Read Anytime Anywhere Easy Ebook Downloads at ebookmeta.

com

Ophthalmology Myron Yanoff Lead Editor Jay S Duker

Lead Editor

https://ebookmeta.com/product/ophthalmology-myron-yanoff-
lead-editor-jay-s-duker-lead-editor/

OR CLICK HERE

DOWLOAD EBOOK

Visit and Get More Ebook Downloads Instantly at https://ebookmeta.com

 Recommended digital products (PDF, EPUB, MOBI) that
you can download immediately if you are interested.

Ophthalmology Review 3rd Edition Myron Yanoff Uriel

Schechter Vincent B Lam

https://ebookmeta.com/product/ophthalmology-review-3rd-edition-myron-
yanoff-uriel-schechter-vincent-b-lam/

ebookmeta.com

Taking Love s Lead H L Day

https://ebookmeta.com/product/taking-love-s-lead-h-l-day/

ebookmeta.com

Male Lead 2 and Male Lead 3 Happy Ending 1st Edition

Unknown

https://ebookmeta.com/product/male-lead-2-and-male-lead-3-happy-
ending-1st-edition-unknown/

ebookmeta.com

UX Decoded: Think and Implement User-Centered Research

Methodologies, and Expert-Led UX Best Practices Dushyant
Kanungo
https://ebookmeta.com/product/ux-decoded-think-and-implement-user-
centered-research-methodologies-and-expert-led-ux-best-practices-
dushyant-kanungo/
ebookmeta.com
Buryoku Book 5 Fire 1st Edition Aaron Oster

https://ebookmeta.com/product/buryoku-book-5-fire-1st-edition-aaron-
oster/

ebookmeta.com

Wintertime Shimmer Quilt Table Runner 1st Edition Jennifer

Sampou

https://ebookmeta.com/product/wintertime-shimmer-quilt-table-
runner-1st-edition-jennifer-sampou/

ebookmeta.com

The Theory and Applications of Iteration Methods 2nd

Edition Argyros

https://ebookmeta.com/product/the-theory-and-applications-of-
iteration-methods-2nd-edition-argyros/

ebookmeta.com

Descendants 2: Uma's Wicked Book: For Villain Kids Disney

Books

https://ebookmeta.com/product/descendants-2-umas-wicked-book-for-
villain-kids-disney-books/

ebookmeta.com

Healing with DMSO 1st Edition Vollmer Amandha Dawn

https://ebookmeta.com/product/healing-with-dmso-1st-edition-vollmer-
amandha-dawn/

ebookmeta.com
Dragonflies and Damselflies: Model Organisms for
Ecological and Evolutionary Research 2nd Edition Alex
Cordoba-Aguilar
https://ebookmeta.com/product/dragonflies-and-damselflies-model-
organisms-for-ecological-and-evolutionary-research-2nd-edition-alex-
cordoba-aguilar/
ebookmeta.com
Ophthalmology
Ophthalmology
LEAD EDITORS FIFTH EDITION
Myron Yanoff, MD Jay S. Duker, MD
Chair Emeritus, Ophthalmology Director
Professor of Ophthalmology & Pathology New England Eye Center
Departments of Ophthalmology & Pathology Professor and Chairman
College of Medicine Department of Ophthalmology
Drexel University Tufts Medical Center
Philadelphia, PA, USA Tufts University School of Medicine
Boston, MA, USA

SECTION EDITORS
James J. Augsburger, MD Michael H. Goldstein, MD, MBA Alfredo A. Sadun, MD, PhD
Professor and Chairman Co-Director, Cornea and External Diseases Flora Thornton Chair, Doheny
Department of Ophthalmology Service Professor of Ophthalmology
University of Cincinnati College of Medicine New England Eye Center Vice-Chair of Ophthalmology, UCLA
Cincinnati, OH, USA Tufts Medical Center Los Angeles, CA, USA
Boston, MA, USA
Dimitri T. Azar, MD, MBA Joel S. Schuman, MD
Senior Director, Google Verily Life Sciences Narsing A. Rao, MD Professor and Chairman of Ophthalmology
Distinguished University Professor and B.A. Professor of Ophthalmology and Pathology Director, NYU Eye Center
Field Chair of Ophthalmic Research USC Roski Eye Institute Professor of Neuroscience and Physiology
Professor of Ophthalmology, Pharmacology, and Department of Ophthalmology Neuroscience Institute
Bioengineering University of Southern California NYU School of Medicine
University of Illinois at Chicago Los Angeles, CA, USA Professor of Electrical and Computer
Chicago, IL, USA Engineering
Shira L. Robbins, MD NYU Tandon School of Engineering
Sophie J. Bakri, MD Clinical Professor of Ophthalmology
Professor of Neural Science
Professor of Ophthalmology Ratner Children’s Eye Center at the Shiley Eye
Center for Neural Science, NYU
Vitreoretinal Diseases & Surgery Institute
New York, NY, USA
Mayo Clinic University of California San Diego
Rochester, MN, USA La Jolla, CA, USA Janey L. Wiggs, MD, PhD
Paul Austin Chandler Professor of
Scott E. Brodie, MD, PhD Emanuel S. Rosen, MD, FRCS, Ophthalmology
Professor of Ophthalmology FRCOphth Harvard Medical School
NYU School of Medicine Private Practice Boston, MA, USA
New York, NY, USA Case Reports Editor for Journal of Cataract &
Jonathan J. Dutton, MD, PhD Refractive Surgery
Professor Emeritus Manchester, UK
Department of Ophthalmology
University of North Carolina
Chapel Hill, NC, USA
For additional online content visit ExpertConsult.com

Edinburgh London New York Oxford Philadelphia St Louis Sydney 2019

© 2019, Elsevier Inc. All rights reserved.

First edition 1999

Second edition 2004
Third edition 2009
Fourth edition 2014

No part of this publication may be reproduced or transmitted in any form or by any means, electronic or
mechanical, including photocopying, recording, or any information storage and retrieval system, without
permission in writing from the publisher. Details on how to seek permission, further information about
the Publisher’s permissions policies and our arrangements with organizations such as the Copyright
Clearance Center and the Copyright Licensing Agency, can be found at our website: www.elsevier.com/
permissions.

This book and the individual contributions contained in it are protected under copyright by the Publisher
(other than as may be noted herein).

Chapter 4.29: “Endothelial Keratoplasty: Targeted Treatment for Corneal Endothelial Dysfunction” by
Marianne O. Price, Francis W. Price, Jr.
Marianne O. Price and Francis W. Price, Jr. retain copyright of the video accompanying this chapter.

Chapter 6.5: “Contact B-Scan Ultrasonography” by Yale L. Fisher, Dov B. Sebrow

Yale L. Fisher retains copyright of the video accompanying this chapter. The remainder of this lecture as
well as additional lectures on ophthalmology can be found at www.OphthalmicEdge.org.

Chapter 7.2: “Mechanisms of Uveitis” by Igal Gery, Chi-Chao Chan

This chapter is in the Public Domain.

Chapter 7.23: “Masquerade Syndromes: Neoplasms” by Nirali Bhatt, Chi-Chao Chan, H. Nida Sen
This chapter is in the Public Domain.

Chapter 11.8: “Torsional Strabismus” by Scott K. McClatchey, Linda R. Dagi

This chapter is in the Public Domain.

Chapter 12.16: “Aesthetic Fillers and Botulinum Toxin for Wrinkle Reduction” by Jean Carruthers,
Alastair Carruthers
Jean Carruthers retains copyright of Figures 12.16.1 & 12.16.6.

Notices

Practitioners and researchers must always rely on their own experience and knowledge in evaluating
and using any information, methods, compounds or experiments described herein. Because of
rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug
dosages should be made. To the fullest extent of the law, no responsibility is assumed by Elsevier,
authors, editors or contributors for any injury and/or damage to persons or property as a matter of
products liability, negligence or otherwise, or from any use or operation of any methods, products,
instructions, or ideas contained in the material herein.

ISBN: 978-0-323-52819-1
E-ISBN: 978-0-323-52821-4
ISBN: 978-0-323-52820-7

Content Strategist: Russell Gabbedy

Content Development Specialist: Sharon Nash
Content Coordinator: Joshua Mearns
Project Manager: Joanna Souch
Design: Brian Salisbury
Illustration Manager: Karen Giacomucci
Illustrator: Richard Tibbitts
Marketing Manager: Claire McKenzie

Printed in China

Last digit is the print number: 9 8 7 6 5 4 3 2 1

 User Guide

User Guide
COLOR CODING
Ophthalmology is organized into 12 parts, which are color-coded as follows
for quick and easy reference:

Part 1: Genetics

Part 2: Optics and Refraction

Part 3: Refractive Surgery

Part 4: Cornea and Ocular Surface Diseases

Part 5: The Lens

Part 6: Retina and Vitreous

Part 7: Uveitis and Other Intraocular Inflammations

Part 8: Intraocular Tumors

Part 9: Neuro-Ophthalmology

Part 10: Glaucoma

Part 11: Pediatric and Adult Strabismus

Part 12: Orbit and Oculoplastics

EXPERTCONSULT WEBSITE
n Full searchable text and downloadable image gallery
n Full reference lists for each chapter
n Additional online content including text, figures, & video clips

v
 Video Contents Video available at
Video Contents
ExpertConsult.com

Part 3: Refractive Surgery Chapter 6.25 Coats’ Disease and Retinal Telangiectasia
Chapter 3.4 LASIK 6.25.1 Pars Plana Vitrectomy and Subretinal Fluid and Exudate Drainage Performed
for a Severe Exudative Retinal Detachment
3.4.1 iLASIK
Chapter 6.32 Macular Hole
Chapter 3.5 Small Incision Lenticule Extraction (SMILE)
6.32.1 Macular Hole Surgery
3.5.1 SMILE Instructional Video
Chapter 6.33 Epiretinal Membrane
Chapter 3.7 Phakic Intraocular Lenses
6.33.1 Epiretinal Membrane Removal
3.7.1 Cachet Lens
3.7.2 Artisan/Verisyse Lens Implantation for Hyperopia After Radial Keratotomy Chapter 6.34 Vitreomacular Traction
3.7.3 Toric Artiflex Phakic Intraocular Lens in a Patient With High Myopia and
6.34.1 Vitreomacular Traction Syndrome
Astigmatism After Deep Anterior Lamellar Keratoplasty
3.7.4 Toric Artiflex Lens Implantation in a Patient With a Previous Intracorneal Chapter 6.39 Rhegmatogenous Retinal Detachment
Ring for Keratoconus 6.39.1 Internal Limiting Membrane (ILM) Peeling for Primary Rhegmatogenous
3.7.5 ICL Implantation Repair to Reduce Postoperative Macular Pucker
3.7.6 ICL Exchange
Chapter 6.41 Choroidal Hemorrhage
Part 4: Cornea and Ocular Surface Diseases 6.41.1 Transconjunctival Trocar/Cannula Drainage of Suprachoroidal Fluid
Chapter 4.17 Noninfectious Keratitis
Chapter 6.43 Posterior Segment Ocular Trauma
4.17.1 Patient With Lax Eyelids Recommended for Sleep Study
6.43.1 Intraocular Foreign Body Removal
Chapter 4.29 Endothelial Keratoplasty: Targeted Treatment for Corneal 6.43.2 Intraocular Foreign Body Removal With Rare Earth Magnet
Endothelial Dysfunction
Part 9: Neuro-Ophthalmology
4.29.1 DSEK Pull-Through
4.29.2 DMEK Donor Preparation Chapter 9.19 Nystagmus, Saccadic Intrusions, and Oscillations
4.29.3 Descemet’s Membrane Endothelial Keratoplasty (DMEK) 9.19.1 Congenital Nystagmus
9.19.2 Oculocutaneous Albinism With Associated Nystagmus
Part 5: The Lens 9.19.3 Latent Nystagmus
Chapter 5.8 Anesthesia for Cataract Surgery 9.19.4 Spasmus Nutans
5.8.1 Standard Technique for Sub-Tenon’s Anesthesia 9.19.5 Right Internuclear Ophthalmoplegia
5.8.2 “Incisionless” Technique for Sub-Tenon’s Anesthesia 9.19.6 Convergence Retraction Nystagmus in Parinaud’s Syndrome

Chapter 5.9 Phacoemulsification Part 10: Glaucoma

5.9.1 Two Examples of “Sculpting” Using Low Flow and Vacuum but Higher Chapter 10.7 Optic Nerve Analysis
Power/Amplitude 10.7.1 Three-Dimensional Imaging of the Optic Nerve Head
5.9.2 Two Examples of Using Higher Flow and Vacuum for Nucleus Fragment
Removal Chapter 10.28 Minimally Invasive and Microincisional Glaucoma Surgeries
Chapter 5.11 Small Incision and Femtosecond Laser-Assisted 10.28.1 iStent G1 Implantation
Cataract Surgery 10.28.2 Key Steps in Trabectome Surgery
5.11.1 Unexpected Subluxation Chapter 10.29 Trabeculectomy
5.11.2 Microincision Phaco 10.29.1 Bleb Leak Detection Using Concentrated Fluorescein Dye
5.11.3 Microincision Refractive Lens Exchange 10.29.2 Trabeculectomy With Mitomycin C
5.11.4 700µ Phaco 10.29.3 5-Fluorouracil Subconjunctival Injection
Chapter 5.13 Combined Procedures Chapter 10.32 Complications of Glaucoma Surgery and Their Management
5.13.1 Combined Phacoemulsification Cataract Surgery and Descemet’s Stripping 10.32.1 Small Pupil Cataract Surgery With Use of Pupil Expansion Ring (I-Ring;
Automated Endothelial Keratoplasty (DSAEK) Beaver Visitec, Waltham, MA) and Trypan Blue Capsular Staining
5.13.2 Combined Phacovitrectomy 10.32.2 Repair of Bleb Leak
Chapter 5.16 Complications of Cataract Surgery
Part 11: Pediatric and Adult Strabismus
5.16.1 Artisan Implantation
Chapter 11.3 Examination of Ocular Alignment and Eye Movements
Part 6: Retina and Vitreous 11.3.1 Strabismus Exam Elements
Chapter 6.3 Retinal and Choroidal Circulation 11.3.2 Cover/Uncover Test
11.3.3 Exotropia
6.3.1 Fluorescein and Indocyanine Green (ICG) Video Angiogram 11.3.4 Esotropia
Chapter 6.5 Contact B-Scan Ultrasonography 11.3.5 Hypertropia
11.3.6 Prism Alternate Cover Test
6.5.1 Examination Techniques for Contact B-Scan Ultrasonography
11.3.7 Simultaneous Prism Cover Test
Chapter 6.11 Scleral Buckling Surgery 11.3.8 Exophoria
11.3.9 Alternate or Cross Cover Test
6.11.1 Scleral Buckle
6.11.2 Suture Total running time approximately 2 hours and 34 minutes
6.11.3 Drain
Chapter 6.12 Vitrectomy
6.12.1 Vitrectomy for Nonclearing Vitreous Hemorrhage

vi
 Preface
Preface

It’s been 20 years since the first edition of Ophthalmology was published. Ophthalmology was never intended to be encyclopedic, but with each
We are delighted that our textbook now has gone to a fifth edition. The lon- edition we strived to make it quite comprehensive, readable, and easy to
gevity of this title reflects the uniqueness and utility of its format; the hard access. Like the fourth edition, this edition is thoroughly revised, with new
work of our authors, editors, and publishers; and the pressing need in our section editors and many new authors. Chapters have been rewritten and
field for updated, clinically relevant information. We continue to recognize restricted to reflect the new way diseases are diagnosed, categorized, and
the advantage of a complete textbook of ophthalmology in a single volume treated. We have discarded out-of-date material and have added numerous
rather than multiple volumes. The basic visual science is admixed with new items. Extra references and other material have been moved online to
clinical information throughout, and we have maintained an entire sepa- keep the book itself as one volume.
rate section dedicated to genetics and the eye.

xii
 Preface to First Edition

Preface to First Edition

Over the past 30 years, enormous technologic advances have occurred in To achieve the same continuity of presentation in the figures as well
many different areas of medicine—lasers, molecular genetics, and immu- as in the text, all of the artworks have been redesigned from the authors’
nology to name a few. This progress has fueled similar advances in almost originals, maximizing their accessibility for the reader. Each section is
every aspect of ophthalmic practice. The assimilation and integration of color coded for easy cross-referencing and navigation through the book.
so much new information makes narrower and more focused ophthalmic Despite the extensive use of color in artworks and photographs through-
practices a necessity. As a direct consequence, many subspecialty textbooks out, the cost of this comprehensive book has been kept to a fraction of the
with extremely narrow focus are now available, covering every aspect of multivolume sets. We hope to make this volume more accessible to more
ophthalmic practice. Concurrently, several excellent multivolume textbooks practitioners throughout the world.
detailing all aspects of ophthalmic practice have been developed. Yet there Although comprehensive, Ophthalmology is not intended to be encyclo-
remains a need for a complete single-volume textbook of ophthalmology pedic. In particular, in dealing with surgery, we do not stress specific tech-
for trainees, nonophthalmologists, and those general ophthalmologists niques or describe rarer ones in meticulous detail. The rapidly changing
(and perhaps specialists) who need an update in specific areas in which nature of surgical aspects of ophthalmic practice is such that the reader
they do not have expertise. Ophthalmology was created to fill this void will need to refer to one or more of the plethora of excellent books that
between the multivolume and narrow subspecialty book. cover specific current techniques in depth. We concentrate instead on
This book is an entirely new, comprehensive, clinically relevant, sin- the areas that are less volatile but, nevertheless, vital surgical indications,
gle-volume textbook of ophthalmology, with a new approach to content and general principles of surgical technique, and complications. The approach
presentation that allows the reader to access key information quickly. Our to referencing is parallel to this: For every topic, all the key references are
approach, from the outset, has been to use templates to maintain a uniform listed, but with the aim of avoiding pages of redundant references where a
chapter structure throughout the book so that the material is presented in smaller number of recent classic reviews will suffice. The overall emphasis
a logical, consistent manner, without repetition. The majority of chapters of Ophthalmology is current information that is relevant to clinical practice
in the book follow one of three templates: the disease-oriented template, superimposed on the broad framework that comprises ophthalmology as
the surgical procedure template, or the diagnostic testing template. Metic- a subspecialty.
ulous planning went into the content, sectioning, and chapter organization Essential to the realization of this ambitious project is the ream of
of the book, with the aim of presenting ophthalmology as it is practiced, Section Editors, each bringing unique insight and expertise to the book.
rather than as a collection of artificially divided aspects. Thus, pediatric They have coordinated their efforts in shaping the contents list, finding
ophthalmology is not in a separate section but is integrated into relevant contributors, and editing chapters to produce a book that we hope will
sections across the book. The basic visual science and clinical information, make a great contribution to ophthalmology.
including systemic manifestations, is integrated throughout, with only two We are grateful to the editors and authors who have contributed to
exceptions. We dedicated an entire section to genetics and the eye, in rec- Ophthalmology and to the superb, dedicated team at Mosby.
ognition of the increasing importance of genetics in ophthalmology. Optics Myron Yanoff
and refraction are included in a single section as well because an under- Jay S. Duker
standing of these subjects is fundamental to all of ophthalmology. July 1998

xiii
 List of Contributors
List of Contributors

The editor(s) would like to acknowledge and offer grateful thanks for the input of all previous editions’ contributors, without whom this new edition
would not have been possible.

Erika C. Acera, OC(C) Ferhina S. Ali, MD, MPH Steve A. Arshinoff, MD, FRCSC Nicole Balducci, MD
Clinical Orthoptist Vitreoretinal Surgery Fellow Associate Professor Consultant
Department of Ophthalmology Wills Eye Hospital University of Toronto Ophthalmology Division
Anne F. and Abraham Ratner Retina Service Department of Ophthalmology and Studio Oculistico d’Azeglio
Children’s Eye Center Mid Atlantic Retina Visual Sciences Bologna, Italy
Shiley Eye Institute Philadelphia, PA, USA Toronto, ON, Canada
University of California San Diego Piero Barboni, MD
La Jolla, CA, USA Jorge L. Alió, MD, PhD Penny A. Asbell, MD, FACS, FARVO Consultant
Professor of Ophthalmology Professor of Ophthalmology Neuro-Ophthalmology
Natalie A. Afshari, MD Miguel Hernandez University, Vissum Icahn School of Medicine at Mount Scientific Institute San Raffaele
Stuart I. Brown MD Chair in Alicante, Spain Sinai Milan, Italy
Ophthalmology in Memory of New York, NY, USA Studio Oculistico d’Azeglio
Donald P. Shiley Norma Allemann, MD Bologna, Italy
Professor of Ophthalmology Adjunct Professor Kerry K. Assil, MD
Chief of Cornea and Refractive Surgery Department of Ophthalmology and Corneal, Cataract and Refractive Cullen J. Barnett, COT, CRA, OCT-C,
Vice Chair of Education Visual Sciences Surgeon CDOS
Shiley Eye Institute University of Illinois at Chicago Medical Director Clinical Supervisor of Ophthalmology
University of California San Diego Chicago, IL, USA The Assil Eye Institute Roski Eye Institute
La Jolla, CA, USA Adjunct Professor Beverly Hills, CA, USA Keck Medicine USC
Department of Ophthalmology and Los Angeles, CA, USA
Anita Agarwal, MD Visual Sciences Neal H. Atebara, MD, FACS
Adjoint Professor of Ophthalmology Escola Paulista de Medicina (EPM) Associate Professor Soumyava Basu, MS
Vanderbilt Eye Institute Universidade Federal de São Paulo Department of Surgery Head of Uveitis Services
West Coast Retina (UNIFESP) University of Hawaii LVPEI Network
Vanderbilt University Medical Center São Paulo, SP, Brazil John A. Burns School of Medicine L V Prasad Eye Institute
San Francisco, CA, USA Honolulu, HI, USA Bhubaneswar, Odisha, India
David Allen, BSc, MB, BS, FRCS,
Joshua S. Agranat, MD FRCOphth James J. Augsburger, MD Priti Batta, MD
Resident Physician Consultant Ophthalmologist (Cataract) Professor of Ophthalmology Assistant Professor of Ophthalmology
Department of Ophthalmology Cataract Treatment Centre Dr. E. Vernon & Eloise C. Smith Chair Director of Medical Student Education
Massachusetts Eye and Ear Sunderland Eye Infirmary of Ophthalmology New York Eye and Ear Infirmary of
Harvard Medical School Sunderland, Tyne & Wear, UK College of Medicine, University of Mount Sinai
Boston, MA, USA Cincinnati New York, NY, USA
Keith G. Allman, MBChB, MD, FRCA Founding Director, Ocular Oncology &
Radwan S. Ajlan, MBBCh, FRCS(C), Consultant Anaesthetist Diagnostic Ultrasonography Service, Caroline R. Baumal, MD, FRCSC
FICO, DABO West of England Eye Unit University of Cincinnati Medical Associate Professor of Ophthalmology
Assistant Professor Royal Devon and Exeter NHS Trust Center Director ROP Service
Retina and Vitreous Exeter, Devon, UK Attending Surgeon, University of Vitreoretinal Surgery
Department of Ophthalmology Cincinnati Medical Center New England Eye Center
University of Kansas School of Nishat P. Alvi, MD Consulting Surgeon, Cincinnati Tufts University
Medicine Medical Director of Ophthalmology Children’s Hospital Medical Center School of Medicine
Kansas City, KS, USA The Vision Institute of Illinois Cincinnati, OH, USA Boston, MA, USA
Elgin, IL, USA
Anam Akhlaq, MBBS G. William Aylward, FRCS, FRCOphth, Srilaxmi Bearelly, MD, MHS
Postdoctoral Fellow Leonard P.K. Ang, MBBS, MD, FRCS, MD Assistant Professor of Ophthalmology
Center for Translational Ocular MRCOphth, MMed, FAMS Consultant Ophthalmologist Ophthalmology
Immunology Associate Professor of Ophthalmology London, UK Columbia University Medical Center
Department of Ophthalmology Medical Director, Lang Eye Centre New York, NY, USA
Tufts Medical Center Singapore Dimitri T. Azar, MD, MBA
Senior Director, Google Verily Life Jesse L. Berry, MD
Boston, MA, USA David J. Apple, MD †
Associate Director, Ocular Oncology
Sciences
Thomas A. Albini, MD Formerly Professor of Ophthalmology Distinguished University Professor Service
Associate Professor of Ophthalmology and Pathology and B.A. Field Chair of Ophthalmic Associate Residency Program Director
Department of Ophthalmology Director, Laboratories for Ophthalmic Research for Ophthalmology
Bascom Palmer Eye Institute Devices Research Professor of Ophthalmology, USC Roski Eye Institute
University of Miami John A. Moran Eye Center Pharmacology, and Bioengineering Keck School of Medicine, University of
Miami, FL, USA University of Utah University of Illinois at Chicago Illinois Southern California
Salt Lake City, UT, USA College of Medicine Attending Surgeon, Children’s Hospital
Ahmed Al-Ghoul, MD, MBA, FRCSC, Chicago, IL, USA of Los Angeles
DipABO Maria Cecilia D. Aquino, MD, MMED, Los Angeles, CA, USA
Clinical Lecturer (Ophthalmology) Sophie J. Bakri, MD
Division of Ophthalmology Resident Physician II Professor of Ophthalmology Angela P. Bessette, MD
Department of Surgery Ophthalmology/Glaucoma Vitreoretinal Diseases & Surgery Assistant Professor
University of Calgary National University Hospital Mayo Clinic Department of Ophthalmology
Calgary, AB, Canada National University Health System Rochester, MN, USA Flaum Eye Institute
Singapore University of Rochester
Laura J. Balcer, MD, MSCE Rochester, NY, USA
Anthony C. Arnold, MD Professor of Neurology
Professor and Chief Vice-Chair, Neurology
Neuro-Ophthalmology Division New York University
xiv UCLA Stein Eye Institute
Los Angeles, CA, USA
School of Medicine
†
Deceased New York, NY, USA
Nirali Bhatt, MD Igor I. Bussel, MS, MHA Chi-Chao Chan, MD Abbot (Abe) Clark, PhD, FARVO
Assistant Professor Doris Duke Clinical Research Fellow Scientist Emeritus Regents Professor of Pharmacology

List of Contributors
Department of Ophthalmology Department of Ophthalmology Laboratory of Immunology and Neuroscience
University of Pennsylvania University of Pittsburgh School of National Eye Institute Executive Director, North Texas Eye
Perelman School of Medicine Medicine National Institutes of Health Research Institute
Philadelphia, PA, USA Pittsburgh, PA, USA Bethesda, MD, USA University of North Texas Health
Visiting Professor Science Center
Orry C. Birdsong, MD Louis B. Cantor, MD Zhongshan Ophthalmic Center Fort Worth, TX, USA
Clinical Fellow Jay C. and Lucile L. Kahn Professor Sun Yat-Sen University
Ophthalmology and Chair China Jonathan C.K. Clarke, MD, FRCOphth
Hoopes Vision Department of Ophthalmology Consultant Ophthalmologist
Draper, UT, USA Indiana University Melinda Y. Chang, MD NIHR Moorfields Biomedical Research
School of Medicine Assistant Professor of Ophthalmology Centre
Jyotirmay Biswas, MS, FMRF, FNAMS, Indianapolis, IN, USA USC Roski Eye Institute and Children’s Moorfields Eye Hospital
FIC, Path, FAICO Hospital Los Angeles UCL Institute of Ophthalmology
Director Hilda Capó, MD Keck School of Medicine of the London, UK
Uveitis and Ocular Pathology Professor of Clinical Ophthalmology University of Southern California
Department Bascom Palmer Eye Institute Los Angeles, CA, USA François Codère, MD
Sankara Nethralaya Division Chief Pediatric Associate Professor
Chennai, Tamil Nadu, India Ophthalmology and Adult Stanley Chang, MD Ophthalmology/Oculoplastic and
Strabismus KK Tse and KT Ying Professor of Orbital Surgery Section
Bahram Bodaghi, MD, PhD, FEBOphth Miller School of Medicine Ophthalmology Université de Montréal
Professor of Ophthalmology John T. Flynn Professor of Department of Ophthalmology Montréal, QC, Canada
DHU ViewRestore Ophthalmology Chair Columbia University
APHP, UPMC, Sorbonne University University of Miami New York, NY, USA Ian P. Conner, MD, PhD
Paris, France Miami, FL, USA Assistant Professor
Victoria S. Chang, MD Ophthalmology
Swaraj Bose, MD Antonio Capone, Jr., MD Assistant Professor of Clinical UPMC Eye Center
Associate Professor of Ophthalmology Professor Ophthalmology Pittsburgh, PA, USA
UCI and Attending Physician Department of Ophthalmology Ophthalmology, Cornea and External
Cedars Sinai Medical Center Oakland University Disease Peter Coombs, MD
Los Angeles, CA, USA William Beaumont Hospital Bascom Palmer Eye Institute Vitreoretinal Physician and Surgeon
School of Medicine University of Miami Utah Eye Centers
Charles S. Bouchard, MD, MA Salt Lake City, UT, USA
Professor and Chairman of Auburn HIlls, MI, USA Naples, FL, USA
Ophthalmology Alastair Carruthers, MA, BM, BCh, David G. Charteris, MD, FRCS(Ed), Zélia M. Corrêa, MD, PhD
Loyola University Health System FRCP(Lon), FRCPC FRCOphth Tom Clancy Endowed Professor of
Maywood, IL, USA Clinical Professor Professor Ophthalmology
Department of Dermatology and Skin Vitreoretinal Unit Head of Ocular Oncology and
Michael E. Boulton, PhD Echography
Susan and Dowd Ritter/RPB Endowed Science Moorfields Eye Hospital
University of British Columbia London, UK Retina Service, Wilmer Eye Institute
Chair of Ophthalmology Johns Hopkins University School of
University of Alabama Birmingham Vancouver, BC, Canada
Soon-Phaik Chee, MD Medicine
Birmingham, AL, USA Jean Carruthers, MD, FRCSC, Professor Baltimore, MD, USA
James D. Brandt, MD FRC(OPHTH) Cataract Service, Ocular Inflammation
Clinical Professor & Immunology Service Steven M. Couch, MD, FACS
Professor Assistant Professor
Department of Ophthalmology & Department of Ophthalmology Singapore National Eye Centre
University of British Columbia Singapore Department of Ophthalmology &
Vision Science Visual Sciences
Vice-Chair for International Programs Fellow
American Society for Ophthalmic John J. Chen, MD, PhD Washington University in St Louis
and New Techology Assistant Professor St Louis, MO, USA
Director - Glaucoma Service Plastic and Reconstructive Surgery
Vancouver, BC, Canada Department of Ophthalmology and
University of California Davis Neurology Stuart G. Coupland, PhD
Sacramento, CA, USA Keith D. Carter, MD, FACS Mayo Clinic Associate Professor
Lillian C. O’Brien and Dr. C.S. O’Brien Rochester, MN, USA Department of Ophthalmology
Scott E. Brodie, MD, PhD University of Ottawa
Professor of Ophthalmology Chair in Ophthalmology
Professor and Chair Xuejing Chen, MD, MS Ottawa, ON, Canada
NYU School of Medicine Clinical Fellow
New York, NY, USA Department of Ophthalmology & Claude L. Cowan, Jr., MD, MPH
Visual Sciences Retina
Ophthalmic Consultants of Boston Clinical Professor of Ophthalmology
Michael C. Brodsky, MD Carver College of Medicine Georgetown University Medical Center
Professor of Ophthalmology and University of Iowa New England Eye Center at Tufts
Medical Center Washington, DC, USA
Neurology Iowa City, IA, USA Staff Physician
Knights Templar Research Professor of Boston, MA, USA
Rafael C. Caruso, MD Surgical Service
Ophthalmology Paul T.K. Chew, MMed, FRCOphth Veterans Affairs Medical Center
Mayo Clinic Staff Clinician
National Eye Institute Director Glaucoma Division Washington, DC, USA
Rochester, MN, USA Ophthalmology/Glaucoma
National Institutes of Health E. Randy Craven, MD
Cassandra C. Brooks, MD Bethesda, MD, USA National University Hospital Singapore
Singapore Associate Professor, Glaucoma
Resident in Ophthalmology Johns Hopkins University
Duke Eye Center Harinderpal S. Chahal, MD
Oculofacial Plastic and Reconstructive Bing Chiu, MD Baltimore, MD, USA
Duke University School of Medicine Ophthalmology Resident
Durham, NC, USA Surgery Catherine A. Cukras, MD, PhD
Eye Medical Center New York University
New York, NY, USA Director, Medical Retina Fellowship
Matthew V. Brumm, MD Fresno, CA, USA Program
Ophthalmologist Clement C. Chow, MD National Eye Institute
Cataract and Refractive Surgery Wallace Chamon, MD
Adjunct Professor Partner Physician National Institutes of Health
Brumm Eye Center Retinal Diagnostic Center Bethesda, MD, USA
Omaha, NE, USA Department of Ophthalmology and
Visual Sciences Campbell, CA, USA
Linda R. Dagi, MD
Donald L. Budenz, MD, MPH University of Illinois at Chicago Mortimer M. Civan, MD Director of Adult Strabismus
Kittner Family Distinguished Professor Chicago, IL, USA Professor of Physiology and Professor Boston Children’s Hospital
and Chairman Adjunct Professor of Medicine Associate Professor of Ophthalmology
Department of Ophthalmology Department of Ophthalmology and Department of Physiology Director of Quality Assurance
University of North Carolina at Chapel Visual Sciences University of Pennsylvania Department of Ophthalmology
Hill Escola Paulista de Medicina (EPM) Perelman School of Medicine Children’s Hospital Ophthalmology
Chapel Hill, NC, USA Universidade Federal de São Paulo Philadelphia, PA, USA Foundation Chair
(UNIFESP) Harvard Medical School
São Paulo, SP, Brazil Boston, MA, USA
xv
 Elie Dahan, MD, MMed, (Ophth)† Gary R. Diamond, MD† Bryan Edgington, MD Ayad A. Farjo, MD
Formerly Senior Consultant Pediatric Formerly Professor of Ophthalmology Associate Professor, Cornea Division President & Director
List of Contributors
Ophthalmology and Glaucoma and Pediatrics Casey Eye Institute Brighton Vision Center
Department of Ophthalmology Drexel University School of Medicine Oregon Health Sciences University Brighton, MI, USA
Ein Tal Eye Hospital Philadelphia, PA, USA Staff Ophthalmologist
Tel Aviv, Israel Veterans Health Administration Eric Feinstein, MD
Daniel Diniz, MD Portland Health Care System Surgical Retina Fellow
Iben Bach Damgaard, MD Surgical Optics Fellow Portland, OR, USA Department of Ophthalmology
PhD Fellow Department of Ophthalmology & Rocky Mountain Lions Eye Institute
Department of Ophthalmology Visual Sciences Howard M. Eggers, MD University of Colorado
Aarhus University Hospital Federal University of São Paulo Professor of Clinical Ophthalmology School of Medicine
Aarhus, Denmark (UNIFESP) Harkness Eye Institute Denver, CO, USA
São Paulo, SP, Brazil New York, NY, USA
Karim F. Damji, MD, FRCSC, MBA Karen B. Fernandez, MD
Professor Diana V. Do, MD Dean Eliott, MD Consultant
Department of Ophthalmology & Professor of Ophthalmology Stelios Evangelos Gragoudas Associate Department of Ophthalmology
Visual Sciences Byers Eye Institute Professor of Ophthalmology The Medical City
University of Alberta Stanford University Harvard Medical School Pasig City, Metro Manila, Philippines
Edmonton, AL, Canada School of Medicine Associate Director, Retina Service
Palo Alto, CA, USA Massachusetts Eye & Ear Yale L. Fisher, MD
Dipankar Das, MD Boston, MA, USA Voluntary Clinical Professor
Senior Consultant & Ocular Pathologist Peter J. Dolman, MD, FRCSC Department of Ophthalmology
Uveitis, Ocular Pathology and Neuro- Clinical Professor George S. Ellis, Jr., MD, FAAP, FAAO, Bascom Palmer Eye Institute
ophthalmology Services Division Head of Oculoplastics and FACS Miami, FL, USA
Sri Sankaradeva Nethralaya Orbital Surgery Director Ophthalmology Voluntary Clinical Professor
Guwahati, Assam, India Fellowship Director Children’s Hospital New Orleans Department of Ophthalmology
Department of Ophthalmology & Associate Clinical Professor of Weill Cornell Medical Center
Adam DeBusk, DO, MS Visual Sciences Ophthalmology and Pediatrics New York, NY, USA
Instructor Division of Oculoplastics and Orbit Tulane University
Department of Ophthalmology University of British Columbia Associate Clinical Professor of Gerald A. Fishman, MD
Wills Eye Hospital Vancouver General Hospital Ophthalmology and Pediatrics Director
Sidney Kimmel Medical College Vancouver, BC, Canada Louisiana State Universities Schools of The Pangere Center for Inherited
Thomas Jefferson University Medicine Retinal Diseases
Philadelphia, PA, USA Sean P. Donahue, MD, PhD New Orleans, LA, USA The Chicago Lighthouse
Professor Professor Emeritus of Ophthalmology
Jose de la Cruz, MD, MSc Department of Ophthalmology & Michael Engelbert, MD, PhD Department of Ophthalmology &
Assistant Professor Visual Sciences Research Assistant Professor Visual Sciences
Ophthalmology, Cornea Refractive Vanderbilt University Department of Ophthalmology University of Illinois at Chicago
Surgery Service Nashville, TN, USA NYU/VRMNY College of Medicine
University of Illinois Eye and Ear New York, NY, USA Chicago, IL, USA
Infirmary Richard K. Dortzbach, MD
Chicago, IL, USA Professor Emeritus Miriam Englander, MD Jorge A. Fortun, MD
Department of Ophthalmology and Attending Surgeon Associate Professor of Ophthalmology
Joseph L. Demer, MD, PhD Visual Sciences Vitreo-Retinal Surgery Vitreoretinal Diseases and Surgery
Arthur L. Rosenbaum Chair in University of Wisconsin Ophthalmic Consultants of Boston Medical Director of Bascom Palmer
Pediatric Ophthalmology School of Medicine and Public Health Boston, MA, USA Eye Institute
Professor of Neurology Madison, WI, USA Palm Beach Gardens Bascom Palmer
Chief, Pediatric Ophthalmology and Bita Esmaeli, MD, FACS Eye Institute
Strabismus Division Kimberly A. Drenser, MD, PhD Professor of Ophthalmology University of Miami Miller School of
Director, Ocular Motility Laboratories Associated Retinal Consultants, PC Director, Ophthalmic Plastic & Medicine
Chair, EyeSTAR Residency/PhD and Department of Ophthalmology Reconstructive Surgery Fellowship Miami, FL, USA
Post-doctoral Fellowship Program in Oakland University Program, Department of Plastic
Ophthalmology and Visual Science William Beaumont Hospital School of Surgery Veronica Vargas Fragoso, MD
Member, Neuroscience Medicine Chair, Graduate Medical Education Refractive Surgery Fellow
Interdepartmental Program Royal Oak, MI, USA Committee Vissum Corporation
Member, Bioengineering University of Texas MD Anderson Alicante, Spain
Interdepartmental Program Jacob S. Duker, MD Cancer Center
University of California Los Angeles Resident Physician Houston, TX, USA Nicola Freeman, MBChB, FCOphth,
Los Angeles, CA, USA Department of Ophthalmology MMed
Bascom Palmer Eye Institute Joshua W. Evans, MD Senior Specialist
Shilpa J. Desai, MD University of Miami Assistant Professor of Ophthalmology Department of Pediatric
Assistant Professor Miami, FL, USA Division of Glaucoma Ophthalmology
Department of Ophthalmology University of Kentucky Red Cross Children’s Hospital
Tufts University Jay S. Duker, MD Lexington, KY, USA Cape Town, Western Province, South
School of Medicine Director Africa
Boston, MA, USA New England Eye Center Monica Evans, MD
Professor and Chairman Ophthalmology David S. Friedman, MD, MPH, PhD
Deepinder K. Dhaliwal, MD, L.Ac Department of Ophthalmology San Jose, Costa Rica Director, Dana Center for Preventive
Professor of Ophthalmology, University Tufts Medical Center Ophthalmology
of Pittsburgh School of Medicine Tufts University School of Medicine Daoud S. Fahd, MD Professor of Ophthalmology, Wilmer/
Director, Cornea and Refractive Boston, MA, USA Clinical Assistant Professor Glaucoma
Surgery Services Department of Ophthalmology Johns Hopkins University
Director and Founder, Center for Vikram D. Durairaj, MD, FACS Ophthalmic Consultants of Beirut Baltimore, MD, USA
Integrative Eye Care ASOPRS Fellowship Director and Jal el Dib, Metn, Lebanon
Co-Director, Cornea and Refractive Managing Partner Deborah I. Friedman, MD, MPH
Oculoplastic and Orbital Surgery Lisa J. Faia, MD Professor
Surgery Fellowship Partner, Associated Retinal Consultants
Associate Medical Director, Charles TOC Eye and Face Department of Neurology
Austin, TX, USA Associate Professor & Neurotherapeutics and
T. Campbell Ocular Microbiology Oakland University
Laboratory Ophthalmology
Jonathan J. Dutton, MD, PhD William Beaumont School of Medicine University of Texas
Medical Director, UPMC Laser Vision Professor Emeritus Ophthalmology - Retina
Center Southwestern Medical Center
Department of Ophthalmology Royal Oak, MI, USA Dallas, TX, USA
University of Pittsburgh Medical University of North Carolina
Center Chapel Hill, NC, USA Katherine A. Fallano, MD Neil J. Friedman, MD
Pittsburgh, PA, USA Department of Ophthalmology Adjunct Clinical Associate Professor
University of Pittsburgh School of Department of Ophthalmology
Medicine Stanford University School of Medicine
Pittsburgh, PA, USA
xvi †
Stanford, CA, USA
Deceased
Nicoletta Fynn-Thompson, MD Jeffrey L. Goldberg, MD, PhD Jason R. Guercio, MD, MBA Joshua H. Hou, MD
Partner Professor and Chairman Senior Resident in Anesthesiology Assistant Professor

List of Contributors
Cornea, Cataract and Refractive Surgery Department of Ophthalmology Department of Anesthesiology Department of Ophthalmology &
Ophthalmic Consultants of Boston Byers Eye Institute at Stanford Duke University Medical Center Visual Neurosciences
Boston, MA, USA University Durham, NC, USA University of Minnesota
Palo Alto, CA, USA Minneapolis, MN, USA
Neha Gadaria-Rathod, MD Julie Gueudry, MD
Assistant Clinical Instructor Debra A. Goldstein, MD, FRCSC Senior Consultant Odette M. Houghton, MD
Department of Ophthalmology Magerstadt Professor of Ophthalmology Senior Associate Consultant
SUNY Downstate Medical Center Ophthalmology Charles Nicolle University Hospital Ophthalmology
New York, NY, USA Director Uveitis Service Rouen, France Mayo Clinic
Northwestern University Scottsdale, AZ, USA
Debora E. Garcia-Zalisnak, MD Feinberg School of Medicine Ahmet Kaan Gündüz, MD
Cornea Fellow Chicago, IL, USA Professor of Ophthalmology Kourtney Houser, MD
Department of Ophthalmology Ankara University Assistant Professor
University of Illinois at Chicago Michael H. Goldstein, MD, MBA Faculty of Medicine Ophthalmology
Chicago, IL, USA Co-Director, Cornea and External Ankara, Turkey University of Tennessee
Diseases Service Health Science Center
Gregg S. Gayre, MD New England Eye Center Joelle A. Hallak, PhD Memphis, TN, USA
Chief of Eye Care Services Tufts Medical Center Assistant Professor, Executive Director
Department of Ophthalmology Boston, MA, USA Ophthalmic Clinical Trials & Frank W. Howes, MBChB, MMed, FCS,
Kaiser Permanente Translational Center FRCS, FRCOphth, FRANZCO
San Rafael, CA, USA John A. Gonzales, MD Department of Ophthalmology & Associate Professor
Assistant Professor Visual Sciences Bond University
Steven J. Gedde, MD Francis I. Proctor Foundation and University of Illinois at Chicago Company and Clinical Director
Professor of Ophthalmology, John Department of Ophthalmology Chicago, IL, USA Cataract Refractive & Glaucoma
G. Clarkson Chair, Vice Chair of University of California San Francisco Surgery
Education San Francisco, CA, USA Julia A. Haller, MD Eye & Laser Centre
Bascom Palmer Eye Institute Ophthalmologist-in-Chief, Wills Eye Gold Coast, QLD, Australia
University of Miami Miller David B. Granet, MD, FACS, FAAp Hospital
School of Medicine Anne F. Ratner Chair of Pediatric William Tasman, MD Endowed Chair Jason Hsu, MD
Miami, FL, USA Ophthalmology Professor and Chair of Ophthalmology Co-Director of Retina Research
Professor of Ophthalmology & Sidney Kimmel Medical College at Retina Service of Wills Eye Hospital
Igal Gery, PhD Pediatrics Thomas Jefferson University Associate Professor of Ophthalmology
Scientist Emerita Director of the Ratner Children’s Eye Philadelphia, PA, USA Thomas Jefferson University
Laboratory of Immunology Center at the Shiley Eye Institute Mid Atlantic Retina
National Eye Institute University of California San Diego Pedram Hamrah, MD, FACS Philadelphia, PA, USA
National Institutes of Health La Jolla, CA, USA Director of Clinical Research
Bethesda, MD, USA Director, Center for Translational Jeffrey J. Hurwitz, MD, FRCS(C)
Matthew J. Gray, MD Ocular Immunology Professsor, Ophthalmology
Ramon C. Ghanem, MD, PhD Assistant Professor Cornea and Associate Professor, Ophthalmology University of Toronto
Director External Disease Tufts Medical Center Oculoplastic Specialist
Cornea and Refractive Surgery Department of Ophthalmology Tufts University Mount Sinai Hospital
Department University of Florida School of Medicine Toronto, ON, Canada
Sadalla Amin Ghanem Eye Hospital Gainesville, FL, USA Boston, MA, USA
Joinville, SC, Brazil Francisco Irochima, PhD
Kyle M. Green, BA David R. Hardten, MD Professor, Biotechnology
Vinícius C. Ghanem, MD, PhD Medical Student Researcher Director of Refractive Surgery Universidade Potiguar
Ophthalmologist, Medical Director Ophthalmology Department of Ophthalmology Natal, Rio Grande do Norte, Brazil
Department of Ophthalmology University of Southern California Minnesota Eye Consultants
Sadalla Amin Ghanem Eye Hospital Roski Eye Institute Minnetonka, MN, USA Jihad Isteitiya, MD
Joinville, SC, Brazil Los Angeles, CA, USA Cornea Fellow, Ophthalmology
Alon Harris, MS, PhD, FARVO Icahn School of Medicine at Mount
Saurabh Ghosh, MBBS, DipOphth, Craig M. Greven, MD Professor of Ophthalmology Sinai
MRCOphth, FRCOphth Richard G. Weaver Professor and Letzter Endowed Chair in New York, NY, USA
Consultant Ophthalmologist Chairman Ophthalmology
Cornea, Cataract, External Eye Disease Department of Ophthalmology Director of Clinical Research Andrea M. Izak, MD
Sunderland Eye Infirmary Wake Forest University Eugene and Marilyn Glick Eye Institute Post-Doctoral Fellow
Sunderland, Tyne & Wear, UK School of Medicine Indiana University Storm Eye Institute
Winston-Salem, NC, USA School of Medicine Medical University of South Carolina
Allister Gibbons, MD Charleston, SC, USA
Assistant Professor Indianapolis, IN, USA
Margaret A. Greven, MD
Bascom Palmer Eye Institute Assistant Professor Jeffrey S. Heier, MD Deborah S. Jacobs, MD
University of Miami Ophthalmology Co-President and Medical Director Associate Professor of Ophthalmology
Miami, FL, USA Wake Forest University Director, Vitreoretinal Service Harvard Medical School
School of Medicine Ophthalmic Consultants of Boston Medical Director
James W. Gigantelli, MD, FACS BostonSight
Professor Winston-Salem, NC, USA Boston, MA, USA
Needham, MA, USA
Department Ophthalmology & Visual Josh C. Gross, MD Leon W. Herndon, Jr., MD
Sciences Clinical Research Fellow Professor, Ophthalmology Sandeep Jain, MD
University of Nebraska Medical Center Ophthalmology Duke University Eye Center Associate Professor, Ophthalmology
Omaha, NE, USA Eugene and Marilyn Glick Eye Institute Durham, NC, USA University of Illinois at Chicago
Indiana School of Medicine Chicago, IL, USA
Pushpanjali Giri, BA Allen C. Ho, MD
Research Specialist Indianapolis, IN, USA Henry D. Jampel, MD, MHS
Wills Eye Hospital Director of Retina
Department of Ophthalmology Ronald L. Gross, MD Research Odd Fellows Professor of
University of Illinois at Chicago Professor and Jane McDermott Schott Retina Service Ophthalmology
College of Medicine Chair Wills Eye Hospital Wilmer Eye Institute
Chicago, IL, USA Chairman, Department of Philadelphia, PA, USA Johns Hopkins University
Ophthalmology School of Medicine
Ivan Goldberg, AM, MB, BS, FRANZCO, Christopher T. Hood, MD Baltimore, MD, USA
FRACS West Virginia University
Morgantown, WV, USA Clinical Assistant Professor
Clinical Professor Michigan Medicine Ophthalmology Lee M. Jampol, MD
University of Sydney Sandeep Grover, MD Cornea and Refractive Surgery Clinic Louis Feinberg Professor of
Head of Discipline of Ophthalmology Associate Professor & Associate Chair W.K. Kellogg Eye Center Ophthalmology
and Glaucoma Unit of Ophthalmology Ann Arbor, MI, USA Feinberg School of Medicine
Sydney Eye Hospital University of Florida Northwestern University
Director Jacksonville, FL, USA Chicago, IL, USA
Eye Associates xvii
Sydney, NSW, Australia
 Aliza Jap, FRCS(G), FRCOphth, FRCS Kevin Kaplowitz, MD Jeremy D. Keenan, MD, MPH Victor T.C. Koh, MBBS, MMed(Oph),
(Ed) Assistant Professor Associate Professor of Ophthalmology FAMS
List of Contributors
Senior Consultant Ophthalmologist Ophthalmology, VA Loma Linda Francis I. Proctor Foundation and Associate Consultant, Ophthalmology
Division of Ophthalmology Loma Linda University Department of Ophthalmology National University Hospital
Changi General Hospital, Singapore Loma Linda, CA, USA University of California San Francisco Singapore
Singapore National Eye Centre San Francisco, CA, USA
Singapore Michael A. Kapusta, MD, FRCSC Thomas Kohnen, MD, PhD, FEBO
Associate Professor Kenneth R. Kenyon, MD Professor and Director
Chris A. Johnson, PhD, DSc Director of Retina and Vitreous Surgery Clinical Professor, Ophthalmology Department of Ophthalmology
Professor Department of Ophthalmology Tufts University University Clinic Frankfurt
Department of Ophthalmology & Jewish General Hospital School of Medicine Goethe University
Visual Sciences McGill University Harvard Medical School Frankfurt am Main
University of Iowa Hospitals and Montreal, QC, Canada Schepens Eye Research Institute Germany
Clinics Boston, MA, USA
Iowa City, IA, USA Rustum Karanjia, MD, PhD, FRCSC Andrew Koustenis, BS
Assistant Professor, Ophthalmology Sir Peng Tee Khaw, PhD, FRCS, FRCP, Medical Student
Mark W. Johnson, MD University of Ottawa FRCOphth, FRCPath, FRSB, FCOptom Clinical Ophthalmology Research
Professor, Chief of Retina Section Ottawa Hospital Research Institute (Hon), DSc, FARVO, FMedSci Internship
Department of Ophthalmology & The Ottawa Hospital Professor of Glaucoma and Ocular Department of Ophthalmology
Visual Sciences Ottawa, ON, Canada Healing Eugene and Marilyn Glick Eye Institute
University of Michigan Doheny Eye Institute Consultant Ophthalmic Surgeon Indiana University
Ann Arbor, MI, USA Doheny Eye Centers Director, National Institute for Health School of Medicine
UCLA, David Geffen School of Research, Biomedical Research Indianapolis, IN, USA
T. Mark Johnson, MD, FRCS(C) Medicine Centre for Ophthalmology
Attending Surgeon, Vitreo-Retinal Los Angeles, CA, USA Moorfields Eye Hospital Stephen S. Lane, MD
Surgery UCL Institute of Ophthalmology Medical Director
Retina Group of Washington Randy H. Kardon, MD, PhD London, UK Adjunct Clinical Professor
Rockville, MD, USA Professor and Director of Neuro- Chief Medical Officer and Head Global
ophthalmology and Pomerantz Gene Kim, MD Franchise Clinical Strategy
Mark M. Kaehr, MD Family Chair in Ophthalmology Assistant Professor and Residency Associated Eye Care
Partner Ophthalmology/Neuro-ophthalmology Program Director University of Minnesota, Alcon
Associated Vitreoretinal and Uveitis Director of the Iowa City VA Center Department of Ophthalmology & Minneapolis, MN, USA
Consultants for the Prevention and Treatment of Visual Science at McGovern Medical
Assistant Clinical Professor of Visual Loss School at UTHealth Patrick J.M. Lavin, MB, MRCPI
Ophthalmology University of Iowa and Iowa City VA Houston, TX, USA Prof. Neurology and Ophthalmology
Indiana University Medical Center Neurology, Ophthalmology and Visual
Associated Vitreoretinal and Uveitis Iowa City, IA, USA Ivana K. Kim, MD Science
Consultants Associate Professor of Ophthalmology Vanderbilt University Medical Center
Indiana University Carol L. Karp, MD Retina Service, Massachusetts Eye and Nashville, TN, USA
School Of Medicine Professor of Ophthalmology Ear
Indianapolis, IN, USA Richard K. Forster Chair in Harvard Medical School Fabio Lavinsky, MD, PhD, MBA
Ophthalmology Boston, MA, USA Research Fellow
Malik Y. Kahook, MD Bascom Palmer Eye Institute NYU Langone Eye Center
The Slater Family Endowed Chair in University of Miami Alan E. Kimura, MD, MPH NYU School of Medicine
Ophthalmology Miller School of Medicine Clinical Associate Professor New York, NY, USA
Vice Chair of Clinical & Translational Miami, FL, USA Department of Ophthalmology Director, Ophthalmic Imaging
Research University of Colorado Department
Professor of Ophthalmology & Chief of Amir H. Kashani, MD, PhD Health Sciences Center Lavinsky Eye Institute
Glaucoma Service Assistant Professor of Clinical Aurora, CO, USA Porto Alegre, Brazil
Director of Glaucoma Fellowship Ophthalmology
University of Colorado University of Southern California Michael Kinori, MD Andrew W. Lawton, MD
School of Medicine Roski Eye Institute Senior Physician Director, Neuro-Ophthalmology
Aurora, CO, USA Los Angeles, CA, USA The Goldschleger Eye Institute Division
Sheba Medical Center, Tel Hashomer Ochsner Health Services
Peter K. Kaiser, MD Michael A. Kass, MD Ramat Gan, Israel New Orleans, LA, USA
Chaney Family Endowed Chair in Bernard Becker Professor,
Ophthalmology Research Ophthalmology and Visual Science Caitriona Kirwan, FRCSI(Ophth) Bryan S. Lee, MD, JD
Professor of Ophthalmology Washington University Consultant Ophthalmic Surgeon Private Practitioner
Cleveland Clinic School of Medicine Mater Private Hospital Altos Eye Physicians
Cole Eye Institute St Louis, MO, USA Dublin, Ireland Los Altos, CA, USA
Cleveland, OH, USA Adjunct Clinical Assistant Professor of
Paula Kataguiri, MD Szilárd Kiss, MD Ophthalmology
Sachin P. Kalarn, MD Research Fellow Chief, Retina Service Director Stanford University
Resident Physician Department of Ophthalmology and Clinical Research Director Stanford, CA, USA
Department of Ophthalmology & Center for Translational Ocular Tele-Ophthalmology Director
Visual Sciences Immunology Compliance Associate Professor of Daniel Lee, MD
University of Maryland Tufts Medical Center Ophthalmology Clinical Instructor, Glaucoma Service
Baltimore, MD, USA New England Eye Center Weill Cornell Medical College Wills Eye Hospital
Boston, MA, USA New York, NY, USA Philadelphia, PA, USA
Ananda Kalevar, MD, FRCSC, DABO PhD Candidate
Associate Professor, Department of John W. Kitchens, MD Gregory D. Lee, MD
Department of Ophthalmology Retina Surgeon, Partner Assistant Professor, Ophthalmology/
Ophthalmology Universidade Federal de São Paulo
University of Sherbrooke Co-Fellowship Director Retina
(UNIFESP) Retina Associates of Kentucky New York University
Sherbrooke, QC, Canada São Paulo, SP, Brazil Lexington, KY, USA New York, NY, USA
Steven Kane, MD L. Jay Katz, MD
Cornea, Cataract, and Refractive Kendra Klein, MD Olivia L. Lee, MD
Director, Glaucoma Service Faculty Physician Assistant Professor of Ophthalmology
Surgery Specialist Wills Eye Hospital
Eye Institute of West Florida Department of Ophthalmology David Geffen School of Medicine
Philadelphia, PA, USA University of Arizona University of California Los Angeles
Largo, FL, USA
Paul L. Kaufman, MD Associated Retina Consultants Los Angeles, CA, USA
Elliott M. Kanner, MD, PhD Ernst H. Bárány Professor of Ocular Phoenix, AZ, USA Associate Medical Director
Chief, Glaucoma Service Pharmacology Doheny Image Reading Center
Hamilton Eye Institute Douglas D. Koch, MD Doheny Eye Institute
Department Chair Emeritus Professor and Allen, Mosbacher, and
University of Tennessee Department of Ophthalmology & Los Angeles, CA, USA
Health Science Center Law Chair in Ophthalmology
Visual Sciences Cullen Eye Institute
Memphis, TN, USA University of Wisconsin-Madison Baylor College of Medicine
xviii School of Medicine & Public Health Houston, TX, USA
Madison, WI, USA
Paul P. Lee, MD, JD Pedro F. Lopez, MD Jodhbir S. Mehta, BSc, MD, MBBS, Majid Moshirfar, MD, FACS
F. Bruce Fralick Professor and Chair Professor and Founding Chair FRCS(Ed), FRCOphth, FAMS Professor of Ophthalmology

List of Contributors
Director W.K. Kellogg Eye Center Department of Ophthalmology Associate Professor, Cornea and Hoopes Vision and John A. Moran Eye
Department of Ophthalmology & Herbert Wertheim College of Medicine External Disease Center
Visual Sciences Florida International University Singapore National Eye Centre Draper, UT, USA
University of Michigan Director of Vitreoretina and Macular Singapore
Ann Arbor, MI, USA Heather E. Moss, MD, PhD
Division
Luis J. Mejico, MD Assistant Professor
Center for Excellence in Eye Care
Richard M.H. Lee, MSc, FRCOphth Professor and Chair of Neurology Departments of Ophthalmology and
Miami, FL, USA
Clinical Fellow Professor of Ophthalmology Neurology & Neurological Sciences
Department of Glaucoma Mats Lundström, MD, PhD SUNY Upstate Medical University Stanford University
Moorfields Eye Hospital Adjunct Professor Emeritus Syracuse, NY, USA Palo Alto, CA, USA
London, UK Department of Clinical Sciences,
Carolina L. Mercado, MD Mark L. Moster, MD
Ophthalmology
Dawn K.A. Lim, MBBS, MRCP, Clinical Research Fellow, Director, Neuro-Ophthalmology
Faculty of Medicine
MMed(Int, Med), MMed(Ophth), FAMS Ophthalmology Fellowship
Lund University
Consultant, Ophthalmology/Glaucoma Bascom Palmer Eye Institute Professor, Neurology and
Lund, Region Skåne, Sweden
National University Hospital Miami, FL, USA Ophthalmology
Singapore Robi N. Maamari, MD Wills Eye Hospital
Ophthalmology Resident Shahzad I. Mian, MD Sidney Kimmel Medical College of
Jennifer I. Lim, MD, FARVO Department of Ophthalmology & Associate Chair, Terry J. Bergstrom Thomas Jefferson University
Marion H. Schenk Esq. Chair in Visual Sciences Professor Philadelphia, PA, USA
Ophthalmology for Research of the Washington University School of Associate Professor, Ophthalmology &
Aging Eye Visual Sciences Kelly W. Muir, MD, MHSc
Medicine in St Louis
Professor of Ophthalmology University of Michigan Associate Professor of Ophthalmology,
St Louis, MO, USA
Director of the Retina Service Ann Arbor, MI, USA Glaucoma Division
University of Illinois at Chicago Assumpta Madu, MD, MBA, PharmD Duke University
Illinois Eye and Ear Infirmary Vice Chair, Operations William F. Mieler, MD, FACS School of Medicine
Chicago, IL, USA Associate Clinical Professor of Cless Family Professor of Durham, NC, USA
Ophthalmology Ophthalmology
Ridia Lim, MBBS, MPH, FRANZCO Vice-Chairman of Education Ann G. Neff, MD
NYU School of Medicine
Ophthalmic Surgeon Illinois Eye and Ear Infirmary Dermatology Associates
NYU Langone Medical Center
Glaucoma Service University of Illinois at Chicago Sarasota, FL, USA
New York, NY, USA
Sydney Eye Hospital College of Medicine Jeffrey A. Nerad, MD
Sydney, NSW, Australia Maya H. Maloney, MD Chicago, IL, USA Oculoplastic & Reconstructive Surgery
Consultant, Medical Retina
Tony K.Y. Lin, MD, FRCSC David Miller, MD Cincinnati Eye Institute
Mayo Clinic
Assistant Professor Associate Clinical Professor of Volunteer Professor, Ophthalmology
Rochester, MN, USA
Department of Ophthalmology Ophthalmology University of Cincinnati
Schulich School of Medicine and Naresh Mandava, MD Harvard Medical School Cincinnati, OH, USA
Dentistry Professor and Chair Boston, MA, USA Neda Nikpoor, MD
Western University Department of Ophthalmology
Clinical Instructor, Ophthalmology
London, ON, Canada University of Colorado Kyle E. Miller, MD
Byers Eye Institute
School of Medicine Assistant Professor, Ophthalmology
John T. Lind, MD, MS Stanford University
Denver, CO, USA Naval Medical Center Portsmouth
Associate Professor Palo Alto, CA, USA
Portsmouth, VA, USA
Department of Ophthalmology & Michael F. Marmor, MD
Robert J. Noecker, MD, MBA
Visual Sciences Professor Tatsuya Mimura, MD, PhD
Director of Glaucoma
Washington University in St Louis Department of Ophthamology Tokyo Womens Medical University
Ophthalmic Consultants of
St Louis, MO, USA Byers Eye Institute Medical Center East
Connecticut
Stanford University Tokyo, Japan
Fairfield, CT, USA
Yao Liu, MD School of Medicine
Assistant Professor Palo Alto, CA, USA Rukhsana G. Mirza, MD Ricardo Nosé, MD
Department of Ophthalmology & Associate Professor Clinical Research Fellow
Jeevan R. Mathura, Jr., MD Department of Ophthalmology
Visual Sciences New England Eye Center
Private Practitioner and Owner Northwestern University
University of Wisconsin-Madison Tufts Medical Center
Diabetic Eye and Macular Disease Feinberg School of Medicine
Madison, WI, USA Boston, MA, USA
Specialists, LLC Chicago, IL, USA
Sidath E. Liyanage, MBBS, FRCOphth, Washington, DC, USA Annabelle A. Okada, MD, DMSc
PhD Mihai Mititelu, MD, MPH Professor of Ophthalmology
Cynthia Mattox, MD Assistant Professor
Consultant Ophthalmologist Kyorin University
Associate Professor, Ophthalmology Department of Ophthalmology &
Bristol Eye Hospital School of Medicine
Tufts University Visual Sciences
Bristol, UK Tokyo, Japan
School of Medicine University of Wisconsin-Madison
Alastair J. Lockwood, BM, BCh, Boston, MA, USA School of Medicine and Public Health Michael O’Keefe, FRCS
FRCOphth, PhD Madison, WI, USA Professor, Ophthalmology
Scott K. McClatchey, MD
Consultant, Ophthalmology Mater Private Hospital
Associate Professor, Ophthalmology Ramana S. Moorthy, MD
Queen Alexandra Hospital Dublin, Ireland
Naval Medical Center Clinical Associate Professor,
Portsmouth, Hampshire, UK San Diego, CA, USA Jeffrey L. Olson, MD
Ophthalmology
Nils A. Loewen, MD, PhD Indiana University Associate Professor
Stephen D. McLeod, MD
Associate Professor of Ophthalmology School of Medicine Department of Ophthalmology
Theresa M. and Wayne M. Caygill
Vice Chair of Electronic Health Founding Partner and CEO University of Colorado
Distinguished Professor and Chair,
Records in Ophthalmology Associated Vitreoretinal and Uveitis School of Medicine
Ophthalmology
University of Pittsburgh Consultants Denver, CO, USA
University of California San Francisco
Pittsburgh, PA, USA San Francisco, CA, USA Indianapolis, IN, USA Jane M. Olver, MB, BS, BSc, FRCS,
Reid A. Longmuir, MD Andrew A. Moshfeghi, MD, MBA FRCOphth
Brian D. McMillan, MD
Assistant Professor Director, Vitreoretinal Fellowship Consultant Ophthalmologist
Assistant Professor of Ophthalmology
Department of Ophthalmology & Associate Professor of Clinical Eye Department
WVU Eye Institute
Visual Sciences Ophthalmology Clinica London
West Virginia University
Vanderbilt University University of Southern California London, UK
School of Medicine
Nashville, TN, USA Morgantown, WV, USA Roski Eye Institute Yvonne A.V. Opalinski, BSc, MD, BFA,
Keck School of Medicine MFA
Alan A. McNab, DMedSc, FRANZCO, Los Angeles, CA, USA Clinical Associate Cardiovascular
FRCOphth
Surgery
Associate Professor and Director
Department of Cardiovascular Surgery
Orbital Plastic and Lacrimal Clinic
Royal Victorian Eye and Ear Hospital Trillium Health Partners xix
Toronto, ON, Canada
Melbourne, VIC, Australia
 Faruk H. Örge, MD Alfio P. Piva, MD P. Kumar Rao, MD Damien C. Rodger, MD, PhD
William R. and Margaret E. Althans Professor of Neurosurgery and Professor of Ophthalmology and Visual Assistant Professor of Clinical
List of Contributors
Chair and Professor Ophthalmology Science Ophthalmology
Director, Center for Pediatric University of Costa Rica Washington University Research Assistant Professor of
Ophthalmology and Adult San Jose, Costa Rica St Louis, MO, USA Biomedical Engineering
Strabismus USC Roski Eye Institute and Viterbi
Rainbow Babies, Children’s Hospital, Dominik W. Podbielski, HonBSc, MSc, Rajesh C. Rao, MD School of Engineering
UH Eye Institute MD, FRCSC Leslie H. and Abigail S. Wexner University of Southern California
Cleveland Medical Center Staff Physician, Ophthalmology Emerging Scholar Los Angeles, CA, USA
Cleveland, OH, USA Prism Eye Institute Assistant Professor, Retina Service
North Toronto Eye Care Department of Ophthalmology & Miin Roh, MD, PhD
Mark Packer, MD, FACS, CPI Toronto, ON, Canada Visual Sciences Vitreoretina Surgery Clinical Fellow
President W.K. Kellogg Eye Center Department of Ophthalmology/Retina
Mark Packer MD Consulting, Inc. Nicolas J. Pondelis, BA University of Michigan Service
Boulder, CO, USA Ophthalmic Photographer and VA Ann Arbor Health System Massachusetts Eye and Ear
Research Assistant Ann Arbor, MI, USA Boston, MA, USA
Suresh K. Pandey, MD Tufts Medical Center
Director, Ophthalmology Boston, MA, USA Sivakumar Rathinam, FAMS, PhD Shiyoung Roh, MD
SuVi Eye Institute and Lasik Laser Professor of Ophthalmology Associate Clinical Professor
Center Francis W. Price, Jr., MD Head of Uveitis Service Tufts University
Kota, Rajasthan, India President Aravind Eye Hospital School of Medicine
Visiting Assistant Professor Price Vision Group Post Graduate Institute of Vice-Chair Division of Ophthalmology
John A. Moran Eye Center Indianapolis, IN, USA Ophthalmology Vice-Chair Department of Surgery
University of Utah Marianne O. Price, PhD, MBA Madurai, Tamil Nadu, India Lahey Hospital and Medical Center
Salt Lake City, UT, USA Executive Director Peabody, MA, USA
Russell W. Read, MD, PhD
Vishal S. Parikh, MD Cornea Research Foundation of Max and Lorayne Cooper Endowed Noel Rosado-Adames, MD
Vitreoretinal Surgery Fellow, Retina America Professor in Ophthalmology Cornea and External Disease Specialist
Service Indianapolis, IN, USA Residency Training Private Practitioner
The Retina Institute Cindy Pritchard, CO University of Alabama at Birmingham OMNI Eye Specialists
St Louis, MO, USA Orthoptist Birmingham, AL, USA Baltimore, MD, USA
Louis R. Pasquale, MD, FARVO Clinical Instructor of Ophthalmology Caio Vinicius Saito Regatieri, MD, PhD Emanuel S. Rosen, MD, FRCS,
Professor of Ophthalmology Children’s Hospital of New Orleans Professor, Ohalmology FRCOphth
Harvard Medical School Tulane University Tufts Medical School Professor
Boston, MA, USA Department of Ophthalmology Boston, MA, USA Department of Vision Sciences
New Orleans, LA, USA Federal University of São Paulo University of Manchester
Sarju S. Patel, MD, MPH, MSc São Paulo, Brazil Manchester, UK
Director of Uveitis Peter A. Quiros, MD
Department of Ophthalmology Associate Professor, Ophthalmology Carl D. Regillo, MD Jonathan B. Rubenstein, MD
Weill Cornell College of Medicine University of California Los Angeles Director Retina Service Deutsch Family Endowed Chair in
New York City, NY, USA Los Angeles, CA, USA Professor of Ophthalmology Ophthalmology
Aleksandra V. Rachitskaya, MD Wills Eye Hospital Retina Service Vice-Chairman of the Department of
Vivek R. Patel, MD Thomas Jefferson University Ophthalmology
Associate Professor, Ophthalmology Assistant Professor of Ophthalmology,
Cleveland Clinic Lerner College of Philadelphia, PA, USA Rush University Medical Center
USC Roski Eye Institute Chicago, IL, USA
Keck School of Medicine Medicine of Case Western Reserve Elias Reichel, MD
Los Angeles, CA, USA University Professor and Vice Chair Richard M. Rubin, MD, LT, COL, USAF,
Vitreoretinal Staff Physician New England Eye Center MC, SFS
Carlos E. Pavesio, MD Cole Eye Institute Tufts University Neuro-Ophthalmologist and Senior
Consultant Ophthalmic Surgeon Cleveland Clinic School of Medicine Flight Surgeon
Medical Retina Cleveland, OH, USA Boston, MA, USA Departments of Ophthalmology and
Moorfields Eye Hospital Aerospace Medicine
London, UK Pradeep Y. Ramulu, MD, MHS, PhD Douglas J. Rhee, MD
Associate Professor of Ophthalmology David Grant USAF Medical Center
Chairman Travis AFB, CA, USA
Victor L. Perez, MD Chief, Glaucoma Division Department of Ophthalmology and
Professor of Ophthalmology Wilmer Eye Institute Visual Sciences Steven E. Rubin, MD
Stephen and Frances Foster Professor Johns Hopkins School of Medicine University Hospitals Case Medical Vice Chair, Residency Program
of Ophthalmology Baltimore, MD, USA Center Director and Co-Chief, Pediatric
Duke University School of Medicine Case Western Reserve University Ophthalmology
Director, Duke Center for Ocular J. Bradley Randleman, MD
Editor-in-Chief School of Medicine Hofstra North Shore–Long Island
Immunology Cleveland, OH, USA Jewish School of Medicine
Durham, NC, USA Journal of Refractive Surgery
Professor of Ophthalmology Great Neck, NY, USA
Alexander L. Ringeisen, MD
Claudia E. Perez-Straziota, MD Director, Cornea & Refractive Surgery Vitreoretinal Surgery Fellow Patrick E. Rubsamen, MD
Clinical Assistant Professor of USC Roski Eye Institute VitreoRetinal Surgery, PA Physician, Vitreoretinal Surgery
Ophthalmology Keck School of Medicine of USC Minneapolis, MN, USA Retina Group of Florida
Roski Eye Institute Los Angeles, CA, USA Boca Raton, FL, USA
University of Southern California Robert Ritch, MD, FACS
Private Practitioner Narsing A. Rao, MD Shelley and Steven Einhorn Jason D. Rupp, MD
Los Angeles, CA, USA Professor of Ophthalmology and Distinguished Chair Ophthalmology Specialist
Pathology Professor of Ophthalmology Department of Ophthalmology and
Lauren T. Phillips, MD Chief of Uveitis Service and New York Eye and Ear Infirmary of Visual Sciences
Assistant Professor, Neurology & Ophthalmic Pathology Laboratory Mount Sinai Washington University
Neurotherapeutics USC Roski Eye Institute New York, NY, USA School of Medicine
University of Texas Keck School of Medicine St Louis, MO, USA
Southwestern Medical Center University of Southern California Shira L. Robbins, MD
Dallas, TX, USA Los Angeles, CA, USA Clinical Professor of Ophthalmology Hossein G. Saadati, MD
Director of Neonatal Ophthalmology Oculofacial/Reconstructive Surgeon,
Jody R. Piltz-Seymour, MD Naveen K. Rao, MD Division of Pediatric Ophthalmology Ophthalmology
Adjunct Professor, Ophthalmology Cornea, Cataract, and Anterior and Strabismus Kaiser Permanente Medical Offices
Perelman School of Medicine Segment Surgery Ratner Children’s Eye Center at the Stockton, CA, USA
University of Pennsylvania Lahey Hospital and Medical Center Shiley Eye Institute
Glaucoma Care Center at Valley Eye Burlington, MA, USA La Jolla, CA, USA Alfredo A. Sadun, MD, PhD
Professionals, LLC Assistant Professor of Ophthalmology Flora Thornton Chair, Doheny
Glaucoma Service, Wills Eye Hospital Tufts University Professor of Ophthalmology
Philadelphia, PA, USA School of Medicine Vice-Chair of Ophthalmology, UCLA
Boston, MA, USA Los Angeles, CA, USA
xx
Osamah J. Saeedi, MD Hermann D. Schubert, MD Roni M. Shtein, MD, MS Sunil K. Srivastava, MD
Associate Professor Professor of Clinical Ophthalmology Associate Professor Staff Physician

List of Contributors
Director of Clinical Research and Pathology Department of Ophthalmology & Cleveland Clinic
Associate Residency Program Director E.S. Harkness Eye Institute Visual Sciences Cole Eye Institute
Department of Ophthalmology & Columbia University University of Michigan Cleveland, OH, USA
Visual Sciences New York, NY, USA Ann Arbor, MI, USA
University of Maryland Brian C. Stagg, MD
School of Medicine Joel S. Schuman, MD Ryan W. Shultz, MD Clinical Lecturer
Baltimore, MD, USA Professor and Chairman of Ophthalmologist, Vitreoretinal Department of Ophthalmology &
Ophthalmology Diseases Visual Sciences
Daniel J. Salchow, MD Director, NYU Eye Center Colorado Permanente Medical Group University of Michigan
Professor of Ophthalmology Professor of Neuroscience and Denver, CO, USA Ann Arbor, MI, USA
Section of Pediatric Ophthalmology, Physiology
Patricia B. Sierra, MD David H.W. Steel, MBBS, FRCOphth
Strabismus and Neuro- Neuroscience Institute
Sacramento Eye Consultants Consultant Ophthalmologist and
ophthalmology NYU School of Medicine
Sacramento, CA, USA Vitreoretinal Surgeon
Department of Ophthalmology Professor of Electrical and Computer
Charité – University Medicine Berlin Engineering Brent Siesky, PhD Sunderland Eye Infirmary
Berlin, Germany NYU Tandon School of Engineering Assistant Director, Research Associate City Hospitals Sunderland NHS
Professor of Neural Engineering Ophthalmology, Glaucoma Research Foundation Trust
Sarwat Salim, MD, FACS Center for Neural Science, NYU and Diagnostic Center Sunderland, Tyne & Wear, UK
Professor of Ophthalmology New York, NY, USA Eugene and Marilyn Glick Eye Institute
Eye Institute Joshua D. Stein, MD, MS
Indiana University Associate Professor, Ophthalmology &
Medical College of Wisconsin Gary S. Schwartz, MD, MHA School of Medicine
Milwaukee, WI, USA Adjunct Associate Professor Visual Sciences
Indianapolis, IN, USA Associate Professor, Health
Department of Ophthalmology
Thomas W. Samuelson, MD University of Minnesota Paul A. Sieving, MD, PhD Management & Policy
Attending Surgeon School of Medicine Associated Eye Director University of Michigan
Glaucoma and Anterior Segment Care National Eye Institute Ann Arbor, MI, USA
Surgery Stillwater, MN, USA National Institutes of Health
Minnesota Eye Consultants, PA Mitchell B. Strominger, MD
Bethesda, MD, USA Professor of Ophthalmology and
Adjunct Associate Professor J. Sebag, MD, FACS, FRCOphth, FARVO
Department of Ophthalmology Founding Director Dimitra Skondra, MD, PhD Pediatrics
University of Minnesota VMR Institute for Vitreous Macula Assistant Professor of Ophthalmology Tufts Medical Center
Minneapolis, MN, USA Retina and Visual Science Boston, MA, USA
Huntington Beach, CA, USA Director, J. Terry Ernest Ocular Alan Sugar, MD
Simrenjeet Sandhu, MD Imaging Center
Ophthalmology Resident Dov B. Sebrow, MD Professor and Vice-Chair,
The University of Chicago Ophthalmology & Visual Sciences
University of Alberta Senior Vitreoretinal Surgical Fellow, Chicago, IL, USA
Edmonton, AL, Canada Ophthalmology/Vitreoretinal Kellogg Eye Center
Diseases Kent W. Small, MD University of Michigan
Marcony R. Santhiago, MD, PhD Edward S. Harkness Eye Institute President/Founder, Vitreo-Retinal Ann Arbor, MI, USA
Adjunct Professor of Ophthalmology Columbia University Medical Center Surgery
Refractive Surgery Department Joel Sugar, MD
Vitreous Retina Macula Consultants of Molecular Insight Research Foundation
University of Southern California Professor and Vice Head,
New York Glendale, CA, USA
Los Angeles, CA, USA Ophthalmology & Visual Sciences
Manhattan Eye, Ear and Throat William E. Smiddy, MD University of Illinois Eye and Ear
Professor of Ophthalmology Hospital
Refractive Surgery Department Professor, Ophthalmology Infirmary
New York, NY, USA Bascom Palmer Eye Institute Chicago, IL, USA
University of São Paulo
São Paulo, SP, Brazil H. Nida Sen, MD, MHS University of Miami
Yevgeniy V. Sychev, MD
Director, Uveitis Felowship Program Miller School of Medicine
Giacomo Savini, MD Senior Clinical Fellow
National Eye Institute Miami, FL, USA
Researcher Ophthalmology/Vitreoretinal Disease
National Institutes of Health Marie Somogyi, MD and Surgery
G.B. Bietti Foundation Bethesda, MD, USA
Rome, Italy Oculoplastic and Orbital Surgery Washington University
Gaurav K. Shah, MD TOC Eye and Face School of Medicine in St Louis
Ibrahim O. Sayed-Ahmed, MD Professor of Clinical Ophthalmology & Austin, TX, USA St Louis, MO, USA
Research Fellow Visual Sciences
Graduate Student in Vision Science H. Kaz Soong, MD Tak Yee Tania Tai, MD
The Retina Institute Chief of Cornea and Refractive Service Assistant Professor, Ophthalmology
and Investigative Ophthalmology Washington University
Bascom Palmer Eye Institute Co-Director of International New York Eye and Ear Infirmary of
School of Medicine Ophthalmology Mount Sinai
Miami, FL, USA St Louis, MO, USA Department of Ophthalmology & New York, NY, USA
Amy C. Scheffler, MD Carol L. Shields, MD Visual Sciences
Assistant Professor of Clinical University of Michigan James C. Tan, MD, PhD
Director, Ocular Oncology Service Associate Professor, Department of
Ophthalmology Wills Eye Hospital Ann Arbor, MI, USA
Assistant Clinical Member, Research Ophthalmology
Professor of Ophthalmology Sarkis H. Soukiasian, MD Doheny Eye Institute
Institute Thomas Jefferson University Director, Cornea and External Diseases University of California Los Angeles
Weill Cornell Medical College Philadelphia, PA, USA Director, Ocular Inflammation and Los Angeles, CA, USA
Houston Methodist Hospital Medical
Uveitis
Center Yevgeniy (Eugene) Shildkrot, MD Myron Tanenbaum, MD
Lahey Health Systems
Retina Consultants of Houston Associate Professor of Ophthalmology Voluntary Professor
Burlington, MA, USA
Houston, TX, USA Ocular Oncology and Vitreoretinal Department of Ophthalmology
Diseases and Surgery Richard F. Spaide, MD Bascom Palmer Eye Institute
Paulo Schor, MD, MSci, DSci University of Virginia Vitreous, Retina, Macula Consultants
Director of Research and Technological University of Miami
Charlottesville, VA, USA of New York Miller School of Medicine
Development New York, NY, USA
Professor of Ophthalmology Bradford J. Shingleton, MD Miami, FL, USA
Department of Ophthalmology & Clinical Associate Professor, Tatyana Spektor, MD Suphi Taneri, MD
Visual Sciences Ophthalmology Cornea and Refractive Surgery Fellow Director, Center for Refractive Surgery,
Escola Paulista de Medicina (EPM) – Harvard Medical School Department of Ophthalmology Eye Department
Universidade Federal de São Paulo Partner, Ophthalmic Consultants Baylor College of Medicine St. Francis Hospital
(UNIFESP) of Boston Houston, TX, USA Associate Professor, Eye Clinic
São Paulo, Brazil Boston, MA, USA Ruhr University Bochum
Thomas C. Spoor, MD, FACS
Private Practitioner Munster, NRW, Germany
Neuro-Ophthalmology and Oculo-
Plastic Surgery
Sarasota Retina Institute xxi
Sarasota, FL, USA
 William Tasman, MD† Julie H. Tsai, MD Brian D. Walker, BS Matthew T. Witmer, MD
Formerly Professor and Emeritus Assistant Professor of Clinical Medical Student Partner Physician, Vitreoretinal Surgery
List of Contributors
Chairman Ophthalmology McGovern Medical School Retina Associates of Western New York
Department of Ophthalmology Albany, NY, USA Houston, TX, USA Rochester, NY, USA
Wills Eye Hospital and Jefferson Clinical Instructor
Medical College Nancy Tucker, MD, FRCSC David S. Walton, MD University of Rochester Medical Center
Philadelphia, PA, USA Chief of Oculoplastics, Ophthalmology President, Children’s Glaucoma Rochester, NY, USA
University of Toronto Foundation
David G. Telander, MD, PhD Toronto, ON, Canada Clinical Professor of Ophthalmology Gadi Wollstein, MD
Clinical Professor Harvard Medical School Professor of Ophthalmology
Department of Ophthalmology Sonal S. Tuli, MD, MEd Surgeon in Ophthalmology Vice Chairman for Clinical Research
University of California Davis Professor and Chair, Ophthalmology Massachusetts Eye and Ear Infirmary Director of Ophthalmic Imaging
Davis, CA, USA University of Florida Boston, MA, USA Research Laboratory
Associate Professor Gainesville, FL, USA Director of Research Education
California Northstate Li Wang, MD, PhD NYU School of Medicine
Caroline W. Vargason, MD, PhD Associate Professor, Ophthalmology
School of Medicine Oculoplastic & Reconstructive Surgery New York, NY, USA
Sacramento, CA, USA Baylor College of Medicine
Fellow Houston, TX, USA Maria A. Woodward, MD, MS
Edmond H. Thall, MD, MS Cincinnati Eye Institute Assistant Professor of Ophthalmology
Consultant in Aerospace Cincinnati, OH, USA Michelle Y. Wang, MD & Visual Sciences
Ophthalmology Associate Physician University of Michigan
Roshni A. Vasaiwala, MD Department of Ophthalmology/
Aeromedical Consultation Service Assistant Professor of Ophthalmology Ann Arbor, MI, USA
Ophthalmology Branch Neuro-Ophthalmology
Director of Cornea Service Southern California Permanente Nicholas K. Wride, MB, ChB, FRCOphth
United States Air Force School of Loyola University Medical Center
Aerospace Medicine Medical Group Consultant Ophthalmologist
Maywood, IL, USA Los Angeles, CA, USA Sunderland Eye Infirmary
Wright–Patterson Air Force Base
Dayton, OH, USA Daniel Vitor Vasconcelos-Santos, MD, City Hospitals Sunderland
Robert C. Wang, MD Sunderland, Tyne & Wear, UK
PhD Partner
Aristomenis Thanos, MD Adjunct Professor of Ophthalmology
Retina Department Texas Retina Assoc Albert Wu, MD, PhD
Director of Uveitis Clinical Associate Professor of Associate Professor of Ophthalmology
Devers Eye Institute Universidade Federal de Minas Gerais
Portland, OR, USA Ophthalmology Icahn School of Medicine at Mount
Belo Horizonte, Minas Gerais, Brazil UT Southwestern Sinai
Christos N. Theophanous, MD Gregory J. Vaughn, MD Dallas, TX, USA New York, NY, USA
Resident Physician Consultant, Global Healthcare Practice
Department of Ophthalmology and Martin Wax, MD David Xu, MD
Spencer Stuart Chief Medical Officer and Executive Resident Physician
Visual Science Atlanta, GA, USA
University of Chicago Medicine Vice-President R&D Stein Eye Institute
Chicago, IL, USA Arthi Venkat, MD, MS, BA PanOptica, Inc. University of California Los Angeles
Staff Physician in Medical Retina and Bernardsville, NJ, USA Los Angeles, CA, USA
Benjamin J. Thomas, MD Uveitis
Physician, Vitreoretinal Surgery Joel M. Weinstein, MD Joshua A. Young, MD
Cleveland Clinic Professor of Ophthalmology and Clinical Professor
Florida Retina Institute Cole Eye Institute
Jacksonville, FL, USA Pediatrics Department of Ophthalmology
Cleveland, OH, USA Penn State University M.S. Hershey New York University
Praneetha Thulasi, MD Guadalupe Villarreal, Jr., MD Medical Center School of Medicine
Assistant Professor of Ophthalmology Attending Hershey, PA, USA Chief Ophthalmologist Correspondent
Cornea, External Diseases, and Department of Ophthalmology EyeWorld Magazine
Refractive Surgery John J. Weiter, MD, PhD Producer and Manager of Podcasting
Mid-Atlantic Permanente Medical Associate Professor of Ophthalmology
Emory University Group American Society of Cataract and
Atlanta, GA, USA Harvard Medical School Refractive Surgery
Falls Church, VA, USA Boston, MA, USA New York, NY, USA
Michael D. Tibbetts, MD Kateki Vinod, MD
Director of Retina Services Liliana Werner, MD, PhD Edward S. Yung, MD
Assistant Professor of Ophthalmology Professor of Ophthalmology & Visual
Tyson Eye Center New York Eye and Ear Infirmary of Clinical Instructor, Glaucoma
Cape Coral, FL, USA Sciences Wills Eye Hospital
Mount Sinai Co-Director Intermountain Ocular
Icahn School of Medicine at Mount Philadelphia, PA, USA
David P. Tingey, BA, MD, FRCSC Research Center
Associate Professor, Ophthalmology Sinai University of Utah Cynthia Yu-Wai-Man, PhD, FRCOphth
Western University New York, NY, USA John A. Moran Eye Center Postdoctoral Research Fellow
London, ON, Canada Jesse M. Vislisel, MD Salt Lake City, UT, USA Rescue, Repair and Regeneration
Staff Physician, Cornea & External UCL Institute of Ophthalmology
Faisal M. Tobaigy, MD Mark Wevill, MBChB, FRCSE, FCS(SA) London, UK
Associate Professor of Ophthalmology Disease Consultant Ophthalmologist
Jazan University Associated Eye Care Optegra Birmingham Eye Hospital Wadih M. Zein, MD
Jazan, Saudi Arabia Stillwater, MN, USA Birmingham, West Midlands, UK Staff Clinician
Ivan Vrcek, MD Ophthalmic Genetics and Visual
Bozho Todorich, MD, PhD Janey L. Wiggs, MD, PhD Function Branch
Staff Physician Partner, Texas Ophthalmic Plastic, Paul Austin Chandler Professor of
Reconstructive, and Orbit Surgery National Eye Institute, NIH
Pennsylvania Retina Specialists, PC Ophthalmology Bethesda, MD, USA
Camp Hill, PA, USA President, Ivan Vrcek, M.D. PA Harvard Medical School
Associate Adjunct Professor of Boston, MA, USA Ivy Zhu, MD
Stuart W. Tompson, PhD Ophthalmology and Oculoplastic Resident Physician
Associate Scientist Surgery, Texas A&M Medical School, Andrew M. Williams, MD Department of Ophthalmology &
Department of Ophthalmology & Dallas Campus Resident Visual Sciences
Visual Sciences Clinical Assistant Professor of Department of Ophthalmology Illinois Eye and Ear Infirmary
University of Wisconsin-Madison Ophthalmology and Oculoplastic University of Pittsburgh University of Illinois at Chicago
Madison, WI, USA Surgery, UT Southwestern Medical School of Medicine College of Medicine
Center Pittsburgh, PA, USA Chicago, IL, USA
James C. Tsai, MD, MBA Dallas, TX, USA
President, New York Eye & Ear George A. Williams, MD
Infirmary of Mount Sinai, Delafield- Hormuz P. Wadia, MD Chair, Department of Ophthalmology
Rodgers Professor and System Chair Assistant Clinical Professor Oakland University
Department of Ophthalmology Department of Ophthalmology William Beaumont School of Medicine
Icahn School of Medicine at Mount James A. Haley VAMC Royal Oak, MI, USA
Sinai Morsani School of Medicine
New York, NY, USA University of South Florida Eye
Institute
xxii †
Tampa, FL, USA
Deceased
 Acknowledgments

Acknowledgments
We are grateful to the editors and authors who have contributed to
Ophthalmology and to the superb, dedicated Ophthalmology team at Else-
vier. We especially would like to thank Sharon Nash and Russell Gabbedy
for their tireless efforts in keeping us on track and making our job
much easier. We would also like to thank Josh Mearns, Content Coordi-
nator; Joanna Souch, Project Manager; Brian Salisbury, Designer; Karen
Giacomucci, Illustration Manager; Richard Tibbitts, Illustrator; Vinod
Kothaparamtath, Multimedia Producer; and Claire McKenzie, Marketing
Manager.
 Dedication

Dedication
We would like to dedicate this book to our wives, Karin Yanoff and Julie
Starr-Duker, and to our children—Steven, David, and Alexis Leyva-Yanoff;
Joanne Grune-Yanoff; and Jake, Claire, Bear, Becca, Sam, Colette, and Elly
Duker—all of whom play such an important part in our lives and without
whose help and understanding we would have never come this far.

xxiii
Part 1 Genetics


Fundamentals of Human Genetics

Janey L. Wiggs 1.1
Definition: The central principles of human genetics with relevance to HUMAN GENOME
eye disease. Human DNA is packaged as chromosomes located in the nuclei of cells.
Chromosomes are composed of individual strands of DNA wound about
proteins called histones. The complex winding and coiling process culmi-
nates in the formation of a chromosome. The entire collection of human
chromosomes includes 22 paired autosomes and two sex chromosomes.
Women have two copies of the X chromosome, and men have one X and
Key Features one Y chromosome (Fig. 1.1.3).
• Gene structure and expression. The set consisting of one of each autosome as well as both sex chro-
• Organization and inheritance of the human genome. mosomes is called the human genome. The chromosomal molecules of
• Mutations and clinical phenotypes. DNA from one human genome, if arranged in tandem end to end, contain
• Gene-based therapies. approximately 3.2 billion base pairs (bp). The Human Genome Project was
formally begun in 1990 with the defined goals to: identify all the approxi-
mately 20,000–25,000 genes in human DNA; determine the sequences of
the 3 billion chemical base pairs that make up human DNA; store this
information in publicly available databases; improve tools for data anal-
DNA AND THE CENTRAL DOGMA OF ysis; transfer related technologies to the private sector; and address the
HUMAN GENETICS
The regulation of cellular growth and function in all human tissue is depen-
dent on the activities of specific protein molecules. In turn, protein activity
STRUCTURE OF THE DNA DOUBLE HELIX
is dependent on the expression of the genes that contain the correct DNA
sequence for protein synthesis. The DNA molecule is a double-stranded
helix. Each strand is composed of a sequence of four nucleotide bases— Sugar–phosphate backbone Separation of individual
adenine (A), guanine (G), cytosine (C), and thymine (T)—joined to a sugar and nitrogenous bases strands allows DNA replication
and a phosphate. The order of the bases in the DNA sequence forms the
genetic code that directs the expression of genes. The double-stranded helix
sugar–
is formed as a result of hydrogen bonding between the nucleotide bases of
phosphate
opposite strands.1 The bonding is specific, such that A always pairs with backbone
T, and G always pairs with C. The specificity of the hydrogen bonding is
one helical turn = 3.4 nm

the molecular basis of the accurate copying of the DNA sequence that is
required during the processes of DNA replication (necessary for cell divi-
sion) and transcription of DNA into RNA (necessary for gene expression
and protein synthesis; Fig. 1.1.1).
Gene expression begins with the recognition of a particular DNA
sequence called the promoter sequence as the start site for RNA synthe-
sis by the enzyme RNA polymerase. The RNA polymerase “reads” the
DNA sequence and assembles a strand of RNA that is complementary
to the DNA sequence. RNA is a single-stranded nucleic acid composed
of the same nucleotide bases as DNA, except that uracil takes the place
of thymine. Human genes (and genes found in other eukaryotic organ-
bases
isms) contain many DNA sequences that are not translated into polypep-
tides and proteins. These sequences are called intervening sequences or
introns. Introns do not have any known specific function, and although
they are transcribed into RNA by RNA polymerase, they are spliced out of
the initial RNA product (termed heteronuclear RNA, or hnRNA) to form
the completed messenger RNA (mRNA). Untranslated RNA may have spe-
cific functions. For example, antisense RNA and micro RNAs (miRNA) 5l 3l 5l 3l
appear to regulate expression of genes.2 The mRNA is the template for original
new chains
original
protein synthesis. Proteins consist of one or more polypeptide chains, chain chain
forming
which are sequences of specific amino acids. The sequence of bases in
the mRNA directs the order of amino acids that make up the polypeptide adenine thymine guanine cytosine
chain. Individual amino acids are encoded by units of three mRNA bases,
termed codons. Transfer RNA (tRNA) molecules bind specific amino acids
Fig. 1.1.1 Structure of the DNA Double Helix. The sugar–phosphate backbone
and recognize the corresponding three-base codon in the mRNA. Cellular and nitrogenous bases of each individual strand are arranged as shown. The two
organelles called ribosomes bind the mRNA in such a configuration that strands of DNA pair by hydrogen bonding between the appropriate bases to form
the RNA sequence is accessible to tRNA molecules and the amino acids the double-helical structure. Separation of individual strands of the DNA molecule
are aligned to form the polypeptide. The polypeptide chain may be pro- allows DNA replication, catalyzed by DNA polymerase. As the new complementary
cessed by a number of other chemical reactions to form the mature protein strands of DNA are synthesized, hydrogen bonds are formed between the 1
(Fig. 1.1.2). appropriate nitrogenous bases.
 1 CENTRAL DOGMA OF MOLECULAR GENETICS

nucleus
PACKAGING OF DNA INTO CHROMOSOMES

DNA double helix

Genetics

cytoplasm chromosome

DNA
transcription

primary
mRNA
processing
mature Nucleosome
mRNA
histone
nucleosome

translation DNA
nuclear nuclear
pore envelope
200 bp of DNA
plasma
membrane protein

Solenoid
exon intron intron spliced out

Fig. 1.1.2 The Central Dogma of Molecular Genetics. Transcription of DNA into
RNA occurs in the nucleus of the cell, catalyzed by the enzyme RNA polymerase.
Mature mRNA is transported to the cytoplasm, where translation of the code
produces amino acids linked to form a polypeptide chain, and ultimately a mature
protein is produced.

Chromosome

ethical, legal, and social issues that may arise from the project. One of chromatin loop
the most important goals, the complete sequence of the human genome, contains approximately
100, 000 bp of DNA
was completed in draft form in 2001.3 Catalogs of variation in the human
genome sequence have also been completed, with the microsatellite repeat
map in 1994,4 the release of the HapMap from the International HapMap
Consortium in 2004,5 and more recently a catalog of variants from the 1000
genomes project.6 dbSNP (https://www.ncbi.nlm.nih.gov/projects/SNP/)
is a database listing single nucleotide polymorphisms (SNPs) that are
single-letter variations in a DNA base sequence. SNPs are bound together chromatin
strand chromatid
to form haplotypes, which are blocks of SNPs that are commonly inherited
together. This binding occurs through the phenomenon of linkage disequi-
librium. Within a haplotype block, which may extend for 10,000–100,000
bases of DNA, the analysis of only a subset of all SNPs may “tag” the entire Fig. 1.1.3 The Packaging of DNA Into Chromosomes. Strands of DNA are wound
haplotype. The International HapMap project has performed an initial tightly around proteins called histones. The DNA–histone complex becomes further
characterization of the linkage disequilibrium patterns between SNPs in coiled to form a nucleosome, which in turn coils to form a solenoid. Solenoids then
multiple different populations. The SNP haplotype blocks identified can form complexes with additional proteins to become the chromatin that ultimately
be examined for association with human disease, especially common dis- forms the chromosome.
orders with complex inheritance. Knowledge about the effects of DNA
variations among individuals can lead to new ways to diagnose, treat,
and prevent human disease. This approach has been used successfully to between chromosomes by recombination (Fig. 1.1.5). The homologous
identify the risk loci for age-related macular degeneration,7–9 myopia,10,11 chromosome pairs line up on the microtubule spindle and divide such
primary open-angle glaucoma,12–14 and Fuchs’ endothelial dystrophy.15 that the maternal and paternal copies of the doubled chromosomes are
distributed to separate daughter cells. A second cell division occurs, and
Mitosis and Meiosis the doubled chromosomes divide, which results in daughter cells that have
half the genetic material of somatic (tissue) cells.
In order for cells to divide, the entire DNA sequence must be copied so
that each daughter cell can receive a complete complement of DNA. The
growth phase of the cell cycle terminates with the separation of the two
BASIC MENDELIAN PRINCIPLES
sister chromatids of each chromosome, and the cell divides during mitosis. Two important rules central to human genetics emerged from the work of
Before cell division, the complete DNA sequence is copied by the enzyme Gregor Mendel, a nineteenth century Austrian monk. The first is the prin-
DNA polymerase in a process called DNA replication. DNA polymerase is ciple of segregation, which states that genes exist in pairs and that only one
an enzyme capable of the synthesis of new strands of DNA using the exact member of each pair is transmitted to the offspring of a mating couple.
sequence of the original DNA as a template. Once the DNA is copied, the The principle of segregation describes the behavior of chromosomes in
old and new copies of the chromosomes form their respective pairs, and meiosis. Mendel’s second rule is the law of independent assortment, which
the cell divides such that one copy of each chromosome pair belongs to states that genes at different loci are transmitted independently. This work
each cell (Fig. 1.1.4). Mitotic cell division produces a daughter cell that is also demonstrated the concepts of dominant and recessive traits. Mendel
an exact replica of the dividing cell. found that certain traits were dominant and could mask the presence of a
Meiotic cell division is a special type of cell division that results in a recessive gene.
reduction of the genetic material in the daughter cells, which become At the same time that Mendel observed that most traits segregate
the reproductive cells—eggs (women) and sperm (men). Meiosis begins independently, according to the law of independent assortment, he unex-
2 with DNA replication, followed by a pairing of the maternal and paternal pectedly found that some traits frequently segregate together. The phys-
chromosomes (homologous pairing) and an exchange of genetic material ical arrangement of genes in a linear array along a chromosome is the
 MITOTIC CELL CYCLE MEIOTIC CELL CYCLE
1.1
Interphase

Fundamentals of Human Genetics

centrioles plasma membrane Metaphase I
nucleus cytoplasm
nucleolus
nuclear envelope

chiasmata

Daughter Anaphase I
cells Prophase
primary oocyte
bipolar primary spermatocyte
spindle
fiber

Prophase I
Telophase I
secondary oocyte
Telophase Prometaphase secondary spermatocyte
microtubule
spindle pole
Metaphase II
centromere
chromatid

Anaphase Metaphase Anaphase II

large egg and

polar bodies
spermatids of
equatorial equal size Haploid gametes
plane (meta-
phase plate)

Fig. 1.1.5 The Meiotic Cell Cycle. During meiosis, the DNA of a diploid cell is
Fig. 1.1.4 The Mitotic Cell Cycle. During mitosis, the DNA of a diploid cell is replicated, which results in the formation of a tetraploid cell that divides twice
replicated, which results in the formation of a tetraploid cell that divides to form to form four haploid cells (gametes). As a consequence of the crossing over and
two identical diploid daughter cells. recombination events that occur during the pairing of homologous chromosomes
before the first division, the four haploid cells may contain different segments of
the original parental chromosomes. For brevity, prophase II and telophase II are not
explanation for this surprising observation. On average, a recombination shown.
event occurs once or twice between two paired homologous chromosomes
during meiosis (Fig. 1.1.6). Most observable traits, by chance, are located
far away from one another on a chromosome, such that recombination is GENETIC RECOMBINATION BY CROSSING OVER
likely to occur between them, or they are located on entirely different chro-
mosomes. If two traits are on separate chromosomes, or a recombination
A a A A a a A a A a A a A a
event is likely to occur between them on the same chromosome, the resul-
tant gamete formed during meiosis has a 50% chance of inheriting differ- B b B B b b B b B b B b B b
ent alleles from each loci, and the two traits respect the law of independent
C c C C c c C C c c C C c c
assortment. If, however, the loci for these two traits are close together on
a chromosome, with the result that a recombination event occurs between D d D D d d D D d d D D d d
them only rarely, the alleles at each loci are passed to descendent gametes
E e E E e e E E e e E E e e
“in phase.” This means that the particular alleles present at each loci in the
offspring reflect the orientation in the parent, and the traits appear to be recombination
“linked.” For example, in Mendel’s study of pea plants, curly leaves were
always found with pink flowers, even though the genes for curly leaves and Fig. 1.1.6 Genetic Recombination by Crossing Over. Two copies of a chromosome
pink flowers are located at distinct loci. These traits are linked, because the are copied by DNA replication. During meiosis, pairing of homologous
curly leaf gene and the pink-flower gene are located close to each other chromosomes occurs, which enables a crossover between chromosomes to take
on a chromosome, and a recombination event only rarely occurs between place. During cell division, the recombined chromosomes separate into individual
them. Recombination and linkage are the fundamental concepts behind daughter cells.
genetic linkage analysis.
particular gene is mutated, the protein product might not be produced,
MUTATIONS or it might be produced but function poorly or even pathologically (dom-
inant negative effect). Point mutations (the substitution of a single base
Mutations are changes in the gene DNA sequence that result in a bio- pair) are the most common mutations encountered in human genetics. 3
logically significant change in the function of the encoded protein. If a Missense mutations are point mutations that cause a change in the amino
 Fig. 1.1.7 Reciprocal GENES AND PHENOTYPES
1 RECIPROCAL TRANSLOCATION Translocation Between
Two Chromosomes. The
Philadelphia chromosome
The relationship between genes and phenotypes is complex. More than
one genetic defect can lead to the same clinical phenotype (genetic het-
(responsible for chronic erogeneity), and different phenotypes can result from the same genetic
Genetics

normal 9 der (9) myelogenous leukemia) is

defect (variable expressivity). Retinitis pigmentosa is an excellent example
shown as an example of
a reciprocal chromosomal
of genetic heterogeneity, as it may be inherited as an X-linked, autosomal
translocation that results dominant, autosomal recessive, or digenic trait, and more than 200 caus-
in an abnormal gene ative genes have been identified.23 Other ocular disorders that are geneti-
product responsible for cally heterogeneous include congenital cataract, glaucoma, and age-related
a clinical disorder. In this macular degeneration. Different genes may contribute to a common phe-
case an exchange occurs notype because they affect different steps in a common pathway. Under-
between the long arm of standing the role of each gene in the disease process can help define the
chromosome 9 and the cellular mechanisms that are responsible for the disease.
normal 22 der (22) long arm of chromosome For many genes, a single mutation that alters a critical site in the
22. protein results in an abnormal phenotype. For some diseases, the resulting
phenotypes are remarkably similar regardless of the nature of the muta-
tion. For example, a wide variety of mutations in RB1 cause retinoblas-
toma. Other diseases, however, exhibit variable expressivity, in which an
individual’s mutation may be responsible for severe disease, mild disease,
or disease that is not clinically detectable (incomplete penetrance). There
are many examples of ocular disease demonstrating variable expressivity,
including Kjer’s autosomal dominant optic atrophy,24 Axenfeld–Rieger syn-
drome,25 and aniridia.26
Different mutations in the same gene can also result in different pheno-
acid sequence of the polypeptide chain. The severity of the missense muta- types (allelic heterogeneity). Allelic heterogeneity accounts for the different
tion is dependent on the chemical properties of the switched amino acids phenotypes of dominant corneal stromal dystrophies caused by mutations
and on the importance of a particular amino acid in the function of the in the TGFB1/BIGH3.27 The phenotypic expression of a mutation may
mature protein. Point mutations also may decrease the level of polypep- depend on its location within a gene. Such variable expressivity based on
tide production because they interrupt the promoter sequence, splice site the location of the mutation is exemplified by mutations in the rds gene,
sequences, or create a premature stop codon. which may cause typical autosomal dominant retinitis pigmentosa or
Gene expression can be affected by the insertion or deletion of large macular dystrophy depending on the position of the genetic defect.28
blocks of DNA sequence. These types of mutations are less common than
point mutations but may result in a more severe change in the activity
of the protein product. A specific category of insertion mutations is the
PATTERNS OF HUMAN INHERITANCE
expansion of trinucleotide repeats found in patients affected by certain The most common patterns of human inheritance are autosomal domi-
neurodegenerative disorders. An interesting clinical phenomenon, “antic- nant, autosomal recessive, X-linked recessive, and mitochondrial. Fig. 1.1.8
ipation,” was understood on a molecular level with the discovery of trinu- shows examples of these four inheritance patterns. Other inheritance pat-
cleotide repeats as the cause of myotonic dystrophy.16 Frequently, offspring terns less commonly encountered in human disease include X-linked dom-
with myotonic dystrophy were affected more severely and at an earlier inant, digenic inheritance (polygenic), pseudodominance, and imprinting.
age than their affected parents and grandparents. Examination of the Fig. 1.1.9 defines the notation and symbols used in pedigree construction.
disease-causing trinucleotide repeat in affected pedigrees demonstrated
that the severity of the disease correlated with the number of repeats found Autosomal Dominant
in the myotonic dystrophy gene in affected individuals. This phenomenon
has been observed in a number of other diseases, including Huntington’s A disease-causing mutation that is present in only one of the two gene
disease.17 copies at an autosomal locus (heterozygous) is a dominant mutation. For
Chromosomal rearrangements may result in breaks in specific genes that example, a patient with dominant retinitis pigmentosa will have a defect in
cause an interruption in the DNA sequence. Usually, the break in DNA one copy of one retinitis pigmentosa gene inherited from one parent who,
sequence results in a truncated, unstable, dysfunctional protein product. in most cases, is also affected by retinitis pigmentosa. The other copy of
Occasionally, the broken gene fuses with another gene to cause a “fusion that gene, the one inherited from the unaffected parent, is normal (wild
polypeptide product,” which may have a novel activity in the cell. Often, type). Affected individuals have a 50% chance of having affected siblings
such a novel activity results in an abnormality in the function of the and a 50% chance of passing the abnormal gene to their offspring; 50% of
cell. An example of such a fusion protein is the product of the chromo- children of an affected individual will be affected. For a dominant disease,
some 9;22 translocation that is associated with many cases of leukemia males and females transmit the disease equally and are affected equally.
(Fig. 1.1.7).18,19 True dominant alleles produce the same phenotype in the heterozy-
A set consisting of one of each autosome as well as an X or a Y chro- gous and homozygous states. In humans, most individuals affected by
mosome is called a haploid set of chromosomes. The normal complement a disease caused by a dominant allele are heterozygous, but occasionally
of two copies of each gene (or two copies of each chromosome) is called homozygous mutations have been described. In cases where the homozy-
diploidy. Rarely, as a result of abnormal chromosome separation during gous individual is more severely affected than the heterozygous individual,
cell division, a cell or organism may have three copies of each chromo- the disease is more appropriately noted to be inherited as a semidomi-
some, which is called triploidy. A triploid human is not viable, but some nant trait. For example, alleles in the PAX3 gene, causing Waardenburg’s
patients have an extra chromosome or an extra segment of a chromosome. syndrome, are semidominant, because a homozygote with more severe
In such a situation, the abnormality is called trisomy for the chromosome disease compared with their heterozygote relatives has been described.29
involved. For example, patients with Down syndrome have three copies of In some pedigrees with an autosomal dominant disease, some indi-
chromosome 21, also referred to as trisomy 21.20 viduals who carry the defective gene do not have the affected phenotype.
If one copy of a pair of chromosomes is absent, the defect is called However, these individuals can still transmit the disease gene to offspring
haploidy. Deletions of the X chromosome are frequently the cause of and have affected children. This phenomenon is called reduced pene-
Duchenne’s muscular dystrophy.21 trance. The gene responsible for retinoblastoma (RB1) is only 90% pene-
Polymorphisms are changes in DNA sequence that don’t have a signif- trant, which means that 10% of the individuals who inherit a mutant copy
icant biological effect. These DNA sequence variants may modify disease of the gene do not develop the tumor.30
processes, but alone are not sufficient to cause disease. Human DNA
sequence is highly variable and includes single nucleotide polymorphisms Autosomal Recessive
(SNPs), microsatellite repeat polymorphisms (20–50 bp repeats of CA or
4 GT sequence), variable number of tandem repeat polymorphisms (VNTR, Diseases that require both copies of a gene to be abnormal for development
repeats of 50–100 bp of DNA), or larger insertion deletions.22 are inherited as recessive traits. Heterozygous carriers of mutant genes are
 Fig. 1.1.8 Patterns of Inheritance. For pedigrees with
PATTERNS OF INHERITANCE an autosomal dominant trait, panel 1 shows inheritance
that originates from a previous generation, panel 1.1
Pedigrees with an autosomal dominant trait 2 shows segregation that originates in the second
generation of this pedigree, and panel 3 shows an

Fundamentals of Human Genetics

Generation apparent “sporadic” case, which is actually a new
I 1 2 3 mutation that arises in the most recent generation.
This mutation has a 50% chance of being passed to
II offspring of the affected individual. For pedigrees with
an autosomal recessive trait, panel 1 shows an isolated
III affected individual in the most recent generation
(whose parents are obligatory carriers of the mutant
Pedigrees with an autosomal recessive trait gene responsible for the condition), panel 2 shows a
pair of affected siblings whose father is also affected
(for the siblings to be affected, the mother must be
I 1 2 3
an obligate carrier of the mutant gene), and panel 3
II shows an isolated affected individual in the most recent
generation who is a product of a consanguineous
III marriage between two obligate carriers of the mutant
gene. For pedigrees with an X-chromosomal trait,
IV panel 1 shows an isolated affected individual whose
disease is caused by a new mutation in the gene
Pedigrees with an X-chromosomal inheritance responsible for this condition, panel 2 shows an isolated
individual who inherited a mutant copy of the gene
from the mother (who is an obligate carrier), and panel
I 1 2 3 3 shows segregation of an X-linked trait through a
multigeneration pedigree (50% of the male offspring are
II affected, and their mothers are obligate carriers of the
disease). For pedigrees with a mitochondrial trait, the
III
panel shows a large, multigeneration pedigree—men
IV and women are affected, but only women have affected
offspring.
V

Pedigrees with a mitochondrial trait

II

III

IV

affected affected unaffected unaffected male, gene unaffected unaffected female, gene
male female male carrier (heterozygous) female carrier (heterozygous)

usually clinically normal. The same recessive defect might affect both gene gene, he will be affected. If a daughter inherits the defective gene, she
copies, in which case the patient is said to be a homozygote. Different reces- will be a carrier. An important characteristic of X-linked recessive disor-
sive defects might affect the two gene copies, in which case the patient is a ders is that males never transmit the disease to sons directly (male-to-male
compound heterozygote. In a family with recessive disease, both parents are transmission).
unaffected carriers, each having one wild-type gene (allele) and one mutant Usually female carriers of an X-linked disease gene do not have any
gene (allele). Each parent has a 50% chance of transmitting the defective clinical evidence of the disease. However, for some X-linked diseases, mild
allele to a child. Because a child must receive a defective allele from both clinical features can be found in female carriers. For example, in X-linked
parents to be affected, each child has a 25% chance of being affected (50% retinoschisis, affected males are severely affected, whereas carrier females
× 50% = 25%), and 50% of the offspring will be carriers of the disease. If have a visually insignificant but clinically detectable retinal abnormality.31
the parents are related, they may be carriers of the same rare mutations, Mild phenotypic expression of the disease gene can be caused by the
and there is a greater chance that a recessive disease can be transmitted process of lyonization. In order for males (with one X chromosome) and
to offspring. Males and females have an equal chance of transmitting and females (with two X chromosomes) to have equal levels of expression of
inheriting the disease alleles. X-linked genes, female cells express genes from only one of their two X
chromosomes. The decision as to which X chromosome is expressed is
X-Linked Recessive made early in embryogenesis, and the line of descending cells faithfully
adheres to the early choice. As a result, females are mosaics, with some
Mutations of the X chromosome produce distinctive inheritance patterns, cells in each tissue expressing the maternally derived X chromosome and
because males have only one copy of the X chromosome and females the remainder expressing the paternally derived X chromosome. When
have two. Most X-linked gene defects are inherited as X-linked recessive one of the X chromosomes carries an abnormal gene, the proportion
traits. Carrier females are typically unaffected because they have both a of cells that express the mutant versus the normal gene in each tissue
normal copy and a defective copy of the disease-associated gene. Carrier can vary.
males are affected because they only have one defective X chromosome Females can also be affected by an X-linked recessive disease if the
and they do not have a normal gene copy to compensate for the defec- father is affected and the mother coincidentally is a carrier of a mutation
tive copy. All of the daughters of an affected male will be carriers of the in the disease gene. In this case, 50% of daughters would be affected,
disease gene because they will inherit the defective X chromosome. None because 50% would inherit the X chromosome from the mother carrying
of the sons of an affected male will be affected or be carriers because the disease gene, and all the daughters would inherit the X chromosome
they will inherit the Y chromosome. Each child of a carrier female has a from the father carrying the disease gene. Because most X-linked disorders 5
50% chance of inheriting the disease gene. If a son inherits the defective are rare, the carrier frequency of disease genes in the general population is
 X-Linked Dominant Inheritance
1 or
BASIC PEDIGREE NOTATION

normal female fraternal twins

This inheritance pattern is similar to X-linked recessive inheritance, except
that all females who are carriers of an abnormal gene on the X chromo-
(not identical) some are affected rather than unaffected. All of the male offspring are also
Genetics

affected. Incontinentia pigmenti is probably inherited as an X-linked dom-

or normal male
identical twins inant trait. Affected females have irregularly pigmented atrophic scars on
the trunk and the extremities and congenital avascularity in the peripheral
single bar retina with secondary retinal neovascularization.34 This and other X-linked
number of children
indicates mating 2 6 for each sex dominant disorders occur almost always in females, and it is likely that the
X chromosome gene defects causing these diseases are embryonic lethals
normal parents and darkened square or
normal offspring, two when present in males.
I circle means affected
girls and a boy, in individual; arrow (when
II birth order indicated or present) indicates the Digenic Inheritance and Polygenic Inheritance
by the numbers; I and affected individual is
1 2 3 Digenic inheritance occurs when a patient has heterozygous defects in
II indicate generations propositus, the begin-
ning of the analysis two different genes, and the combination of the two gene defects causes
single parent as disease. Individuals who have a mutation in only one of the genes are
presented means normal. Digenic inheritance is different from recessive inheritance,
partner is normal autosomal heterozygous
and because the two mutations involve different disease genes. In some retini-
or of no significance recessive
tis pigmentosa families, mutation analysis of the peripherin gene and the
to the analysis
X-linked carrier ROM1 gene showed that the affected individuals harbor specific mutations
in both genes. Individuals with a mutation in only one copy of either gene
double bar indicates dead
and were unaffected by the disease.35 Triallelic inheritance has been described
a consanguineous union
(mating between in some families affected by Bardet–Biedl syndrome (BBS). In these pedi-
close relatives) aborted or stillborn grees, affected individuals carry three mutations in one or two BBS genes
(12 BBS genes have been identified),36 and unaffected individuals have only
two abnormal alleles. In some families, it has been proposed that BBS may
not be a single-gene recessive disease but a complex trait requiring at least
Fig. 1.1.9 Basic Pedigree Notation. Typical symbols used in pedigree construction three mutant alleles to manifest the phenotype. This would be an example
are defined. of triallelic inheritance.37
If the expression of a heritable trait or predisposition is influenced by
the combination of alleles at three or more loci, it is polygenic. Because
low, and the chance that a carrier female would mate with a male affected of the complex inheritance, conditions caused by multiple alleles do not
by the same disease is quite low. demonstrate a simple inheritance pattern. These complex traits may also
be influenced by environmental conditions. Examples of phenotypes in
Mitochondrial Inheritance ophthalmology that exhibit complex inheritance because of contributions
of multiple genes and environmental factors are myopia,38 age-related
Mitochondria are small organelles located in the cytoplasm of cells. They macular degeneration,39 and adult-onset open-angle glaucoma.40
function to generate ATP for the cell and are most abundant in cells that
have high energy requirements, such as muscle and nerve cells. Mito- Imprinting
chondria have their own small chromosome—16,569 bp of DNA encoding
for 13 mitochondrial proteins, 2 ribosomal RNAs, and 22 tRNAs. Muta- Some mutations give rise to autosomal dominant traits that are transmitted
tions occurring in genes located on the mitochondrial chromosome cause by parents of either sex, but they are expressed only when inherited from a
a number of diseases, including Leber’s hereditary optic atrophy32 and parent of one particular sex. In families affected with these disorders, they
Kearns–Sayre syndrome.33 Mutations occurring on the mitochondrial chro- would appear to be transmitted in an autosomal dominant pattern from
mosome are inherited only from the mother because virtually all human one parent (either the mother or the father) and would not be transmitted
mitochondria are derived from the maternal egg. Fathers do not transmit from the other parent. Occasionally, the same mutation gives rise to a dif-
mitochondria to their offspring. ferent disorder depending on the sex of the parent transmitting the trait.
Cells vary in the number of mitochondria they contain, and when These parental sex effects are evidence of a phenomenon called imprinting.
cells divide, the mitochondria are divided randomly. As a result, different Although the molecular mechanisms responsible for imprinting are not
cells can have varying numbers of mitochondria, and if a fraction of the completely understood, it appears to be associated with DNA methylation
mitochondria contain a mutated gene, different cells will have a varying patterns that can mark certain genes with their parental origin.41
proportion of healthy versus mutant mitochondria. The distribution of
mutant mitochondria is called heteroplasmy, and the proportion of mutant
mitochondria can vary from cell to cell and can also change with age. Dif-
MOLECULAR MECHANISMS OF DISEASE
ferences in the relative proportions of mutant mitochondria can partly Autosomal Dominant
explain the observed variable severity of mitochondrial diseases and also
the variable age of onset of mitochondrial diseases. Disorders inherited as autosomal dominant traits result from mutations
that occur in only one copy of a gene (i.e., in heterozygous individuals).
Pseudodominance Usually, the parental origin of the mutation does not matter. However, if
the gene is subject to imprinting, then mutations in the maternal or pater-
This term describes an apparent dominant inheritance pattern due to reces- nal copy of the gene may give rise to different phenotypes.
sive defects in a disease gene. This situation arises when a parent affected
by a recessive disease (two abnormal copies of the disease gene) has a Haploinsufficiency
spouse who is a carrier of one abnormal copy of the disease gene. Children Under normal circumstances, each copy of a gene produces a protein
from this couple will always inherit a defective gene copy from the affected product. If a mutation occurs such that one copy of a gene no longer pro-
parent and will have a 50% chance of inheriting the defective gene copy duces a protein product, then the amount of that protein in the cell has
from the unaffected carrier parent. On average, half of the children will been reduced by half. Mutations that cause a reduction in the amount of
inherit two defective gene copies and will be affected. The pedigree would protein or lead to inactivation of the protein are called loss-of-function muta-
mimic a dominant pedigree because of apparent direct transmission of the tions. For many cellular processes, this reduction in protein quantity does
disease from the affected parent to affected children and because approxi- not have consequences, i.e., the heterozygous state is normal, and these
mately 50% of the children will be affected. Pseudodominant transmission mutations may be inherited as recessive traits (see later section). However,
6 is uncommon, because few people are asymptomatic carriers for any par- for some cellular processes there is an absolute requirement for the full
ticular recessive gene. dosage of protein product, which can only be furnished if both copies of
a particular gene are active. Diseases that are caused by inheritance of a
GENE THERAPY USING A RETROVIRUS VECTOR
single mutation reducing the protein level by half are inherited as domi-
nant traits. 1.1
Therapeutic gene engineered into retrovirus DNA
Gain-of-Function Dominant Negative Effect

Fundamentals of Human Genetics

retrovirus
Autosomal dominant disorders can be caused by mutant proteins that
have a detrimental effect on the normal tissue. Mutations in one copy of a
gene may produce a mutant protein that can accumulate as a toxic product therapeutic
or in some other way interfere with the normal function of the cell. The human gene
mutant protein may also interfere with the function of the normal protein
expressed by the remaining normal copy of the gene, thus eliminating any Recombinant virus replicates in a packaging cell
normal protein activity. It is possible to have gain-of-function mutations
that can also be dominant negative because the new function of the protein replace retroviral genes
with therapeutic human gene
also interferes with the function of the remaining normal copy of the gene.

packaging cell
Autosomal and X-Linked Recessive
Recessive disorders result from mutations present on both the maternal
and paternal copies of a gene. Mutations responsible for recessive disease
typically cause a loss of biological activity, either because they create a
defective protein product that has little or no biological activity or because
they interfere with the normal expression of the gene (regulatory muta-
unpackagable virions
tions). Most individuals heterozygous for recessive disorders, both autoso-
mal and X-linked, are clinically normal. helper provirus

GENE THERAPY
Mutations in the DNA sequence of a particular gene can result in a protein
Replicated recombinant virus infects the target cell and inserts copies of the therapeutic gene
product that is not produced, works poorly, or has acquired a novel func-
tion that is detrimental to the cell. Gene-based therapies can involve deliv-
ery of a normal gene to disease tissue, replacing or augmenting protein
activity with other proteins or small molecules, decreasing abnormal gene
expression, or genome-editing techniques to repair the mutation. Thera- RNA
peutic genes can be delivered to specific tissues using modified viruses as reverse
transcription
vectors42 (Fig. 1.1.10). A successful example of this approach is the resto-
ration of vision in a canine model of Leber’s congenital amaurosis using a DNA human
recombinant adeno-associated virus carrying the normal gene (RPE65).43 target cell
Human trials using a similar approach also successfully restored vision in
patients with RPE65 mutations.44 therapeutic
gene product
Diseases caused by mutations that create a gene product that is
destructive to the cell (dominant negative or gain of function mutations)
need to be treated using a different approach. In these cases, genes or nucleus
oligonucleotides—in particular antisense molecules—that can reduce
expression of the mutated gene are introduced into the cell.45 Gene editing
using CRISPR/Cas9 (Fig. 1.1.11) is another potentially useful approach for
gain of function or loss of function mutations.46 Recent advances have pro- Fig. 1.1.10 Gene Therapy Using a Retrovirus Vector. A therapeutic gene is
duced highly potent in vivo gene therapy vectors for targeting retina.47 In engineered genetically into the retrovirus DNA and replaces most of the viral DNA
addition, new methods are emerging to introduce therapeutic genes into sequences. The “recombinant virus” that carries the therapeutic gene is allowed to
damaged tissue using nonviral mechanisms based on nanotechnology.48 replicate in a special “packaging cell“ that also contains normal virus that carries the
genes required for viral replication. The replicated recombinant virus is allowed to
infect the human diseased tissue, or “target cell.“ The recombinant virus may invade
the diseased tissue but cannot replicate or destroy the cell. The recombinant virus
inserts copies of the normal therapeutic gene into the host genome and produces
the normal protein product.

7
 1 GENE EDITING USING CRISPR/cas 9
Genetics

target nucleus
mutation: T2929C PAM
CGACAGGAAT T TGCAGGT
T A
5’ T G A T G A T G A T T T T G AG ACC A AC T GG AC T G T GGGG AG AGGG AG AG A A ACC A T ACC A T GG ACC T T C 3’

3’ AC T AC T AC T A A A AC T C T GG T T G ACC T G AC ACCCC T C T CCC T C T C T T T GG T A T GG T ACC T GG A AG 5’

A T
GCTGTCCT T AAACGTCCA

5’ U A GUUUUAGAGCUA G
guide CGACAGGAAUUUGCAGGU A
AA
A
GUUCAACUAUUGCCUGAUCGGAAUAAAAU CGAU sgRNA scaffold
U A
A GA
A
AAAGUGGCACCGA
G
3’ UUUUCGUGGCU

DSB repair
NHEJ HDR

C TGGAC TG T CGAC AGGA A T T TGC AGGG T A AC TGC T A TGGGGAGAGGGAGAGA A ACC A T AC A T T T TGAGACC A AC TGGAC TG T CGAC AGGA A T T TGC AG G T A TGGGGAGAGGGA

GACC TGAC AGC TG T CC T T A A ACG T CCC A T TGACGA T ACCCC T C T CCC T C T C T T TGG T A TG T A A A AC T C TGG T TGACC TGAC AGC TGT CC T T A A ACG T C C A T ACCCC T C T CCC T

GAC TG T CGAC AGGA A T T TGC AGGACCG T CCG T C A AC T T A TGGGGAGAGGGAGAGA A ACC A T TGAGACC A AC TGGAC TG T CGAC AGGA A T T TGC AGG T A TGGGGAGAGGGAGAGA A A

C TGAC AGC TG T CC T T A A ACG T CC TGGC AGGC AG T TGA A T ACCCC T C T CCC T C T C T T TGG T A AC T C TGG T TGACC T A AC AGC TG T CC T T A A ACG T CC A T ACCCC T C T CCC T C T C T T T

insertions donor template

GAGACC A AC TGGAC TG T CGAC AGGA A T T T - - - - - T A TGGGGAGAGGGAGAGA A ACC A T ACC

C T C TGG T TGACC TGAC AGC TG T CC T T A A A - - - - - A T ACCCC T C T CCC T C T C T T TGG T A TGG A T T T TGAGACC A AC TGGAC TG T CGAC AGGAAT T TGCAG GTGGGGAGAGGGAGAGA A ACC

T A A A AC T C TGG T TGACC TGAC AGC TGT CC T CCCC T C T CCC T C T C T T TGG

GAGACC A AC TGGAC TG T CGAC AGGA A - - - - - - - - - A TGGGGAGAGGGAGAGA A ACC A T ACC A
GGAT TGTCGACAGGAAT T TGC AGG T A
C T C TGG T TGACC TGAC AGC TG T CC T T - - - - - - - - - T ACCCC T C T CCC T C T C T T TGG T A TGG T T
T TGAGACC A AC A A ACG TGGA T GGGGAGAGGGAGAGA A ACC
deletions
A AC T C TGG T TGACCTAACAGCTGTCCT TAAACGTCCATACCCC T C T CCC T C T C T T TGG

A T T T TGAGACC A AC TGGA T TG T CGAC AGGA A T T TGC AGG T A TGGGGAGAGGGA

T A A A AC T C TGG T TGACC T A AC AGC TGT CC T T A A ACG T CC A T ACCCC T C T CCC T

precise repair

Fig. 1.1.11 Gene Editing Using CRISPR/Cas9. The CRISPR/Cas-DNA binding creates a double-stranded DNA break (DSB), which can be repaired through nonhomologous
end joining (NHEJ) or homology directed repair (HDR) pathways. Here, the Streptococcus pyogenes Cas9 nuclease, with a “NGG” protospacer adjacent motif (PAM) sequence,
has been directed to target the region containing the BEST1 c929T > C (Ile310Thr) mutation. The guide RNA is complementary to the non-PAM strand, and the DNA cut site
is three nucleotides from the PAM sequence. Double strand DNA breaks typically undergo repair by NHEJ, which results in deletions and insertions of variable length. DNA
nicks are generally repaired through HDR, where a donor template can be used to incorporate precise genomic modifications. (Adapted from Hung SS, McCaughey T, Swann
O, et al. Genome engineering in ophthalmology: application of CRISPR/Cas to the treatment of eye disease. Prog Retin Eye Res 2016;53:1–20.)

KEY REFERENCES Hysi PG, Young TL, Mackey DA, et al. A genome-wide association study for myopia and
refractive error identifies a susceptibility locus at 15q25. Nat Genet 2010;42:902–5.
1000 Genomes Project Consortium. A map of human genome variation from population-scale Maguire AM, Simonelli F, Pierce EA, et al. Safety and efficacy of gene transfer for Leber’s
sequencing. Nature 2010;467:1061–73. congenital amaurosis. N Engl J Med 2008;358:2240–8.
Bailey JN, Loomis SJ, Kang JH, et al. Genome-wide association analysis identifies TXNRD2, Thorleifsson G, Walters GB, Hewitt AW, et al. Common variants near CAV1 and CAV2 are
ATXN2 and FOXC1 as susceptibility loci for primary open-angle glaucoma. Nat Genet associated with primary open-angle glaucoma. Nat Genet 2010;42:906–9.
2016;48(2):189–94. Wiggs JL, Yaspan BL, Hauser MA, et al. Common variants at 9p21 and 8q22 are associated
Baratz KH, Tosakulwong N, Ryu E, et al. E2-2 protein and Fuchs’s corneal dystrophy. N Engl with increased susceptibility to optic nerve degeneration in glaucoma. PLoS Genet
J Med 2010;363(11):1016–24. 2012;8(4):e1002654.
Haines JL, Hauser MA, Schmidt S, et al. Complement factor H variant increases the risk of
age-related macular degeneration. Science 2005;308:419–21.
Han J, Thompson-Lowrey AJ, Reiss A, et al. OPA1 mutations and mitochondrial DNA haplo- Access the complete reference list online at ExpertConsult.com
types in autosomal dominant optic atrophy. Genet Med 2006;8:217–25.
8
REFERENCES 24. Han J, Thompson-Lowrey AJ, Reiss A, et al. OPA1 mutations and mitochondrial DNA
haplotypes in autosomal dominant optic atrophy. Genet Med 2006;8:217–25.
1. Watson JD, Crick FHC. Molecular structure of nucleic acids: a structure for deoxyribose
nucleic acid. Nature 1953;171:737–8.
25. Hjalt TA, Semina EV. Current molecular understanding of Axenfeld–Rieger syndrome.
Expert Rev Mol Med 2005;7:1–17.
1.1
2. Esteller M. Non-coding RNAs in human disease. Nat Rev Genet 2011;12(12):861–74. 26. Vincent MC, Gallai R, Olivier D, et al. Variable phenotype related to a novel PAX 6 muta-
tion (IVS4+5G>C) in a family presenting congenital nystagmus and foveal hypoplasia.

Fundamentals of Human Genetics

3. Wolfsberg TG, McEntyre J, Schuler GD. Guide to the draft human genome. Nature
2001;409:824–6. Am J Ophthalmol 2004;138:1016–21.
4. Murray JC, Buetow KH, Weber JL, et al. A comprehensive human linkage map with centi- 27. Schmedt T, Silva MM, Ziaei A, et al. Molecular bases of corneal endothelial dystrophies.
morgan density. Cooperative Human Linkage Center (CHLC). Science 1994;265:2049–54. Exp Eye Res 2012;95:24–34.
5. The International HapMap Consortium. The International HapMap Project. Nature 28. Stuck MW, Conley SM, Naash MI. RDS functional domains and dysfunction in disease.
2003;426:789–96. Adv Exp Med Biol 2016;854:217–22.
6. 1000 Genomes Project Consortium. A map of human genome variation from popula- 29. Wollnik B, Tukel T, Uyguner O, et al. Homozygous and heterozygous inheritance of
tion-scale sequencing. Nature 2010;28:1061–73. PAX3 mutations causes different types of Waardenburg syndrome. Am J Med Genet A
7. Haines JL, Hauser MA, Schmidt S, et al. Complement factor H variant increases the risk 2003;122:42–5.
of age-related macular degeneration. Science 2005;308:419–21. 30. Harbour JW. Molecular basis of low-penetrance retinoblastoma. Arch Ophthalmol
8. Seddon JM, Yu Y, Miller EC, et al. Rare variants in CFI, C3 and C9 are associated with 2001;119:1699–704.
high risk of advanced age-related macular degeneration. Nat Genet 2013;45(11):1366–70. 31. Sikkink SK, Biswas S, Parry NR, et al. X-linked retinoschisis: an update. J Med Genet
9. Fritsche LG, Igl W, Bailey JN, et al. A large genome-wide association study of age-related 2007;44:225–32.
macular degeneration highlights contributions of rare and common variants. Nat Genet 32. Newman NJ. Hereditary optic neuropathies: from the mitochondria to the optic nerve.
2016;48(2):134–43. Am J Ophthalmol 2005;140:517–23.
10. Hysi PG, Young TL, Mackey DA, et al. A genome-wide association study for myopia and 33. Schmiedel J, Jackson S, Schafer J, et al. Mitochondrial cytopathies. J Neurol 2003;250:
refractive error identifies a susceptibility locus at 15q25. Nat Genet 2010;42:902–5. 267–77.
11. Verhoeven VJ, Hysi PG, Wojciechowski R, et al. Genome-wide meta-analyses of multian- 34. Shields CL, Eagle RC Jr, Shah RM, et al. Multifocal hypopigmented retinal pigment epi-
cestry cohorts identify multiple new susceptibility loci for refractive error and myopia. thelial lesions in incontinentia pigmenti. Retina 2006;26:328–33.
Nat Genet 2013;45(3):314–18. 35. Kajiwara K, Berson EL, Dryja TP. Digenic retinitis pigmentosa due to mutations at the
12. Thorleifsson G, Walters GB, Hewitt AW, et al. Common variants near CAV1 and CAV2 unlinked peripherin/RDS and ROM1 loci. Science 1994;264:1604–8.
are associated with primary open-angle glaucoma. Nat Genet 2010;42:906–9. 36. Sheffield VC. The blind leading the obese: the molecular pathophysiology of a human
13. Wiggs JL, Yaspan BL, Hauser MA, et al. Common variants at 9p21 and 8q22 are associ- obesity syndrome. Trans Am Clin Climatol Assoc 2010;121:172–81.
ated with increased susceptibility to optic nerve degeneration in glaucoma. PLoS Genet 37. Eichers ER, Lewis RA, Katsanis N, et al. Triallelic inheritance: a bridge between Mende-
2012;8(4):e1002654. lian and multifactorial traits. Ann Med 2004;36:262–72.
14. Bailey JN, Loomis SJ, Kang JH, et al. Genome-wide association analysis identifies 38. Hornbeak DM, Young TL. Myopia genetics: a review of current research and emerging
TXNRD2, ATXN2 and FOXC1 as susceptibility loci for primary open-angle glaucoma. trends. Curr Opin Ophthalmol 2009;20:356–62.
Nat Genet 2016;48(2):189–94. 39. Deangelis MM, Silveira AC, Carr EA, et al. Genetics of age-related macular degeneration:
15. Baratz KH, Tosakulwong N, Ryu E, et al. E2-2 protein and Fuchs’s corneal dystrophy. current concepts, future directions. Semin Ophthalmol 2011;26:77–93.
N Engl J Med 2010;363:1016–24. 40. Wiggs JL, Pasquale LR. Genetics of glaucoma. Hum Mol Genet 2017;26(R1):R21–7.
16. Lindblad K, Schalling M. Expanded repeat sequences and disease. Semin Neurol 41. Lewis A, Reik W. How imprinting centres work. Cytogenet Genome Res 2006;113:81–9.
1999;19:289–99. 42. Bennett J, Chung DC, Maguire A. Gene delivery to the retina: from mouse to man.
17. Lee JM, Ramos EM, Lee JH, et al. CAG repeat expansion in Huntington disease deter- Methods Enzymol 2012;507:255–74.
mines age at onset in a fully dominant fashion. Neurology 2012;78:690–5. 43. Acland GM, Aguirre GD, Ray J, et al. Gene therapy restores vision in a canine model of
18. Kato T, Kurahashi H, Emanuel BS. Chromosomal translocations and palindromic AT-rich childhood blindness. Nat Genet 2001;28:92–5.
repeats. Curr Opin Genet Dev 2012;22(3):221–8. 44. Maguire AM, Simonelli F, Pierce EA, et al. Safety and efficacy of gene transfer for Leber’s
19. Vladareanu AM, Müller-Tidow C, Bumbea H, et al. Molecular markers guide diagno- congenital amaurosis. N Engl J Med 2008;358:2240–8.
sis and treatment in Philadelphia chromosome-negative myeloproliferative disorders 45. Pelletier R, Caron SO, Puymirat J. RNA based gene therapy for dominantly inherited
(Review). Oncol Rep 2010;23:595–604. diseases. Curr Gene Ther 2006;6:131–46.
20. Roubertoux PL, Kerdelhue B. Trisomy 21: from chromosomes to mental retardation. 46. Hung SS, McCaughey T, Swann O, et al. Genome engineering in ophthalmology: appli-
Behav Genet 2006;36:346–54. cation of CRISPR/Cas to the treatment of eye disease. Prog Retin Eye Res 2016;53:
21. Soltanzadeh P, Friez MJ, Dunn D, et al. Clinical and genetic characterization of mani- 1–20.
festing carriers of DMD mutations. Neuromuscul Disord 2010;20:499–504. 47. Zinn E, Pacouret S, Khaychuk V, et al. In silico reconstruction of the viral evolutionary
22. Little PF. Structure and function of the human genome. Genome Res 2005;15:1759–66. lineage yields a potent gene therapy vector. Cell Rep 2015;12(6):1056–68.
23. Daiger SP, Sullivan LS, Bowne SJ. Genes and mutations causing retinitis pigmentosa. 48. Vasir JK, Labhasetwar V. Polymeric nanoparticles for gene delivery. Expert Opin Drug
Clin Genet 2013;84(2):132–41. Deliv 2006;3:325–44.

8.e1
Part 1 Genetics


Molecular Genetics of Selected

Ocular Disorders 1.2
Janey L. Wiggs

trichrome and have been termed “hyalin.” In lattice dystrophy, branching

Definition: The molecular mechanisms underlying selected inherited amyloid deposits gradually opacify the visual axis. These deposits exhibit a
eye disorders as defined by the responsible genetic mutations. characteristic birefringence under polarized light after staining with Congo
red. Avellino dystrophy includes features of both granular and lattice dys-
trophies. Reis–Bücklers dystrophy appears to involve primarily Bowman’s
layer and the superficial stroma.
Key Features All four dystrophies were mapped genetically to a common interval on
• Inherited disorders affecting the ocular anterior segment. chromosome 5q31, and mutations in a single gene, TGFB1 (also known
• Genetic defects causing abnormal ocular development. as BIGH3), located in this region were found in affected individuals.2 The
• Inherited retinal degenerations. product of this gene, keratoepithelin, is probably an extracellular matrix
• Retinoblastoma. protein that modulates cell adhesion. Four different missense mutations,
• Disorders involving the optic nerve and extraocular muscles. which occur at two arginine codons in the gene, have been found (Fig.
1.2.1). Interestingly, mutations at one of these arginine codons cause lattice
dystrophy type I or Avellino dystrophy, the two dystrophies characterized
by amyloid deposits. Mutations at the other arginine codon appear to result
INTRODUCTION in either granular dystrophy or Reis–Bücklers dystrophy. The mutation
analysis of this gene demonstrates that different mutations within a single
Tremendous advances in the molecular genetics of human disease have gene can result in different phenotypes.
been made in the past 20 years. Many genes responsible for inherited The mutation that causes Avellino and lattice dystrophies abolishes a
eye diseases have been isolated and characterized, and the chromosomal putative phosphorylation site, which probably is required for the normal
location of a number of additional genes has been determined. Identify- structure of keratoepithelin. Destruction of this aspect of the protein struc-
ing and characterizing genes responsible for human disease has led to ture leads to formation of the amyloid deposits that are responsible for
DNA-based methods of diagnosis; novel therapeutic approaches, including opacification of the cornea. Consequently, the mutant protein is destructive
gene therapy; and improved knowledge about the molecular events that to the normal tissue. Mutations at the R555 (arginine at amino acid posi-
underlie the disease processes. The disorders discussed in this chapter tion 555) appear to result in either granular dystrophy or Reis–Bücklers
represent important examples of major advances in human ocular molec- dystrophy. These phenotype–genotype correlations demonstrate the vari-
ular genetics. able expressivity of mutations in this gene and the significance of alter-
Although all inherited disorders are the result of gene mutations, the ation of the arginine residues 124 and 555.
molecular consequences of a mutation are quite variable. The type of
mutation responsible for a disease usually defines the inheritance pattern.
For example, mutations that create an abnormal protein detrimental to the ANIRIDIA, PETER’S ANOMALY, AUTOSOMAL
cell are typically autosomal dominant, because only one mutant gene is
required to disrupt normal cell function. Mutations that result in proteins
DOMINANT KERATITIS
that have reduced biological activity (loss of function) may be inherited as Some cellular processes require a level of protein production that results
autosomal dominant or autosomal recessive conditions, depending on the from the expression of both copies of a particular gene. Such proteins
number of copies of normal genes (and the amount of normal protein) may be involved in a variety of biological processes. Certain disorders are
required. Disorders may be caused by mutations in mitochondrial DNA caused by the disruption of one copy of a gene that reduces the protein
that result in a characteristic maternal inheritance pattern. Also, mutations level by half. Such a reduction is also called “haploinsufficiency.”
in genes carried on the X chromosome result in characteristic inheritance
patterns.
KERATOEPITHEILIN GENE
DOMINANT CORNEAL DYSTROPHIES
The autosomal dominant corneal dystrophies are an excellent example of recognition
dominant negative mutations that result in the formation of a toxic protein. sequence for
secretory homologous
Four types of autosomal dominant dystrophies that affect the stroma of the integrins
signal domains
cornea are well characterized1:
D1 D2 D3 D4
• Groenouw (granular) type I.
• Lattice type I.
• Avellino (combined granular-lattice).
• Reis–Bücklers.
Arg124 Cys (lattice type 1) Arg 555 Trp (Groenouw 2)
Although all four corneal dystrophies affect the anterior stroma, the Arg 124 His (Avellino) Arg 555 Glu (Reis—Bücklers dystrophy)
clinical and pathological features differ. The granular dystrophies typically
form discrete, white, localized deposits that may obscure vision progres- Fig. 1.2.1 Keratoepithelin Gene. Arrows point to the location of the reported 9
sively. Histopathologically, these deposits stain bright red with Masson mutations.
 1 PAX6 GENE MYOCILIN/TIGR PROTEIN GENE

Schematic gene structure

Genetics

ATG 5a TAA 368

leucine zipper
364
437
347 504aa
1 32 117 169

1 2 3 4 5 6 7 8 9 10 11 12 13 72 179 259 501

paired box homeobox PST domain signal peptide myosin (25%) olfactomedin (40%)
200 bp

Proposed protein structure

Fig. 1.2.2 The PAX6 Gene. (Data with permission from Glaser T, et al. PAX6 gene
mutations in aniridia. In: Wiggs JL, editor. Molecular genetics of ocular disease. New
York: Wiley–Liss; 1995. p. 51–82.) 119
126
130
123
Mutations in the PAX6 gene are responsible for aniridia, Peter’s 133
anomaly, and autosomal dominant keratitis.3 Most of the mutations
responsible for these disorders alter the paired-box sequence within the 122
gene (Fig. 1.2.2) and result in inactivation of one copy of the PAX6 gene. 166 159 134
The paired-box sequence is an important element that is necessary for 169 152
the regulatory function of the protein. Losing half the normal paired-box 158
129 127
sequence, and probably other regulatory elements within the gene, appears 147 145
to be the critical event that results in the associated ocular disorders. The
protein plays an important role in ocular development, presumably by reg-
ulating the expression of genes that are involved in embryogenesis of the 118 136 138
120
eye. A reduction in the amount of active gene product alters the expression
of these genes, which results in abnormal development. The genes that
code for the lens crystallin proteins are one class of genes developmentally 131
125
regulated by the PAX6 protein.
The clinical disorders caused by mutations in PAX6 exhibit extensive
phenotypic variability. Similar mutations may give rise to aniridia, Peter’s 132 124
anomaly, or autosomal dominant keratitis. Variation in the phenotype asso-
ciated with a mutation is termed “variable expressivity” and is a common arginine
feature of disorders that arise from haploinsufficiency. It is possible that 121 128 117
leucine
the variability of the mutant phenotype results from the random activation
of downstream genes that occurs when only half the required gene product
is available.
Fig. 1.2.3 MYOC (Myocilin). The myosin-like domain, the olfactomedin-like domain,
and the leucine zipper are indicated. Amino acids altered in patients with juvenile-
RIEGER’S SYNDROME or adult-onset glaucoma are shown. (Reprinted by permission of Federation of
Rieger’s syndrome is an autosomal dominant disorder of morphogenesis the European Biochemical Societies from Orteto J, Escribano J, Coca-Prados M.
that results in abnormal development of the anterior segment of the eye. Cloning and characterization of subtracted cDNAs from a human ciliary body library
encoding TIGR, a protein involved in juvenile open angle glaucoma with homology
Typical clinical findings may include posterior embryotoxon, iris hypopla-
to myosin and olfactomedin. FEBS Lett 1997;413:349–53.)
sia, iridocorneal adhesions, and corectopia. Approximately 50% of affected
individuals develop a high-pressure glaucoma associated with severe optic
nerve disease. The cause of the glaucoma associated with this syndrome
is not known, although anomalous development of the anterior chamber
JUVENILE GLAUCOMA
angle structures is usually found. Primary juvenile open-angle glaucoma is a rare disorder that develops
Genetic heterogeneity of Rieger’s syndrome is indicated by the variety during the first two decades of life. Affected patients typically present
of chromosomal abnormalities that have been associated with the condi- with a high intraocular pressure (IOP), which ultimately requires surgical
tion, including deletions of chromosome 4 and chromosome 13. Genes for therapy. Juvenile glaucoma may be inherited as an autosomal dominant
Rieger’s syndrome are located on chromosomes 4q25, 13q14, and 6p25. trait, and large pedigrees have been identified and used for genetic linkage
Iris hypoplasia is the dominant clinical feature of pedigrees linked to the analysis. One gene responsible for this condition, MYOC, codes for the
6p25 locus, whereas pedigrees linked to 4q25 and 13q14 demonstrate the myocilin protein and is located on chromosome 1q23 (GLC1A).
full range of ocular and systemic abnormalities found in these patients. Myocilin has been shown to be expressed in the human retina, ciliary
The genes located on chromosomes 4q25 and 6p25 have been identi- body, and trabecular meshwork. The protein has several functional
fied.4 The chromosome 4q25 gene (PITX2) codes for a bicoid homeobox domains, including a region homologous to a family of proteins called
transcription factor. Like PAX6, this gene is expressed during eye devel- olfactomedins. Although the function of the protein and the olfactome-
opment and is probably involved in the ocular developmental processes. din domain is not known, nearly all the mutations associated with glau-
The chromosome 6p25 gene FOXC1 (also called FKHL7) is a member coma have been found in the olfactomedin portion of the protein (Fig.
of a forkhead family of regulatory proteins. FOXC1 is expressed during 1.2.3).5 Mutations in myocilin also have been associated with some cases of
ocular development, and mutations alter the dosage of the gene product. adult-onset primary open-angle glaucoma. Patients with only one copy of
There is some indication that the FOXC1 protein and the PITX2 protein the myocilin gene (because of chromosomal deletion removing the second
interact during ocular development. The identification of other genes copy of the gene) or without any functional myocilin (caused by homo-
responsible for Rieger’s syndrome and anterior segment dysgenesis is zygosity of a stop-codon polymorphism in the first part of the gene) do
necessary to determine whether these genes are part of a common devel- not develop glaucoma. Collectively these results suggest that mutations
10 opmental pathway or represent redundant functions necessary for eye in myocilin cause a gain-of-function or dominant negative effect rather
development. than a loss-of-function or haploinsufficiency. The role of myocilin in IOP
elevation is not completely known, but in vitro studies show that myo- RETINITIS PIGMENTOSA
cilin mutants are misfolded and detergent resistant. Myocilin mutations
may be secretion incompetent and accumulate in the endoplasmic retic- The molecular genetics of retinitis pigmentosa (RP) is exceedingly complex. 1.2
ulum (ER) inducing ER stress. Recent studies using a transgenic mouse The disease can exhibit sporadic, autosomal dominant, autosomal reces-
model indicate that compounds that relieve ER stress can also reduce the sive, X-linked, or digenic inheritance. At least 200 genes are known to be

Molecular Genetics of Selected Ocular Disorders

mutation-associated elevation of IOP.6 associated with RP, and a number of genes have been mapped but not yet
found. Most of these genes are expressed preferentially in the retina, but
CONGENITAL GLAUCOMA some are expressed systemically. A useful resource listing genes respon-
sible for various forms of retinal diseases, including retinitis pigmentosa,
Congenital glaucoma is a genetically heterogeneous condition, with both can be found at the RetNet website (http://www.sph.uth.tmc.edu/Retnet/).
autosomal recessive and autosomal dominant forms reported. Two genes Mutations in rhodopsin can cause an autosomal dominant form of RP
responsible for autosomal recessive congenital glaucoma have been iden- that provides an interesting example of how mutant proteins can interfere
tified, CYP1B1, a member of the cytochrome P-450 family of proteins with normal cellular processes. Initially, one form of autosomal dominant
(cytochrome P-4501B1)7 and LTBP2 (latent transforming growth factor beta RP was mapped to chromosome 3q24. With a candidate gene approach,
binding protein 2).8 Mutations in CYP1B1 have been identified in patients the rhodopsin gene was identified as the cause of the disease in affected
with autosomal recessive congenital glaucoma from all over the world but families.14 Many of the first mutations detected in the rhodopsin protein
especially in areas where consanguinity is a custom.9 Responsible muta- were missense mutations located in the C-terminus of the gene (Fig. 1.2.4).
tions disrupt the function of the protein, implying that a loss of function To explore the pathogenical mechanisms of these mutations, transgenic
of the protein results in the phenotype.9 Recurrent mutations are likely to mice were created that carried mutant copies of the gene.15 Histopatho-
be the result of founder chromosomes that have been distributed to pop- logical studies of these mice showed an accumulation of vesicles that con-
ulations throughout the world.10,11 Because the defects responsible for con- tained rhodopsin at the junction between the inner and outer segments of
genital glaucoma are predominantly developmental, cytochrome P-4501B1 the photoreceptors. The vesicles probably interfere with the normal regen-
and latent transforming growth factor beta binding protein 2 must play a eration of the photoreceptors, thus causing photoreceptor degeneration.
direct or indirect role in the development of the anterior segment of the Because the C-terminus of the nascent polypeptide is involved in the trans-
eye. port of the maturing protein, the accumulation of rhodopsin-filled vesicles
is likely to result from abnormal transport of the mutant rhodopsin to the
NONSYNDROMIC CONGENITAL CATARACT membranes of the outer segments.
Null mutations (mutations that cause a prematurely shortened or trun-
At least one-third of all congenital cataracts are familial and are not asso- cated protein) also have been found in the rhodopsin gene in patients who
ciated with other abnormalities of the eye or with systemic abnormalities. have autosomal recessive retinitis pigmentosa (see Fig. 1.2.4).16 Mutations
A number of different genes can contribute to congenital cataract, includ- responsible for recessive disease typically cause a loss of biological activity,
ing some that code for the crystallin proteins.12 The human γ-crystallin
genes constitute a multigene family that contains at least seven highly
related members. All seven of the γ-crystallin genes have been assigned
to chromosome 2q34-q35. Of the genes mapped to this region, only two of
them, γ-C and γ-D, encode abundant proteins. Two of the genes, γ-E and TABLE 1.2.1 Web-Based Resources for
γ-F, are pseudogenes, which means they are not expressed in the normal Inherited Human Ocular Disorders
lens. A pedigree affected by the Coppock cataract, a congenital cataract that
involves primarily the embryonic lens, was shown to be linked genetically NCBI National Center for http://www.ncbi.nlm.nih.gov/
to the region that contains the γ-crystallin genes. In individuals affected by Biotechnology Information
the Coppock cataract, additional regulatory sequences have been found in OMIM Online Mendelian http://www.ncbi.nlm.nih.gov/omim
the promoter region of the γ-E pseudogene.13 This result implies that the Inheritance in Man
γ-E pseudogene is expressed in affected individuals and that expression of RetNet Retinal disease genes http://www.sph.uth.tmc.edu/Retnet/
the pseudogene is the event that leads to cataract formation. A number of Genes and Disease Systemic inherited disorders http://www.ncbi.nlm.nih.gov/books/
other genes have been associated with hereditary cataract. A useful col- (NCBI Bookshelf ) NBK22183/
lection of mutations and phenotypes can be found at the OMIM website UCSC Human genome sequence http://www.genome.ucsc.edu
(Table 1.2.1). browser

Fig. 1.2.4 Human Rhodopsin Mutations. The red

HUMAN RHODOPSIN MUTATIONS circles indicate the amino acids altered by mutations
in the gene in patients who have autosomal dominant
Autosomal dominant Autosomal recessive retinitis pigmentosa. The translational stop site that
results from a nonsense mutation is indicated as a red
circle in a patient who has autosomal recessive retinitis
C C pigmentosa.

N N

G90D P23H K296E A292E

K296M 11
 either because they create a defective protein product that has little or no atrophy, an autosomal recessive condition characterized by circular areas

1 biological activity or because they interfere with the normal expression of

the gene (regulatory mutations). Most individuals heterozygous for autoso-
mal recessive disorders are clinically normal. Unlike the missense muta-
of chorioretinal atrophy. Mutations in the gene for ornithine ketoacid ami-
notransferase mapped to chromosome 10q26 have been associated with
the disease in affected individuals.24 Most of the responsible mutations
tions responsible for the dominant form of the disease, the null mutations are missense mutations, which presumably result in an inactive enzyme.
Genetics

in rhodopsin produce an inactive protein that is not destructive to the cell. One mutation has been found in homozygous form in the vast majority of
Null mutations result in retinitis pigmentosa only when they are present apparently unrelated cases of gyrate atrophy in Finland, an example of a
in both copies of the gene. Mutations in just one copy of the gene (hetero- founder effect that produces a common mutation in an isolated population.
zygous individuals) do not have a clinically detectable phenotype. Identification of the enzyme defect responsible for this disease makes
it an interesting candidate for gene therapy. Previous studies indicated
STARGARDT DISEASE that a lower ornithine level, achieved through a strict low-arginine diet,
may retard the progression of the disease.25 Replacement of the abnormal
Stargardt disease is characterized by progressive bilateral atrophy of the gene—or genetic engineering to produce a supply of normal enzyme—
macular retinal pigment epithelium (RPE) and neuroepithelium, with the may result in a reduction of ornithine levels without dietary restrictions.
frequent appearance of orange–yellow flecks distributed around the macula.
The choroid is characteristically dark on fluorescein angiography in about
80% of cases. The disease results in a loss of central acuity that may have
COLOR VISION
a juvenile to adult onset and is inherited as an autosomal recessive trait. Defective red–green color vision affects 2%–6% of men and results from
Inactivation of both copies of the responsible gene is necessary to cause the a variety of defects that involve the color vision genes. In humans, the
disease. Mutations in a photoreceptor cell-specific ATP-binding transporter three cone pigments—blue, green, and red—mediate color vision. Each
gene (ABCA4 or ABCR) have been found in affected patients.17,18 Most visual pigment consists of an integral membrane apoprotein bound to
disease-related mutations are missense mutations in conserved amino the chromophore 11-cis retinal. The genes for the red and green pigments
acid positions. The retina-specific ABC transporter (ABCA4) responsible are located on the X chromosome, and the gene for the blue pigment is
for Stargardt disease is a member of a family of transporter proteins and located on chromosome 7. The X chromosome location of the red and green
is expressed in rod photoreceptors, which indicates that this protein medi- pigment genes accounts for the X-linked inheritance pattern observed in
ates the transport of an essential molecule either into or out of photore- red or green color vision defects.
ceptor cells. Accumulation of a lipofuscin-like substance in ABCA4-related The common variations in red or green color vision are caused by the
disease may result from inactivation of this transporter protein. loss of either the red or the green cone pigment (dichromasy) or by the
production of a visual pigment with a shifted absorption spectrum (anom-
X-LINKED JUVENILE RETINOSCHISIS alous trichromasy). A single amino acid change (serine to alanine) in the
red photopigment gene is the most common color vision variation. Among
Retinoschisis is a maculopathy caused by intraretinal splitting; the defect Caucasian men, 62% have serine at position 180 in the red pigment protein,
most likely involves retinal Müller cells. Retinoschisis is inherited as an and 38% have alanine in this position. Men who carry the red pigment
X-linked recessive trait. X-linked recessive disorders, like autosomal reces- with serine at position 180 have a greater sensitivity to long-wavelength
sive disorders, are caused by inactivating mutations. Because men have radiation than do men who carry alanine at this position.26 Recent work
only one X chromosome, one mutant copy of a gene responsible for an suggests that gene therapy could correct color vision defects.27
X-linked trait results in the disease. Usually women are heterozygous
carriers of recessive X-linked traits and do not demonstrate any clinical
abnormalities. Mutations in the gene coding for retinoschisin have been
RETINOBLASTOMA
shown to be the cause of the disease.19 The protein is involved in cell– A gene responsible for the childhood eye tumor retinoblastoma was identi-
cell interaction and may be active in cell adhesion processes during retinal fied in 1986 on chromosome 13q14.28 The gene product is involved in regu-
development. Most retinoschisis gene (XLRS1) mutations cause a loss of lation of the cell cycle. Absence of this protein in an embryonic retinal cell
protein function. results in the uncontrolled cell growth that eventually produces a tumor.29
Susceptibility to hereditary retinoblastoma is inherited as an autosomal
NORRIE’S DISEASE dominant trait. Mutations in the retinoblastoma gene result in underpro-
duction of the protein product or production of an inactive protein product.
Norrie’s disease is an X-linked disorder characterized by progressive, bilat- A retinal cell that has only one mutant copy of the retinoblastoma gene
eral, congenital blindness associated with retinal dysplasia that has been does not become a tumor. However, inactivation of the remaining normal
referred to as a “pseudoglioma.” The disease can include mental retar- copy of the retinoblastoma gene is very likely in at least one retinal cell
dation and hearing defects. Norrie’s disease is inherited as an X-linked out of the millions present in each retina. Among individuals who inherit
recessive trait, and a causative gene has been identified on the X chromo- a mutant copy of the retinoblastoma gene, 90% sustain a second hit to
some that has a tertiary structure similar to transforming growth factor-β.20 the remaining normal copy of the gene and develop a tumor (Fig. 1.2.5).30
Norrie’s disease is a member of the familial exudative vitreoretinopathy Fifty percent of the offspring of individuals affected by hereditary retino-
(FEVR) syndromes, which are genetically heterogeneous inherited blinding blastoma will inherit the mutant copy of the gene and are predisposed to
disorders of the retinal vascular system, and to date three other loci have develop the tumor. Approximately 10% of individuals who inherit a muta-
been mapped.21 Mutations in the Norrie’s disease gene have been found in tion do not sustain a second mutation and do not develop a tumor. The off-
a small subset of patients with severe retinopathy of prematurity (ROP), spring of these “carrier” individuals also have a 50% chance of inheriting
although defects in this gene do not appear to be a major factor in ROP.22 the mutant copy of the retinoblastoma gene (see Fig. 1.2.5).

SORSBY’S MACULAR DYSTROPHY ALBINISM

Sorsby’s macular dystrophy is an autosomal dominant disorder character- Autosomal recessive diseases often result from defects in enzymatic
ized by early onset bilateral and multifocal choroidal neovascularization proteins. Albinism is the result of a series of defects in the synthesis of
resulting in macular edema, hemorrhage, and exudation. The disease typ- melanin pigment.31 Melanin is synthesized from the amino acid tyrosine,
ically begins at about 40 years of age. Missense mutations in the gene that which is first converted into dihydroxyphenylalanine through the action of
codes for tissue inhibitor metalloproteinase-3 (TIMP-3) have been found in the copper-containing enzyme tyrosinase. An absence of tyrosinase results
affected individuals.23 This protein is involved in remodeling of the extra- in one form of albinism. Mutations in the gene that codes for tyrosinase
cellular matrix. Inactivation of the protein may lead to an increase in activ- are responsible for tyrosinase-negative ocular cutaneous albinism. Most of
ity of the metalloproteinase, which may contribute to the pathogenesis of the mutations responsible for this disease cluster in the binding sites for
the disease.23 copper and disrupt the metal ion–protein interaction necessary for enzyme
function.32 Both copies of the gene for tyrosinase must be mutated before a
GYRATE ATROPHY significant interruption of melanin production occurs. Heterozygous indi-
viduals do not have a clinically apparent phenotype, which suggests that
12 Hyperornithinemia results from deficiency of the enzyme ornithine one functional copy of the gene produces sufficient active enzyme for the
ketoacid aminotransferase and has been shown to be the cause of gyrate melanin level to be phenotypically normal (Fig. 1.2.6).
LEBER’S OPTIC NEUROPATHY of the disease, all affected individuals were related through the maternal

Mutations in mitochondrial DNA are an important cause of human

lineage, consistent with inheritance of human mitochondrial DNA.
Patients affected by LHON typically present in midlife with acute or 1.2
disease. Disorders that result from mutations in mitochondrial DNA subacute, painless, central vision loss that results in a permanent central
demonstrate a maternal inheritance pattern. Maternal inheritance differs scotoma and loss of sight. The manifestation of the disease varies tremen-

Molecular Genetics of Selected Ocular Disorders

from mendelian inheritance, in that men and women are affected equally, dously, especially with respect to onset of visual loss and severity of the
but only affected females transmit the disease to their offspring. The char- outcome. The eyes may be affected simultaneously or sequentially; the
acteristic segregation and assortment of mendelian disorders depend on disease may progress rapidly over a period of weeks to months or slowly
the meiotic division of maternal and paternal chromosomes found in over several years. Within a family, the disease may also vary among
the nucleus of cells. In contrast, mitochondrial DNA is derived from the affected members.
maternal egg and replicates and divides with the cell cytoplasm by simple Several factors contribute to the variable phenotype of this condition.
fission. A mutation that occurs in mitochondrial DNA is present in all cells Certain mutations are associated with more severe disease, and some
of the organism, which includes the gametes. Female eggs have abnormal mitochondrial DNA haplotypes appear to be associated with more severe
mitochondria that may be passed to offspring. Sperm contain mitochon- disease.34 Another important factor that affects the severity of the disease
dria but do not transmit mitochondria to the fertilized egg. A man who is the heteroplasmic distribution of mutant and normal mitochondria. Not
carries a mitochondrial DNA mutation may be affected by the disease, but all mitochondria present in diseased tissue carry DNA mutations. During
he cannot transmit the disease to his offspring. cell division, mitochondria and other cytoplasmic organelles are distrib-
Leber’s hereditary optic neuropathy (LHON) was one of the first dis- uted arbitrarily to the daughter cells. Consequently, the daughter cells
eases to be recognized as a mitochondrial DNA disorder.33 In familial cases are likely to have unequal numbers of mutant and normal mitochondria
(Fig. 1.2.7). Because the diseased mitochondria are distributed to develop-
ing tissues, some tissues accumulate more abnormal mitochondria than
INHERITANCE OF RETINOBLASTOMA others. Hence, some individuals have more abnormal mitochondria in the
optic nerve and develop a more severe optic neuropathy.

retina tumor CONGENITAL FIBROSIS SYNDROMES AND

DISORDERS OF AXON GUIDANCE
gametes Congenital fibrosis of the extraocular muscles and Duane’s syndrome are
inherited forms of congenital fibrosis and strabismus. At least 20 genes con-
tribute to these conditions and other disorders of axon guidance,35 with the
ARIX/PHOX2A genes causing congenital fibrosis of extraocular muscles
type 236 and the SALL4 gene causing Duane’s radial ray syndrome.37
50% 50%

retina AUTOSOMAL DOMINANT OPTIC ATROPHY

Of the inherited optic atrophies, autosomal dominant Kjer optic atrophy
gametes is the most common. This disease results in a progressive loss of visual
acuity, centrocecal scotoma, and bilateral temporal atrophy of the optic
nerve. The onset is typically in the first two decades of life. The condition
is inherited as an autosomal dominant trait with variable expressivity, and
10% 90%
mutations in OPA1 have been found in a number of affected families.38,39
no second hit second hit
OPA1 codes for a dynamin-related GTPase that is targeted to mitochon-
dria and may function to stabilize mitochondrial membrane integrity. It
normal is interesting that this gene and the gene responsible for another optic
retina atrophy, Leber’s hereditary optic atrophy (see earlier), both function in the
affected tumor
mitochondria, emphasizing the critical role of mitochondria in optic nerve
function.

Fig. 1.2.5 Inheritance of Retinoblastoma. Individuals who inherit a mutation in COMPLEX TRAITS
the retinoblastoma gene are heterozygous for the mutation in all cells of the body.
The “second hit” to the remaining normal copy of the gene occurs in a developing Human phenotypes inherited as polygenic or “complex” traits do not follow
retinal cell and leads to tumor formation (see text for explanation). the typical patterns of mendelian inheritance. Complex traits are relatively

Fig. 1.2.6 Metabolism of Tyrosine to Produce

METABOLISM OF TYROSINE TO PRODUCE MELANIN Melanin. In the final step, dopamine is converted into
an indole derivative that condenses to form the high-
molecular-weight pigment melanin.
NH3 O2 H 2O NH3 CO2
CH2CHCOO 
CH2CHCOO CH2CH2NH3

melanin
OH
OH dihydrobiopterin OH OH

tetrahydrobiopterin

tyrosine tyrosine hydroxylase dihydroxyphenylalanine dopamine

13
 common disorders. Generally, DNA variants associated with these disor-

1 HETEROPLASMY IN MITOCHONDRIA ders are not causal but influence disease suspectibility.40 Environmental
factors may also contribute to complex disease risk. For example, genetic
variants in complement factor H (CFH) and LOC37718 are known to be
nucleus
major genetic risk factors for age-related macular degeneration,41–44 and
Genetics

normal mitochondrion combined with smoking the risk is increased.45 The genome-wide associa-
mutant mitochondrion tion study (GWAS) approach has also successfully identified genes contrib-
uting to other common complex ocular conditions and traits,40 including
primary open-angle glaucoma,46,47 primary angle-closure glaucoma,48 exfo-
liation syndrome and glaucoma,49,50 myopia,51,52 and Fuchs’ endothelial
cell division dystrophy.53

KEY REFERENCES
Alexander C, Votruba M, Pesch UE, et al. OPA1, encoding a dynamin-related GTPase, is
mutated in autosomal dominant optic atrophy linked to chromosome 3q28. Nat Genet
2000;26:211–15.
Baratz KH, Tosakulwong N, Ryu E, et al. E2-2 protein and Fuchs’s corneal dystrophy. N Engl
J Med 2010;363:1016–24.
Cooke Bailey JN, Sobrin L, Pericak-Vance MA, et al. Advances in the genomics of common
eye diseases. Hum Mol Genet 2013;22(R1):R59–65.
replication and cell division Engle EC. Human genetic disorders of axon guidance. Cold Spring Harb Perspect Biol
2010;2:a001784.
Hysi PG, Young TL, Mackey DA, et al. A genome-wide association study for myopia and
refractive error identifies a susceptibility locus at 15q25. Nat Genet 2010;42:902–5.
Klein RJ, Zeiss C, Chew EY, et al. Complement factor H polymorphism in age-related
macular degeneration. Science 2005;308:385–9.
Neitz J, Neitz M. The genetics of normal and defective color vision. Vision Res 2011;51:633–51.
Sergouniotis PI, Davidson AE, Lenassi E, et al. Retinal structure, function, and molecular
pathologic features in gyrate atrophy. Ophthalmology 2012;119:596–605.
Thorleifsson G, Magnusson KP, Sulem P, et al. Common sequence variants in the LOXL1
gene confer susceptibility to exfoliation glaucoma. Science 2007;317:1397–400.
Zode GS, Bugge KE, Mohan K, et al. Topical ocular sodium 4-phenylbutyrate rescues glau-
coma in a myocilin mouse model of primary open-angle glaucoma. Invest Ophthalmol
Vis Sci 2012;53:1557–65.
Fig. 1.2.7 Heteroplasmy in Mitochondria. Daughter cells that result from the
division of a cell that contains mitochondria with mutant DNA may contain unequal
numbers of mutant mitochondria. Subsequent divisions lead to a population of cells Access the complete reference list online at ExpertConsult.com
with different numbers of normal and abnormal mitochondria.

14
REFERENCES 26. Neitz J, Neitz M. The genetics of normal and defective color vision. Vision Res
2011;51:633–51.
1. Musch DC, Niziol LM, Stein JD, et al. Prevalence of corneal dystrophies in the United
States: estimates from claims data. Invest Ophthalmol Vis Sci 2011;52:6959–63.
27. Mancuso K, Hauswirth WW, Li Q, et al. Gene therapy for red-green colour blindness in
adult primates. Nature 2009;461:784–7.
1.2
2. Kannabiran C, Klintworth GK. TGFBI gene mutations in corneal dystrophies. Hum 28. Friend SH, Bernards R, Rogelj S, et al. A human DNA segment with properties of the
gene that predisposes to retinoblastoma and osteosarcoma. Nature 1986;643–6.

Molecular Genetics of Selected Ocular Disorders

Mutat 2006;27:615–25.
3. Kokotas H, Petersen MB. Clinical and molecular aspects of aniridia. Clin Genet 29. Manning AL, Dyson NJ. RB: mitotic implications of a tumour suppressor. Nat Rev
2010;77:409–20. Cancer 2012;12:220–6.
4. Hjalt TA, Semina EV. Current molecular understanding of Axenfeld–Rieger syndrome. 30. Dimaras H, Kimani K, Dimba EA, et al. Retinoblastoma. Lancet 2012;379:1436–46.
Expert Rev Mol Med 2005;7:1–17. 31. Tomita Y, Suzuki T. Genetics of pigmentary disorders. Am J Med Genet C Semin Med
5. Hewitt AW, Mackey DA, Craig JE. Myocilin allele-specific glaucoma phenotype database. Genet 2004;131C(1):75–81.
Hum Mutat 2008;29:207–11. 32. Ray K, Chaki M, Sengupta M. Tyrosinase and ocular diseases: some novel thoughts on the
6. Zode GS, Bugge KE, Mohan K, et al. Topical ocular sodium 4-phenylbutyrate rescues molecular basis of oculocutaneous albinism type 1. Prog Retin Eye Res 2007;26:323–58.
glaucoma in a myocilin mouse model of primary open-angle glaucoma. Invest Ophthal- 33. Wallace DC, Singh G, Lott MT, et al. Mitochondrial DNA mutation associated with
mol Vis Sci 2012;53:1557–65. Leber’s hereditary optic neuropathy. Science 1988;242:1427–30.
7. Bejjani BA, Stockton DW, Lewis RA, et al. Multiple CYP1B1 mutations and incomplete 34. Ji Y, Zhang AM, Jia X, et al. Mitochondrial DNA haplogroups M7b1’2 and M8a affect
penetrance in an inbred population segregating primary congenital glaucoma suggest clinical expression of Leber hereditary optic neuropathy in Chinese families with the
frequent de novo events and a dominant modifier locus. Hum Mol Genet 2000;9:367–74. m.11778G→a mutation. Am J Hum Genet 2008;83:760–8.
8. Narooie-Nejad M, Paylakhi SH, Shojaee S, et al. Loss of function mutations in the gene 35. Engle EC. Human genetic disorders of axon guidance. Cold Spring Harb Perspect Biol
encoding latent transforming growth factor beta binding protein 2, LTBP2, cause primary 2010;2:a001784.
congenital glaucoma. Hum Mol Genet 2009;18:3969–77. 36. Nakano M, Yamada K, Fain J, et al. Homozygous mutations in ARIX (PHOX2A) result in
9. Li N, Zhou Y, Du L, et al. Overview of cytochrome P450 1B1 gene mutations in patients congenital fibrosis of the extraocular muscles type 2. Nat Genet 2001;29:315–20.
with primary congenital glaucoma. Exp Eye Res 2011;93:572–9. 37. Al-Baradie R, Yamada K, St Hilaire C, et al. Duane radial ray syndrome (Okihiro syn-
10. Chakrabarti S, Kaur K, Kaur I, et al. Globally, CYP1B1 mutations in primary congenital drome) maps to 20q13 and results from mutations in SALL4, a new member of the SAL
glaucoma are strongly structured by geographic and haplotype backgrounds. Invest Oph- family. Am J Hum Genet 2002;71:1195–9.
thalmol Vis Sci 2006;47:43–7. 38. Alexander C, Votruba M, Pesch UE, et al. OPA1, encoding a dynamin-related GTPase, is
11. Sena DF, Finzi S, Rodgers K, et al. Founder mutations of CYP1B1 gene in patients with mutated in autosomal dominant optic atrophy linked to chromosome 3q28. Nat Genet
congenital glaucoma from the United States and Brazil. J Med Genet 2004;41:e6. 2000;26:211–15.
12. Hejtmancik JF. Congenital cataracts and their molecular genetics. Semin Cell Dev Biol 39. Yu-Wai-Man P, Griffiths PG, Chinnery PF. Mitochondrial optic neuropathies – disease
2008;19:134–49. mechanisms and therapeutic strategies. Prog Retin Eye Res 2011;30:81–114.
13. Héon E, Priston M, Schorderet DF, et al. The gamma-crystallins and human cataracts: a 40. Cooke Bailey JN, Sobrin L, Pericak-Vance MA, et al. Advances in the genomics of
puzzle made clearer. Am J Hum Genet 1999;65:1261–7. common eye diseases. Hum Mol Genet 2013;22(R1):R59–65.
14. Dryja TP, McGee TL, Reichel E, et al. A point mutation of the rhodopsin gene in one 41. Klein RJ, Zeiss C, Chew EY, et al. Complement factor H polymorphism in age-related
form of retinitis pigmentosa. Nature 1990;343:364–6. macular degeneration. Science 2005;308:385–9.
15. Li T, Snyder WK, Olsson JE, et al. Transgenic mice carrying the dominant rhodopsin 42. Edwards AO, Ritter R 3rd, Abel KJ, et al. Complement factor H polymorphism and
mutation P347S: evidence for defective vectorial transport of rhodopsin to the outer seg- age-related macular degeneration. Science 2005;308:421–4.
ments. Proc Natl Acad Sci USA 1996;93:14176–81. 43. Haines JL, Hauser MA, Schmidt S, et al. Complement factor H variant increases the risk
16. Rosenfeld PJ, Cowley GS, McGee TL, et al. A null mutation in the rhodopsin gene of age-related macular degeneration. Science 2005;308:419–21.
caused rod photoreceptor dysfunction and autosomal recessive retinitis pigmentosa. Nat 44. Rivera A, Fisher SA, Fritsche LG, et al. Hypothetical LOC387715 is a second major sus-
Genet 1992;1:209–13. ceptibility gene for age-related macular degeneration, contributing independently of
17. Allikmets R, Singh N, Sun H, et al. A photoreceptor cell-specific ATP-binding trans- complement factor H to disease risk. Hum Mol Genet 2005;14:3227–36.
porter gene (ABCR) is mutated in recessive Stargardt macular dystrophy. Nat Genet 45. Schmidt S, Hauser MA, Scott WK, et al. Cigarette smoking strongly modifies the
1997;15:236–46. association of LOC387715 and age-related macular degeneration. Am J Hum Genet
18. Vasireddy V, Wong P, Ayyagari R. Genetics and molecular pathology of Stargardt-like 2006;78:852–64.
macular degeneration. Prog Retin Eye Res 2010;29:191–207. 46. Thorleifsson G, Walters GB, Hewitt AW, et al. Common variants near CAV1 and CAV2
19. Vijayasarathy C, Ziccardi L, Sieving PA. Biology of retinoschisin. Adv Exp Med Biol are associated with primary open-angle glaucoma. Nat Genet 2010;42:906–9.
2012;723:513–18. 47. Bailey JN, Loomis SJ, Kang JH, et al. Genome-wide association analysis identifies
20. Nikopoulos K, Venselaar H, Collin RW, et al. Overview of the mutation spectrum in TXNRD2, ATXN2 and FOXC1 as susceptibility loci for primary open-angle glaucoma.
familial exudative vitreoretinopathy and Norrie disease with identification of 21 novel Nat Genet 2016;48(2):189–94.
variants in FZD4, LRP5, and NDP. Hum Mutat 2010;31:656–66. 48. Khor CC, Do T, Jia H, et al. Genome-wide association study identifies five new suscepti-
21. Toomes C, Downey LM, Bottomley HM, et al. Further evidence of genetic heterogeneity bility loci for primary angle closure glaucoma. Nat Genet 2016;48(5):556–62.
in familial exudative vitreoretinopathy: exclusion of EVR1, EVR3, and EVR4 in a large 49. Thorleifsson G, Magnusson KP, Sulem P, et al. Common sequence variants in the
autosomal dominant pedigree. Br J Ophthalmol 2005;89:194–7. LOXL1 gene confer susceptibility to exfoliation glaucoma. Science 2007;317:1397–400.
22. Hutcheson KA, Paluru PC, Bernstein SL, et al. Norrie disease gene sequence variants 50. Aung T, Ozaki M, Lee MC, et al. Genetic association study of exfoliation syndrome
in an ethnically diverse population with retinopathy of prematurity. Mol Vis 2005;11: identifies a protective rare variant at LOXL1 and five new susceptibility loci. Nat Genet
501–8. 2017;49(7):993–1004.
23. Li Z, Clarke MP, Barker MD, et al. TIMP3 mutation in Sorsby’s fundus dystrophy: 51. Solouki AM, Verhoeven VJ, van Duijn CM, et al. A genome-wide association study
molecular insights. Expert Rev Mol Med 2005;7:1–15. identifies a susceptibility locus for refractive errors and myopia at 15q14. Nat Genet
24. Sergouniotis PI, Davidson AE, Lenassi E, et al. Retinal structure, function, and molecular 2010;42:897–901.
pathologic features in gyrate atrophy. Ophthalmology 2012;119:596–605. 52. Hysi PG, Young TL, Mackey DA, et al. A genome-wide association study for myopia and
25. Caruso RC, Nussenblatt RB, Csaky KG, et al. Assessment of visual function in patients refractive error identifies a susceptibility locus at 15q25. Nat Genet 2010;42:902–5.
with gyrate atrophy who are considered candidates for gene replacement. Arch Ophthal- 53. Baratz KH, Tosakulwong N, Ryu E, et al. E2-2 protein and Fuchs’s corneal dystrophy. N
mol 2001;119:667–9. Engl J Med 2010;363:1016–24.

14.e1
Part 1 Genetics


Genetic Testing and Genetic Counseling

Janey L. Wiggs 1.3
Definition: A genetic test is any clinical or laboratory investigation Methods for DNA-Based Genetic Testing
that provides information about the likelihood that an individual is Although genetic testing can be performed using DNA, RNA, or protein,
affected with a heritable disease. The majority of genetic tests are based DNA is the easiest to work with, and most genetic tests use this as the
on molecular evaluations of genomic DNA designed to identify the DNA starting material. A biological sample from the patient is needed before
mutations responsible for the disease. genetic testing can be performed. The inclusion of family members may
help the evaluation, but they are not absolutely required. DNA for testing
can be obtained from a number of sources, including blood samples,
mouthwash samples or buccal swabs, archived pathology specimens, or
from hair.4–6
Key Features Genomic DNA sequencing is the most commonly used method to detect
• Indications and methods for genetic testing for ocular disorders. mutations. For many disorders, sequencing the entire responsible gene is
• Genetic counseling and ethical issues. necessary, including all exons, immediate flanking intron sequences with
splice signals and 5′ and 3′ flanking regulatory regions. Some disorders
are caused by a specific mutation in a gene, and genetic testing can be
limited to an evaluation of a single gene. For other diseases, however, such
as the inherited retinal degenerations, sequencing multiple genes may
GENETIC TESTING be required before a causative mutation is identified. For diseases with
Role of Genetic Testing in the Clinic many causative genes, a panel test that allows for sequencing all genes at
once is both more effective and more efficient.7 Alternatively, whole exome
DNA-based genetic tests can identify individuals at risk for disease before sequencing (WES) that captures and sequences all coding regions of the
any clinical evidence is present (presymptomatic testing).1 This informa- genome can also be a preferred approach for disorders with many possi-
tion coupled with effective genetic counseling and clinical screening can ble genetic mutations.8 Genomic DNA sequencing will not usually identify
be useful. An effective presymptomatic test needs to meet the specificity large chromosomal abnormalities, including large copy number variations
and sensitivity expectations for any clinical test. Sensitivity is the number (deletions or insertions) or chromosomal translocations. Other techniques
of affected individuals that are positive for a test compared with the total are necessary to detect large chromosomal abnormalities, including karyo-
number of affected individuals (including those that tested negative for typing and multiplex ligation-dependent probe amplification (MLPA).9,10
the test). Specificity is the number of unaffected individuals that are nega- For diseases that are caused primarily by a limited set of mutations (for
tive for the test compared with the total number of unaffected individuals example, the three mutations that commonly cause Leber’s hereditary
tested (including those that tested positive for the test) (Fig. 1.3.1). optic neuropathy (LHON),11 specific tests such as allele-specific polymerase
The identification of a mutation responsible for a disease through chain reaction (PCR) amplification or TaqMan assays can be used and can
DNA-based genetic testing can establish a molecular diagnosis. For some be more efficient than sequencing the entire gene (Table 1.3.1).
disorders, such as juvenile open-angle glaucoma caused by mutations in
MYOC,2 specific mutations have been correlated with severity of disease or Current Recommendations for Genetic Testing for
other clinical features that are useful prognostically. A molecular diagnosis
may also help guide therapy and is required before gene-based therapies Ophthalmic Diseases
can be utilized. For example, mutations in a number of different genes can Currently, genetic testing is indicated for patients with clinical evidence
cause Leber’s hereditary amaurosis, but only those patients with disease of a disorder whose causative genes have been identified and for which
due to mutations in RPE65 will benefit from novel RPE65-based therapies
using gene replacement.3
TABLE 1.3.1 Common Types of Genetic Tests
Method Indication Example
Single gene DNA Different mutations distributed Sequencing OPA1 in patients
sequencing throughout a single gene are with autosomal dominant
Fig. 1.3.1 Definition of known to cause the inherited optic neuropathy
SPECIFICITY AND SENSITIVITY Sensitivity and Specificity condition
for a Laboratory Test. Multiple gene DNA Mutations in multiple genes are Inherited retinal
Sensitivity is defined as sequencing known to cause the condition degenerations
the number of affected Multiplex ligation- Detects deletions and MLPA testing for PAX6
individuals positive for dependent probe duplications in genes known to deletions in patients with
Affected Unaffected
the test (A) divided by the amplification (MLPA) cause the condition and that aniridia
individuals individuals
total number of affected may be missed by sequence-
Individuals individuals tested (A + C). based approaches
A B Specificity is defined as TaqMan assay or Detects a single DNA base pair Three mutations commonly
positive for test
the number of unaffected allele-specific assay change and is used if a small cause Leber’s hereditary
Individuals individuals negative for set of mutations are primarily optic neuropathy (LHON)
C D the cause of the condition
negative for test the test (D) divided by the
total number of unaffected Karyotype Detects large chromosomal Down syndrome
A D individuals tested (B + D). rearrangements including
Sensitivity Specificity
A+C B+D
deletions, duplications, and
translocations
15
 the identification of the genetic mutation contributing to the disease has (3) understand the alternatives for dealing with the risk of recurrence, (4)

1 sufficient specificity and sensitivity that testing will be clinically useful.

Serious failures of a diagnostic test are false positives (individuals without
the disease who test positively) and false negatives (individuals with the
choose a course of action that seems to them appropriate in their view
of their risk, their family goals, and their ethical and religious standards
and act in accordance with that decision, and (5) to make the best possible
disease who test negatively). Although genes have been identified for adjustment to the disorder in an affected family member and/or to the risk
Genetics

some common complex disorders such as age-related macular degenera- of recurrence of that disorder.
tion, primary open-angle glaucoma, and exfoliation syndrome, in general,
testing for these mutations is not sufficiently sensitive and specific that the
test results are clinically meaningful. For example, over 90% of patients
with exfoliation syndrome carry one of two missense changes in LOXL1;
Clinical Evaluation and Family History
however, up to 80% of normal individuals also carry these same DNA An accurate diagnosis is the first step in productive genetic counseling.
sequence variants.12 Clearly the identification of these missense mutations The patient–physician discussion of the natural history of the disease and
alone is not clinically useful. Examples of genetic tests that are useful of its prognosis and management is entirely dependent on the correct
include RPE65 for Leber’s hereditary amaurosis,13 PAX6 for aniridia,14 identification of the disorder that affects the patient. Risk assessment for
MYOC for early onset primary open-angle glaucoma,15 and OPA1 for optic other family members and options for prenatal diagnosis also depend on
neuropathy,16 as well as many other genes that are known to cause inher- an accurate diagnosis. In some cases, appropriate genetic testing may help
ited ocular conditions.17 establish the diagnosis. Examination of other family members may be
indicated to determine whether a particular finding is hereditary.
CLIA Laboratories A complete family history of the incidence of the disorder is neces-
sary to determine the pattern of inheritance of the condition. The mode
Laboratories in the United States offering genetic testing must comply with of inheritance (i.e., autosomal dominant, autosomal recessive, X-linked, or
regulations under the Clinical Laboratory Improvement Amendments of maternal) must be known to calculate the recurrence risk to additional
1988 (CLIA). The Centers for Medicare and Medicaid Services administers family members, and it helps confirm the original diagnosis. For the
CLIA and requires that laboratories meet certain standards related to per- record of family information, the gender and birth date of each individual
sonnel qualifications, quality control procedures, and proficiency testing and his or her relationship to other family members are indicated using
programs in order to receive certification. This regulatory system was put in the standard pedigree symbols. It is also helpful to record the age of onset
place to encourage safe, accurate, and accessible genetic tests. In addition of the disorder in question (as accurately as this can be determined). The
to ensuring that consumers have access to genetic tests that are safe, accu- pedigree diagram must include as many family members as possible. Mis-
rate, and informative, these policies encourage the development of genetic carriages, stillbirths, and consanguineous parents are indicated.
tests, genetic technologies, and the industry that produces these products. Occasionally a patient may appear to be affected by a condition that is
A number of CLIA-certified laboratories performing genetic testing for eye known to be inherited, but the patient is unable to provide a family history
diseases exist in the United States. For a list of CLIA-certified laborato- of the disease. Several important explanations for a negative family history
ries participating in the National Eye Institute (NEI)-sponsored eyeGENE must be considered before the conclusion is made that the patient does
network, see the NEI website at http://www.nei.nih.gov. CLIA-certified lab- not have a heritable condition. First, the patient may not be aware that
oratories offering genetic testing can also be found at GeneTests: https:// other family members are affected by the disease. Individuals frequently
www.genetests.org/. are reluctant to share information about medical problems, even with close
family members. Second, many disorders exhibit variable expressivity or
Genetic Reports reduced penetrance, which means that other family members may carry a
defective gene that is not expressed or results in only a mild form of the
A genetic test report is a sensitive document that is the main form of com- disease that is not readily observed. Third, false paternity may produce an
munication between the CLIA laboratory and the physician requesting the individual affected by a disease that is not found in anyone else belonging
genetic test. Genetic test reports may be shared with the patient and with to the acknowledged pedigree. Genetic testing can easily determine the
genetic counselors. The report should include (1) the type of genetic test paternity (and maternity) of any individual if blood samples are obtained
performed (i.e., sequencing or other methodology), (2) the gene or genes from relevant family members. Fourth, a new mutation may arise that
that were evaluated, (3) the results of the testing, (4) information about the affects an individual and may be passed to offspring, even though existing
pathogenicity of the sequence variants, (5) recommendations for clinical family members show no evidence of the disease.
follow-up based on the results of testing, and (6) literature references pro-
viding additional information about the genes and mutations responsible Risk Prediction Based on Inheritance
for the disease. The report should be written clearly and have appropriate
contact information. Once the diagnosis and family history of the disorder are established, risk
Novel DNA sequence changes are frequently found as a result of prediction in other family members (existing and unborn) may be calcu-
genomic DNA sequencing. New DNA sequence changes (variants) may lated. The chance that an individual known to be affected by an autosomal
be benign polymorphisms or causative mutations. Additional studies must dominant disorder will transmit the disease to his or her offspring is 50%.
be done before the sequence change can be designated as disease causing. This figure may be modified depending on the penetrance of the condition.
Demonstrating that the mutant protein has an abnormal function or eval- For example, retinoblastoma is inherited as an autosomal dominant trait,
uation of the mutant gene in an animal model would be an ideal test of and 50% of the children of an affected parent should be affected. However,
pathogenicity, but these approaches are time consuming and may not be usually only 40%–45% of the children at risk are affected, because the pen-
possible. Current approaches to evaluate the pathogenicity of a novel DNA etrance of the retinoblastoma trait is only 80%–90%, which means that
sequence variant are based on (1) population data, (2) computational and 5%–10% of children who have inherited an abnormal copy of the retino-
predictive data from in silico estimates for pathogenicity such as SIFT18 and blastoma gene do not develop ocular tumors.
PolyPhen-2,19 (3) functional data, and (4) segregation data for families.20 An individual affected by an autosomal recessive trait will have unaf-
fected children unless he or she partners with another individual affected
GENETIC COUNSELING by the disease or with an individual who is a carrier of the disease. Two
individuals affected by an autosomal recessive disease produce only
Genetic counseling has become an important part of any clinical medicine affected offspring. (There are some rare exceptions to this rule. If the
practice. In 1975 the American Society of Human Genetics adopted this disease is the result of mutations in two different genes, it is possible for
descriptive definition of genetic counseling21: two individuals affected by an autosomal recessive trait to produce normal
children. Also, in rare cases, different mutations in the same gene may
Genetic counseling is a communication process which deals with the compensate for each other, and the resultant offspring will be normal.)
human problems associated with the occurrence or risk of occurrence of If an individual affected by an autosomal recessive disease partners with
a genetic disorder in a family. This process involves an attempt by one or a heterozygous carrier of a gene defect responsible for that disorder, the
more appropriately trained persons to help the individual or family to (1) chance of producing an affected child is 50%. Among the offspring of an
comprehend the medical facts including the diagnosis, probable course of individual affected by an autosomal recessive disease, 50% will be carriers
16 the disorder, and the available management, (2) appreciate the way heredity of the disorder. If one of these offspring partners with another carrier of
contributes to the disorder and the risk of recurrence in specified relatives, the disease, the chance of producing an affected child is 25%.
 BOX 1.3.1 Types of Clinical Genetics Services and Programs
Indications to Refer for Genetic Counseling
Center-Based Genetics Clinic
Known Inherited Condition 1.3
• Outreach clinics Genetic counseling can be useful for a family with a member affected
• Inpatient consultations by an established diagnosis. In this case the goal of the counseling is to

Genetic Testing and Genetic Counseling

describe recurrence risks for other family members. For example, if a
Specialty Clinics child has retinoblastoma and a positive family history, the family may be
• Metabolic clinic referred for genetic counseling to review recurrence risks. If diagnostic
• Spina bifida clinic testing has been performed, that can also be discussed and will aid in the
• Hemophilia clinic presentation of the recurrence risks, especially if other family members
• Craniofacial clinic have been tested.
• Other single-disorder clinics (e.g., neurofibromatosis type 1 clinic)
Prenatal Diagnosis Program: Perinatal Genetics
Ocular and Systemic Congenital Anomalies
• Amniocentesis/chorionic villus sampling clinics Individuals with multiple ocular and systemic anomalies may or may
• Ultrasound program not fit into a particular syndrome. In these situations, the experience of
• Maternal serum α-fetoprotein program a geneticist in recognizing malformation patterns and understanding the
variability of genetic conditions can aid diagnosis. If an underlying cause
Genetic Screening is identified, relatives can then undergo genetic counseling.
• Newborn screening program/follow-up clinic
• Other population-screening programs (e.g., for Tay–Sachs disease) Specific Eye Diseases
Education/Training
A genetic evaluation is important for families with inherited eye diseases.
• Healthcare professional Many ophthalmological diseases have a well-documented inheritance
• General public pattern, and describing the inheritance to family members may help
• School system identify affected relatives who could be diagnosed and treated early in the
• Teratology information services course of the disease. This is especially important in families with condi-
tions such as dominantly inherited juvenile glaucoma.

Ocular Defects Associated With Genetic Diseases

Many genetic diseases have associated ocular defects. For example, a diag-
nosis of neurofibromatosis type 1 may be made in a child because Lisch
nodules were detected on a clinical examination.23 The child and family
should be referred for genetic counseling to help define the recurrence
X-linked disorders are always passed from a female carrier who has risks for other family members.
inherited a copy of an abnormal gene on the X chromosome received from
either her mother (who was a carrier) or her father (who was affected by Confidentiality
the disease). Man-to-man transmission is not seen in diseases caused
by defects in genes located on the X chromosome. Among sons born to Confidentiality is an important issue in genetic testing and genetic coun-
female carriers of X-linked disorders, 50% are affected by the disease, and seling. Confidentiality issues should be discussed before the initiation of
50% of daughters born to female carriers of X-linked disorders are carriers testing so there is consensus on how results are reported, who receives
of the disease. All the daughters of men affected by X-linked disorders are results, and where the information is documented.
carriers of the disease.
Mitochondrial disorders are inherited by sons and daughters from
the mother. The frequency of affected offspring and the severity of the
KEY REFERENCES
disease in affected offspring depend on the number of abnormal mito- Consugar MB, Navarro-Gomez D, Place EM, et al. Panel-based genetic diagnostic testing
for inherited eye diseases is highly accurate and reproducible, and more sensitive for
chondria present in the egg that gives rise to the affected child. Diseased variant detection, than exome sequencing. Genet Med 2015;17(4):253–61.
and normal mitochondria are distributed randomly in all cells of the body, Feero WG, Guttmacher AE, Collins FS. Genomic medicine – an updated primer. N Engl J
including the female gametes. As a result, not all the eggs present in a Med 2010;362:2001–11.
woman affected by a mitochondrial disorder have the same number of Kwon YH, Fingert JH, Kuehn MH, et al. Primary open-angle glaucoma. N Engl J Med
2009;360:1113–24.
affected mitochondria (heteroplasmy). Men affected by mitochondrial dis- Maguire AM, Simonelli F, Pierce EA, et al. Safety and efficacy of gene transfer for Leber’s
orders only rarely have affected children, because very few mitochondria congenital amaurosis. N Engl J Med 2008;358:2240–8.
in the developing embryo are derived from the sperm used to fertilize Muto R, Yamamori S, Ohashi H, et al. Prediction by FISH analysis of the occurrence of
the egg.22 Wilms tumor in aniridia patients. Am J Med Genet 2002;108:285–9.
With careful diagnosis and family history assessment, even sporadic Sim NL, Kumar P, Hu J, et al. SIFT web server: predicting effects of amino acid substitutions
on proteins. Nucleic Acids Res 2012;40(Web Server issue):W452–7.
cases of heritable disorders are identifiable. In such cases, an estimate of Wiggs JL, Pierce EA. Genetic testing for inherited eye disease: who benefits? JAMA Ophthal-
recurrence risk can be calculated using the available pedigree and clini- mol 2013;131(10):1265–6.
cal information and the statistical principle called Bayes’ theorem. These
individuals should be referred to clinical genetics services such as those Access the complete reference list online at ExpertConsult.com
commonly found in hospital settings (Box 1.3.1).

17
REFERENCES 12. Fan BJ, Pasquale LR, Rhee D, et al. LOXL1 promoter haplotypes are associated with
exfoliation syndrome in a U.S. Caucasian population. Invest Ophthalmol Vis Sci
1. Feero WG, Guttmacher AE, Collins FS. Genomic medicine – an updated primer. N Engl
J Med 2010;362:2001–11.
2011;52:2372–8.
13. Jacobson SG, Cideciyan AV, Ratnakaram R, et al. Gene therapy for Leber congenital
1.3
2. Kwon YH, Fingert JH, Kuehn MH, et al. Primary open-angle glaucoma. N Engl J Med amaurosis caused by RPE65 mutations: safety and efficacy in 15 children and adults
followed up to 3 years. Arch Ophthalmol 2012;130:9–24.

Genetic Testing and Genetic Counseling

2009;360:1113–24.
3. Maguire AM, Simonelli F, Pierce EA, et al. Safety and efficacy of gene transfer for Leber’s 14. Zhang X, Wang P, Li S, et al. Mutation spectrum of PAX6 in Chinese patients with
congenital amaurosis. N Engl J Med 2008;358:2240–8. aniridia. Mol Vis 2011;17:2139–47.
4. Mulot C, Stucker I, Clavel J, et al. Collection of human genomic DNA from buccal cells 15. Alward WL, Kwon YH, Khanna CL, et al. Variations in the myocilin gene in patients with
for genetics studies: comparison between cytobrush, mouthwash, and treated card. J open-angle glaucoma. Arch Ophthalmol 2002;120:1189–97.
Biomed Biotechnol 2005;3:291–6. 16. Yu-Wai-Man P, Shankar SP, Biousse V, et al. Genetic screening for OPA1 and OPA3
5. Nussenzveig RH, Burjanivova T, Salama ME, et al. Detection of JAK2 mutations in par- mutations in patients with suspected inherited optic neuropathies. Ophthalmology
affin marrow biopsies by high resolution melting analysis: identification of L611S alone 2011;118:558–63.
and in cis with V617F in polycythemia vera. Leuk Lymphoma 2012;53:2479–86. 17. Wiggs JL, Pierce EA. Genetic testing for inherited eye disease: who benefits? JAMA Oph-
6. Suenaga E, Nakamura H. Evaluation of three methods for effective extraction of DNA thalmol 2013;131(10):1265–6.
from human hair. J Chromatogr B Analyt Technol Biomed Life Sci 2005;820:137–41. 18. Sim NL, Kumar P, Hu J, et al. SIFT web server: predicting effects of amino acid substi-
7. Consugar MB, Navarro-Gomez D, Place EM, et al. Panel-based genetic diagnostic testing tutions on proteins. Nucleic Acids Res 2012;40(Web Server issue):W452–7.
for inherited eye diseases is highly accurate and reproducible, and more sensitive for 19. Adzhubei IA, Schmidt S, Peshkin L, et al. A method and server for predicting damaging
variant detection, than exome sequencing. Genet Med 2015;17:253–61. missense mutations. Nat Methods 2010;7(4):248–9.
8. Green RC, Berg JS, Berry GT, et al. Exploring concordance and discordance for return of 20. Patel RY, Shah N, Jackson AR, et al. ClinGen pathogenicity calculator: a configurable
incidental findings from clinical sequencing. Genet Med 2012;14(4):405–10. system for assessing pathogenicity of genetic variants. Genome Med 2017;9(1):3.
9. Muto R, Yamamori S, Ohashi H, et al. Prediction by FISH analysis of the occurrence of 21. Epstein CJ, Erickson RP, Hall BD, et al. The center-satellite system for the wide-scale
Wilms tumor in aniridia patients. Am J Med Genet 2002;108:285–9. distribution of genetic counseling services. Am J Hum Genet 1975;27:322–32.
10. Wawrocka A, Budny B, Debicki S, et al. PAX6 3′ deletion in a family with aniridia. Oph- 22. Wallace DC. Mitochondrial DNA sequence variation in human evolution and disease.
thalmic Genet 2012;33:44–8. Proc Natl Acad Sci USA 1994;91:8739–46.
11. Tang S, Halberg MC, Floyd KC, et al. Analysis of common mitochondrial DNA muta- 23. Ruggieri M, Pavone P, Polizzi A, et al. Ophthalmological manifestations in segmental
tions by allele-specific oligonucleotide and Southern blot hybridization. Methods Mol neurofibromatosis type 1. Br J Ophthalmol 2004;88:1429–33.
Biol 2012;837:259–79.

17.e1
Part 2 Optics and Refraction


Light
Scott E. Brodie 2.1
750 nm (red) to about 440 nm (violet). Longer wavelengths may be dis-
Definitions: cernable as heat (“infrared”) and can be detected by suitable photographic
Light – Electromagnetic energy detectable by the eye. emulsions and electronic camera chips. Shorter wavelengths (“ultraviolet”)
Geometrical Optics – The properties of light governed by propagation are sometimes visible in eyes after removal of the crystalline lens and can
in straight lines, refraction, and reflection. be seen by some insects (Fig. 2.1.1).
Physical Optics – The properties of light described by wave phenomena The behavior of light under ordinary circumstances is very familiar,
such as interference, diffraction, and polarization. but careful observations reveal important subtleties that have fascinated
Quantum Optics – The properties of light described by absorption and scientists for hundreds of years. In general, the behavior of light in detail
emission of energy in discrete quanta, proportional to frequency. depends on the scale of the objects with which it interacts.
Interactions between light and large objects (relative to the wave-
length of the light) generally follow simple geometrical rules and come
Key Features under the heading of “geometrical optics.” This is the regime of typical
• Specular Reflection – Light reflects off smooth surfaces so that the human experience—light rays travel in straight lines through homoge-
angle of incidence equals the angle of reflection. neous media but may be reflected by polished smooth surfaces or may be
• Snell’s Law – The relationship between the bending of light at an refracted (bent) as they pass from one medium to another. These interac-
interface surface to the speed of light on either side of the interface. tions of light with matter are governed by the law of (specular) reflection
• Vergence Equation – The relationship between the power of a lens and Snell’s law, respectively. Geometrical optics is the appropriate tool for
and the location of the images it forms. understanding the use of lenses for the formation of images—as in the
human eye—or as modified by lenses such as spectacles, contact lenses, or
intraocular lens implants.
INTRODUCTION When the dimensions of optical systems are comparable to the wave-
length of the light passing through them, the effects of interference
Visible light is the portion of the electromagnetic spectrum that can be become evident, demonstrating the “wave-like” properties of light. Perhaps
detected by the eye. In practice, this ranges from wavelengths of about the most common example is the diffraction of light as it passes through

Fig. 2.1.1 The Electromagnetic

THE ELECTROMAGNETIC SPECTRUM Spectrum. The pictures of mountains,
people, buttons, viruses, etc., are used to
produce a real (i.e., visceral) feeling of the
visible spectrum nm size of some of the wavelengths. In the bar
at the bottom of the figure, gray portions
radio 700 600 500 400 of the bar indicate regions of the spectrum
to which the atmosphere is transparent.
1 GHz 100 GHz
(Adapted from Zeilik M. Astronomy: the
infrared evolving universe. 3rd ed. New York:
m Harper & Row; 1982.)
AM FM
540–1650 kHz 88–108 MHz
ultraviolet

soft X-rays hard

-rays
frequency (Hz)
3 102 3 104 3 106 3 108 3 1010 3 1012 3 1014 3 1016 3 1018 31020 3 1022 3 1024

106 104 102 1 10–2 10–4 10–6 10–8 10–10 10–12 10–14 10–16
wavelength (m)

mountains factory people button point dust bacteria virus atom atomic nucleus

size

atmospheric transparency

19
Exploring the Variety of Random
Documents with Different Content
The said father Fray Victorio went to Roma with that letter, and although it reached
the hands of his Holiness, yet he could not obtain that haste which he desired, for the
ambassador was in disgrace with the pope because of some trouble which he had
had with certain Portuguese which cost blood and deaths. His Holiness was very
angry at that trouble, and it was necessary for the ambassador to leave Roma. But
the father, not losing courage, as he had many powerful friends in that capital, as he
had been raised there and had started for Filipinas from Minerva, exerted himself
and obtained the opportunity to pay his respects to his Holiness and to lay his
proposition before him, to which the pontiff answered in formal words: “In the time
of our predecessor the same instance was made by the king of España, but it was not
granted. How now do they return to insist again?” And it was so that the first letter
of his Majesty was brought, and that benefit which was striven for was not obtained
on account of the occupations and for other reasons which his Holiness must have
had (in which the great providence of God in the government of the holy oracles of
His vicars is to be noted, since a pontiff worthy of adoration had so singular an idea
of Filipinas and of the university which was requested there) although the father left
disconsolate. But by direction of a cardinal, his fellow countryman the father again
renewed his courage, and, after waiting several months, again paid his respects to his
Holiness, and gave him a memorial of his desire. His Holiness caused it to be
received by his secretary, and the next day it was taken to the signatura,2 and a
decree was made that in regard to the erection of this university, a committee
[congregacion] of four cardinals and four prelates named there should be formed.
The president of it was the most eminent Cardinal Saqueti, the father’s countryman
who had aided him from the beginning. The said prelates informed, then, and visited
by the father, and being informed of the advisability of what was asked, it was
concluded in the said committee that it was fitting to concede that favor to the king
of España. Therefore, his Holiness despatched his apostolic bull in regard to this
erection, that bull being as follows:

[This bull3 will be found in VOL. XXXV, pp. 203–208.]

This brief was presented to the royal Council of the Indias, and the gentlemen of that
council having read it, ordered a testimony of its presentation to be given July 28,
1646. That was attested on the thirty-first of the same month by Diego Lopez de
Leytona y Mendoza, chief official of the papers of grace, government, and war, of
the secretary’s office of the royal Council of the Indias for the district of Nueva
España. The fact that he was also the chief official of the said royal Council, and that
credit must be given to him, was testified by the royal notaries, Diego Carreño
Aldrete, and Antonio Gomez, on the said thirty-first of July of the said year.
Likewise, the said brief was presented, and the testimony of its presentation, in the
royal Council of the Indias before the members of the royal Audiencia of this city of
Manila. They having read it, determined that the party of the university of Santo
Tomás could make use of the said brief. Consequently, they so voted by an act on the
eighth of July, 1648, of which testimony was given on the said day by Captain Diego
Nuñez Crespo, assembly clerk of the said royal Audiencia of Manila. Likewise, the
said brief was presented before the dean and cabildo of this holy metropolitan
church of Manila with the said presentations of the royal Council and Audiencia.
The said gentlemen considered it as presented, and allowed the college of Santo
Tomás to make use of it, and its rector, now or in the future, in the form and manner
which is contained in the said bull. The clerk of the cabildo, Fernando de Caravajal,
attested that on the same day on which the said act was voted, namely, July 14,
1648. This university having been inaugurated, then, and erected with so great honor
into a pontifical and royal institution, its rector and first chancellor, namely, father
Fray Martin Real de la Cruz, by virtue of his apostolic authority, made the necessary
statutes, following in them all the custom and practice of the royal university of
Mexico (of which from its beginning it has esteemed itself as the close daughter, and
in which it has found the just functions of a noble mother with the exchange of
letters and favors which the latter has given to it). Thus the said father rector
ordained them, August 28, 1648, and they are observed inviolably and are like those
of the said their royal and always noble mother, which were determined after the
style and form of the most celebrated university of Salamanca.

In 1651 this university and its rector wrote to the said university of Mexico giving an
account of its erection, stating that in it was born their obligation of attentive respect
as daughter of that royal university, since the king our sovereign had given that
university to it as mother and mistress. Consequently, it yielded and dedicated itself
to that university and in regard to this the father concluded his letter with all due
consideration and affection. In the year of 53, that most noble and ever famous
university wrote this our university the following letter, which was written in full
cloister.

Very illustrious Sirs:

This royal university of Mexico was greatly favored by the letter of your Lordship
the past year of 51, in which was expressed the appreciation and estimation which is
right and which is fitting for so illustrious a cloister, and with the greatest pleasure
received your adoption; which if it is the teaching of the Holy Spirit (Proverbs xvii),
Gloria filiorum patres eorum, immediately before it had said: Corona senum filii
filiorum.4 Consequently, it will consider that royal university as its crown and glory,
and as such will venerate it forever. It will give his Majesty (whom may God
preserve) thanks for the favors which he concedes to your Lordship by his decree of
the rights to enjoy the privileges which are enjoyed in this royal university. What
may be necessary for it, in so far as documents and papers are concerned, and for the
pretension of your Lordship, will be delivered to the reverend father master, Fray
Francisco de la Trinidad, so that we may carry them and present them to his Majesty
in his royal Council of the Indias. In all the other things which may offer themselves
for the service of your Lordship for its greater luster and increase, this royal
university and its entire cloister will assist it with all promptness. May God preserve
your Lordship in all happiness, etc. Mexico, February 7, 1653. Master Fray Juan
de Ayrolo y Flores, rector.

After his signature were those of eight doctors and masters and lastly that of the
blessed secretary, Christoval Bernardo de la Plaza. This university erected with so
fortunate beginnings with all that luster worthy of all estimation, has continued to
advance. There have been and are very learned persons who have studied there, who
have occupied prebends and dignities in the holy church of Manila, and in other
churches of our España, and it has had three sons, most worthy bishops, one of
whom ascended to the archiepiscopal see of this city, of whom we shall treat in due
time.

II

ROYAL DECREE GRANTING TITLE OF “ROYAL”

TO THE COLLEGE OF SANCTO TOMAS
The King. Inasmuch as Fray Sebastián de Valverde, of the Order of Preachers, and
procurator-general of the province of Santísimo Rosario of Filipinas, has represented
to me, among other matters, that since the establishment of the college of Santo
Tomás in the city of Manila, and especially since, at the instance of Felipe IV, a
public academy or university was erected in it by his Holiness, Innocent X, in the
year one thousand six hundred and forty-five,5 in behalf of his order, not only has it
redeemed its obligation in the public instruction with well-known benefit to those
vassals, in which the religious have filled the chairs at the expense of the private
property of the above-mentioned college, but also, at the same time, in order to
inspire in the minds of its pupils the illumination of the holy doctrine of the angelic
doctor St. Thomas, which some factional spirits in that capital, in whom still lives
the seed of the suppressed doctrine,6 are attempting to confuse with useless projects,
have endeavored likewise to infuse into their hearts the fidelity, loyalty, and love due
my royal person—and one of the most signal and noble proofs that attest this truth is
the promptness, with which the present rector, Fray Domingo Collantes, in this last
war, in observance of the suggestion of that governor, raised four companies of fifty
soldiers apiece among the collegiates and students, on whose clothing and support
he spent some thousands of pesos from the beginning of the war until the peace was
made, and at the same time placing at the disposition of the same government all the
grain of the harvest and the cattle of its estates—and inasmuch as he has petitioned
me that, in order that this signal example of the fidelity and generosity with which
the above-named college served me and continues to serve me, may be remembered
by the inhabitants of those islands, I deign to signify to it my royal pleasure and
kindness by admitting it under my sovereign protection and patronage, and by
granting to it the title of “very loyal;” therefore, my Council of the Indias having
examined the above petition, together with the information given in regard to it by
the general accountant’s office, and the explanation of my fiscal, I have resolved in
the conference of the tenth of January of this year, to concede, among other things,
and as I concede by this my royal decree, the sole name of “royal” to the above-
named college of Santo Tomás of the city of Manila, with the distinct condition and
declaration, that it shall never have the right of petitioning assistance from my royal
treasury. Therefore, by this present, I order and command my governor and captain-
general of the above-mentioned islands, the regent and auditors of my royal
Audiencia in the islands, and all other ministers, judges, and justices of those
provinces, and I request and charge the very reverend bishop of that metropolitan
church, the venerable dean and cabildo in vacant see, and all other ecclesiastical
prelates and judges to whom this pertains, to observe, fulfil, and execute, and cause
to be observed, fulfilled, and executed, exactly and effectively, my herein expressed
royal resolution, as and in the manner herein set forth, without violating it, or
permitting it to be violated in any way, for thus is my will. Given in El Pardo, March
seven, one thousand seven hundred and eighty-five.7

I the King

By command of the king our sovereign:

Antonio Ventura De Taranco

III

HISTORICAL ACCOUNT
[Below follows an interesting account of the university of Santo Tomás, by the
Dominican friar, Evarista Fernandez Arias, from his Discurso leido en la apertura
de sus estudios (de la universidad) el dia 2 de Julio de 1885—i.e., “Discourse read at
the opening of its studies (of the university) July 2, 1885” (Manila, 1885). Its author
was a professor of the university.]

The university of Santo Tomás, of Manila, graced with the titles of royal and
pontifical by the Catholic kings and the supreme pontiffs, holds the first place
among all the educational institutions of the Philippines on account of its antiquity,
its history, and its importance. It was established in 1619, under the name of College
of Santo Tomás, having, as its basis, a holy legacy from his Excellency, Fray Miguel
de Benavides, of the Order of Preachers, second archbishop of Manila, who is
considered as its true founder. By this legacy, the sum of 1,600 pesos was turned
over to the fathers of his order, of the province of the Santísimo Rosario, who,
accepting it, in accordance with his purposes and intentions, immediately proceeded
to carry the plan into effect. Thus, after various contingencies, on the day of the
festival of the Assumption of the Virgin, in the year mentioned, after having been
authorized by the general government of these islands, and by both the ecclesiastical
and the secular chapters, Fray Baltasar Fort, its first rector, proceeded to the
inauguration of its studies by giving fellowships to twelve young men belonging to
the most distinguished families of Manila. The permission granted by the general
government and other authorities of this capital, was formally confirmed by his
Catholic Majesty, Felipe IV, in his royal decree of November 29, 1623, in which he
said of this institution: “It has afforded and affords great advantages to the young,
the preaching of the gospel, and the instruction of the children of the inhabitants.”

The chronicles of those times show that the number of young men, mostly children
of Spaniards, who attended the schools of the Dominican fathers was not small; but
the difficulty of not being able to receive academic degrees was an obstacle to the
progress of the studies. For this reason, Pope Paul V was asked to authorize the
order to confer the customary degrees upon the pupils of this college. This
permission was granted for ten years, upon the expiration of which time, it was
necessary to again apply to the Roman pontiff, then Urban VIII, for the extension of
the concession for a similar term of years. This uncertain condition of affairs was
not, as is evident, most conducive to progress in these studies, for which reason
Felipe IV, desiring to regulate this concession consistently and permanently,
requested, through his ambassador, an apostolic brief from the supreme pontiff,
Innocent X, in 1645, which should confer upon the college of Santo Tomás (the title)
and honors of a university, with all the privileges of those of the same class in the
Peninsula, authorizing it to confer academic degrees in the schools of theology and
philosophy. Afterwards, in 1734, this concession was extended by Clement XII,8
also on the petition of the king of Spain, to the schools of canonical and civil law,
and to others that might in time be established.

The year following the erection of this university by Innocent X and Felipe IV, its
first rector and chancellor, Fray Martin Real de la Cruz, who so distinguished
himself in the conversion of the Cagayanes, framed the laws, which continued in
force until 1785. The greater part of these were similar to the laws of the university
of Mexico, to which his Catholic Majesty desired to conform them, as appears from
his letter written on December 20, 1644, to his ambassador at Rome.

In the beginning the only courses were dogmatic and moral theology, philosophy,
and the humanities; Latin and Spanish grammar, rhetoric, and poetry were included
in the humanities, and the study of all the branches comprised in the works of Santo
Tomás de Aquino formed a part of the courses in theology and philosophy.9 This
was the custom in most of the universities existing at that time, a custom that
responded perfectly to the necessities of that century, and more particularly to the
special requirements of this country at that period. In the first stage of their
civilization, education in the Philippines was based exclusively on religion; and the
local necessities and the aspirations of the first Spaniards, echoing faithfully the
sentiments expressed many times concerning this subject by the Catholic monarchs,
demanded a literary center where the bishops and missionaries might find a solution
for the many and varied doubts which arose in the exercise of their ministry; where
the governors-general might receive ideas of profound and consistent methods of
government for the direction of the towns and for their relations with neighboring
nations, and where the alcaldes and encomenderos might learn the lessons of
Christian charity and justice, which they not infrequently failed to observe. In what a
satisfactory manner the university of Santo Tomás fulfilled this duty is shown by the
illustrious names of Fathers Berart, Marron, Santa Cruz, Pardo, Sanchez, and the
celebrated Father Paz, and many others whom it would take too long to mention,
whose brilliant and wise writings contain discussions of all kinds regarding the
practical life of these people. It is also shown by the royal decree of 1862, in which
his Catholic Majesty, admitting this institution under his protection, says that
degrees in theology and letters are given with all strictness and display to qualified
persons in those islands, this being of notable utility in that it furnishes subjects
capable of filling the offices of curates and prebendaries.

The eighteenth century arrived, and, with the coming of the Bourbon dynasty to the
Spanish throne, new germs of civilization took root throughout the monarchy, and
were felt as far as these remote shores. Then the faculty of jurisprudence and
canonical law was established (the establishment of which the Dominican
corporation had endeavored to secure years before), because with the increase of the
native and mestizo population, and with the consolidation upon a religious basis of
the social life of these peoples, there was not a sufficient number of lawyers for the
administration of justice. Lawyers did not come from the Peninsula, and for that
reason, if not for other better and more noble reasons, it was necessary to seek them
within the bounds of the islands. Hence, faculties of jurisprudence and canonical law
were established, with courses in Roman law and institutes and the sacred canons.
The pupils could hope for the degree of licentiate in jurisprudence and canonical law
after a four years’ course in these studies, and four other years called pasantía years,
which were taken in connection with the law course, and were years of practice in
the office of some lawyer. During these so-called pasantía years, the pupils were
required to defend a proposition every week and sum up the opposing arguments,
and were permitted to act as substitutes during the absence of any of the professors
of the faculty.

The course of institutes and canonical law was the only course in law given in most
of the universities of that period, the professors being charged with making the
applications necessary to the Spanish laws and those of the Indias, explaining the
points in which they differed from the Roman and canonical laws.

The instruction continued thus during the greater part of the eighteenth century, the
university conferring degrees in theology, philosophy, and canonical and Roman
law. The courses in moral theology and the humanities were pursued without the
formalities of enrolment and without a fixed number of terms, until toward the end
of that century. With the increase of the commerce and the intercourse of these
islands with Europe, and under the influence of the government of Carlos III, it was
decided in the university assembly of 1785, to extend the faculty of theology by the
establishment of chairs in literature and sacred writings, and that of law by two
additional chairs of canonical and Roman law. It was also decided to create the
faculty of medicine, together with a chair of mathematics, applied to commerce and
navigation in conformity with the necessities of the times. Father Amador, professor
of canonical law, having been appointed to form the new laws, in accordance with
the resolution of the assembly, concluded them during the same year, 1785. These
laws, after being approved by the superior government of these islands, are now in
force except in the points modified by subsequent laws. These laws provided that all
professorships, with the exception of those belonging to the private patronage of the
Order of St. Dominic, should be conferred by competitive examinations. It also
prescribed rules for the conferring of academic degrees by the faculties of theology,
canons, law, philosophy, and the new one of medicine, it being provided that, in
order to secure the degree of bachelor of theology, canons, civil law, and medicine, it
was necessary to have passed in four courses, and for philosophy in three, and that,
after having obtained the title of bachelor, it was necessary to exercise the pasantía
for four years in the schools of theology and law, and for three years in the other
schools. Rules werealso provided for the courses, the enrolments, and the
examination fees. These laws were taken to a great extent from those in force in the
universities of Salamanca, Mexico, and Lima.

About that time the king of Spain confirmed the privilege of exemption from tribute
for all those who had received the degree of bachelor, and also for the pupils of the
university, in consideration of “the utility and necessity for this branch of the state to
encourage these studies, without which no community can flourish; for, if it should
be ordered, contrary to the practice observed up to the present time, that the tribute
be paid, the schools would be deserted, to the general injury of these islands.”

Because of the indolence of the times and the lack of pupils, it became necessary to
abolish the school of medicine and the class of mathematics and drawing, which
were afterwards incorporated by the consulado, and the superior studies continued
during the first part of the present century as they existed at the beginning of the
eighteenth century. It was not until the year 1836, on the petition of the corporation
of St. Dominic, that the chair of Spanish law was created, increasing the faculty of
laws.

By a royal order of 1837, continuing the progressive course initiated in the

instruction at the university, a commission, presided over by the director of the
university, was appointed for the purpose of studying the method of extending the
instruction, and making a report upon the manner of filling the chairs which should
be created, at the same time preparing a plan of studies, conforming as far as
possible with that in force in the Peninsula. The report of this commission was
awaiting the decision of the court of appeals when a new royal order of April 2,
1842, provided for the appointment of a new commission, also presided over by the
director of the university, and consisting of one associate justice of the royal court of
appeals, a prebendary of the cathedral chapter, a member of the municipal council,
and one of the economic association, for the purpose of preparing a new plan of
studies in harmony with the necessities of the times. The new commission, having
worked with great activity, presented its completed report, submitting a plan of laws
for this university which included the college of San José, notwithstanding the
opposition of its rector, who, as prebendary, formed part of the commission.
According to this plan of studies, instruction in theology, philosophy, and
jurisprudence was improved, chairs of medicine, pharmacy, and chemistry were
created, and that of physics was extended. Upon the submission of this plan of
studies to the supreme government of his Majesty, it was provided by another royal
order of April 2, 1846, that funds be secured for the establishment of said change in
the university, without injuring the interests of anybody, but respecting those
existing in so far as possible.

In fulfilment of this decree, on the twenty-sixth of the following August, this

superior government appointed another commission, to which was communicated a
royal order of April 15, 1847, which appointed, as a member of the same, the rector
and chancellor of the university; and another royal order of July 12, of the same
year, which directed said commission not to include in the budget of studies “the
property of the college of Santo Tomás, as it is the exclusive property of the
Dominican fathers.”10

Unfortunately this commission was dissolved just before the completion of its work,
on account of the absence of some members in the Peninsula, there remaining only
one (in addition to the rector of the university), who later resigned his membership
in the commission, under date of October 28, 1848. But by a royal order of April 19,
1849, the action of this superior government in not accepting said resignation was
approved, and in the place of the absent members, Señor Montes de Oca was
appointed and instructions given that another competent person should associate
with them, in order that the work of university reform might continue. But as the
commission did not hasten the matter with the speed desired by the government of
his Majesty, another royal order was issued, under date of October 19, 1852, urging
the commission to conclude the plan, and budget of studies, in accordance with the
wishes and the interest of his Majesty for the welfare and prosperity of this colony.
However, the difficulty of reconciling very great extremes, such as the preservation,
in a new plan of studies, of everything already in existence that should be in
harmony with the studies of the universities of Spain, the formation of a budget
without injuring the interests of anyone, and a thousand other necessary
considerations, placed under the charge of the commission by more than one royal
decree, were more than sufficient causes to prevent the board from finishing its
laborious contract and including its complicated work in the brief period desired.
Hence, it was not until February 16, 1856, that its work was done, and the long-
desired plan of studies concluded. This plan was at once sent to the superior
government of these islands, in order that it might finally be forwarded when it
should be deemed convenient. The papers were still in the hands of the secretary of
the government in March, 1859, when a fire occurred in the town of San Miguel,
where said secretary resided at the time, and unfortunately the papers, in the
compilation of which so much valuable labor had been expended, were burned. So
unfortunate an occurrence must naturally have delayed this matter, although by
chance there was in the possession of the rector of the university a copy of all these
works and the previous writings of the board which were used in the compilation of
the desired plan. The rector of the university was requested by the government of
these islands to furnish all the previous writings in his possession on the works and
plan of studies which had been destroyed while in the possession of the secretary,
and which should serve as a basis for the new papers treating of the same subject.

But before sending the report to his Majesty, for his final approval, the superior
government received some copies of the plan of studies newly established in the
universities of the Peninsula, together with a royal order directing that it be adapted
in so far as possible to the plan for these islands which was to be presented for the
approbation of his Majesty. This circumstance led to the suspension of the
proceedings instituted, and obliged this superior government to appoint another
commission, or, rather, to complete the old one, which had already become
disintegrated by the absence of some of its members, to revise the work and the plan
of studies formerly proposed, and to harmonize it, if possible, with the plan of
studies, a copy of which was sent to the members of the board for the purpose
indicated.

Thus, on April 5, 1861, General Lemery appointed the lacking members of said
commission, in which figured, as in the former commissions, the director and
chancellor of this university. The commission concluded its work on February 20,
1862. The plan of studies prepared by this last commission was presented on the
same day to the superior government of the islands and was finally transmitted with
a favorable report to the government of his Majesty without the sovereign approval
for its establishment having as yet been given.

This lack of approval of the superior government did not prevent the consideration
of the means of immediately carrying into effect the change in the studies, and soon
afterwards, in 1865, secondary instruction was adopted with the degree of bachelor
of arts, commercial expert, and surveyor, and chemical and industrial expert, as in
the universities of the Peninsula. The classes were opened the following year, in
accordance with a provisional program taken from that of Cuba. In 1867, this
program was given the supreme approval. Secondary instruction having been
happily inaugurated, the approval of the plan of superior instruction, submitted by
the university to the government of his Majesty, was being awaited, when a decree
arrived from the regent of the kingdom, Don Francisco Serrano, countersigned by
the colonial minister, Señor Moret,11 which secularized the official studies, and,
suppressing the existing colleges and the universities of Santo Tomás, converted
them into the Philippine Institute and the university of the Philippines respectively,
thus ignoring all the elements which they had accumulated in their teaching during
three centuries of existence, and turning over the literary future of the people to the
hazardous plan, inspired, notwithstanding the loyal patriotism of the minister, by a
doctrine diametrically opposed to that which had served as a solid basis for welfare
and progress. The corporations of Manila, the bishops, and the clergy, with a
majority of the householders, protested against a measure which, although it fulfilled
the hopes of the university in regard to new chairs and schools, deprived them of any
value by separating them completely from the religious basis. These protests were
heard by the governor of these islands, Señor Izquierdo, who provisionally resolved
that the decree be not executed in regard to the secularization, but that it be carried
out with regard to the new schools. This resolution was fully approved by the
government of the Peninsula. Thus, in 1871, the schools of medicine and pharmacy
were established, and the other schools were extended. By a resolution of General
Moriones, the governor of these islands, which was confirmed by his Catholic
Majesty, it was decided to appoint a director of the college of San José, which was
granted in perpetuity to the rector of the university, and of an administrator, on the
recommendation of the said director, for the management of revenues.12

In 1876, the study of the profession of notary was inaugurated, and two professors
were appointed to teach these subjects. Finally, in 1879 and 1880, the auxiliary
courses of medicine and pharmacy, midwives, assistant surgeons, and practitioners
in pharmacy were created. From this date, the university of Manila has had a
complete course of superior and secondary instruction, better than some universities
of the Peninsula.13

This is the brief history of the first and most important educational institution of
these islands,14 in which it may be seen that, without the violence of certain schools,
with the moderation and firmness demanded by reforms in the branch of public
instruction, this university combining perfectly scientific interests with religion and
patriotic interests, has been able to rise to the height required by the circumstances
of the period, and has fulfilled the aspirations of all true lovers of Christian and
Spanish civilization.
1 See also San Antonio’s sketch, VOL. XXVIII, pp. 136–139. ↑
2 Signatura: a tribunal of the Roman court, composed of several prelates, in which various matters
of grace and justice are determined. See Novísimo Diccionario. ↑
3 Hernaez (Colección de bulas, pp. 471, 472) prints a bull by Clement XII, dated September 2,
1734, granting authority for the teaching of both canon and civil law to the university established in
the college of Santo Tomás of the Order of St. Dominic at Manila, in which portions of Innocent’s
bull are inserted. This bull (translated by Rev. T. C. Middleton, O.S.A.) is as follows: “Clement XII
Pope. In future remembrance of the affair. Long ago at the instance of Philip IV, of renowned
memory, and during his life Catholic King of the Spains, letters in the form of a brief, of the
following tenor, were issued by our predecessor, Innocent X, Pope, of happy memory, to wit: [Here
follow the portions of Innocent’s bull which are quoted, and Clement continues:]
“Since moreover, as has been represented to us lately on the part of our very dear son in Christ,
Philip, also Catholic King of the same Spains, in the academy or university of general study of the
said college, two new chairs have been erected, one indeed of the canons, to be held by a religious of
the said order, the other, however, of the institutes of civil and canon law, to be held by a doctor in
both laws, the afore named King Philip desires very earnestly that the letters above inserted be
extended by us ... to the two chairs just erected as said....
“Accordingly as requested, by the said authority, in virtue of these presents, the form and
arrangement of the same letters inserted above being maintained however in the others, we extend ...
the letters or indult above inserted to the above-named two new chairs also, until in the said city of
Manila another university be erected. Given at Rome, at St. Mary Major’s under the seal of the
Fisherman, September 2, 1734, the fifth year of our pontificate.” A note by Hernaez reads as follows:
“Pope Clement XII conceded authority to grant academical degrees in the college of the Society of
Jesus in Manila, December 6, 1735, as is mentioned by Father Murillo [Velarde] in his Cursus juris
canonici (Madrid, 1763), book v, título v, no. 62.” ↑
4 The position of these two Latin clauses (Proverbs, xvii, 6) is reversed in the Vulgate edition. The
translation, according to the Douay version, is: “Children’s children are the crown of old men: and the
glory of the children are their fathers.” ↑
5 See VOL. XXXV, pp. 203–208. ↑
6 Perhaps a reference to the Jesuits, who were expelled in 1768. ↑
7 See also the following documents regarding the college and university of Santo Tomás:
Foundation of the college, April 28, 1611, VOL. XVII, pp. 155–171; Royal permission, November
27, 1623, VOL. XX, pp. 260, 261; and University of Santo Tomás (royal letters in regard to its
elevation into a university), November 9, 1639, VOL. XXIX, pp. 175–177. ↑
8 See this brief, ante, pp. 146–147, note 73. ↑
9 Bowring (Visit to the Philippines , p. 194) says of the condition of Santo Tomás: “In the
university of St. Thomas there are about a thousand students. The professorships are of theology, the
canon and civil law, metaphysics and grammar; but no attention is given to the natural sciences, to the
modern languages, nor have any of the educational reforms which have penetrated most of the
colleges of Europe and America found their way to the Philippines.” ↑
10 Of the college of Santo Tomás, the report of the Dominican friars in 1883 to the colonial
exposition of Amsterdam says: “The building occupied by the university of Santo Tomás has
contained since 1611 the college of the same name, which is under the direction of the Dominican
friars, who gratuitously educate therein from 30 to 40 youths, the children of poor families, generally
providing all the expenses for their career, and preparing them so that in the future they can fill an
unembarrassed and suitable place in society. Many of these youths have become distinguished in
scientific circles, and for their honesty in the legal profession, while others have been honored with
the miter of a bishop, and have occupied venerable positions in ecclesiastical chapters. The youths
educated in this college were not only Spaniards, but included also natives and mestizos, some of
whom entered as servants, which was an honor solicited by many; and on some occasions four large
dormitories of this college have been completely filled. There was a period when some entered and
paid a moderate amount, according to the archives in the college, but this period was a very short one,
because the documents on file in the archives show that at the beginning and at the middle of the
seventeenth century, and during a greater part of the eighteenth century, no free pupils were admitted,
and the few who were admitted paid a moderate tuition fee in proportion to the means of the family.
In the beginning the only branches of secondary instruction taught in the college were the so-called
philological or grammatical studies, and after proficiency therein any of the careers established in the
university was followed.” See Census of Philippines, iii, pp. 596, 597. ↑
11 Of the Moret decree, Tomás G. del Rosario, writing on education in the Philippines, in Census of
Philippines, iii, p. 637, says: “This decree, countersigned by the eminent colonial minister, Don
Segismundo Moret, introducing modern advances in Philippine legislation, secularizing instruction
and giving it all kinds of guarantees and liberties, this long-awaited provision, caused a great outburst
of enthusiasm throughout the archipelago, as it signified the manumission of the popular conscience
from a slavery bound with the chains of fanaticism and inimical irreconcilability. In many provinces
and in the city of Manila, this never-to-be-forgotten resolution of the Spanish government was
received with signs of evident joy. Later, under various pretexts, all those who had expressed joy were
cruelly persecuted, and put in jail, or deported as insurgents, masons, filibusters, etc., these measures
extending even to those who were merely suspected. This is the history of all theocratic or despotic
governments. It is true that some residents and parents of families protested against this provision,
together with the corporations, the bishops, and the clergy, but these residents and fathers of families
did so either through fear or because they were debtors to or members of the families of the friars.
Some did so for fear of being discovered, but most of them to carry out ambitions; no one made a
protest with sincerity and in good faith. Everything was hypocrisy, as is the case, and must be the
case, among all nations oppressed by absolutism.” R. L. Packard’s article, “Education in Cuba, Porto
Rico, and the Philippines” included in the Report of the Commissioner of Education 1897–98, i, pp.
909–983, gives (pp. 976, 977), the plan of studies of the Moret decree of November 6, which is as
follows: Spanish and Latin grammar; elements of rhetoric and poetry; elements of physical
geography; elements of descriptive geography in general and the Philippines in particular; universal
history—history of Spain and the Philippine Islands; arithmetic and algebra; geometry and plane
trigonometry; elements of physics and chemistry and of natural history; psychology, logic, and moral
philosophy; general outline of anatomy, physiology, and hygiene. The studies for the industrial
profession included: mercantile arithmetic; bookkeeping and accounts; political economy and
mercantile and industrial legislation; geography and commercial statistics; French, English, Tagálog,
and Visayan; surveying; spherical trigonometry; cosmography, pilotage, and maneuvers; theoretical
and applied mechanics; physics and chemistry applied to the arts; topographical drawing and
hydrography; lineal and ornamental drawing—landscape, figures, and painting. The university of
Santo Tomás, which changed its title to that of the university of the Philippines by this decree was
organized as to its faculties of law and medicine, and the latter contained the following studies:
descriptive and general anatomy, two courses; exercises in osteology and dissection, two courses;
physiology, one course; public and private hygiene, one course; general pathology, with clinics and
pathological anatomy, one course; therapeutics, materia medica, and writing prescriptions, one
course; surgical pathology, with operations, bandaging, etc., one course; medical pathology, one
course; obstetrics and special pathology of women and children, with clinics, one course; medical and
surgical clinics, two courses; legal and toxicological medicine, one course. The pharmaceutical
course was also reorganized by this decree. The same minister had proposed October 2, 1870, “that
instruction should be given at the university of Madrid in Tagálog and other studies which would give
information about the Philippines and the English and Dutch East India possessions and their
methods of government, especially for the benefit of those who intended to enter the colonial
service.” December 5, 1870, in an exposition of the history, conditions, and needs of public
instruction in the Philippines, he recites the early activity of the Augustinians, Dominicans, and
Jesuits, in education. He points out that by the process of absorption by the religious orders, education
became concentrated in their hands, and while they had done much good in early times, their
narrowness and conservatism rendered secularization of instruction necessary. ↑
12 October 29, 1875, a royal order was issued regulating the courses in the university, and
prescribing courses of study. Packard, ut supra, p. 977. ↑
13 Of the studies of secondary instruction given in Santo Tomás, San Juan de Letran, and San José,
as well as the private schools, the Census of Philippines, iii, pp. 601, 602, says: “They had the defects
inherent in the plan of instruction which the friars developed in the Philippines. It suited their plans
that scientific and literary knowledge should not become general nor be very extensive, for which
reason they took but little interest in the study of those subjects or in the quality of the instruction.
Their educational establishments were places of luxury for the children of wealthy and well-to-do
families, rather than establishments in which to perfect and develop the minds of Filipino youth. It is
true that they were careful to give them a religious education, tending to make them respect the
omnipotent power of the monastic corporations, at least three certificates being required every year,
proving that the pupil had gone to confession, in order to permit him to stand the examination at the
end of the term.” ↑
14 See the courses of study for the schools of jurisprudence, theology, and canons, medicine,
pharmacy, and the notarial profession, in accordance with the royal decree of October 29, 1875, and
the studies given in the school for practitioners in medicine and practitioners in pharmacy, approved
by the general government of the Philippines on March 4, and December 29, 1879, and afterward
confirmed by the supreme government, in Census of Philippines, iii, pp. 627–629. A course was also
given under the same authority for midwives. According to a Dominican report submitted at the
Exposition of Madrid, in 1887, the university of Santo Tomás conferred degrees upon 957 bachelors,
132 licentiates, and 97 doctors in philosophy, theology, canonical law, and civil law from 1645 to
1820. The graduations from 1820 to 1850 were as follows: theology, 457; canons, 325; institute, 748;
civil law, 203; philosophy, 2,173. From 1850 to 1870, the graduations were: theology, 822; Roman
and canonical law, 1,540; civil law, 658; philosophy, 3,405. The graduations from 1871 to 1886 were
as follows: preparatory course in theology and jurisprudence, 745; preparatory course in pharmacy
and medicine, 660; dogmatic theology, 406; moral theology, 104; canonical law, 36; jurisprudence,
1,904; pharmacy, 356; medicine, 1,029. The report of 1887 contains the following in regard to the
university: “The university of Manila has the titles of royal and pontifical, which reveal its glorious
destiny of propagating in this archipelago religion and love for Spain. It is under the most special
patronage of the angelical doctor [i.e., St. Thomas Aquinas], presenting in its name of royal and
pontifical university of Santo Tomás the ideals which have prompted its foundation and directed its
development for a period of almost three centuries. Its organization is simple without being
rudimentary. Having for a basis religious education, at the same time that it avoids the danger of
professors expounding more or less advanced theories, which in practice sooner or later, are reduced
to moral ruins, both public and private, it contains the pupil within the circle of a severe discipline, in
which, if some apparently see oppression and a suppression of spirit, this apparent oppression is
softened by the paternal affection which the priests in charge of the instruction know how to bestow
upon the natives of this archipelago. A constant encouragement to the young, directed by prudent and
affectionate discipline; that is the standard observed by the university of Manila as to its pupils.” It
was impossible for the friars to extend this purely religious education to university studies, as the
persons devoting themselves to such studies were already adult persons. Graduates from the
university, although officially recognized by the Spanish government, rarely received official aid. The
few Filipinos who were appointed to the notarial and law positions, received such appointment only
temporarily. The same is true also regarding physicians. This condition was one factor in the
development of the last revolution against Spain. The Dominican report of 1887 also says: “Both
secondary and higher instruction cost nothing to the treasury in the Philippines. The colleges of Santo
Tomás and of San Juan de Letran are supported from the funds of the corporation to which they
belong. The expenses of the university are defrayed with regard to the studies of medicine and
pharmacy by the revenues of the college of San José, devoted to that purpose by several royal orders,
the balance in the treasury of the college last year [i.e., 1886], after the deduction of all expenses,
having been only $173.94. The other expenses of the university are defrayed by the Order of St.
Dominic, which has assigned for this purpose, a large personnel serving without charge. Furthermore,
the building of the college of Santo Tomás, its library, museum, cabinet, and other equipment, are
devoted to educational purposes, with all the personnel and supplies necessary for its preservation and
improvement. The only university receipts are those from the payment of matriculations, examination
fees, and diplomas. The average receipts, deducting therefrom what corresponds, according to law, to
professors, the secretary, etc., amount to $14,000, and the expenditures to $30,000. The latter figure
does not include the cost of repairs, the support of the building, cabinet, museum, and library, and
other dependencies of Santo Tomás, religions feasts, and other expenses which are not defrayed from
the treasury of the university.” See ut supra, pp. 626–635.
See also J. Valinau’s La universidad de Manila, in La politica de España en Filipinas, a periodical
published for eight years, under the directorship of José Feced, and the editorship of Pablo Feced and
W. E. Retana, for the year 1891, pp. 26–29, 38–41, 50–52, 62–64, 74–76, 88–90, 98–100, 110–112,
122–124, 134–136. On pp. 122, 123, is given the number of professors in the various faculties in
1887, as follows: theology and canons, 8, all religious, except one in charge of the class of Roman
law, which is taught by an advocate; jurisprudence, 14 professors, 7 of whom were religious and 7
jurisconsults of Manila; medicine, 15 professors, the 3 in charge of the preparatory course being
religious, and the other 12 physicians; pharmacy, 8 professors, 3 (the same as those in the preceding)
being religious, and the remainder, pharmacists of Manila; 11 professors in charge of commerce,
agriculture, and industry, all religious except one—in all a total of 56 professors, of whom 27 were
religious. The library of the university contained about 12,000 volumes, and the physics cabinet about
300 instruments. Valinau, a former student of the university, and in civil life, defends the rule of the
friars against detractors. ↑
ROYAL COLLEGE OF SAN FELIPE DE AUSTRIA

FOUNDATION AND SUPPRESSION

[Diaz (Conquistas de las Filipinas), speaks as follows of the short existence of the royal
college of San Felipe.]

Governor Don Sebastián Hurtado de Corcuera, a magnanimous gentleman, determined

to found a royal college under the title of San Felipe in honor of Felipe IV, in whose
reign he assigned four thousand pesos from the royal treasury for twenty becas, until
other means should be carried out for their support. He joined it to the college of San
José of Manila, which is under the charge and direction of the Jesuit religious of the
Society. The latter college is the older in foundation of the two in the city, leaving out of
account the seminary of San Juán de Letrán, which together with the college of Santo
Tomás is in charge of the religious of St. Dominic. Both colleges are gardens of letters
and virtue which adorn the ecclesiastical estate, both secular and regular. Very many
very eminent persons, both seculars and regulars,1 have graduated from those colleges,
and up to this time three bishops, and Doctor Endaya y Haro, who after being dean of the
cathedral of Plasencia, España, is at present archdeacon of Alarcón, a dignity of the
cathedral of Cuenca, one of the greatest dignities of España, besides many others who
require a separate history. The twenty becas were given to the finest youths in Manila on
the day of St. Sebastian of that year, 1641, amid great applause and gatherings, and they
were given the title of royal collegiates.2 The religious of the Society of Jesus took
charge of the management and instruction of that college with that care and zeal which
they usually display. But the permanence of that college endured only during the
government of Don Sebastián Hurtado de Corcuera, namely, until the year 1644, when
that royal college of San Felipe was destroyed, and the fathers of the Society had to pay
the 12,000 pesos which they had spent during those three years on the support [of those
pupils], the many good representations made by the said religious—who charged that the
royal decree which was couched in very strict terms for that purpose, was obtained by
false representation3—being of no avail. The new governor Don Diego Faxardo
executed that decree with the integrity which these islands experienced in him. The royal
treasury owed 8,000 pesos to the fathers of the Society, but they were not allowed to
receive them on account. Thus they had to lose those loans. Our province aided them
with 8,000 pesos which it had in deposit from some annuities [censos] which their
owners had received, and 4,000 were lent them by Captain Manuel Estacio Venegas, a
very important person of these islands.4... This was the beginning, permanence, and end
of that unfortunate college of San Felipe, whose idea we have seen to have been
executed and established by the royal will of King Don Felipe V, in the foundation of the
royal college of San Felipe newly established in houses that formerly belonged to
Captain Gabriel Diaz del Castillo, and afterward confiscated for the properties of
Licentiate Manuel Suárez de Olivera, who was also an example of the advantage of
wealth in this world, for his wealth all went up in smoke without his having gotten from
it (and he had much) enough to apply to a mass for his soul. The royal college of San
Felipe has twelve violet colored becas over red mantles, with the arms of Castilla and
Leon in silver on the breast. They are obliged to be present at the cathedral in their
seminary body during the divine offices, and serve as acolytes and other lesser duties of
the altar. Their first rector and the only one as yet, is Licentiate Don Gabriel de Isturis,
presbyter, advocate of the royal Audiencia. He was alcalde-in-ordinary of the city of
Manila while in the world, and alcalde-mayor of the alcaicería of the Parián of the
Sangleys.5

II

SUMMARY OF HISTORY
[The following is condensed from annotations of Rev. Pablo Pastells, S.J., in his edition
of Colin’s Labor evangélica.]

The college of San Felipe de Austria was founded by Sebastián Hurtado de Corcuera, at
the instance of the ayuntamiento of Manila, and was annexed to the college of San José
of Manila. The cabildo proposed to Corcuera, December 15, 1640, that eighteen royal
fellowships and two college servants be assigned in the college of San José or Santo
Tomás, which were to be given as a reward to those possessing greatest merit and
highest rank, because of the great poverty of many of the children and descendants of
those who had performed the greatest services for the crown in Filipinas. In view of the
fact that there are two universities in Manila, Corcuera is asked to confer in regard to the
matter, “so that in the college which his Lordship shall assign, of the two above-
mentioned, there be eighteen fellowships, and two college servants—twenty in all—and
that to them be appointed those who shall deserve it most and those of the highest rank,
with the beca and gown that shall be regarded as fitting, in order that they may be
recognized as such, and which shall be different from those worn by the other students.
For their support and clothing, a sum of three thousand pesos shall be set aside
annually.” The graduates were to succeed, after passing competitive examination, to the
canonries of the Manila cathedral.

Corcuera signed the decree founding the college, December 23, 1640, and the direction
of the same was given to the Jesuits. By that decree, twenty fellowships were created,
and six Pampango college servants provided for. The turn of four thousand pesos was
assigned for their support, 3,000 being for the twenty fellowships, and the remaining
1,000 for one master and the six servants. Provision was made for this sum from four
hundred of the general licenses which were issued to the Sangleys, granting them
permission to remain in Manila.

January 19, 1641, Corcuera issued the rules and regulations for the new college—thirty-
three in number—after having conferred with Doctor Diego de Rivera Maldonado;
auditor of the royal Audiencia. These rules and regulations provide as follows:6

1. There shall be twenty collegiates, “who must be the sons, grandsons, or descendants
of deserving persons who have served his Majesty in these islands. The sons of the
auditors of this royal Audiencia, living or dead, and those of the royal official judges,
and those of all the war officers, great and small, shall always have the preference; and
in default of them, any others of these islands, who possess the necessary qualifications.
Said collegiates shall be in the charge and under the care of the father rector, present or
future, of the said college; and no one shall enter the college or be received therein
unless he shall have presented a government provision therefor to the said father rector.”

2. The college servants shall be of influential Pampango families, and they shall be
taught “to read and write, and the Spanish language,” and shall be given clerkships if
they show aptitude therefor.

3. The collegiates must be of pure race and have no mixture of Moorish or Jewish blood,
to the fourth degree, and shall have no negro or Bengal blood, or that of any similar
nation, in their veins, or a fourth part of Filipino blood.

4. The royal arms shall be placed above the principal door of the college, and
surrounding those arms the Latin words: Collegium regale divi Philippi [Royal college
of San Felipe].

5. The outside clothing worn by the collegiates shall be a gown of blue and black silk,
and a beca of purple velvet, and on the left side an escutcheon with the arms of Castilla
and Leon with the royal crown above, and below, the fleece whence protrudes the cross
of Alcantara, edged at the points with gold. The sleeves and bonnet shall be black. In the
house they shall wear a garment of the same silk and color in place of the gown. The
college servants shall wear a semi-cassock of the same silk material, with hat and girdle,
with the royal arms on the left side of the breast.

6. All that is necessary for the support and clothing of the collegiates shall be given
them, being paid for from the 150 pesos assigned for each one. They shall each be
provided with one silken gown, one beca of purple velvet, one silken garment, one
bonnet, four pairs of sleeves of black taffeta, six shirts and six pairs of linen breeches,
twelve pairs of shoes, four pairs of cotton socks, two pairs of breeches and two doublets,
and one dozen linen collars.

7. Twelve of the collegiates shall be art students [pasantes de facultad], and the other
eight, grammar, but the governors may vary the number of those in each branch at their
pleasure.

8. The course shall take eight years, and shall comprise three in arts and four in
theology; and no collegiate may be more than seven years in the said college and one
year as a lodger, unless elected as a conciliar the last year, after which he shall then be a
lodger. Those studying grammar shall remain nine years.

9. When there is a sufficient number who wish to be given a fellowship, a competitive

examination shall be held.

10. Until there are those who can compete for the fellowships, they shall be appointed
after taking an examination given by the three fathers named by the rector.

11. All collegiates must take an oath of mutual defense in and out of the college, and
must defend the Immaculate Conception of the Virgin.

12. The collegiates must be given sufficient food, and on certain feast days, viz., of Sts.
Philip and James, St. Sebastian, and the day of the Immaculate Conception, something
extra.

13. The hours shall correspond to those of the university of San José.

14. The collegiates shall confess and take communion at least five times per year, viz.,
on the three feasts of Christmas, Easter, and Pentecost, and the days of Sts. Sebastian
and Philip, under penalty of a fortnight’s seclusion every time they fail to observe it, and
loss of their college portion for that time.

15. The students of San José shall be preferred to all others in competition for
fellowships.

16. These shall be defended every Saturday when no legal obstacle presents itself.
17. All the collegiates shall be obliged to attend vespers and mass in the royal chapel on
St. Sebastian’s day, and on the feast of the most holy sacrament held at the same place,
and they shall have to take part in the procession of the latter day as well as on the day of
Sts. Philip and James (May 2).

18. Gambling with cards, dice, or in other manner is forbidden, the penalties being for
the first time, seclusion for a fortnight and deprivation of the college portion for that
time; for the second, that penalty doubled, and for the third, dismissal from the college.

19. The college shall be locked after the evening prayer, after time has been allowed for
the collegiates to arrive from the farthest part of the city. The third time that any
collegiate is late, he shall be dismissed from the college. No collegiate may go into the
city without his gown and beca.

20. The library shall be open two hours in the morning and two in the afternoon, but no
book shall be taken from it, “under penalty that the collegiate so doing, shall not enter
the library for six months, and shall pay the college for the book, unless he return it. The
librarian or attendant shall be the senior collegiate, and he shall be present in the said
library one hour in the morning and one in the afternoon.”

21. Corcuera prescribes that he be advised of any case for expulsion in order that he may
give permission for such expulsion. Expulsion shall take place if it is proved that any
collegiate has obtained the beca for sinister reasons, or is not of the proper purity of
blood.

22. The collegiates shall live a good moral life under penalty of expulsion.

23. Collegiates shall be preferred in all appointments to the beneficed curacies and in the
church dignities.

24. Every day the collegiates shall recite a prayer for the king, besides a responsary for
the deceased sovereigns. They shall assemble (as is the custom at San José) twice in the
chapel, once on rising in the morning, and the second time at night, at which times the
said prayers shall be repeated.

25. The auditor Diego de Rivera shall be the protector of the college, and in his absence,
the one who shall be appointed by the government. The governor shall inspect the
college annually without the intervention of any ecclesiastic, but he may delegate it to
the father provincial of the Society.

26. On the day of the patron saint of the college, the collegiates shall assemble and three
of the most capable shall be chosen as assistants to the rector in matters of importance.
27 and 28. The college shall contain archives for the conservation of important papers,
and records.

29. The rector shall have especial care of the money assigned for the support of the
collegiates.

30. One of the art or theological collegiates shall be elected annually as conciliar, when
the number is sufficient to warrant it.

31. If the expenses of the degree of doctor or licentiate in any course reach 400 pesos,
counting the fees, theaters, gloves, collations, and other things, the royal collegiates shall
pay only half the fees to the doctors and teachers.

32. The senior collegiate in any course shall be graduated before the other students in
that course.

33. The college is entrusted to the Jesuits as Corcuera has full confidence in them.

The Dominicans asked that the twenty fellowships founded by Corcuera be adjudged to
their college, without any gratification or income. Their request was made by the rector
of that college, Fray Domingo Goncales, and the other religious of the same, and they
offered to take the twenty students free of all charge to the king, as an appreciation of the
latter’s many favors to their college. Corcuera answered the request by a decree,
November 23, 1640, in which he suggested that the Dominicans might use the 3,000
pesos which they offered for the support of the fellowships, for bringing over
missionaries of their order from Spain, thus relieving the king of that expense. But it is
not in accord with the greatness of the king to listen to such a proposal. On August 8,
1641, Corcuera wrote to Felipe IV, stating the reason which induced him to found the
college. He cites therein the request made him by the Manila cabildo, encloses the
Dominican’s petition, and gives his reasons for refusing it. He also asks that the college
be exempted from the payment of the half-annats, as it is a royal institution.

When Diego Fajardo took possession of the government, August 11, 1644, he ordered
the assignments for the fellowships, amounting now to 12,000 pesos, belonging to the
college of San Felipe, now received by the college of San José, to be returned, in
accordance with a royal decree dated June 16, 1643, ordering the former college
discontinued. The Jesuits urged against the measure “that his Majesty did not order that
the Society should pay the said sum, but that there be given to the royal treasury what
the Society had received, leaving it to the decision of the royal official judges how it was
to be paid and by whom; that the seminary of San José was a distinct college, and had
made no use of what had been spent in the support of the royal college; that it was only
interested because it had given them a house in which to live: consequently it was not
right that it should pay from the income which its founder had instituted, what they had
not eaten and drunk. As regards the embargo of property, we alleged immunity, for it was
proved that the incomes of the college of San José were ecclesiastical.” The sentence
was given in favor of the Society by the royal officials, but the governor would not
listen. The Society were ordered to pay the 12,000 within three days. The governor
refused to discount 8,000 pesos owed the Society by the treasury, and to take 4,000
pesos in cash, and hence, it became necessary for the Society to seek a loan. The king on
fuller information, ordered the Society to be reimbursed to the amount of the 12,000
pesos, if it had been collected from them, by a royal decree dated March 17, 1647.7

1 The original is asi bonetes como capillas. Bonetes refers to the secular priest who wears a bonnet, in
contradistinction to the regular, who wears a hood or cowl, capilla. See Appleton’s New Velázquez
Dictionary. ↑
2 Concepción says (vi, pp. 190, 191) that a house was bought for the new college next to the college of
San José; and January 20, 1641, the first becas were given. Some of the Jesuits did not approve the new
college, and sighted the fatal results from afar, “from taking so great a sum from the royal treasury,
without sufficient authorization.” “But the fathers in power trampled everything under foot, for they were
quite confident in its introduction, and thought that if those powers had no effect, no harm would come
from its results, while the present gain was very great and constant.” ↑
3 “The Society alleged that the decree was obtained on false representation and contained falsehoods in
its narration; that its execution should be suspended, until truer reports were given to the sovereign; that,
even laying aside this vice, the Society, against whom the execution was to be made, was not a party; that
the royal decree did not order it, nor did law declare it, because neither the Society nor the college of San
Joseph was interested in such sum, which at best ought to be collected from the collegiates, for whose use
it had been spent, or from the governor, at whose order the money had been paid out; and that the embargo
was an excess on laymen, since it was in ecclesiastical incomes.” On this account the royal officials
decreed in favor of the Society. See Concepción’s Historia, vi, pp. 191, 192. ↑
4 “The Society continued its demands at court, and gained their plea, and the governor was ordered, in
case that sum had been collected, to restore it to the Society. If that sum had not been paid, no further
effort was to be made to collect it. Seemingly this order had no effect, for the king gave them as
recompense an encomienda, in which the Society were to make good their losses.” Concepción’s Historia,
vi, p. 193. ↑
5 See post, pp. 187–192. ↑
6 We present these regulations for the most part only in abstract. ↑
7 This decree is given by Fray Bernardino Nozaleda de Villa, the last Spanish archbishop of Manila, in
his Colegio de S. José, (appendix, document no. 5, pp. x, xi), a pamphlet presenting the Church side in the
recent controversy of San José College, argued before the Philippine Commission; and also by Pastells, in
his edition of Colin, ii, pp. 493, 494. See also various documents treating of this college presented by
Pastells, ut supra, iii, pp. 763–781. ↑
SECULAR PRIESTS IN THE PHILIPPINES
Summary of a letter by Archbishop Pardo (dated June 6, 1680), in answer to a letter from the
king and a royal decree of August 22, 1077.

This decree ordained that the archbishop should make all the efforts that he possibly
could to maintain at their studies such Indians of the islands as were inclined to that
pursuit, and in due time should promote them to holy orders, when he found them
properly instructed; and that for this purpose some boys should enter the colleges that
the Dominicans and Jesuits maintain, until a seminary be founded. The archbishop stated
the little inclination that the Indians have for theological and moral studies, and that
there was the additional difficulty of their evil customs, their vices, and their
preconceived ideas—which made it necessary to treat them as children, even when they
were fifty or sixty years old. He considered even the sons of Spaniards, born in the
islands, unsuitable for priests, since they were reared by Indian or slave women, because
of their defective training and education in youth. Finally, on account of the sloth
produced by the climate, and of effeminacy and levity of disposition, it was evident that
if they were ordained priests and made ministers to the Indians when they were not
sufficiently qualified therefor, through the necessity there was for them, they did not
again open a book, and with their vicious habits set a very bad example to their
parishioners. That which should be done was to send from España those religious who
were most zealous for the conversion of souls.1

1 See LeRoy’s Philippine Life in Town and Country (New York and London, 1905), pp. 120–122. See
also various estimates on the capacities of the Filipinos in LeRoy’s article “Friars in the Philippines,” in
Political Science Quarterly, xviii, pp. 675–678. ↑
ROYAL DECREE CONCERNING NATIVE SCHOOLS

The King. Inasmuch as it is ordered by law v, título 13, book i,1 of the Nueva
Recopilación de las Indias that all the archbishops and bishops of the Indias give order
in their dioceses to the curas and missionaries to the effect that by using the most mild
means, they order and direct all the Indians to be taught the Spanish language, and the
Christian doctrine in that language, so that they may become more proficient in the
mysteries of our holy Catholic faith, gain profit for their salvation, and attain other
advantages in their government and mode of living; and inasmuch as it is ordered by
another law, namely, law xviii, título i, of book vi, that schools be founded for the
Indians and teachers appointed to teach the Castilian language to those who wish of their
own free will to learn it, in the manner that may be of least trouble to them and without
cost to them; and since it appears that the sacristans of the churches can do this well, just
as in the villages of these kingdoms they teach reading, writing, and the Christian
doctrine:2 therefore, considering, in my royal Council of the Indias, the great advisability
of observing this in the future strictly and inviolably, as it is inferred to be the most
efficient means for banishing idolatries, to which the Indians are for the greater part
addicted at present, as they were in the beginning of their conversion, from this means
also it follows that the vexations which are practiced on them will cease in whole or in
great part, and the Indians will be able to make their complaints directly to the superiors
without making use of interpreters, who being bribed change the translation, I have
resolved to order and command, as I do by this present, my viceroys, presidents,
governors, corregidors, and alcaldes-mayor, who hold office at present or shall hold
office in the future, of all the provinces of Nueva España, Guatemala, Filipinas Islands,
and Barlovento, and I ask and request the archbishops and bishops of the metropolitan
churches and cathedrals of those countries, each one, so far as it concerns him, to watch
carefully and strictly over the observance of the laws above cited. They shall cause them
to be carried out strictly, without any opposition or interpretation, so that the Indians
may study the Castilian language and begin immediately to learn it. I charge all to have
especial care in this, and I warn (as I do by this present) the viceroys, presidents,
governors, corregidors, and alcaldes-mayor of all the provinces and islands above
mentioned, that the non-observance of this shall be charged against them in their
residencias.3 I also order and command generally all the ecclesiastical and secular
ministers mentioned in this despatch, to report to me on all occasions when a fleet sails,
and on all other occasions that offer, that they have placed in practice what is expressed
and mentioned by the above-mentioned laws, and of what they shall continue to do in
their observance and punctual performance, and the result thereof; for it is so important
for the end which is proposed and so to the service of God and myself, to be informed of