubu, D. Ashfo, and S.
in food samples from India and clinical Salmonella Anzene. 2013. Incidence of antimicrobial resistance pattern
isolates in Nigeria. of some clinical isolates of Salmonella typhi in Akwanga,
Nasarrawa State, Nigeria: J. Med. Biomed. Sci. 4:1–5.
Ausubel, F., R. Brent, R. E. Kingston, D. D. Moore, J. G.
Acknowledgments Seidman, J. A. Smith, et al. 1992. Current protocols in
molecular biology. 2nd ed. Green Publications Associations,
Financial Support from Indian Council of Medical
New York.
Research, Government of India is gratefully acknowledged.
Bauer, A. W., W. M. M. Kirby, J. C. Sherris, and M. Turck.
Project no: AMR/37/2011/ECD-1. One year Research
1966. Antibiotic susceptibility testing by standardized single
Training Fellowship for Developing Country Scientist sup-
disc method. Am. J. Clin. Pathol. 45:493–496.
port was provided by Center For International Co-opera-
Bhowmick, P.P., D. Devegowda, H. A. Ruwandeepika, I.
tion in Science, Department of Science and Technology,
Karunasagar, and I. Karunasagar. 2009. Presence of
India.
Salmonella. J. Fish Dis. 32:801–805.
Clinical and Laboratory Standards Institute [CLSI]. 2010.
Conflict of Interest Performance Standards for Antimicrobial Susceptibility
Testing; Twentieth Informational Supplement. CLSI
None declared.

ª 2014 The Authors. Food Science & Nutrition published by Wiley Periodicals, Inc. 441
 20487177, 2014, 4, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/fsn3.119 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [27/01/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Antimicrobial-Resistant Genes in Salmonella Y. O. Adesiji et al.

document M100-S20. Clinical and Laboratory Standards fluoroquinolone-resistant E. coli in Nigeria temporally
Institute, Wayne, PA. associated with fluoroquinolone use. BMC Infect. Dis.
Collignon, P., J. H. Powers, T. M. Chiller, A. Aidara-Kane, and 11:312.
F. M. Aarestrup. 2009. World Health Organization ranking Ma, M., H. I. Wang, Yu Y Yong, D. Zhang, and S. Liu. 2007.
of antimicrobials according to their importance in human Detection of antimicrobial resistance genes of pathogenic
medicine: a critical step for developing risk management Salmonella from swine with DNA microarray. J. Vet. Diagn.
strategies for the use of antimicrobials in food production Invest. 19:161–167.
animals. Clin. Infect. Dis. 49:132–141. Mann, S., J. D. Siler, D. Jordan, and L. D. Warnick. 2011.
Cummings, K. J., G. A. Perkins, S. M. Khatibzadeh, L. D. Antimicrobial susceptibility of fecal Escherichia coli isolates
Warnick, and C. Altier. 2013. Antimicrobial resistance in dairy cows following systemic treatment with ceftiofur or
trends among Salmonella isolates obtained from dairy cattle penicillin. Foodborne Pathog. Dis. 8:861–867.
in the northeastern United States, 2004–2011. Foodborne Maynard, C., J. M. Fairbrother, S. Bekal, F. Sanschagrin, R. C.
Pathog. Dis. 10:353–361. Levesque, R. Brousseau, et al. 2003. Antimicrobial resistance
Davis, M. A., D. D. Hancock, and T. E. Besser. 2002. genes in enterotoxigenic Escherichia coli O149:K91 isolates
Multiresistant clones of Salmonella enterica: the importance obtained over a 23-year period from pigs. Antimicrob.
of dissemination. J. Lab. Clin. Med. 140:135–141. Agents Chemother. 47:3214–3221.
Deekshit, V. K., B. K. Kumar, P. Rai, S. Srikumar, I. Morley, P. S., D. A. Dargatz, D. R. Hyatt, G. A. Dewell, J. G.
Karunasagar, and I. Karunasagar. 2012. Detection of class 1 Patterson, B. A. Burgess, et al. 2011. Effects of restricted
integrons in Salmonella Weltevreden and silent antibiotic antimicrobial exposure on antimicrobial resistance in fecal
resistance genes in some seafood-associated nontyphoidal Escherichia coli from feedlot cattle. Foodborne Pathog. Dis.
isolates of Salmonella in south-west coast of India. J. Appl. 8:87–98.
Microbiol. 112:1113–1122 doi: 10.1111/j.13652672.2012. Ogunleye, A. O., A. T. P. AjuwapeA. I. Adetosoye, and S. A.
05290 Carlson. 2013. Characterization of Salmonella enterica Ituri
Dione, M. M., U. Ikumapayi, D. Saha, N. I. Mohammed, R. isolated from diseased poultry in Nigeria. Afr. J. Biotechnol.
A. Adegbola, S. Geerts, et al. 2011. Antimicrobial resistance 12:21–25.
and virulence genes of non-typhoidal Salmonella isolates Rahn, K., S. A. De-Grandis, R. C. Clarke, S. A. McEwen, J. E
in The Gambia and Senegal. J. Infect. Dev. Ctries. 5:765– Gala0 n, C Ginocchio, et al. 1992. Amplification of an invA
775. gene sequence of Salmonella typhimurium by polymerase
Fashae, K., F. Ogunsola, F. M. Aarestrup, and R. S. chain reaction as a specific method of detection of
Hendriksen. 2010. Antimicrobial susceptibility and serovars Salmonella. Mol. Cell. Probes 6:271–279.
of Salmonella from chickens and humans in Ibadan, Nigeria. Smith, S. I., M. A. Fowora, H. A. Goodluck, F. O. Nwaokorie,
J. Infect. Dev. Ctries. 4:484–494. O. O. Aboaba, and B. Opere. 2011. Molecular typing of
Fasure, A. K., A. M. DejiAgboola, and K. Akinyemi. 2012. Salmonella spp. isolated from food handlers and animals in
Antimicrobial resistance patterns and emerging Nigeria. Int. J. Mol. Epidemiol. Genet. 2:73–77.
fluoroquinolone resistant Salmonella isolates from poultry Van, T. T., G. Moutafis, T. Istivan, L. T. Tran, and P. J. Coloe.
and asymptomatic poultry workers. Afr. J. Microbiol. Res. 2007. Detection of Salmonella spp. in retail raw food
6:2610–26152. samples from Vietnam and characterization of their
Food and Drug Administration (FDA), and Andrew, W. H. antibiotic resistance. Appl. Environ. Microbiol. 73: 6885–
1996. AOAC INTERNATIONAL’s three validation programs 6890.
for methods used in the microbiological analysis of foods. Wannaprasat, W., P. Padungtod, and R. Chuanchuen. 2011.
Trends Food. Sci. Technol. 7:147–151. In Bacteriological Class 1 integrons and virulence genes in Salmonella enterica
analytical annual 8th ed. Pp. 25–35. isolates from pork and humans. Int. J. Antimicrob. Agents
Heider, L. C., J. A. Funk, A. E. Hoet, R. W. Meiring, W. A. 37:457–461.
Gebreyes, and T. E. Wittum. 2009. Identification of Yaqoob, E., I. Hussain, and I. U. Rahman. 2007. Molecular
Escherichia coli and Salmonella enterica organisms with characterization by using random amplified polymorphic
reduced susceptibility to ceftriaxone from fecal samples of DNA (RAPD) analysis of Salmonella enteritidis isolates
cows in dairy herds. Am. J. Vet. Res. 70:389–393. recovered from avian and human sources. Pakistan Vet. J.
Jones, D. D., R. Law, and A. K. Bej. 1993. Detection of 27:102–104.
Salmonella spp. in oysters using polymerase chain reaction Zhao, S., D. G. White, B. Ge, S. Ayers, S. Friedman, L.
(PCR) and gene probes. J. Food Sci. 58:1191–1197 doi:10. English, et al. 2001. Identification and characterization of
1089/fpd.2012.1285. integron-mediated antibiotic resistance among Shiga toxin
Lamikanra, A., J. L. Crowe, R. S. Lijek, B. W. Odetoyin, J. producing Escherichia coli isolates. Appl. Environ. Microbiol.
Wain, A. O. Aboderion, et al. 2011. Rapid evolution of 67:1558–1564.

442 ª 2014 The Authors. Food Science & Nutrition published by Wiley Periodicals, Inc.