A STUDY OF GENETIC ANALYSIS OF MULTIDRUG

RESISTANT SALMONELLA TYPHI

Dr. Khalid Mahmood

MBBS, M. Phil (Microbiology)

SUPERVISOR
Prof. Dr. Mateen Izhar
Head of Pathology Division & Department of Microbiology FPGMI,
Shaikh Zayed Medical Complex Lahore

Dissertation in partial fulfillment of the requirement for the award of PhD degree in
Microbiology from University of the Punjab, Lahore, Pakistan

PLACE OF WORK
Federal Postgraduate Medical Institute, Shaikh Zayed Medical Complex, Lahore

&
School of Biological Sciences, University of the Punjab, Lahore, Pakistan

2012
 CERTIFICATE OF APPROVAL

This is to certify that research work described in this thesis, entitled “A STUDY OF
GENETIC ANALYSIS OF MULTI DRUG RESISTANT SALMONELLA TYPHI” is the
original work of Dr. Khalid Mahmood and has been carried out under my supervision. I
have personally gone through all the data/results/materials reported in the manuscript and
certify their correctness/authenticity. I further certify that the material included in this
thesis has not been used in part or full in a manuscript already submitted or in the process
of submission in partial/complete fulfilment of the award of any other degree from any
other institution. I also certify that the thesis has been prepared under my supervision
according to the prescribed format and I endorse its evaluation for the award of PhD
degree through the official procedures of the university.

Research Supervisor

(Prof. Dr. Mateen Izhar)

BSc (pb), MBBS (pb), MSc (London)
Ph.D (Cantab), FRCPath (UK)
Head Division of Pathology &
Department of Microbiology &Virology
Fedral Post Graduate Medical Institute Shaikh Zayed Hospital Lahore

i
 DEDICATION
I dedicate this PhD write up to the solders of Pak army who sacrificed their lives for the
honour of their mother land in Gayari sector at Siachen.

ii
 ACKNOWLEDGEMENTS

Praise be to Almighty Allah whom are all attributers of knowledge and peace be
to the prophet Muhammad (PBUH) for His blessing on this mankind.

I am deeply indebted to my worthy supervisor Prof. Dr. Mateen Izhar for his
valuable advices, guidance, tolerance and constant encouragement at every stage of my
work enabling me to pursue my endeavors and broaden my horizon of knowledge. It was
a pleasure working with a scholar of his stature.

My sincere and heartfelt thanks to Prof. Dr Saleem Haider chairman, Agriculture

Research Institute University of the Punjab, Lahore. Prof. Dr. Javaid Iqbal Qazi. Head
Department of Microbiology, Prof. Dr. Naeem Rashid School of Biological Sciences and
Dr. Nakhshab Chaudhary (FPGMI) Lahore, for giving me encouragement to take the
first step in this project and then providing invaluable guidance in all respects.

I would like to extend my thanks and gratitude to Dr. Akbar Ali, Dr. Saadat Ali,
Dr. Muhammad Faisal Basher at School of Biological Sciences, Dr. M. Idrees Khan and
Mr. Muhammad Farooque Rasool (CEMB), University of the Punjab Lahore for their
contributions towards technical aspects of this research project.

I must also thank my children, Dr. Muhammad Ahmed, Dr Usman Ahmed and
Dr. Mariam Khalid who helped me with the photographic aspect of my research project.
I express my gratitude for their love, patience and understanding.

Special thanks are due, to Muhammad Tahir Malik, Bilal Tanveer, Irfan Rafique
Maqsood Arif, Irfan Fayyaz, Muhammad Adnan and Mr. Imran Ismail (CL&RC) who
helped me immensely and extended their support whenever I needed it.

I would like to record my cordial thanks to all my friends and colleagues for their
moral support and cooperation during my research work, also appreciate the laboratory
assistants and other staff members at Shaikh Zayed hospital Lahore.
(Dr. Khalid Mahmood)

iii
 CONTENTS

Certificate of approval i
Dedication ii
Acknowledgements iii
Contents iv
List of Tables viii
List of Figures ix
Commonly used abbreviations xi
Summary xiii
INTRODUCTION 1
Antimicrobial Resistance 3
Chloramphenicol Resistance 3
Ampicillin and Trimethoprim/Sulfamethoxazole Resistance 3
Multi-drug resistant (MDR) S. typhi 4
Fluoroquinolone Resistance 4
Extended - Spectrum β - Lactamases (ESBLS) 5
Re-emergence of first line anti-typhoid drugs 5
OBJECTIVE OF THE STUDY 6
LITERATURE REVIEW 7
History of organism 8
Morphology and Cultural Characteristics 8
Classification 8
Identification 9
Antibiotic susceptibility testing 10
Virulence 10
Epidemiology of typhoid fever 11
Infective dose of Salmonella 13
Diseases caused by Salmonella 13
Gastroenteritis 14
Focal abscess 14
Typhoid fever 15
Carrier state 15

iv
 Sources of infection and Risk factors 16
Patient age group 16
Seasons 17
Mortality rate and Relapse 17
Complications 17
Diagnosis of typhoid fever 18
Treatment of typhoid fever 18
First line anti typhoid drugs 18
Chloramphenicol 18
Ampicillin and Trimethoprim/Sulfamethoxazole 19
Multi-drug resistant S. typhi 19
Fluoroquinolones resistance 20
Cephalosporin Resistance 21
Extended-Spectrum β-Lactamases (ESBLS) In S. typhi 21
Mechanisms of drug resistance in S. typhi 21
Genetics of chloramphenicol resistance in S. typhi 22
Types of plasmid involved in Resistance 23
The Prevalence of Inc H plasmid in the S. typhi 23
Conjugal transfer of inc. H plasmid 25
Molecular size and stability of Inc H plasmid 25
Characteristic encoded by Inc H. plasmid 26
R-factor epidemiology 28
R-factor transfer in vivo 28
R-factor transfer under environmental conditions 28
Environmental aspects of H plasmid transfer 29
PATIENTS, MATERIALS ANDMETHODS 30
Sample collection 31
Sample culture 31
Identification of isolates 31
Serological identification 31
Biochemical identification using AP1- 20E 32
Methodology of API -20E 32
Antimicrobial susceptibility testing 32
Methodology 32
v
 Antimicrobial agents tested 33
Extended spectrum βeta lactamase (ESBL) production 33
Double disc synergy test (DDST) 33
Storage of Bacterial Isolates 34
Revival of Salmonella typhi isolates 34
Molecular methods (DNA isolation of S. typhi) 34
Molecular Confirmation of S. typhi strains 34
PCR detection of fliC gene 35
Agarose gel electrophoresis 35
PCR Amplification of multidrug resistant genes in S. typhi: 35
PCR detection of catP gene 35
PCR Detection of tem (β-lactamase) gene 37
PCR detection of Sul-2 gene 37
PCR detection of gyrA gene 37
Confirmation by Sequence 37
RESULTS 39
Morphology and gram staining of isolates 40
Biochemical identification 42
Confirmation of isolates 44
Isolation of S. typhi 44
Isolation of multi-drug resistant S. typhi 47
First line anti typhoid drugs sensitivity 50
Fluoroquinolones sensitivity 51
Cephalosporin sensitivity 55
Extended spectrum βeta lactamase (ESBL) production 55
Carbapenem and others sensitivity 55
Detection and amplification of fliC gene 56
Detection of drug resistance genes in MDR S. typhi 56
Amplification of catP gene conferring chloramphenicol resistance 57
Amplification of tem gene conferring ampicillin resistance 58
Amplification of sul-2 gene conferring resistance to trimethoprim –
sulfamethoxazole 58
Amplification of gyrA gene conferring resistance to ciprofloxacin 59
Representative sequencing Chromatograph of fliC, catP, tem, sul 2
vi
 and gyrA gene products 59
DISCUSSION 61
Prevalence of Salmonella typhi 62
Isolation rate of S. typhi 63
Isolation rate of multi-drug resistant S. typhi 63
Antimicrobial susceptibility 64
Extended spectrum β lactamase production 65
Drug resistance in S. typhi 66
RECOMMENDATIONS FOR PHYSICIAN 68
CONCLUSIONS 69
APPENDICES 70
Gram staining 71
API 20E 72
Salmonella serotyping scheme 75
Representative sequencing Chromatograph of
(fliC, catP, tem, sul 2 and gyrA gene products) 79
EFERENCES 83

vii
LIST OF TABLES

Table 1. Primers used for the confirmation of S. typhi 47

Table 2. Primers used for detection of drug resistance genes 49
Table 3. Distribution of the patients in different age groups 53
Table 4. Biochemical reactions of S. typhi studied by API-20E 56
Table 5. The isolation of S. typhi in different months from 2005-6 to 2009-10 59
Table 6. Isolation rate of MDR S. typhi 60
Table 7. Monthly isolation of MDR S. typhi from 2005-2010 61
Table 8. Resistance pattern of S. typhi isolates against different antimicrobials
during study period 62
Table 9. Observed resistance/susceptibility pattern of S. typhi against first line
anti-typhoid drugs 63
Table 10. Observed resistance/susceptibility pattern of S. typhi against
Fluoroquinolones 64
Table 11. Incidence of Nalidixic acid resistant S. typhi isolates. 65

viii
 LIST OF FIGURES

Fig. 1. Gender distribution of patients 53

Fig. 2. Typical colonies of Salmonella typhi on Mac Conkey agar 54
Fig. 3. Microscopic appearance of the Gram negative rods 54
Fig. 4. Appearance of the bacterial growth in TSI 55
Fig. 5. Strip showing oxidase test results 55
Fig: 6, API 20-E test results 56
Fig. 7. API strip showing the summery of the results of the tests performed 57
Fig. 8.Slide picture of salmonella typhi confirmation by anti-sera 57
Fig. 9. Average prevalence of typhoid fever in each month 58
Fig. 10.Isolation rate of S. typhi from 2005 to 2010 58
Fig. 11. Average monthly isolation of MDR S. typhi from2005-2010 60
Fig. 12. Resistance/susceptibility pattern of S. typhi observed in 2005-6 63
Fig. 13.Resistance/susceptibility pattern of S. typhi observed in 2005-6 64
Fig. 14. Resistance/susceptibility pattern of S. typhi observed in 2005-6 65
Fig. 15. Resistance/susceptibility pattern of S. typhi observed in 2007-8 66
Fig. 16. Resistance/susceptibility pattern of S. typhi observed in 2008-9 66
Fig. 17. Resistance/susceptibility pattern of S. typhi observed in 2009-10 67
Fig. 18. Resistance/susceptibility pattern of S. typhi observed in 2009-10 67
Fig. 19. DDST showing increased ZOI with Augmentin 68
Fig. 20.A representative agarose gel electrophoresis picture showing PCR
bands of fliC, gyrA, sul2,temand catP 69
Fig. 21.A representative agarose gel electrophoresis picture showing PCR
bands of fliC gene 70
Fig. 22.A representative agarose gel electrophoresis picture showing PCR
bands of catP gene 70
Fig. 23.A representative agarose gel electrophoresis picture showing PCR
bands of tem gene 71
Fig. 24.A representative agarose gel electrophoresis picture showing
PCR bands of sul 2 gene 71
Fig. 25.A representative agarose gel electrophoresis picture showing PCR
bands of gyrA gene 72
Fig. 26. Sequencing chromatogram of gyrA PCR product showing mutation 72
ix
Fig. 27.A representative agarose gel electrophoresis picture showing
multiplex PCR bands of sul 2, fliC and tem genes 73

x
 List of Abbreviations

A. baumanni Acinetobacter baumannii

API Analytical Profile Index

ATCC American Type Culture Collection

BHI Brain Heart Infusion
CI Confidence Interval

CLSI Clinical Laboratory Standards Institute

DNA Deoxyribonucleic acid

E. faecalis Enterococcus faecalis

E. coli Escherichia coli

Fig. Figure
GIT Gastrointestinal Tract

IBU Inhibine Antibacterial Unit (IBU)

MDR Multi Drug Resistance

MGO Methylglyoxal
MH agar Mueller Hinton Agar

MIC Minimum Inhibitory Concentration

NaCl Sodium Chloride

P. aeruginosa Pseudomonas aeruginosa

S. paratyphi A Salmonella paratyphi A

S. typhi Salmonella typhi

SLE Systemic Leupus Erythematosus
TSA Tryptic Soya Agar
Taq Thermus aquaticus
TSB Tryptic Soya Broth

WHO World Health Organization

xi
 SUMMARY

Typhoid fever is an old disease transmitted by faecally contaminated food and water.
Typhoid carriers handling food also spread the disease. MDR S. typhi is a serious health
problem in developing countries. Majority of the global typhoid epidemics occur in
tropical, subtropical and Asian countries. Typhoid fever represents a common cause of
death in Pakistan. WHO report revealed 33 million new cases causing more than 200,000
deaths annually. In Asian countries mortality rate is between 12 to 32% which can be
reduced to 0.5% with proper treatment.

Chloramphenicol was considered gold standard drug for typhoid fever till
chloramphenicol resistant outbreak occurred in Mexico. Subsequently treatment scenario
changed from first line anti typhoid to fluoroquinolones or cephalosporin. Withdrawal of
first line anti-typhoid drugs caused loss of R- plasmid from S. typhi which resulted in re-
emerging sensitivity of these drugs. New emergence of extended spectrum beta lactamase
production in MDR S. typhi has not only restricted treatment options but also transpires the
need of genetic analysis of MDR S. typhi and reappraisal of antibiotics sensitivity.

Salmonella typhi isolates included in the study after confirmation by API testing and
serotyping. Antimicrobial susceptibility was determined by Kriby-Bauer disc diffusion
method. Three isolates of MDR Salmonella typhi were found ESBL producer on double
disc synergy test and molecular reconfirmation of the isolates by detection of fliC gene.
PCR amplification of (catP, tem (β-lactamase), sul-2 and gyrA) genes were carried out and
amplified products sequenced for the confirmation of right sequence of respective gene
products. Sequencing results showed that Ser 83 to Phe (TCC to TTC) mutation found in
all cases. The PCR results were in accordance with the multi-drug resistant pattern of S.
typhi as detected by disc diffusion method.

S. typhi equally infected both sexes and disease incidence was higher among children.
Maximum cases were reported during hot and humid weather and minimum during cold
season but typhoid fever remained endemic throughout the year. Significant decrease in
incidence of S. typhi and MDR S. typhi was observed from 2005 to 2010. Increased
susceptibility of the first- line anti typhoid drugs and decreased susceptibility of quinolones
was observed in this study. Significant resistance against ciprofloxacin suggests unreliable
xii
efficacy of the drug which reflects the wide spread misuse of ciprofloxacin. Carbapenem
group showed maximum susceptibility and were the most potent antimicrobials available.

Treating physician should investigate the patient with pyrexia of unknown origin for
typhoid fever and treatment must be based on susceptibility report because MDR S. typhi is
frequently prevalent. Intensive infection control measures, rational antimicrobial use and
regular surveillance should be carried out to control the emergence of antimicrobial
resistance. In Pakistan best solution for the prevention of typhoid fever is provision of clean
drinking water and adequate sanitation alongwith educating people at large for personal
hygiene which can reduce the incidence of the disease significantly.

xiii
INTRODUCTION

1
 Multi drug resistant Salmonella typhi (MDR S. typhi), the causative agent of
typhoid fever, continues to be a major public health problem in developing countries of
Asia, Africa and Latin America, affecting both local populations and travelers to the
endemic areas (Le et al., 2005; Hasan et al., 2008; Crump and Mintz et al., 2010; Essa et
al., 2012). Up to 78 % of the world population lives in developing countries and 93% of
global epidemics of typhoid fever occur in Asia (Murray and Lopez, 1997; Siddiqui et
al., 2006). Frequent out breaks have been reported from South Asian countries and the
disease is a serious potential threat to the developed nations (Uneke, 2008).

According to the World Health Organization (WHO) 27-33 million new cases of
typhoid fever are reported each year causing 216,000 deaths (Chrisopher et al., 2007).
Typhoid fever remains endemic throughout the year and represents the 4th most common
cause of death in Pakistan (Hanan1995; Tran et al., 2005; Arif et al., 2005). In Indian
subcontinent too, typhoid fever is endemic (El-Akkad1970; Farid et al., 1975; Asna et
al., 2003). Infection caused by MDR S. typhi results in higher rate of morbidity, mortality
and complications (Rowe and Threllfal, 1990; Ahasan et al., 1993; Pang et al., 1995;
Khan et al., 1996). Mortality rates ranging from 12 to 32% have been reported from
Pakistan, India, Bangladesh, Nepal and Indonesia. However, the incidence can be
reduced from 30 % to 0.5% with proper treatment (Parry et al., 2002; Cook and Wain,
2004; Lakshmi et al., 2006).

S. typhi exclusively a human pathogen is transmitted by faeco-oral route.

Incidence of typhoid fever has been significantly reduced in overcrowded urban areas of
the USA and Europe after provision of clean drinking water, better sanitary conditions
and hygiene (Bottieau et al., 2006). Sporadic cases of typhoid fever still occur in
developed countries because of foreign traveling and consumption of imported
contaminated food (Cooke et al., 2007). In England and Wales more than 70 % typhoid
fever patients represent immigrants returning from India and Pakistan (Crump et al.,
2004).

Disease burden is under - estimated due to limited availability of culture facilities

and poor disease reporting systems in developing countries including Pakistan (Siddiqui
et al., 2006; Steele and Weetch, 2007; Deroeck, 2007). Chloramphenicol was first
introduced by Wood ward for the treatment of S. typhi infection in 1948. It proved an
2
ideal drug, because application of chloramphenicol reduced duration of fever from weeks
to days and mortality to less than 1%. (Woodward et al., 1948; Colquhoun and Weetch,
1950; Gupta, 1994; Chande et al., 2002; Wain et al., 2003; Mateen A. et al., 2004;
Tsonyo et al., 2007). The drug yielded fairly uniform clinical response all over the world
(Woodward et al., 1948; Bottieau et al., 2006). It remained gold standard drug of choice
even having a risk of developing a-plastic anemia till the emergence of drug resistant
Salmonella serotypes (Snego and Bhutta, 1987; Islam et al., 1993).

Antimicrobial Resistance
Development of drug resistance in bacteria for frequently employed and/or low
dose administered antibiotics is a well-known phenomenon since more than 50 years.
The S. typhi has been documented for resistance against the forth mentioning drugs
(Levy, 2000).

Chloramphenicol Resistance
Chloramphenicol resistant strain of S. typhi was first reported in 1950 from
England (Colquhoun and Weetch, 1950), in 1959 from India (Murti et al., 1962;
Agrawal, 1962; Njoku, 1965), in 1965 from South Africa and in 1967 from Greece
(Konitomichalou, 1967; Agarwal et al., 1981; Mirza et al., 1996; Ackers et al., 2000).
From Pakistan first case of chloramphenicol resistant S. typhi was identified in 1987 and
then its incidence increased to peak level within few years (Mirza and Hart, 1993).

First outbreak of chloramphenicol resistant S. typhi occurred in 1972 reported

from Mexico (Paniker and Vimala, 1972; Butler et al., 1973). Outbreaks have also been
reported from India, Pakistan, Vietnam, Thailand, Korea and Peru (Sippel et al., 1981;
Hannan, 1991; Mushtaq, 2006). Wide spread plasmid mediated chloramphenicol
resistant strains pose a serious threat to treatment failure and urge to search for alternate
drugs (Paniker and Vimala, 1972; Wain et al.,2003; Cooke and Wain, 2004).

Ampicillin and Co-trimoxazole Resistance

Ampicillin proved to be an excellent antimicrobial for treatment of S. typhi since
1961-1967 (Brown and Acred, 1961; Rolinson and Stevens, 1961; Kaye et al., 1967).
Ampicillin became the drug of choice in cases of chloramphenicol resistant S. typhi
strains (Mills-Robertson et al., 2002; Wain et al., 2004; Kariuki et al., 2004). Ampicillin
3
sensitive but chloramphenicol resistant S. typhi isolates have been reported from India in
1972, Vietnam and other countries in1973 (Pillay et al., 1975; Scragg and Rubidge,
1975). Trimethoprim/sulfamethoxazole (SXT) combination was found to be as good as
ampicillin and thus used as drug of choice in cases of typhoid fever caused by ampicillin
resistant S. typhi strains (Butler et al., 1982).

Multi-drug resistant (MDR) S. typhi

S. typhi isolates simultaneously resistant to three or more different groups of
drugs are considered multi-drug resistant (MDR). First report of MDR S. typhi appeared
in 1972 from Mexico (Center for disease control (1976), from Nepal (Watson and
Pettibone, 1991) from Vietnam in1993 (Suganthi et al., 1993; Parry, 2002). From
Pakistan first MDR S. typhi was documented in 1987 (Hannan et al., 1988; Karamat et
al., 1996). MDR S. typhi incidence increased to over 80 % in India and Pakistan (Takkar
and Khurana, 1995; Karamat et al., 1996).

Incidence of 100% MDR S. typhi were reported from Calcutta and Karachi
during 2000 (Saha et al., 2001; Mubeena et al., 2006). Emergence of plasmid mediated
MDR S. typhi has increased the fatality rate in Pakistan, India, Sri Lanka and Bangladesh
(Tong et al., 2000; Ugwu et al., 2005; Siddiqui et al., 2006).

Fluoroquinolone Resistance
Ciprofloxacin has been successfully used against S. typhi, resistant to first line
anti typhoid drugs till 1990 (Gupta, 1994). Decreased susceptibility to ciprofloxacin was
reported in 1992 which spread globally. From Pakistan first case of reduced
susceptibility to ciprofloxacin was reported in 1993 (Hannan et al., 1993; Butt et al.,
2003; Threlfall et al., 2006). Higher level fluoroquinolone resistant S. typhi strains are a
major problem in tropical and South Asian countries (Renuka et al., 2005; Chu et al.,
2007). Nalidixic acid resistance and decreased susceptibility to ciprofloxacinis
considered due to single mutation in gyrA gene while higher fluoroquinolone resistance
is associated with double mutations. Its incidence has increased in subcontinent and
neighboring countries (Mushtaq, 2006).

4
Extended Spectrum β Lactamases (ESBLS)
Plasmid and chromosomal mediated resistance against first line anti typhoid and
fluoroquinolones has limited the treatment options to third generation cephalosporin
(Shanahan al., 1998). Among third generation cephalosporin, ceftriaxone is considered
the drug of choice for fluoroquinolone resistant or MDR S. typhi infections (Bottieau et
al., 2006; Al Naiemi et al., 2008). Extended spectrum β lactamase producing S. typhi
was also reported from Netherland (Al Naiemi et al., 2008). Nosocomial infection
caused by ESBL producing Salmonella has been reported from Latin America, France,
Senegal, Africa, Asia and Europe (Winokur et al., 2001; Gniadkowski, 2001; Weill,
2004; Su et al., 2005). Sporadic cases of third generation cephalosporin resistant S. typhi
were reported from Bangladesh, India and Pakistan (Saha et al., 1999; Madhulika et al.,
2004). Emergence of an ESBL in MDR S. typhi constitutes a new challenge and has
become a matter of serious concern, especially in the developing countries. Newly
emerged resistant trait has further restricted the treatment options.

Re-emergence of first line anti-typhoid drugs sensitivity

Ciprofloxacin and third generation cephalosporin have been used since last two
decades. Withdrawal of first line anti-typhoid drugs resulted in decreased incidence of
MDR S. typhi reported from Pakistan (Mahmood, 2000; Tariq, 2005), India (Chande et
al., 2002), Bangladesh (Rahman et al., 2003) and from Egypt (Momtaz et al., 2002).
Increased sensitivity of chloramphenicol was also reported from India (Chande et al.,
2002; Ananad, 2004), Egypt (Wasfy et al., 2002) and England (Cooke et al., 2007). Re-
emergence of sensitivity of ampicillin, trimethoprim/sulfamethoxazole and
chloramphenicol was reported from South East Asia and 100% sensitivity reported
fromIndia (Lathi, 2005). Excellent susceptibility of ampicillin, trimethoprim/
sulfamethoxazole and chloramphenicol against S. typhi has also been noted by other
workers (Mandal et al., 2004; Dhanashree, 2007; Gupta et al., 2009). Thus it can now be
hoped that chloramphenicol and ampicillin may once again be considered as effective
first line anti typhoid drugs.

Re-emerging sensitivity of 1st line anti typhoid on one hand, and new emergence
of ESBLS on the other hand transpired the need for genetic analysis of MDR S. typhi and
reappraisal of antibiotics sensitivity.

5
Aims and objectives

The present study aims at the following objectives.

1. To assess the prevalence of S. typhi and MDR S. typhi infections in our local set up.
2. To find out percentile sensitivity of different groups of antimicrobials.
3. To detect drug resistant genes by PCR.
4. To study emergence of ESBLS production.
5. To prepare the guideline for treating physicians.

6
LITERATURE REVIEW

7
History of typhoid fever
Typhoid fever was first described in 1643 by Wills. Bud (1856) reported that
enteric fever is infectious in nature and could be spread through patient or carrier’s
faeces and urine. Contaminated food, milk and water play important role in transmission
of typhoid fever. These observations were considered the milestones in developing
community hygiene (cited in Collier Encyclopedia 1989). The causative organism was
named after the pathologist’s name Daniel E. Salman who isolated the bacterium from
the intestine of pig and the strain was called Salmonella choleraseuis (Eberth, 1880;
Miller Pegues, 2000). Eberth (1880) first observed the typhoid bacilli in the mesenteric
lymph node and spleen in fatal cases of enteric fever and named it Salmonella typhosum.
Salmonella was cultured for the first time on artificial media by Salmon and Smith (cited
in Collier Encyclopedia 1989).

Morphology and Cultural Characteristics

S. typhi is gram negative bacilli, 2-4 µm long and 0.1-0.6 µm in width, non-
lactose fermenting and most species are motile. It can grow on blood agar and Mac.
conkey agar media. Colonies are usually gray with average diameter of 2 – 3 mm. They
may be circular and low convex with smooth surface. Several selective media have been
recommended for culturing this bacterium including salmonella shegella agar, Wilson
and Blain’s Bismuth sulphate medium and deoxycholate citrate medium (Parker, 1964).

Classification
S. typhi belongs to genus Salmonella, member of family enterobacteriaceae
(Rahn, 1937). Antigenic variations among strains of the genus Salmonella were noted
and serological classification was introduced by Schutze (1921) using specific anti- sera.
Kauffmann suggested simple diagnostic scheme using limited number of sera which
made the presumptive sero-typing of most Salmonellae possible (Kauffmann et al.,
1952).

Biochemical classification of S. typhi was reported by Shaw (1956). S. typhi

differs from most other Salmonellae species biochemically by being citrate negative and
not producing gas when it breaks down sugar. The name S. Kauffmanni was suggested.
The S. cholerasuis is biochemically atypical and does not ferment arabinose. The S.
Arizona often ferments lactose and is ONPG positive, liquefies gelatin slowly and
8
manifests usually malonate positive reaction (Ewing, 1963). The genus Salmonella has
been divided into various subgenera considered as species by Kauffman and White
(1966) such as S. Kauffmannii (subgenus I), S. salamae (subgenus II), S. arizona
(subgenus III) and S. houtenae (subgenus IV). S. pullorun and S. gallinarum are often
combined but the S. pullorun produces the gas while the S. gallinarum does not (Le
Minor et al., 1970). The genus was further split into groups A, B, C & D etc. Each group
shared a common somatic antigen. In case of more than one somatic antigens present on
one strain, they were considered as antigenic determinant. They were further sub divided
into sub groups e.g. Group “C” is divided into sub groups C-1 & C-2. The first was
characterized by the “O” antigen 6 & 7, while the second by “O” antigen 6 & 8. There
are 40 groups, the first 26 were designated by alphabets (ABCDEF), while the remaining
by number of their groups determining antigens etc. (Center for disease control 1976;
Chun et al., 1977; Clark et al., 1984). Serological classification has been simplified to
only 12 “O” sera 18 “H” sera and V1 sera can be used to classify the genus Salmonella
(Kauffman et al., 1952).

Bacterio-phage, a unique method of strain / group discrimination has been

established (Craigie and Yen, 1938). Six sub groups in genus Salmonella have been
reported. Sub group I includes obligate parasites and pathogens of human beings and
warm blooded domestic animals. Sub group II, III-a, III-b, IV and V are isolated from
environment and cold blooded animals. The II, III-a, and III-b can cause disease in
human beings. It is concluded that all these strains are related to S. enterica single
species (Edwards and Ewing, 1986).

Identification
Genus Salmonella was first identified by using biochemical tests (Abrams et al.,
1966). Carbohydrates are fermented with production of acid and gas. S. typhi produces
only acid. Glucose and mannitol are fermented, but lactose, sucrose, salicin or adonital
are not fermented. ONPG test is negative. Buissiere and Nardon (1968) described strip
based biochemical identification of Salmonella. Commercial form of this strip is called
analytical Profile Index (API) system. Martin et al. (1971) reported 88 % and Smith et
al. (1972) reported 96 % positive results of S. typhi by using API system. More than 50
characters could be determined by API method. Twenty tests of API strip are more than
sufficient for identification of salmonella (Bondi et al., 1947; Martin et al., 1971; Smith
9
et al., 1978). Another test method was developed which was improved for performing
biochemical identification using paper disks impregnated with substrate test reagents
(Snyder et al., 1951; Pickett et al., 1955).

Antibiotic susceptibility testing

Antimicrobial susceptibility is determined by zone of inhibition around the
antibiotic disc (Cooper, 1955). Rate of diffusion depends largely on molecular weight of
the antimicrobial agents (Garrod and Grady, 1971). Muller Hinton medium with4 mm
agar thickness is recommended for antibiotic susceptibility testing. Zone of inhibition
increases in size as the thickness of the agar is reduced and vice versa (Bauer et al.,
1964; Ericsson and Sherris, 1971; Davis and Stout, 1971; Barry and Fay, 1973).

Paper discs used for antimicrobials susceptibility were introduced by Vincent and
Morley (1944). This method is more commonly used as compared to cup or tablet
method (Morley, 1945; Lund and Funder, 1951; Bauer et al., 1964). Disc diffusion
susceptibility testing method was recommended by National Committee of antimicrobial
susceptibility testing and has been widely used in USA (Thornsberry, 1974).This method
was modified by Ericsson and Sherris (1971) then by Thorns berry (1974). The method
is commonly used in British laboratories (Stockes and worthy, 1972). Three control
strains, Staphylococcus aureus, E. coli and Pseudomonas aeruginosa must be tested
parallel to each test strain as recommended by Brown and Blowers (1978).

Virulence
Salmonella species are protected from phagocytosis due to its smooth cell wall
(Cunningham et al., 1975). Smooth surface of Salmonella prevents activation of
complement (Makela, et al., 1973; Liang-Takasaki et al., 1983). Flagella and
chemotactically directed motility are essential for adhesion to intestinal epithelial cells
and also contribute to the survival of salmonella in phagocytic cells (Savage, 1972;
Uhlman and Jones, 1982).

Salmonella entero-toxin is produced in low concentration and is related to its cell

wall (Houston, 1981). Koupal (1975) reported that Salmonella toxin is strongly
associated with lipopolysaccharide in the outer membrane of bacterial cell. Prostaglandin
and Salmonella entero-toxin activate adenylate-cyclase which acts synergistically to
10
produce diarrhea. Plasmids play a key role in virulence. Loss of plasmid leads to loss of
virulence (Jiwa, 1981; Baird et al., 1985; Helmuth et al., 1985; Nakamura et al., 1985).
Plasmid expressed a more virulent phenotype manifested by a more adhesive and
invasive organism in a HeLa cell system. Some strains of Salmonella can readily accept
and maintain plasmid which carries drug resistance or to an increase in transposon each
carrying a drug resistance gene as happens in E. Coli. Plasmid can confer properties
which contribute to the bacterial strain communicability and virulence in addition to the
properties of drug resistance, entero-toxigenicity, or surface antigen synthesis (Deboy et
al., 1980; Rowe et al., 1980; Robert et al., 1982).

Epidemiology of typhoid fever

According to the world health origination 33 million new cases and 216000
deaths occur each year globally due to the disease of typhoid fever (Crump et al., 2004;
Wellcome trust Sanger Institute, 2010). In Asia alone, 21 million new cases are reported
annually (Ivanoff, 1995; Bethell, et al., 1996; Aarestrup et al., 2003). Highest incidence
of 1000 cases / 100,000 people occurred in South Asia (Pang et al., 1995). Annual
incidence rate of 980 / 100,000 from India and 198 / 100,000from Southern Vietnam has
been reported (Parry, 2002). South East Asia has an incidence of 110 cases / 100,000
which is the third highest incidence rate for any region, Pakistan falls into this region
(Siddiqui et al., 2006).

Annual incidence reported from Papu, New Guinea and Indonesia is about
1200/100000 population. In South East Asia and South Central Asia highest epidemic
rates of greater than 100 / 100000 cases per year have been recorded. Rest of the Asia,
Africa, Latin America, the Caribbean and Oceania (except Australia and New Zealand)
has incidence rates of 10 - 100/100000 (McConkey, 2002). It has highest incidence rate
of 274 cases per 10000 people over five times higher than the second highest from Latin
America (Crumpet al., 2004).

11
 Typhoid fever has significantly decreased in western countries and its incidence
has been brought to lowest level, especially in USA, England and Wales. In UK, there is
approximately one case per 100,000/ population per year (Crump et al., 2004). In the
developed countries most cases of enteric fever occur in immigrants and their incidence
is increasing (Bhutta et al., 1996; WHO 2006). Majority of patients have a history of
travel to endemic area. In England 150 - 300 cases of typhoid fever occur each year,
where maximum patients come from India and Pakistan (Cooke et al., 2007). Typhoid
fever caused by egg product was reported during the out breaks of salmonellosis in 1963.
Salmonella species have been isolated from faeces of birds and animals. S. typhi
epidemics caused by eggs, chicken, ducks, turkeys and poultry products account for
50%, beef and pork 13%, raw and powdered milk 4% of total incidence of epidemics.
Reservoir among domestic animals is a key factor in epidemiology (Bennett and Hook,
1959).

Since man is the only reservoir of S. typhi, contact with typhoid patients or
typhoid carrier is essential for spread of infection. Contaminated food by asymptomatic
typhoid carriers is another source of infection (Parker, 1964). Pancreatic extract, liver
12
extract, carmine dye, bile salt, pepsin, gelatin, vitamins, thyroid extract, adrenal cortical
extract and pituitary extract, diagnostic or pharmacological animal origin preparations
have been considered as source of infection and outbreaks (Baine et al., 1973). Marked
decline of infection in developed nations is merely due to improved sanitary measures
and proper chemotherapy (Edelman and Levine, 1986; Johanson and Aderele, 1981;
Edelman and Levine, 1986; Chatterjee et al., 2001).

Typhoid fever is still commonest febrile illness reported from major cities of
Pakistan including Rawalpindi, Islamabad, Lahore, Quetta, Karachi, Bahawalpur and
Dera Ghazi Khan. S. typhi is the main serotype responsible causing typhoid fever in
Indian subcontinent (Farooqui et al., 1990; Yousaf and Sadick, 1990; Sabherwal et al.,
1992).

Infective dose of Salmonella

Infective dose of S. typhi bacterium sufficient to cause disease depends upon the
targeted person and portal of entry. In human large number of organisms are required to
cause infection (Jacobsen, 1964). In case of aerosols small number of organisms required
to cause infection in animals and birds. In case of per-orally large number of organisms
are required to produce the disease (Crozier and Woodward, 1962).

It is noted that less than 50 ml liquid bolus can pass easily through stomach.
Organism along with such a small bolus will have minimum contact with the gastric
juice and directly enter into small intestine where small number of organisms multiply
and cause the disease (Silverio, 1964; Mossel and Oei, 1975). A positive co-relation
between the infective dose and development of disease was observed in a study
conducted on volunteers groups. When 109, 107, 105 and 103organisms per ml were given
orally to the volunteers they develop disease in descending order 100 %, 50 %, 25 % and
0% (Hornick, et al., 1970).

Diseases caused by Salmonella

Any serotypes of Salmonella (S. typhi, S. para typhi A, B, or C) can cause
gastroenteritis, focal abscess, enteric fever or asymptomatic carrier state. These clinical
conditions are not mutually exclusive. Infected patient may rarely exhibit all the four.

13
Gastroenteritis is the most common encountered clinical condition (Saphra and Winter,
1957).

Gastroenteritis
Major signs and symptoms are diarrhea, abdominal pain and vomiting, incubation
period of gastroenteritis lasts for 6 - 48 hours (Mandal and Mani, 1976; Appelbaum,
1976). In USA 20,000 cases of gastroenteritis were reported in 1975, the incidence of
disease increased with the passage of time and number of cases reached to 42,028 during
1986. The incidence of disease has been assumed 100 times more than reported officially
(Hargrett-Beem, et al., 1988). More than 24000 species causing gastroenteritis in human
have been identified. The most common encountered serotype was S. typhimurium.
Other common serotypes causing food poisoning were S. agona, S. enteriditis, S. hadar,
S. heidelberg, S. Indiana and S. Newport (Aserkoff and Bennett, 1969: Joseph and
Palmer, 1989).

Gastroenteritis caused by Salmonella species resolve without developing any

complication. Only fluids and electrolyte replacement is required. In gastroenteritis
patients, antibiotics always prolonged the excretion of Salmonella in stool. Treatment
with antibiotics like ampicillin has facilitated the establishment of gastro-intestinal
infection rather than to cure (Aserkoff and Bennett, 1969; Rose and Miller, 1969;
Hornick, et al., 1970; Washington, 1975; Water worth, 1978, and Istrup and Washington,
1983).

Focal abscess
Focal typhoid abscess caused by S. enteritidis was identified in 1982 while
typhoid abscess caused by Salmonella typhi reported secondary to typhoid fever (Robert,
et al., 1982; Rehman et al., 1991). Meningitis caused by Salmonella species including S.
enteridis, S. para typhi A and S. heidelberg in different age groups was reported (Qadri,
et al., 1976; Bhutta et al., 1991). Salmonella can cause osteomyelitis in a healthy person
or in patients suffering from sickle-cell hemoglobinopathies, systemic lupus
erythematosus (SLE), bone surgery, trauma and cirrhosis of liver (Saphra and Winter,
1957; Rowland1961; Ortiz-Neu et al., 1978; Rubin, 1982).

14
 Pericarditis caused by Salmonellawas first reported in 1936, subsequently by S.
typhimurium in patients suffering from SLE in 1986 and by S. Hada in 1993 and
endocarditis caused by S. enteritidis in prosthetic heart valve patient (Cohen, et al., 1936;
Shanson et al., 1977; Dale, et al., 1986 and Aziz. et al.,1993). Splenic abscess causing S.
agona and S. chastr, hepatic abscess by Salmonella and respiratory tract infection was
caused by Salmonella species (Saphra and Winter, 1957; Lasch, 1966; Hornick, et al.,
1970; Sharr, 1972; Poon and Sanders, 1972; Mandel and Mani, 1976; Appelbaum, et al.,
1976; Scott, et al., 1977; Barney, et al., 1977).

Typhoid fever
Typhoid fever was previously confused with typhus fever, later on distinguished
from the typhus and globally coined as typhoid fever (Ochiai et al., 1959; Falcow, 1975;
Lacey, 1975). Typhoid fever caused by S. typhi is an acute systemic disease presented
with anorexia, nausea, lethargy, malaise, head ache and fever. Step ladder pattern fever is
the characteristic feature of typhoid fever found in majority of patients. Diarrhoea is
watery in nature and contains leucocytes. Duration of illness lasts for 4-5 weeks (Foster,
1983; Akthar, et al., 1987). During incubation period bacteria invade macrophages and
spread throughout the reticulo-endothelial system. Incubation period is prolonged in case
of contaminated water and shorter in case of contaminated food (Datta et al., 1979).
Symptomatic period usually represents in three phases. Progressive elevation of the
temperature followed by bacteremia is the characteristic features during first week of
illness. Rose spots, abdominal pain and splenomegaly are key signs in second week. The
third week is marked by intense intestinal inflammatory response which may results in
perforation and hemorrhage. During first week of the illness Salmonella can be isolated
from 80 % patient’s blood culture sample. Causative organism can also be isolated from
20-30 % patients even in third week if sample has been collected before starting
antimicrobial therapy (Stuart and Pullen, 1946).

Carrier state
Typhoid carrier is a patient who excretes S. typhi organisms in urine or faeces for
more than three months after treatment (WHO 2003). Infected individual can carry the
typhoid bacilli for days to years without showing any symptom of disease. Typhoid
bacilli multiply in the gall bladder and reach the intestine though bile duct. In adults,
carrier state of typhoid fever was reported from 15 – 45 years of age (Goodall and
15
Washbourn, 1996). Higher incidence of carrier state observed in women than men, ratio
is 3:1 (Senthilkumar and Prabakaran, 2005). Maximum incidence of carrier state (10%)
in age group from (20-59) years and minimum (0.3%) in less than 20 years of age was
observed (Ames and Robins, 1943). Carrier state can occur in 1.7 % typhoid fever
patients even after 60 weeks of active disease (Rubenstein, et al., 1944). Females
frequently become chronic carriers represent 65 to 70% of total carrier population. About
8.5 % female excrete Salmonella for more than three months and 4.2 % for more than
one year. Incidence is very low among the men and only 1.7 % excretes Salmonella for
three month and 0.8 % for more than year (Arbuzova, 1960; Musher and Rubenstein,
1973).

Sources of infection and risk factors

The most important primary source of infection is stool or urine of typhoid
patient or carrier (Ahmad et al., 1994; Mubeena et al., 2006). Secondary sources are
contaminated water, food, fingers, flies, and fomites (Topley and Wilson, 1990). S. typhi
rapidly grows in milk without changing its taste and appearance. S. typhi can survive in
water from 2 - 7 days, over a month in ice and ice cream, up to 70 days in soil irrigated
with sewage water during winter months / moist environment and from 30 to 35 days
during summer / dry season (WHO.1969). Risk factors contributing to typhoid fever
endemicity include limited availability of safe clean drinking water, poor sewage
disposal facilities and lack of disease awareness (Tehmina et al., 2001).

Patient age groups

Typhoid fever is more common in young children and infants but incidence is
under reported from Pakistan because of natural reluctance to draw 5 ml blood from
infants. Passive detection of S. typhi also contributes to under estimation of disease in
children and infants (Rathish, et al., 1995; Bhutta, 1996; Saqib and Ahmed, 2000; Lin et
al., 2000). Majority of typhoid patients (75 - 80 %) were reported from pediatric age
group (William and Mahle, 1993; Bhutta, 1996; Dutta and Kanwal, 1998; Usha Das and
Bhattacharya, 2006). In South Asia, incidence is 57 % in less than 5 years of age and 27
% in less than 2 years of age (Bhutta and Husein, 2006). Goodall and Washbourn, (1996)
on the other hand, noted that typhoid fever is more common in adult age from 21 -40
years.

16
Seasons
During hot and rainy season number of typhoid fever patients increase because
higher temperature (from 30 - 35 oC) with humidity favors growth of Salmonella typhi.
In Pakistan, maximum cases are reported during and after monsoon rains (Lin et al.,
2000). Flies increase to enormous number during summer and serve as vector in
transmission of typhoid infection (Gupta, 1994; Laurie et al., 1995; Wain et al., 1998).
More over heavy rainfall causes flooding and mixing of sewage water with drinking
water resulting in contamination hence increase in typhoid patients (Velema et al., 1997;
Siddiqui et al., 2006).

Mortality rate and Relapse

Typhoid fever causes higher rates of morbidity, mortality and complications
(Pang et al., 1995; Khan et al., 1996 and Rowe et al., 1997). In younger age group 1.6 %
mortality rate has been reported (Lakshmi et al., 2006; Doughari et al., 2007). Mortality
rate of 12- 32 % was reported from Indonesia, India and Nigeria (John et al., 2003) and
14 % - 34 % from Africa (Kouame et al., 2004; Ugwu et al., 2005; Aziz et al., 2005).
Mortality can be reduced with effective drugs in proper dose and duration of treatment
(Cook, 2004; Lakshmi et al., 2006).

WHO reported relapse rate 5 - 15 % in typhoid patients treated with

chloramphenicol and 4 - 8 % with ampicillin (WHO 2003). Typhoid patients treated with
ampicillin are frequently prone to relapse than patients treated with chloramphenicol
(Yew et al., 1991) and relapse rate (5-10%) can be prevented with 2-3 weeks
chloramphenicol treatment (Momtaz et al., 2002).

Complications
Most common complications of typhoid fever are gastrointestinal hemorrhage
and perforation. Complications may be observed in 10-15 % cases after two weeks of S.
typhi infection, out of which 5-30 % patients may die due to lack of adequate treatment.
Higher rate of complications and mortality encountered among children have been
reported (Sinha et al., 1999; Siddiqui et al., 2006).

Single perforation may occur in the terminal ileum in more than 70% patients.
Multiple perforations and encephalopathy may also occur in some patient (Agbakwuru,
17
2003). Hepatic or spleenic abscess, pancreatitis, encephalomyelitis, osteomyelitis and
glomerulonephritis may also be observed in few patients. Renal failure and myocarditis
can cause circularity collapse. Severe diarrhea, toxicity and disseminated intravascular
coagulation are more common in infants (Richens, 2004; Laloum et al., 2005).

Diagnosis of typhoid fever

Clinical diagnosis of typhoid fever is difficult in endemic areas because typhoid
presentation mimic a number of other febrile illnesses and isolation rate of S. typhi is
only 40 - 60 % mainly due to self-medication (Ochiai et al., 2005; Berkley et al., 2005).
Bone marrow culture is more sensitive but difficult to obtain, relatively invasive and of
little use in public health setting. Urine and stool culture are positive after first week of
illness with very low sensitivity in developing countries. Blood culture positive typhoid
incidence is about half of the actual figure of typhoid fever. Typhidot and tubex detect
1gM against a host specific S. typhi antigen. Blood leucocytes count is usually low
(20000 – 25000/mm3) with wide range in younger children. Thrombocytopenia is a
marker of illness and may accompany disseminated intravascular coagulation (Gilman et
al., 1975; Wain et al., 1998). .

Treatment of typhoid fever

For the treatment of typhoid fever, prevention of carrier state and complications,
selection of right drug, proper dose, and adequate duration is essential (Shirakawa et al.,
2006).

First line anti typhoid drugs

Chloramphenicol

S. typhi a lethal pathogen, was successfully treated with chloramphenicol for a

long time which reduced mortality to less than 1% and duration of fever from weeks to
days (Mateen A, 2004; Tsonyo, 2007). Chloramphenicol was gold standard drug till
emergence of drug resistant Salmonella serotypes (Snego and Bhutta, 1987; Islam,
1993).

First chloramphenicol resistant S. typhi case was identified just after two years of
its induction in medical therapy from England (Colquhoun and Weetch, 1950) and
18
subsequently from Africa, Greece and India (Agrawal, 1959; Murti, et al., 1962; Njoku-
Obi, 1965 and Kontomichalou, 1967). Outbreaks of chloramphenicol resistant S. typhi
were reported from India, Pakistan, Vietnam, Thailand, Korea and Peru (Sipple, et al.,
1981; Rowe et al., 1997 and Mirza et al., 2000). Monitoring of asymptomatic carriers
resulted in decreased frequency of chloramphenicol resistant S. typhi out breaks from
1.83 to 0.83 per year from (1960 – 1979) to (1980 - 1999) (P = 0.0001) reported from
USA (Parry, 2004).

Ampicillin and Trimethoprim / Sulfamethoxazole

Ampicillin and trimethoprim/sulfamethoxazole were considered suitable next

choice for chloramphenicol resistant S. typhi infection. Plasmid encoded resistance of S.
typhi to ampicillin was first observed in 1979 then trimethoprim / sulfamethoxazole was
introduced in 1980 and plasmid encoded trimethoprim / sulfamethoxazole resistant
developed shortly after wards (Rodrigues et al., 1998; Sanghavi et al., 1999 and Kariuki
et al., 2004). Ampicillin and trimethoprim/ sulfamethoxazolewere considered standard
antimicrobials till mid 1980’s for the treatment of enteric fever (Nair et al., 2004 and
Wain and Kidgell, 2004).

Multidrug resistant S. typhi

Wide spread use of chloramphenicol, ampicillin and trimethoprim/

sulfamethoxazole has resulted in multidrug resistance in Salmonellae. Strains
simultaneously resistant to three or more different groups of drugs are designated as
(MDR S. typhi) which is a real challenge in the developing countries (Holmberg et al.,
1984). From sub-continent prevalence of MDR S. typhi was reported in mid 80s (Rao et
al., 1993). MDR S. typhi incidence sharply increased from 60% to 90% from 1991 to
1993 (Rowe, et al., 1997; Rasaily et al., 1994 and Hazir et al., 2002). Over 86% MDR S.
typhi strains from Vietnam (Nguyen, 1993) and 93% from India (Bhat, 1998). MDR S.
typhi strain encompasses China, South East Asia and Indian sub-continent (Mirza, 1996;
Graham et al., 2002), also reported from Kuwait (Suganthi et al.,1993), Qatar (Uwydah
et al.,1991), Kenya 65% (Kariuki et al.,2004; Wain and Kidgell, 2004) and Egypt 60%
(Momtaz, et al., 2002).

19
Fluoroquinolones resistance

MDR S. typhi was treated effectively with ciprofloxacin, was a drug of choice in
Bangladesh and regional countries of South East Asia where disease is endemic. The
quinolones were found effective with100% cure rate (Wang et al., 1989; Anand et al.,
1990; Ahmed et al., 1992) and became the first line empirical drugs for MDR S. typhi
infection (Parry et al., 2002; Vollaard et al., 2005 and Okeke et al., 2005).

Nalidixic acid resistant strain with decreased susceptibility to ciprofloxacin was

first detected in 1991 resulting in treatment failure and spread globally. Incidence of
14% resistance was reported from United Kingdom in 2001 (Dunne et al., 2000; Graham
et al., 2000; Threlfall and Ward, 2001). Incidence of decreased susceptibility to
ciprofloxacin and nalidixic acid resistant S. typhi was reported from Europe and Japan
during 1999 – 201 (Threlfall et al., 1999; Hirose et al., 2001). Similar incidences were
reported from India, Vietnam, Tajikistan and United Kingdom (Karmaker, 1991;
Jesudason et al., 1996; Murdoch et al., 1998; 2002; Haque et al., 2003).

The strains with decreased susceptibility to ciprofloxacin were interpreted

ciprofloxacin susceptible according to disk testing criteria although associated with
treatment failures. Gradual increase in MICs of ciprofloxacin was noticed but still lower
than the breakpoint of resistance, therefore revision in break point for ciprofloxacin
sensitivity was suggested (Bottieau et al., 2006; Parry et al., 2007; Crump et al., 2008).
Finally ciprofloxacin sensitivity break point revised (CLSI 2010).

Nalidixic acid resistance and decreased susceptibility to ciprofloxacin is acquired

due to mutation (s) in gyrA gene characteristically occurring at position 83 of the DNA
gyrase enzyme (changing serine to phenylalanine/Tyrosine) and position 87 (changing
aspartate to tyrosine/glycine). Increased fluoroquinolone resistance is associated with
both the mutations in the gyrA gene; its incidence has increased frequently in Asian
countries (Hasan et al., 2005; Mushtaq, 2006; Chau et al., 2007).

From Pakistan, first fluoroquinolone resistant S. typhi was reported in 1993

(Hannan et al., 1993). S. typhi strains both ciprofloxacin resistant and ciprofloxacin
susceptible but resistant to Nalidixic acid are prevalent in the sub-continent and their
20
incidence has increased (Rowe et al., 1997). In Pakistan over 90% MDR S. typhi strains
and more than 82 % with decreased susceptibility to ciprofloxacin have complicated the
treatment (Haque and Rahman, 2003).

Cephalosporin Resistance
Plasmid mediated emergence of quinolone resistance left the treatment choices to
beta lactams and third generation cephalosporin. Cephalosporin cure rate of 82-97 %
against MDR S. typhi infection has been reported from India and Pakistan (Frenck, 2003;
Bhutta, 2006). In developing countries usefulness of third generation cephalosporin
including ceftriaxone, cefotaxime and ceftazidime is very limited due to cost effective
and parenteral route for administration. Ceftriaxone resistant sporadic cases of S. typhi
were reported from different parts of the world (Crump et al., 2008; Yoon et al., 2009
and Malini et al., 2009).

Extended-Spectrum β-Lactamases (ESBLS) in S. typhi

Ceftriaxone a third generation cephalosporin is considered the drug of choice for
fluoroquinolone resistant and MDR S. typhi infection (Parry, 2002; Malini et al., 2009).
Extended spectrum beta lactamase producing Salmonella causing nosocomial infection
has been reported from Latin America, Africa, Asia and Europe. Salmonella have been
found to express a wide variety of ESBL types including TEM, SHV, PER and CTXM
enzyme. Emerging extended spectrum beta lactamase producing S. typhi constituted a
new challenge for treating physicians in endemic countries (Tzouvelekis et al., 2003;
Batchelor et al., 2005; Paterson, 2006; Bottieau et al., 2006; Al Naiemiet al., 2008).

Mechanisms of drug resistance in S. typhi

Plasmid (R- factor) was first defined as autonomously replicating DNA in
enterobacteriaceae and the Plasmid DNA carries the genetic determinants for resistance
to one or more antibiotics. Plasmid conferring antimicrobial resistance should be called
as R-plasmid (Watanab, 1963). R-plasmid is of two types conjugative and non-
conjugative. Conjugative plasmids transfer their copies from one bacterium to another
through tube called sex pili. R-plasmid can be transferred from one bacterium to another.
When introduced in a new bacterial host they replicate independently and are inherited
by both daughter cells at cell division (Novick, 1969; Datta, 1975).

21
 Plasmids (R-plasmids) transfer resistance from one bacterium to another and
colonization of patient with resistant strains. It is reported that environmental selection
by antibiotics in gastrointestinal tract has epidemiological significance. The incidence of
transfer of R-plasmids from natural isolates to suitable recipient bacteria is generally
very low. The R-plasmid can be transferred among enterobacteriaceae either by
conjugation or by transformation. Drug resistance hardly occurred in normal gut and the
transfer of drug resistance may be detected in special environment for example during
antibiotic therapy (Lacey, 1975; Akthar et al., 1987).

Genetics of chloramphenicol resistance in S. typhi

Chloramphenicol resistance is mediated by plasmid which belongs to
incompatibility group named Inc. H. group. H plasmids can be subdivided in to H1 and
H2. It is thermo sensitive and can be transferred into E. Coli K-12 in overnight
incubation at 30oC. Plasmid determinants comprising with chloramphenicol (C),
sulfonamide (Su), tetracycline (T) and streptomycin (St) (C, Su, T, St) were considered
to be the causal agents for individual typhoid epidemics occur in Thailand, South
Vietnam and India. Chloramphenicol resistance associated with inc. H plasmid has been
observed in different serotypes of Salmonellae including S. typhimurium. In an outbreak
of animals and humans infection occurred in Singapore and Malaysia, resistance to
ampicillin, tetracycline and kanamycin coded by H1 R-factor have been isolated from S.
typhimurium Phage type 193 (Anderson et al.,1975; Anderson, 1977; Anand, 1990).

A study conducted on calves infected by S. typhimurium explains that the specific

Salmonella strains carrying H – plasmids are distributed in clonal and epidemic fashion.
Numerous milk born outbreaks caused by sulfonamide and tetracycline resistant S.
typhimurium phage type 204 have been reported (Threlfall et al., 1982). In
Leicestershire epizootic infection of calves were reported caused by a strain of type 204.
Considerable clinical significance has been observed due to the wide spread
dissemination of multi resistant H. plasmid carrying S. typhimurium in bovine sources
apart from the economic implication to cattle industry. Threlfall conducted study in UK,
reported 289 strains with inc. H. containing S. typhimurium and 216 non-inc. H. strain
out of 505 human infections. Inc. H. group plasmid has medical and veterinary
significance but the plasmid transfer system and the other genomic determinants are
however, largely unknown. The origin of plasmid, temperature sensitivity for transfer,
22
prevalence in other gram negative bacteria and in animals or humans from different
regions of the world are also not known and transpires the need for considerable research
during the past more than a decade (Threlfall et al.,1980; Threlfall et al.,1982).

Types of plasmid involved in Resistance

Twenty six different incompatibility (inc.) groups among plasmid of enteric
bacteria have been reported. Inc. H. plasmids were reclassified in to two separate H.
incompatibility groups and designated as inc. H1 and inc. H11. The inc. H1 plasmid was
further sub divided into inc. H (11,12 and 13) and all the H1 were thermo-sensitive for
conjugal transfer and are large molecules with molecular weight of 100 M Daltons or
more (Grindely, et al.,1973; Taylor and Grant, 1977;Roussel and Chabbert, 1978;
Bradley et al.,1982).

Inc. H13 plasmids were referred to as inc. H3and these sub groups contained
MIP 233 on known plasmid which was incompatible with sub groups H11 and H12
plasmid. The pili specified by inc. H11 and H12 plasmid were serologically related to H.
pili and those specified by inc. H13 have been serologically different from all known
pilus types including H pili (Minor et al., 1976; Bradley et al., 1982).

The Prevalence of inc. H plasmid in the S. typhi

Global distribution of plasmid in S. typhi and S. typhimurium was known and
Group H12 plasmid frequently found in S. typhimurium isolates from human source from
Canada, mainly H12 plasmids were isolated from animal and human sources. Plasmid in
S. typhimurium from human source in Mexico was predominantly inc. 1i and inc. H.
plasmid could not identified in isolates from Australia and New Zealand (Anderson
(1977). Inc. H11 was the dominant plasmid type in isolates of human and animal origin
in Southeast Asia. Inc. H12 contributing 21 % of transferable plasmid in Africa. In
Middle East F1me plasmid was widely distributed in S. typhimurium clone causing
severe infections in pediatric units. Anderson concluded from observation that in a
particular region, ecological conditions had favored the emergence of particular strains of
S. typhimurium armed with particular plasmid and the strains had established themselves
(Anderson et al., 1973; Anderson, 1977).

23
 Out breaks of human Salmonellosis caused by resistant strains of S. typhimurium
affected pediatric units, and in systemic invasion, 30% mortality rate has been observed
due to multi resistant nature of the dominant plasmid type extremely limited the therapy.
These findings were supported by Avril (1977) who studied 410 strains in France and
Belgium belongings to six serotypes of epidemic salmonella collected from France and
Belgium. Resistant pattern encoded by inc. H. was predominantly (C, St, SU, T)
chloramphenicol, streptomycin, sulfonamide and tetracycline (Avril et al., 1977).

European, Canadian and Japanese studies suggest that incidence of particular R-

factor type can change with time and environmental conditions of salmonella species in a
particular geographical region. Change in plasmid type distribution simply related with
change in antibiotic usage. In S. typhi, chloramphenicol resistance is associated with the
inc. H. plasmid which encodes many other antibiotic resistant determinants. H. plasmid
is not confined to any single phage type of S. typhi, indicated by the isolation of nine
distinct Vi phage types carrying H11 plasmid encoding (C, S, SU, T) resistance from
South Vietnam and Thailand during typhoid epidemics (Anderson et al., 1973; Anderson
et al., 1974; Bezanson et al., 1981).

S. typhimurium serovar was the most predominant among the multidrug resistant
salmonella. Presence of H. plasmid in wild as well as caged birds in the absence of any
known selective pressure was also reported in a study conducted in Japan (Niida et al.,
1983). Chloramphenicol resistant salmonella serotypes isolated from animal has been
reported at peak level in the past and associated with inc. H. plasmid encoding resistance
to other clinically important drugs. Inc. H. Salmonella serovar causing epidemics in
intensive livestock units are usually of a clonal nature may be distributed rapidly in
different regions due to animal transportation. Salmonella infection is most commonly
caused by poultry and Pork. Salmonella infection in human is largely associated with
pediatric units causing systemic invasions. Meningitis is the main complication observed
with 30 % mortality rate. Inc. H. plasmid encodes resistant determinants to five or more
clinically useful antibiotics. Numerous out breaks of inc. H. plasmid have seriously
compromised the antimicrobial therapy. Taylor reported that animals are the original
source for these inc. H. plasmid mediated Salmonella strains (Lintonet al., 1981;
Tayloret al., 1982; Niida et al., 1983).

24
Conjugal transfer of inc. H plasmid
The plasmids identified in typhoid bacteria have optimum conjugal transfer
efficiency at 37⁰C. If temperature is below 37⁰C, transfer efficiency will be markedly
decreased. Thermo-sensitivity is the main distinguishing feature of H1 group i.e.
conjugate most efficiently at temperature below 37⁰C. Environment also affects in which
conjugation take place and the transfer of plasmid. Thermo-sensitivity has been
described as ability of H. plasmid to transfer more efficiently at temperature between
22⁰C to 30⁰C than 37⁰C. Transferability of H1 plasmid from resistant (R +
enterobacteria) to E. Colik12, divide the plasmid into two groups. Both groups optimally
work at different temperatures for conjugation. Group I have optimal transferability at
22⁰C while group II plasmid at temperature 22⁰C-33⁰C transfer efficiently. H12
subgroup was found in both groups whereas H11 plasmid was found in group II. Poor
transmissibility at 37⁰C has been observed (Bradley et al., 1980; Taylor et al., 1982).

Molecular size and stability of inc. H plasmid

Inc. H. plasmids are maintained in E. Coli K12 at 37⁰C indicating replication of
plasmid is not thermo-sensitive and maintenance of H. plasmid is less efficient in
Salmonella. Maintenance of H1 plasmid in S. typhi in different environmental conditions
is as follow.
a. In the presence of bile salts, at pH values from 6.3-7.3
b. In anaerobic environment.
Plasmids H11 and H12 were lost from S. typhi at variable rates up to 20 % cases. It has
been observed that H+ Salmonella strains, if stored at room temperature, lost their
resistance phenotype within 2-3 months (Taylor et al., 1978; Rangnekar et al., 1982).

Plasmid H1 457 has been found very unstable disappeared completely from host
E. Coli K-12 and Klebsiella in nutrient broth at a rate of 0-75% per generation. It was
further reported that most of the original drug resistances were non-conjugative and
determined no pili. Plasmid also gave rise to variants which lacked 25 M Dalton DNA.
Bradley reported another H11 plasmid Ph H1 508 stably maintained in both hosts. Inc. S
(H-12) plasmid was stable in E.Coli-K12 during growth at 30⁰C and at 42⁰C and
originally detected in Serratiamarcescens. Stability of thermo sensitive plasmids isolated
from different enterobacterial species and transferred them to E. Coli K-12. Out of 73
plasmids 34 were stably maintained after three daily passages at 44⁰C in broth culture. It
25
was proved that plasmid loss was determined solely by the loss of drug resistance
determinants. The rate of loss varied from 1 to 100 % in remaining 39 plasmids. H11
plasmid appeared to be more stable than plasmid of the H12 sub group during growth at
44⁰C. An Inc. plasmid which was isolated from different hosts (E. Coli K-12, E. Coli and
S. typhimurium) has shown a marked level of instability (Smith et al., 1978; Taylor and
Levine, 1980; Bradley et al., 1982);

Characteristic encoded by Inc H. plasmid

Characteristics encoded by Inc. H. plasmid had been concerned with drug
resistance determinants because of clinical and veterinary significance. Number of
phenotype character may be encoded by H. plasmid DNA suggested by the large size of
Inc. H. plasmid. Plasmid encoded genes for individual sugar utilization from a range of
different incompatibility groups. Inc. H plasmids carrying the gene for lactose or sucrose
utilization have been isolated from a number of different Salmonella serovar. It has been
observed by Smith that thermo sensitive plasmid of H11 sub group can transfer citrate
phenotype from original Salmonella typhi host to E. Coli K12. H11 plasmid encoding the
citrate determinant was isolated from E. Coli of animal and bird origin. Hybridization
studies between the H11 plasmid and a cloned citrate determinant from an Inc. H.
plasmid indicated no DNA homology between the citrate genes carried by plasmid from
these two Inc. groups (Ishiguro et al., 1980; Shinagawa et al., 1982).

Resistance to As, Hg and Te had been associated with plasmid of inc. H. group. It
has been observed that metal resistance is a specific characteristic of H12 plasmid with
Te resistance. Single plasmid belong to sub group- H13 and the smaller number of
plasmid assigned to H11 group also encode tellurium resistance. It has been observed
from the studies that inc. H plasmid confers simultaneous resistance to number of drugs.
It is difficult to assess the relative incidence of different combinations of antimicrobials
resistance determinants within the H. Incompatibility group. Commonly
chloramphenicol, sulfonamide, streptomycin and tetracycline (C, Su, S, T) profile was
associated with H11 sub group in Salmonella. The (C, Su, S, T) resistance was also
mediated by other H. plasmid and by plasmid from other inc. group. Dominant resistance
profile of (C, S, K, T) chloramphenicol, streptomycin, kanamycin and tetracycline It is
also concluded that chloramphenicol resistance was derived from spontaneous mutation
of current pattern and Inc. H12 plasmid do not mediate chloramphenicol resistance. It is
26
concluded from studies conducted on S. typhiurium phenotype193 possess H11 plasmid
which mediate Ampicillin and kanamycin (A, K) or ampicillin, kanamycin and
trimethoprim (A, K, T) resistance. Although chloramphenicol resistance determinant is
one the most widely encountered resistance specified by plasmid of the H group. It is
generally considered that chloramphenicol resistance determinant is not an integral
coding region on inc. H. plasmid (Anderson, 1975; Taylor et. al., 1978).

Chloramphenicol acetyl-transferase (CAT) is an intracellular tetrameric enzyme

which acetylates and inactivates the antibiotics using acetyl-coA as acyl donor. High
level resistance is mediate to chloramphenicol. Naturally occurring 15 variants of (CAT)
have been known and could be differentiated from one another by molecular weight,
plasmid linkage, mode of synthesis, native electrophoretic mobility, their reagent
sensitivity and affinity to chromatography. R-plasmids determined three different CAT
enzymes which could be distinguished with the help of MIC values, Km values for
chloramphenicol, electrophoretic mobility and inhibition by DTNB reported by Foster.
Type I CAT was commonly encoded by fi plasmid from a variety of incompatibility
groups including the H12 sub group observed by (Gaffney et al.,1978) Large number of
transposons have been identified which carry the genes for resistance to one or more
antimicrobials. Transposons which transpose at high frequency are widely distributed
among plasmid of many groups and transposons which transpose at low frequency were
found in narrow range of plasmids (Gaffney et al., 1978; Foster, 1983; Smith and Burns,
1984).

Transposibility of resistance determinants for trimethoprim and streptomycin /

spectinomycin carried by H11 plasmid isolated from a Klabsella aerogenosa strain
obtained from a patient suffering from enteric fever. Digestion of the plasmid DNA with
Hind III followed by gel separation and screening for the characteristic internal
fragments of Tn7, indicated that the H11 plasmid carried a Tn7-like transposon which
determined a type 1 dihydrofolate reductase. Persistence of E. Coli strain carrying the
H12 plasmid, pJT4, in the calf intestine. Simultaneous experiments with plasmid
negative, isogenic strains clearly indicated that pJT4 carried genes enhanced the ability
of the host strain to maintain itself in the intestine. It is assumed that pJT4 may code for
changes in the outer membrane that lessen immunogenicity or that enhanced resistance
to gut immune mechanism (Richard and Datta, 1982; Timoney and Linton, 1982).
27
R-factor epidemiology
Higher incidence of antibiotic resistance has been found in meat animal. Jackson
proved that highly resistant E. Coli were found in pigs, poultry and calves and a few
numbers occurring in adult cattle and sheep. Linton stated that majority of E. Coli in pig,
poultry and calves were resistant to one or more of the therapeutically useful antibiotics
whether or not the animal is receiving these antibiotics. The sero-type distribution of E.
Coli in human and animal. Based on o-serotype alone it is impossible to distinguished
normal gut E. Coli of animals from those present in humans (Jackson, 1981; Linton et
al., 1981; Linton, 1982).

R-factor transfer in vivo

Resistant strain of E. Coli from animal origin if acquired by man or its
persistence for longer period in the gut of humans do not produced any detectable
pathological effects. Therefore the potential transfer of R factor from transient R+ animal
E. Coli or from more persistent animal serotype which temporarily colonized the gut, to
the endogenous E. Coli strains or to pathogenic species such as Salmonella or Shigella.
Colonization of intestine by a specific strain mainly depends upon the surface structure
of that particular strain (Cohen, 1973; Broda, 1979).

R-factor transfer occurred within the gut has a considerable controversy.

Enterobacteria accounted less than 1 % of the total flora in the gut and the conditions in
the normal gut are not conductive towards conjugation. Petrocheilou concluded that
transfer of R-factor commonly not occur in the gut and demonstrated transfer of plasmid
between E. Coli strains in the gut of a healthy volunteer in the absence of antibiotic
selection (Petrocheilou et al., 1976).

R-factor transfer under environmental conditions

Coliform with R factor in faecally contaminated water, sewage water, plants, and
sediments have presented insignificant difference of survival of R+ and R- bacteria.
Identical results have been also reported from a project (Fontain and Hoadley, 1976;
Bell, 1978).
R factor transfer can occur in dialysis bags immersed in a river and dam under
specific environmental conditions. And in a study on conventional sewage treatment
28
plants inactivation (quiescent) process such as sedimentation have been observed to
favor conjugation and transfer of resistance among enterobacterial strains of E. Coli,
Proteus mirabilis and S. enteridis could transfer their R-factors to E. Coli and Shigella
sonnei in membrane diffusion chamber which were placed in the primary and secondary
setting tanks of waste water treatment plant. R+ E. Coli strains randomly at temperature
ranging between 15⁰C - 35⁰C from river water, sea water and nutrient broth for
transferability of these isolates and observed transfer of R-factor in about 50 % of the
isolates under temperature, nutrient and environmental conditions (Grabow et al., 1975;
Grabow et al., 1976; Cook, 1980).

Environmental aspects of H plasmid transfer

Calves infected with a H12 plasmid harboring chloramphenicol resistant strains
of S. typhimurium in a calf unit, invariably harbored E. Coli resistant to the same range
of antibiotics. The excretion of resistant coliform pattern and the combination of R-
determinants carried by 89 % of the chloramphenicol resistant E. Coli, indicated that the
H12 plasmid had been transferred from Salmonella to indigenous E. Coli strain. H12
plasmid has been detected from six different serotype of E. Coli it means multiple
transfers had been occurred between Salmonella and E. Coli or between H+ E. Coli
trans-conjugants and other sensitive E. Coli strains. It is further reported that
colonization of the animal occurred by the faeco-oral route and transfer of H plasmid had
occurred outside the animal in the faecally contaminated environment. With respect to
the ecology of H. plasmid rapid dissemination of H. plasmid in Salmonella isolates has
been reported (Anderson, 1977; Linton et al., 1981).

29
PATIENTS, MATERIALS AND METHODS

30
 In this study four thousands seven hundred and forty eight (n = 4748) S. typhi
isolates were collected from blood culture samples of patients who were admitted or
visited outpatient department of Sheikh Zayed Medical Complex Hospital, Lahore, with
the complaints of pyrexia of unknown origin or septicemia during five years from July
2005 to June 2010. One sample from each patient was included in the study.

Sample collection
From adult patients 5-10 ml and from children/infants 1-5 ml blood was collected
and inoculated to blood culture bottles containing 45 ml brain-heart infusion broth.
Bottles were labeled with patient name, age, sex, date and location and were incubated
aerobically at 37⁰C for one week.

Sample culture
Blood culture samples collected from patients were first sub cultured on
Mac.Conkey Salmonella and Shigella (SS) agar plates after 48 hours of incubation.
Inoculated plates were incubated aerobically at 37⁰C for 24 hours in inverted position. In
case of no growth observed after 24 hours the plates were re-incubated for another 24
hours. The growths sub cultures were repeated on 5th and 7th days of incubation.

Identification of isolates
Laboratory standard operating procedure for identification of the organism
included colonial morphology, gram staining, serological and biochemical tests
employing AP1 – 20E identification system of Biomeriux, inc. France (Cowan& steal,
1997; fine gold, 1999). For Gram staining, cells from a single isolated 2-4 mm flat non
lactose fermenting colony were smeared on glass slide and stained with gram stain and
examined.

Serological identification
Serological identification of S. typhi was performed by Salmonella O, H & V1
antigen (BD Difco, USA) according to the instructions of manufactures. Accordingly a
drop of distilled water was placed on a clean glass slide, and a single colony of the test
organism from Mac. Conkey agar plate was employed for making a homogenous
suspension by thorough mixing. This was followed by addition of one drop of
agglutination sera of S. typhi and the suspension was again mixed with a sterile stick.
31
The slide was rotated for 10-15 seconds and observed for agglutination with necked eye.
Positive and negative controls were used for comparison.

Biochemical identification using AP1- 20E

AP1 – 20E system was used for identification of organisms which provided an
easy and quick identification.

Methodology of API -20E

Twenty one test results in the API – 20E system were converted to seven digits
profile using octal coding system and identification was made though the analytical
profile index, following to the instructions of manufactures.

Antimicrobial susceptibility testing

The antimicrobial susceptibility pattern of S. typhi was determined by Kirby-Baur
disc diffusion method in accordance with the Clinical and Laboratory Standard Institute
(CLSI) guideline using commercially available antimicrobial discs (Oxoid, Basingstoke,
USA). E-Coli (ATCC – 25922) was used as control strain for all the antimicrobial
susceptibility tests.

Methodology
Antimicrobial susceptibility was performed on diagnostic sensitivity test (DST)
agar media with 4mm thickness. Bacterial test inocula were standardized to match with a
0.5 Mac Farland turbidity standard (1x108cfu/ml). Sterile swab was first immersed into a
given inoculum ampoule. The agar plate was inoculated by streaking evenly with the
swab. Before applying the antimicrobial discs, plates were held at room temperature for a
few minutes so that the surface moisture should be absorbed. Then the antimicrobial
discs were placed on the agar at appropriate distance from center to center. The discs
were tapped gently with the help of blunt end of a sterile metal probe to ensure complete
and uniform contact with the agar surface. Plates were then inverted and incubated
aerobically at 37⁰C for 24 hours.

32
Antimicrobial agents tested
In vitro susceptibility of antimicrobials was determined by using 5 mm
commercially available discs on Muller- Hinton agar following the modification of
Kirby-Bauer disc diffusion method according to CLSI recommendations. The
antimicrobial agents tested were ampicillin (10mg/l), chloramphenicol (30mg/l),
trimethoprim (1.25mg/l), sulfamethoxazole (25mg/l), ceftriaxone (30mg/l), cefotaxime
(30mg/l) ceftazidem (30mg/l), ciprofloxacin (5mg/l), nalidixic acid(5mg/l) and others as
mentioned in the Table 8, 9 and 10.

Zone edges examined with naked eye were considered point of complete
inhibition of growth. Zone of inhibition around each antibiotic disc was measured with
the help of vernier caliper. If the distance between radius of zone in controlled area and
the radius of zone in the testing area was equal to or less than 3 mm, the test organism
was considered sensitive while it was considered resistant if the zone radius measured
was equal or more than 3 mm. Production of extended spectrum beta lactamase (ESBL)
was evaluated using cephalosporin indicator discs in combination with co– amoxiclav.
Staphylococcus aureus (ATCC – 25923), Pseudomonas aeruginosa (ATCC – 27853), E.
coli (ATCC – 25922), Acinetobacter baumanni (ATCC – 29212) and Enterococcus
faccalis (ATCC – 29212) were used as reference strains and treated similarly for quality
control.

Extended spectrum βeta lactamase (ESBL) production

S. typhi µisolates were tested for extended spectrum beta lactamase (ESBL)
production using ceftazidime (CAZ), cefotaxime (CTX) or ceftriaxone (CRO) indicator
discs (oxide) following the CLSI criteria (12). The isolates that showed zones of
inhibition (ZOI) less than 22mm for CAZ and less than 27mm for CTX were also tested
by double disc synergy test in combination with the co-amoxiclav (amoxicillin +
clavulanic acid).

Double disc synergy test (DDST)

Muller-Hinton (MH) agar was inoculated with test isolate to give a semi
confluent growth using CAZ (30ug) and AMC (20ug). The discs were then placed
strategically 25-30 mm apart from center to center following overnight incubation at

33
37⁰C for 24 hours aerobically. The isolates showing an increase in ZOI equal or more
than 5mm were phenotypically confirmed as ESBL producer.

Storage of Bacterial Isolates

The isolates were preserved in 16% v/v glycerol in tryptic soya broth (Oxoid Ltd
UK) and then stored at – 70⁰C. The bacterial strains were sub cultured and retested for
characteristic features before use. Working cultures were maintained on tryptone soya
agar (TSA) slant at 2 – 8⁰C for up to two weeks.

Revival of S. typhi isolates

The isolates were revived in TSB by inoculation of 3ml medium with 50µl of
thawed stock culture followed by incubation at 370⁰C for 24 hours. The growth in TSB
was sub cultured on Mac. Conkey agar plates and incubated overnight to obtain pure
culture for further use.

DNA isolation of S. typhi

Single isolated colony of average size measuring 2 to 4 µm was picked up and
mixed in 30ul T.E in 0.2ml PCR tube with the help of 200ul tip. PCR tubes were then
placed in the thermo cycler, heated at 95⁰C for 5min, cooled down to room temperature
and centrifuged at 500g for 30 second. Supernatant was saved as a source of DNA for
further use in PCR.

Molecular Confirmation of S. typhi strains

Primers used for the confirmation of S. typhi (Accession number = AF 332601)
isolates are shown in Table 1.

Table: 1. Primers used for the confirmation of S. typhi.

Target Amplicon
Primer Oligonuleotide sequence(5-3) Reference
gene size b/p

STN (F) F-5’ act gctaaaacc act act 3’ Song et at

fliC 363
STN (R) R-5’ tggagacttcggtcgcgtag 3’ 1993

34
PCR detection of fliC gene
Detection of fliC gene confirms the isolate as S. typhi reported by Song et al.
(1993) and Frankel (1994). For detection of fliC gene in the test isolate a PCR was done
using 1x PCR buffer (Famentas), 1.5mM MgCl2, 0.2mM dNTPs, 0.5mM primers (STN-
F and STN-R, accession number AF332601, Table 1) and 0.5U Taq polymerase and 2µl
of DNA. The total reaction volume was 20ul. Optimized conditions for amplification of
fliC gene were 30 cycles of 1 minute each at 94⁰C, 53⁰C and 72⁰C followed by final
extension at 72⁰C for 5 mints. All procedures including culture, DNA extraction and
PCR were carried out in specific separate cabin with designated set of pipettes and tips.
Reagents used in the PCR were divided in aliquots which were discarded after single use
to ensure further safety.

Agarose gel electrophoresis

PCR products were loaded on 1.5% agarose gel and electrophoresis was
performed in 1xTAE at 100 volts. Ten µl of each PCR product was mixed with 2µl DNA
loading dye and loaded on gel.
Agarose gel was prepared by dissolving 1.5% agarose in 1X TAE by boiling. It
was cooled down to approximately 60⁰C and ethidium bromide was added to a final
concentration of 0.5µg/ml. Then it was poured into the casting tray containing a sample
comb and allowed to solidify. After gel solidification the comb was removed and gel was
transferred in the electrophoresis chamber and the buffer was added till the gel just
dipped in the buffer. The PCR products mixed with 6x loading dye were loaded on gel.
A 100bp DNA ladder was used as molecular size maker (Fermentas). The bands in the
gel were observed and a photographed was taken using gel doc instrument.

PCR Amplification of genes in MDR S. typhi isolates

PCR detection of catP gene

PCR was done for the detection of chloramphenicol drug resistance gene (catP)
using 1X PCR buffer (Fermentas), 1.5mM MgCl2, 0.2mMdNTPs, 0.5mM both primers
(catP F& catP R, table 2), 0.5U Taq polymerase and 2µl of the template DNA. The total
reaction volume was 20µl. The cycling condition for PCR were initial denaturing at 95⁰C
for 2 minutes followed by 35 cycler of 95⁰C for 30sec, 50⁰C for 30sec and 72⁰C for
45seconds.
35
Table 2.Primers used for detection of drug resistance genes.

Accession Targeted Amplicon

Primer Oligonucleotide sequence (‘5-‘3) Drug Reference
Number gene size (bp)

ASRC (F) F 5’- cctgcc act cat cgcagt -3’ Beatriz et al.,
U 46780 catP Chloramphenicol 623
ASRC (R) R 5’- ccaccgttgata tat eec -3’ 2001

A (F) F 5’- geacgagtgggttacatc ga-3’ Carlson et al.,

Ay 436361-1 Tem Ampicillin 311
A (R) R 5’- ggtcctccgatggttgtc ag-3’ 1999

SUL (F) F 5’- tcaacataacctcggacg gt-3’ Trimethoprim/ Chu et al.,,

x-57730 sul2 707
SUL(R) R 5’- gat gaagtcaggtcc ace t -3’ sulfamethoxazole 2001

CiP (F) F 5’- taccgt cat agt tat cca cga-3’ Molbak K et al.,
Ay 302580 GyrA Ciprofloxacin 313
CiP (R) R 5’-gta ctttacgccatgaac gt-3’ 1999

36
PCR detection of tem (β-lactamase) gene
Ampicillin drug resistant gene(tem) was detected by PCR using 1x PCR buffer
(Fermentas) , 2.0mM MgCl2, 0.2mM dNTPs, 0.5mM each of forward and reverse
primers (tem F& tem R, Table 2), 0.5U Taq polymerase and 2µl of the template DNA.
The total reaction volume was 20µl. The thermocycler conditions for PCR reaction were
initial denaturing at 95⁰C for 2 minutes followed by 35cycler of 95⁰C for 30sec, 50⁰C
for 30sec and 72⁰C for 45seconds.

PCR detection of sul-2 gene

For the detection sulfonamide resistant gene (sul-2), a PCR was done using 1x
PCR buffer (Fermentas), 1.5m MMgCl2, 0.2mMdNTPs, 0.5m Meach primer (sul-2,
Fand sul-2 R Table -2), 0.5U Taq polymerase and 2µl of the template DNA. The total
reaction volume was 20ul. Thermocycler conditions for PCR reactions were initial
denaturing at 95⁰C for 2 minutes followed by 35 cycles of 95⁰C for 30 seconds 50⁰C for
30 seconds and 72⁰C for 1 minute.

All the PCR amplification products were electrophoresed on 1.5% (w/v) agarose gel in
TAE at 100 volts as earlier in this section.

PCR detection of gyrA gene

For the detection of gyrA gene mutations responsible for fluoroquinolones
resistance, a PCR was done using 1x PCR buffer (Fermentas), 1.5mM MgCl2 0.2mM
dNTPs, 0.5mM of both primers (gyrA F & gyrA R, Table 2), 0.5U Taq polymerase and
2µl of the template DNA . The total reaction volume was 20µl. Thermocycler conditions
for PCR reaction were initial denaturing at 95 ⁰C for 2minutes followed by 35 cycles of
95⁰C for 30 seconds, 50⁰C for 30 seconds and 72⁰C for 1minute. PCR products were
observed by gel electrophoresis and a picture was taken.

Confirmation by Sequence
All the PCR products were sequenced for the confirmation of right sequence of
fliC, Sul-2, Tem, CatP and gyrA gene products. In case of gyrA gene, mutations were
also studied by sequencing. Before sequencing, PCR products were cleaned up using
Silica Bead DNA Gel Extraction Kit by Fermentas using following procedure.

37
 The gel slice containing the DNA fragment was excised using a clean scalpel and
placed into a pre-weighed 1.5 ml tube and weighed again. The weight of the gel
slice was recorded.
 Added a 3:1 volume of Binding Buffer (6M NaI) to the gel slice (volume:
weight) and incubated at 55°C for 5 min or until the gel slice was completely
dissolved. The tube was inverted every few minutes to facilitate the melting
process.
 A 7μlSilica Powder Suspension was added to the DNA/Binding Buffer mixture
and incubated the mixture for 5 min at 55°C to allow for binding of the DNA to
the silica matrix. The tube was inverted every few minutes to keep the silica
powder in suspension.
 The tube was centrifuged shortly to get the pellet of silica powder/DNA mixture.
The supernatant was removed carefully.
 The pellet was washed with 500 μl of ice cold 75% ethanol, spun shortly and the
supernatant was discarded. The washing procedure was repeated. The silica pellet
was air dried for 15min.
 The DNA was eluted in 30 μl low TE.

38
RESULTS

39
 The present study was conducted on four thousands seven hundred and forty
eight S. typhi isolates collected from typhoid patients. Among all the patients, 2429
(52%) were males and 2250 (48%) were females. Male to female ratio of 1:1.02
appeared insignificant (Fig. 1).

Fig. 1.Gender distribution of patients

Patients were classified into three age groups, children (5-15 years), adults (16-60
years) and elders (61-85 years). Maximum number of patients was from children age
group followed by adult age group. The number of patient decreased to minimum in
elder age group. In all the age groups, the percentage of male patients was higher than
that of females (Table 3).

Table 3. Distribution of the patients in different age groups

Age group (years) Total (%) Male (%) Female (%)

Children (5-15) 2245 (47.3) 1253 (48) 992 (46)

Adult (16-60) 1666 (35) 870 (34) 796 (37)

Elder age (61-85) 837 (17.7) 470 (18) 367 (17)

Morphology and gram staining of the bacterial isolates

Colonies grown on Mac Conkey agar after 24 hours of incubation were colorless,
typically non lactose fermenting, translucent and circular having size from pin point to 2
mm in diameter. Microscopic examination of stained smear made from selected colonies
40
revealed gram negative rods of 3 to 5µm in length and 0.5 to 1.0 µm in width. Results
were reproducible (Fig. 2and 3).

Fig. 2. Typical colonies of Salmonella typhi on Mac Conkey agar

Fig. 3.Microscopic appearance of the Gram negative rods

41
Biochemical identification of the bacterial isolates
Test isolates inoculated on triple sugar iron (TSI) medium after 24 hours of
incubation showed typical S. typhi characteristics, including red slant and yellow butt.
Slight blackening in the medium indicated H2S production. Spreading growth along
inoculation showed motility of pathogens (Fig. 4). Oxidase test was negative (Fig. 5).
The results of API-20E strip (Bio-meraux, Hazelwood, Durhan NC, USA) are shown in
Table 4 and Fig. 6, 7. All the results were reproducible.

Fig. 4.Appearance of the bacterial growth in TSI, Reddish Slant indicated alkaline
reaction; Blackening showed H2S production and Yellow butt expressed Acidic reaction.

Fig. 5.Strip showing oxidase test results. Left side-Negative confirming Non-lactose
fermenting (S. typhi) and right side-Positive control pseudomonas aeruginosa (right)
42
 Table 4. Biochemical reactions of S. typhi studied by API-20E

Results
Test Active ingredient Reaction/Enzyme %
Negative Positive
ONPG 2-nitrophenyl-ßd-ala ß-galactosidase Colorless Yellow 100
ADH L-arginine Arginine Dihydrolase Yellow Red/orange 98
LDC L-Lysine Lysine Decarboxylase Yellow Red/orange 98
ODC L-ornithine Ornithine Decarboxylase Yellow Red/orange 100
CIT Trisodium citrate Citrate utilization Pale/green/yellow Blue-green/blue 100
H2S Sodium thiosulfate H2S production Colorless/greyish Black deposit 92
URE Urea Urease Yellow Red/orange 100
TDA L-tryptophane TryptophaneDeaminase Yellow Reddish brown 100
IND L-tryptophane Indole production Colorless/ Pale Pink 100
VP Sodium pyruvate Acetone production Colorless Pink/red 100
GEL Gelatin Gelatinase No diffusion black pigment 100
GLU D-glucose Fermentation/Oxidation Blue/blue-green Yellow/grayish 100
MAN D-mannitol Fermentation/Oxidation Blue/blue-green Yellow 99
INO Inositol Fermentation/Oxidation Blue/blue-green Yellow 100
SOR D-sorbitol Fermentation/Oxidation Blue/blue-green Yellow 100
RHA L-rhamnose Fermentation/Oxidation Blue/blue-green Yellow 100
SAC D-sucrose Fermentation/Oxidation Blue/blue-green Yellow 100
MEL D-melibiose Fermentation/Oxidation Blue/blue-green Yellow 95
AMY Amygdalin Blue/blue-green Blue/blue-green Yellow 100
ARA L-arabinose Fermentation/Oxidation Blue/blue-green Yellow 100

Fig: 6, API 20-E test results

43
Fig.7. API strip showing the summery of the results of the tests performed

Confirmation of the bacterial isolates by anti-sera

Isolates were confirmed using anti-sera (Bio-Rad Laboratories CA, USA). Strong
positive agglutination was observed within 30 seconds with anti-sera. Negative and
positive controls including E. Coli NCTC 10418 and S. typhi ATCC 6539 respectively
were used (Fig 8). Anti-sera results were reproducible.

Fig. 8. Slide picture of salmonella typhi confirmation by anti-sera showing negative (left)
and positive (right) agglutination results

Isolation of S. typhi
Isolation of S. typhi was noted in each month of the year, throughout the study
period from 2005 – 2010. A decreasing trend was seen in the overall isolation of S. typhi
from 2005-6 to 2009-10 (P< 0.001, Fig. 10). Maximum incidence (10.7% to 11.2 %)
occurred during hot and humid months of June, July and August. Incidence decreased to
minimal in winter season during November, December, January and February
44
accounting 6.6% to 7.3%. During rest of the months (March to May and in September
and October), the incidence remained between 7.6% and 7.7% throughout the study
period (Fig. 9,Table 5).

Fig. 9.Average prevalence of typhoid fever in each month observed from 2005 to 2010

Fig. 10.Isolation rate of S. typhi from 2005 to 2010

45
Table 5. Isolation of S. typhi in different months from 2005-6 to 2009-10

Total
Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec
cases

124 96 118 99 120 134 138 142 93 116 102 90

2005-6 1372
(9%) (6.9%) (8.6%) (7.2%) (8.7%) (9.7%) (10.0%) (10.3%) (6.7%) (8.4%) (7.4%) (6.5%)

72 76 81 46 98 120 125 118 96 78 72 68

2006-7 1050
(6.8%) (7.2%) (7.7%) (4.3%) (9.3%) (11.4%) (11.9%) (11.2%) (9.1%) (7.4%) (6.8%) (6.4%)

68 71 79 49 92 116 118 110 84 76 82 73

2007-8 1018
(6.6%) (6.9%) (7.7%) (4.8%) (9.0%) (11.3%) (11.5%) (10.8%) (8.2%) (7.4%) (8.0%) (7.1%)

51 49 58 62 65 85 91 86 53 49 57 54
2008-9 760
(6.7%) (6.4%) (7.6%) (8.1%) (8.5%) (11.1%) (11.9%) (11.3%) (6.9%) (6.4%) (7.5%) (7.1%)

43 39 41 43 48 61 59 57 46 42 35 34
2009-10 548
(7.8%) (7.1%) (7.4%) (7.8%) (8.7%) (11.1%) (10.7%) (10.4%) (8.3%) (7.6%) (6.3%) (6.2%)

46
Isolation of multi-drug resistant S. typhi
Out of 4748 S. typhi isolates, 431 were MDR S. typhi. Among these MDR S. typhi,
180 were collected during 2005. Isolation number decreased gradually to only 23 isolates in
2010, the decreasing trend was statistically significant (P < 0.001, Table 6). Maximum
average incidence was seen during the months of July and August (Table 7, Fig. 11).

Table 6.Isolation rate of MDR S. typhi

year No. of MDR isolates %age

2005-6 180 13.0%
2006-7 110 10.4%
2007-8 80 7.8%
2008-9 38 5.0%
2009-10 23 4.2%

Fig. 11. Average monthly isolation of MDR S. typhi from 2005-2010

47
Table 7. Monthly isolation of MDR S. typhi from 2005-2010

Total
year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec
cases

14/124 12/96 11/118 7/99 15/120 21/134 29/138 33/142 9/93 12/116 6/102 11/90
2005-6 180/1372
(11.2%) (12.5%) (9.3%) (7.0%) (12.5%) (15.6%) (21%) (23.2%) (9.6%) (10.3%) (5.8%) (12.2%)

7/72 7/76 9/81 5/46 9/98 13/120 17/125 14/118 8/96 7/78 7/72 7/68
2006-7 110/1050
(9.7%) (9.2%) (11.1%) (10.8%) (9.1%) (10.8%) (13.6%) (11.8%) (8.3%) (8.9%) (9.7%) (10.2%)

5/68 6/71 7/79 4/49 8/92 10/116 11/118 8/110 6/84 4/76 6/82 5/73
2007-8 80/1018
(7.3%) (8.4%) (8.8%) (8.1%) (8.6%) (8.6%) (9.3%) (7.2%) (7.1%) (5.2%) (7.3%) (6.8%)

2/51 1/49 2/58 3/62 3/65 6/85 6/91 6/86 3/53 2/49 2/57 2/54
2008-9 38/760
(3.9%) (2%) (3.4%) (4.8%) (4.6%) (7%) (6.5%) (6.9%) (5.6%) (4%) (3.5%) (3.7%)

1/43 1/39 1/41 2/43 2/48 3/61 4/59 3/57 2/46 2/42 1/35 1/34
2009-10 23/548
(2.3%) (2.5%) (2.4%) (4.6%) (4.1%) (4.9%) (6.7%) (5.2%) (4.7%) (4.7%) (2.8%) (2.9%)

48
Table 8.Resistance pattern of S. typhi isolates against different antimicrobials during study period

2005-6 2006-7 2007-8 2008-9 2009-10

Drugs N=1372 %age N=1050 %age N=1018 %age N=760 %age N=548 %age

Ceftriaxone 196 14.2 160 15.2 162 15.9 118 13.5 23 4.2

Cefotaxime 248 18 171 16.2 132 12.9 108 14.2 26 4.7

Ceftazidime 226 16.4 158 15 145 14.2 90 11.8 28 5.1

Sparfloxacin 208 14.8 127 12 108 10.6 96 12.6 58 10.5

Gentacin 248 18 168 16 140 13.7 120 15.7 87 15.8

Imipenem 36 2.0 26 2.4 31 3.0 18 2.3 10 1.8

Meropenem 42 3.1 31 2.9 31 3.0 17 2.2 11 2.0

49
 First line anti typhoid drugs sensitivity
Significantly increasing susceptibility of first- line anti typhoid drugs was
observed against the S. typhi isolates. Sensitivity of chloramphenicol, ampicillin and
trimethoprim / Sulfamethoxazole increased from 53.9 %, 29.9 % and 36.1 %, respectively
during 2005 to 87.3 %, 81.1 % and 78.2 % in 2010 against the S. typhi of this study
(Table 9, Fig. 12, 13).

Table 9.Observed resistance / susceptibility pattern of S. typhi against first line anti-
typhoid drugs

2005-6 2006-7 2007-8 2008-9 2009-10 P

Resistance 632 278 195 101 70

Chloramphenicol <0.001
Susceptibility 740 772 823 659 478

Resistance 962 685 236 161 104

Ampicillin <0.001
Susceptibility 410 365 782 599 444

Trimethoprim / Resistance 878 602 248 183 120

<0.001
Sulfamethoxazole Susceptibility 494 448 770 577 428

Fig. 12. Resistance / susceptibility pattern of S. typhi observed in 2005-6. The organism
shows susceptibility to ciprofloxacin (in the center) and resistance to first line anti-typhoid
drugs along with tetracycline and erythrocin (peripheral rim).
50
Fig. 13. Resistance / susceptibility pattern of S. typhi observed in 2005-6. The organism
shows reduced susceptibility to ciprofloxacin (in the center) and resistance to first line anti-
typhoid drugs along with tetracycline and erythrocin (peripheral rim).

Fluoroquinolones sensitivity
Ciprofloxacin showed gradual reduction in sensitivity pattern from 2005 to 2010.
Susceptibility of ciprofloxacin was 83.9 % in 2005 which reduced to 45.1 % during the year
2010. Incidence of nalidixic acid resistant S. typhi decreased significantly from 2005-6 to
2006-7. The incidence significantly increased from 2006-7 to 2009-10 (Table 10, P<0.001).

Table 10.Observed resistance / susceptibility pattern of S. typhi against fluoroquinolones

2005-6 2006-7 2007-8 2008-9 2009-10 P

Resistance 220 380 498 410 301

Ciprofloxacin <0.001
Susceptibility 1152 670 520 350 247

Resistance 1236 742 895 726 526

Nalidixic Acid <0.001
Susceptibility 136 308 123 34 28

Isolation of S. typhi resistant to nalidixic acid showing reduced susceptibility to

ciprofloxacin increased gradually while that of resistant to nalidixic acid showing
susceptibility to ciprofloxacin decreased gradually during the study period (Table 11, Fig.
14, 15, 16, 17 and 18).
51
 Table 11. Incidence of Nalidixic acid resistant S. typhi isolates

Ciprofloxacin Reduced Ciprofloxacin sensitive

Year
susceptibility S. typhi (%age) S. typhi (%age)

2005-6 79/1372(5.7 %) 1293/1372(94.3%)

2006-7 109/1050(10.3%) 941/1050(89.7%)

2007-8 256/1018(25.1%) 762/1018(74.9%)

2008-9 228/760(30.0%) 532/760(70.0%)

2009-10 206/548(37.6%) 342/548(62.4%)

Fig. 14. Resistance / susceptibility pattern of S. typhi observed in 2005-6. The organism
shows susceptibility to fluoroquinolones and resistance to first line anti-typhoid drugs.

52
Fig. 15. Resistance / susceptibility pattern of S. typhi observed in 2007-8. The organism
shows susceptibility to ciprofloxacin while resistance to nalidixic acid and first line anti-
typhoid drugs.

Fig. 16. Resistance / susceptibility pattern of S. typhi observed in 2008-9. The organism
shows susceptibility to first line anti-typhoid drugs, reduced susceptibility to ciprofloxacin
while resistance to nalidixic acid.

53
Fig. 17. Resistance / susceptibility pattern of S. typhi observed in 2009-10. The organism
shows susceptibility to ciprofloxacin, nalidixic and first line anti-typhoid drugs.

Fig. 18. Resistance / susceptibility pattern of S. typhi observed in 2009-10. The organism
shows reduced susceptibility to ciprofloxacin and susceptibility to first line anti-typhoid
drugs while resistance to nalidixic acid.

54
Cephalosporin sensitivity
Susceptibility of cephalosporin (ceftriaxone, cefotaxime and ceftazidime) was found
95.7 %, 94.8 % and 94.6 % respectively throughout the study period on MH agar among
4748 S. typhi isolates (Table 8).

Extended spectrum βeta lactamase (ESBL) production

Out of 431- MDR S. typhi specimens, 238 isolates showed reduced susceptibility to
cephalosporin on Muller – Hinton agar using modified Kirby - Bauer disc diffusion method.
These isolates were further tested for ESBL production using double disc synergy test. Only
three isolates appeared ESBL producers (0.69 %) in present study (Fig. 19).

Fig. 19. DDST showing increased ZOI with Augmentin

Carbapenem and gentamycin sensitivity

S. typhi (n =4748) isolates were tested for susceptibility of carbapenem, and
gentamycin. Imipenem and meropenem were the most potent antimicrobials with 97.7% and
97.8% susceptibility. Second most effective drug against S. typhi and MDR S. typhi
respectively was gentamycin with 84.2 % effective against the isolates tested (Table 8).

55
PCR detection of resistance genes in MDR S. typhi
Detection of catP, tem, sul-2 and gyr A genes by PCR amplification methods were
done in all the 100 MDR S. typhi isolates (Fig. 20). The PCR products were sequenced for
the confirmation of results. The results were in accordance with the MDR pattern of S. typhi
detected by disc diffusion method.

Fig. 20.A representative agarose gel electrophoresis picture showing PCR bands of fliC
(363bp), gyrA (313bp), sul2 (707bp), tem (311bp) and catP (623bp) genes M is 50bp DNA
marker

PCR detection of fliC gene

The fliC gene is considered to be very specific for S. typhi. Amplification of a 363-
bp region of fliC gene using specific primers (Table 2) confirmed that all the test isolates
were S. typhi (Fig. 21).

56
Fig. 21.A representative agarose gel electrophoresis picture showing PCR bands of fliC gene
Lane 1 and 2 show negative and positive controls respectively Lanes 3-16 show PCR bands
from different test samples. M is 50bp DNA marker.

Amplification of catP gene

Chloramphenicol resistant susceptibility pattern of S. typhi isolates were determined
in all the selected samples by Kirby-Baur disc diffusion method. Chloramphenicol resistance
is conferred by an enzyme encoded by catP gene. The presence of catP gene in S. typhi was
confirmed by PCR amplification of 623- bp product using specific primers given in Table 2
(Fig. 22).

Fig. 22.A representative agarose gel electrophoresis picture showing PCR bands of catP
gene Lane 1 and 2 show negative and positive controls respectively. Lanes 3-16 show PCR
bands from different test samples. M is 100bp DNA marker

57
Amplification of tem gene conferring ampicillin resistance
Ampicillin resistance in S. typhi isolates is considered to be related to tem gene. In all
the S. typhi isolates, ampicillin resistance was also determined by Kirby-Baur disc diffusion
method. Amplification of 311- bp product using specific primers (Table 2) confirmed the
presence of tem gene in S. typhi isolates resistant to ampicillin (Fig. 23).

Fig. 23.A representative agarose gel electrophoresis picture showing PCR bands of tem gene
Lane 1 and 2 show negative and positive controls respectively Lanes 3-15 show PCR bands
from different test samples. M is 50bp DNA marker

Amplification of sul-2 gene

Sul-2 gene is associated with trimethoprim / sulfamethoxazole resistance. PCR
amplification of a 707 bp fragment of Sul-2 gene (Fig. 24) was carried out by using
previously reported primers (Table 2), which confirmed the presence of Sul-2 in isolates of
S. typhi. Trimethoprim / sulfamethoxazole resistance was also determined by Kirby-Baur
disc diffusion method in these isolates.

Fig. 24.A representative agarose gel electrophoresis picture showing PCR bands of sul 2
gene Lane 1 and 2 show negative and positive controls respectively. Lanes 3-15 show PCR
bands from different test samples. M is 100bp DNA marker

58
Amplification of gyrA gene
Mutations in gyrA gene (Ser 83 to Phe / Tyr and Asp 87 to Gly / Tyr) are related to
fluoroquinolones resistance. Presence of gyrA gene was confirmed by PCR amplification of
313 bp product (Fig. 25) using specific primers (Table 2) in selected samples of S. typhi. The
mutations were detected by sequencing. These isolates showed reduced susceptibility to
ciprofloxacin by Kirby-Baur disc diffusion method.

Fig. 25.A representative agarose gel electrophoresis picture showing PCR bands of gyr A
gene. Lane 1 and 2 show negative and positive controls respectively. Lanes 3-16 show PCR
bands from different test samples. M is 50bp DNA marker

Sequencing results showed that Ser 83 to Phe (TCC to TTC) mutation was found in
all the cases. No mutation at codon 87 was seen in any case. The results confirmed that the
resistance in the organism against fluoroquinolones was due to a mutation present at codon
83 (Fig. 26).

Fig. 26. A representative sequencing chromatogram of gyrA PCR product showing G to A

mutation (C to T in reverse sequence)

59
Sequence of the PCR
productCCGGGGCTTCTTTTTTCAAGATCGGCCTCAGTCCGTGGGCGATTTTCGCAGACGGA
TCTCCGTATAACGCATTGCCGCCGCGGAGTCGCCGTCATAGAACCGAAGTTACCCTGACCA
TCCACCAGCATGTAACGCAGCGAGAATGGCTGCGCCATACGAACGATGGTGTCATACACTG
CGAAATCGCCGTGGGGATGGCCTTACCGATT

Reverse Sequence of above

AATCGGTAAGGCCATCCCCACGGCGATTTCGCAGTGTATGACACCATCGTTCGTATGGCGC
AGCCATTCTCGCTGCGTTACATGCTGGTGGATGGTCAGGGTAACTTCGGTTCTATGACGGC
GACTCCGCGGCGGCAATGCGTTATACGGAGATCCGTCTGCGAAAATCGCCCACGGACTGAG
GCCGATCTTGAAAAAAGAAGCCCCGG

Fig. 27. A representative agarose gel electrophoresis picture showing multiplex PCR bands
of sul2 (707 bp), fliC (363 bp) and tem (311 bp) genes Lane 1-5 show PCR bands from
different test samples. M is 50 bp DNA marker

60
DISCUSSION

61
In present study male typhoid patients were 52% of the total cohort which is in accordance
with the studies conducted by Bhatta et al. (2005). Likewise Mubeena et al. (2006)
conducted a survey in Karachi and reported that males were infected more than females.
Kustner, (1979) from South Africa mentioned that both sexes were almost equally infected,
although slight female dominance among hospital admitted patients has been reported too
(Watson,1954; Chalmers, 1971 and Gaffar, 1992). From these diverse studies it appears that
the incidence of typhoid fever has no gender influence.

Maximum pediatric patients (47%) were followed by adult (35%) and elder age
group (18%). These findings are comparable with the results reported from Karachi,
Pakistan (Bhutta1996). Dutta and Kanwal (1998) from Sri Lanka and Das Usha and
Bhattacharya, (2006) from India reported pediatric age group frequently infected by S. typhi.

Highest incidence in children below 5 years of age reported by various workers

(Sinha et al., 1999 and Siddiqui et al., 2006) is probably due to exposure of relatively large
infecting doses of organisms / body weight. Saha et al. (2001) from Bangladesh reported
57% patients of below 5 years of age. Bhatta et al. (2005) on the other hand reported adult
age group from 21 to 40 years was more prone to enteric fever. Such variable results reflect
hygienic stranded variations practiced for different age groups in different localities and in
parts also are indicative of a particular age group shown in the total population

Prevalence of Salmonella typhi

Typhoid cases identified in each month and incidence pattern showed maximum
cases during hot and humid weather and minimum during cold season. Impact of climate
has been described by many workers with the conclusion that hot rainy season and humid
environmental conditions enhance the prevalence of typhoid fever (Velema et al., 1997;
Luby et al., 1998; Lin et al., 2000).

These seasonal variations are due to less likely hood of the S. typhi rapid growth
rates and less consumption of water and other contaminated fluids in colder months. While

62
there is no evidence to suggest that the incidence of enteric fever has gone down because
factors responsible for endemicity of enteric fever in our country like overcrowding, lacks of
clean drinking water, inadequate sewage disposal system and poor hygienic conditions have
not changed.

Enteric fever is a serious public health problem in South East Asian countries
including Pakistan (Edelman and Levine, 1986). Bhutta (1991) and Sabherwal et al. (1992)
stated that municipal tap water is a possible vehicle for spreading the of S. typhi infection.
From the above studies it can be concluded that public health measures, general hygiene
practices, food preparation and improvement in water quality should be simultaneously
focused for prevention of typhoid fever.

Isolation of S. typhi
A significant decrease in isolation rate of S. typhi from 2005 to 2010 is indicative of
progress in the general public hygienic conditions as well as health education to some
extent. Finding of the present study are comparable with the observations of Saha et al. ,
(1999) and Sood et al., (1999) who also reported decreased isolation of S. typhi in their
studies. Tariq et al., (2005) from Rawalpindi, Pakistan also reported similar findings. The
decrease in the isolation rate of the organism in the lab does not necessarily reflect a
decrease in the prevalence of the disease in community. Antibiotics are easily available to
people in Pakistan without any prescription from a physician. A patient with any type of
fever may buy antibiotic from pharmacy for self-medication. In such cases, the incidence is
not reported. Treatment should be based on culture and sensitivity report, which is not being
practiced in Pakistan by majority of the physicians. In most of the cases, the patients are on
prior antibiotics before culture and sensitivity testing. In such cases also, the isolation rate
will be decreased.

Isolation rate of multi-drug resistant S. typhi

MDR S. typhi declined from 180 to 23 isolates from 2005 to 2010. These results are
in good agreement with the findings of Wafsy et al. (2002), Mills-Robertson et al. (2002)
who reported decreasing trend in isolation of MDR S. typhi. Takkar et al. (1995), Agarawal

63
et al. (1998), Rahman et al. (2002) and Lathi (2005) reported decreased isolation rate of
MDR S. typhi.
Decreased isolation of MDR S. typhi in our study might have occurred due to the
with-drawl of first line anti typhoid drugs as empirical therapy because of their
compromised response after the year 2000. Several studies have documented higher rates of
isolation of MDR S. typhi before the year 2000 (Rowe et al., 1990; Karamat et al.,
1991;Butta et al., 1991and Agarwal et al., 1992). Higher incidence in these studies is
attributable to widespread use of first line anti typhoid drugs as empirical therapy for the
enteric fever during 1990s. Results of the present study indicated gradual decrease in
incidence of disease caused by MDR S. typhi from 180 to 23 isolates from 2005 to 2010.
This might be a reflection of improvement in general health concern, personal and domestic
hygiene, relatively better sanitary condition, concern over quality of drinking water and food
etc. Metro, Makro, Hyper star, K&Ns and Zenith are providing hygienically approved
quality food and mineral water. Frequent use of third generation cephalosporin has also
contributed towards the decrease in isolations of MDR S. typhi.

Antimicrobial susceptibility
The susceptibility of first line anti-typhoid drugs increased while that of quinolone
group (ciprofloxacin) decreased for the S. typhi isolates in present study. Third generation
cephalosporin, carbapenem and gentamycin were found to be highly effective against S.
typhi infection. On the contrary, Doughari et al. (2007) reported increase in the resistance
against first line anti typhoid drugs from 2001 to 2003. Similar results have also been
reported by Bhat et al. (1998) and Mateen A et al. (2004). They also reported that only 2.5%
to 15% of the isolates did not respond to ciprofloxacin while 3% to7% of the isolates did not
respond to cephalosporin.

In the present study, fifty five percent MDR S. typhi isolates resistant to ciprofloxacin
during 2009-10 (Table 10) suggests that efficacy of the drug is unreliable. This reflects the
wide spread use or misuse of ciprofloxacin. Self-medication, low dose intake, shorter
duration of treatment and more frequently prescribed nature might have been contributing
for the present results.

64
 Frequently prescribed drug is a well-known phenomenon contributing toward the
development of resistance. Due to poverty, many patients cannot consultant treating
physician. They start self-therapy after sharing disease problem with colleagues. Having a
little bit relief is sufficient in such instances for stopping medicine. Short duration therapy is
also practiced due to common belief prevalent in the society about harmful side effects of
the allopathic drugs.

Increased resistance against first line anti typhoid drugs and higher sensitivity of
quinolones has been reported extensively till 2002 (Sanghavi et al., 1999; Mahmood, 2000;
Hakanen et al., 2001; Parry et al., 2002; Tariq et al., 2003 and Tsonyo et al.,2007). Studies
conducted afterward contrarily reported increased sensitivity of first line anti typhoid drugs
and decreased susceptibility of quinolones. Dromgny et al. (2003) reported excellent
sensitivity of first line anti typhoid drugs with less than 1% resistance among 232 isolates of
S. typhi in Dakar, Sengial. Madhulika et al. (2004) from India also reported similar findings.

Third generation cephalosporin has been reported very effective against MDR S.
typhi without risk of relapse. Ceftriaxone was reported to be 100 % effective against MDR
S. typhi in many studies (Tehmina et al., 2001; Talti, 2003 and Mateen A et al., 2004).
Anand et al. (1990) from India reported 82-97% cure rate with third generation
cephalosporin. Saha et al. (1999) and Haque et al. (2003) detected resistance against third
generation cephalosporin in few strains of MDR S. typhi. Bhat et al. (1998) reported 3%
third generation cephalosporin resistance among MDR S. typhi isolates.

Extended spectrum β lactamase production

Only three isolates out of 431 MDR S. typhi were identified as ESBL producer using
double disc synergy test accounting (0.69 %) in the present study which is comparable to the
studies conducted in Canada, Poland, England, and France, where up to 3% ESBL
production has been reported in MDR S. typhi (weill et al., 2004; Batchelor et al., 2005:
Patterson et al., 2006;). Mohanty et al. (2006) reported 3-8% ESBL production in
Salmonella species in India. Dunne, (2000) from Latin America reported 2.8% ESBL
producing MDR S. typhi. Emergence of ESBL production in MDR S. typhi has constituted a

65
new challenge for physicians treating enteric fever, especially in developing countries where
typhoid is highly endemic.

Drug resistance in S. typhi

S. typhi acquire drug resistance most commonly through plasmid. Resistance to
chloramphenicol, ampicillin and trimethoprim / sulfamethoxazole and tetracycline is often
encoded by plasmids belonging to the incompatibility complex group Inc. H1 (Rowe et al.,
1990; Hampton et al., 1998). Results of antimicrobial susceptibility showed 431 MDR S.
typhi isolates resistant to chloramphenicol, ampicillin and trimethoprim / sulfamethoxazole.
Resistance to all the drugs is due to presence of a single plasmid, because no any other
plasmid could be isolated in S. typhi strains which were sensitive to chloramphenicol,
ampicillin and trimethoprim - sulfamethoxazole. Rowe et al. (1990) reported similar
observations from his study. Karmakar et al. (1991) reported that S. typhi isolate were found
to be resistant to chloramphenicol, ampicillin, tetracycline and streptomycin.

Clinical suspicion of typhoid fever can be confirmed by blood, urine and stool
culture of patient. Blood culture isolation is time consuming and bacterial isolation rate is
only 30 % due to prior medication by patients. This compelled for development of some
effective method which can diagnose enteric fever at an early stage, provide information for
focused therapy and must be cost effective. For diagnosis of S. typhi, fliC gene was
considered best (Song et al., 1993). We targeted catP gene using primers mentioned in the
section (Patients, Materials and Methods) which gave results that were in total agreement
with those obtained by disc diffusion method in all our isolates of the study. Ampicillin
resistance in Salmonella may be due to tem-beta-lactamase (Shanahan et al., 1988). We
detected tem gene in 100 MDR S. typhi isolates of study using primers described in the
section (Patients, Materials and Methods) which was exactly in accordance to the sensitivity
pattern determined by disc diffusion method in these isolates. Trimethoprim-
sulfamethoxazole resistance in gram-negative bacilli is usually due to acquisition of sul 1 or
sul 2 gene (Skold, 2000; Enne et al., 2001). Sul 2 gene was selected because it is universally
present in clinical isolates of S. typhi resistant to this drug (Aerstrup et al., 2003). The results
of sul2 gene amplification were in accordance with the finding of disc diffusion method in

66
all isolates of MDR S. typhi. Ciprofloxacin resistance is usually attributed to gyr A gene
mutations (Jones et al., 2000). Plasmid mediated qyr gene has been shown to be involved
with quinolone resistance in E. Coli as well (Wang et al., 2003). For the amplification of
gyr A gene we use primers described in the section (Patients, Materials and Methods). The
results were similar to the findings obtained by disc diffusion method. The sequencing
results confirmed that the resistance was due to a C to T mutation at codon 83 (TCC to
TTC). The other reported mutations were not seen in any resistant isolate.

PCR conditions were optimized for simultaneous amplification of specific S. typhi

fliC gene and relevant drug resistant genes. This multiplex PCR could differentiate between
different genes easily (Fig. 27). Multiplex PCR, in addition to its excellent sensitivity, can
provide results very quickly within 2 hours and enable the clinicians to have a rapid,
definitive diagnosis for the selection of a suitable therapy as compared to blood culture
sensitivity testing which needs at least 4-5 days. The early and focused therapy will ensure
early recovery of patient and also save financial resources that would have been spent on hit
and trial treatment. The rapid and successful elimination of typhoid bacilli will certainly
reduce the carrier rate which is the main source of spread of infection. The rapid diagnosis
and elimination of pathogen will help in controlling disease and will be a better check on
emergence of new drug resistance strains.

67
 RECOMMENDATION FOR PHYSICIAN

1) Patient with pyrexia of unknown origin should be investigated for typhoid fever.

2) Drug therapy must be based on susceptibility report and physician should follow,
up to date guidelines.

3) If facilities exist molecular methods should be preferred.

4) Infection control measures and regular surveillance for antimicrobial resistance in

hospitals

5) Prescription from physician should mandatory and over the counter availability of
drugs must be restricted.

68
 CONCLUSIONS

1. Typhoid fever can be prevented by provision of clean drinking water and adequate
sanitation.

2. Education of the peoples for personal hygiene, preventing contamination of food or

water and importance of hand washing before eating or food handling.

3. Self-medication and misuse of drugs has resulted in higher prevalence of MDR S.

typhi in our society.

4. S. typhi isolates should be continuously monitored for the presence of plasmid

carrying resistant markers against antimicrobials.

5. Avoid close contact with suspected patients during acute phase of disease.

69
APPENDICES

70
 APPENDIX (A)
Gram Stain

Preparation of the Smear

A thin film of the material on a clean glass slide, using a sterile loop was made. The
slide was air dried and then heat fixed by passing it through a flame, making sure that it
should not become too hot to touch. To be visible on a slide, organisms that stain by the
Gram method must be present in concentrations of a minimum of 104 to 105 organisms / ml
of un-concentrated staining fluid. At lower concentrations, the Gram stain of a clinical
specimen seldom reveals organisms even if the culture is positive. Smears that are not
properly fixed tend to be washed away during staining and washing resulting in the absence
of stained bacteria.

Staining Procedure
1. The smear was covered with crystal violet stain for 60 seconds.
2. The crystal violet was poured off and washed thoroughly with iodine solution. The
slide was then covered with iodine solution and allowed to act for 30 seconds.
3. The iodine solution was poured off and then decolorized with acetone-ethanol until
the color ceased to come out of the smear (This took about 3-4 seconds).
4. The slide was thoroughly washed with water.
5. The slide was counterstained with diluted carbolfuchsin for 30 seconds. Washed with
water, blotted with absorbent paper and air dried.

Quality Control
Staphylococcus aureus (ATCC 25923)
Escherichia coli (ATCC 25922)

Results
Organisms that retained the violet-iodine complexes after washing in acetone-ethanol stain
purple and were termed as Gram-positive, those that lost this complex stain and became red
from the counter stain carbolfuchsin were termed Gram-negative.

71
 APPENDIX (B)
API 20E

API 20E is a standardized identification system for Enterobacteriaceae and other

non-fastidious, Gram negative rods which uses 21 miniaturized biochemical tests and a
database.

Principle
The API 20E strip consists of 20 micro tubes containing dehydrated substrates.
These tests are inoculated with a bacterial suspension that reconstitutes the media. During
incubation, metabolism produces color changes that are either spontaneous or revealed by
the addition of reagents. The reactions are read according to the Reading Table and the
identification is obtained by referring to the Analytical Profile Index or using the
identification software.

Procedure

Oxidase Test
The oxidase test was performed according to the manufacturer's instructions for use.
The result of this test was recorded result sheet as it is an integral part of the final profile
(21st identification test).

Preparation of the Strip

1) Five ml of distilled water was distributed into the honeycombed well of the tray to
create a humid atmosphere.

2) On the elongated flap of the tray, the strain reference was recorded.
3) Strip was removed from its packaging and placed in the incubation box.

72
Preparation of the Inoculum
A single well isolated colony from overnight culture was picked up with inoculating
loop and emulsified into a tube containing 5 ml of sterile distilled water. This suspension
was used immediately after preparation.

Inoculation of the Strip

1) Both tube and cupule of the tests CIT , VP and GEL were filled with the bacterial
suspension.
2) Only the tube (and not the cupule) of the other tests were filled
3) The tests ADH, LDC,ODC, H2S and URE, mineral oil was overlaid to create ana-
erobiosis
4) Incubation box was closed with flap and incubated at 37°C for 18 hours.

Reading the Strip

1) Reading Table was consulted for reading the results of API strip after incubation.
2) All the positive were recorded on the result sheet and then reagents were added for
following tests:
3) TDA Test: 1 drop of TDA reagent was added. Appearance of reddish brown color
was considered a positive reaction and recorded on the result sheet.
4) IND Test: 1 drop of JAMES reagent was added and a pink color in the whole cupule
was taken as a positive reaction.
5) VP Test: 1 drop each of VP 1 and VP 2 reagents were added and result was recorded
after 10 minutes. A pink or red color indicated a positive reaction. Slightly pink color
after 10 minutes was not considered positive.
6) The indole production test was performed last since this reaction releases gaseous
products which interfere with the interpretation of other tests on the strip.
7) In case, the number of positive tests (including the GLU test) before adding the
reagents were less than 3:
8) Re-incubated the strip for a further 24 hours without adding any reagents.

73
9) Supplementary tests were performed in case the recorded results were not
conclusive.

Interpretation
Identification was obtained with the numerical profile.

Determination of the numerical profile

On the result sheet, the tests were separated into groups of 3 and a value 1, 2 or 4 is
indicated for each. By adding together the values corresponding to positive reactions within
each group, a 7-digit profile number was obtained for the 20 tests of the API 20 E strip. The
oxidase reaction constitutes the 21st test and has a value of 4 if it is positive.

Identification
This was performed using the database (V4.0) with the Analytical Profile Index by
looking up the numerical profile.

Quality Control
Escherichia coli ATCC 25922 was used for quality control

74
 APPENDIX (C)
Salmonella Serotyping Scheme

1. Difco Salmonella O Anti-sera are used in slide agglutination tests for the
identification of Salmonella by somatic (O) antigens.
2. Difco Salmonella H Anti-sera are used in tube agglutination tests for the
identification of Salmonella by flagellar (H) antigens.
3. Difco Salmonella Vi Antiserum was used in slide agglutination tests for the
identification of Salmonella Vi.

Principles of the Procedure

1. Salmonella O antigens are somatic (O) heat-stable antigens and were identified first.
2. The Vi antigen is a heat-labile envelope antigen that may surround a cell wall and
mask somatic antigen activity.
3. Microorganisms having the Vi Antigen will not agglutinate in O anti-sera.
4. In order to determine the O antigen of these cultures, a suspension of the organism
was boiled to destroy the heat-labile envelope antigen and then tested with O anti-
sera.
5. The flagellar (H) antigens are heat labile and are usually associated with motility.

Slide Test Procedure

Salmonella O and Vi Anti-sera

1. 1 drop (35 µL) of each antiserum to be tested was dispensed on an agglutination

slide.
2. From an overnight solid agar medium, a loop-full of an isolated colony was
transferred to the reaction area above and mixed thoroughly.

75
3. Negative control: 1 drop of 0.85% sterile NaCl solution was transferred on an
agglutination slide and 1 drop of each Difco Salmonella O Antiserum was added to
be tested on an agglutination slide and mixed thoroughly.
4. Positive control: 1 drop of each Difco Salmonella O Antiserum was dispensed on an
agglutination slide.
5. The slides were rotated for 1 min and read for agglutination. Results were read
within 1 min.

Tube Test Preparation

1. 0.6% Formalized Saline was prepared by adding 6 ml formaldehyde per 1000 mL of

sterile 0.85% NaCl solution.
2. Test organism: The organism was grown in Motility GI Medium in order to increase
the motility of the organism. The tube was inoculated slightly below the surface of
the medium using the stab method and incubated at 35-37°C for 18-20 h.
3. Only those organisms were transferred that have successfully migrated to 50-60 mm
through the medium in 18-20 h.
4. Brain Heart Infusion Broth was used for cultivating motile Salmonella prior to
testing and incubated at 35°C for 4-6 h.
5. Test organism suspension was prepared by using equal volumes of broth culture and
0.6% formalized saline. The final density of this test suspension was adjusted that of
a McFarland Turbidity Standard No. 3.
6. Salmonella H Anti-sera: A 1:250 dilution was prepared by adding 0.1 ml
reconstituted antiserum to 25 mL of 0.85% NaCl solution. After mixing equal
amounts (0.5 ml) of diluted antiserum and test isolate, the final dilution was 1:1,000.

Tube Test Procedure

Salmonella H Anti-sera

1. A 12 x 75 mm culture tube was prepared for each organism to be tested.

2. Diluted antiserum: 0.5 ml of diluted antiserum was dispensed in each tube.
76
3. Test isolate: 0.5 ml of test isolate was added in appropriate tube.
4. Positive control: 0.5 ml of antigen positive control was added in a tube containing
0.5 mL of antiserum.
5. Negative control: 0.5 ml of 0.85% NaCl solution was added to a tube containing 0.5
mL of test isolate.
6. Incubated all tubes in a water bath at 50°C for 1 h.
7. Flocculation (agglutination) was observed.
8. Tube Test was repeated using a phase-reversed test organism.

Phase Reversal

1. Motility GI Medium phase reversal medium was prepared according to directions.

2. Antiserum was prepared opposite to the phase desired.
3. 1ml of a 1:10 dilution of antiserum was added to 25ml of sterile GI Motility Medium
and thoroughly mixed. Poured into a sterile Petri dish and allowed to solidify.
4. Inoculated by punching the edge of the solidified medium and incubated at 37°C for
24 h.
5. Growth was transferred from the spreading edge opposite the inoculation site to a
liquid medium for testing according to steps already mentioned.

Results

Slide Test
1. 4+100% agglutination, background is clear to slightly hazy. 1+ 25% agglutination,
background is cloudy.
2. 3+75% agglutination, background is slightly cloudy.
3. 2+ 50% agglutination, background is moderately cloudy.
4. The positive control should show 3+ or greater agglutination.
5. The negative control should show no agglutination.
6. For test isolates, a 3+ or greater agglutination is a positive result.
7. A partial (less than 3+) or delayed agglutination reaction was considered
negative.
77
Tube Test

1. 4+100% agglutination; background is clear to slightly hazy. 1+ 25% agglutination;

background is cloudy.
2. 3+75% agglutination; background is slightly cloudy.
3. 2+50% agglutination; background is moderately cloudy.
4. The positive control should show 3+ or greater agglutination at the routine test
dilution (RTD).
5. The negative control should show no agglutination.

78
 Representative Sequencing Chromatograms

(fliC, CatP, tem, sul-2 and gyrA PCR products)

Fig. xxx. F1F Sequencing Chromatogram of fliC gene PCR product

Deduced sequence of fliC gene PCR product

TTCTTAATAAAAGTAAATGTTTCTTTTGTGACGTTGCTCAACTGGAGCTGTGATTTTGGTGGCGCAATGGTAAA
TCTGAAGTTGTTACTGCTACCGATGGTAAGACTTACTTAGCAAGCGACCTTGACAAACATAACTTCAGAACAGG
CGGTGAGCTTAAAGAGGTTAATACAGATAAGACTGAAAACCCACTGCAGAAAATTGATGCTGCCTTGGCACAGG
TTGATACACTTCGTTCTGACCTGGGTGCGGTTCAGAACCGTTTCAACTCCGCTATCACCAACCTGGGCAATACC
GTAAATAACCTGTCTTCTGCCCGTAGCCGTATCGAAGATTCCGACTACGCGACCCGAAGTCTCCAA

79
Fig.xxx Sequencing Chromatogram of catP gene PCR product

Sequence of catP gene PCR product

TGGGTTTGGTTCATTAAGCATTCTGCCGACATGGAGCCATCACAACGGCATGATGAACCTGAATCGCCACGCGG
CATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGG
CCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCT
TTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATC
GTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACAC
TATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGGAATTCCGGATAGCATTCATCATGGGGGGAGATG
TGGTAAAGGCCGGGGAAACTTTTGCTATTGTCTTTTTTTGGAAGGGAGAC

Figxxx Sequencing Chromatogram of tem gene PCR product

80
Sequence of tem gene PCR product
CGAAAGGTTCACAGCGGTAGATCCTTGAGAGTTTTCGCCCCGAGACGTTTTCCAATGATGAGCACTTTTAAGTT
CTGCTATGTGGTGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCA
GAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCA
GTGCTGCCATAACCATGAGTGATAACACTGCTGCCAACTTACTTCTGACAACGATCGGAGGACCA

Figxxx G1F Sequencing Chromatogram of gyr A gene PCR product

Sequence of gyr A gene PCR product

tgtctgtcattgttggccgttgtccgagatggcctgaagccggtacaccgtcgcgtactttacgcca
tgaacgtattgggcaatgactggaacaaagcctataaaaaatctgcccgtgtcgttggtgacgtaat
cggtaaataccatccccacggcgattccgcagtgtatgacaccatcgttcgtatggcgcagccattc
tcgctgcgttacatgctggtggatggtcagggtaacttcggttctattgacggcgactccgcggcgg
caatgcgttatacggagatccgtctggcgaaaatcgcccacggactgatggccgatctcgaaaaaga
gacggtggatttcgtggataactatgacggtacggaaaaaattccggacgtcatgccgaccaaaatt
ccgaatctgctggtgaacggttcttccggtatcgcagtaggtatggcgacgaatttcctcggcccac
aacggcaatatcccgccgcacaa

81
Fig xxx .Sequencing Chromatogram of sul 2 gene PCR product

Sequence of sul 2 gene PCR product

taggcatgatctaaccctcggtctctggcgtcgcgactgcgaaatttcgcgagggtttccg
agaaggtgattgcgcttcgcagatctccaggcgcgtgggtgcggacgtagtcagcgccatt
gccgatcgcgtgaagttccgccgcaaggctcgctggacccagatcctttacaggaaggcca
acggtggcgcccaagaaggatttccgcgacaccgagaccaatagcggaagccccaacgccg
acttcagcttttgaaggttcgacagcacgtgcagcgatgtttccggtgcggggctcaagaa
aaatcccatccccggatcgaggatgagccggtcggcagcgaccccgctccgtcgcaaggcg
gaaacccgcgcctcgaagaaccgcacaatctcgtcgagcgcgtcttcgggtcgaaggtgac
cggtgcgggtggcgatgccatcccgctgcgctgagtgcataaccaccagcctgcagtccgc
ctcagcaatatcgggatagagcgcagggtcaggaaatccttggatatcgttcaggtagccc
acgccgcgcttgagcgcatagcgctgggtttccggttggaagctgtcgattgaaacacggt
gcatctgatcggacagggcgtctaagagcggcgcaatacgtctgatctcatcggccggcga
tacaggcctcgcgtccggatggctggcggccggtccgacatccacgacgtctgatccgact
cgcagcatttcgatcgccgcggtgacagcgccggcggggtctagccgccggctctcatcga
agaaggagtcctcggtgagattcagaatgccgaacaccgtcaccat

82
REFERENCES

83
Aarestrup FM, Wiuff C, Molbak K, Threlfall EJ. Is it time to change fluoroquinolone
breakpoints for Salmonella spp. Antimicrob agents chemother 2003;47(2):827–9.
Abdul Mateen Khan Muhammad Noman Yousaf, Tariq Mehmood current trends in the
management of typhoid fever, Gomal Journal of medical Sciences July-Dec.,2004
Vol. 2.No.2; 59-61.
Abrams, I.F., Cochran, W.D., Holmes, L.B., Marsh, E.B. and Moore, J.A. A Salmonella
newport outbreak in a premature nursery with a one-year follow-up. Effect of
ampicillin following bacteriologic failure of response to kanamycin. Pediatrics1966; 37
: 616.
Ackers ML, Puhr ND, Tauxe RV, Mintz ED. Laboratory-based surveillance of
Salmonella serotype Typhi infections in the United States: antimicrobial
resistance on the rise. JAMA 2000; 283 : 2668-73
Agarwal KC. Panhotra BR, Arya VK, et al. Typhoid fever due to chloramphcnicol
resistance Salmonella typhi associated with R-plasmid. Indian .j Med Res.
1981;73:484-88.
Agbakwuru EA, Adesunkanmi AR, Fadiora SO, Olayinka OS, Aderonmu AO, Ogundoyin
OO et al. A review of typhoid perforation in a rural African hospital. West African
Journal of Medicine 2003; 22(1):22-25.
Agrawal, S. C.: Chloramphenicol resistance of Salmonella species in India, 1959-61. Bid.
R.H.O., 27: 331-335, 1962
Agarwal,V.,Brahmne,R.B.,Dhanvijay,A.G.,Jalgaonkar, 'P.D., Pathak, A.A. and Saoji,
A.M.Antibiogram, phage types and biotypes of Salmonella typhi isolated in Nagpur.
Indian J. Med. Res. 1992; 95[A] : 14.
Agarwal KS. Singh SK, Kumar n, Srivastav, R Rajkumar A.A study of Current trends in
enteric fever J Commun Dis 1998-17174.
Ahasan HN, Rafiqueuddin AKM, Chowdhury mAJ, Azhar MA, Ara M, Farazi MA.
Complications of enteric fever encountered in medical wards. J Dhaka Med Coll
1993; 2: 32-33
Ahmad ZU, Siddiqui AM and Hasan O. Emergence of drug resistant enteric fever in
Bangladesh Pak Armed Forces Med J 1994: 44(2):14-16.
84
Ahmed, Alam, M.N. Haq S.A. Majid M.N. Hasan Z Ahsan, S.A., Ahmed, N. and Rehman,
K.M. (1992) Multidrug resistant enteric fever in Bangladesh. Bangladesh J. Med, 3,
38-41
Akhtar, A.M., Malik, Z.A. and Hashmi, A. Treatment of typhoid fever with ofloxacin. Pak.
Air Force J. 1987; 40(i) : 6.
Al Naiemi N, Zwart B, Rijnsburger MC, Roosendaal R, Debets-Ossenkopp YJ, Mulder JA
et al.Extended-Spectrum-Beta-Lactamase Production in a Salmonella enterica
Serotype Typhi Strain from the Philippines. J Clin Microbiol2008; 46(8):2794–5.
Ames, W.R. and Robins, M. Age and Sex as factors in the development of the typhoid carrier
state, and a method for estimating carrier prevalence. Am. J. Public Health 1943; 33 :
221.
Anand AC, Kataria VK, Singh W, et al. An epidemic of multiresistant entenc fever in eastern
India. Lancet, 1990: 1. 352

Anand, A.C. The anatomy of an epidemic (the final report on an epidemic) of multidrug
resistant enteric fever in eastern India. Trop. Gastroenterol 1993; 14(1): 21.
Anderson ES and smith HP. Brit. Med. J 1972; 3:
Anderson ES, Joseph SW, Nasution Q. Febrile illness resulting in hospital admission, A
bacteriological & serological study in Jakarta Indonesia.Am.J.Trop.Med.Hyg. 1976;
25:116
Anderson, E.S, and Threlfall, E.J. The characterization of plasmid in the Enterobacteria. J.
Hyg. Camb. 1974; 7 2 : 471
Anderson, E.S. The problem and implications of chloramphenicol resistance in the typhoid
bacillus J. Hyg. Carob. 1975; 7 4 : 2 8 9
Anderson, E.S., Threlfall, E.J., Carr, J.M. and McConnell, M.M. Clonal distribution of
resistance plasmid-carrying Salmonella typhimurium, mainly in the Middle East.
J. Hyg. 1 9 7 7 ; 7 9 : 4 2 5 .
Appelbaum, P.C., Scragg, J. and Sehouland, M.M. Colonic involvement in Salmonellosis.
Lancet 1976; 2 . 102.
Arbuzova, V.A. Features of reservoirs of Salmonella among human Subjects. J. of Microbiol.
Epidemiol. and Immunology (USSR) 1960; 31 : 1353.

85
Arif Maqsood Ali, Ayaz Hussain Qureshi, Shahid Rafi, Sajjad Hussain Mirza.
Changing frequencies and current status of Multiple-Drug Resistant Typhoidal
Salmonellae in year 2001-2003 at Rawalpindi. Infect Dis J Jan ;14(1):3-6 2005.
Aserkoff, B. and Bennett, J.V. Effect of antibiotic therapy in acute Salmonellosis on the faecal
excretion of Salmonella. N. Engl. J. Med. 1969; 281 : 636.
Asna S.M.Z. and Haq, J.A. (2003): Decrease of antibiotic resistance in Salmonella typhi
isolated from patients attending hospitals of Dhaka City over a 3 year period. Int. J.
Antimicrob, Agents 16, 249-251.
Avril, J. L., Dabernat ,H.J., Gerbaud ,G.R., Horodniceanu, T., Lambert- Zechovsky, N.,
Leminor S., Mendez B. and Chabbert, Y.A.Groups d’ incomeptible des plasmiddes R
chez les Sauches de Salmonella epidemiques. Ann Microbial. (inst. Pasteur) 1977;128
(B) : 12
Aziz, A., Jaffri, W., Jawed, A.T., Shaikh.A., Farooqui. B., Ashfaq, M. K. and Hag, N.U.
Salmonella hadar pericarditis. Annals of Saudi Medicine 1993; 13(1) : 85.
Aziz M, Qadir A, Aziz M, Faizullah., Aziz M, Qadir A et al. Prognostic factors in typhoid
perforation. Jcpsp, Journal of the College of Physicians & Surgeons - Pakistan 2005;
15(11):704-707.

Baine, E.B., Gangarosa, E.J., Bennett, J.V. and Barker, W.H. Jr. Institutional Salmonellosis. J.
Infect. Dis. 1973; 128 : 357.
Baird, G.D., Manning, E.J. and Jones, P.W. Evidence for related virulence sequences in
plasmid of Salmonella dublin and Salmonella typhimurium. J. Gen. Microbiol. 1985;
131 : 1815.
Barney, D.P, Fisher, R. and Schaffner, W . S a l m o n e l l a empyema: A review. South
Med. J. 1977; 70 : 375.
Barry, A.L. and Fay, G.D. The amount of agar in antimicrobial disk susceptibility test plates.
Am. J. of Pathology 1973; 59 : 196.
Bauer, A.W., Kirby, W.M.M., Sherris, J.C. and Turck, M. Antibiotic susceptibility testing by a
standardized single disk method. Am. J. Clin. Pathol. 1964; 45 : 493.
Bell, R.B. Antibiotic resistance patterns of faecal coliform isolated from domestic
sewage beforeand after treatment in an aerobic lagoon Can. J. Microbiol. 1978;
24 : 886
86
Bennett, 1.L. and Hook, E.W: Infections diseases (Some aspects of Salmonellosis). Annu. Rev.
Med. 1959; 10 : 1.
Berkley JA, Lowe BS, Mwangi I, Williams T, Bauni E, Mwarumba S, et al. Bacteremia
among children admitted to a rural hospital in Kenya. N Engl J Med 2005;352: 39-
47.
Bethell. D.B., N.p.J Day M.D nguyen, C.memullin, T.L. Ha. T.h.T Dong, T.N.m.Le, T.M.L
nguyen, Q.D nguyen, V.Ha A.P MacGowan L.O white and N.J White. 1996
pharmacokinetics of oral and intravenous ofloxcin in children with multidrug-
resistant typhoid fever. Antimicrob. Agents Chemother. 40:2167-2172.
Bezanson, G.S., Pauze, M. and Lior, H. Antibiotic resistance and R-plasmid in food-chain
Salmonella: evidence of plasmid relatedness. Appl. Environ. Microbiol. 1981; 41 :
585.
Bhatta CP Bhuyan KCa and Maharjan Antibiotic Sensitivity Pattern of Salmonella
Species Isolated from Blood Culture. Journal of Nepal Health research Council Vol.3
No.2 October 2005.
Bhat KG, Andrade AT, Karadesai SG, Hemashettar BM, Patil CS. Antimicrobial
susceptibility of Salmonella typhi to quinolones & cephalosporins. Indian J Med Res.
1998 Jun;107:247-51.Department of Microbiology, J.N. Medical College, Belgaum.
Bhattacharya SK (2006). The malaria and typhoidfever burden in the slums of Kolkata,
India: data from a prospective community-based study. Trans. R. Soc. Trop. Med.
Hyg., 100: 725-733
Bhutta ZA, Naqvi SH, Razzaq RA, et al. Multidrug-resistant typhoid in children:
presentation and clinical features, RIl)., 1991,13: 832-3
Bhutta ZA. Impact of age and drug resistance on mortality in typhoid fever. Arch Dis Child
1996;75: 21.
Bhutta ZA, Ochiai RL, Wang X, von Seidlein L, Yang J, Bhattacharya SK, et al.
Salmonella paratyphi A rates, Asia. Emerg Infect Dis 2005;11: 1764-6.
Bhutta Zulfiqar A , Husein Lalji Dewraj Current concepts in the diagnosis and treatment
of typhoid fever BMJ. 2006 July 8; 333 (7558):78–82.
Bondi, A., Sapulding, E.H., Smith, D.E. and Dietz. A routine method for the rapid
determination of susceptibility to penicillin and other antibiotics. American J. of
Med. Sci. 1947;213
87
Bottieau E, Clerinx J, Schrooten W, Enden EV, Wouters R, Esbroeck MV et al. Etiology
and Outcome of Fever after a Stay in the Tropics. Arch Intern Med 2006; 166:1642-8
Bradley, D.E., Hughes, V.M., Richards, H. and Datta, N.R-plasmid of a new incompatibility
group determine constitutive production of H pili. Plasmid 1982; 7230.
Bradley, D.E., Taylor, D.E. and Cohen, D.R. Specification of surface mating systems among
conjugative drug resistance plasmid in Escherichia coli K12. J. Bacteriol. 1980; 143 :
1466..
Broda, ?. Conjugation in bacteria, In: Plasmids of Medical, Environmental and Commercial
importance ED Timmis K.N. and Puhler A. (Ed) 1979; Elsevier North-Holland New
York; PP 47..
Brown, D.M. and Acred, P."Penbritin"- new broad-spectrum antibiotic; preliminary
pharmacology and chemotherapy. B.M.J. 1961; 2 : 197
Brown, D.M. and Blowers, R. Disc methods of sensitivity testing and other semi quantitative
methods In: Laboratory Methods in Antimicrobial Chemotherapy. Published for
British Society for Antimicrobial Chemotherapy by Churchill Livingstone Edinburgh
London, 1978; PP 8.
Buissiere, J. and Nardon , P. Micro method ed' identification des bacteries I. Interet de la
quantification descaracteresbiochimiques.Annuls.Inst.Pasteur.Paris.1968; 115 :
218.
Butler, T., Linh, N N., Arnold, K. and Pollack, M. Chloramphenicol-resistant typhoid fever
in Vietnam associated with R factor. Lancet 1973; i i : 983
Butler, T., Rumans, L. and Arnold, K. Response of typhoid fever caused by
chloramphenicol susceptible and chloramphenicol resistant strains of Salmonella
typhi to treatment with trimethoprim-Sulfamethoxazole. Rev. Infect. Dis. 1982; 4 :
551
Butler, T., W. R Bell, J. Levin, N. N. Linh, and K. Arnold. 1978. Typhoid fever; studies of
blood coagulation, bacteremia, and endotoxemia. Arch. Intern. Med. 138:407-410
Butt T, Ahmad RN, Mahmood A, Zaidi S. Ciprofloxacin treatment failure in typhoid
fever case, Pakistan. Emerg Infect Dis 2003; 9 : 1621-2.
Center for Disease Control. Salmonella Surveillance Annual Summary 1975, Atlanta
Georgia. USA. September 1976
Chande C, Shrikhande S, Kapale S, Agrawal S, Fule RP. Change in antimicrobial resistance
88
 pattern of Salmonella Typhi in central India. Indian J Med Res. 2002 Jun;115:248-
50. Department of Microbiology, Government Medical College, Nagpur, India.
Chatterjee H, Jagdish S, Pai D, Satish N, Jayadev D, Reddy PS et al. Changing trends in
outcome of typhoid ileal perforations over three decades in Pondicherry. Tropical
Gastroenterology 2001; 22(3):155-158.
Chalmer IM. Typhoid fever in an endemic area: a great” imitator” S Afr Med J 1971;45:
470-472
Chau TT, Campbell JI, Galindo CM, Van Minh Hoang N, Diep TS, Nga TTet al.
Antimicrobial drug resistance of Salmonella enterica serovar typhi in Asia and
molecular mechanism of reduced susceptibility to the fluoroquinolones. Antimicrob
Agents Chemother 2007;51(12):4315-23.
Christopher M. Parry, Vo Anh HO Le ,Thi Phuong Phan Van Be Bay Mai Ngoc Lanh Le
Thanh Tung , Nguyen Thi Hong Tham, joh wain ,Randomized controlled
comparison of Oflooxacin, Azithromycin and Ofloxacin-Azthromycin combination
for the treatment of MDR and Nalidixic acid resistant typhoid fever Antimicrobial
agents and chemotherapy March 2007,P 819-825.
Chun D. Scol SY, Cho DT et al, Drug resislance and R-plasmids in salmonella typhi isolated
in Korea. Antimicrobe Agents, Chemother, 1977.11:209-13.
Clark, W.A., Hollis, D.G. and Weaver, R.E., Identification of unusual pathogenic Gram
negative aerobic and facultatively anaerobic bacteria. Atlanta; Centers for Disease
Control, 1984.
Clinical and Laboratory Standards Institute. 2010. Performance standards for antimicrobial
susceptibility testing: Twentieth Informational Supplement January 2010 Vol 30.
Number 1 M100-S20 ISBN 1-56238-716-2, ISSN 0273-3899 (Replaced M100-S19
Vol 29 No3.
Clinical and Laboratory Standards Institute. 2005. Performance standards for antimicrobial
disk susceptibility tests, approved standard, 8th ed. (M2–A8). Clinical and
Laboratory Standards Institute, Wayne, Pa.
Cohen, L., Fink, H. and Gray,I. Salmonella su-pestifer bacteraemia with pericarditis,
pneumonia and pleural effusion. J.A.M.A. 1936; 107 : 331.
Cohen, S.N. Chloramphenicol-ampicillin resistant Salmonella typhi in California. Morbidity
and Mortality Weekly Report 1973; 22 : 183.
89
Collier's Encyclopedia Vol: 22 Macmillian Educational Company. Collier. Inc London
Colquhoun, J. and Weetch, R. S.: Resistance to chloramphenicol developing during
treatment of typhoid fever. Lancet ii, 621-623, 1950.
Complement activation by polysaccharide of lipopolysaccharide: an important virulence
determinant of Salmonella. Infect. Immune. 1983; 41 : 563..
Cooke FJ, Day M, Wain J, Ward LR, Threfall EJ. Cases of typhoid fever imported into
England, Scotland and Wales (2000-2003). Trans R Soc Trop Med Hyg.
2007;101:398-404.
Cooke FJ, Wain J. The Emergence of AntibioticResistance in Typhoid Fever. Travel Med
Infect Dis.2004;2:67-74
Cooke, M.D. R-factor transfer under environmental conditions; in proc. 4th Int. Symposium
on Antibiotic Resistance: Transposition and Other Mechanisms. Mitsuhashi S. Rosival
L and Kremery V. Eds;springer-Verlag 1980 : 20
Cooper, K.E. Theory of antibiotic inhibition zones in agaz media. Nature 1955; 176 : 510.
Craigie, J. and Yen, C.H. Vi-phage typing method of Salmonella typhi. CTanad. Publ. Hlth.
1938; 29 . 448.
Crozier, D. and Woodward, T.E. Armed Forces Epidemiological Board: Activities of the
commission on Epidemiological Survey 1961. Milit. Med. 1962; 127 : 701
Crump J., Luby, S. Mintz, E 2004. The global burden of typhoid fever. Bull World Health
Organ 82, 346-353
Crump JA, Kretsinger K, Gay K, Hoekstra RM, Vugia DJ et al. Clinical response and
outcome of infection with Salmonella Typhi with decreased susceptibility to
fluoroquinolones: a United States Food Net multi-center retrospective cohort study.
Antimicrob Agents Chemother 2008;52:1278-84
Crump JA, Lubsy SP, Mintz ED. The global burden of enteric fever. Bull World Health
Organ. 2004; 82:346-53.
Crump JA, Mintz ED. Global trends in typhoid and paratyphoid fever. Clin Inf Dis 2010;
50:241 -6
Cunningham, R.K., Soderstrom, T.O. and Gillman, C.F. Phagocytosis as a surface
phenomenon V. Contact angles and phagocytosis of rough and smooth strains of
Salmonella typhimurium and the influence of specific- antiserum. Immunol. Commun.
1975; 4 : 429.
90
Cowan ST, Steel KJ. Manual of the Identification of Medical Bacteria. Cambridge:
Cambridge University Press, 1974.
Dale, L., Haggman, D.O. and Susan, J. Non-typhoidal Salmonella pericarditis. Pedriatic Inf.
Dis. 1986; 5(2) : 259.
Datta, N. Epidemiology and classification of plasmids In: Microbiology Schlessinger D.E.
2nd Ed. American Society for Microbiology, Washington D.C.1975: P P 9-15.
Datta, N., Hugh, V.M., Nugent, M.E. and Richards, H. Plasmids and transposons and their
stability and mutability in bacteria isolated during an outbreak of hospital infection.
Plasmid1979; 2 : 182.
Datta, N. Plasmids of enteric bacteria In: Antimicrobial Drug resistance ED Bryan, L.E.
Academic Press, London 1984; PP 487
Davies, W.W. and Stout, T.R. Disc plate method of microbiological antibiotic assay. factors
influencing variability and error applied microbiology 1971; 22: 659.
DeBoy II, J.M., Wachsmuth, I.K. and Davis, B. Antibiotic resistance in entero toxi genic
and nonntero toxi genic Escheria c o l l . J. Clin. Microbiol. 1980; 12 : 264.
Deroeck D, Jodar L, Clemens J.Putting typhoid vaccination on the global health agenda. N
Engl J Med 2007;357:1069-71.
dhanashree b. Antibiotic susceptibility profile of Salmonella enterica serovars: Trend over
three years showing re-emergence of chloramphenicol sensitivity and rare serovars.
Indian J Med Sci 2007;61:576-9
D o u g h a r i , J . H . , E l m a h m o o d , A . M 1. a n d N g g a d a , H . P . Retrospective study
on the antibiotic resistant pattern of S a l m o n e l a t y p h i , Department of Medical
Microbiology and Parasitology, University or Port Harcourt Teaching Hospital, PMB
6173 – Port Harcourt, Rivers State, Nigeria. PMB 2007 Yola. Adamawa State,
Nigeria.
DS, Chaudhury R. Enteric fever treatment failures: a global concern. Emerg infect Dis 2001;
7: 762-763
Dunne EF, Fey PD, Kludt P et al. Emergence of domestically acquired caftriaxone-resistant
Salmonella infections associated with AmpC?-lactamase. JAMA 2000; 284 : 3151-
3156.
Dutta AK, Kanwal SK. Typhoid fever: An Asian perspective. In: Proceedings on the
APPSGAN workshop on Pediatric Gastroenterology and Nutrition, Galle, Sri-
91
 Lanka, October 1998, pp 71-78.
Edelman R, Levine MM, Summery of an International workshop on Typhoid fever.
Rev.infect.Dis 1986; 8: 329 – 49
Edwards and Ewing's: The genus Salmonella.In Identification of Enterobacteriaceae Ed by
William and Ewing, 4th edition Elsevier Science Publishing Company New York
1986; PP 181-246.
El-AkkadAM . Statistics and epidemiology of typhoid fever in UAR. J Egypt Public Health
Assoc 1970;45:8-16
Ericsson, H. and Sherris, J.C. Antibiotic sensitivity testing. Report of an International
Collaborative study. Acta. Pathol. Microbiol. Scandi. 1971; Section B (Suppl) : 217.
Essa F.abdullah ,H.Faryal,Fatima K, Irfan S.Iqbal S Mir enteric fever in Karachi : current
anti microbial susceptibility of Salmonalla typhi isolate journal of physician and
surgeon Pakistan 2012 ,vol 22 (3): 147-150
Ewing, W.H. An outline of nomenclature for the family Enterobacteriaceae. Int. Bull. Bact.
Nomencl. Taxan. 1963; 13 : 95.
Falcow, S. Infections Multiple Drug Resistance, Chapter 5 Pion Ltd London 1975.
FaridZ, MinerWF, HassanA, TrabolsiB . Misuse of antibiotics. N Engl J Med 1975;
292:216.
Farooqui, B., Ashfaq, M.K., Khurshid, M. and Ahmed, M.S. Epidemiology of typhoid fever.
National Health 1990; 8(6,7) : 20.
Finegold SM, baron EJ. In: Bailey & Scott's Diagnostic Microbiology. 7th Ed. Missouri: CV
Mosby Co., 1986;
Finegold SM, Sutter VL, Atterberry HR, Rosenblast SE. In: Manual of Clinical
Microbiology. Lennette EH, Spaulding EH, Tralant JP (eds). 4th Ed. Washington:
American Soceity of Microbiology, 1985.
Fontaine, T.D III. and Hoadley, A.W. Transferable drug resistance associated with coliform
isolated from hospital and domestic sewage. Health Lab. Sci. 1976; 13 : 238.
Foster, T.J. Plasmid-determined resistance to antimicrobial drugs and toxic metal ions in
bacteria. Microbiol. Rev. 1983; 47 : 361.
Frenck RW, Jr., Clemens J, Frenck RWJ, Clemens J. Helicobacter in the developing world.
Microbes & Infection 2003; 5(8):705-713.
Gaffar MSA, Seedat YK, Coovadia YM, Khan Q. The white cell count in typhoid fever
92
 Trop Geogr Med 1992; 44: 32-37
Gaffney, D.F., Foster, T.J. and Shaw, W.V. Chloramphenicol acetyltransferases determined
by R plasmids from Gram-negative bacteria. J. Gen. Microbiol. 1978; 109 : 351
Garrod, L.P. and O'Grady, F. In: Antibiotic and Chemotherapy ED Garrod LP and O'Grady
F, 3rd Ed. Williams and Wilkins Company Baltimore, 1971; PP 350-358.
Gilman, R.H., Terminal, M. and Levine, M.M. Relative efficacy of blood, urine, rectal swab,
bone marrow and rose-spot cultures for recovery of Salmonella typhi in typhoid
fever. Lancet 1975; 1: 1211.
Gniadkowski M (2001). Evolution and epidemiology of extended spectrum ß -
lactamases (ESBL) and ESBL producing microorganisms. Clin. Microbiol.
Infect. 7: 597-608.
Goodall EW and Washbourn JW, editors. London: aris; 1996. p. 290-329.
Gotuzzo, E.G. Characteristics epidemiologicas de la fiebre hfoidea en Lima. Diagnostico.
1981; 8 : 76.
Grabow, W.O.K., Vanzyl, M. and Prozesky, O.W. Behavior in conventional sewage
purification processes of coliform bacteria with transferable and nontransferable drug
resistance. Water. Res. 1976; 10 : 7
Graham SM, Graham SM. Salmonellosis in children in developing and developed countries
and populations. Current Opinion in Infectious Diseases 2002; 15(5):507-512.
Gupta A (1994). Multidrug-resistant typhoid fever in children: epidemiology and
therapeutic approach. Pediatr. Infect. Dis. J., 13: 134-140
Gupta V, Kaur J, Kaistha N. re-emerging chloramphenicol sensitivity and emerging low level
ciprofloxacin resistance among Salmonella enterica serotype typhi isolates in North
India. Trop Doct 2009;39:28-30.
Hannan A et al. Ofloxacin- a possible breakthrough in the treatment of typhoid fever caused
by chloramphenicol resistant Salmonella typhi. In: Nicoletti G, Cocuzza G, eds.
Proceedings of 6th Mediterranean Congress of Chemotherapy, 22-27 May 1988,
Hannan A, Butt T, Islam SN First quinolone resistant typhoid salmonella. Pakistan Armed
Forces medical Journal, 1993, 44:27-30
Hannan A. Changing pattern of Salmonella typhi isolates in Pakistan and their unchanged
response to ofloxacin. Intemational J Experiment Clin Chemotherapy 1991; 4: 225

93
Hannan A. Typhoid in Pakistan a decade of experience in abstract from proceeding
ofnationa symposium on tropical and infectious diseases at armed forces institute of
pathology, Rawalpindi, September1995.
Hakanen A, Kotilainen P, Huovinen P, Helenius H, Siitonen A. Reduced fluoroquinolone
susceptibility in Salmonella enterica serotypes in travelers returning from Southeast
Asia.EmergInfectDis.2001;7:996-1003.
Haque SMZ, Haq JA, Rahman MM. nalidixic Acid-resistant Salmonella enteric serovar
Typhi with decreased susceptibility to ciprofloxacin caused treatment failures: a
report from Bangladesh. Jpn J Infect Dis 2003; 56: 32-33
Hargret-Bean, H.J., Pavia, A.T. and Tauxe, R.V. Salmonella isolates for humans in the
United States; 1984-1986 MMWR. Annual Summary 1988; 37 . 25
Hasan R, Cooke FJ, Nair S, Harish BN, Wain J. Typhoid and paratyphoid fever. Lancet.
2005; 366:1603-4.
Hasan R, Zafar A, Abbas Z, Mahraj V, Malik F, Zaidi A. Antibiotic resistance among
Salmonella enterica serovar typhi and Paratyphi A in Pakistan (2001-2006). J
Infect Developing Countries 2008; 2:289-94.
Hazir T, SA Qazi, KA Abbas and MA Khan (2002). Therapeutic re-appraisal of multi drug
resistant Salmonella typhi (MDRST) in Pakistani children. J. Pak Med Assoc 52:
123-127
Helmuth, R., Stephan, R. and Bunge, C. Epidemiology of virulence-associated plasmid and
outer membrane protein patterns within seven common Salmonella serotypes. Infect.
Immune. 1985; 48 : 175.
Hirose K, Tamura K, Sagara H, Watanabe H. Antibiotic susceptibilities of Salmonella
enterica serovar Typhi and S. enterica serovar Paratyphi A isolated from patients in
Japan. Antimicrob Agents Chemother. 2001; 45: 956-8
Holmberg SD, Osterholm MT, Senger KA, Cohen ML. Drug-resistant salmonella
from animals fed antimicrobials. N Engl J Med 1984; 311: 61722.
Hornick, R.B., Greisman, S.E. and Woodward, T.E. Typhoid fever: Pathogenesis and
immunogenic control. N. Engl. J. Med. 1970; 283 : 686
Houston, C.W., Koo, F.C.W. and Peterson, J.W. Characterization of Salmonella toxin
released by mitomycin C-treated cells. Infect. Immune. 1981; 32 : 916.

94
Istrup, D.M. and Washington, J.A. The importance of volume of blood cultured in the
detection of bacteraemia and fungaemia. Diagnosis of Microbiology and Infectious
Diseases 1983; 1107.
Ishiguro, N., Goto, J. and Sato, G. Genetical relationship between R-plasmids derived from
Salmonella and E. coil obtained from a pig farm and its epidemiological
significance. J. Hyg. Camb. 1980; 84 : 365.
Islam, A., T. Butler, i.Kabir, and N.h. Alam, 1993. Treatment of typhoid fever with
ceftriaxone for 5 days or chloramphenicol for 14 days: a randomized clinical trial.
Antimicrob. Agents Chemother. 37:1572-1575.
Ivanoff B. Typhoid fever :global situation and WHO recommendations Southeast Asian
Trop Med public health 1995:26(suppl 2):1-6
Jackson, G. A survey of antibiotic resistance of E. coil isolated from animals in Great
Britain from 1971 to 1977. Vet. Record 1981; 108 : 325.
Jacobsen, 1910: Principles of Bacteriology, Virology and Imunology (Vol 2) ED
Topley W.W.E. and Wilson CS 7th Ed. Butler and Tanner Ltd, London1964; PP
332-- 355.
Jesudason, M. v., Malathy, B. and John, T. J. (1996): Trends of increasing level of minimum
inhibitory concentration (MIC)of ciprofloxacin to Salmonella typhi Indian J. Med
Res. 103,247-249.
Jiwa, S.F. 11. Probing for enterotoxigenicity among Salmonella: and evaluation of
biological assays. J. Clin. Microbiol. 1981; 1 4 : 4 6 3 .
Johnes A. Crump, Timothy J. Barrett, Jennifer T. Nelson, and Frederick J. Angulo
Reevaluating Fluoroquinolone Breakpoints for Salmonela enterica Serotype
Typhi and for Non-Typhi Salmonellae Foodborne and Diarrheal Diseases Branch,
National Center for Infectious Diseases, and Epidemic Intelligence Service, Division
of Applied Public Health Training, Epidemiology Program Office, Centers for
Disease Control and Prevention, Atlanta, Georgia CID 2003:37 (1 July).2000
Johnson, A.Q.K. and Aderele, W.I. Enteric fever in childhood. J. of Trop. Med. and Hyg.
1981; 8 4 , 2 9 .
Joseph, C.A. and Palmer, S.R. Outbreaks of Salmonella infection in England and
Wales1978-1987. Br. Med. J. 1989; 2 9 8 : 1 1 6 1 .
Karamat K A, Akhtar M A, Malik I A, Rehat R etal. Multidrug resistant Salmonella typhi of
95
 Northern Pakistan. Pakistan Journal of Pathology, 1991: 2:37-3

Karamat KA, Butt. T, hannan A,Islam SN, Hussain T. Quershi AH, Qamar RH. Problem of
multidrug resistant typhoid fever in Rawalpindi/Islamaad area Pk Armed Forces med
j 1996; 46(2) 48-54
Kariuki S, Revathi G, Muyodi J, et al. Characterization of multidrug resistant typhoid
outbreaks in Kenya J Clin Microbiol 2004; 42: 1477-1482
Karmaker S, Biswas D, Shaikh NM, Chatterjee K, Kataria VK, Kumar R. Role of a large
plasmid of S.typhi encoding multiple drug resistance. J Med Microbiol1991;34 :149-
51.
Kauffmann-White F. and Edwards, P.R. Classification and nomenclature of
Enterobacteriaceae. Int. Bull. Bact. Nomencl. Taxon. 1952; 2 : 2.
Kauffmann-White F. The bacteriology of Enterobacteriaceae. Copenhagen Munksgaard.
1966; P 1-400.
Kaye et, D., Rocha, H. and Eyekmans, L. Comparison of parenteral ampicillin and
parenteral chloramphenicol in the treatment of typhoid fever. Ann. N.Y. Acad. Sci.
1967; 145 : 423
Khan MH, Ain Q and Jamil H. Multidrug resistant typhoid in adults. JCPSP 1996; 6;33-35
Koneman EW, SD Allen, WM Janda, PC Schrechenberger and WC Winn (1997).
Antimicrobial susceptibility testing. In: Color Atlas and Text book of diagnostic
microbiology, London: Lippincott Williams and Wilkins 5: 785-856.
Konitomichalou, P. First Chloramphenicol resistant S. typhi strain isolated in Greece.
Pathologica et Microbiologia 1967; 30 : 71.
Kouame J, Kouadio L, Turquin HT, Kouame J, Kouadio L, Turquin HT. Typhoid ileal
perforation: surgical experience of 64 cases. Acta Chirurgica Belgica 2004;
104(4):445-447.
Koupal, L.R. and Deibel, R.H. Assay, characterization and localization and an enterotoxin
produced by Salmonella. Infect. Immune. 1975; 11 : 14.
Kustner HGV. Trends in four major communicable diseases S Arf Med J 1979: 55 : 460 - 473.
Lacey, R.W. A critical appraisal of the importance of R-factors in the Enterobacteriaceae in
Vivo. J. antimicrob. Chemother. 1975; 1 : 25.
Lakshmi V, Ashok R, Susmita J, Shailaja VV, Lakshmi V, Ashok R et al. Changing trends
96
 in the antibiograms of Salmonella isolates at a tertiary care hospital in Hyderabad.
Indian Journal of Medical Microbiology 2006; 24(1):45-48.
Laloum E, Zeller V, Graff W, Aerts J, Chazerain P, Mamoudy P et al. Salmonella typhi
osteitis can mimic tuberculosis. A report of three cases. Joint, Bone, Spine: Revue du
Rhumatisme 2005; 72(2):171-174.
Lathi Nair, Sudarsana J Changing Sensitivity Pattern of Salmonella typhi in Calicut
Microbiology Department Medical College, Calicut, India 2005 E-
Mail:[email protected]
Le Minor, L., Rohde, R. and Taylor, J. Nomenclaturedes Salmonella. Annals. Inst. Pasteur.
Paris 1970; 119; 206.
Le TA, Lejay-Collin M, Grimont PA, Hoang TL, Nguyen TV, Grimont F, Scavizzi MR
(2005). Endemic, epidemic clone of Salmonela enterica serovar typhi harboring a
single multidrug-resistant plasmid in Vietnam between 1995 and 2002. J. Clin.
Microbiol. 43: 3594-3599.
Levy SB (2001) Antibacterial household products: cause for concern. Emerg Infect Dis 7:
512-515
Liang-Takasaki Saxen H.and Makela P.H. Lund, E., Funder, S.B., Chritensonm H. and
Dupot, A. Sensitivity test with the tablet method. Acta pathologica et Microbiologica
Scandinavia 1951; 29 : 221.
Liang-Takasaki,C-J,Saxen, H.and Makela,P.H.Complement activation by
polysaccharide of lipopolysaccharide: an important virulence determinant of
Salmonella. Infect. Immune. 1983; 41 : 563.
Lin FYC, Ho VA, Bay PV, Thuy NIT, Bryla D, Thanh CT, et al. The . epidemiology of
typhoid fever in the Dong Thap province, Mekong Delta region of Vietnam. Am J
Trop Med Hyg 2000; 62;644-8
Linton, A.H. and Timoney, J.F. and Hinton M. The ecology of chloramphenicol-resistance
in S. typhimurium and E. coli in calves with endemic Salmonella infection. J. Appl.
Bact. 1981; 50 . 115
Linton, A.H. The Swann Report and its impact in the control of antibiotic Resistant Bacteria.
Stuart-Harris C. and Harris D.M. Eds. Academic Press, London. 1982; PP 183
Luby SP, Faizan MK, Fisher-Hoch SP, Syed A, Mintz ED, Bhutta ZA, et al. Risk fac!-ors
for typhoid fever in an endemic setting Karachi Pakistan epidemiologic
97
Lund, E., Funder, S.B., Chritensonm H. and Dupot, A. Sensitivity test with the tablet method.
Acta pathologica et Microbiologica Scandinavia 1951; 29 : 221.
M John, H. T., George, A. j., Yingyuan, Z., Wang, F . and David C. H. (2003)
Plasmid- Mediated Quinolone Resistance in Clinical Isolates of Escherichia coli
from Shanghai, China. Antimicrobial Agents and Chemotherapy.47(7): 2242-48
M. D. Smith, N. P. J. Day, L. T. Phi, C. M. Parry, and N. J. White. 1997. Short courses of
ofloxacin for the treatment of enteric fever. Trans. R. Soc. Trop. Med. Hyg. 91:347-
349.
Madhulika U,Harish BN Parija SC.Current patteren in antimicrobial susceptibility of
Salmonella Typhi isolates in Pondicherry.Indian J Med Res 2004;120:111-4
Mahmood A. Present status of antibiotic susceptibility pattern of Salmonella typhi isolates
at a tertiary care hospital in Karachi. Journal of the Pakistan Medical Association.
2000. 50(12) 428
Makela, P.J., Valtonen, V.V. and Valtonen, M. Role of 0-antigen (lipopolysaccharide) factors
in the virulence of Salmonella. J. Infect. Dis. 1973; 128 : S81.
Malini R. Capoor, Deepthi Nair, Jitendra Posti, Smita Singhal, Monorama Deb, Pushpa
Aggarwal, and Parukutty Pillai Minimum inhibitory concentration of carbapenems
and tigecycline against Salmonella spp. J Med Microbiol 2009 58: 337-41.
Mandal S, Mandal Md, Pal NK. reduced minimum inhibitory concentration of
chloramphenicol for salmonella enterica serovar typhi. Indian J Med Sci 2004 ; 58 :
16-23
Mandel, B. K. and Mani, V. Colonic involvement in Salmonellosis Lancet 1976; 1 : 887
Martin, W,J., Brates, S.F. and Ball, M.M. Evaluation of reagent-impregnated strips for
identification of Enterobacteriaceae. Am. J. Med. Technol. 1971; 37 , 99.
McConkey SJ, McConkey SJ. Case series of acute abdominal surgery in rural Sierra Leone.
World Journal of Surgery 2002; 26(4):509-513.
Medhat Shehab and Aref Al-Nakkas Clinical and microbiological investigations of typhoid
fever in an infectious disease hospital in Kuwait (2007), 56, 538-544
Miller Sl and Pegues DA, Salmonella species, including Salmonella typhi in: principal and
practice of infectious Diseases edited by Mandell GL, Bennett JE and Dolin R,
London, Churchill Livingstone,2000;pp.2344-2359
Mills-Robertson F, Addy ME, Mensah P, Crupper SS, Mills-Robertson F, Addy ME et al.
98
 Molecular characterization of antibiotic resistance in clinical Salmonella typhi
isolated in Ghana. FEMS Microbiology Letters 2002; 215(2):249-253.
Minor, L.Le., Coynault, C., Chabberi, Y., Gerbaud, G. and Minor,, S.Le. Groupes de
compatibdite de plasmides metaboliques. Ann. Microbiol. (Inst pasteur) 1976; 127B :
Mirza S, Kariuki S, Mamun KZ, Beeching NJ, Hart CA. Analysis of plasmid and
chromosomal DNA of multidrug resistant Salmonella enterica serovar typhi from
Asia. J Clin Microbiol 2000; 38:1449-52.
Mirza SH, Beeching NJ, Hart CA. Multi-drug resistant typhoid: a global problem. J Med
Microbiol 1996; 11 : 317-9.
Mirza SH, Hart CA. Plasmid encoded multi-drug resistance in Salmonella typhifrom
Pakistan. Annals of Trop Med Parasitol 1993;87:373-7.
Molecular analysis of incHI1 antimicrobial resistance plasmids from Salmonella serovar
Typhi strains associated with typhoid fever. Antimicrob Agents Chemother
2003;47:2732-9.
Molbak K, Baggesen DL, Aarestrup FM, et al. An outbreak of multidrug resistant Salmonela
enterica serotype Typhimurium DT104. N Engl J Med 1999; 34 1:1420–5.
Mohanty S, Renuka K, Sood S, Das BK and Kapil A (2006) Antibiogram pattern and
seasonality of Salmonella serotypes in a North Indian tertiary care hospital.
Epidemiology and Infection 134: 961-966
Momtaz O. Wasfy1, Robert Frenck1,Tharwat F. Ismail1, Hoda Mansour, Joseph L.
Malone1, and Frank J. Mahoney Trends of Multiple-Drug Resistance among
Salmonella Serotype Typhi Isolates during a 14-Year Period in Egypt CID 2002 ; 35
(15 NOVEMBER) . 1265
Morley, D.C. A simple method of testing the sensitivity of wound bacteria to penicillin and
Sulfamethoxazole by the use of impregnated blotting paper discs. J. of Path. and Bact.
1945;57 ; 379.
Mossel, D.A.A. and Oei, H.Y. Person-to-person transmission of enteric bacterial infection
Lancet 1975; i : 751.
Mubeena RS, Saleem AK, Ameena RS. Prevalence of enteric fever in Karachi. Infect Dis J
Pak 2006; 15:103-
Murdoch DA, Banatval NA, Bone A, Shoismatulloev BI. Epidemic' ciprofloxacin- resistant
Salmonella typhi in Tajikistan. Lancet 1998; 351: 339
99
Murray CJL, Lopez AD. Mortality by cause for eight regions of the world: global burden of
disease study. Lancet 1997; 349: 1269-1276
Murti, B. R., Rajyalakshmi, K. and Bhaskaran, C. S.: Resistance of Salmonella typhi to
chloramphenicol. Part I. A preliminary report. J. Clin. Pathol., 15: 544-551, 1962.
Musher, L.M. and Rubenstein, A.D. Permanent carriers of non-typhosa Salmonella. Arch.
Intern. Med. 1973; 132 : 869.
Mushtaq MA. What after ciprofloxacin and ceftriaxone in treatment of Salmonella typhi.
Pak J Med Sci 2006;22 (1):1 51-4.
Nair L, Sudarsana J, Pushpa KK. Epidemic of Salmonella enterica Serotype paratyphi A
in Calicut-Kerala. Calicut Med J 2004; 2:e2.
Nakamura, M., Sato, S. and Ohya, T. Possible relationship of a 36 mega dalton Salmonella
enteritidis plasmid to virulence in mice. Infect. Immune. 1985; 47 : 831.
Nakamura, M.,Sato,S. and Ohya,T.PossibleNepal, in 2003. Diagn Microbiol Infect Dis
2006;54: 299-303
Nguyen TA, ha-Ba-K, nguyen TD la fievre typhoid au sud du viet- nam, 1990-1993 Bull
Soc Pathol Exot 1993-; 86: 476-8
Niida, M., Makino, S., Ishiguro, N., Sato, G. and Nishio, T. Genetic properties of
conjugative R-plasmids in E. coli and Salmonella isolates from feral and domestic
pigeons, crows and kites. Zbt. Bakt. Hyg. I. Abt. Orig. 1983; A255 : 271.
Njoku-Obi, A. N. and Njoku-Obi, J. C.: Resistance of Salmonella typhosa to
chloramphenicol. J. Bacteriol., 90: 552-553, 1965.
Novick, R.P. Plasmid. Bacteriol. Rev. 1969; 33 : 210.
Ochiai RL, Wang X, von Seidlein L, Yang J, Bhutta ZA, Bhattacharya SK et al. Salmonella
paratyphi A rates, Asia. Emerging Infectious Diseases 2005; 11(11):1764-1766.
Ochiai, K., Yamanaka, T., Kimura, K. and Sawada, O. Studies on inheritance of drug
resistance between Shigella strains and E.coli strains. Nippon. Iji. Shimpo.1959; 1861
: 34.
of typhoid fever BMJ. 2006 July 8; 333(7558): 78–82.
Okeke IN, Klugman KP, Bhutta ZA, Duse AG, Jenkins P, O'Brien TF, et al. Antimicrobial
resistance in developing countries. Part II: strategies for containment. Lancet Infect
Dis 2005;5: 568-80.

100
Ortiz-Neu, C., Marr, J.C. and Cherubin, C.E. Bone and joint infections due to Salmonella J.
Infect. Dis. 1978; 138 : 820.
Pang, T., Z.A Bhutta, B.B Finlay, and M.Altwegg. 1995. Typhoid fever and other
salmonellosis: a continuing challenge. Trends Microbiol. 3:253-255
Paniker, C.K.J. and Vimala, K.N. Transferable chloramphenicol resistance in Salmonella
typhi. Nature 1972; 239 : 109
Parker, M.T. Salmonella In Principles of Bacteriology, Virology and Imunology (Vol 2) ED
Topley WWE and Wilson C.S. 7th ed. Butler and Tanner Ltd, London 1964; PP 332-
355.
Parry C (2003). Antimicrobial drug resistance in Salmonela enterica. Curr. Op. Infect.
Dis. 16: 467-472.
Parry CM (2004). Typhoid Fever. Curr. Infect. Dis. Rep., 6: 27-33.
Parry CM, Hien TT, Dougan G, White NJ, Farrar JJ, Parry CM et al. Typhoid fever. New
England Journal of Medicine 2002; 347(22):1770-1782.
Parry CM, HO VA, Phoung LT, Bay VB, Lanh MN, Tung Ie T et al. Randomized controlled
comparison of Ofloxacin, Azithromycin, and an Ofloxacin- Azithromycin
combination for treatment of Multidrug-Resistant and Nalidixic Acid-Resistant
Typhoid Fever. Antimicrob Agents Chemother 2007;51:819-25
Paterson DL (2006). Resistance in gram-negative bacteria: enterobacteriaceae Am. J.
Infect. Control. 34: S20-28.
Petrocheilou, V., Grinsted, J. and Richmond, M.H. R-plasrnid transfer in vivo in the absence
of antibiotic selection pressure. Antimicrob. Agents Chemother. 1976; 10 : 753
Pickett, M.J., Scott, M.L. and Hoyt, R.E. Tableted mediums for biochemical tests in diagnostic
bacteriology. Am. J. Med. Technol. 1955; 21 : 170.
Pillay, N., Adams, E.B. and Coombes, N.D. Comparative trial of amoxycillin and
chloramphenicol in treatment of typhoid fever in adults. Lancet 1975; i i : 333.
Poon, M. and Sanders, M.G. Hepatic abscess caused by Salmonella paratyphi B. Can. Med.
Assoc. J. 1972; 107 : 529.
Qadri, S.M.H., Berotte, J.H. and Wende, R.D. Salmonella heidelberg as a causative agent of
meningitis. Tex. Med. 1976; 72 : 56.
Quantification des caracteres biochimiques. Annuls. Inst. Pasteur. Paris. 1968; 115 : 218.

101
Quantitation of bacteria in blood of typhoid fever patients and relationship between counts
and clinical features transmissibility, and antibiotic resistance. J Clin Microbiol
1998;36: 1683-7
Rahman M, Siddique AK, Shoma S, Rashid H, Salam MA, Ahmed QS, Nair GB, Breiman
RF. Epidemiol Infect. 2006 Apr;134 (2) : 433-8.
Rahman2 Nalidixic Acid-Resistant Salmonella enterica Serovar Typhi with Decreased
Susceptibility to Ciprofloxacin Caused Treatment Failure: A Report from
Bangladesh. Jpn. J. Infect., Dis. 56, 2003.
Rahn, O. New principles for the classification of bacteria. Zent bl. Bakt. Parasit. Kde. Abt. II.
1937; 96 : 273.
Rangnekar, V.M., Banker, D.D. and Jhala, H.I. Drug resistance and incompatibility groups of
R-plasmid in intestinal Escherichia coll. Ind. J. Med. Res. 1982; 75 : 492
Rapid diagnosis of typhoid fever through identification of Salmonella typhi within 18 hours
of specimen acquisition by culture of the mononuclear cell-platelet fraction of blood.
Clin. Microbiol. 28:825827 Trop Med Int Health .1997;2: 1 088.-94
Rasaily R, Dutta P, Saha MR, Mitra U, Lahiri M, Pal SC. Multidrug resistant typhoid fever
in hospitalized children. Eur J Epidemiol 1994;10:41 46.
Rao PS, Rajashekar V, Varghese GK, Shivananda G. Emergence of multidrug resistant
salmonella typhi ir ral Southern India. Am J Trop Med Hyg 1993; 48: 108-111.
Rio M, Garcia1M, Cubedo M, Prez D. Time series in the epidemiology of typhoid fever in
Spain. Med Clin Bare 1996; 1 06:68-69.
Rathish KC, Chandrashekar MR and Negesha CN. An outbreak of Multidrug resistant
typhoid fever in 1.Bangalore. Indian J Pediatr 1995; 62:445-448
Rehman, M.T.A., Basir, N., Zia, N. and Farooqi, B. Thyroid abscess an unusual
complication of typhoid fever. J. Tropical Med. and Hyg. 1991; 94 : 55.
Renuka K, Seema S, Das BS, Kapil A. High level ciprofloxacin resistance in Salmonella
enterica serotype Typhi in India. J Med Microbiol 2005 ; 54: 999-1000
Richards, H. and Datta, N. Plasmids and transposons acquired bySalmonella typhi in man.
Plasmid 1982; 8 : 9.
Richens J. Typhoid Fever. In: Cohen J&PWG, editor. Cohen & Powderly: Infectious
Diseases. Edinburgh: Mosby Inc., 2004: 1561-1565.

102
Robert, M., Walter, J.R. and James, R. Salmonella thyroiditis apathetic thyrotoxicosis and
follicular carcinoma in a laotian women. Cancer 1982; 50 : 2493.
Rodrigues C, metha A, Joshi Vr. Quinolone resistant enteric fever – problems and remedies.
JAPI 1998; 46(8): 751-52.
Rolinson GN and Stevens S. Microbiological studies of new broad-spectrum penicillin
"penbritin". Brit. M. J. 1961; 2 : 191.
Rose, S.B. and Miller, R.E. Studies with the agar cup-plate method I A standardize agar cup-
plate technique. J. of Bact. 1969; 38 : 525.
Rosenthal, S.L. Exacerbation of salmonella Enteritis due to ampicillin. N. Engl. J. Med.
1969; 280 : 147.
Roussel, A.F. and Chabbert, Y.A. Taxonomy and epidemiology of Gram-negative bacterial
plasmids studies by DNA-DNA filter by hybridization in formamide. J. Gen.
Microbiol. 1978; 104 : 269.
Rowe B, EJ. Multidrug resistant Salmonella Typhi, a worldwide epidemic. Clin Infect Dis
1997; 24 (Suppl 1) : S 106-9.
Rowe, B., Frost, J.A., Threlfall, E.J. and Ward, L.R.Spread of multiresistant clone of
Salmonella byphimurium phage type in South-East Asia and the Middle East.
Lancet 1980; i : 1070.
Rowe, B., Ward, L. R. and Threlfall . E. J. (1990) Spread of multiresistant Salmonella typhi.
Lanct . 337 : 1065.
Rowland, H.A.K. The complications of typhoid fever. J. Trop. Med. Hyg. 1961; 64 : 143.
Rubenstein, A.D., Feenster, R.F. and Smith, H.M. Salmonellosis as a public health problem
in wartime. Am. J. Public health 1944; 34 : 841.
Rubin, R.H. Human Salmonellosis: Epidemiology, pathogenesis and clinical syndromes
Infect. Dis. Pract. 1982; 6 : 1.
Sabherwal, U., Chaudhary, U. and Saint, S. Multi-resistant Salmonella typhi in Haryana
in 1989-1990. Indian J. Med. Res. 1992; 95(A) : 12.
Saha SK, Baqui AH, Hanif M, Darmstadt GL, Ruhulamin M, Nagatake T et al. Typhoid
fever in Bangladesh: implications for vaccination policy. Pediatric Infectious
Disease Journal 2001; 20(5):521-524.
Saha SK, Talukder SY, Islam M, Saha S. A highly ceftriaxoneresistant Salmonella Typhi
in Bangladesh. Pediatr Infect Dis J 1999; 18 : 387
103
Salmonella typhi to treatment with trimethoprim-Sulfamethoxazole. Rev. Infect. Dis.
1982; 4 : 551.
Sanghavi SK, Mane MP, Niphadkar KB. Multidrug resistance in Salmonella serotypes.
Indian journal of Medical Microbiology 1999:17(2): 88-90
Saphra, I. and Winter, J.W. Clinical manifestations of Salmonellosis in man. An evaluation of
7779 human infections identified at the New York Salmonella Centre. New Engl. J. of
Med. 1957; 256 : 1128.
Saqib A, Ahmed A. Culture and sensitivity of Salmonella species; analysis of a two year
data. J Pak Med Assoc 2000;50:282-4
Savage, D.C. Survival on mucosal epithelia, epithelial penetration and growth in tissues of
pathogenic bacteria. In: Microbial pathogenicity in man and animals (22nd Symp Soc
Gen Micrbobiol) ED Smith H. and Pearce J.H. Cambridge. 1972; P 25.
Schutze, H. Identification of Salmonella by using specific antisera J. Hyg. 1921; 20 : 230.
Scott, I.H.K., Thomas, H.W. and Walters, R.O. Acute splenic abscess due to Salmonella
chestor. Br. Med. J. 1977; 1 : 688.
Scragg, J.N. and Rubidge, C.J. Amoxycillin in the treatment of typhoid fever in children. Am.
Trop. Med. Hyg. 1975; 24: 860.
Shanahan PM, Jesudason MV, Thomson CJ, Amyes SG. J Clin Microbiol. Molecular
analysis of and identification of antibiotic resistance genes in clinical isolates of
Salmonella typhi from India. J Clin Microbiol. 1998 Jun;36(6):1595-600.
Shanson, D.C., Brigden, W. and Weaver, E.M.J. Salmonella e n t e r i t i d i s endocarditis. Br.
Med. J.1977; 1 : 612.
Sharr, M.M. Splenic abscess due to Salmonella agona. Br. Med. J. 1972; 1 : 546.
Shaw, C. Distinction between Salmonella and Arizona by Leifson's sodium malonate medium.
Int. Bull. Bact. Nomencl. Taxon. 1956; 6:1
Shinagawa, M., Makino, S., Hirato, T., Ishiguro, N. andSato, G. Comparison of DNA sequences
required form the function of citrate-utilization among Different
citrateutilization plasmid.J.Bacteriol. 1982; 151 : 1046.
Shirakawa T, Acharya B, Kinoshita S, Kumagai S, Gotoh A, Kawabata M. Decreased
susceptibility to fluoroquinolones and gyrA gene mutation in the Salmonella enterica
serovar Typhi and Paratyphi A isolated in Kathmandu, Nepal, in 2003. Diagn
Microbiol Infect Dis 2006 ; 54: 299-303.
104
Shirakawa T, Acharya B, Kinoshita S, Kumagai S, Gotoh A, Kawabata M. Decreased
susceptibility to fluoroquinolones and gyrA gene mutation in the Salmonella enterica
serovar Typhi and Paratyphi A isolated in Kathmandu,
Siddiqui FJ, Rabbani F, Hasan R, Nizami SQ, Bhutta ZA. Typhoid fever in children: some
epidemiological considerations from Karachi, Pakistan. Int J Infect Dis 2006;
10:21 5-22.
Silverio, J. Gastric emptying time in the newborn and then nursling. Am. J. Med. Sci. 1964;
247: 732.
Sinha A, Sazawal S, Kumar R, Sood S, Reddaiah VP, Singh B, et al. Typhoid fever in
children aged less than 5 years. Lancet 1999; 357.
Sippel JE, DiabAS, MikhailAI,. Chloramphenicol resistant Salmonella typhi in Egypt Trans
R Soc Trop Med Hyg 1981;75:613.
Smith, W.H., Parsell, Z. and Green P. Thermosensitive antibiotic resistance plasmid in
Enterobacteria J. Gen. Microbiol. 1978; 109 : 37.
Smith, A.L. and Burns, J.L. Resistance to Chloramphenicol and fusidic acid, In:
Antimicrobial Drug Resistance Ed by Bryan LE. PP 293. Academic. Press. New.
York. 1984
Snego R H Bhutta Z A. Multiple drug resistant Salmonella. GMPA (editorial) 1987: 212-5
Snyder, M.L., Donnely, D. and Nix, M.J. On some practical applications of impregnated,
dried paperdiscs containing various reagents for the cultural differentiation of bacteria.
Am. J. Med. Technol. 1951; 17 : 105.Stanley, P.J.
Song, J. H., Cho, H., Park, M. Y., Na, D.S., Moon, H . B. and Pai, C. H. 1993. Detection o
Salmonella typhi in the blood of patients wth typhoid fever by polymerase chain
reaction. J Clin Microbiol. 31:1439-1443.
Steele AD and Ivanoff B. 6th International Conference on Typhoid Feverand other
Salmonelloses, Guilin, China,12-14 November 2005. J health popul nutr
2007;25:122-4.
Stokes, E.J. and Waterworth, P.M. Antibiotic Sensitivity tests by diffusion methods
Association of Clinical Pathologists Broad sheet 1972 : 55.
Stuart, M. D. and R. L. Pullen. 1946. Typhoid: clinical analysis of three hundred and sixty
cases. Arch. Intern. Med. 78:629-661.

105
Su LH, Wu TL, Chia JH, Chu C, Kuo AJ, Chiu CH (2005). Increasing ceftriaxone
resistance in Salmonella isolates from a university hospital in Taiwan. J.
Antimicrob. Chemother. 55: 846-852.
Suganthi R, Rajasekar V, Vargese GK, Shivanada PG. Emergence of multi drug resistant
S.typhi in rural Southern India. Am J Trop Med Hyg 1993 ; 48 : 1 08-11
Takkar VP, Kumar R. Takkar R, Khurana S. Resurgence of Chloramphenicol sensitive
Salmonella typhi. Indian Pediatr 1995: 32: 58687
Taormina Giardini Naxos, Italy. Florence, Italy, Edizioni Revise Scientifiche, 1988; 383-5.
Tariq, Ahmad RN, Salman M, Kazmi SY. Changing trends in drug resistance among
typhoid salmonellae in Rawalpindi, Pakistan. East Mediterr Health J. 2005 Sep-
Nov;11(5-6):1038-44
Taylor, D.E. and Grant, R.B. Incompatibility and surface exclusion properties ofH1 andH2
plasmid. J. Bacteriol. 1977; 131 : 174
Taylor, D.E. and Levine, J.C. Studies of temperature- sensitive transfer and maintenance of
H incompatibility group plasmid J. Gen. Microbiol. 1980; 116 : 475
Taylor, D.E., Levine, J.G. and Kouvelos, K.L. Incidenceof plasmidDNA inSalmonella strains
isolated from clinical sources in Ontario, Canada, during 1979 and 1980. Can. J.
Microbiol. 1982; 28 : 1150
Taylor, D.E., Shermer, M. and Grant, R.B. Incidence of the H12 group of plasmid in
chloramphenicolsensitive Salmonella isolated in 1974 from clinical sources in
Ontario. Can. J. Microbiol. 1978; 24 : 600
Tehmina Munir, Munir Lodhi, Tariq Butt, Karamat Ahmed Karamat. Incidence and
Multidrug Resistance in Typhoid Salmonellae in Bahawalpur Area. Pak Armed
Forces Med J Jan ;2001.51(1):10-13
Thornsberry, C. The agar diffusion antimicrobial susceptibility test. In: Current Techniques for
antibiotic susceptibility testing. ED Barlow A, Charles C and Thomas. Springfield,
Illinois 1974; PP 6-16.
Threlfall EJ, Fisher IST, Berghold C, Gerner-Smidt P, Tschape H, Cormican M, Luzzi I,
Schnieder F, Wannet W, Machado J and Edwards G (2003) Trends in antimicrobial
drug resistance in Salmonella enterica serotypes Typhi and Paratyphi A isolated in
Europe, 1999-2001 International Journal of Antimicrob Agents 22: 487-491
Threlfall EJ, Day M, de Pinna E, Lawrence J. Drug-resistant enteric fever in the UK. Lancet
106
 2006 ; 367 : 1576.
Threlfall EJ, Ward LR, Skinner JA, Smith HR, Lacey S. Ciprofloxacin resistant Salmonela
Typhi and treatment failure. Lancet 1999; 353: 1590–1.
Threlfall EJ, Ward LR. Decreased susceptibility to ciprofloxacin in Salmonella enterica
serotype Typhi, United Kingdom. Emerg Infect Dis 2001; 7 : 448-50.
Threlfall, E.J., Ward, L.R., Ashley, A.S. and Rowe, B. Plasmid-encoded trimethoprim
resistance in multiresistant epidemic Salmonella typhimurium phage type 204 and
193 in Britain. Br. Med. J. 1980; 280 : 1210.
Threlfall, E.J.Carr, J.M. and Anderson, E.S. Compatibility reactions of resistance plasmid in
Salmonella typhimurium of Middle Eastern origin. Proc. Soc. Gen. Microbial. 1982;
3 : 88.
Timoney, J.F. and Linton, A.H. Experimental ecological studies on H2 plasmid in the intestine
and faeces of the calf. J. Appl. Bact. 1982; 52 : 41
Topley and Wilson's principles of bacteriology, virology and immunity 7th ed. Edward
Arnold, London, England. Sudarmono, S. P. Pulungsih, M. Lesmana, P. Tjaniadi, N.
Sukri, and S. L. Hoffman. 1990. Rapid diagnosis of typhoid fever through
identification of Salmonella typhi within 18 hours of specimen acquisition by culture
of the mononuclear cell-platelet fraction of blood. Clin. Microbiol. 28:825827 Trop
Med Int Health .1997;2: 1 088.-94
Tran HH, Bjune G, Nguyen BM, Rottingen JA, Grais RF, Guerin PJ et al. Risk factors
associated with typhoid fever in Son La province, northern Vietnam. Transactions of
the Royal Society of Tropical Medicine & Hygiene 2005; 99( 11):819-826.
Tsonyo Dimitrov, Eded E. Udo ,Ossama Albaksami, Shehab Al-Shehab, Abdal Kilani
Medhat Shehab and Aref Al-Nakkas Clinical and microbiological investigations of
typhoid fever in an infectious disease hospital in Kuwait Journal of Medical
Microbiology (2007), 56, 538-544.
Tzouvelekis LS, Lukova V, Tassios PT, Fluit AC, Jones RN, Legakis NJ (2003).
Resistance to ß-lactams among blood isolates of Salmonella spp. in European
hospitals: results from the sentry Antimicrobial Surveillance Program 1997-98.
Clin. Microbiol. Infect. 9: 149-152.

107
Ugwu BT, Yiltok SJ, Kidmas AT, Opaluwa AS, Ugwu BT, Yiltok SJ et al. Typhoid
intestinal perforation in north central Nigeria. West African Journal of Medicine
2005; 24(1):1-6.
Uhlman, D.L. and Jones, G.W. Chemotaxis as a factor in interactions between HeLa cells and
Salmonella typhimurium. J Gen Microbiol 1982; 128 : 415.
Uneke C (2008). Concurrent malaria and typhoid fever in the tropics: the diagnostic
challenges and public health implications. J. Vector Borne Dis., 45: 133-1 42
Usha Das & Bhattacharya S.S,Antibiogram phage, typing & biotyping of Salmonella
Typhi & Salmonella Paratyphi A from Rourkela ,Orissa. Indian J Med Res
124,july 2006,pp 109-111
Uwaydah AK, Matar I, Chacko KC and Davidson JC (1991) The emergence of
antimicrobial resistant Salmonella typhi in Qatar: epidemiology and therapeutic
implications. Trans R Soc Trop Med Hyg 85: 790-792.
Velema JP, van Wijnen G, van Naerssen T, Jota S. Typhoid fever in Ujung Pandang,
Indonesia-high risk groupsai1cfhigh-risk behavior Trop Med Int Health .1997;2: 1
088.-94
Vollaard AM, Ali S, Widjaja S, Asten HA, Visser LG, Surjadi C et al. Identification of
typhoid fever and paratyphoid fever cases at presentation in outpatient clinics in
Jakarta, Indonesia. Transactions of the Royal Society of Tropical Medicine &
Hygiene 2005; 99(6):440-450.
Wain J, Diem Nga LT, Kidgell C, James K, Fortune S, Song Diep T et al.
Molecular analysis of incHI1 antimicrobial resistance plasmids from Salmonella
serovar Typhi strains associated with typhoid fever Antimicrob Agents Chemother
2003;47:2732-9.
Wain J, Diep TS, Ho VA, Walsh AM, Nguyen TT, Parry CM, et al. Quantitation of bacteria
in blood of typhoid fever patients and relationship between counts and clinical
features, transmissibility, and antibiotic resistance. J Clin Microbiol 1998;36: 1683-
7
Wain J, Kidgell c. The emergence of multidrug resistance to antimicrobial agents for the
treatment of typhoid fever. Trans R Soc Trop Med Hyg 2004; 98:423-30.
Wang, F., Gu, X-J., Zhang, M-F. and Tai, T-Y. Treatmentof typhoid fever with ofloxacin. J. of
Antimicrob. Chemother. 1989; 23 : 785.
108
Wasfy MO et al. Trends of multiple-drug resistance among Salmonella serotype Typhi
isolates during a 14-year period in Egypt. Clinical infectious diseases, 2002 35(10):
1265-8
Washington, J.C. Blood cultures: Principles and techniques. Mayo Clinical Proceedings 1975;
50 . 91.
Watson, J.P., Pettibone, E. C. 1991, Chloramphenicol and ampicillin resistant Salmonella
typhi in Nepal. J. Nep. Med. Asso. 29. 259-261
Watanabe, T. Infective heredity of multiple-drug resistance in bacteria, Bacteriol, Rev.
1963; 27: 87.
Waterworth, P.M. Quantitative methods for bacterial sensitivity testing. In: Laboratory
Methods in Antimicrobial Chemotherapy. Published for the British Society for
Antimicrobial Chemotherapy Churchill Livingstone Edinburgh London 1978; PP 31-
40.
Watson, J .P. Pettibone, E. C. 1991, Chloramphenicol and ampicillin resistant Salmonella
typhi in Nepal. J. Nep. Med. Asso. 29. 259-261
Wellcome trust Sanger Institute. Antibiotic Resistance Advance in Asia. Available from;
http://www.sanger.ac.uk/about/press/2006/060224.html 21May 2010, date last
accessed.
Weill F X, Demartin M, Tande D, Espie E, Rakotoarivony I, Grimont PA (2004). SHV-
12-like extended-spectrum-beta-lactamase-producing strains of Salmonella
enterica serotypes Babelsberg and Enteritidis isolated in France among infants
adopted from Mali. J. Clin. Microbiol. 42: 2432-2437.
WHO. Public Health Papers 1969; No. 38 P.78.
World Health Organization Geneva; 2002.
World Health Organization Department of Vaccines and Biologicals. Background
document: the diagnosis, prevention and treatment of typhoid fever. Geneva: WHO,
2003:19-23.
WHO Traditional Medicine Strategy 2002–2005 WHO. Public Health Papers 1969; No. 38
P.78.
World Health Organization. 6th International Conference on Typhoid Feve and other
Salmonelloses.2006.Geneva,WHO.
William T, Mahle MD. Salmonella typhi infection in children younger than five years of
109
 age. Pediatr Infect Dis J 1993; 12: 627-631.
Winokur PL, Canton R, Casellas JM, Legakis NJ (2001). Variations in the prevalence
of strains expressing an extended spectrum - lactamase phenotype and
characterization of isolates from Europe, the Americas and the Western Pacific
region. Clin. Infect. Dis. 32: S94–103.
Woodward, T. E., Smadel, J. E., Ley, H. L., Green, R. and Mankikar, D. S.: Preliminary
report on the beneficial effect of chloromyecetin in the treatment of typhoid fever.
Ann. Int. Med., 29: 131-134 1948.
World Health Organization. 6th International Conference on Typhoid Feve and other
Salmonelloses. 2006. Geneva, WHO World Journal of Surgery 2002; 26(4):509-513.
Yew FS, Chew SK, Goh KT, Monterio EH, Lim YS. Typhoid fever in Singapore: a review
of 370 cases. J Trop Med Hyg 1991;94:352-7
Yoon HJ, Cho SH, Kim SH. A Case of Multidrug-Resistant Salmonella enterica Serovar
Typhi Treated with a Bench to Bedside Approach. Yonsei Med J 2009; 50(1):147-
51
Yousaf, M. and Sadick, A. Ofloxacin in the treatment of typhoid fever unresponsive to
chloramphenicol. C (1990)
Bhutta A Zulfiqar A , Husein Lalji Dewraj Current concepts in the diagnosis and
treatment of typhoid fever BMJ. 2006 July 8; 333(7558): 78–82.

110
PUBLICATION

111
 African Journal of Microbiology Research Vol. 6(4), pp. 793-
797, 30 January, 2012 Available online at
http://www.academicjournals.org/AJMR
DOI: 10.5897/AJMR1 1.1055
ISSN 1996-0808 ©201 2 Academic Journals

Full Length Research Paper

Emergence of extended-spectrum β -lactamase

producing Salmonella typhi in Pakistan
1 1 2 3
Khalid Mahmood , Mateen Izhar , Nakhshab Choudhry , Ghulam Mujtaba and
4
Naeem Rashid *

¹
Department of Microbiology, Sheikh Zayed Hospital,
²
Lahore, Pakistan. Department of Biochemistry,
3
Sheikh Zayed Hospital, Lahore, Pakistan. Institute of
Nuclear Medicine and Oncology (INMOL), Lahore,
4
Pakistan. School of Biological Sciences, University of
the Punjab, Lahore, Pakistan.
Accepted 29 December, 2011

Enteric fever caused by Salmonella typhi, is an increasing health problem affecting

the major population in tropical and subtropical regions of the world. Development of
multi drug resistance in S. typhi strains has further increased the severity of the
problem. In Pakistan and neighboring countries, more than 80% S. typhi strains have
been reported as multi drug resistant. A total of 4200 isolates collected during four
years study period starting from Jan. 2006 to Dec. 2009, were initially screened using
the first-line anti typhoid drugs. Out of them 408 were resistant to all the first-line
antityphoid drugs. It was confirmed by polymerase chain reaction that all these
isolates contained fliC, sul, catP, tem and gyrA genes. Only three of them (0.7%) had
shown extended-s p e c t r u m β -lactamases production by double disk synergy test.
Infection control surveillance, better hygiene along with controlled use of anti
microbials would minimize the impact of extended-s p e c t r u m β -lactamases and their
spread in hospital and intensive care unit patients.

Key words: Extended-s p e c t r u m β -lactamase, multi drug resistance, salmonella typhi,

polymerase chain reaction, Pakistan.

INTRODUCTION
112
Multi drug resistant (MDR) Salmonella typhi, causing
enteric fever continues to be a major public health problem
in tropics and subtropics of the world, affecting both local
population and travelers to the endemic area. Frequent out
breaks have been reported in South Asian countries (Le et
al., 2005; Mulvey et al., 2003). In Pakistan, Iran, Nepal,
Bangladesh and India more than 80% MDR S. typhi have
been reported during the past two decades (Mohanty et al.,
2006; Menezes et al., 2011). Treatment scenario has
changed from first line anti typhoid such as
chloremphenicol (C), ampicillin (AMP), and trimethoprim-
sulphamethoxazol (SXT) to

*Correspondi
ng author. E-mail: [email protected] or
[email protected]. Tel: +92 42 99231534. Fax: +92
42 99230980.

fluoroquinolones and cephalosporins (Parry, 2003; Zaki

and Karande, 2011). Extended s p e c t r u m β -lactamases
(ESBL) are enzymes that can hydrolyze oxyimino-beta
lactams causing resistance to third generation
cephalosporins, resulting in treatment failure and
association with higher morbidity and mortality among
immuno-compromised patients (Rasheed et al., 2000;
Bush, 2001). Nosocomial infection caused by ESBL
producing S. typhi has been reported from Latin America,
France, Senegal, Africa, Asia, and Europe (Winokur et al.,
2001; Weill, 2004a, b; Gniadkowski, 2001; Su et al., 2005).
The emergence of ESBL in MDR S. typhi, constitutes a
new challenge and has become a matter of concern
especially in under developed countries.
S. typhi has been found to produce a wide variety of
ESBL types including TEM, SHV, PER and CTXM enzyme
(Batchelor et al., 2005; Paterson, 2006; Tzouvelekis et al.,
2003). Phenotypic detection methods

113
794 Afr. J. Microbiol. Res.

Table 1. Primer sequences used in this study for PCR amplification.

Primer S e q u e n c e ( 5 ’ -3 ’ ) Gene Size (bp)

fliC F ACTGCTAAAACC ACTACT fliC 363
fliC R TGGAGACTTCGGTCGCGTAG

sul2 F sul2 R TCAACATAACCTCGGACAGT sul2 707

GATGAAGTCAGCTCCACCT
catP F catP R
CCTGCCACTCATCGCAGT catP 623
CCACCGTTGATATATCCC
tem F tem R

GCACGAGTGGGTTACATCGA tem 311

gyrA F gyrA R GGTCCTCCGATCGTTGTCAG

TACCGTCATAGTTATCCACGA gyrA 313

GTACTTTACGCCATGAACGT

perform poorly in bacterial isolates harbouring AmpC gene SXT, ciprofloxacin (CIP), ofloxacin (OFX), cefotaxime (CTX),
(Robberts et al., 2009). AmpC β-lactamases are included in ceftriaxone (CRO), ceftazidime (CAZ), imipenem (IPM), and
class C and are not inhibited by clavulanic acid or other β- meropenem (MEM). Escherichia coli (ATCC 25922) was used as a
lactamase inhibitors. Thus if an ESBL confirmatory test using control. S. typhi isolates were labeled MDR when showing
clavulanic acid is not performed, many AmpC producing strains resistance to all the first line antityphoid drugs.
may be presumed to be ESBL producing strains (Fred et al., Genomic DNA from MDR samples was extracted by standard
1999; Hague, 2011). Detection of microorganisms with phenol/chloroform method (Sambrook et al., 1989) and
multiple β -lactamases that may interfere with the phenotypic subsequently parts of the genes responsible for resistance to these
confirmatory tests can only be accomplished by iso-electric drugs were amplified by PCR using the primers given in Table 1.
focusing or DNA sequencing methods that are usually not All the MDR S. typhi isolates were screened for ESBL production
available in clinical labs (Goussard and Courvalin, 1999; Pfaller using CAZ and CTX indicator discs (Oxoid, Cambridge, UK). The
et al., 2001). isolates showing the zones of inhibition (ZOI) ~ 22 mm and 27 mm
for CAZ and CTX respectively were further tested in combination
with amoxicillin/clavulanic (AMC). The isolates showing an increase
The primary objective of this study was to assess the incidence
in ZOI by greater than or equal to 5 mm when evaluated in
of ESBL producing MDR S. typhi and their antimicrobial
combination with AMC were phenotypically considered as ESBL
sensitivity pattern in Pakistani population using double disc producers.
synergy test (DDST) from blood samples of the patients
DDST was performed by inoculating Mueller-Hinton (MH) agar
suffering from enteric fever who visited out patients departments
with test isolates to give a semi confluent growth. CAZ 30 µg and
or were admitted in Sheikh Zayed Hospital Lahore, Pakistan. AMC 20 µg discs were then placed strategically 25-30 mm apart
(centre to centre) following over night incubation aerobically at
37°C. ESBL production was inferred when the zone of inhibition
METHODS around the indicator disc was expanded by AMC.
This prospective and cross sectional study was conducted from
RESULTS
January 2006 to December 2009 at tertiary care, university
teaching Federal Post Graduate Sheikh Zayed Medical Complex
(referral hospital with 450 beds) in Lahore, Pakistan. S. typhi were During the four years study period from January 2006 to
isolated from the blood of the patients admitted in the Hospital. December 2009, a total of 4200 S. typhi isolates were collected
Blood sample from the patients were collected in blood culture from blood culture samples of typhoid patients.
bottles and incubated at 37°C for 24 h. Sample from blood culture The ratio of S. typhi ranged between 1372 (32.6%)
bottle were inoculated on MacConkey and S.S agar. Plates were isolates during 2006, 1050 (25%) in 2007, 1018 (24.2%)
then incubated at 37°C for 24 h. Identification of the micro- in 2008 and 760 (18.09%) during 2009. The results
organisms was carried out by using API 20 E (Bio Meraux, indicated that the isolation of S. typhi was significantly
Hazelwood, Durham NC, USA), polyvalent “O”Anti sera (Bio-Rad decreased to 18.09% in 2009 from 32.6% in 2006 (Table 2).
Laboratories CA, USA) and subsequently specific (fliC) gene was
isolated by polymerase chain reaction (PCR). Antimicrobial Out of total 4200 S. typhi specimen 408 (9.7%) were resistant
susceptibility tests were performed by using standard disc diffusion to all the first-line anti-typhoid drugs (C, AMP and SXT),
method following Clinical Laboratory Standards Institute (CLSI) therefore were labeled as MDR S. typhi. Isolation rate of MDR
recommendations. The panel of antibiotics tested includes AMP, C, S. typhi reduced to 5% (38 isolates) during 2009 from 13% (180
isolates) during 2006
 Mahmood et al. 795

Table 2. Isolation of S . ty phi during the study period (n=4200).

Year No. of isolates %age MDR positive %age ESBL Producer

2006 1372 32.6 180 13.1 1
2007 1050 25 110 10.4 1
2008 1018 24.2 80 7.8 1
2009 760 18.09 38 5 0
Total 4200 100 408 36.3 3 (0.73 %)

Table 3. Antimicrobial resistant pattern of S . ty phi isolates during 2006-2009.

Year 2006 (n = 1372) Year 2007 (n = 1050) Year 2008 (n = 1018) Year 2009 (n = 760)
Drug n %age n %age n %age
n %age
Chlorompjenicol 632 46.06 278 27.3 195 19.1 101 13.2
Ampicillin 962 70.1 685 49.9 236 23.1 161 21.1
Co-trimoxazole 878 63.9 602 43.8 248 24.3 183 24.0
Ciprofloxacin 220 16.1 380 36.1 498 48.9 410 53.9
Nalidixic acid 1236 90.08 742 70.6 1206 87.9 312 95.6
Ceftriaxone 196 14.2 160 15.2 162 15.9 118 13.5
Cefotaxime 248 18.0 171 16.2 132 12.9 108 14.2
Ceftazidime 226 16.4 158 15.0 145 14.2 90 11.8
Sparfloxacin 208 14.8 127 12.0 108 10.6 96 12.6
Gentacin 248 18.0 168 16.0 140 13.7 120 15.7
Imipenem 36 2.0 26 2.4 31 3.0 18 2.3
Meropenem 42 3.1 31 2.9 31 3.0 17 2.2
n = nu mber of isolates.

(P< 0.001) as given in Table 2. Among the first line anti primers which resulted in the amplification of a DNA
typhoid drugs C showed decreasing resistance patterns fragment of 313 bp in all the isolates (Figure 1B).
from 46.06% in 2006, 27.3% in 2007, 19.1% in 2008 and
13.2% in 2009. AMP also showed decreasing resistance
patterns from 70.1% in 2006, 49.9% in 2007, 23.1% in
2008, and 21.1% in 2009. Resistant patterns for SXT were
also decreased from 63.9% in 2006, 43.8% in 2007, 24.3%
in 2008, and 24% in 2009. On the other hand CIP showed
year wise increased resistant patterns from 16.1% in 2006,
36.1% in 2007, 48.9% in 2008, and 53.9% in 2009 (Table
3).
ESBL production was suspected in isolates showing
reduced susceptibility to CRO, CAZ or CTX and was tested
for ESBL production using DDST. Only three isolates, one
in each year from 2006-2008 out of 408 (0.7%) were found
to be ESBL producer. No incidence of ESBL production
was observed in 2009.
All the 408 MDR isolates were further examined for the
presence of fliC gene by PCR by using fliC F and fliC R
primers as priming strands and genomic DNA of MDR
isolates resulted in the amplification of 363 bp DNA
fragments indicating that all the isolates were S. typhi.
Three of the representative isolates are shown in (Figure
1A). We also performed PCR by using gyrA F and gyrA R

795
 Mahmood et al. 796
When we performed PCR by using sul2 F and sul2 R
primers, a 707 bp DNA fragment was amplified in all the
cases reflecting the presence sul2 gene which was
responsible for resistance against SXT (Figure 1 C). The
presence of tem gene, responsible for resistance against
AMP, was demonstrated by the amplification of 311 bp
DNA fragments (Figure 1 D) by using tem F and tem R
primers. Presence of catP gene is one of the factors
responsible for resistance against C in S. typhi isolates.
When we performed PCR by using catP F and catP R
primers, a DNA fragment of 623 bp was amplified (Figure 1
E) reflecting the presence of catP gene in all the 408
isolates.

DISCUSSION

MDR in S. typhi is a major therapeutic concern and now

ESBL emergence in these isolates has constituted a new
challenge for physicians treating typhoid fever in
developing countries where typhoid fever is endemic. In
the present study, decreasing isolation rate, both in S.
typhi and MDR S. typhi has been observed. Decreased
isolation of S. typhi is assumed to be due to over all
improvements in environmental, water and sanitary
conditions, public awareness and personal hygiene. It

796
 Mahmood et al. 797

Figure 1. Ethidium bromide stained 1% agarose gel demonstrating the PCR amplification of fliC gene, for identification of S. typhi,
and various genes responsible for antimicrobial drug resistance.

can also be attributed to withdrawal of first-line anti-typhoid

drugs (C, AMP and SXT) for empirical therapy, preventing
risk factors for acquiring MDR which includes isolation of
patients, short hospital stay, continuous surveillance,
controlled and judicial antibiotic use in hospital and ICU
(Cassettari et al., 2009). Similar decreasing pattern has
been observed in studies conducted in India, Nepal,
Kuwait, and USA (Bradford, 2001; Pokharel et al., 2006;
Rotimi et al., 2008). Prevalence of MDR S. typhi varies
from 0 to 61 % in different parts of the world (Kariuki et al.,
2010; Threlfall et al., 2003). Our study demonstrated the
presence of 0.7% ESBL producers among MDR S. typhi
isolates which is comparable to the studies conducted in
Canada, Poland, England, and France where 0-3% ESBL
production has been reported in MDR S. typhi (Batchelor
et al., 2005; Weill et al., 2004; Mohanty et al., 2006). Since
ESBL genes are usually located on mobile genetic
elements, the emergence of an ESBL S. typhi may be
attributed to exchange of mobile genetic elements.
Increased CIP resistance from 16.1 to 53.9% in MDR S.
typhi isolates (Table 3), observed in this study, suggests
that efficacy of CIP is unreliable against MDR S. typhi
isolates. This reflects the wide spread use or misuse of
CIP. Self prescription by patients and incomplete courses
of treatment are features contributing to development of
resistance to CIP in MDR S. typhi.

REFERENCES

Batchelor M, Hopkins K, Threlfall EJ, Clifton-Hadley FA, Stallwood AD,

Davies RH, Liebana E (2005). Bla (CTXM) genes in clinical Salmonella
isolates recovered from humans in England and Wales from 1992 to
2003. Antimicrob. Agents Chemother. 49: 1319-1322.
797
 Mahmood et al. 798

Bradford PA (2001). Extended-spectrum b β -lactamases in the 21st

century: characterization, epidemiology, and detection of this important
resistance threat. Clin. Microbiol. Rev., 14: 933–951.
B u s h K ( 2 0 0 1 ) . N e w β -lactamases in gram-negative bacteria: diversity and
impact on the selection of antimicrobial therapy. Clin. Infect. Dis., 32:
1085-1089.
Cassettari VC, Da Selveria IR, Dropa M, Lincopan N, Mamizuka EM,
Matté MH, Matté GR, Menezes PR (2009). Risk factors for colonization
of newborn infants during an outbreak of extended-s p e c t r u m β -
lactamase producing Klebsiella pneumonia in an intermediate-risk
neonatal unit. J. Hosp. Infect., 71: 340-347.
Fred CT, Mohammad MJ, Gorton TS, Dembek ZF (1999). Detection and
Reporting of Organisms Producing Extended-Spectrum β lactamases:
Survey of Laboratories in Connecticut. J. Clin. Micriobiol., 37: 4065-
4070.
Gniadkowski M (2001). Evolution and epidemiology of extended spectrum
ß-lactamases (ESBL) and ESBL producing microorganisms. Clin.
Microbiol. Infect., 7: 597-608.
Goussard S, Courvalin P (1999). Updated sequence information for tem
beta-lactamases genes. Antimicrob. Agents Chemother., 43: 367-370.
Hague R (2011). What is the threat from extended spectr u m β lactamase-
producing organisms in children? Arch. Dis. Child., 96: 325-327.
Kariuki S, Revathi G, Kiiru J, Mengo DM, Mwituria J, Muyodi J, Munyalo A,
Teo YY, Holt KE, Robert A, Dougan KG (2010). Typhoid in Kenya Is
Associated with a Dominant Multidrug-Resistant Salmonella enterica
Serovar Typhi Haplotype That Is Also Widespread in Southeast Asia. J.
Clin. Microbiol., 48: 2171 -2176.
Le TA, Lejay-Collin M, Grimont PA, Hoang TL, Nguyen TV, Grimont F,
Scavizzi MR (2005). Endemic, epidemic clone of Salmonella enterica
serovar typhi harboring a single multidrug-resistant plasmid in Vietnam
between 1995 and 2002. J. Clin. Microbiol. 43: 3594-3599. Menezes GA,
Harish BN, Khan MA, Goessens WHF, Hays JP (2011). Antimicrobial
resistance trends in blood culture positive Salmonella typhi isolates from
Pondicherry, India, 2005–2009. Clin. Microbiol.
Infect. Available from:
http://onlinelibrary.wiley.com/doi/1 0.111 1/j.1469-0691 .2011 .03546.x.
Mohanty S, Renuka K, Sood S, Das BK, Kapil A (2006). Antibiogram
pattern and seasonality of Salmonella serotypes in a North Indian
tertiary care hospital. Epidemiol. Infect., 134: 961-966.
Mulvey MR, Soule G, Boyd D, Demczuk W, Ahmed R (2003).

798
 Mahmood et al. 799

Characterization of the first extended-spectrum β -lactamase-producing Salmonella isolate identified in Canada. J. Clin.
Microbiol. 41: 460– 462.
Parry C (2003). Antimicrobial drug resistance in Salmonella enterica. Curr. Op. Infect. Dis., 16: 467-472.
Paterson DL (2006). Resistance in Gram-negative bacteria: enterobacteriaceae. Am. J. Infect. Control, 34: S20-28.
Pfaller MA, Acar J, Jones RN, Verhoef J, Turnidge J, Sader HS (2001). Integration of molecular characterization of
microorganisms in a global antimicrobial resistance surveillance program. Clin. Infect. Dis., 32: S156-167.
Pokharel BM, Koirala J, Dahal RK, Mishra SK, Khadga PK, Tuladhar NR (2006). Multidrug-resistant and extended-spectrum
β -lactamase (ESBL)–producing Salmonella enterica (serotypes Typhi and Paratyphi A) from blood isolates in Nepal:
surveillance of resistance and a search for newer alternatives. Int. J. Infect. Dis., 10: 434–438.
Rasheed JK, AndersonJGJ, Yigit H, Queenan AM, Doménech-Sánchez A, Swenson JM, Biddle JW, Ferraro MJ, Jacoby GA,
Tenover FC (2000). Characterization of the extended spectrum β -lactamase reference strain, klebsiella pneumonia K6
(ATCC 700603), which produces the novel enzyme SHV-18. Antimicrob. Agents Chemother., 44: 2382-2388.
Robberts FJL, PC Kohner PC, Patel R (2009). Unreliable Extended-spectrum B-lactamase Detection in the Presence of
Plasmid-Mediated Ampc in Escherichia coli Clinical Isolates. J. Clin. Microbiol., 47: 358-361.
Rotimi VO, Jamal W, Pal T, Sovenned A, Albert MJ (2008). Emergence of CTX-M-1 5 type extended-spectrum beta-
lactamaseproducing Salmonella spp. in Kuwait and the United Arab Emirates. J. Med. Microbiol., 57: 881–886.
Sambrook J, Fritsch E F, Maniatis T (1989). In: Molecular Cloning: A
laboratory manual. Cold Spring Harbor Laboratory Press, NY, USA.

799
 Mahmood et al. 800

Su LH, Wu TL, Chia JH, Chu C, Kuo AJ, Chiu CH (2005). Increasing ceftriaxone resistance in Salmonella isolates from a
university hospital in Taiwan. J. Antimicrob. Chemother., 55: 846-852.
Threlfall EJ, Fisher IST, Berghold C, Gerner-Smidt P, Tschape H, Cormican M, Luzzi I, Schnieder F, Wannet W, Machado J,
Edwards G (2003). Trends in antimicrobial drug resistance in Salmonella enterica serotypes Typhi and Paratyphi A isolated
in Europe, 1999-2001. Int. J. Antimicrob. Agents., 22: 487-491.
Tzouvelekis LS, Lukova V, Tassios PT, Fluit AC, Jones RN, Legakis NJ (2003). Resistance to ß-lactams among blood
isolates of Salmonella spp. in European hospitals: results from the SENTRY Antimicrobial Surveillance Program 1997-98.
Clin. Microbiol. Infect., 9: 149-152.
Weill F X, Demartin M, Tande D, Espie E, Rakotoarivony I, Grimont PA (2004a). SHV-12-like extended-spectrum-beta-
lactamase-producing strains of Salmonella enterica serotypes Babelsberg and Enteritidis isolated in France among infants
adopted from Mali. J. Clin. Microbiol., 42: 2432-2437.
Weill FX, Perrier-Gros-Claude JD, Demartin M, Coignard S, Grimont PA (2004b). Characterization of extended-spectrum β -
lactamase (CTXM-15)-producing strains of Salmonella enterica isolated in France and Senegal. FEMS. Microbiol. Lett., 238:
353–358.
Winokur PL, Canton R, Casellas JM, Legakis NJ (2001). Variations in the prevalence of strains e xpressing an extended
spectrum β lactamase phenotype and characterization of isolates from Europe, the Americas and the Western Pacific region.
Clin. Infect. Dis., 32: S94–103.
Zaki SA, Karande S (2011). Multidrug-resistant typhoid fever: a review. J. Infect. Dev. Ctries, 5: 324-337.

800