Probiotics & Antimicro. Prot.

(2017) 9:262–277
DOI 10.1007/s12602-017-9256-z

Probiotic Potential of a Lactobacillus Bacterium of Canine

Faecal-Origin and Its Impact on Select Gut Health
Indices and Immune Response of Dogs
Sachin Kumar 1,2 & Ashok Kumar Pattanaik 1,3 & Shalini Sharma 1 &
Sunil Eknath Jadhav 1 & Narayan Dutta 1 & Avneesh Kumar 1

Published online: 10 February 2017

# Springer Science+Business Media New York 2017

Abstract The objective of the present study was to de- dairy-origin probiotic) and cPRO (with L. johnsonii
velop a probiotic of canine-origin for its potential appli- CPN23 as a canine-origin probiotic). Results of the 9-
cation in pet nutrition. Accordingly, 32 lactic acid bac- week study indicated that supplementation of cPRO im-
teria (LAB) strains were isolated from faeces of dogs, proved (P < 0.05) the faecal concentration of acetate
out of which 9 strains were short-listed for further and butyrate with a concomitant reduction (P < 0.05)
in vitro testing based on the aggregation time and cell in faecal ammonia. The cell-mediated immune response,
surface hydrophobicity. The results of acid-, bile- and assessed as delayed-type hypersensitivity reaction to
phenol-tolerance tests indicated that out of the nine, phytohaemagglutinin-P, was better (P < 0.05) in dogs
isolate cPRO23 was having better resistance to these fed cPRO as compared to the CON dogs. There were,
adverse conditions likely to be encountered in the gas- however, no variations evident in the antibody response
trointestinal tract. The isolate also showed optimal en- to sheep-erythrocytes among the three groups. It is con-
zymatic activities for amylase, lipase and protease. cluded that the canine-origin L. johnsonii CPN23, in
Further assessments also indicated its superiority in addition to possessing all the in vitro functional attri-
terms of co-aggregation and antagonistic activity against butes of a candidate probiotic, also has the potential to
pathogenic strains of Salmonella typhimurium and be used as a probiotic in pet nutrition programs.
Salmonella enteritidis. Subsequently, the isolate was
identified through 16S rRNA sequencing and sequence Keywords Canine-origin . Dogs . Immunity . Gut health .
homology, and designated as Lactobacillus johnsonii In vitro . Lactobacillus johnsonii CPN23 . Probiotics
CPN23. The candidate probiotic was then evaluated
in vivo using 15 adult Labrador dogs, divided into 3
groups, viz. CON (with no probiotics), dPRO (with Introduction
Lactobacillus acidophilus NCDC 15 as a conventional
The intestinal microbiota is a complex dynamic ecosystem
that harbours ~1014 cfu of bacteria composed of 500 to 1000
different species [1]. These commensal microbes are impor-
* Ashok Kumar Pattanaik tant determinants for maintaining the stability of digestive
[email protected]; [email protected] tract and help prevent intestinal infections by modulating im-
mune response and supporting overall health of the host [2, 3].
1 However, in the event of any perturbations in their symbiotic
Clinical and Pet Nutrition Laboratory, Centre of Advanced Faculty
Training in Animal Nutrition, ICAR-Indian Veterinary Research relationship with the host, either owing to endogenous and/or
Institute, Izatnagar 243 122, India exogenous factors, the homoeostasis is lost leading to clinical
2
Present address: Animal Nutrition Division, ICAR-National Dairy conditions. In these scenarios, probiotics play an important
Research Institute, Karnal 132 001, India role in restoring the host-bacteria mutualism. Probiotics are
3
Present address: Department of Food Science and Human Nutrition, live culture of microbes that are added to the food to exert
University of Illinois, Urbana, IL 61801, USA beneficial effects on the host, and have been widely used in
Probiotics & Antimicro. Prot. (2017) 9:262–277 263

health and disease situations. The most commonly used mi- origin from the faeces of dog and test its efficacy in vivo using
croorganisms as probiotics belong to the strains of lactic acid adult Labrador dogs.
bacteria [4]. Within the group of lactic acid bacteria (LAB),
Lactobacillus species is the most commonly utilized microor-
ganisms used as probiotics [5]. Material and Methods
Host species specificity is often considered as a re-
quirement for optimizing the beneficial impacts of a Isolation and Characterization of LAB Isolates
probiotic [6, 7]. This is particularly important if the
probiotic is intended to be used as a therapeutic for Fresh faecal samples, collected aseptically from rectum of five
management of GI disorders. The specificity of adhe- Labrador dogs, were homogenized in phosphate-buffered sa-
sion of probiotic bacteria, lactobacilli for example, to line (PBS) and centrifuged. One millilitre of the supernatant
epithelial cells is host-specific, and if the colonization was inoculated in to 9 ml Lactobacillus-selective broth (MRS
is to be reached, it is essential to administer the bacteria broth; Difco Laboratories) and incubated at 37 °C for 24 h for
that have been originated from the host species for enrichment. Subsequently, 1 ml of this enriched culture was
which they are being given [8]. It is therefore important serially diluted (ten-fold) in sterile normal saline (0.85% w/v
for the introduced microbes not to disturb the indige- NaCl) and appropriate dilution was plated on MRS agar and
nous population, which has already been adapted to the incubated at 37 °C for 24–48 h. Thirty-two well-isolated col-
environment of the GI tract to work both for and with onies were picked up with sterile needles into sterile MRS
the host [9]. This concept has led to successful deve- broth (10-ml tubes) and incubated for 24 h at 37 °C and puri-
lopment and validation of several of species-specific fied by streaking twice on MRS agar. The colonies appeared
probiotics involving human [10], farm animals [11], were examined based on microscopic, morphological and bio-
commercial poultry [12, 13], aquatic species [14], etc. chemical tests involving Gram-staining, catalase test and car-
However, research on the development of probiotic of bohydrate fermentation profile for identification of prospec-
canine-origin has not taken up in the right earnest yet. tive LAB. All the isolates were stored at refrigeration temper-
It has been conceptualized that a successful canine pro- ature (2 to 5 °C) between subcultures, and all stock cultures
biotic organism should ideally be derived from the canine GI were stored at −70 °C in 50% glycerol. Each isolate was
tract [5]. There are some in vitro studies on the probiotic maintained by sub-culturing in MRS broth using 1% inocu-
properties, including the probiotics of canine-origin, conduct- lum. The probiotic properties of the isolates were compared
ed by several researchers [5, 15–17]. However, studies on with the dairy-origin probiotic Lactobacillus acidophilus
using canine origin probiotic are very limited and, as a NCDC 15 (dPRO) procured from the National Collection of
result, the probiotics widely used in the dogs are mainly Dairy Cultures, Karnal, India.
of non-canine origin. Most of the commercial probiotic All isolates were subjected to the Gram staining procedure
strains for dogs also do not have a canine origin [18]. for confirming the LAB as Gram-positive rods. The isolates
Safety and functional properties for the selection of a novel were then tested for the presence of catalase. The 24-h-old
probiotics are of paramount importance, and are generally cultures picked from a MRS agar were placed on a slide and
based on a series of in vitro assays. Because, there are a num- added with a drop of 3% H2O2. Appearance of instant bub-
ber of requirements for probiotic strains to adapt to the intes- bling due to release of oxygen indicated a catalase-positive
tinal environment of an animal species, e.g. bile acid tolerance reaction.
and affinity to the intestinal mucosa and glycoproteins [9], and
it applies to candidate probiotics of both allochthonous and Aggregation Test
autochthonous origins. Hence, for a probiotic to be successful,
it must not only survive exposure to gastric acid and bile after The isolates were subjected to aggregation test [22] by putting
ingestion but must also be capable of colonizing the GI tract in the overnight cultures of LAB into microfuge tube. It was
the presence of the pre-existing microflora [19, 20]. This is all allowed to be kept undisturbed for 2 h and examined every
the more important for potential clinical use of the probiotics, 15 min to denote the time taken for complete aggregation of
because when used therapeutically, probiotic supplementation the bacterial cells to the bottom of the tubes, leaving a clear
is intended to re-establish a healthy bacterial balance [21]. supernatant fluid.
Hence, a successful canine-origin probiotic development pro-
gram should not only involve development and in vitro con- Cell Surface Hydrophobicity Assay
firmation of the safety and functional attributes but also its
successful validation using dogs, the target animal. Keeping The degree of hydrophobicity of the isolates based on the
the above background in view, the present study was under- affinity of the bacterial cells (cultured overnight in MRS
taken to isolate and characterize a lactobacilli strain of canine- broth) to toluene or xylene in a two-phase system was
264 Probiotics & Antimicro. Prot. (2017) 9:262–277

determined [23]. Hydrophobicity was calculated from three rial suspension due to cells partitioning into the hydrocarbon
replicates as the percent decrease in OD of the original bacte- layer as:

h . i
Hydrophobicity % ¼ ðA600 before mixing−A600 after mixingÞ ðA600 ; after mixingÞ  100

Biochemical Characterization was diluted to a concentration of ~107/ml. Subsequently, the

counts of viable cells were determined by growing the suspen-
Based on the time taken for aggregation (≤75 min) and hydro- sions on MRS containing different concentration (viz. 0.0, 0.03
phobicity (>80%), nine isolates were chosen for further studies. and 1.0% w/v) of purified bile (Ox Bile; HiMedia Laboratories,
These selected isolates were evaluated further for their growth at Mumbai, India) anaerobically at 37 °C for 48 h [25].
diverse culture conditions involving varied temperature (15, 37, Additionally, 5-ml tubes of MRS broth with and without 0.3
45 and 60 °C), pH (2.0, 4.0 and 6.0) and salt (NaCl; 6.5 and and 1% (w/v) bile were inoculated (1%) with freshly prepared
10%) by inoculating 10-ml tubes of MRS broth with 1% inocula, cultures of the isolates. All tubes were incubated in a water bath
and assessing the growth at the end of 24-h incubation (at 37 °C at 37 °C for 6 h and absorbance was read hourly at 620 nm using
in case of different pH and NaCl). In all three cases, the growth uninoculated broth as the blank. The time taken for the A620 nm
indicated by appearance of turbidity was observed visually. The of each culture to increase by 0.3 units was taken as the basis for
ability of the selected isolates to ferment various sugars was also comparison of bile tolerance [5].
examined using HiCarbohydrate™ kit (HiMedia Laboratories Similarly, bacterial suspensions of the isolates were inocu-
Pvt. Ltd., Mumbai, India). lated (1%, v/v) in MRS broth adjusted at pH 6, 4 and 2 or MRS
broth without or with 0.4% phenol for determining
Detection of Enzymatic Activities growth/survival of LAB under low pH [25] and pres-
ence of phenol [2, 10]. After 24 h of incubation at
The selected LAB strains were tested for the presence of enzyme 37 °C, the cultures were appropriately diluted and
(viz., amylase, protease and lipase) activities [24] as spread plated on MRS agar, and viability was deter-
Lactobacillus secretes enzymes on overnight culture for facilitat- mined by standard plate count.
ing digestion process. To detect the enzyme activity, the LAB
cultures were sub-cultured and cell-free supernatant (CFS) ob-
tained by centrifugation at 7500 g for 5 min. It was followed by Interaction of the LAB Strains with Pathogens
spot-inoculation of the CFS into respective media (MRS medium
containing starch for amylase, olive oil and gum Arabic for li- Co-aggregation Test
pase, and skim milk for protease). The plates were incubated
anaerobically at 37 °C for 48 h. The relative enzymatic activity The co-aggregation potential of the LAB isolates with two
was identified by visual observation and the halo zone formed pathogenic bacteria viz. Salmonella enteritidis and
surrounding each colony was measured for qualitative assay of Salmonella typhimurium was carried out [26]. Suspensions
the enzymes. of the respective LAB cultures and both the pathogenic strains
were adjusted to an OD of 0.5 using phosphate buffer at pH 7.
Evaluation of Probiotic Attributes Equal volumes (0.5 ml) of the cell suspension of each patho-
gen and the test isolates were placed together in a test tube and
The nine short-listed LAB isolates were tested for their ability to mixed thoroughly using a vortex. The OD600 of the bacterial
thrive in simulated (in vitro) gut-like conditions involving low mixture was measured following incubation at 37 °C for 4 h
pH, bile salt and presence of phenol. Overnight cultures of the against control (tube containing 1-ml of a suspension of indi-
isolates were centrifuged at 7500×g for 5 min at 4 °C. After re- vidual bacterial strains). The percentage of co-aggregation
suspending the culture pellets in the phosphate buffer (pH 6), it was calculated [27] as:

Percentage of coaggregation ¼ f½ðPC þ LCÞ=2−ðP þ LÞ=ðPC þ LCÞ=2g  100

Where PC and LC represent the OD600 in control tubes P + L represents the optical density of the mixed culture after
containing only pathogen or LAB cultures, respectively, and the same period of incubation.
Probiotics & Antimicro. Prot. (2017) 9:262–277 265

Antagonistic Activity In Vivo Evaluation

The inhibitory activity of the isolates was assessed by well Animals and Feeding
diffusion assay [28]. Plates containing solidified nutrient agar
was overlaid with soft nutrient agar (0.7% agar in nutrient Fifteen adult healthy Labrador female dogs (~5 years;
broth) and inoculated with an overnight culture of S. 22.9 ± 0.6 kg average BW) were divided into 3 equal groups
typhimurium or S. enteritidis. Wells were made in the agar at and fed on a pressure-cooked semi-moist diet nutritionally
the periphery and one at the center each 6 mm in diameter, and adequate as per NRC [33] for a period of 15 days for adapta-
30 μl of CFS of the LAB isolates (obtained by centrifugation tion. Subsequently, the basal diet was supplemented with ei-
at 7500×g for 5 min) was transferred into each well. The plates ther no probiotics (CON), or with the probiotic of canine-
were incubated aerobically for 24 h at 37 °C following which origin (LAB isolate cPRO23; cPRO) or dairy-origin (L.
these were examined for clear inhibition zones around the acidophilus NCDC 15; dPRO) at 2–3 × 108 cfu per animal/
wells, which were then measured. day. The CON group received a placebo (MRS broth). All the
dogs had 24 h access to ad libitum clean and fresh water. The
Antibiotic Sensitivity Profile of Lactobacilli Isolates dogs were provided access to socialization and exercise in an
open area adjacent to the kennel.
Overnight grown cultures of each isolates was spread evenly
on MRS agar plates and readymade Octo Disc antibiograms Study Protocol and Analyses
(HiMedia Laboratories Pvt. Ltd., Mumbai, India) were placed
upside down, pressed on the top of agar plates and incubated During the 9-week experiment, faecal samples were collected
overnight at 37 °C, and checked for growth inhibition zones for four consecutive days after 7 weeks of feeding trial. Faeces
[29]. Bacterial resistance was defined as the absence of growth excreted by dogs were pooled over 24-h periods and stored in
inhibition zone around the antibiotic discs. individually marked clean and sterile polyethylene bags in
refrigerated (4 °C) conditions until the time of sampling.
Molecular Characterization The faeces thus collected were weighed individually for each
dog, mixed thoroughly, and brought to the laboratory for fur-
Out of the nine short-listed LAB isolates, the isolate cPRO23 ther sampling. Aliquots were drawn from the faecal samples
which showed the optimal desirable functional attributes as a and processed for determination of dry matter (DM) and fer-
candidate probiotic processed for genomic DNA extraction mentative metabolites as described elsewhere [3]. The pH of
and identified based on PCR amplification and sequencing the faecal samples was measured with the help of pH meter
of 16S rRNA gene using bacterial universal primers (27F 5′- (pH Spear; Eutech Instruments, Malaysia). Lactate, ammonia
AGAGTTTGATCCTGGCTCAG and 1492R 5′-GGTT and short-chain chain fatty acids (SCFA) in the faecal samples
ACCTTGTTACGACTT) [30]. The PCR was performed in were estimated adopting standard procedures as detailed in an
25 μl reaction volumes containing 2X Taq Master Mix, earlier publication [34].
0.25 mM forward primer, 0.25 mM reverse primer and Enumeration of select bacterial species in the faecal sam-
0.4 ng of genomic DNA and nuclease-free water to make ples was done using culture-dependent methods as detailed
volume 25 μl. Temperature cycling conditions for PCR were elsewhere [35]. About 5 g fresh faeces was collected asepti-
as follows: an initial heating of 95 °C for 3 min, followed by cally from the rectum of individual animals and processed
40 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C using selective media for Lactobacilli (Rogosa agar),
for 30 s, extension at 72 °C for 90 s and terminating with a Coliforms (MacConkey agar), Clostridia (Reinforced
5 min final incubation of 72 °C. Gradient temperature PCR Clostridial agar) and Bifidobacteria (Bifidobacteria agar).
was utilized to improve primer-annealing temperatures to The bacterial colonies were counted between 24 to 48 h as
make certain a high degree of primer specificity during assays colony forming units (cfu) per g faeces and expressed as log10
[31]. The PCR products were examined with electrophoresis cfu/g.
(Gel Electrophoresis Systems. Major Science, Taiwan) on a On day 58 of the study, all dogs were injected intra-
1.5% w/v agarose gel, stained by Safe Lab nucleic acid stain. dermally with 50 μg phytohaemagglutinin-P (PHA-P;
The PCR products were purified, and sequenced and analysed Sigma, St Louis, MO, USA) dissolved in 100 μl PBS in order
for sequence homology by BLAST (http://www.ncbi.nlm.nih. to assess the cell-mediated immunity (CMI) [36]. The resul-
gov/). Sequences of close relatives together with the newly tant type-IV delayed-type hypersensitivity (DTH) response
determined sequences were aligned using the ClustalW was assessed by measuring the skin induration at 0, 12, 24,
software program (NCBI, Bethesda, MD, USA) [32]. The 48 and 72 h post-injection using a digital Vernier’s calliper.
sequence was submitted to NCBI for obtaining GenBank Following 5 weeks of experimental feeding, dogs were
Accession Number. intravenously injected with 1 ml of a 10% suspension of
266 Probiotics & Antimicro. Prot. (2017) 9:262–277

washed sheep red blood cell (SRBC; in 0.15 M NaCl) as an Table 1 Comparative cell surface hydrophobicity and aggregation time
of the nine short-listed LAB isolates
antigen for assessing their humoral immune (HI) response
[35]. Sera samples were collected before injection (day 0) Isolates Hydrophobicity (%)1 Aggregation time (min)
and subsequently at days 7, 14, 21 and 28, and stored at
−20 °C for antibody measurement using the microtitre Toluene Xylene
haemagglutination (HA) procedure [37]. dPRO 56.41a 50.89a 60
bc
cPRO-4 86.10 85.88bc 75
Statistical Analyses
cPRO-6 85.13bc 83.89bc 75
cPRO-7 87.18bc 84.31bc 75
The experimental data generated from the in vitro tests were
cPRO-8 88.19bc 81.90b 75
analysed by one-way analysis of variance using SPSS 18.0
cPRO-16 83.98b 89.46c 75
(SPSS Inc., Chicago, IL, USA). The in vivo faecal metabolites
cPRO-22 85.63bc 82.35b 60
data were also subjected to one-way ANOVA. Differences
cPRO-23 89.87c 89.50c 60
between the means were determined by Duncan’s multiple
cPRO-29 89.66c 80.91b 75
range test. Additionally, contrast analysis was employed to
cPRO-30 89.05bc 82.81b 75
ascertain the differences, if any, between the treatments
SEM 1.59 1.84 –
cPRO and dPRO. The immunological data were analysed
P value <0.001 <0.001 –
adopting ANOVA for repeated-measures procedure.
Contrast2 <0.001 <0.001 –
Analysis included between-subjects main effect of diet,
within-subjects main effect of period of sampling and interac- Means bearing different superscripts in a column differ significantly
tion between periods of sampling × diet. The effects were (P < 0.05)
considered significant at P < 0.05 and declared as trend at 1
Mean of three observations each
0.05 < P < 0.10. 2
Significant difference between dPRO vs. all cPRO isolates taken
together

Results and Discussion

aggregation time of 60 min while others did show 75 min.
Isolation and Characterization In terms of cell surface hydrophobicity, cPRO23 exhibited
the highest (P < 0.001) hydrophobicity both in toluene as well
The bacterial populations of GI tract are specific and particular as in xylene. The reference strain dPRO (L. acidophilus
for the different class of animals [38]. In the present investi- NCDC 15) showed less aggregation time and lower hydro-
gation, we isolated 32 different isolates and identified all of phobicity (P < 0.001) as compared to canine-origin dPRO
them as Gram-positive and catalase-negative. Likewise, isolates. Strains with high aggregation had better attachment
Perelmuter et al. [16] isolated and identified Lactobacillus to the epithelial cells [25]. Considering the fact that the strains
murinus from faeces of a healthy dog and characterized the can adhere to cell monolayers if they can auto-aggregate and
LAB as Gram-positive, non-sporulated rods, glucose manifest strong hydrophobicity [41], isolate cPRO23 is appar-
homofermenter, catalase- and oxidase-negative. ently a better probiotic candidate.

Aggregation Time and Cell Surface Hydrophobicity Biochemical Characterization

Aggregation test is appropriate as first step for screening of The results of the biochemical attributes of the isolates
probiotic strains owing to its simplicity and applicability to a (Table 2) indicate that all the nine isolates exhibited luxurious
large number of test strains [25, 12, 39]. It shows clumping of growth at pH 4, moderate growth at pH 6 and weak growth at
strains together and potential adhesion ability to the epithelial pH 2, and apparently were not different from the reference
cells indirectly but in a strong way [39]. It has been reported strain dPRO. All the isolates recorded maximum (luxurious)
that bacterial cell surface hydrophobicity and auto- growth at 37 and 45 °C with comparatively weaker growth at
aggregation ability are directly correlated [40]. 15 °C. However, at higher temperature (60 °C), none of the
In the present investigation, those isolates having aggrega- isolates could grow except for the cPRO4, cPRO22 and
tions time ≤75 min and hydrophobicity >80% were selected cPRO23, and the reference strain dPRO. Likewise, there
for further evaluation (Table 1). On this basis, nine isolates was no variations among the test isolates (including dPRO)
(cPRO4, cPRO6, cPRO7, cPRO8, cPRO16, cPRO22, when grown in media with low (6.5%) or high (10%) NaCl
cPRO23, cPRO29 and cPRO30) were selected for further concentrations, although there was a reduction in the extent of
screening. Isolates cPRO4, cPRO22 and cPRO23 showed growth across the isolates with increasing the salt levels in the
Probiotics & Antimicro. Prot. (2017) 9:262–277 267

Table 2 Comparative growth1 of the LAB isolates upon exposure to Table 3 Carbohydrate fermentation1 of LAB isolates using API CHL
varied conditions of pH, temperature and salt (NaCl) concentrations identification systems2

Isolates pH Temperature (°C) NaCl (%) Attributes dPRO cPRO

2.0 4.0 6.0 15 37 45 60 6.5 10 4 6 7 8 16 22 23 29 30

dPRO + +++ ++ + +++ +++ + ++ + Lactose + + + + + + + + + +

cPRO-4 + +++ ++ + +++ +++ + ++ + Xylose + + + + + + + + + +
cPRO-6 + +++ ++ + +++ +++ − ++ + Maltose + + + + + + + + + +
cPRO-7 + +++ ++ + +++ +++ − ++ + Fructose + + + + + + + + + +
cPRO-8 + +++ ++ + +++ +++ − ++ + Dextrose + + + + + + + + + +
cPRO-16 + +++ ++ + +++ +++ − ++ + Galactose + + + + + + + + + +
cPRO-22 + +++ ++ + +++ +++ + ++ + Raffinose + + + + + + + + + +
cPRO-23 + +++ ++ + +++ +++ + ++ + Trehalose + + + + + + + + + +
cPRO-29 + +++ ++ + +++ +++ − ++ + Melibiose + + + + + + + + + +
cPRO-30 + +++ ++ + +++ +++ − ++ + Sucrose + + + + + + + + + +
1 L-arabinose + + + + + + + + + +
Growth criteria: +++ (luxurious growth), ++ (Moderate growth), +
Mannose + + + + + + + + + +
(weak growth), − (no growth)
Inulin + + + + + + + + + +
Sodium gluconate + + + + + + + + + +
Glycerol + + + + + + + + + +
media. There were no variations among the isolates in terms of
their carbohydrate fermentability (Table 3). Out of the 34 Salicin + + + + + + + + + +
sugars tested, the isolates could hydrolyze all except the four Dulcitol + + + + + + + + + +
sugars viz. esculin, ONPG, citrate and malonate. Inositol + + + + + + + + + +
Sorbitol + + + + + + + + + +
Mannitol + + + + + + + + + +
Enzymatic Activity Adonitol + + + + + + + + + +
Erythritol + + + + + + + + + +
All the candidate isolates showed the variable (P < 0.001) α-Methyl-D-glucoside + + + + + + + + + +
ability to secrets the enzymes tested viz. amylase, lipase and Rhamnose + + + + + + + + + +
protease (Fig. 1). The highest (P < 0.001) activities for amy- Cellobiose + + + + + + + + + +
lase and lipase was shown by isolates cPRO16, cPRO22 and Melezitose + + + + + + + + + +
cPRO23 (although not in the same order); these values are α-Methyl-D-mannoside + + + + + + + + + +
apparently at par with the reference strain dPRO. However, Xylitol + + + + + + + + + +
protease activity was the maximum in cPRO23 followed by ONPG _ _ _ _ _ _ _ _ _ _
cPRO22 and cPRO4 being significantly (P < 0.001) higher in Esculin _ _ _ _ _ _ _ _ _ _
comparison to dPRO. The enzymatic release assays are im- D-arabinose + + + + + + + + + +
portant for characterizing the probiotic potential of bacterial Citrate _ _ _ _ _ _ _ _ _ _
strains. A probiotic possessing enzymatic activities involving Malonate _ _ _ _ _ _ _ _ _ _
amylase, protease and lipase can improve the digestion pro- Sorbose + + + + + + + + + +
cess. There are reports that Lactobacillus with high amylase
activity resulted in improved feed conversion in pigs [42].
1
Readings were recorded after 24 h at 37 °C; ‘+’ denotes positive reac-
tion, and ‘–’ denotes negative reaction
Although there are differences among the isolates in the extent 2
Carried out using HiCarbohydrate™ kit (HiMedia Laboratories Pvt.
of individual enzyme activity, the isolate cPRO23 was found Ltd., Mumbai, India)
to possess optimal activities for all the three enzymes tested.
Furthermore, when compared against the dPRO, it showed
higher (P < 0.001) amylase and protease activities which Probiotic Attributes
was accompanied by a comparable (6.25 ± 0.48 vs.
6.75 ± 0.25; P > 0.05) lipase activity. The current re- Bile Salt and Acid Tolerance
sults are in accordance with earlier reports involving
LAB isolated from poultry where the authors found that All the isolates showed resistance to bile at 0.3% oxgall concen-
bacterial isolates from poultry displayed different amy- tration while there was a decrease in cfu count of all isolates at
lase and protease activities [39]. 1% level (Table 4). Nonetheless, isolates cPRO8, cPRO16,
268 Probiotics & Antimicro. Prot. (2017) 9:262–277

Fig. 1 Comparative enzymatic 20

Amylase Lipase Protease

Enzyme activity (as halo zones, mm)

(amylase, lipase and protease) 18
activities of the nine selected
16
canine-origin LAB isolates
(cPRO) vis-à-vis the diary-origin 14
(dPRO) isolate
12

10

0
dPRO cPRO4 cPRO6 cPRO7 cPRO8 cPRO16 cPRO22 cPRO23 cPRO29 cPRO30
Lactobacilli isolates

cPRO22 and cPRO23 grew significantly faster (P < 0.001) in similar values indicative of comparable resistance to low pH
MRS agar containing 1% oxgall concentration in comparison to (2.0) as that of the reference probiotic dPRO.
others with the values being comparable to the dPRO. Moreover, The ability to survive under low pH during gastric transit
when bile tolerance was compared in terms of the time taken by and tolerance to bile salts are the foremost requisites for a
isolates to increase absorbance by 0.3 units, it was observed that probiotic culture to be established in the gut [43, 44]. It has
isolate cPRO23 grew faster (P < 0.001; indicated by the lowest been reported that bile resistance could differ among strains of
time) in the presence of bile salt at both the levels even when a single species of enteric lactobacilli and that this difference
compared to dPRO (Table 4). could account for differences in ability to colonize the intesti-
All the isolates did show a decrease in resistance as pH nal tract [45]. Bacteria are stressed both by bile salts and by
decreased from 6.0 to 2.0 (Table 5). However, except for iso- low-pH condition in stomach [2]. In a study of canine-sourced
lates cPRO4 and cPRO6, all the other LAB isolates showed probiotic Lactobacillus fermentum AD1, it was observed that

Table 4 Bile salt tolerance of

LAB isolates exposed to varied Bacterial isolates Bacterial count (log10 cfu/ml) Time1 (h)
concentration of bile in the media
(at 37 °C for 24 h) Bile concentration2 (%) Bile concentration2 (%)

0.0 0.3 1.0 0.0 0.3 1.0

dPRO 10.30a 10.11 8.99bcd 3.12de 3.19bcd 5.12d

b a de bcd
cPRO4 10.39 10.11 8.81 3.06 3.20 5.46e
cPRO6 10.38b 10.06 8.91abc 2.84b 3.04ab 5.42e
cPRO7 10.31a 10.12 8.95bc 3.15e 3.52e 6.65h
cPRO8 10.39b 10.14 9.01cd 3.16e 3.29d 4.57b
cPRO16 10.41b 10.15 9.00cd 3.05de 3.22cd 4.83c
cPRO22 10.42b 10.16 9.06d 2.89bc 3.23cd 5.73f
cPRO23 10.43b 10.16 9.07d 2.70a 3.02a 4.24a
cPRO29 10.39b 10.12 8.89ab 2.90bc 3.07ab 5.55ef
cPRO30 10.40b 10.10 8.95bc 3.00cd 3.10ab 6.39g
SEM 0.08 0.11 0.14 0.039 0.049 0.086
P value <0.001 0.212 <0.001 <0.001 <0.001 <0.001
Contrast3 <0.001 0.335 0.200 0.001 0.436 0.002

Each value is represents the mean of three replicates

Means bearing different superscripts in a column differ significantly (P < 0.05)
1
Time taken by isolates to increase absorbance by 0.3 units at A620 nm
2
Purified bile (Ox Bile; HiMedia) concentration (%) in MRS agar
3
Significant difference between dPRO vs. all cPRO isolates taken together
Probiotics & Antimicro. Prot. (2017) 9:262–277 269

Table 5 Bacterial cell count

(log10 cfu/ml) of LAB isolates Isolates Acid tolerance Phenol tolerance
exposed to varied acidity (pH)
and 0.4% phenol in the media (at pH Phenol − Phenol +
37 °C for 24 h)
6.0 4.0 2.0 0h 24 h % 0h 24 h %
change change

dPRO 10.25bc 8.97 6.87cde 7.11b 9.12a 28.26b 7.10b 8.15d 14.76c
bc
cPRO4 10.23 8.92 6.76b 7.22 c 9.13a 26.44b 7.22c 8.08ab 12.03b
cPRO6 10.29c 9.05 6.52a 7.41d 8.99a 21.39a 7.37de 7.98a 8.18a
cPRO7 10.27c 8.89 6.89de 7.42d 10.16bc 36.87de 7.45e 9.12de 22.36e
cPRO8 10.28c 9.03 6.81bcd 7.17bc 10.02b 39.80e 7.10b 9.03c 27.13f
cPRO16 10.24bc 9.01 6.87bcde 7.27c 10.04b 38.03de 7.29cd 9.01c 23.70e
cPRO22 10.15ab 8.94 6.94e 7.42d 10.04b 35.26b 7.43e 9.06de 21.92e
cPRO23 10.29c 9.00 6.92de 7.40d 10.21c 37.81de 7.43e 9.20d 23.76e
cPRO29 10.10a 8.90 6.77bc 7.39d 10.15bc 37.49de 7.39de 9.09de 22.99e
cPRO30 10.28c 8.92 6.82bcd 6.93a 9.11a 31.49c 6.86a 8.10ab 18.04d
SEM 0.15 0.18 0.15 0.16 0.22 4.39 0.15 0.21 3.16
P value 0.008 0.088 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001
Contrast1 0.360 0.438 0.100 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001

Means bearing different superscripts in a column differ significantly (P < 0.05)

1
Significant difference between dPRO vs. all cPRO isolates taken together

the strain expressed in vitro survival at pH 3.0 after 3 h typhimurium was maximum with isolates cPRO8, cPRO16,
(86.8%) and in the presence of 1% bile (75.4%) [46]. In the cPRO22 and cPRO23 being significantly (P < 0.001) higher
present study, the demonstrated ability of cPRO23 to survive than the reference dPRO strain. Likewise, co-aggregation with
in bile acid and at low pH are suggestive of it being a good S. enteritidis was strongest in cPRO6 followed by cPRO30
probiotic candidate; apparently, it possesses the potential to and cPRO23 and were significantly (P < 0.05) higher than the
colonize and persist in the GI tract. dPRO. Co-aggregation test has become an established criteri-
on for the selection of bacteria as probiotic since it
shows the ability of lactobacilli to interact with patho-
Phenol Tolerance
genic bacteria [2, 50]. In the present study, cPRO23 had
shown the strongest co-aggregation percentage against
Phenols may be formed in the intestine by bacterial deamination
both the pathogens, which suggested that this isolate
of various aromatic amino acids derived from dietary or endog-
could be a good probiotic candidate. The ability of the
enously produced proteins [47, 48], and may have bacteriostatic
isolates to co-aggregate with the pathogens could con-
effect [49]. Thus, phenol tolerance assay may therefore generate
tribute potential probiotic properties, which may enable
additional information on the potential for survival of lactobacilli
them to form a barrier to prevent colonization by path-
in the GI tract [10, 49]. All LAB isolates in the present study
ogenic microbiota in the gut [51].
exhibited a reduction in growth with the addition of phenol as
could be seen from the comparative growth data of the control
(Table 5). However, the LAB isolates exhibited better
Antagonistic Activity
(P < 0.001) phenol tolerance when compared to the reference
dPRO strain, with the exception of cPRO6 and cPRO8.
The antagonistic activity of the lactobacilli isolates
Moreover, isolates cPRO8, cPRO23 and cPRO16 exhibited the
against the two pathogens was shown in Fig. 3. With
maximum tolerance among the test isolates.
the exception of isolates cPRO16, cPRO22 and
cPRO23, all other isolates showed lower (P < 0.001)
Pathogen Interaction antagonistic activity against S. typhimurium. The same
three isolates also exhibited maximum antagonistic ac-
Co-aggregation tivity against S. enteritidis, and in this case, the values
were higher (P < 0.001) than the reference dPRO strain.
All LAB isolates were able to co-aggregate with both the The antagonistic activity of the isolates that represents
pathogens (Fig. 2). Percentage of co-aggregation with S. their antimicrobial action is due to the potential of LAB
270 Probiotics & Antimicro. Prot. (2017) 9:262–277

Fig. 2 Comparative efficacy of a 60 S. typhimurium S. enteritis

the nine selected canine-origin
LAB isolates (cPRO) vis-à-vis the
diary-origin (dPRO) isolate for 50
co-aggregation with (a) and an-

% Coaggregation
tagonism against (b) pathogenic 40
bacteria (Salmonella typhimurium
and Salmonella enteritidis) 30

20

10

0
dPRO cPRO4 cPRO6 cPRO7 cPRO8 cPRO16 cPRO22 cPRO23 cPRO29 cPRO30
Lactobacilli isolates

b 45

40
S. typhimurium S. enteritis

35
Inhibition zone (mm)

30

25

20

15

10

0
dPRO cPRO4 cPRO6 cPRO7 cPRO8 cPRO16 cPRO22 cPRO23 cPRO29 cPRO30
Lactobacilli isolates

to produce lactic acid and bacteriocins. Environment of vancomycin, which has been recognized as intrinsic
GI tract is suitable for growing of pathogenic bacteria if property of Lactobacillus species [57].
the luminal pH goes towards the basic [52, 53]. A re-
duction of pH due to lactic acid inhibits the growth of
pathogens. The production of antimicrobial agents could Molecular Characterization
be easily demonstrated in vitro by the disc diffusion
assay; they include fatty acids, organic acids, hydrogen Out of the nine short-listed LAB isolates, cPRO23 isolate
peroxide, diacetyl, acetoin and the small, heat-stable in- exhibited the most desirable characteristics of a candi-
hibitory peptides called ‘bacteriocins’ [54, 55]. The date probiotic and therefore processed for molecular
present findings are also similar to those observed by identification. The PCR amplification of the isolated
earlier researchers [25, 56]. DNA resulted in a product of 1447 bp (Fig. 3a). Its
sequencing (partial sequencing of 16S rDNA) and sub-
sequent homology analysis through BLAST showed that
Antibiotic Sensitivity Profile the isolate had 99.9% homology with L. johnsonii
(NCBI data base). Thus, it was identified as L.
One of the required properties of the candidate probiotic iso- johnsonii and designated as L. johnsonii CPN23
lates is that they should be safe for consumption, i.e. they (Fig. 3b). The sequence has been submitted to
should lack antimicrobial resistance. The nine LAB isolates GenBank under accession number KP065494. Similar
including the reference isolate dPRO, in the present to the present findings, Lactobacillus reuteri [5] and L.
case, were found susceptible to all the tested antibiotics murinus [16] have been isolated from dog faeces and
except vancomycin (Table 6). Similar to our findings, were found to have good probiotic activity in vitro.
Jena et al. [2] observed that lactobacilli strains isolated The type of diet, pattern of feeding and food format
from rat faeces were susceptible to antibiotics except affect the microbiota composition of the GI tract.
Probiotics & Antimicro. Prot. (2017) 9:262–277 271

Fig. 3 Isolation of genomic

DNA [a; lane M: 1 kb ladder,
lanes 1–3: PCR product of LAB
isolate cPRO23; 1447 bp] and
sequence homology of 16S rRNA
of isolate cPRO-23 with that of
others available in GenBank da-
tabase (b)

In Vivo Evaluation probiotics, irrespective of their origin, resulted in a reduction

in faecal ammonia accompanying a trend for increased lactate,
Gut Health Indices more so with supplementation of the canine-origin L.
johnsonii CPN23. Ammonia is formed during colonic fermen-
Supplementation of probiotics had no effect (P > 0.05) on the tation of protein and is presumed to be formed in smaller
faecal pH, which were in the close range of 6.02 to 6.26. amounts in the presence of probiotic bacteria.
However, faecal ammonia was reduced (P = 0.012) in both The data on faecal concentrations acetate and butyrate var-
the cPRO and dPRO groups vis-à-vis the CON (Fig. 4a). ied significantly (P < 0.001) among the three dietary groups
Faecal lactate, on the other hand, tended to be higher and were higher in dogs supplemented with the canine-origin
(P = 0.091) in cPRO as compared to CON (Fig. 4a). probiotic (cPRO) than the dairy-origin probiotic supplement-
Contrary to the present observation, a reduction in faecal pH ed dPRO which, in turn, was higher than the CON values
in L. fermentum supplemented dogs was reported [46]. (Fig. 4b). Faecal levels of propionate, on the other hand, was
Although it is clear that the pattern of fermentation in the comparable between cPRO and dPRO, although it tended
intestinal tract determines the faecal pH [58], the differences (P = 0.086) to be higher in dPRO compared to CON. The
in the findings could be due to variability in terms of the basal faecal concentrations of total SCFA were, however, higher
diet and type of probiotics besides the method and duration of (P < 0.01) in both the probiotic-supplemented groups irrespec-
probiotic feeding. Dietary supplementation of both the tive of origin, when compared to CON. An increase in faecal
272 Probiotics & Antimicro. Prot. (2017) 9:262–277

Table 6 Antibiotic sensitivity (diameter of inhibition zone; mm) probiotic. Furthermore, while the total SCFA in the faeces
profiles of lactobacilli isolates
was statistically similar between cPRO and dPRO, the value
Isolates Antibiotics1 in the former was ~8% higher than that of the dPRO group.
The higher production of SCFA is expected by the action of
CIP OF SPX GAT AT AZM VA DO probiotic bacteria accelerating the breakdown of carbohy-
dPRO 17 (S)2 27 (S) 23(S) 25(S) 26(S) 25(S) 7(R) 25(S)
drates that are resistant to indigenous bacteria [59]. Further
in situations of limited energy supply, microbiota ferment ami-
cPRO4 19(S) 09(R) 26(S) 22(S) 17(S) 18(S) 6(R) 20(S)
no acids to SCFA and ammonia to obtain energy. The SCFA
cPRO6 24(S) 20(S) 24(S) 21(S) 25(S) 20(S) 7(R) 20(S)
serve as an energy source for the host, providing 10–30% of
cPRO7 16(S) 16(S) 28(S) 20(S) 24(S) 24(S) 6(R) 22(S)
basal metabolic requirements including energy for liver cells,
cPRO8 25(S) 18(S) 21(S) 23(S) 23(S) 17(I) 9(R) 28(S)
colonocytes and peripheral tissues with only about 5% excret-
cPRO16 22(S) 23(S) 20(S) 23(S) 28(S) 15(I) 7(R) 24(S)
ed in the faeces [60]. It has been a general observation that
cPRO22 25(S) 25(S) 26(S) 23(S) 22(S) 19(S) 6(R) 17(S)
acceleration in the net production of SCFA and lactic acid by
cPRO23 28(S) 20(S) 25(S) 22(S) 20(S) 22(S) 6(R) 24(S)
probiotics use diminishes the net production of ammonia, a
cPRO29 20(S) 00(R) 24(S) 24(S) 24(S) 27(S) 7(R) 20(S)
trend, which is apparent in the current study as well.
cPRO30 16(S) 18(S) 29(S) 26(S) 21(S) 29(S) 7(R) 19(S)
Corroborating the present observations, faecal ammonia con-
1
CIP ciprofloxacin (5 μg), OF ofloxacin (5 μg), SPX sparfloxacin (5 μg), centration was found to be significantly lower because of L.
GAT gatifloxacin (5 μg), AT aztreonam (30 μg), AZM azithromycin acidophilus administration in Labrador dogs fed on a wheat-
(15 μg), VA vancomycin (30 μg), DO doxycyclin hydrochloride (30 μg) based homemade diet [61]. On the contrary, no variations in
2
Subscripts (within parentheses) following the values indicates: S sensi- the levels of faecal ammonia among dietary groups fed probi-
tive, R resistant
otic or synbiotic [62]. Overall, the differences in response
could be assumed to be brought about by diet matrix and/or
acetate and butyrate in dogs of cPRO group vis-à-vis dPRO is food format as these factors affected the response of probiotics
indicative of better adaptation of the canine-origin probiotic in in terms of probiotic survival, physiology and efficacy [63].
the hindgut of the dogs in comparison to the dairy-origin The data on faecal bacteria counts (Fig. 5) shows that
lactobacilli population was significantly (P < 0.01) higher in
a 40 both the probiotic-fed groups irrespective of their origins as
CON cPRO dPRO
a compared to the CON. There was, however, no effect
(P > 0.05) of probiotic administration on the faecal
μmol/g dry faeces

30 b b
bifidobacteria count. The faecal coliforms count was signifi-
cantly lower (P < 0.01) in both the probiotic-supplemented
20 groups cPRO and dRO as compared to CON. On the other
hand, a reducing trend (P = 0.071) in clostridia count was
evident in dogs supplemented with cPRO as compared to
10
CON. The GI microbiota is of great importance and plays an
important role in host health due to its involvement in nutri-
0 tional, immunologic and physiological functions [64]. It is the
Ammonia Lactate
most adaptable and renewable metabolic organ of the body
that acts as significant barrier to exogenous pathogenic micro-
b 600 bial infection [62] and its composition and activities can affect
a
500 both intestinal and systemic physiology [65]. Faecal coloniza-
b
μmol/g dry faeces

tion is widely used to assess probiotic colonization [66]. A

c
400 significantly lowering in faecal coliform count in groups sup-
300 a plemented with probiotics was recorded in the present study.
b ab Similarly, a reducing trend in clostridium count was also evi-
200 dent in dogs supplemented with the canine-origin probiotic
a
c b cPRO. However, these results need to be further confirmed
100
using molecular characterization of the faecal microbiota.
0 Nonetheless, both clostridia and coliforms are considered as
Acetate Propionate Butyrate
health-negative while lactobacilli and bifidobacteria are
Fig. 4 Faecal fermentative metabolites (a) and short-chain fatty acids
(bz) concentrations of dogs supplemented with probiotics of canine-
regarded as health-positive. There are many reports that sup-
(cPRO), and dairy- origin (dPRO) vis-a-vis non-supplemented control port the present findings. The use of L. acidophilus strain
(CON) DSM13241 in the food as a probiotic was associated with
Probiotics & Antimicro. Prot. (2017) 9:262–277 273

15.0
14.0
CON Immune Response
13.0 cPRO
Count, log10 cfu/g

12.0
The DTH response data in the form of absolute increase in skin
dPRO
11.0 induration showed the maximum values in all the three groups at
10.0 12-h post-inoculation of PHA-P, beyond which there was a
9.0 steady decline till 96-h post-inoculation (Fig. 6). Furthermore,
8.0 there was a significant (P = 0.053) improvement in the skin
7.0 induration in cPRO (8.3 ± 0.3 mm) group when compared with
6.0 CON (7.5 ± 0.2 mm) while that of dPRO (7.9 ± 0.3 mm) group
Lactobacilli Bifidobacteria Clostridia Coliforms
Faecal bacteria
was comparable to both CON and dPRO. The corresponding
Fig. 5 Faecal microbial count in dogs supplemented with probiotics of values were 116.6 ± 2.6 for CON, 128.2 ± 5.9 for cPRO, and
canine- (cPRO) and dairy-origin (dPRO) vis-a-vis non-supplemented 123.0 ± 3.2 for dPRO, when compared on the basis of % in-
control (CON) crease in skin induration than the respective 0-h values. The HI
response data indicated that the antibody (HA) titre in all the
increased numbers of faecal lactobacilli but decreased num- three groups showed a gradual increase up to 14-day post-inoc-
bers of clostridial organisms in healthy adult dogs [67]. ulation followed by a decline thereafter till day 28 (Fig. 7). There
Supplementation of potential probiotic L. fermentum AD1 was, however, no variation (P > 0.05) in the antibody response
strain in healthy dogs has shown significant increases in against SRBC among the three dietary groups.
lactobacilli and enterococci in the canine faeces [46]. The CMI response is mediated by the thymus-derived T lym-
Likewise, supplementation of Lactobacillus rhamnosus strain phocytes, which are responsible for DTH reactions. The DTH
GG (LGG) to dogs resulted in significant increase in faecal reaction is based on an antigen-specific, T cell-dependent recall
level of LGG than control [68]. Dietary administration of dogs response manifested as an inflammatory reaction that reaches
with the probiotic strain L. fermentum CCM 7421 resulted in peak intensity between <24 to 48-h after the antigenic challenge
significant increase in mean LAB populations and a reduction [69], and often considered as a good indicator of CMI response
in clostridial numbers in the faeces [62]. On contrary, the in vivo [70]. Probiotics are able to prevent intestinal diseases
faecal population of both health positive and health negative through both humoral- and cell-mediated immune modulation
bacteria was found to be similar when L. acidophilus was [71] which endorsed the present improvements seen in terms of
administered to dogs on homemade diets [61]. The survival the improved DTH response by the cPRO group dogs vis-à-vis
and persistence of the probiotic bacteria depend on the many the CON. This, in turn, could be construed as an indication that
factors such as survivability in acid and bile besides their the current canine-origin probiotic L. johnsonii CPN23 facilitat-
ability to adhere to intestinal epithelial cells and to colonize ed improved CMI response capability by the host than that of the
the intestinal tract. The present results are indicative of the dairy-origin probiotic. The mechanisms by which probiotic bac-
functional role of the canine-origin L. johnsonii CPN23 as a teria affect the immune system are largely unknown, but many of
potential probiotic, which can also be assumed to have an the probiotics have been reported increase the innate or the ac-
edge over the dairy-origin probiotic, especially with the ob- quired immune response [72]. Probiotics may lead to an in-
served reducing trend in faecal clostridium count in dogs sup- creased IgA production and stimulation of macrophage, contrib-
plemented with cPRO. uting thereby to improved immunity [73]. Several studies have
DTH response (skin thickness, mm)

11.0 2.4

10.0 2.2

2.0
9.0
HA titre, log2

1.8
8.0
1.6
7.0
1.4
6.0
1.2
5.0 1.0

4.0 0.8
0h 12h 24h 48h 72h 7d 14d 21d 28d
Hours post-inoculation Days post-inoculation

Fig. 6 Cell-mediated immune response (DTH reaction to PHA-P) by Fig. 7 Humoral immune response (antibody titre against sheep-RBC) by
dogs supplemented with probiotics of canine- (cPRO) and dairy-origin dogs supplemented with probiotics of canine- (cPRO) and dairy-origin
(dPRO) vis-a-vis non-supplemented control (CON) (dPRO) vis-a-vis non-supplemented control (CON)
274 Probiotics & Antimicro. Prot. (2017) 9:262–277

reported that probiotics are able to regulate both anti- and pro- in the diets of dogs, in both healthy as well various clinical
inflammatory cytokine productions [74]. Similar to the present scenarios warranting immunomodulation. Future research
observation on the positive effect of the canine-origin probi- should therefore aim at establishing its effectiveness when fed
otic on CMI response, the results of another study alone as well in combination with proven prebiotics, in order to
showed that a dietary probiotic enhanced specific im- maximize the beneficial effects. In one of our previous studies,
mune functions in young dogs [75]. Stimulation of sys- we have found that supplementation of prebiotics in the diet of
temic components of the immune system, in particular carnivores has been beneficial in terms of gut health indices [86].
the CMI, may help to regulate changes in the gut micro- Another study with swine has demonstrated that Lactobacillus
biota, for example by increasing macrophage phagocytic ac- spp. (mainly L. johnsonii and L. reuteri species) dominate the
tivity using lactic acid bacteria [76]. Similar to our observa- porcine small intestine and are promoted by dietary inclusion of
tions, a study evaluating the effects of E. faecalis on the im- chicory pectin and prebiotic inulin [87].
mune function of mice has reported an improved CMI indi- Use of another strain of L. johnsonii XS4 to pregnant sows
cated by enhanced DTH response compared to the control has resulted in better reproductive outcome [88]; hence, similar
[77]. studies could be carried out in the future to explore the potential
L. johnsonii is a Gram-positive non-spore-forming bacillus application of L. johnsonii CPN23 in dogs under different phys-
named for its capacity to produce lactic acid, and has been iological stages including growing, lactating and geriatric
subjected to extensive studies due to their probiotic activity animals.
in recent years [78]. Various studies carried out using different
strains across human, laboratory animals and agriculturally
important species of animals have shown that the bacteria Conclusion
can be used as a probiotic for beneficial results in a variety
of clinical conditions. Based on above findings, it may be concluded that out of the
L. johnsonii FI9785 has been reported as a potential compet- nine strains of LAB isolates derived from canine faeces and
itive exclusion agent to control C. perfringens and other patho- screened further using a battery of in vitro tests, the isolate
gens in poultry [79], as has been confirmed in our study using cPRO23 was found to possess desirable characteristics of a can-
Salmonella spp. Moreover, L. johnsonii P47-HY was able to didate probiotic. The isolate, identified as L. johnsonii cPRO23
interact with enterotoxigenic Escherichia coli directly and re- through 16S rRNA sequencing, was found to impart positive
duced its detrimental effect on IPEC-J2 cells, highlighting its influence on the hindgut fermentative metabolites and cell-
probiotic potential [80]. Another novel strain of L. johnsonii mediated immune response when supplemented in the diet of
No. 1088 isolated from the gastric juice of human was found dogs. However, further in-depth studies involving its influence
to have the strong acid resistance, inhibited the growth of E. coli on faecal microbiota, metabolic and immunologic competence
O-157, S. typhimurium and Clostridium difficile, and shown of dogs are warranted to validate its species-specific probiotic
potential attributes beneficial for supporting Helicobacter pylori potential.
eradication [81].
Potential regulatory action of L. johnsonii LA1 on the mucosal
Acknowledgements The authors wish to acknowledge the Director,
immune system is mediated by its ability to sensitize human ICAR-Indian Veterinary Research Institute, Izatnagar, India for all the
intestinal epithelial cells to express TGFβ, which may in turn facilities provided. The financial support provided to the first author in
control mucosal T cell homeostasis [82]. Similarly, another strain the form of Senior Research Fellowship by the institute is also
acknowledged.
of L. johnsonii (JCM 2012T) has been identified to be involved in
the regulation of IL-12 production [83], which influences T cell
responses. Dietary supplementation of a probiotic cocktail con- Compliance with Ethical Standards
taining L. johnsonii (NCC2667) has been demonstrated to be
useful in dogs with food responsive diarrhoea and proved bene- Funding The authors wish to acknowledge the funding provided by the
Indian Council of Agriculture Research, New Delhi, India for this study
ficial in terms of intestinal cytokine patterns and microbiota, under the Niche Area of Excellence Program.
diminishing numbers of enterobacteria and increasing lactobacilli
in faeces [84]. Conflict of Interest The authors declare that they have no conflict of
Feeding of another strain of L. johnsonii (N6.2) was asso- interest.
ciated with a reduction of diabetes prevalence in BioBreeding
diabetes-prone (BB–DP) rats [85], indicating possible role of Ethical Approval All procedures performed in studies involving ani-
the current probiotics in metabolic modification of glucose mals were in accordance with the ethical standards of the institution or
practice at which the studies were conducted. The study protocol involv-
homoeostasis. ing the animal use was approved by the Institutional Animal Ethics
The above findings are a clear indication that the identified Committee (IAEC) and the Committee for the Purpose of Control and
bacteria L. johnsonii CPN23 has potential for use as a probiotic Supervision of Experiments on Animals (CPCSEA).
Probiotics & Antimicro. Prot. (2017) 9:262–277 275

References 21. Kelley R, Hayek MG, Levy K (2012) Effects of varying doses of a
probiotic supplement fed to healthy dogs undergoing kenneling
stress. Int J Appl Res 10:205–216
1. Manson JM, Rauch M, Gilmore MS (2008) The commensal micro- 22. Reniero R, Cocconcelli PS, Bottazzi V, Morelli L (1992) High
biology of the gastrointestinal tract. Adv Exp Med Biol 635:15–28 frequency of conjugation in lactobacillus mediated by an
2. Jena PK, Trivedi D, Thakore K, Chaudhary H, Giri SS, Seshadri S aggregation-promoting factor. J Gen Microbiol 138:763–768
(2013) Isolation and characterization of probiotic properties of 23. Ekmekci H, Aslim B, Ozturk S (2009) Characterization of vaginal
Lactobacilli isolated from rat faecal microbiota. Microbiol lactobacilli coaggregation ability with Escherichia coli. Microbiol
Immunol 57:407–416 Immunol 53:59–65
3. Kore KB, Pattanaik AK, Sharma K, Mirajkar PP (2012) Effect of 24. Kim EY, Kim YH, Rhee MH et al (2007) Selection of
feeding traditionally prepared fermented milk dahi (curd) as a lLactobacillus sp. PSC101 that produces active dietary enzymes
probiotics on nutritional status, hindgut health and haematology in such as amylase, lipase, phytase and protease in pigs. J Gen Appl
dogs. Indian J Tradit Know 11:35–39 Microbiol 53:111–117
4. El-Naggar MYM (2004) Comparative study of probiotic culture to 25. Garriga M, Pascual M, Monfort JM, Hugas M (1998) Selection of
control the growth of Escherichia coli O157: H7 and Salmonella lactobacilli for chicken probiotic adjuncts. J Appl Microbiol 84:
typhimurium. Biotechnol 3:173–180 125–132
5. McCoy S, Gilliland SE (2007) Isolation and characterization of 26. Jin LZ, Ho YW, Abdullah N, Ali MA, Jalaludin S (1996)
lactobacillus species having potential for use as probiotic cultures Antagonistic effects of intestinal Lactobacillus isolates on patho-
for dogs. J Food Sci 72:M94–M97 gens of chicken. Lett Appl Microbiol 23:67–71
6. Dunne C, Murphy L, Flynn S et al (1999) Probiotics: from myth to 27. Handley PS, Harty DWS, Wyatt JE, Brown CR, Doran JP, Gibbs
reality. Demonstration of functionality in animal models of disease ACC (1987) A comparison of the adhesion, co-aggregation and cell-
and in human clinical trials. Antonie Van Leeuwenhoek 76:279–292 surface hydrophobicity properties of fibrillar and fimbriate strains of
7. Ouwehand AC, Salminen S, Isolauri E (2002) Probiotics: an over- Streptococcus salivarius. J Gen Microbiol 133:3207–3217
view of beneficial effects. Antonie Van Leeuwenhoek 82:279–289 28. Schillinger U, Lucke F (1989) Antibacterial activity of
8. Fuller R (1986) Probiotics. J Appl Bacteriol 60:1–6 Lactobacillus sake isolated from meat. Appl Environ Microbiol
9. Uyeno Y, Shigemori S, Shimosato T (2015) Effect of probiotics/ 55:1901–1906
prebiotics on cattle health and productivity. Microbes Environ 30: 29. Patil MM, Pal A, Anand T, Ramana KV (2010) Isolation and char-
126–132 acterization of lactic acid bacteria from curd and cucumber. Indian J
10. Xanthopoulos V, Litopoulou-Tzanetaki E, Tzanetakis N (2000) Biotechnol 9:166–172
Characterization of lactobacillus isolates from infant faeces as die- 30. Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E,
tary adjuncts. Food Microbiol 17:2205–2215 Goodfellow M (eds) Nucleic acid techniques in bacterial systemat-
11. Agazzi A, Tirloni E, Stella S et al (2014) Effects of species-specific ics. Wiley, New York, pp 115–175
probiotic addition to milk replacer on calf health and performance 31. Tajabadi N, Mardan M, Manap MYA, Mustafa S (2013) Molecular
during the first month of life. Ann Anim Sci 14:101–115 identification of Lactobacillus spp. isolated from the honey comb of
12. Ehrmann MA, Kurzak P, Bauer J, Vogel RF (2002) the honey bee (Apis dorsata) by 16S rRNA gene sequencing. J Apic
Characterization of lactobacilli towards their use as probiotic ad- Res 52:235–241
juncts in poultry. J Appl Microbiol 92:966–975 32. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG
13. Vineetha PG, Tomar S, Saxena VK, Susan C, Sandeep S, Adil K, (1997) The CLUSTAL_X windows interface: flexible strategies for
Mukesh K (2016) Screening of Lactobacillus isolates from gastro- multiple sequence alignment aided by quality analysis tools.
intestinal tract of guinea fowl for probiotic qualities using in vitro Nucleic Acids Res 25:4876–4882
tests to select species-specific probiotic candidates. Br Poult Sci 57: 33. NRC (2006) Nutrient requirements of dogs and cats. National
474–482 Academy Press, Washington
14. Nandi A, Dan SK, Banerjee G, Ghosh P, Ghosh K, Ringø E, Ray 34. Samal L, Chaturvedi VB, Saikumar G, Somvanshi R, Pattanaik AK
AK (2016) Probiotic potential of autochthonous bacteria isolated (2015) Prebiotic potential of Jerusalem artichoke (Helianthus
from the gastrointestinal tract of four freshwater teleosts. Probiotics tuberosus L.) in Wistar rats: effects of levels of supplementation
Antimicro Prot. doi:10.1007/s12602-016-9228-8 on hindgut fermentation, intestinal morphology, blood metabolites
15. Biagi G, Cipollini I, Pompei A, Zaghini G, Matteuzzi D (2007) and immune response. J Sci Food Agric 95:1689–1696
Effect of a Lactobacillus animalis strain on composition and me- 35. Samal L, Chaturvedi VB, Baliyan S, Saxena M, Pattanaik AK
tabolism of the intestinal microflora in adult dogs. Vet Microbiol (2012) Jerusalem artichoke as a potential prebiotic: influence on
124:160–165 nutrient utilization, hindgut fermentation and immune response of
16. Perelmuter K, Fraga M, Zunino P (2008) In vitro activity of poten- Labrador dogs. Anim Nutr Feed Technol 12:343–352
tial probiotic Lactobacillus murinus isolated from the dog. J Appl 36. Pattanaik AK, Khan SA, Goswami TK (2007) Influence of iodine
Microbiol 104:1718–1725 on nutritional, metabolic and immunological response of goats fed
17. O’Mahony D, Murphy KB, MacSharry J et al (2009) Portrait of a Leucaena leucocephala leaf meal diet. J Agric Sci 145:395–405
canine probiotic Bifidobacterium—from gut to gut. Vet Microbiol 37. Wegmann TG, Smithies O (1966) A simple hemagglutination sys-
139:106–112 tem requiring small amounts of red cells and antibodies.
18. Manninen TJK, Rinkinen ML, Beasley SS, Saris PEJ (2006) Transfusion 6:67–73
Alteration of the canine small-intestinal lactic acid bacterium mi- 38. Fuller R (1975) Nature of the determinant responsible for the adhe-
crobiota by feeding of potential probiotics. Appl Environ Microbiol sion of lactobacilli to chicken crop epithelial cell. J Appl Bacteriol
72:6539–6543 37:245–250
19. Tuomola E, Crittenden R, Playne M, Isolauri E, Salminen S (2001) 39. Taheri HR, Moravej H, Tabandeh F, Zaghari M, Shivazad M (2009)
Quality assurance criteria for probiotic bacteria. Am J Clin Nutr 73: Screening of lactic acid bacteria toward their selection as a source of
393S–398S chicken probiotic. Poult Sci 88:1586–1593
20. Strompfova V, Laukova A, Ouwehand AC (2004) Selection of 40. Patel AK, Ahire JJ, Pawar SP, Chaudhari BL, Chincholkar SB
Enterococci for potential canine probiotic additives. Vet Microbiol (2009) Comparative accounts of probiotic characteristics of
100:107–114 Bacillus spp. isolated from food wastes. Food Res Int 42:505–510
276 Probiotics & Antimicro. Prot. (2017) 9:262–277

41. DelRe B, Sgorbati B, Miglioli M, Palenzona D (2000) Adhesion, Chaudhary LC (eds) Animal nutrition research strategies for food
autoaggregation and hydrophobicity of 13 strains of security, Animal Nutrition Association, Izatnagar, India, p 253
Bifidobacterium longum. Letts Appl Microbiol 31:438–442 62. Strompfová V, Lauková A, Cilik D (2013) Synbiotic administration
42. Lee HS, Gilliland SE, Carter S (2001) Amylolytic cultures of of canine-derived strain Lactobacillus fermentum CCM 7421 and
Lactobacillus acidophilus: potential probiotics to improve dietary inulin to healthy dogs. Can J Microbiol 59:347–352
starch utilization. J Food Sci 66:338–344 63. Pattanaik AK, Kumar A, Baliyan S, Kumar A, Jadhav SE (2013) Effect
43. Reid G (2001) Probiotic agents to protect the urogenital tract of dietary protein matrix in homemade diets on the response to probi-
against infection. Am J Clin Nutr 73:437–443 otic supplementation by Labrador dogs. In: Proc of Waltham
44. Morelli L (2007) In vitro assessment of probiotic bacteria: from International Nutritional Sciences Symposium. Mars Inc. and
survival to functionality. Int Dairy J 17:1278–1283 Waltham, Portland, OR, USA p 136. https://www.waltham.com/
45. Gilliland SE, Staley TE, Bush LJ (1984) Importance of bile toler- dyn/_assets/_pdfs/winss/FINALWINSSProceedings2013.pdf.
ance of Lactobacillus acidophilus used as dietary adjunct. J Dairy Accessed 3 Nov 2016
Sci 67:3045–3051 64. Collado MC, Isolauri E, Salminen S, Sanz Y (2009) The impact of
46. Strompfova V, Marciňáková M, Simonová M, Matijašić BB, probiotic on gut health. Curr Drug Metab 10:68–78
Laukova A (2006) Application of potential probiotic 65. Conway PL (1995) Microbial ecology of the human large intestine.
Lactobacillus fermentum AD1 strain in healthy dogs. Anaerobe In: Ginson GR, MacFarlane GT (eds) Human colonic bacteria: role
12:75–79 in nutrition, physiology and pathology. CRC Press, Boca Raton, pp
47. Gilliland SE, Walker DK (1990) Factors to consider when selecting 1–24
a culture of L. acidophilus as a dietary adjunct to produce a hyper- 66. Goldin BR (1998) Health benefits of probiotics. Br J Nutr 80:S203–
cholesterolemic effect in humans. J Dairy Sci 73:905–909 S207
48. Suskovic J, Brkic B, Matosic S, Maric V (1997) Lactobacillus 67. Baillon MLA, Jones ZVM, Butterwick RF (2004) Effects of probi-
acidophilus M92 as potential probiotic strain. Milchwissenschaft otic Lactobacillus acidophilus strain DSM13241 in healthy adult
52:430–435 dogs. Am J Vet Res 65:338–343
49. Pinto MGV, Franz CMAP, Schillinger U, Holzapfel WH (2006) 68. Weese JS, Andersen MEC (2002) Preliminary evaluation of
Lactobacillus spp. with in vitro probiotic properties from human Lactobacillus rhamnosus strain GG, a potential probiotic in dogs.
faeces and traditional fermented products. Int J Food Microbiol Can Vet J 43:771–774
109:205–214 69. Meydani SN, Woel-Kyu HA (2000) Immunologic effects of yogurt.
50. Malik A, Sakamoto M, Hanazaki S, Osawa M, Suzuki T, Tochigi Am J Clin Nutr 71:861–872
M, Kakii K (2003) Coaggregation among nonflocculating bacteria 70. Kim HW, Chew BP, Wong TS, Park JS, Weng BC, Byrne KM et al
isolated from activated sludge. Appl Environ Microbiol 69:6056– (2000) Dietary lutein stimulates immune response in the canine. Vet
6063 Immunol Immunopathol 74:315–327
51. Collado MC, Meriluoto J, Salminen S (2007) Measurement of ag- 71. Erickson KL, Hubbard NE (2000) Probiotic immunomodulation in
gregation properties between probiotics and pathogens: in vitro health and disease. J Nutr 130:403S–409S
evaluation of different methods. J Microbiol Methods 71:71–74 72. Galdeano CM, Perdigón G (2006) The probiotic bacterium
52. Presser KA, Ratkowsky DA, Ross T (1997) Modelling the growth Lactobacillus casei induces activation of the gut mucosal immune
rate of Escherichia coli as a function of pH and lactic acid concen- system through innate immunity. Clin Vaccine Immunol 13:219–
tration. Appl Environ Microbiol 63:2355–2360 226
53. Payne JB, Osborne JA, Jenkins PK, Sheldon BW (2007) Modeling 73. Perdigon G, Alvarze SE, Vintine M, Medine M, Medici M (1999)
the growth and death kinetics of Salmonella in poultry litter as a Study of the possible mechanisms involved in the mucosal immune
function of pH and water activity. Poult Sci 86:191–201 system activation by lactic acid bacteria. J Dairy Sci 82:1108–1114
54. Soomro AH, Masud T, Anwaar K (2002) Role of lactic acid bacte- 74. Matsuzaki T, Chin J (2000) Modulating immune responses with
ria (LAB) in food reservation and human health: a review. Pak J probiotic bacteria. Immunol Cell Biol 78:67–73
Nutr 1:20–24 75. Benyacoub J, Maulden GLC, Cavadini C et al (2003)
55. Simova ED, Beshkova DB, Dimitrov ZP (2009) Characterization Supplementation of food with Enterococcus faecium (SF68) stim-
and antimicrobial spectrum of bacteriocins produced by lactic acid ulates immune functions in young dogs. J Nutr 133:1158–1162
bacteria isolated from traditional Bulgarian dairy products. J Appl 76. Hatcher GE, Lambrecht RS (1993) Augmentation of macrophage
Microbiol 106:692–701 phagocytic activity by cell-free extracts of selected lactic acid-
56. Reque FE, Pandey A, Franco SG, Soccol CR (2000) Isolation, producing bacteria. J Dairy Sci 76:2485–2492
identification and physiological study of Lactobacillus fermentum 77. Shimada T, Cai Y, Cheng L, Motonaga C, Fukada K, Kitamura Y
LBP for use as probiotic in chickens. Braz J Microbiol 31:303–307 et al (2009) Immunomodulation effects of heat-treated
57. Ghosh AR (2012) Appraisal of probiotics and prebiotics in gastro- Enterococcus faecalis FK-23 (FK-23) in mice. J Nanjing Med
intestinal infections. Gastroenterol 3:1–27 Univ 23:173–176
58. Kore KB, Pattanaik AK, Das A, Sharma K (2009) Evaluation of 78. Wu X, Zhao C, Guo Z, Hao Y, Li J, Shi H, Sun Y (2016) Genome
alternative cereal sources in dog diets: effect on nutrient utilisation sequence of Lactobacillus johnsonii strain W1, isolated from mice.
and hindgut fermentation characteristics. J Sci Food Agric 89: Genome Announc 4(3):e00561–e00516. doi:10.1128/genomeA.
2174–2180 00561-16
59. Sakata T, Kojima T, Fujieda M, Takahashi M, Michibata T (2003) 79. La Ragione RM, Narbad A, Gasson MJ, Woodward MJ
Influences of probiotic bacteria on organic acid production by pig (2004) In vivo characterization of Lactobacillus johnsonii
caecal bacteria in vitro. Proc Nutr Soc 62:73–80 FI9785 for use as a defined competitive exclusion agent
60. Cummings JH, Macfarlane GT (1991) Review: the control and against bacterial pathogens in poultry. Lett Appl Microbiol
consequences of bacterial fermentation in the human colon. J 38:197–205
Appl Bacteriol 70:443–459 80. Liu H, Roos S, Jonsson H, Ahl D, Dicksved J, Lindberg JE, Lundh
61. Pattanaik AK, Kumar A, Baliyan S, Dutta N, Kumar A, Jadhav SE T (2015) Effects of Lactobacillus johnsonii and Lactobacillus
(2012) Effect of source of cereal on the response to probiotic sup- reuteri on gut barrier function and heat shock proteins in intestinal
plementation in Labrador dogs reared on homemade diets. In: porcine epithelial cells. Physiol Rep 3(4):e12355. doi:10.14814/
Pattanaik AK, Dutta N, Verma AK, Jadhav SE, Dhuria RK, phy2.12355
Probiotics & Antimicro. Prot. (2017) 9:262–277 277

81. Aiba Y, Nakano Y, Koga Y, Takahashi K, Komatsu Y (2015) A Triplett EW, Neu J, Lorca GL (2010) Lactobacillus johnsonii N6.2
highly acid-resistant novel strain of Lactobacillus johnsonii no. mitigates the development of type 1 diabetes in BB-DP rats. PLoS
1088 has antibacterial activity, including that against Helicobacter One 5:e10507. doi:10.1371/journal.pone.0010507
pylori, and inhibits gastrin-mediated acid production in mice. 86. Pradhan SK, Das A, Kullu SS, Saini M, Pattanaik AK, Dutta N,
MicrobiologyOpen 4:465–474 Sharma AK (2015) Effect of feeding Jerusalem artichoke
82. Haller D, Bode C, Hammes WP, Pfeifer AM, Schiffrin EJ, Blum S (Helianthus tuberosus) root as prebiotic on nutrient utilization, fecal
(2000) Non-pathogenic bacteria elicit a differential cytokine re- characteristics and serum metabolite profile of captive Indian leop-
sponse by intestinal epithelial cell/leucocyte co-cultures. Gut 47: ard (Panthera pardus fusca) fed a meat-on-bone diet. Zoo Biol 34:
79–87 153–162
83. Shida K, Kiyoshima-Shibata J, Kaji R, Nagaoka M, Nanno M 87. Liu H, Ivarsson E, Dicksved J, Lundh T, Lindberg JE (2012)
(2009) Peptidoglycan from lactobacilli inhibits interleukin-12 pro- Inclusion of chicory (Cichorium intybus L.) in pigs’ diets affects
duction by macrophages induced by Lactobacillus casei through the intestinal microenvironment and the gut microbiota. Appl
toll-like receptor 2-dependent and independent mechanisms. Environ Microbiol 78:4102–4109
Immunology 128:e858–e869 88. Wang J, Jin HF, Hou CL, Wang SX, Zhang DY, Liu H, Shan DC,
84. Sauter SN, Benyacoub J, Allenspach K, Gaschen F, Ontsouka E, Wang YM (2014) Effects of Lactobacillus johnsonii XS4 supple-
Reuteler G et al (2006) Effects of probiotic bacteria in dogs with mentation on reproductive performance, gut environment, and
food responsive diarrhoea treated with an elimination diet. J Anim blood biochemical and immunological index in lactating sows.
Physiol Anim Nutr (Berl) 90:269–277 Livestock Sci 164:96–101
85. Valladares R, Sankar D, Li N, Williams E, Lai KK, Abdelgeliel AS,
Gonzalez CF, Wasserfall CH, Larkin J, Schatz D, Atkinson MA,