Osong Public Health Res Perspect 2016 7(6), 373e377

http://dx.doi.org/10.1016/j.phrp.2016.10.002
pISSN 2210-9099 eISSN 2233-6052

- ORIGINAL ARTICLE -

Rapid Molecular Approach for Simultaneous

Detection of Salmonella spp., Shigella spp., and
Vibrio cholera
Reza Ranjbar a,*, Ali Naghoni a, Davoud Afshar b, Farhad Nikkhahi c,
Mohsen Mohammadi d
a
Molecular Biology Research Center, Baqiyatallah University of Medical Sciences, Tehran, Iran.
b
Department of Microbiology, Faculty of Medicine, Zanjan University of Medical Sciences, Zanjan, Iran.
c
Department of Pathobiology, School of Public Health, Tehran University of Medical Sciences, Tehran,
Iran.
d
Department of Pharmaceutical Biotechnology, Faculty of Pharmacy, Lorestan University of Medical
Sciences, Khorramabad, Iran.

Received: August 21, Abstract

2016 Objectives: Gastrointestinal tract infection is still one of the serious public
Revised: September health problems in many geographic areas and is endemic in most countries
22, 2016 including Iran. Early detection of the gastrointestinal tract pathogens can be
Accepted: October 10, extremely important. The aim of the current study was to apply a shortened
2016 time-multiplex polymerase chain reaction (PCR) for rapid and simultaneous
detection of Salmonella spp., Shigella spp., and Vibrio cholera.
KEYWORDS: Methods: The standard and clinical strains of Salmonella spp., Shigella spp., and
multiplex PCR, V. cholerae were used in the assay. Multiplex PCR was performed and optimized
based on amplification of invA, putative integrase, and ompW genes for
Salmonella spp.,
detecting Salmonella spp., Shigella spp., and V. cholerae, respectively. The
Shigella spp.,
specificity of the assay was evaluated by testing 12 different bacterial species.
Vibrio cholerae
Results: Only Salmonella spp., Shigella spp., and V. cholerae strains had positive
results when subjected to the assay using multiplex PCR. The assay showed a high
sensitivity, and no amplification products were observed in multiplex PCR with
any of the other microorganisms.
Conclusion: Our study indicated that the invA, putative integrase, and ompW-
based multiplex PCR assay appears to be an efficient method for rapid and
simultaneous detection of Salmonella spp., Shigella spp., and V. cholerae.

1. Introduction enteric infections occur each year. These infections cause

significant morbidity and death in children younger than
Worldwide, gastrointestinal tract infections are the 5 years in particular and in elderly people. It has been
second most important cause of death; about 25 million estimated that 4e6 million children die each year because

*Corresponding author.
E-mail: [email protected] (R. Ranjbar).

Copyright ª 2016 Korea Centers for Disease Control and Prevention. Published by Elsevier Korea LLC. This is an open access article
under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
374 R. Ranjbar, et al

of diarrheal diseases, particularly in the developing The traditional methods for detection of bacterial
countries [1]. Numerous outbreaks of diarrheal illness infections are still primarily based on culture and sero-
caused by various microorganisms have been reported. logical methods that may take several days to be
Microorganisms such as Shigella, Salmonella, Vibrio, completed. There has been a general move toward mo-
Escherichia coli, Campylobacter jejuni, Giardia lamblia, lecular methods for microbial detection, which are based
Cryptosporidium, and Rotaviruses have been reported to less on phenotypic features and more on stable geno-
be the most important causes of diarrheal outbreaks. Sal- typic characteristics. In recent years, polymerase chain
monella spp., Shigella spp., and V. cholerae are the most reaction (PCR) and similar nucleotide-based methods
important bacterial causes of diarrhea in Iran [2e5]. have become potentially powerful alternative ap-
The diseases caused by all of these microorganisms proaches in microbiological diagnostics because of their
could be serious, resulting in death. V. cholerae causes higher user-friendliness, rapidity, reproducibility, accu-
cholera, a disease with endemic or pandemic potential racy, and affordability. These methods have also gained
characterized by watery diarrhea and vomiting, leading momentum in terms of use for rapid, specific, and sen-
to severe and rapidly progressing dehydration and shock sitive detection of foodborne pathogens [10e15].
[6]. The symptoms are caused by cholera toxin, which is Multiplex polymerase chain reaction is a variant of
produced by pathogenic strains of V. cholerae. Many PCR in which two or more loci are simultaneously
efforts have been made to introduce a more effective amplified in the same reaction [16]. This technique is a
vaccine, but many researches have shown that the powerful molecular method in microbiological di-
vaccination has no role for cholera; however, new oral agnostics that allows the simultaneous amplification of
vaccines are displaying egregious promise [7]. more than one target sequence in a single PCR reaction,
Shigellosis and salmonellosis are caused by Shigella saving considerable time and effort, and decreasing the
spp. and Salmonella spp., respectively. These organisms number of reactions to be performed in order to assess
are likely to be the common cause of diarrhea world- the possible presence of foodborne pathogens [16e18].
wide. Shigella spp. are the causative agents of inflam- In this study, we describe a multiplex PCR assay for
matory diarrhea and dysentery, thus presenting a serious the rapid and simultaneous detection of Salmonella spp.,
challenge to public health authorities worldwide [5]. Shigella spp., and Vibrio cholera.
Although shigellosis has no known animal reservoirs,
we are still lacking an effective vaccine owing to poor
immune responses to oral vaccines and existence of 2. Materials and methods
multiple serotypes [8].
Unlike Shigella, Salmonella spp. (except Salmonella 2.1. Bacterial strains
enterica subspecies Typhi) are found in many animals. The bacterial strains were obtained from the Pasteur
Thus, salmonellosis is well recognized as zoonosis dis- Institute, Tehran, Iran and used in this study (Table 1).
ease [9]. The prevalence of Salmonella infection varies Clinical isolates of the three most important foodborne
depending on the waste disposal, water supply, food bacterial pathogens including Salmonella and Shigella
preparation practices, and climate. Gastroenteritis is the were obtained from patients admitted to Children’s
most common disease among children caused by Sal- Medical Center and Baqiyatallah Hospitals in Tehran,
monella [5]. Iran, during 2012e2014. Subsequently, identification of

Table 1. Bacterial strains included in this study, and performance of the multiplex PCR assay for detecting Salmonella,
Shigella, and Vibrio cholera.

Strains Reference Multiplex PCR results

Salmonella serovar Albany ATCC 51960 þ
Salmonella serovar Enteritidis ATCC 4931 þ
Salmonella serovar Hadar ATCC 51956 þ
Salmonella serovar Reading ATCC 6967 þ
Salmonella serovar Typhi ATCC 19430 þ
Salmonella serovar Typhimurium ATCC 14028 þ
Citrobacter freundii ATCC 8090 
Escherichia coli ATCC 25922 
Shigella flexneri PTCC 1234 þ
Shigella soneii ATCC 9290 þ
Staphylococcus aureus PTCC 1189 
Vibrio cholerae PTCC 1611 þ
ATCC Z American Type Culture Collection (USA); bp Z base pair; PCR Z polymerase chain reaction; PTCC Z Persian Type Culture Collection
(Iran).
Simultaneous detection of Salmonella spp., Shigella spp., and V. cholerae 375

the references and clinical strains was confirmed by The amplified DNA was separated by 1% agarose gel
culture, biochemical testing by the API test system electrophoresis, stained with ethidium bromide, and
(BioMérieux, Marcy-l’Étoile, France), and slide agglu- visualized by UV transilluminator.
tination with serovar specific antisera (Staten Serum
Institute, Copenhagen, Denmark). V. cholerae isolates 2.4. Sensitivity and specificity
were provided by the Molecular Biology Research To determine the sensitivity of the multiplex PCR
Center affiliated to Baqiyatallah Hospital. assay, 10-fold serial dilutions were made from extracted
All bacterial strains were grown either on Brain Heart genomic DNA (498 ng/mL), and the detection limit
Infusion (BHI; Difco Laboratories, Detroit, MI, USA) or of the multiplex PCR was defined as the lowest con-
LuriaeBertani (LB) broth (Merck, Darmstadt, Ger- centration of DNA that could be amplified. The speci-
many) at 37 C for 18e24 hours. ficity of multiplex PCR was evaluated using three
species including Staphylococcus aureus PTCC (Persian
2.2. DNA extraction Type Culture Collection) 1189, E. coli ATCC (Amer-
Genomic DNAs from all microorganisms were ican Type Culture Collection) 25922, and Citrobacter
extracted using the DNA extraction kit (DNP, DNA freundii ATCC 8090 as negative controls.
Extraction Kit; Cinagene Company, Tehran, Iran) ac-
cording to the manufacturer’s instructions. DNA con-
centration and purity were spectrophotometrically 3. Results
assessed by reading A260 and A280 and confirmed by
visualization on 1% agarose gel. Then, DNA was diluted The multiplex PCR using three sets of primer pairs
to 1 mg/mL in nuclease-free water and stored at e20 C targeted for the invA, putative integrase, and ompW
until required for analysis. genes, correctly identified Salmonella spp., Shigella
spp., and V. cholerae and differentiated them by the
2.3. Primers and multiplex PCR conditions different-size bands products: three positive bands,
The AlleleID software version 7.01 (Premier Biosoft which consist of invA (403 bp), putative integrase
Int., Palo Alto, CA, USA) was used for all oligonucle- (159 bp), and ompW (592 bp) PCR products (Figure 1).
otide primers designed in this study. All primers were No amplification products were observed in multiplex
purchased from Bioneer (Daejeon, South Korea). The in PCR with any of the other microorganisms subjected to
silico specificity was analyzed using the Basic Local the assay (Table 1). The sensitivity of the multiplex PCR
Alignment Search Tool (BLAST) from the GenBank was assessed to be 5 ng/mL of the pure DNA.
database. The characteristics of the primers used for
multiplex PCR are given in Table 2.
PCR was carried out with a 50-mL mixture containing 4. Discussion
10mM TriseHCl (pH 8.3), 50mM.
In this study, we used KCl, 1.5mM MgCl2, 1 U of Salmonella spp., Shigella spp., and V. cholerae are
Taq DNA polymerase (Promega, Madison, WI, USA), responsible for large numbers of intestinal infections
0.2mM deoxynucleoside triphosphate, a 0.1mM con- in humans worldwide. Molecular techniques, such as
centration of each primers, and 5 mL of the DNA multiplex PCR, are proving useful in detection of
sample. pathogens in a wide spectrum of matrices [10,19]. This
Multiplex PCR was performed under the following technique enables us to identify these three pathogens
conditions: 35 cycles with heat denaturation at 95 C for at one experiment, obviating the need for three
30 seconds, primer annealing at 60 C for 30 seconds, separate experiments. The use of multiplex PCR sub-
and DNA extension at 72 C for 60 seconds in Eppendorf stantially reduces the time and manpower required
gradient master cycler (Roche, Mannheim, Germany). when compared with conventional methodologies. Here,

Table 2. Primers sequences used for amplification by multiplex PCR.

Primer name Sequence (50 /30 ) Product (bp) Target Reference

Vibrio-F ATAATGGCTCACCAAGAAGG 592 ompW This study
Vibrio-R TTAGAACTTATAACCACC
Shigella-F TCCGTCATGCTGGATGAACGATGT 159 Putative integrase Ranjbar et al [2]
Shigella -R ACAGTTCAGGATTGCCCGAGACACA
Salmonella-F GTATTGTTGATTAATGACATCCG 403 invA This study
Salmonella-R ATATTACGCTACGGAAACACGTT
bp Z base pair; PCR Z polymerase chain reaction.
376 R. Ranjbar, et al

method could be useful for quick detection of foodborne

pathogens.
There are inconsistent reports about the sensitivity of
multiplex PCR. According to Tsai et al [29], the sensi-
tivity of multiplex PCR is considerably lower than that
of monoplex PCR because of the primers’ interference,
so that it can be decreased several times compared with
conventional PCR. However, Al-Talib et al [30] showed
that multiplex PCR has a high level of sensitivity, and it
might be useful as an alternative diagnostic tool for
diarrheal diseases. In our study, a high level of sensi-
tivity (5 ng/mL) was also observed. It appears that the
Figure 1. The multiplex PCR results. Lanes 2e4, uniplex sensitivity of multiplex PCR is related to primer length
PCR of some representative strains of Vibrio cholera, Salmo- and can be enhanced by shortening the primers’ length.
nella spp., and Shigella spp., respectively. Lane 1, multiplex However, this modification leads to low specificity.
PCR for the same three bacterial strains in a single PCR tube.
The infections caused by enteric pathogens
M Z molecular weight (100 bp DNA ladder); PCR Z poly-
merase chain reaction.
comprise second commonest medical problems after
respiratory infectious disease [31,32]. Salmonella,
we report a multiplex PCR assay for detection of Sal- Shigella, and Vibrio are among the most prevalent and
monella, Shigella, and V. cholerae based on invA, endemic food and water- borne pathogens in Iran
ompW, and putative integrase genes, respectively. Pre- [33e36]. Rapid and simultaneous detection of these
vious studies indicated that these genes are conserved in common bacteria in is extremely important to ensure
each species. Many studies noted that invA is a specific food and water safety. For this purpose, we developed
and sensitive target for detection of Salmonella spp. and successfully applied a multiplex PCR for the rapid
[20,21]. Also, the ompW gene has been previously used identification of Salmonella spp., Shigella spp., and V.
for identification of V. cholerae, owing to its specificity cholera. This technique decreases the test time of PCR.
[22]. Furthermore, restriction fragment length poly- This method is simple and rapid, and the results ob-
morphism analysis and nucleotide sequence data have tained proved to be highly specific and sensitive and
shown that the ompW gene is highly conserved among can be expanded to additional species. Moreover,
all V. cholerae biotypes, suggesting the ompW gene can multiplex PCR may provide an epidemiological tool to
be considered a good target for the specific identification investigate the wide spread of diarrheagenic pathogens
of V. cholerae strains [23]. in various areas worldwide.
Unlike the above-mentioned species, Shigella ge-
nomes have a high level of similarity with the E. coli
genome; hence, the whole sequences of Shigella dys- Conflicts of interest
enteriae, Shigella boydii, Shigella flexneri, and Shigella
sonnei have w3 Mb of genomic DNA in common with The authors declare that there is no conflict of interests.
all sequenced E. coli genomes [24]. However, based on
the comparative genomic analysis, a specific target References
known as putative integrase locus, conserved in all
Shigella species, was subjected to identification of 1. Guerrant RL, Hughes JM, Lima NL, et al. Diarrhea in developed
Shigella species. Hence, Shigella-specific primers were and developing countries: magnitude, special settings, and etiol-
designed based on putative integrase locus. The results ogies. Rev Infect Dis 1990;12:S41e50.
2. Ranjbar R, Afshar D, Mehrabi Tavana A, et al. Development of
also showed that this locus is a suitable target for spe-
multiplex PCR for simultaneous detection of three pathogenic
cific identification of Shigella species. Shigella species. Iran J Public Health 2014;43:1657e63.
In many research studies, multiplex PCR has been 3. Ranjbar R, Rahbar M, Naghoni A, et al. A cholera outbreak
applied for rapid identification of diarrheal agents associated with drinking contaminated well water. Arch Iran Med
[25,26]. All of these studies noted that multiplex PCR is 2011;14:339e40.
4. Ranjbar R, Naghoni A, Farshad S, et al. Use of TaqMan real-time
a reliable, useful, and cost-effective assay, which is
PCR for rapid detection of Salmonella serotypes Typhi and
consistent with our results. Jin et al [27] studied food- Typhimurium. Acta Microbiol Immunol Hung 2014;61:121e30.
borne pathogenic bacteria including C. jejuni, Shigella, 5. Mulatu G, Beyene G, Zeynudin A. Prevalence of Shigella, Sal-
Salmonella, Vibrio parahaemolyticus, S. aureus, E. coli monella and Campylobacter species and their susceptibility patters
O157:H7, and several other bacterial species and among under five children with diarrhea in Hawassa town, south
Ethiopia. Ethiop J Health Sci 2014;24:101e8.
showed that multiplex PCR is time-saving assay in
6. Akoachere JFT, Mbuntcha CK. Water sources as reservoirs of
comparison with conventional PCR. Furthermore, Pan- Vibrio cholerae O1 and non-O1 strains in Bepanda, Douala
iagua et al [28], who described the detection of different (Cameroon): relationship between isolation and physico-chemical
foodborne pathogens by multiplex PCR, noted that this factors. BMC Infect Dis 2014;14:421.
Simultaneous detection of Salmonella spp., Shigella spp., and V. cholerae 377

7. Sack DA, Sack RB, Nair GB, et al. Cholera. Lancet 2004;17:223e33. 22. Wei S, Zhao H, Xian Y, et al. Multiplex PCR assays for the
8. Kweon MN. Shigellosis: the current status of vaccine develop- detection of Vibrio alginolyticus, Vibrio parahaemolyticus, Vibrio
ment. Curr Opin Infect Dis 2008;2:313e8. vulnificus, and Vibrio cholerae with an internal amplification
9. Okoro CK, Kingsley RA, Connor TR, et al. Intra-continental control. Diagn Microbiol Infect Dis 2014;79:115e8.
spread of human invasive Salmonella Typhimurium pathovariants 23. Nandi B, Nandy RK, Mukhopadhyay S, et al. Rapid method for
in sub-Saharan Africa. Nat Genet 2012;44:1215e21. species-specific identification of Vibrio cholerae using primers
10. Karami A, Ranjbar R, Ahmadi Z, et al. Rapid detection of targeted to the gene of outer membrane protein OmpW. J Clin
different serovares of Salmonella entrica by Multiplex PCR. Iran J Microbiol 2000;38:4145e51.
Publ Health 2007;36:38e42. 24. Yang F, Yang J, Zhang X, et al. Genome dynamics and diversity
11. Malorny B, Hoorfar J, Bunge C, et al. Multicenter validation of the of Shigella species, the etiologic agents of bacillary dysentery.
analytical accuracy of Salmonella PCR: towards an international Nucleic Acids Res 2005;33:6445e58.
standard. Am Soc Microbiol 2003;69:290e6. 25. Chen J, Tang J, Liu J, et al. Development and evaluation of a
12. Popovic T, Bopp C, Olsvik O, et al. Epidemiologic application of multiplex PCR for simultaneous detection of five foodborne
a standardized ribotype scheme for Vibrio cholerae O1. J Clin pathogens. J Appl Microbiol 2012;112:823e30.
Microbiol 1993;31:2474e82. 26. Vondrakova L, Pazlarova J, Demnerova K. Detection, identification
13. Vargas M, Gascon J, Jimenez De Anta MT, et al. Prevalence of and quantification of Campylobacter jejuni, coli and lari in food
Shigella enterotoxins 1 and 2 among Shigella strains isolated from matrices all at once using multiplex qPCR. Gut Pathog 2014;6:12.
patients with traveler’s diarrhea. J Clin Microbiol 1999;37: 27. Jin SQ, Yin BC, Ye BC. Multiplexed bead-based mesofluidic
3608e11. system for detection of food-borne pathogenic bacteria. Am Soc
14. Roy S, Thanasekaran K, Dutta Roy AR, et al. Distribution of Microbiol 2009;75:6647e54.
Shigella enterotoxin genes and secreted autotransporter toxin 28. Paniagua GL, Monroy E, Garcı́a-González O, et al. Two or more
gene among diverse species and serotypes of Shigella isolated enteropathogens are associated with diarrhoea in Mexican chil-
from Andaman Islands, India. Trop Med Int Health 2006;11: dren. Ann Clin Microbiol Antimicrob 2007;6:17.
1694e8. 29. Tsai YL, Tran B, Sangermano LR, et al. Detection of poliovirus,
15. Orrett FA. Prevalence of Shigella serogroups and their antimi- hepatitis A virus, and rotavirus from sewage and ocean water by
crobial resistance patterns in southern Trinidad. J Health Popul triplex reverse transcriptase PCR. Appl Environ Microbiol 1994;
Nutr 2008;26:456e62. 60:2400e7.
16. Akiba M, Kusumoto M, Iwata T. Rapid identification of Salmo- 30. Al-Talib H, Latif B, Mohd-Zain Z. Pentaplex PCR assay for
nella enterica serovars, Typhimurium, Choleraesuis, Infantis, detection of hemorrhagic bacteria from stool samples. J Clin
Hadar, Enteritidis, Dublin and Gallinarum, by multiplex PCR. J Microbiol 2014;52:3244e9.
Microbiol Methods 2011;85:9e15. 31. Ranjbar R, Soltan Dallal MM, Pourshafie MR, et al. Serogroup
17. Kong RY, Lee SK, Law TW, et al. Rapid detection of six types of distribution of Shigella spp. in Tehran. Iranian J Publ Health 2004;
bacterial pathogens in marine waters by multiplex PCR. Water Res 33:32e5.
2002;36:2802e12. 32. Ranjbar R, Salimkhani E, Sadeghifard N, et al. An outbreak of
18. Amini K, Zahraei-Salehi T, Nikbakht G, et al. Molecular detection gastroenteritis of unknown origin in Tehran. Pak J Biol Sci 2007;
of invA and spv virulence genes in Salmonella enteritidis isolated 10:1138e40.
from human and animals in Iran. Afr J Microbiol Res 2010;4: 33. Ranjbar R, Rahbar M, Naghoni A, et al. A cholera outbreak
2202e10. associated with drinking contaminated well water. Arch Iran Med
19. Bohaychuk VM, Gensler GE, McFall ME, et al. A real-time PCR 2011;14:339e40.
assay for the detection of Salmonella in a wide variety of food and 34. Pourshafie MR, Bakhshi B, Ranjbar R, et al. Dissemination of a
foodeanimal matrices. J Food Prot 2007;70:1080e7. single Vibrio cholerae clone in cholera outbreaks during 2005 in
20. Rahn K, De Grandis SA, Clarke RC, et al. Amplification of an Iran. J Med Microbiol 2007;56:1615e9.
invA gene sequence of Salmonella typhimurium by polymerase 35. Ranjbar R, Giammanco GM, Farshad S, et al. Serotypes, antibiotic
chain reaction as a specific method of detection of Salmonella. resistance, and class 1 integrons in Salmonella isolates from pe-
Mol Cell Probes 1992;6:271e9. diatric cases of enteritis in Tehran, Iran. Foodborne Pathog Dis
21. Mainar-Jaimea RC, Andrésa S, Vicoa JP, et al. Sensitivity of the 2011;8:47e53.
ISO 6579:2002/Amd 1:2007 standard method for detection of 36. Ranjbar R, Hosseini MJ, Kaffashian AR, et al. An outbreak of
Salmonella spp. on mesenteric lymph nodes from slaughter pigs. J shigellosis due to Shigella flexneri serotype 3a in a prison in Iran.
Clin Microbiol 2013;51:89e94. Arch Iran Med 2010;13:413e6.