Hindawi

Aquaculture Nutrition
Volume 2024, Article ID 1402602, 13 pages
https://doi.org/10.1155/2024/1402602

Research Article
Combined Replacement of Fishmeal and Fish Oil by
Poultry Byproduct Meal and Mixed Oil: Effects on the Growth
Performance, Body Composition, and Muscle Quality of
Tiger Puffer

Lili Zhao,1,2 Lin Li,1,3 Feiran Zhang,1 Peng Li,4 Yanlu Li,1 Jian Liu,1 Yuliang Wei ,1,2
Mengqing Liang ,1,2 Qiang Ma ,1 and Houguo Xu 1,2
1
State Key Laboratory of Mariculture Biobreeding and Sustainable Goods, Yellow Sea Fisheries Research Institute,
Chinese Academy of Fishery Sciences, 106 Nanjing Road, Qingdao 266071, China
2
Laboratory for Marine Fisheries Science and Food Production Processes, Laoshan Laboratory, 1 Wenhai Road, Qingdao 266237,
China
3
Qingdao Aquarium, 2 Laiyang Road, Qingdao 266003, China
4
North American Renderers Association, 500 Montgomery Street Suite 310, Alexandria 22314, USA

Correspondence should be addressed to Qiang Ma; [email protected] and Houguo Xu; [email protected]

Received 23 August 2023; Revised 31 January 2024; Accepted 1 February 2024; Published 15 February 2024

Academic Editor: Adrian J. Hernandez

Copyright © 2024 Lili Zhao et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

This study aimed to evaluate the effects of combined replacement of fishmeal (FM) and fish oil (FO) with poultry byproduct meal
(PBM) and mixed oil (MO, poultry oil: coconut oil = 1 : 1) on growth performance, body composition and muscle quality of tiger
puffer (Takifugu rubripes). Fish with an average initial body weight of 14.29 g were selected for the feeding experiment. FM
accounting for 0%, 5%, and 10% of the diet was replaced by PBM. For each grade of FM replacement, 5% FO or MO was used
as added oil. The six experimental diets were designated as FO-FM, MO-FM, FO-5PBM, MO-5PBM, FO-10PBM, and MO-10PBM,
respectively. Each treatment was performed in triplicate with 30 fish per replicate. The feeding period was 45 days. There was no
significant difference in growth performance among the groups. Dietary supplementation of both PBM and MO had marginal effects
on whole-fish proximate composition, except that dietary MO supplementation significantly increased the liver moisture content. In
serum, there were no significant differences in contents of triglyceride, total cholesterol, total bile acid, and protein carbonyl among
groups, but the malondialdehyde content was reduced by MO. The fatty acid composition in fish mirrored those in the diets, but the
omega-3 sparing effects of saturated and monounsaturated fatty acid in MO can still be observed. Dietary PBM and MO had
marginal effects on free amino acid composition and texture of fish muscle, but exerted complicated effects on the muscle volatile
flavor compound composition. In conclusion, combined fishmeal (10% of the diet) and fish oil (5% of the diet) replacement with
poultry byproduct and mixed oil (poultry oil + coconut oil) had no adverse effects on the growth performance and body proximate
composition of farmed tiger puffer. However, these replacements changed the muscle flavor compound profile.

1. Introduction this research area, demonstrating the great potential of terres-

trially sourced ingredients [1–8].
The rapid development of aquaculture requires a huge Among the terrestrially sourced ingredients, poultry bypro-
amount of fishmeal (FM) and fish oil (FO). However, the ducts, including poultry byproduct meal (PBM), and poultry
stable supply of FM and FO is becoming a big challenge. oil (PO), have been widely used in aquafeeds. Previous studies
Therefore, searching for suitable and efficient alternative pro- showed that the PBM can replace 25%–70% of FM in fish feeds:
tein and lipid sources has been an urgent task for the aqua- 25% for large yellow croaker (Larimichthys crocea) [9] and
culture industry. Numerous studies have been conducted in tench (Tinca tinca) [10], 30% for pufferfish (Takifugu obscurus)
2 Aquaculture Nutrition

[11] and black sea bream (Acanthoparus schlegelii) [12], 50% sources for tiger puffer diets. Lim et al. [48] found that
for Atlantic salmon (Salmo salar) [13], black sea turbot (Psetta replacement of 30% FM with soybean meal did not affect
maeoticus) [14], and European eel (Anguilla anguilla) [15], the growth of tiger puffer. Wei et al. [49] even found that
40%–60% for hybrid grouper (Epinephelus fuscoguttatus ♀ × replacement of 42.8% FM in low-FM (28% of dry matter)
Epinephelus lanceolatus ♂) [16], and 67% for rainbow trout diet with fish protein hydrolysate slightly increased the
(Oncorhynchus mykiss) [17]. growth of tiger puffer, although no significant difference
Compared to FM replacement by PBM, PO is able to replace was observed.
FO at higher levels. It has been suggested that PO can replace
30%–100% of FO in fish feeds without compromising fish 2. Materials and Methods
growth: 33.3% for rainbow trout [18], 50% for Japanese sea
bass (Lateolabrax japonicus) [19] and Atlantic salmon [20], 2.1. Experimental Diets. Six isonitrogenous (approximately
75% for Florida pompano (Seriola lalandi) [21] and sablefish 48% crude protein) and isolipidic (approximately 7.5% crude
lipid) experimental diets were formulated. The FM used in
(Anoplopoma fimbria) [22], and 50%–100% for yellowtail king-
this study was Pollock meal (super level, steamed dried,
fish (Seriola lalandi) [23], 100% for gilthead sea bream (Sparus
Tecnologica De Alimentos S.A., Peru) with a protein content
aurata) [24], brown trout (Salmo trutta L.) [25], barramundi
of 69.0% and a lipid content of 9.9% (of dry matter). There
(Lates calcarifer) [26], and largemouth bass (Micropterus sal-
were three grades of FM replacement with PBM. For these
moides) [27].
three grades, the FM level was 45%, 40%, and 35% (dry
All these results suggest that both PBM and PO have
matter basis), respectively, and accordingly the PBM level
great potential as alternative ingredients in fish feeds. How-
was 0%, 5%, and 10%, respectively. The PBM supplied by
ever, most of these studies investigated the efficiency of PBM
North American Renderers Association (CA, USA) had a
and PO separately. Very limited studies have investigated the
protein content of 66.5% and a lipid content of 13.9% (of
efficacy of combined use of PBM and PO in fish feeds.
dry matter). For each grade of FM replacement, 5% FO
Farmed fish are supposed to provide long-chain polyunsatu-
or mixed oil (MO, PO : CCO = 1 : 1) was used as added oil.
rated fatty acids (LC-PUFA), in particular eicosapentaenoic
The six experimental diets were named FO-FM, MO-FM,
acid (EPA, 20 : 5n-3) and docosahexaenoic acid (DHA, 22 :
FO-5PBM, MO-5PBM, FO-10PBM, and MO-10PBM,
6n-3), for human consumers. However, when the farmed fish
respectively. The PO was produced along with the
were fed diets with high levels of terrestrially sourced oils, the PBM production. The byproducts of chicken processing,
LC-PUFA contents usually decrease [28–31]. Therefore, mainly including skin, skeleton, trims and viscera, were first
when the FO in fish feeds is replaced by terrestrially sourced boiled and then centrifuged to separate the oils. The formu-
oils, how to maintain as high LC-PUFA contents in farmed lation and proximate composition of the six experimental
fish products as possible is of great significance to human diets are presented in Table 1. The fatty acid compositions
consumers [30, 32, 33]. Compared to FO, terrestrially of FO, MO, and experimental diets are presented in Table 2.
sourced oils usually contain higher levels of saturated and The diets were made with a pelleting machine (single-screw,
monounsaturated fatty acids (SFA and MUFA, respectively). laboratory-level) and dried at 55°C. The diets were stored at
The SFA and MUFA in terrestrially sourced oils have been a refrigerator room (−20°C) prior to use.
reported to have “n-3 LC-PUFA sparing effects” [33–42].
Specifically, for PO, this n-3 LC-PUFA sparing effect has 2.2. Feeding Procedure and Sampling. Tiger puffer juveniles
been reported in Murray cod (Maccullochella peelii peelii) with an average initial body weight of 14.29 g were used in
[39], rainbow trout [43], and Atlantic salmon [44]. However, this feeding experiment. Fish were purchased from Tangshan
complete FO replacement by PO compromised the fish Haidu Seafood Co., Ltd. (Tangshan, China), and reared in
growth and health in some species, possibly due to the unbal- Yellow-Sea Aqua Co., Ltd. (Yantai, Shandong Province,
anced contents of SFA and MUFA in PO, which contains China). To prevent cannibalism, which is common for tiger
more MUFA than SFA [24]. Specifically, for tiger puffer puffer, the lower fish teeth were cut short before the feeding
(Takifugu rubripes), our previous studies have shown that trial. Before the start of the feeding trial, the experimental fish
this species may have a high capacity to utilize SFA [45]. were temporarily raised in polyethylene tanks (2 m3) and fed a
Coconut oil (CCO) is one of the oils which are the richest commercial feed (protein content, 50% dry matter; lipid con-
in SFA. A mixture of PO with CCO could result in a more tent, 8% dry matter; Qingdao Surgreen Biological Engineering
balanced profile of SFA and MUFA [46]. Co. Ltd., Qingdao, China) for 2 weeks to acclimate to the
The present study aimed to evaluate the efficacy of FM experimental conditions. A flow-through seawater (salinity
and FO replacement with combined use of PBM and a mix- in the range of 28–32) system was used for the feeding experi-
ture of PO and CCO. Growth, body composition (in partic- ment. A total of 540 fish were randomly allocated into 18
ular fatty acid composition), and muscle quality were experimental tanks (0.7 × 0.7 × 0.4 m3). Each diet was ran-
measured. Tiger puffer, which is an important aquaculture domly assigned to triplicate tanks, and each tank had
species in East Asia, was the target fish species of this study. 30 fish. Fish were fed to apparent satiation by hand three
Some studies have revealed the efficacy of some alternative times daily (7:30, 12:30, and 18:30). Uneaten feeds were
oils such as beef tallow, soybean oil, linseed oil, and rapeseed siphoned out and the numbers of uneaten feeds in each
oil in the diets of tiger puffer [33, 47]. However, few studies tank after each feeding were recorded to adjust the feed con-
have been conducted to screen suitable alternative protein sumption data (based on an average weight of pellets). The
Aquaculture Nutrition 3

TABLE 1: Formulation and proximate composition of the experimental diets (% dry matter basis).
Ingredients FO-FM MO-FM FO-5PBM MO-5PBM FO-10PBM MO-10PBM
Fish meal1 45 45 40 40 35 35
Poultry byproduct meal1 0 0 5 5 10 10
Corn gluten meal2 7 7 7 7 7 7
Soybean meal3 7 7 7 7 7 7
Dephenolized cottonseed protein4 7 7 7 7 7 7
Wheat meal5 19.68 19.68 19.68 19.68 19.68 19.68
Brewer’s yeast6 5 5 5 5 5 5
Mineral premix7 0.5 0.5 0.5 0.5 0.5 0.5
Vitamin premix7 1 1 1 1 1 1
Monocalcium phosphate7 1 1 1 1 1 1
L-ascorbyl-2-polyphosphate7 0.2 0.2 0.2 0.2 0.2 0.2
Choline chloride7 0.2 0.2 0.2 0.2 0.2 0.2
Attractant7 0.3 0.3 0.3 0.3 0.3 0.3
Ethoxyquin7 0.02 0.02 0.02 0.02 0.02 0.02
Mold inhibitor7 0.1 0.1 0.1 0.1 0.1 0.1
Soya lecithin7 1 1 1 1 1 1
Fish oil 5 0 5 0 5 0
Mixed oil8 0 5 0 5 0 5
Proximate composition
Crude protein 48.00 47.90 47.02 48.34 47.89 47.92
Crude lipid 7.24 7.48 7.88 7.52 7.51 8.14
Ash 10.34 10.43 10.01 10.24 9.81 9.92
1
The Pollock meal had a protein content of 69.0% and a lipid content of 9.9% (of dry matter). The chicken byproduct meal had a protein content of 66.5% and a
lipid content of 13.9% (of dry matter). 2The corn gluten meal had protein content of 65.4% and a lipid content of 0.7% (of dry matter). 3The soybean meal had
protein content of 52.2% and a lipid content of 1.7% (of dry matter). 4The dephenolized cottonseed protein had protein content of 64.2% and a lipid content of
10.9% (of dry matter). 5The wheat meal had protein content of 15.1% and a lipid content of 1.1% (of dry matter). 6The Brewer’s yeast had protein content of
53.7% and a lipid content of 2.2% (of dry matter). 7Vitamin premix, mineral premix, and other additives were purchased from Qingdao Surgreen Bioengi-
neering Co. Ltd. 8Mixed oil: 1 : 1 mixture of poultry oil and coconut oil. The oils were purchased from the Shandong Haiding Agriculture and Animal
Husbandry Co., Ltd. FO, fish oil; FM, fishmeal; MO, mixed oil; PBM, poultry byproduct meal.

TABLE 2: Fatty acids composition of fish oil, mixed oil, and experimental diets (% total fatty acid).
Fatty acid FO MO FO-FM MO-FM FO-5PBM MO-5PBM FO-10PBM MO-10PBM
12 : 0 0.06 26.2 0.08 11.6 0.08 11.5 0.09 10.8
14 : 0 5.18 9.92 4.62 6.61 4.35 6.10 4.23 5.62
16 : 0 18.2 17.9 21.9 19.2 22.5 20.3 24.8 22.1
18 : 0 4.36 5.57 5.06 4.95 5.32 5.41 5.90 5.94
∑SFA 29.4 59.6 32.3 42.3 32.9 43.5 35.7 44.6
16 : 1n-7 5.31 2.67 4.96 3.27 5.02 3.49 5.28 3.93
18 : 1n-9 14.7 26.1 14.7 17.7 17.0 20.7 19.5 21.8
20 : 1n-9 3.98 0.39 1.79 1.08 1.68 1.18 1.71 1.27
∑MUFA 29.4 29.4 21.5 22.0 23.7 25.3 26.5 27.1
18 : 2n-6 11.7 10.5 11.8 14.6 12.3 16.2 14.5 17.1
20 : 2n-6 0.37 ND 0.33 0.21 0.33 0.43 0.29 0.39
20 : 3n-6 5.26 ND 0.08 1.39 0.10 0.09 0.11 0.09
20 : 4n-6 0.13 0.15 0.91 1.24 0.89 1.60 0.91 0.95
∑n-6PUFA 21.2 10.6 13.1 17.5 13.6 18.4 15.8 18.5
18 : 3n-3 1.97 0.20 2.79 0.49 2.72 0.54 2.60 0.74
20 : 5n-3 7.33 ND 9.53 3.71 7.26 3.35 5.86 3.08
22 : 5n-3 1.47 ND 4.32 0.77 4.94 0.67 1.36 0.66
22 : 6n-3 13.8 ND 13.0 9.89 11.9 4.41 8.87 4.27
∑n-3PUFA 25.6 0.20 29.7 14.9 26.8 8.97 18.7 8.75
∑n-3/∑n-6 1.21 0.02 2.26 0.85 1.96 0.49 1.18 0.47
FO, fish oil; FM, fishmeal; MO, mixed oil; PBM, poultry byproduct meal; SFA, saturated fatty acid; MUFA, mono-unsaturated fatty acid; PUFA, poly-
unsaturated fatty acid; ND, nondetectable.
4 Aquaculture Nutrition

TABLE 3: Sequences information of the primers used in this work.

Primer Sequence (5′−3′) GenBank reference PL (bp)
16S rRNA-F ATGTGGACCTGTATGAATGGC
NC 004299.1 119
16S rRNA-R CTCCATAGGGTCTTCTCGTCTT
CYTB-F CCTCCTGGGCTTCACAATCA
NC 004299.1 123
CYTB-R TTAATGTGGGCGGGGGTAAC
β-Actin-F GACGCAAAACCTCCGAACTG
Gene ID 101,079,312 129
β-Actin-R CCTCCAAACGGATCAGCACA
EF1α-F TGGCCTTTAGCCGAATGAGG
Gene ID 653,026 117
EF1α-R TGTCGGGCCAATCAATCCAG
PL, product length; CYTB, cytochrome B.

feeding duration was 45 days. During the whole feeding purchased from the Nanjing Jiancheng Bioengineering Insti-
period, the water temperature ranged from 22 to 28°C; pH tute (Nanjing, Jiangsu Province, China).
in the range of 7.4–7.8; dissolved oxygen >5 mg/L; ammonia-
N <0.5 mg/L; and nitrite <0.2 mg/L. 2.5. Mitochondrial DNA Copy Number. The DNA was
At the end of the feeding trial, fish were first fasted for extracted from liver and muscle samples with the DP324
24 hr before sampling. The weight and survival of fish in each kit (Tiangen, Beijing, China). Specific primers target genes
tank were measured and recorded. After anesthetization with (cytochrome B (CYTB) of mitochondrial DNA and 16S
eugenol (eugenol: water = 1/10,000), three fish from each rRNA) and reference genes (β-actin and ef1α) were designed
tank were collected for the assay of proximate composition (Table 3). The reaction system of PCR consists of 1 μL cDNA
of whole fish. Four more experimental fish from each tank template, 0.4 μL forward primer (10 μM), 0.4 μL reverse
were randomly collected for the collection of the serum, primer (10 μM), 5 μL SYBR Green Pro Taq HS Premix II,
muscle, and liver samples. From each fish, two pieces (2 × and 3.2 μL sterilized water. The PCR program was: 95°C for
2 cm2) of dorsal muscle were collected from each body side. 30 s followed by 40 cycles of “95°C for 5 s, 57°C for 30 s, and
In the following analysis, the muscle samples were then cut 72°C for 30 s”. Other method details can be found in our
into smaller pieces for the assay of muscle texture (can be previous publications [51].
reused for other assays), fatty acid composition, proximate
2.6. Analysis of Fatty Acid Composition and Free Amino Acid.
composition, peroxidation products, free amino acid compo- The fatty acid compositions of oil, diet, muscle, and liver
sition, volatile flavor compound profile, as well as gene were analyzed with gas chromatography (GC2010 pro, Shi-
expression. A pooled sample from four fish of each tank madzu, Kyoto, Japan) equipped with a flame ionization
was used for each assay. Two pieces (2 cm from the small detector and a quartz capillary column (SH-RT−2560, 100
tip) of liver tissues were collected from each fish, for the analysis m × 0.25 mm × 0.20 μm). Lipids were first extracted from the
of fatty acid composition and gene expression. Samples from samples using the chloroform methanol method. Fatty acids
each tank were also pooled for the analysis. The blood from the in the lipid samples were then saponified and methylated
caudal vein was collected, and the serum samples were collected with boron trifluoride and KOH-methanol. The fatty acid
as previously described [50]. All protocols of fish rearing and contents are expressed as % total fatty acids (TFA). More
sampling practices in this study, were reviewed and approved details can be found in our previous publications [51].
by the Animal Care and Use Committee of Yellow Sea Fisheries The muscle samples were deproteinized using trichlor-
Research Institute. oacetic acid (6%) and centrifuged at 10,000g at 4°C for
10 min to obtain the supernatant. Amino acid contents
2.3. Analysis of the Proximate Composition of Fish and Diets. were determined using the L-8900 amino acid analyzer
The proximate composition of experimental diets, whole (Hitachi, Japan).
fish, and tissue samples was analyzed with the methods of
Association of Official Analytical Chemists. The moisture 2.7. Analysis of Volatile Organic Compounds in the Muscle.
content was assayed by drying at 110°C. The crude protein Muscle samples from three typical groups, FO-FM, MO-FM,
content and lipid content were measured with the Kjeldahl and FO-10PBM, were used for the volatile organic compounds
(Foss 2300, N × 6.25) and Soxhlet method (Foss Soxtec™ analysis. The comparison between groups FO-FM and MO-FM
2050, petroleum ether extraction), respectively. The ash con- and that between groups FO-FM and FO-10PBM most typically
tent was assayed by incineration at 550°C for 8 hr. indicate the influence of dietary MO and PBM, respectively. This
analysis was conducted with gas chromatography-ion migration
2.4. Biochemical Parameters of Serum and Muscle. Serum and spectrometry (GC-IMS). A FlavourSpec® platform (G.A.S,
muscle samples from four fish of each tank were pooled. The Dordmund, Germany) and a MXT-5 column (15 m × 0.53
total cholesterol (TC), total bile acid (TBA), malondialde- mm × 1.0 μm; RESTEK, Bellefonte, USA) were used in this
hyde (MDA), total triglyceride (TG), and protein carbonyl analysis. The IMS and column temperatures were 45 and
(PC) concentrations were analyzed with commercial kits 60°C, respectively. High-purity nitrogen (purity = 99.999%)
Aquaculture Nutrition 5

TABLE 4: Growth performance and somatic parameters of experimental tiger puffer (mean  standard error).
Parameter FO-FM MO-FM FO-5PBM MO-5PBM FO-10PBM MO-10PBM P-value
IBW (g) 14.2  0.18 14.2  0.10 14.4  0.13 14.2  0.03 14.5  0.04 14.4  0.03 0.256
FBW (g) 76.3  1.36 72.2  2.06 73.7  4.65 73.0  0.41 72.5  2.05 68.0  4.02 0.533
Survival (%) 98.3  1.67 99.0  1.11 100  0.00 100  0.00 100  0.00 98.3  1.67 0.743
WG (%) 437  2.99 410  13.8 412  27.6 413  1.65 400  15.6 372  27.1 0.343
SGR (%/d) 3.73  0.01 3.62  0.06 3.63  0.12 3.63  0.01 3.57  0.07 3.44  0.13 0.341
FI (%/d) 2.61  0.04 2.54  0.02 2.50  0.01 2.56  0.02 2.54  0.04 2.46  0.04 0.111
FCR 0.85  0.03 0.83  0.03 0.82  0.02 0.84  0.00 0.84  0.04 0.81  0.04 0.755
HSI (%) 10.7  0.42 10.4  0.48 11.3  0.95 10.4  0.76 10.4  0.82 10.0  0.72 0.841
VSI (%) 15.7  0.30 15.6  0.41 16.9  0.98 15.2  1.17 15.2  1.84 15.2  0.98 0.822
CF (g/cm3) 3.63  0.06 3.63  0.12 3.83  0.03 3.49  0.13 3.62  0.10 3.50  0.06 0.322
IBW, initial body weight; FBW, final body weight; WG, weight gain; SGR, specific growth rate; FI, feed intake; FCR, feed conversion ratio; HSI, hepatosomatic
index; VSI, viscerosomatic index; CF, condition factor; WG = (final weight − initial weight)/initial weight × 100; SGR = (ln(final weight) − ln(initial weight))/
days of experiment × 100; FI = total dry feed intake/(days of experiment × (initial weight + final weight)/2) × 100; FCR = (final weight − initial weight)/total
feed intake; CF = body weight/body length3 × 100; HSI = liver weight/body weight × 100; VSI = visceral weight/body weight × 100.

TABLE 5: Proximate composition of whole fish, muscle and liver in experimental tiger puffer (% wet weight, mean  standard error).
Parameter FO-FM MO-FM FO-5PBM MO-5PBM FO-10PBM MO-10PBM P-value
Whole fish
Moisture 74.7  0.23 75.1  0.30 74.7  0.85 75.0  0.22 75.0  0.08 75.3  0.19 0.905
Crude lipid 5.25  0.25 5.58  0.11 6.63  0.64 5.64  0.13 5.68  0.20 5.28  0.37 0.122
Crude protein 15.7  0.51 16.7  0.21 16.1  0.46 15.8  0.40 15.7  0.24 16.2  0.27 0.454
Ash 2.39  0.05 2.46  0.02 2.32  0.04 2.36  0.08 2.40  0.05 2.41  0.01 0.728
Muscle
Moisture 79.9  0.35 78.1  0.16 79.9  0.04 79.8  0.30 80.0  0.66 78.4  0.13 0.960
Crude lipid 0.46  0.05 0.45  0.01 0.46  0.01 0.51  0.05 0.53  0.02 0.51  0.02 0.317
Crude protein 17.7  0.56 19.3  0.10 17.7  0.06 17.7  0.25 17.6  0.74 19.0  0.22 0.064
Liver
Moisture 26.8  1.20a 32.0  0.60b 29.7  0.53ab 31.1  1.21ab 28.2  0.68ab 30.7  1.18ab 0.031
Crude lipid 57.4  1.83 57.3  1.95 61.5  3.74 55.1  2.52 60.7  2.31 54.5  1.63 0.335
Data in a same row not sharing a same superscript letter were significantly different (one-way ANOVA).

was used as the carrier gas. A total of 3 g muscle sample was weighed (W2) to calculate cooking loss and centrifugal loss.
weighed accurately and placed in a vial (20 mL). The samples The cooking (centrifugal) loss (%) = 100 × (W1 − W2)/W1.
were then incubated at 60°C for 15 min (500 r/min). The
automatic injection needle temperature was 85°C, and a final 2.9. Statistical Analyses. All percentage data were arcsine trans-
sample of 500 μL gas was injected into the machine. A major formed before analysis. The data were analyzed with one-way
software VOCal and three plug-in, namely, Reporter, Gallery ANOVA followed by Tukey’s test to analyze the differences
Plot, and Dynamic PCA, were used to visualize the results. among the treatments. Differences are determined as
significant when P <0:05. All data results are presented as
means  standard error.
2.8. Texture Profile Analysis (TPA) and Water-Holding
Capacity (WHC) in the Muscle. The texture profile by Tex- 3. Results
ture Analyser (TMS—PRO, Food Technology Corporation)
was measured based on 3.0 × 2.0 cm2 sliced muscle samples. 3.1. Growth Performances, Body Compositions, and Somatic
The measurement condition consisted of a 25N load cell, 8 Indices. No significant differences were observed in survival,
mm cylinder probe, 30% deformation rate, and a double feed efficiency, weight gain, specific growth rate, and somatic
cycle at a constant rate of 30 mm/min. The instrument soft- indices of fish from different groups (P >0:05, Table 4).
ware output parameters including hardness, gumminess, However, the weight gain in group MO-10PBM was slightly
springiness, cohesiveness, adhesiveness, and chewiness. lower compared to the other groups.
Six pieces of flesh (about 3 g) were sampled from the The MO and PBM supplementation had mild effects on the
dorsal muscle to measure the water-holding capacity: The proximate compositions of whole body, muscle, and liver
flesh sample (W1) was steamed for 5 min or centrifuged at (Table 5). Dietary MO supplementation significantly increased
3,000 r/min for 10 min, then wiped off the surface liquid and the moisture content of the liver (P <0:05, Table 5).
6 Aquaculture Nutrition

TABLE 6: Serum and muscle biochemical indices of experimental tiger puffer (mean  standard error).
Parameter FO-FM MO-FM FO-5PBM MO-5PBM FO-10PBM MO-10PBM P-value
Serum
TG (mmol/L) 1.15  0.07 0.74  0.09 0.86  0.00 1.05  0.28 0.89  0.31 0.52  0.02 0.232
TC (mmol/L) 9.13  0.32 8.24  0.23 8.04  0.51 7.52  1.44 7.72  0.66 6.25  0.06 0.179
TBA (µmol/L) 5.60  0.40 5.29  0.51 5.84  0.21 6.14  0.60 6.31  0.63 5.03  0.34 0.519
MDA (nmol/ml) 6.48  0.33b 4.23  0.12a 5.45  0.19b 3.96  0.23a 5.66  0.06b 3.76  0.34a <0.001
PC (nmol/mg) 0.27  0.02 0.38  0.15 0.47  0.01 0.38  0.08 0.32  0.12 0.25  0.05 0.518
Muscle
MDA (nmol/g) 0.95  0.22 0.93  0.18 0.91  0.29 0.83  0.10 0.99  0.11 1.10  0.11 0.923
PC (nmol/mg) 0.72  0.01 0.66  0.07 0.61  0.02 0.66  0.05 0.60  0.02 0.51  0.02 0.079
TG, triacylglycerol; TC, total cholesterol; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; TBA, total bile acid; MDA,
malondialdehyde; PC, protein carbonyl. a,bData in a same row not sharing a same superscript letter were significantly different (one-way ANOVA).

1.4
1.2
Relative gene expression

1
0.8
0.6
0.4
0.2
0
Muscle (16S) Liver (16S) Muscle (CYTB) Liver (CYTB)
FO-FM MO-5PBM
MO-FM FO-10PBM
FO-5PBM MO-10PBM

FIGURE 1: Mitochondrial DNA copy number (relative gene expression of 16S rRNA and cytochrome B in mitochondrial DNA) in the liver and
muscle of experimental tiger puffer. Green frame: FO treatment; red frame: MO treatment; black fill: FM treatment; gray fill: 5% PBM
treatment; white fill: 10% PBM treatment.

TABLE 7: Muscle texture and water-holding capacity of experimental tiger puffer (mean  standard error).
Parameter FO-FM MO-FM FO-5PBM MO-5PBM FO-10PBM MO-10PBM P-value
Hardness (N) 4.25  0.38 3.21  0.41 5.15  1.26 4.12  0.11 4.12  0.02 3.70  1.15 0.486
Adhesiveness (mJ) 0.04  0.00 0.05  0.00 0.04  0.00 0.04  0.00 0.04  0.00 0.05  0.00 0.051
Cohesiveness (Ratio) 0.41  0.01 0.41  0.00 0.41  0.02 0.45  0.01 0.42  0.00 0.40  0.01 0.995
Springiness (mm) 1.30  0.11 1.15  0.06 1.32  0.17 1.47  0.00 1.41  0.27 1.10  0.07 0.943
Gumminess (N) 1.78  0.18 1.31  0.16 2.15  0.62 2.05  0.13 1.75  0.01 1.51  0.51 0.691
Chewiness (mJ) 2.41  0.44 1.54  0.20 2.95  1.18 2.71  0.12 2.47  0.48 1.71  0.66 0.704
Centrifugal water loss (%) 14.0  2.31 13.4  0.22 15.2  0.95 14.2  1.64 16.4  1.08 13.1  0.75 0.625
Cooking loss (%) 34.2  0.94 35.8  0.47 37.6  1.93 36.9  0.41 37.0  1.06 34.6  0.16 0.137

3.2. Serum and Muscle Biochemical Parameters. In serum, no 3.4. Muscle Texture and Water-Holding Capacity. The MO
significant difference was observed in TG, TC, TBA, and PC and PBM supplementation did not significantly affect the hard-
of fish among different groups. However, the serum MDA ness, adhesiveness, cohesiveness, springiness, gumminess, che-
content was significantly decreased by MO (P <0:05, Table 6). winess, cooking loss ratio, and centrifugal loss ratio of fish
There were no significant differences in muscle MDA and PC muscle (P >0:05, Table 7).
contents among dietary groups (P >0:05, Table 6).
3.5. Fatty Acid Composition in Muscle and Liver. In the mus-
cle, dietary MO significantly (P <0:05) increased the C18 :
3.3. Mitochondrial DNA Copy Number. The MO and PBM 2n-6 content, but significantly (P <0:05) decreased the con-
supplementation did not significantly affect the relative gene tents of C22 : 6n-3 (DHA; Table 8).
expression of 16S rRNA and cytochrome B in the mitochon- In the liver, dietary MO significantly (P <0:05) increased
drial DHA of both muscle and liver (Figure 1). the contents of C12 : 0, C14 : 0, C18 : 1n−9, and C18 : 2n-6,
Aquaculture Nutrition 7

TABLE 8: Fatty acid compositions in the muscle of experimental tiger puffer (% total fatty acids, mean  standard error).
Fatty acid FO-FM MO-FM FO-5PBM MO-5PBM FO-10PBM MO-10PBM P-value
C12 : 0 0.00  0.00 0.00  0.00 0.00  0.00 0.24  0.24 0.18  0.18 0.00  0.00 0.679
C14 : 0 1.76  0.80 1.68  0.21 0.71  0.06 1.60  0.04 0.35  0.18 1.44  0.04 0.133
C16 : 0 21.6  0.90 22.3  0.31 22.8  0.23 21.6  0.70 21.7  0.22 21.8  0.86 0.763
C18 : 0 9.78  0.83 11.3  0.09 10.7  0.22 11.1  0.21 10.6  0.26 11.3  0.13 0.173
∑SFA 40.5  1.73 38.8  0.64 38.1  0.07 38.5  0.39 38.0  0.83 39.2  0.47 0.486
C16 : 1n-7 0.80  0.40 0.78  0.39 1.19  0.04 1.04  0.12 0.71  0.35 0.56  0.56 0.874
C18 : 1n-9 13.6  1.89 14.4  0.15 12.7  0.07 14.9  0.72 14.2  0.18 16.1  0.50 0.412
∑MUFA 14.4  1.49 15.2  0.39 13.9  0.11 15.9  0.84 14.9  0.26 16.7  1.06 0.429
C18 : 2n-6 8.48  0.70a 17.2  0.79b 10.6  0.41a 17.2  1.67b 11.2  0.30a 18.7  1.06b <0.001
C20 : 4n-6 1.23  0.62 1.05  0.53 2.27  0.06 1.55  0.08 2.46  0.03 2.11  0.24 0.127
∑n-6PUFA 9.72  1.30a 18.2  1.32bc 12.8  0.47ab 18.8  1.74bc 13.7  0.27ab 20.8  0.82c 0.001
C20 : 5n-3 5.17  0.88 5.11  0.26 6.13  0.14 4.73  0.00 5.64  0.15 4.13  0.11 0.162
C22 : 5n-3 3.73  0.26 3.91  0.13 3.92  0.00 3.87  0.20 3.77  0.08 3.48  0.50 0.795
C22 : 6n-3 23.3  0.83c 16.5  1.50abc 21.8  1.12bc 15.6  1.92ab 21.1  0.74bc 13.6  1.99a 0.004
∑n-3PUFA 32.2  1.92c 25.5  1.12abc 31.8  0.98c 24.2  1.72ab 30.5  0.84bc 21.2  1.38a 0.002
∑n-3/∑n-6 3.39  0.30d 1.42  0.18ab 2.48  0.17cd 1.33  0.20ab 2.23  0.09bc 1.02  0.11a <0.001
Data in a same row not sharing a same superscript letter were significantly different (one-way ANOVA).

TABLE 9: Fatty acid compositions in the liver of experimental tiger puffer (% total fatty acids, mean  standard error).
Fatty acid FO-FM MO-FM FO-5PBM MO-5PBM FO-10PBM MO-10PBM P-value
C12 : 0 0.01  0.01a 2.87  0.16b 0.00  0.00a 2.77  0.22b 0.00  0.00a 2.72  0.01b <0.001
C14 : 0 3.02  0.17a 5.98  0.19b 2.74  0.05a 5.57  0.18b 2.88  0.06a 5.53  0.05b <0.001
C16 : 0 23.2  1.09 24.0  1.34 24.3  1.56 24.6  0.77 24.0  0.39 24.5  0.01 0.916
C18 : 0 11.0  0.18b 11.3  0.21b 10.8  0.14b 11.0  0.45b 9.33  0.15a 10.2  0.20ab 0.003
∑SFA 37.7  1.05ab 44.4  1.58c 38.3  1.48ab 44.1  1.01c 36.5  0.61a 43.1  0.24bc 0.001
C16 : 1n-7 6.07  0.23ab 5.27  0.14a 6.06  0.05ab 5.51  0.37a 6.74  0.16b 5.45  0.10a 0.008
C18 : 1n-9 19.8  0.55a 23.1  0.05cd 20.4  0.01ab 24.6  0.54de 22.0  0.16bc 25.6  0.08e <0.001
C20 : 1n-9 1.21  0.04 1.12  0.05 1.18  0.13 1.05  0.07 1.28  0.07 1.11  0.03 0.230
∑MUFA 27.1  0.72a 29.5  0.22bc 27.7  0.19ab 31.2  0.25cd 30.0  0.06c 32.2  0.22d <0.001
C18 : 2n-6 9.97  0.23a 12.3  0.35bc 10.0  0.46a 12.6  0.27c 11.1  0.21ab 13.1  0.17c <0.001
C20 : 2n-6 0.59  0.06 0.63  0.04 0.57  0.02 0.61  0.05 0.60  0.02 0.66  0.07 0.887
C20 : 4n−6 0.46  0.02b 0.28  0.03a 0.49  0.04b 0.28  0.02a 0.48  0.02b 0.27  0.00a <0.001
∑n-6PUFA 11.0  0.31a 13.2  0.42bc 11.1  0.52a 13.5  0.31bc 12.2  0.21ab 14.1  0.24c <0.001
C18 : 3n-3 2.11  0.03b 0.97  0.05a 2.01  0.02b 0.98  0.15a 1.94  0.02b 1.00  0.06a <0.001
C20 : 5n-3 4.77  0.38b 2.44  0.2a 4.3  0.43b 2.11  0.11a 3.92  0.08b 1.84  0.02a <0.001
C22 : 5n-3 3.34  0.32abc 2.24  0.22ab 3.69  0.35bc 2.20  0.15a 3.71  0.41c 1.91  0.08a 0.004
C22 : 6n-3 11.2  0.87b 5.71  0.50a 10.5  0.65b 4.96  0.31a 9.38  0.27b 4.38  0.24a <0.001
∑n-3PUFA 21.4  1.38b 11.4  0.96a 20.4  0.76b 10.3  0.70a 19.0  0.71b 9.12  0.13a <0.001
∑n-3/∑n-6 1.95  0.12c 0.86  0.05a 1.85  0.02bc 0.76  0.05a 1.56  0.04b 0.65  0.02a <0.001
Data in a same row not sharing a same superscript letter were significantly different (one-way ANOVA).

but significantly (P <0:05) decreased the contents of C16 : were subjected to the analysis of muscle volatile flavor compo-
1n-7, C18 : 3n-3, ARA, C20 : 5n-3 (EPA), C22 : 5n-3, and DHA nents, in order to determine the influences of MO and PBM.
(Table 9). Dietary PBM significantly (P <0:05) increased the From all the muscle samples, 49 volatile flavor components were
C18 : 1n-9 content. detected, of which 45 were identified successfully (Figures 2 and
3, Table S1). Compared to the FO-FM group, the MO-FM group
3.6. Free Amino Acids Composition in Muscle. Both dietary had lower abundance of acetic acid, ethyl 2-hydroxypropanoate,
MO and PBM resulted in very few changes in amino acid (Z)-4-heptenal, and propanoic acid, but higher abundance of 2-
composition of fish muscle (Table 10). methylbutanal, 3-methylbutanal dimer, 3-methylbutanal mono-
mer, methyl isobutyl ketone, pentanal monomer, pentanal dimer,
3.7. Volatile Flavor Components in the Muscle. Three char- n-hexanol, octanal dimer, 2-hexanone, 2-heptanone, hexanal
acteristic groups, namely, FO-FM, MO-FM, and FO-10PBM, dimer, and pentan-1-ol dimer (Figure 2). Compared to the
8 Aquaculture Nutrition

TABLE 10: Free amino acid and taurine compositions in the muscle of experimental tiger puffer (g/kg, dry matter basis, mean  standard
error).
Amino acid FO-FM MO-FM FO-5PBM MO-5PBM FO-10PBM MO-10PBM P-value
Thr 1.37  0.15 0.93  0.04 1.10  0.07 1.06  0.03 1.09  0.01 0.90  0.11 0.094
Val 0.41  0.08 0.25  0.02 0.32  0.05 0.29  0.05 0.33  0.00 0.29  0.04 0.579
Met 0.75  0.07 0.72  0.08 0.78  0.06 0.73  0.02 0.68  0.01 0.77  0.02 0.961
Ile 0.13  0.06 0.09  0.03 0.11  0.05 0.14  0.02 0.15  0.00 0.12  0.05 0.539
Leu 0.20  0.07 0.13  0.01 0.17  0.04 0.19  0.01 0.20  0.00 0.16  0.04 0.490
Phe 0.86  0.05 0.78  0.06 0.77  0.10 0.74  0.01 0.71  0.01 0.77  0.03 0.265
Lys 3.99  0.53 4.34  0.12 3.08  0.01 4.63  0.15 3.80  0.02 4.02  0.04 0.506
His 0.28  0.03b 0.16  0.01ab 0.20  0.00ab 0.21  0.02ab 0.22  0.01ab 0.14  0.03a 0.025
Arg 0.94  0.21 1.05  0.04 0.91  0.04 1.25  0.14 1.27  0.02 1.26  0.09 0.192
∑EAA 8.93  0.64 8.45  0.21 7.43  0.38 9.24  0.19 8.46  0.03 8.52  0.20 0.399
Tau 34.63  1.09 35.35  1.82 33.96  3.15 33.95  2.76 33.37  2.74 34.23  0.04 0.968
Asp 0.30  0.01 0.28  0.02 0.32  0.02 0.27  0.01 0.29  0.01 0.34  0.00 0.551
Ser 0.22  0.01 0.26  0.03 0.24  0.03 0.19  0.04 0.23  0.01 0.25  0.03 0.507
Glu 0.38  0.04 0.33  0.03 0.41  0.03 0.39  0.06 0.42  0.01 0.37  0.02 0.782
Gly 1.98  0.06b 2.11  0.05b 1.93  0.13b 1.58  0.02a 2.47  0.03c 2.75  0.01c 0.041
Ala 1.87  0.09abc 2.04  0.04bc 1.96  0.01bc 1.61  0.25ab 1.37  0.01a 2.15  0.06c 0.788
Tyr 0.16  0.05 0.11  0.00 0.14  0.04 0.15  0.00 0.16  0.01 0.14  0.02 0.562
∑NEAA 39.5  1.16 40.5  1.84 34.0  3.39 38.1  2.38 38.0  2.53 40.2  0.12 0.928
∑AA 48.5  0.52 48.9  1.93 46.4  3.77 47.4  2.19 46.7  2.75 48.7  0.22 0.818
Data in a same row not sharing a same superscript letter were significantly different.

FO-FM
FO-FM
FO-FM
MO-FM
MO-FM
MO-FM

(E)-hept-2-enal
Ethyl 2-hydroxypropanoate
Acetic acid

(E)-2-pentenal-M
(E)-2-pentenal-D
(Z)-4-heptenal
Propanoic acid

1-propanol
Ethanol
Acetone
Ethyl acetate-M
Ethyl acetate-D
Pent-1-en-3-ol
Methyl acetate
2-Butanone-M
2-Butanone-D
Oct-1-en-3-ol
2-Methylbutanal

Hexanal-M
Hexanal-D
Nonanal
Methyl isobutyl ketone

2
3
4
5

Benzaldehyde-D
Methyl-5-hepten-2-one

n-Hexanol

Octanal-M
Octanal-D
3-Octanol

Pentan-1-ol-M
Pentan-1-ol-D
(E)-2-hexenal-M
(E)-2-hexenal-D
Benzaldehyde-M
3-Methylbutanal-M
3-Methylbutanal-D
2, 3-pentanedione

Pentanal-M
Pentanal-D
Ethyl propanoate
1

3-Ethylpyridine

2-Hexanone
2-Heptanone
Heptanal-M
Heptanal-D

Prop-1-ene-3, 3’-thiobis

FIGURE 2: Gallery plot of volatile compounds in muscle of the FO-FM group and MO-FM group. The brightness indicates relative compound
abundance. A column represents the signal peak of a certain volatile organic compound in different samples. A line represents all signal peaks
of volatile organic compound selected from a certain sample. Compounds named as numbers were not successfully identified.

FO-FM
FO-FM
FO-FM
FO-10PBM
FO-10PBM
FO-10PBM
(E)-hept-2-enal
Ethyl 2-hydroxypropanoate
Acetic acid
Nonanal
Oct-1-en-3-ol

(Z)-4-heptenal

Ethanol
2-Butanone-M
2-Butanone-D
3-Ethylpyridine

(E)-2-pentenal-M
(E)-2-pentenal-D

1-propanol
Propanoic acid
Ethyl propanoate

3
4
2
Ethyl acetate-M
Ethyl acetate-D
Pent-1-en-3-ol

Acetone
Methyl-5-hepten-2-one

n-Hexanol

Heptanal-M
Heptanal-D
Hexanal-M
Hexanal-D
Pentanal-M
Pentanal-D
2-Methylbutanal
Methyl acetate

Methyl isobutyl ketone

1
5
Pentan-1-ol-M
Pentan-1-ol-D
Octanal-M
Octanal-D
Benzaldehyde-M
Benzaldehyde-D
3-Octanol

(E)-2-hexenal-M
(E)-2-hexenal-D
3-Methylbutanal-M
3-Methylbutanal-D

2, 3-pentanedione
2-Hexanone

2-Heptanone
Prop-1-ene-3, 3’-thiobis

FIGURE 3: Gallery plot of volatile compounds in muscle of the FO-FM group and FO-10PBM group. The brightness indicates relative compound
abundance. A column represents the signal peak of a certain volatile organic compound in different samples. A line represents all signal peaks of
volatile organic compound selected from a certain sample. Compounds named as numbers were not successfully identified.
Aquaculture Nutrition 9

3,000.0

2,000.0
MO-FM
1,000.0 PO-FM PO-FM

PC 2 (22%)
PO-FM
0.0 MO-FM +

–1,000.0

–2,000.0
MO-FM
–3,000.0
–3,000.0 –2,000.0 –1,000.0 0.0 1,000.0 2,000.0 3,000.0
PC 1 (55.7%)

FIGURE 4: Principal component analysis (PCA) in volatile compounds in the muscle of the FO-FM group and MO-FM group.

3,000.0
FO-10PBM

2,000.0

1,000.0
PC 2 (26%)

FO-10PBM
0.0 +
FO-FM
FO-FM FO-10PBM
–1,000.0 FO-FM

–2,000.0

–3,000.0
–3,000.0 –2,000.0 –1,000.0 0.0 1,000.0 2,000.0 3,000.0
PC 1 (51%)

FIGURE 5: Principal component analysis (PCA) in volatile compounds in the muscle of the FO-FM group and FO−10PBM group.

FO-FM group, the FO-10PBM group showed lower abundance gilthead sea bream (Sparus aurata, <50% replacement)
of ethyl 2-hydroxypropanoate, acetic acid, (E)-2-pentenal dimer, [52, 53], gibel carp (Carassius auratus gibelio, <50% replace-
(E)-2-pentenal monomer, methyl-5-hepten-2-one, 1-propanol, ment) [54], cuneate drum (Nibea miichthioides, <50%
and propanoic acid, but higher abundance of 3-methylbutanal replacement) [55], and obscure pufferfish (<30% replace-
monomer, 3-methylbutanal dimer, 2-methylbutanal, and 2,3- ment) [11]. Complete FO replacement by PO had no signifi-
pentanedione (Figure 3). cant effect on the growth of brown trout (Salmo trutta) [25],
The principal component analysis (PCA) showed that pacific white shrimp (Litopenaeus vannamei) [56], large-
the muscle volatile flavor components clustered separately mouth bass (Micropterus salmoides) [27], and barramundi
depending on dietary lipid source (Figure 4) or protein (Lates calcarifer) [57].
source (Figure 5). Specific to tiger puffer, limited studies have shown that
soybean meal and fish protein hydrolysate can replace a
4. Discussion certain percentage (30% and 42.8%, respectively) of FM in
tiger puffer diets [33, 50]. As for the application of alternative
The current study clearly showed that 22% FM replacement lipid sources in tiger puffer diets, our previous studies have
(10% of diet) and 100% replacement of added oil (67% of total shown that PO and soybean oil can replace 100% added FO
dietary lipid) with PBM and MO did not comprise the growth in the diets of tiger puffer [50]. That was partly why PO was
performance of farmed tiger puffer, indicating the great further tested in this study. However, 100% replacement of
potential of this replacement strategy. Results of the present the 6% added FO with other alternative lipid sources such as
study were consistent with the results observed in other fish linseed oil, rapeseed oil, and beef tallow significantly reduced
species. As mentioned above, PBM can replace 25%–70% of the growth of juvenile tiger puffer [33]. The present study
FM in fish feeds, while PO can replace FO at higher levels also indicates that combined use of PBM and PO was feasi-
(usually 30%–100%). Low percentage replacement of dietary ble. Similarly, for Atlantic salmon (Salmo salar), the replace-
FM by PBM also had no significant effect on the growth of ment of 50% FO and FM in the diet by PO and PBM also had
10 Aquaculture Nutrition

no significant effects on the growth performance [13]. Nev- compounds in tiger puffer mainly consist of aldehyde, alco-
ertheless, despite the high potential of the combined use of hol, ketone, and ester compounds. The volatile flavor com-
PBM and PO in fish diets, the present results still showed a pound composition was clearly changed by both MO and
decreasing trend (without significant differences) in growth PBM. The MO group had lower abundance of (Z)-4-heptenal,
with increasing PBM and PO levels. In a longer feeding but higher abundance of 2-methylbutanal, 3-methylbutanal
period, significant growth reduction induced by PBM and dimer, 3-methylbutanal monomer, pentanal monomer, pen-
PO may be observed. tanal dimer, n-hexanol, octanal dimer, and hexanal dimer.
The fish body composition was not obviously affected by (Z)-4-heptenal is derived from the lipid oxidation of n-3
dietary supplementation of both PBM and MO. However, it PUFA [68], which usually indicates the deterioration of fish
should be noted that dietary MO increased the moisture and presents flavor of boiled fish and fatty grease. The lower
content in the liver. The increase of lipid content by dietary levels of (Z)-4-heptanal in the MO and PBM groups may be
MO was consistent with a previous study on PO substitution due to the fact that the control group contained a higher
for FO in tiger puffer [50]. The increase of liver moisture proportion of n-3 PUFA that was more easily oxidized. There-
content could be related to the (although not significant) fore, the addition of MO or PBM to the diet will reduce the
decrease of lipid content. However, this result was in contrast adverse flavors caused by lipid oxidation. The 2-methylbuta-
with other studies on alternative lipid sources which showed nal, which has strong burnt flavor, may be related to the
that FO replacement by alternative lipid sources easily causes degradation of amino acid [69]. The 3-methylbutanal, which
an increase in lipid content in fish liver [30]. was also higher in abundance in the MO group, has green
The fatty acid composition of experimental tiger puffer grass, vegetables, almond, and malt flavors. Pentanal, which is
generally reflected those of the diets, as observed in the other probably derived from n-6 PUFA oxidation [70], has a pun-
studies [30, 35]. In this study, CCO was blended into PO to gent flavor. Both octanal and hexanal have grassy, leafy, fruity,
balance the composition of MUFA and SFA, considering that and other plant flavors [71]. The PBM group had lower abun-
CCO is rich in SFA typically C12 : 0 [58]. The contents of C12 : 0 dance of 1-octene-3-ol, nonanal, (E)-2-pentenal dimer, and
and C14 : 0 in the liver but not the muscle of tiger puffer were (E)-2-pentenal monomer, but higher abundance of 3-methyl-
increased by dietary MO. The SFA content in tiger puffer mus- butanal monomer, 3-methylbutanal dimer, 2-methylbutanal,
cle was not obviously affected by dietary MO, indicating that and 2,3-pentanedione. The 1-octene-3-ol, which may result in
the excess SFA in MO may be readily utilized by fish. This the flavors of fishy, fatty, and mushroom, is a product of
provided evidence for the omega-3 fatty acids sparing effects oxidation of linoleic acid or other polyunsaturated fatty acid
of SFA, which have been widely observed in other fish studies [68, 69, 72]. Nonanal, showing geranium, plastic, and marine
[39, 40, 59–64]. Nevertheless, dietary MO still decreased the flavors, is the product of oxidation of oleic acid and linoleic
DHA and EPA contents in the muscle (EPA, by 15.6%; DHA, acid [73]. The above results showed that the effects of FM and
by 30.3%) and especially the liver (EPA, by 50.1%; DHA, by FO replacement by PBM and MO resulted in both pleasant
50.5%). Attention should be paid on this if the fillet quality is and unpleasant changes in flavor. The overall influence on
considered. However, on the other hand, this may contribute to fish flesh flavor needs to be comprehensively evaluated by
the lower malondialdehyde (MDA), which is a product of lipid other parameters, in particular by a sensory evaluation.
peroxidation, content in the serum of the MO group. In other In conclusion, combined replacement of FM and FO by
studies on tiger puffer, it was observed that the FO replacement PBM and MO had no significant effect on the growth perfor-
with rapeseed oil also reduced the MDA level [33]. Since, LC- mance and body proximate composition of tiger puffer. The
PUFA are more susceptible to peroxidation compared to SFA supplementation of both PBM and MO significantly decreased
and MUFA, the fish oil, which is rich in LC-PUFA, is under the malondialdehyde content in serum. The FM and FO replace-
higher peroxidation pressure. The lower MDA content in the ment by PBM and MO also reduced the fillet volatile flavor
muscle of fish fed alternative oils is a favorable quality trait. compounds derived from PUFA oxidation, such as (Z)-4-hep-
This advantage could be more significant in longer term experi- tenal, 1-octene-3-ol, and nonanal. Further studies examining
ments considering that the MDA accumulates in fish muscle. higher FM replacement levels by PBM are recommended.
Free amino acid (FAA) is an important flavor component
in fish flesh products. When the FO was replaced by MO in Data Availability
the diet of tiger puffer, the lysine content in muscle tended to Raw data supporting the conclusions of this manuscript will
increase and the histidine and threonine contents tended to be made available by the authors, without undue reservation,
decrease. Lysine is a sweet amino acid and histidine is a bitter to any qualified researcher.
amino acid [65]. Therefore, it was speculated that the sweet-
ness can be increased but the bitterness can be reduced by
dietary MO. In all groups, taurine was the most abundant
Conflicts of Interest
FAA. Similar results were observed in sea bass (Dicen- The authors declare that they have no conflicts of interest.
trarchus labrax) [66] and gibel carp [67]. However, it seemed
that taurine has no effect on the taste or the formation of Authors’ Contributions
aromatic active ingredients [66].
Besides FFA, volatile organic compounds also have great Conceptualization and funding acquisition were assigned to
influence on fish flesh quality. The identified volatile flavor QM and HX. Formal analysis and data curation were
Aquaculture Nutrition 11

assigned to LZ, LL, and FZ. Methodology and software were obscurus),” Aquaculture Research, vol. 53, no. 6, pp. 2354–
assigned to PL, YL, JL, and YW. Conduction of feeding trial 2365, 2022.
and writing-original draft was assigned to LZ and LL. [12] M. Irm, S. Taj, M. Jin, J. Luo, H. J. T. Andriamialinirina, and
Writing-review, editing, and supervision was assigned to Q. Zhou, “Effects of replacement of fish meal by poultry by-
QM, ML, and HX. product meal on growth performance and gene expression
involved in protein metabolism for juvenile black sea bream
(Acanthoparus schlegelii),” Aquaculture, vol. 528, no. 15,
Acknowledgments Article ID 735544, 2020.
[13] B. Hatlen, J. V. Jakobsen, V. Crampton et al., “Growth, feed
This work was supported by the Central Public-Interest utilization and endocrine responses in Atlantic Salmon (Salmo
Scientific Institution Basal Research Fund, CAFS/YSFRI salar) fed diets added poultry by-product meal and blood meal
(2022XT0403, 20603,022,022,004, and 2023TD52), the Nat- in combination with poultry oil,” Aquaculture Nutrition,
ural Science Foundation of Shandong Province Outstanding vol. 21, no. 5, pp. 714–725, 2015.
Youth Foundation (ZR2021YQ24), and the Earmarked [14] M. Yigit, M. Erdem, S. Koshio, S. Ergun, A. Turker, and
Funds for China Agriculture Research System (CARS-47). B. Karaali, “Substituting fish meal with poultry by-product meal
in diets for black sea turbot Psetta maeotica,” Aquaculture
Nutrition, vol. 12, no. 5, pp. 340–347, 2006.
Supplementary Materials [15] M. L. Gallagher and J. Degani, “Poultry meal and poultry oil as
sources of protein and lipid in the diet of European eels
Table S1: the relatively quantitative results of muscle volatile (Anguilla anguilla),” Aquaculture, vol. 73, no. 1–4, pp. 177–
organic compounds. (Supplementary Materials) 187, 1988.
[16] Z. Wang, X. Qian, S. Xie, and B. Yun, “Changes of growth
References performance and plasma biochemical parameters of hybrid
grouper (Epinephelus lanceolatus♂ × Epinephelus fuscogutta-
[1] J. Pickova and T. Mørkøre, “Alternate oils in fish feeds,” tus♀) in response to substitution of dietary fishmeal with poultry
European Journal of Lipid Science and Technology, vol. 109, by-product meal,” Aquaculture Reports, vol. 18, Article ID
no. 3, pp. 256–263, 2007. 100516, 2020.
[2] C. Nasopoulou and I. Zabetakis, “Benefits of fish oil [17] D. Badillo, S. Z. Herzka, and M. T. Viana, “Protein retention
replacement by plant originated oils in compounded fish assessment of four levels of poultry by-product substitution of
feeds. A review,” Food Science and Technology, vol. 47, no. 2, fishmeal in rainbow trout (Oncorhynchus mykiss) diets using
pp. 217–224, 2012. stable isotopes of nitrogen (δ15N) as natural tracers,” PLOS
[3] C. Aragao, A. T. Goncalves, B. Costas, R. Azeredo, ONE, vol. 9, no. 9, Article ID 107523, 2014.
M. J. Xavier, and S. Engrola, “Alternative proteins for fish [18] K. K. M. Liu, F. T. Barrows, R. W. Hardy, and F. M. Dong,
diets: implications beyond growth,” Animals, vol. 12, no. 9, “Body composition, growth performance, and product quality
Article ID 1211, 2022. of rainbow trout (Oncorhynchus mykiss) fed diets containing
[4] M. Henry, L. Gasco, G. Piccolo, and E. Fountoulaki, “Review poultry fat, soybean/corn lecithin, or menhaden oil,”
on the use of insects in the diet of farmed fish: past and future,” Aquaculture, vol. 238, no. 1–4, pp. 309–328, 2004.
Animal Feed Science and Technology, vol. 203, pp. 1–22, 2015. [19] M. Xue, L. Luo, X. Wu et al., “Effects of six alternative lipid
[5] S. Albrektsen, R. Kortet, P. V. Skov et al., “Future feed sources on growth and tissue fatty acid composition in
resources in sustainable salmonid production: a review,” Japanese sea bass (Lateolabrax japonicus),” Aquaculture,
Reviews in Aquaculture, vol. 14, no. 4, pp. 1790–1821, 2022. vol. 260, no. 1–4, pp. 206–214, 2006.
[6] N. Montoya-Camacho, E. Marquez-Rios, F. J. Castillo-Yanez [20] G. Rosenlund, A. Obach, M. G. Sandberg, H. Standal, and
et al., “Adavances in the use of alternative protein sources for K. Tveit, “Effect of alternative lipid sources on long-term
tilapia feeding,” Reviews in Aquaculture, vol. 11, no. 3, growth performance and quality of Atlantic salmon (Salmo
pp. 515–526, 2019. salar L.),” Aquaculture Research, vol. 32, pp. 323–328, 2001.
[7] R. Luthada-Raswiswi, S. Mukaratirwa, and G. O’Brien, [21] A. N. Rombenso, J. T. Trushenski, and M. H. Schwarz, “Fish
“Animal protein sources as a substitute for fishmeal in oil replacement in feeds for juvenile Florida Pompano:
aquaculture diets: a systematic review and meta-analysis,” composition of alternative lipid influences degree of tissue
Applied Sciences-Basel, vol. 11, no. 9, Article ID 3854, 2021. fatty acid profile distortion,” Aquaculture, vol. 458, pp. 177–
[8] J. Sales, “The effect of fish meal replacement by soyabean 186, 2016.
products on fish growth: a meta-analysis,” The British Journal [22] E. Friesen, S. K. Balfry, B. J. Skura, M. Ikonomou, and
of Nutrition, vol. 102, no. 12, pp. 1709–1722, 2009. D. A. Higgs, “Evaluation of poultry fat and blends of poultry
[9] X. Wang, H. Luo, Y. Zheng et al., “Effects of poultry by- fat with cold-pressed flaxseed oil as supplemental dietary lipid
product meal replacing fish meal on growth performance, feed sources for juvenile sablefish (Anoplopoma fimbria),”
utilization, intestinal morphology and microbiota communi- Aquaculture Research, vol. 44, no. 2, pp. 300–316, 2013.
ties in juvenile large yellow croaker (Larimichthys crocea),” [23] J. N. Bowyer, J. G. Qin, R. P. Smullen, and D. A. J. Stone,
Aquaculture Reports, vol. 30, Article ID 101547, 2023. “Replacement of fish oil by poultry oil and canola oil in
[10] A. Gonzalez-Rodriguez, J. D. Celada, J. M. Carral, M. Saez- yellowtail kingfish (Seriola lalandi) at optimal and suboptimal
Royuela, V. Garcia, and J. B. Fuertes, “Evaluation of poultry temperatures,” Aquaculture, vol. 356, pp. 211–222, 2012.
by-product meal as partial replacement of fish meal in [24] M. Carvalho, D. Montero, G. Rosenlund, R. Fontanillas,
practical diets for juvenile tench (Tinca tinca L.),” Aquaculture R. Ginés, and M. Izquierdo, “Effective complete replacement
Research, vol. 47, pp. 1612–1621, 2014. of fish oil by combining poultry and microalgae oils in
[11] X. Cui, M. Liang, Y. Wei et al., “Application of poultry by- practical diets for gilthead sea bream (Sparus aurata)
product meal in diets of obscure pufferfish (Takifugu fingerlings,” Aquaculture, vol. 529, Article ID 735696, 2020.
12 Aquaculture Nutrition

[25] G. M. Turchini, T. Mentasti, L. Frøyland et al., “Effects of [39] G. M. Turchini, D. S. Francis, S. P. S. D. Senadheera,
alternative dietary lipid sources on performance, tissue T. Thanuthong, and S. S. De Silva, “Fish oil replacement
chemical composition, mitochondrial fatty acid oxidation with different vegetable oils in Murray cod: evidence of an
capabilities and sensory characteristics in brown trout (Salmo “omega-3 sparing effect, by other dietary fatty acids,”
trutta L.),” Aquaculture, vol. 225, no. 1–4, pp. 251–267, 2003. Aquaculture, vol. 315, no. 3-4, pp. 250–259, 2011.
[26] W. A. R. Wan Ahmad, D. A. J. Stone, and K. A. Schuller, [40] G. M. Turchini, V. M. Moretti, K. Hermon et al., “Monola oil
“Dietary fish oil replacement with palm or poultry oil increases versus canola oil as a fish oil replacer in rainbow trout feeds:
fillet oxidative stability and decreases liver glutathione peroxidase effects on growth, fatty acid metabolism and final eating
activity in barramundi (Lates calcarifer),” Fish Physiology and quality,” Food Chemistry, vol. 141, no. 2, pp. 1335–1344, 2013.
Biochemistry, vol. 39, no. 6, pp. 1631–1640, 2013. [41] A. N. Rombenso, J. T. Trushenski, and M. Drawbridge,
[27] B. Yun, M. Xue, J. Wang et al., “Effects of lipid sources and “Saturated lipids are more effective than others in juvenile
lipid peroxidation on feed intake, growth, and tissue fatty acid California yellowtail feeds—understanding and harnessing
compositions of largemouth bass (Micropterus salmoides),” LC-PUFA sparing for fish oil replacement,” Aquaculture,
Aquaculture International, vol. 21, pp. 97–110, 2013. vol. 493, pp. 192–203, 2018.
[28] A. Masiha, E. Ebrahimi, N. Mahboobi Soofiani, and [42] H. Xu, Z. Liao, Q. Zhang, Y. Wei, and M. Liang, “A moderately
M. Kadivar, “Effect of dietary canola oil level on the growth high level of dietary lipid inhibited the protein secretion
performance and fatty acid composition of fingerlings of function of liver in juvenile tiger puffer Takifugu rubripes,”
rainbow trout (Oncorhynchus mykiss),” Iranian Journal of Aquaculture, vol. 498, pp. 17–27, 2019.
Fisheries Science, vol. 14, no. 2, pp. 336–349, 2015. [43] M. S. Hossain, M. Peng, and B. C. Small, “Optimizing the fatty
[29] Y. Emre, A. Kurtoglu, N. Emre, B. Guroy, and D. Guroy, acid profile of novel terrestrial oil blends in low fishmeal diets
“Effect of replacing dietary fish oil with soybean oil on growth of rainbow trout (Oncorhynchus mykiss) yields comparable
performance, fatty acid composition and haematological fish growth, total fillet n-3 LC-PUFA content, and health
parameters of juvenile meagre, Argyrosomus regius,” Aquacul- performance relative to fish oil,” Aquaculture, vol. 545,
ture Research, vol. 47, no. 7, pp. 2256–2265, 2016. Article ID 737230, 2021.
[30] H. Xu, G. M. Turchini, D. S. Francis et al., “Are fish what they [44] J. G. Bell, J. Pratoomyot, F. Strachan et al., “Growth, flesh
eat? A fatty acid’s perspective,” Progress in Lipid Research, adiposity and fatty acid composition of Atlantic salmon
vol. 80, Article ID 101064, 2020. (Salmo salar) families with contrasting flesh adiposity: effects
[31] D. Xu, X. Xiang, X. Li et al., “Effects of dietary vegetable oils of replacement of dietary fish oil with vegetable oils,”
replacing fish oil on fatty acid composition, lipid metabolism Aquaculture, vol. 306, no. 1–4, pp. 225–232, 2010.
and inflammatory response in adipose tissue of large yellow [45] H. Xu, Z. Liao, Q. Zhang, Y. Wei, and M. Liang, “Effects of
croaker (Larimichthys crocea),” Journal of Marine Science and dietary n-6 polyunsaturated fatty acids on growth performance,
Engineering, vol. 10, no. 11, Article ID 1760, 2022. body composition, haematological parameters and hepatic
[32] O. T. Eroldoğan, M. Elsabagh, Y. Emre et al., “Circadian physiology of juvenile tiger puffer (Takifugu rubripes),”
feeding schedules in gilthead sea bream (Sparus aurata) and Aquaculture Nutrition, vol. 25, no. 5, pp. 1073–1086, 2019.
European sea bass (Dicentrarchus labrax): a comparative [46] M. D. E. Dias, N. P. Siqueira, L. L. da Conceição et al.,
approach towards improving dietary fish oil utilization and n- “Consumption of virgin coconut oil in Wistar rats increases
3 LCPUFA metabolism,” Aquaculture, vol. 495, pp. 806–814, saturated fatty acids in the liver and adipose tissue, as well as
2018. adipose tissue inflammation,” Journal of Functional Foods,
[33] Z. Liao, Z. Sun, Q. Bi et al., “Application of the fish oil-finishing vol. 48, pp. 472–480, 2018.
strategy in a lean marine teleost, tiger puffer (Takifugu rubripes),” [47] H.-X. Wu, W.-J. Li, L. Zhang et al., “Microbiota derived
Aquaculture, vol. 534, Article ID 736306, 2021. butyrate affected the muscle texture of Nile tilapia
[34] W.-K. Ng, P.-K. Lim, and P.-L. Boey, “Dietary lipid and palm (Oreochromis niloticus) fed with different protein sources,”
oil source affects growth, fatty acid composition and muscle α- Food Chemistry, vol. 393, Article ID 133392, 2022.
tocopherol concentration of African catfish, Clarias gariepi- [48] S.-J. Lim, S.-S. Kim, G.-Y. Ko et al., “Fish meal replacement by
nus,” Aquaculture, vol. 215, no. 1–4, pp. 229–243, 2003. soybean meal in diets for tiger puffer, Takifugu rubripes,”
[35] G. M. Turchini, D. S. Francis, and S. S. De Silva, “Fatty acid Aquaculture, vol. 313, no. 1–4, pp. 165–170, 2011.
metabolism in the freshwater fish Murray cod (Maccullochella [49] Y. Wei, J. Wang, X. Zhang et al., “Fish protein hydrolysate
peelii peelii) deduced by the whole-body fatty acid balance supplementation in plant protein based diets for tiger puffer
method,” Comparative Biochemistry and Physiology Part B: (Takifugu rubripes) is an effective strategy of fish meal sparing,”
Biochemistry and Molecular Biology, vol. 144, no. 1, pp. 110– Aquaculture Reports, vol. 20, Article ID 100720, 2021.
118, 2006. [50] L. Li, F. Zhang, X. Meng et al., “Fish oil replacement with poultry oil
[36] J. T. Trushenski, H. A. Lewis, and C. C. Kohler, “Fatty acid in the diet of tiger puffer (Takifugu rubripes): effects on growth
profile of sunshine bass: I. Profile change is affected by initial performance, body composition, and lipid metabolism,” Aquacul-
composition and differs among tissues,” Lipids, vol. 43, no. 7, ture Nutrition, vol. 2022, Article ID 2337933, 11 pages, 2022.
pp. 629–641, 2008. [51] X. Meng, Q. Bi, L. Cao et al., “Evaluation of necessity of
[37] J. T. Trushenski, “Saturated lipid sources in feeds for sunshine cholesterol supplementation in diets of two marine teleosts,
bass: alterations in production performance and tissue fatty turbot (Scophthalmus maximus) and tiger puffer (Takifugu
acid composition,” North American Journal of Aquaculture, rubripes): effects on growth and lipid metabolism,” Aquacul-
vol. 71, no. 4, pp. 363–373, 2009. ture Nutrition, vol. 2022, Article ID 4160991, 18 pages, 2022.
[38] G. M. Turchini and D. S. Francis, “Fatty acid metabolism [52] F. Fontinha, R. Magalhaes, S. Moutinho et al., “Effect of dietary
(desaturation, elongation and β-oxidation) in rainbow trout poultry meal and oil on growth, digestive capacity, and gut
fed fish oil-or linseed oil-based diets,” British Journal of microbiota of gilthead seabream (Sparus aurata) juveniles,”
Nutrition, vol. 102, no. 1, pp. 69–81, 2009. Aquaculture, vol. 530, Article ID 735879, 2021.
Aquaculture Nutrition 13

[53] I. T. Karapanagiotidis, P. Psofakis, E. Mente, E. Malandrakis, [66] A. Fuentes, I. Fernández-Segovia, J. A. Serra, and J. M. Barat,
and E. Golomazou, “Effect of fishmeal replacement by poultry “Comparison of wild and cultured sea bass (Dicentrarchus
by-product meal on growth performance, proximate composi- labrax) quality,” Food Chemistry, vol. 119, no. 4, pp. 1514–
tion, digestive enzyme activity, haematological parameters and 1518, 2010.
gene expression of gilthead seabream (Sparus aurata),” [67] L. Zhou, D. Han, X. Zhu, Y. Yang, J. Jin, and S. Xie, “Effects of
Aquaculture Nutrition, vol. 25, no. 1, pp. 3–14, 2019. total replacement of fish oil by pork lard or rapeseed oil and
[54] Y. Yang, S. Xie, Y. Cui et al., “Effect of replacement of dietary recovery by a fish oil finishing diet on growth, health and fish
fish meal by meat and bone meal and poultry by-product meal quality of gibel carp (Carassius auratus gibelio),” Aquaculture
on growth and feed utilization of gibel carp, Carassius auratus Research, vol. 47, no. 9, pp. 2961–2975, 2016.
gibelio,” Aquaculture Nutrition, vol. 10, no. 5, pp. 289–294, [68] G. Duflos, V. M. Coin, M. Cornu, J. F. Antinelli, and P. Mallel,
2004. “Determination of volatile compounds to characterize fish
[55] Y. Wang, J.-L. Guo, D. P. Bureau, and Z.-H. Cui, “Replace- spoilage using headspace/mass spectrometry and solid-phase
ment of fish meal by rendered animal protein ingredients in microextraction/gas chromatography/mass spectrometry,”
feeds for cuneate drum (Nibea miichthioides),” Aquaculture, Journal of the Science of Food and Agriculture, vol. 86, no. 4,
vol. 252, no. 2–4, pp. 476–483, 2006. pp. 600–611, 2006.
[56] L. E. Cruz-Suárez, M. Nieto-López, C. Guajardo-Barbosa, [69] P. Gao, W. Wang, Q. Jiang, Y. Xu, and W. Xia, “Effect of
M. Tapia-Salazar, U. Scholz, and D. Ricque-Marie, “Replace- autochthonous starter cultures on the volatile flavour compounds
ment of fish meal with poultry by-product meal in practical of Chinese traditional fermented fish (Suan yu),” International
diets for Litopenaeus vannamei, and digestibility of the tested Journal of Food Science & Technology, vol. 51, no. 7, pp. 1630–
ingredients and diets,” Aquaculture, vol. 272, no. 1–4, pp. 466– 1637, 2016.
476, 2007. [70] H. Mu, Z. Wei, L. Yi et al., “Dietary fishmeal levels affect the
[57] W.-K. Ng, C.-Y. Chong, Y. Wang, and N. Romano, “Effects of volatile compounds in cooked muscle of farmed large yellow
dietary fish and vegetable oils on the growth, tissue fatty acid croaker Larimichthys crocea,” Aquaculture Research, vol. 48,
composition, oxidative stability and vitamin E content of red no. 12, pp. 5821–5834, 2017.
hybrid tilapia and efficacy of using fish oil finishing diets,” [71] A. H. Sherif, M. Y. Gouda, N. A. Naena, and A. H. Ali,
Aquaculture, vol. 372, pp. 97–110, 2013. “Alternate weekly exchanges of feeding regime affect the
[58] T. Ding, N. Xu, Y. Liu et al., “Optimal amounts of coconut oil diversity of intestinal microbiota and immune status of Nile
in diets improve the growth, antioxidant capacity and lipid tilapia Oreochromis niloticus,” Aquaculture Research, vol. 51,
metabolism of large yellow croaker (Larimichthys crocea),” no. 10, pp. 4327–4339, 2020.
Marine Life Science & Technology, vol. 2, pp. 376–385, 2020. [72] X. Zhou, Y. Chong, Y. Ding, S. Gu, and L. Liu, “Determination
[59] A. Apraku, L. Liu, X. Leng, E. J. Rupia, and C. L. Ayisi, of the effects of different washing processes on aroma
“Evaluation of blended virgin coconut oil and fish oil on growth characteristics in silver carp mince by MMSE-GC-MS, e-nose
performance and resistance to streptococcus iniae challenge of and sensory evaluation,” Food Chemistry, vol. 207, pp. 205–
Nile tilapia (Oreochromis niloticus),” Egyptian Journal of Basic 213, 2016.
and Applied Sciences, vol. 4, no. 3, pp. 175–184, 2017. [73] B. C. Jones, M. M. Rocker, R. S. J. Keast et al., “Systematic
[60] H. Xu, Q. Ai, K. Mai et al., “Effects of dietary arachidonic acid review of the odorous volatile compounds that contribute to
on growth performance, survival, immune response and tissue flavour profiles of aquatic animals,” Reviews in Aquaculture,
fatty acid composition of juvenile Japanese seabass, Lateolabrax vol. 14, no. 3, pp. 1418–1477, 2022.
japonicus,” Aquaculture, vol. 307, no. 1-2, pp. 75–82, 2010.
[61] M. Salini, S. Irvin, N. Bourne et al., “Marginal efficiencies of
long chain-polyunsaturated fatty acid use by barramundi
(Lates calcarifer) when fed diets with varying blends of fish oil
and poultry fat,” Aquaculture, vol. 449, pp. 48–57, 2015.
[62] H. Xu, J. Wang, K. Mai et al., “Dietary docosahex-aenoic acid to
eicosapentaenoic acid (DHA/EPA) ratio influenced growth
performance, immune response, stress resistance and tissue
fatty acid composition of juvenile Japanese seabass, Lateolabrax
japo,” Aquaculture Research, vol. 47, pp. 741–757, 2016.
[63] H. Xu, L. Cao, Y. Zhang et al., “Dietary arachidonic acid
differentially regulates the gonadal steroidogenesis in the
marine teleost, tongue sole (Cynoglossus semilaevis), depend-
ing on fish gender and maturation stage,” Aquaculture,
vol. 468, Part 1, pp. 378–385, 2017.
[64] M. J. Salini, G. M. Turchini, and B. D. Glencross, “Effect of
dietary saturated and mono-unsaturated fatty acids in juvenile
barramundi Lates calcarifer,” Aquaculture Nutrition, vol. 23,
no. 2, pp. 264–275, 2017.
[65] D. E. Braga, A. Giombelli, B. G. Botelho, J. Goncalves, and
M. B. A. Gloria, “Feasibility of using free bioactive amines and
amino acids for quality assessment and discrimination of
animal meals,” Animal Feed Science and Technology, vol. 302,
Article ID 115676, 2023.