Annals of Botany 122: 947–959, 2018

doi: 10.1093/aob/mcy094, available online at www.academic.oup.com/aob

Matching symbiotic associations of an endangered orchid to habitat to improve

conservation outcomes
Noushka Reiter1,2,*, Ann C. Lawrie3 and Celeste C. Linde2

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

Royal Botanic Gardens Victoria, Cnr Ballarto Rd and Botanic Drive, Cranbourne, VIC 3977, Australia, 2Ecology and
1

Evolution, Research School of Biology, College of Science, The Australian National University, Canberra, ACT 2601, Australia
and 3School of Science, RMIT University (Bundoora West Campus), PO Box 71, Bundoora, VIC 3083, Australia.
*For correspondence. E-mail [email protected]

Received: 12 March 2017 Returned for revision: 1 February 2018 Editorial decision: 22 March 2018 Accepted: 13 May 2018
Published electronically 12 June 2018

• Background and Aims An understanding of mycorrhizal variation, orchid seed germination temperature and
the effect of co-occurring plant species could be critical for optimizing conservation translocations of endangered
plants with specialized mycorrhizal associations.
• Methods Focusing on the orchid Thelymitra epipactoides, we isolated mycorrhizal fungi from ten plants
within each of three sites; Shallow Sands Woodland (SSW), Damp Heathland (DH) and Coastal Heathland Scrub
(CHS). Twenty-seven fungal isolates were tested for symbiotic germination under three 24 h temperature cycles:
12 °C for 16 h–16 °C for 8 h, 16 °C for 16 h–24 °C for 8 h or 27 °C constant. Fungi were sequenced using the
internal transcribed spacer (ITS), nuclear large subunit 1 (nLSU1), nLSU2 and mitochondrial large rRNA gene
(mtLSU). Orchids were grown to maturity and co-planted with each of ten associated plant species in a glasshouse
experiment with tuber width measured at 12 months after co-planting.
• Key Results Two Tulasnella fungal lineages were isolated and identified by phylogenetic analyses, operational
taxonomic unit 1 (OTU1) and ‘T. asymmetrica’. Fungal lineages were specific to sites and did not co-occur. OTU1
(from the SSW site) germinated seed predominantly at 12–16 °C (typical of autumn–winter temperature) whereas
‘T. asymmetrica’ (from the DH and CHS sites) germinated seed across all three temperature ranges. There was
no difference in the growth of adult orchids germinated with different OTUs. There was a significant reduction in
tuber size of T. epipactoides when co-planted with six of the commonly co-occurring plant species.
• Conclusions We found that orchid fungal lineages and their germination temperature can change with habitat,
and established that translocation sites can be optimized with knowledge of co-occurring plant interactions. For
conservation translocations, particularly under a changing climate, we recommend that plants should be grown
with mycorrhizal fungi tailored to the recipient site.

Key words: Orchidaceae, mycorrhizae, Tulasnella, translocation, Thelymitra epipactoides

INTRODUCTION their range (Johnson and Steiner, 1997). Therefore, conservation

translocations of plants with specialized ecological interactions
Globally, one in five plant species are under threat of extinction require not only a thorough knowledge of the threats and threat
(Pimm et al., 2014; Anderson et al., 2016) from a diversity of management (Vallee, 2004), but also a detailed understanding of
threats such as habitat destruction (Tilman et al., 1994), invasive the ecology (Reiter et al., 2016) of the pollinators (Phillips et al.,
species (Mack et al., 2000), overexploitation (Brook et al., 2008) 2014; Reiter et al., 2017) and mycorrhizal fungal associations
and climate change (Thomas et al., 2004). Human intervention (Batty et al., 2001). Yet specialized ecological interactions are
is required to prevent extinctions, and increasingly conservation rarely specifically addressed in plant conservation translocations
translocations (see definition in IUCNS, 2013, i.e. the deliberate (Reiter et al., 2016). Addressing this gap in both knowledge and
movement of organisms intended to yield a conservation benefit conservation practice has the potential to increase the long-term
at a population, species or ecosystem level) offer the last hope for success of plant translocations.
species’ survival. One possible factor increasing the likelihood The Orchidaceae is a charismatic and diverse plant family with
of extinction is specialization with a partner organism (Harcourt approx. 26 567 species globally (World Checklist of Selected
et al., 2002). Where specialists lose an essential symbiosis from Plant Families, 2017). With high levels of geographic endem-
part of their range, such as pollinators (Robertson et al., 1999; ism and complex relationships with other organisms (Swarts and
Anderson et al., 2011; Pauw and Hawkins, 2011; Reiter et al., Dixon, 2009; Orejuela-Gartner, 2012), it has been predicted that
2017) or mycorrhizal fungi (Shefferson et al., 2005; Swarts many orchids may be among the first to decline when a habitat is
et al., 2010), a range retraction is inevitable. Conversely, general- degraded (Backhouse, 2007). All orchids are reliant on mycor-
ists are more likely to be resilient to losing a symbiotic partner rhizal associations in order to germinate in the wild (Warcup, 1971;
as they may be able to switch to another association in part of

© The Author(s) 2018. Published by Oxford University Press on behalf of the Annals of Botany Company.
All rights reserved. For permissions, please e-mail: [email protected].
948 Reiter et al. — Optimizing mycorrhizae in translocations

Rasmussen, 1995, 2002). However, their level of dependence may conservation are studies that both sequence and test germination
change throughout their life cycle (Rasmussen, 2002; Cameron ability (McCormick et al., 2004; Roche et al., 2010; Smith et al.,
et al., 2006). For example, there is evidence in some species that 2010; Phillips et al., 2011; Linde et al., 2014; Mujica et al., 2016).
dependence on mycorrhizal fungi for nutrition and survival differs In most orchids, we do not know if the mycorrhizal fungi that
between seedlings and mature plants (Waterman and Bidartondo, germinate seed also sustain adult plants. Tests for mycorrhizal
2008), achlorophyllous (Selosse and Roy, 2009) and chlorophyl- compatibility with orchids typically are conducted with seed ger-
lous species (Stöckel et al., 2014). Furthermore, orchids differ in mination studies, where the production of rhizoids or a green leaf
their specificity for mycorrhizal symbionts (Swarts et al., 2010), constitutes a positive interaction (Batty et al., 2001; Roche et al.,

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

which may affect their predisposition to extinction, through limit- 2010; Davis et al., 2015; Phillips et al., 2016). Longer term trials
ing suitable sites at local or regional scales. that compare the efficacy of different fungal species on orchid
Orchids most commonly form mycorrhizal associations with growth with maturation are rare, but showed that OMFs which
fungi belonging to three groups (Tulasnellaceae, Sebacinaceae induced the most seed to germinate were not necessarily those
and Ceratobasidiaceae) of the basidiomycetes (Taylor et al., that resulted in the best survival of orchid seedlings (Rasmussen,
2002; Weiss et al., 2004). The Tulasnellaceae are widespread 1995; Huynh et al., 2009). Furthermore, Smith et al. (2010)
orchid mycorrhizal fungi (OMFs) in both temperate and tropical cautioned that long-term success in orchid survival under field
regions (Dearnaley et al., 2012), and yet their ecology remains conditions may be dependent on highly specific host–fungus
largely unstudied (Selosse and Martos, 2014); but see Fochi interactions that may prove to be significant in the long term.
et al. (2017). Orchids forming mycorrhizal relationships with To date, the surrounding non-orchid flora’s effect on orchid
Tulasnellaceae may form relationships with either a phylogenet- growth, either detrimentally by competing for resources or posi-
ically narrow group of fungi, e.g. Cypripedium spp. (Shefferson tively by providing nutrients or suitable microclimate, is under-
et al., 2005, 2007) or a phylogenetically broad group of fungi explored. If we are to conduct conservation translocations on
(e.g. Tipularia discolor associations; McCormick et al., 2004). species that are reliant upon mycorrhizal fungi for germination
Given their reliance on fungi for germination and in many and to sustain populations in the wild, we require the fungi to be
cases annual growth, the distribution of OMFs could theoret- cultivable, able to germinate the seed and sustain adult plants. We
ically affect the geographic ranges of orchids. Orchids that are need to understand whether these symbiotic associations change
generalists (associating with a phylogenetically broad group of with different habitats and whether the ability of the mycor-
fungi), e.g. Dactylorhiza majalis (Jacquemyn et al., 2012), may rhizal fungi to germinate orchid seed changes under different
have a broad distribution due to less specific niche requirements climatic conditions. Mycorrhizal distribution may be limited
of their fungi. On the other hand, orchids that are specialists may by edaphic conditions, including: soil chemistry, moisture, pH,
have fewer fungal associations, but if the OMFs have a wide geo- organic content and nutrient availability (Perkins and McGee,
graphic distribution, e.g. in Pheladenia deformis (Davis et al., 1995; McCormick et al., 2004; Bunch et al., 2013; McCormick
2015), the orchid’s distribution is not limited by the OMF with and Jacquemyn, 2014). In arbuscular mycorrhiza, the associated
which it associates. Those orchids that have a specific mycor- vegetation or even invasive plant species may affect the mycor-
rhizal relationship, but only associate with fungi that also have rhizal community abundance (Zubek et al., 2016). Therefore,
limited distribution, are likely to be restricted in range (Swarts tests of mycorrhizal symbiosis may benefit not only from the
et al., 2010), though in practice there has been limited evidence evaluation of short-term seed germination but also from longer
for orchid mycorrhiza with restricted ranges. Therefore, high term growth alone and with associated species from the sites
mycorrhizal specificity (i.e. an orchid only forming symbiosis where the orchids occur. We are not aware of any study with
with one or a few lineages of mycorrhizal fungi from a narrow orchids that have utilized pot trials with naturally co-occurring
phylogenetic lineage) is not necessarily associated with orchid plant species to investigate how they affect orchid growth.
rarity. For example, narrow phylogenetic groups of tulasnelloid Here we investigate aspects of mycorrhizal ecology useful
mycorrhizal fungi were found in threatened and common spe- for optimizing germination and conservation translocations.
cies of Drakaea (Phillips et al., 2011, 2014; Linde et al., 2014) We use Thelymitra epipactoides (Orchidaceae), a species pre-
and Chiloglottis (Roche et al., 2010; Linde et al., 2017), but viously widespread across south-eastern mainland Australia, as
because the OMFs are widely distributed (covering the range our study species. Due to habitat destruction, T. epipactoides is
of the entire orchid genus), no impact on species distribution is now endangered under the federal Environment Protection and
expected. It is likely that factors other than OMF specificity and Biodiversity Conservation Act (1999) and is considered a high
distribution impact on orchid distribution, as some rare orchids priority for conservation translocation (Coates et al., 2002). It
such as the highly endemic terrestrial Teagueia morphospecies now has a discontinuous distribution ranging from coastal to
in Ecuador, associate with a Tulasnellaceae OMF that has a near-desert habitats across its range (Jeanes and Backhouse,
worldwide distribution (Suárez et al., 2016). 2006). Thelymitra epipactoides associates with Tulasnella
To be confident that fungi associated with orchids are mycor- asymmetrica based on morphological culture identification
rhizal, it is important to show an effective symbiosis between (Warcup, 1981). In order to optimize germination and conserva-
orchid and fungus. Although direct sequencing from orchid roots tion translocations, we investigate the OMF associations from
and soil allows for a complete picture of those organisms pre- T. epipactoides growing in ecologically and climatically dif-
sent, it does not enlighten us on the ability of these organisms ferent sites. Furthermore, we investigate whether OMFs from
to form an effective mycorrhizal association. Some caution is the different sites differ in their optimum temperature require-
needed in the interpretation of patterns of specificity in previous ments for seed germination. Specifically, we ask the follow-
papers, where the fungi identified have not been tested directly ing questions. (1) Is there habitat-driven variation in Tulasnella
for the ability to form symbioses (see papers cited in the review associated with T. epipactoides? (2) Do Tulasnella operational
of McCormick and Jacquemyn, 2014). More useful for orchid taxonomic units (OTUs) from climatically different sites have
 Reiter et al. — Optimizing mycorrhizae in translocations 949

different temperature requirements for orchid seed germin- verticillata, with a middle storey of Leptospermum conti-
ation? (3) Do symbiotically grown T. epipactoides plants bene- nentale. The understorey included Poa poiformis, Lomandra
fit from co-planting with associated flora? longifolia, Correa reflexa and Dianella brevicaulis. The grass
Rytidosperma occurs at all sites.
MATERIALS AND METHODS

Study species Fungal isolation

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

The genus Thelymitra consists of approx. 110 species, with a In winter, when plants were actively growing, ten plants from
distribution across Australia, New Zealand, Indonesia, New each site had sections of lateral roots above the tubers removed,
Caledonia, New Guinea and the Philippines (Jeanes, 2013). and fungi were isolated from these roots within 4 h of collec-
Thelymitra epipactoides is a summer-dormant herbaceous geo- tion. Roots were gently rubbed by hand and rinsed for 15 min
phyte that survives over summer as an underground tuber. Each in running water before selected regions were surface-steri-
tuber produces a single leaf and a flowering stalk to 18–30 cm lized in 0.05 % NaOCl for 3 min and rinsed with sterile water.
tall with a raceme of between six and 25 flowers (Fig. 1) with a Root tissue was sliced open with a glass blade to release pelo-
metallic lustre coloured pink, bronze, green, blue or red (Jeanes, tons. Pelotons were rinsed in a series of sterile water droplets
2011). The orchid is thought to be food deceptive and polli- (Rasmussen et al., 1990) in a laminar flow cabinet. Individual
nated by native bees (Nomia and Lasioglossum sp.) (Cropper pelotons were plated onto fungal isolation medium (FIM)
and Calder, 1990). (Clements et al., 1986) containing 0.05 g L–1 streptomycin.
Three isolates per plant were grown, of which 32 isolates were
sequenced across all regions.
Sites
Thelymitra epipactoides populations growing in three habi- Fungal sequencing
tats were studied: Shallow Sands Woodland (SSW), Damp
Heathland (DH) and Coastal Heathland Scrub (CHS) (Table 1; Fungal isolates were sub-cultured into 40 mL aliquots of
Fig. 2). All three sites have a Mediterranean climate with cooler liquid oatmeal broth (25 g of rolled oats, boiled, strained
wetter winters and hotter drier summers. These sites represent and made up to 1 L with water) and grown in shake-culture
the range of habitats and climate in which the species is known at 25 °C for 4 weeks. Fungal pellets were removed from the
to occur, with variation in soil types, rainfall and temperature liquid medium, blotted on tissue and DNA was extracted from
between sites. The SSW site is the driest with the most extreme approx. 100 mg of each fungus using a Qiagen Plant DNeasy
temperature ranges, whereas the CHS site is the wettest with the kit according to the manufacturer’s instructions, including the
least temperature range (Table 1; Fig. 2). The SSW vegetation optional centrifugation step (Qiagen, Hilden, Germany), and
is open with an overstorey of Eucalyptus leucoxylon, Callitris elution into 2 × 50 μL instead of 2 × 100 μL.
gracilis and Allocasuarina verticillata, a middle storey of a var- Sequences of four regions [internal transcribed spacer (ITS),
iety of acacias and a diverse understorey of Astroloma, bulbs nuclear large subunit 1 (nLSU1), nLSU2 and mitochondrial
including Arthropodium fimbriatum and Bulbine bulbosa, and large rRNA gene (mtLSU)] were obtained using the primers and
15 orchid species. The DH site is dense and consists predom- thermocycling conditions listed in Table 2. Thirty-two isolates
inantly of Leptospermum continentale and a variety of acacias across all sites were sequenced across all regions: with 13 isolates
with a diverse understorey of Lepidosperma, Stackhousia, from SSH, eight from DH and 11 from CHS sites. For the ini-
Thomasia petalocalyx, Kennedia prostrata and a variety of tial PCR amplifications, each 25 μL reaction contained 12.5 μL
legumes (Fabaceae). The CHS site is dense and consists of of Promega GoTaq Green Master Mix, 8.5 μL of nuclease-free
an overstorey of Melaleuca lanceolata and Allocasuarina water, 1 μL each of forward and reverse primers (10–25 μm) and

A B

Fig. 1. Mature plants of Thelymitra epipactoides grown during this study.

950 Reiter et al. — Optimizing mycorrhizae in translocations

Table 1. Vegetation type, location, number of Thelymitra epipactoides plants sampled across populations, Bureau of Meteorology wea-
ther station number (Australian Government Bureau of Meteorology, 2017), soil type, average annual rainfall, maximum daytime tem-
perature, average temperature and minimum temperature of study sites

Vegetation type Location No. of plants Weather Soil Average annual Maximum daytime Average daytime Minimum
analysed station no. rainfall (mm) temperature temperature temperature

Shallow Sands Kiata Flora and Fauna 10 78015 Deep sand 327.1 46 22.6 –5
Woodland Reserve

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

Damp Heathland Lake Mundi Flora 10 90182 Sandy loam 695.2 44.5 20.1 –3.1
and Fauna Reserve
Coastal Heathland Port Campbell National 10 90015 Clay loam 905.1 43.3 17.3 –1.1
Scrub Park

SOUTH 120 35
AUSTRALIA NEW SOUTH Sydney
100 30
WALES

Temperature (°C)
Adelaide Canberra 25

Rainfall (mm)
80
20
Kiata 60
15
40
Lake VICTORIA 10
Mundi
Melbourne
20 5
Port
0 0
Campbell
100 km
Jan Mar May Jul Sep Nov

120 35 120 35

100 30 100 30
Temperature (°C)

Temperature (°C)
25 25
Rainfall (mm)

Rainfall (mm)

80 80
20 20
60 60
15 15
40 40
10 10
20 5 20 5
0 0 0 0
Jan Mar May Jul Sep Nov Jan Mar May Jul Sep Nov

Mean monthly maximum temperature (°C) Mean monthly minimum temperature (°C)

Fig. 2. Rainfall and temperature for each site from the closest weather stations of the Australian Government Bureau of Meteorology: Nhill for the SSW site (top
right), Casterton for DHS (bottom left) and Cape Otway lighthouse for the CH site (bottom right). Bars = mean monthly rainfall (mm).

2 μL containing 5–20 ng of genomic DNA or sterile nuclease- of 10× buffer, 14 μL of nuclease-free water, 1 μL of Big Dye
free water. After amplification in a G-Storm thermocycler using mix (Version 3.1), 1 μL of the appropriate primer (0.16 μm) and
the PCR conditions in Table 2, a 5 μL aliquot of the products 2 μL of cleaned PCR product (5–20 ng). Cycling parameters
was electrophoresed at 80–100 V alongside a GeneRuler™ were as in Table 2. DNA was precipitated using the Applied
100 bp Plus ladder in a 1.4 % agarose gel either in TBE [Tris- Biosystems ethanol-precipitation protocol 1, and products
borate-EDTA: 10.8 g L–1 Tris base, 5.5 g L–1 boric acid, 4 mL of were electrophoresed and sequenced at Micromon, Monash
0.5 m EDTA pH 8.0] or in TAE (Tris-acetate-EDTA: 4.84 g L–1 University (https://platforms.monash.edu/micromon/).
Tris base, 1.142 g L–1 glacial acetic acid, 2 mL of 0.5 m EDTA
pH 8.0), stained with ethidium bromide and imaged using a Bio-
Rad Gel Doc system with Quantity One software.
Analysis of DNA sequence data
The PCR products were purified using a Qiagen QIAquick
PCR Purification Kit according to the manufacturer’s instruc- Alignments of the four DNA sequence regions were per-
tions. Purified products were sequenced using the BigDye formed in Geneious V10.0.8 (Kearse et al., 2012). A Maximum
Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Likelihood analysis for each individual DNA region, as well
www.thermofisher.com). Each 20 μL reaction contained: 2 μL as a concatenated four-region alignment, was run in RAxML
 Reiter et al. — Optimizing mycorrhizae in translocations 951

(Stamatakis et al., 2008) through Geneious with 1000 bootstrap

Bruns Lab (http://nature.berkeley.edu/

Bruns Lab (http://nature.berkeley.edu/

replicates. Furthermore, a Bayesian analysis was run in MrBayes
3.2.2 (Ronquist et al., 2012), also through Geneious. Analyses

ITS, nuclear ribosomal internal transcribed spacer region; nLSU1, nuclear large subunit (28S) region 1; nLSU2, nuclear large subunit (28S) region 2; and MtLSU, mitochondrial large RNA gene
were run for 2 million generations (first 25 % discarded as burn-in,

brunslab/tour/primers.htm)

brunslab/tour/primers.htm)

Applied Biosystems (www.

Markov chain sampled every 1000 generations) with four chains,
using the GTR + G model. Although trees were rooted to T. albida,

thermofisher.com)
trees were later visualized and midpoint rooted in Figtree v 1.4

White et al. (1990)

White et al. (1990)
(Rambaut and Drummond, 2012). Convergence was considered to

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

be sufficient if the s.d. of the split frequencies was <0.02.
References

The maximum level of sequence divergence at the ITS was

calculated within a putative species using Geneious V10.0.8
(Kearse et al., 2012). To establish the level of divergence within
species, minimum and maximum sequence divergences within a
Final extension

clade were calculated. Also, the maximum sequence divergence

72 °C (10 min)

72 °C (10 min)
72 °C (10 min)

72 °C (10 min)

within a species was compared with the minimum genetic diver-

gence with any of the individuals in the sister clade. Closely
–

related sequences from GenBank were included in Figs 3 and 4.

Table 2. Primers and cycling conditions used for fungal DNA analysis

72 °C (2 min)

72 °C (2 min)

72 °C (1 min)

60 °C (4 min)
72°C (1 min)

Symbiotic germination: general methods

Extension

Seed collected from 7–10 hand-pollinated T. epipactoides

individuals from each of the above three sites was combined
and thoroughly mixed, air-dried and stored with dried silica
49 °C (1 min)

50 °C (1 min)

crystals at 4 °C for up to 6 months for use in symbiotic seed

51 °C (30 s)
51 °C (30 s)

50 °C (5 s)
Annealing

germination tests. Seeds were surface-sterilized with 0.5 %

NaOCl (10 % Domestos®) for 3 min, drained by vacuum onto a
3 μm pore filter, rinsed with sterile water and plated onto ster-
Cycling parameters

ile filter paper on plates of oatmeal agar (OMA) (Clements and

94 °C (1 min)

94 °C (1 min)

Ellyard, 1979) with 2 g L–1 sucrose and 0.1 g L–1 yeast extract in
Denaturation

94 °C (30 s)

96 °C (10 s)
94 °C (30 s)

a laminar flow cabinet. A 1 cm OMA agar block colonized with

an isolated fungus was placed on two ends of the filter paper.
Plates were sealed with Parafilm® and incubated in the dark.
No. of
cycles

Symbiotic germination temperature trial

35

35

25
35

35

Sequencing results confirmed only two fungal OTUs, with

94 °C (10 min)

94 °C (10 min)
94 °C (10 min)

94 °C (10 min)

only one OTU isolated at any given site. To test if temperature

denaturation

affected germination in OTU1 and ‘T. asymmetrica’, 27 fungal

–

isolates (nine isolates from the SSW pertaining to OTU1, and 18

Initial

isolates pertaining to ‘T. asymmetrica’ which included nine iso-

lates from each of the DH and CHS sites) were tested for sym-
biotic germination under three temperature cycles: 12 °C for 16
ML5: (CTCGGCAAATTATCCTCATAAG)
ML6: (CAGTAGAAGCTGCATAGGGTC)
TW14: (GCTATCCTGAGGGAAACTTC)

h–16 °C for 8 h, 16 °C for 16 h–24 °C for 8 h, or 27 °C constant.

CTW13: (CGTCTTGAAACACGGACC)

ITS4/ML6/CTB6/TW13/CTW13/TW14
ITS1: (TCCGTAGGTGAACCTGCGG)
ITS4: (TCCTCCGCTTATTGATATGC)

TW13: (GGTCCGTGTTTCAAGACG)
Ctb6: (GCATATCAATAAGCGGAGG)

There were three replicated germination plates per fungal iso-

late per temperature treatment [thus a minimum of 27 replicates
were tested of OTU1 (SSW) and 54 replicates for ‘T. asym-
metrica’ (DH and CHS)]. Germination was scored as the pres-
ence or absence on the production of leaf primordia (Stage 5 of
Warcup, 1981).
Primers (5’–3’)

Symbiotic germination effect of fungal OTU on growth of adult

plants
To test the effect of site of isolation of fungi and the effect
of fungal OTU on growth of adult plants, germinated seed-
PCR region/

Sequencing

lings from the above trial were flasked using the methods of
MtLSU
nLSU1

nLSU2

Reiter et al. (2016), and grown for a further 8 weeks before

type

ITS

de-flasking. We de-flasked 35 T. epipactoides germinated with

952 Reiter et al. — Optimizing mycorrhizae in translocations

KC928365_Tulasnella sp. tiro29

0.99/83 KC291644 Tulasnella sp. HJ16JG
0.99/91 GU166420 Tulasnella sp. C3-DT-TC-1
GU166427 Tulasnella sp. C2-DT-TC-1
GU166428 Tulasnella sp. C1-DT-TC-1
AL.K10.1 Shallow Sands Woodland
AL.K10.5 Shallow Sands Woodland
0.93/ AL.K12.9 Shallow Sands Woodland
AL.K14.1 Shallow Sands Woodland
AL.K14.5 Shallow Sands Woodland
ALK14.10 Shallow Sands Woodland
ALK14.8 Shallow Sands Woodland OTU1

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

0.81/ ALKSE1.7 Shallow Sands Woodland
1/100 ALKSE2.2 Shallow Sands Woodland
0.81/
ALKSE2.8.2 Shallow Sands Woodland
ALKSE2.9 Shallow Sands Woodland
ALKSE3.5 Shallow Sands Woodland
ALKSE4.3 Shallow Sands Woodland
1/98 GU166405 Tulasnella sp. from Paphiopedium villosum Pv-Qs-0-2
1/98 GU166426 Tulasnella sp. Dfr-Qs-3-1
1/100 HM230648 from Cymbidium kanran
KC152334 (Tulasnella sp. ECU 4) DC271 C001
1/100 KC152378 T. albida
0.90/ KC152379 T. albida
0.85/94 KC152364 T. cf. pinicola DC309 C010
1/ DQ457642 T. pruinosa AFTOL 610
KC152376 (Tulasnella sp. ECU 3) DC157 C004
AL.LM3.5.1 Damp Heathland
AL.LM3.5.2 Damp Heathland
1/100 AL.LM3.6 Damp Heathland
AL.LM7.3 Damp Heathland
AL.PC7.2 Coastal Healthland Scrub
AL.PC7.5 Coastal Healthland Scrub
AL.PC8.1 Coastal Healthland Scrub
AL.PC8.2 Coastal Healthland Scrub
AL.PC10.4.1 Coastal Healthland Scrub
AL.PC10.5 Coastal Healthland Scrub
AL.PC10.6 Coastal Healthland Scrub ‘Tulasnella asymmetrica’
AL.PC10.10 Coastal Healthland Scrub
DQ368048 ‘T. asymmetrica’ MAFF P305809 from T. epipactoides
KC152350 ‘T. asymmetrica’ MAFF305809 C003
KC152354 ‘T. asymmetrica’ MAFF305809 C001
DQ368047 ‘T. asymmetrica’ MAFF305808
KC152356 ‘T. asymmetrica’ MAFF 305808 C001
AL.LM4.4.1 Damp Heathland
ALLM5.5.1 Damp Heathland
AL.LM9.7.1 Damp Heathland
1/97 AL.LM9.8.1 Damp Heathland
AL.PC3.8 Coastal Haalhland Scrub
AL.PC3.9 Coastal Haalhland Scrub
KC152347 ‘T. asymmetrica’ MAFF305808 C002
KC152348 ‘T. asymmetrica’ MAFF305808 C005
DQ388046 Tulasnella asymmetrica MAFF P305806
1/100 KC152339 Tulasnella asymmetrica MAFF305806 C001
KC152343 Tulasnella asymmetrica MAFF305806 C005
KC152340 Tulasnella asymmetrica MAFF305806 C002
KC152341 Tulasnella asymmetrica MAFF305806 C003
0.02

Fig. 3. Phylogenetic tree for the ITS region of Tulasnella isolates from the Shallow Sands Woodland, Damp Sands Heathland and Coastal Heathland sites. The
sequences clustered into two well-supported (bootstrap = 100 %) OTUs (‘Tulasnella asymmetrica’ and OTU1), based on a 5 % sequence divergence cut-off (Linde
et al., 2014, 2017). Warcup’s (1981) isolates of T. asymmetrica were separated into T. asymmetrica and ‘T. asymmetrica’ based on phylogenetic divergence (Cruz
et al., 2014). We have kept this separation and refer to ‘T. asymmetrica’ in the text. GenBank numbers are listed in Supplementary Data Table S3.

OTU1 from the SSW site and 70 T. epipactoides germinated and thus were also able to be used as controls in the co-plant-
with ‘T. asymmetrica’, 35 from each of the DH and CHS sites. ing experiment.
Each seedling was de-flasked into Bio Gro Terrestrial Orchid
Conservation Mix in 12 inch diameter plastic pots (one plant Co-planting with associated flora
per pot) and watered in the glasshouse as required. We meas-
ured the diameter of the tuber of adult plants (12 months after We conducted a controlled glasshouse experiment with ten spe-
deflasking) at the widest point as our growth measurement cies of plant that were selected on the basis of co-occurring with
(plants lose there leaves annually so leaf measurements are T. epipactoides. The plants consisted of three species that naturally
not ideal). Thus symbiotically germinated T. epipactoides occurred at the SSW site, six species that naturally occurred at the
with fungi from the SSW as well as fungi from DH and DH and CHS sites, and one species, Rytidosperma caespitosum,
CHS, were compared with a one-way analysis of variance that occurred at all sites. The number of co-occurring plants avail-
(ANOVA) using the Analysis ToolPak, Microsoft Excel 2013. able to use of each species varied between 12 and 64 (Table 3).
Potted plants were randomized in their positioning on benches Seedlings from the above T. epipactoides germination trial ger-
throughout the glasshouse amongst the below co-planting trial minated with either OTU1 (SSW) or ‘T. asymmetrica’ (DH and
 Reiter et al. — Optimizing mycorrhizae in translocations 953

KC152340 Tulasnella asymmetrica MAFF305806 C002

KC152341 Tulasnella asymmetrica MAFF305806 C002
DQ388046 Tulasnella asymmetrica MAFF P305806
KC152339 Tulasnella asymmetrica MAFF305806 C001
KC152343 Tulasnella asymmetrica MAFF305806 C005
KC928365_ Tulasnella sp. tiro29
1/100 KC152378 T. albida
KC152379 T. albida
1/94 KC152364 T. cf. pinicola DC309 C010
0.82/ DQ457642 T. pruinosa AFTOL 610
KC152376 (Tulasnella sp. ECU 3) DC157 C004
KC291644 Tulasnella sp. HJ16JG

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

1/100
1/98 GU166420 Tulasnella sp. C3-DT-TC-1
GU166427 Tulasnella sp. C2-DT-TC-1
GU166428 Tulasnella sp. C1-DT-TC-1
AL.K10.1 Shallow Sands Woodland
AL.K10.5 Shallow Sands Woodland
0.95/ AL.K12.9 Shallow Sands Woodland
AL.K14.1 Shallow Sands Woodland
AL.K14.5 Shallow Sands Woodland
AL.K14.8 Shallow Sands Woodland
AL.K14.10 Shallow Sands Woodland
ALKSE1.7 Shallow Sands Woodland
1/100 ALKSE2.2 Shallow Sands Woodland
AL.KSE2.8.2 Shallow Sands Woodland
AL.KSE2.9 Shallow Sands Woodland
AL.KSE3.5 Shallow Sands Woodland
AL.KSE4.3 Shallow Sands Woodland
1/97 GU166405 Tulasnella sp. from Paphiopedium villosum Pv-Qs-0-2
1/98 GU166426 Tulasnella sp. Dfr-Qs-3-1
1/100 HM230648 from Cymbidium kanran
KC152334 (Tulasnella sp. ECU 4) DC271 C001
AL.LM3.5.1 Damp Heathland
1/100 AL.LM3.5.2 Damp Heathland
AL.LM3.6 Damp Heathland
AL.LM7.3 Damp Heathland
AL.PC7.2 Coastal Heathland Scrub
AL.PC7.5 Coastal Heathland Scrub
AL.PC8.1 Coastal Heathland Scrub
AL.PC8.2 Coastal Heathland Scrub
AL.PC10.4.1 Coastal Heathland Scrub
AL.PC10.5 Coastal Heathland Scrub
AL.PC10.6 Coastal Heathland Scrub
AL.PC10.10 Coastal Heathland Scrub
DQ388048 ‘T. asymmetrica’ MAFF P305809 from T. epipactoides
KC15235O ‘T. asymmetrica’ MAFF305809 C003
KC152354 ‘T. asymmetrica’ MAFF305809 C001
DQ388047 ‘T. asymmetrica’ MAFF P305808
KC152356 ‘T. asymmetrica’ MAFF305809 C001
AL.LM4.4.1 Damp Heathland
AL.LM5.5.1 Damp Heathland
AL.LM9.7.1 Damp Heathland
AL.LM9.8.1 Damp Heathland
1/100 AL.PC3.6 Coastal Heathland Scrub
AL.PC3.6 Coastal Heathland Scrub
KC152347 ‘T. asymmetrica’ MAFF305808 C002
KC152348 ‘T. asymmetrica’ MAFF305808 C005

0.03

Fig. 4. Concatenated phylogenetic tree for the ITS, nLSU1, nLSU2 and mtLSU region of Tulasnella isolates from the Shallow Sands Woodland, Damp Sands
Heathland and Coastal Heathland sites. The sequences clustered into two well-supported (bootstrap = 100 %) OTUs (‘Tulasnella asymmetrica’ and OTU1), based
on a 5 % sequence divergence cut-off (Linde et al., 2014, 2017). Warcup’s (1981) isolates of T. asymmetrica were separated into T. asymmetrica and ‘T. asymmet-
rica’ based on phylogenetic divergence (Cruz et al., 2014). We have kept this separation and refer to ‘T. asymmetrica’ as such in the text. Data are available from
the Dryad Digital Repository: https://doi.org/10.5061/dryad.7sb22cb

CHS) were used for the co-planting experiments. Thus each pot Potting was in winter while the orchid was actively grow-
had one orchid seedling, grown with one fungal species, and one ing. Seedlings were potted into Bio Gro Terrestrial Orchid
co-occurring plant species (Table 3). Plants naturally occurring Conservation Mix in 12 inch diameter plastic pots. Pots were
at the SSW site were co-planted with T. epipactoides grown with randomized across glasshouse benches and incubated in a tem-
OTU1, plants naturally occurring at the DH and CHS were co- perature-controlled glasshouse with 12 °C night and 25 °C day
planted with T. epipactoides grown with ‘T. asymmetrica’, and temperatures. Plants received natural light and were watered as
R. caespitosum which occurs across all three sites received in sep- required for 12 months. After 12 months of co-planting, tuber
arate pots T. epipactoides grown with either OTU1 or ‘T. asym- width (at the largest dimensions) of each orchid was measured.
metrica’. This experiment was conducted at the same time as Results were analysed using a one-way ANOVA; subsequently
the effect of fungal OTU experiment, allowing the potted plants a two-tailed t-test assuming unequal variance was performed to
grown with either OTU1 or ‘T. asymmetrica’ alone (without co- compare each pair of means (e.g. the respective T. epipactoides
plants) to be used as controls. OTU without co-planted species control group mean compared
954 Reiter et al. — Optimizing mycorrhizae in translocations

Table 3. Species co-planted with Thelymitra epipactoides

Species co-planted with Thelymitra Shallow Sands Damp Coastal OTU used Replicates
epipactoides Woodland Heathland Heathland Scrub per OTU

Acacia euthycarpa (J.M.Black) J.M.Black * 1 12

Allocasuarina verticillata (Lam.) * 1 26
L.A.S.Johnson
Rytidosperma caespitosuma * * * 1, ‘T. asymmetrica’ 28, 64
Callitris gracilis R.T.Baker * 1 12

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

Kennedia prostrata R.Br. * ‘T. asymmetrica’ 32
Leptospermum continentale Joy Thomps. * * ‘T. asymmetrica’ 54
Lomandra longifolia Labill. * ‘T. asymmetrica’ 32
Poa poiformis (Labill.) Druce * ‘T. asymmetrica’ 30
Pultenaea canaliculata F.Muell. * ‘T. asymmetrica’ 29
Thomasia petalocalyx F.Muell. * ‘T. asymmetrica’ 21

*Site of mycorrhizal isolates co-planted, OTU used and replicates per OTU. Includes nine isolates from the SSW relating to OTU1, and 18 isolates from the
DH and CHS relating to ‘T. asymmetrica’.
a
Rytidosperma caespitosum (Gaudich.) Connor & Edgar was the only species to occur commonly across all three sites and was therefore the only species to be
tested with both OTU1 and ‘T. asymmetrica’.

with that of T. epipactoides OTU with specific co-planted species Do OTUs germinate orchid seed under different temperatures?
group mean) using the Analysis ToolPak, Microsoft Excel 2013.
Symbiotic germination was successful at one or more tem-
peratures with the majority of the 27 isolates tested. The num-
RESULTS ber of plates showing germination was significantly affected by
temperature (ANOVA, F = 6.76, P = 0.001). Tulasnella isolated
Is there habitat-driven variation in Tulasnella associated with from orchids in SSW (OTU1) germinated seed at the lower
T. epipactoides? tested temperature cycles (12–16 °C and 16–24 °C) (Table 4).
‘Tulasnella asymmetrica’ from DH and CHS germinated seed
Thirty-one Tulasnella isolates were successfully sequenced at all three temperature ranges (Table 4).
across all four regions. For the nLSU1 region, all fungi had
amplicons of about 650 bp. For the nLSU2 region, all fungi had
amplicons of about 350 bp. The DH and CHS isolates had mito- Symbiotic germination effect of fungal OTU on growth of adult
chondrial amplicons about 100 bp larger than those from SSW. plants
This was due to an insert at the 3’ end that was removed for the
We found no effect of fungal OTU on growth of adult plants.
alignment and so had no influence on the relationships shown.
There was no significant difference in tuber size between mature
Isolate ALPC3.4 was sequenced but not included in the trees
orchids when comparing sites of OTU isolation (SSW, DH and
because it had a short sequence (non-overlapping ITS1 and 4).
CHS) on growth (ANOVA, F = 3.08, P = 0.652). There was
The ITS sequences formed two well-supported (boot-
no significant difference in tuber size between mature orchids
strap = 100 %) OTUs, based on a 5 % sequence divergence
grown with isolates of OTU1 (SSW) or ‘T. asymmetrica’ (DH
cut-off (Linde et al., 2014, 2017) (Fig. 3; Supplementary Data
and CHS) (ANOVA, F = 0.428, P = 0.652) when planted with-
Table S2). A similar topology and clustering resulted for nLSU
out associated flora.
and mtLSU regions (data not shown). Consequently, a phylo-
genetic tree representing a concatenated data set is presented
(Fig. 4). In all trees, sequences representing isolates from DH Do symbiotically grown T. epipactoides plants benefit from
and CHS clustered together (Figs 3 and 4). Warcup’s (1981)
co-planting with associated flora?
isolates of T. asymmetrica were separated into T. asymmetrica
and ‘T. asymmetrica’ based on phylogenetic divergence (Cruz Tuber size of T. epipactoides co-planted with associated
et al., 2014). We have kept this separation and refer to ‘T. asym- plant species was significantly different between treatments
metrica’ as such throughout this manuscript. Furthermore, (ANOVA, F = 5.374, P < 0.001). Six associated species:
these sequences [including seven reference sequences from Rytidosperma caespitosum, Kennedia prostrata, Pultenaea
GenBank, suggested as ‘T. asymmetrica’ (Cruz et al., 2014)], canaliculata, Poa poiformis, Leptospermum continentale
showed <3 % sequence divergence and therefore were consid- and Thomasia petalocalyx co-planted with T. epipactoides
ered ‘T. asymmetrica’ (Fig. 3; Supplementary Data Table S2). grown with ‘T. asymmetrica’ isolates had a significant
Sequences of isolates from SSW clustered into a unique, well- (P < 0.005) detrimental effect on the tuber size of T. epi-
supported OTU (OTU1), with no close match to any GenBank pactoides compared with those grown without companion
sequence. All isolates from T. epipactoides clearly separated plants (Supplementary Data Table S1). Co-planting with
into two clades representing two fungal OTUs separated accord- R. caespitosum resulted in significantly (P < 0.05) smaller
ing to habitat, with isolates from the SSW pertaining to OTU1 tuber widths of T. epipactoides when orchid seed was grown
and those from the DH and CHS pertaining to ‘T. asymmetrica’. with ‘T. asymmetrica’ compared with seed grown with OTU1
 Reiter et al. — Optimizing mycorrhizae in translocations 955

Table 4. Germination as a percentage of plates that germinated T. epipactoides seed to stage 5 with 27 isolates (nine from OTU1 and
18 from ‘T. asymmetrica’) under three temperatures

Vegetation community OTU No. of isolates Germination %

Low (12–16 °C) Medium (16–24 °C) High (27 °C)

Shallow Sands Woodland 1 9 66.6 % (n = 27 plates) 22.2 % (n = 27 plates) 0 % (n = 27 plates)

Damp Heathland and Coastal Heathland Scrub ‘T. asymmetrica’ 18 77.7 % (n = 54 plates) 83.3 % (n = 54 plates) 66.6 % (n = 54 plates)

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

Acacia OTU1
Allocasuarina OTU1
Rytidosperma ‘T. asymmetrica’*
Rytidosperma OTU1
Callitris OTU1
Kennedia ‘T. asymmetrica’*
Leptospermum ‘T. asymmetrica’*
Lomandra ‘T. asymmetrica’*
Poa ‘T. asymmetrica’*
Pultenaea ‘T. asymmetrica’*
Thomasia ‘T. asymmetrica’*
No companion plant ‘T. asymmetrica’*
No companion plant OTU1

1 2 3 4 5 6 7

Mean tuber width (mm) with 95 % Cl

Fig. 5. Mean tuber width of seedlings of T. epipactoides grown with either fungus OTU1 or fungus ‘T. asymmetrica’, co-planted with co-occurring plant species
after12 months in a pot trial against control without co-planted species. Lines represent the 95 % confidence interval calculated for each individual treatment.
Significant differences (P ≤ 0.05) between control and co-occurring plant treatments are indicated by asterisks.

(Supplementary Data Table S1). Thelymitra epipactoides show that a terrestrial orchid has different optimal germination
tuber size germinated with fungal OTU1 and subsequently temperatures depending on the OMF species present.
grown by co-planting with associated plant species from the
OTU1 site (SSW) (Fig. 5) did not differ significantly from Is there ecologically driven variation in Tulasnella associated with
control tubers grown without any co-plants. T. epipactoides?
Fungi isolated from T. epipactoides were tulasnelloid, as
DISCUSSION expected from a previous study on Thelymitra species in south-
eastern Australia by Warcup (1981). Warcup (1981) isolated
Highlights
79 Tulasnella strains from 15 of the then 35 Thelymitra spe-
This study provides clear evidence for two tulasnelloid OMFs cies (Thelymitra was revised by Jeanes, 2002) showing that
associated with T. epipactoides. These two tulasnelloid fungi Thelymitra associated with seven species of Tulasnella, namely
were not detected to co-occur at the same sites within pelo- T. calospora, T. asymmetrica, T. cruciata, T. irregularis,
tons isolated from T. epipactoides roots and were found in T. violea, T. alantospora and an undescribed species.
different habitats. Tulasnella OTU1 occurs in the drier SSW The ITS region provides species delineation in Tulasnella
site while ‘T. asymmetrica’ occurs in the wetter DH and CHS that is equivalent to that from multiple nuclear and mitochon-
sites. In addition, this is the first study to grow orchid seed to drial sequences (Cruz et al., 2011; Linde et al., 2014). The
adult plants to test fitness differences with the use of different research presented here supports this conclusion, as sequences
OMFs. However, the two OTUs tested did not result in differ- from the nLSU (28S) and mitochondrial ribosomes supported
ences in orchid tuber widths in adult plants. This study shows the same phylogenetic pattern as with the ITS region. All the
that the growth (measured by tuber width) of T. epipactoides Tulasnella fungi isolated in this study grouped into two distinct
germinated with OTU1 and ‘T. asymmetrica’, was significantly OTUs. One of the OTUs (OTU1) was only isolated from the
(P < 0.005) reduced when co-planted with five of ten tested SSW site, whereas isolates identified as ‘T. asymmetrica’ were
co-occurring plant species compared with controls without co- obtained from the DH and CHS sites. Warcup’s (1981) isolates
occurring plant species. Furthermore, this study is the first to from Australian Thelymitra species named as T. asymmetrica,
956 Reiter et al. — Optimizing mycorrhizae in translocations

were separated into T. asymmetrica and ‘T. asymmetrica’ based (McCormick et al., 2006). Kartzinel et al. (2013) found that a
on phylogenetic divergence (Cruz et al., 2014). We show that decrease in seasonal precipitation correlated with a decrease in
‘T. asymmetrica’ and a new, but related lineage (OTU1), are diversity of the Tullasnellaceae in a tropical epiphytic orchid.
associated with T. epipactoides. The percentage sequence diver- Similarly, Phillips et al. (2016) found that OTUs of Sebacina
gence between ‘T. asymmetrica’ and OTU1 in the ITS region, associated with Caladenia stem-collars varied across soil
exceeded a 5 % cut-off, as suggested from other Tulasnella types and rainfall in South West Australia Bio regions, with
studies (Linde et al., 2014, 2017). The maximum sequence the Northern Wheatbelt only showing one Sebacina OTU and
divergence within each of OTU1 and ‘T. asymmetrica’ is <3 the Swan Coastal Plain (wetter than the Northern Wheatbelt)

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

%, in line with the arbitrary figure of 97 % similarity for an a larger diversity with six OTUs present (although sampling
OTU (McCormick et al., 2006; Nilsson et al., 2008; Peay et al., across each region was limited). Additionally, decreases in
2008) used by others (Roche et al., 2010; Jacquemyn et al., soil P and N decreased OTU richness from Bipinnula species
2011; Kartzinel et al., 2013; Pandey et al., 2013). in Chile (Mujica et al., 2016). The above findings suggest that
The two Tulasnella symbionts found in this study did not co- some fungal OTUs are adapted to different environmental con-
occur at any of the three sites in the root samples, with OTU1 ditions. It is also possible that the mycorrhizal fungi are adapted
only detected in the SSW site (dry – forest), while ‘T. asym- to different habitats (Oja et al., 2015; Jacquemyn et al., 2016;
metrica’ was found at sites DH and CHS (wetter – heath- Ruibal et al., 2017), though habitat and environmental condi-
land). There are three possible explanations for the apparent tions are difficult to tease apart. In the SSW habitat, which has
habitat-driven switch of Tulasnella symbionts. The first is that more stressful environmental conditions (for fungi), it is likely
a reduced suite of tulasnelloid fungi is present in each type of that these limitations on available compatible fungi resulted in
habitat; all may have been present initially but some may have the orchids forming mycorrhiza with an available fungus differ-
declined due to intolerance of drier conditions or a decline in, ent from that at the more mesic near-coastal sites.
or competition for, available resources for saprophytic growth The presence of two OTUs of Tulasnella forming effect-
(Brundrett et al., 2003; Mehra et al., 2017). This would sug- ive mycorrhizal associations in climatically different sites
gest that fungal ecological specificity (Perkins and McGee, of T. epipactoides is not surprising given the formerly wide-
1995) is the over-riding determinant of which fungi the orchid spread distribution of this endangered species. This is con-
encounters and then orchid phylogeny determines whether or trary to the hypothesis that threatened orchids have greater
not a symbiosis is possible, rather than absolute specificity mycorrhizal specificity than common orchids and become
(Curtis, 1939). The second is that the entire suite of tulasnelloid rare because their compatible fungi are restricted geo-
fungi is present, but the orchid preferentially forms mycorrhizal graphically (Swarts et al., 2010). It also contrasts with high
symbioses with only one of the fungi depending on the envir- fungal specificity in all the Drakaea (Tulasnella secunda)
onment, as shown in Goodyera pubescens (McCormick et al., (Phillips et al., 2011), Caleana (T. secunda) (Linde et al.,
2006), which switch fungal associations in drought years. In 2014) and Chiloglottis (Tulasnella prima and T. sphagneti)
other studies, Cypripedium acaule had a broad association species, which are mostly common (Linde et al., 2017).
between soil chemistry, elevation and root-associated fungi Furthermore, the rare Diuris fragrantissima was shown
(Bunch et al., 2013) and Bipinnula species, which have soil to associate with a range of closely related Tulasnella
nutrients modulating mycorrhizal associations (Mujica et al., OTUs (Smith et al., 2010), and several OTUs have been
2016). A third possibility is that the orchid forms mycorrhizal found in some rare (Kartzinel et al., 2013; Pandey et al.,
associations predominantly with different fungi as it matures 2013) and locally endemic orchids (Suárez et al., 2016).
(McCormick et al., 2004; Otero et al., 2005; Bidartondo and Therefore, we suggest that mycorrhizal specificity in T. epi-
Read, 2008). This is deemed unlikely as all orchids sampled pactoides does not cause orchid rarity. The germination of
were mature and seeds germinated equally with the fungi from Tipularia discolor only in the presence of wood colonized
mature plants from each site. All tested fungi were also able to by specific fungi at a limited range of decomposition stages
maintain the orchids in pot trials to 18 months maturity. In other (McCormick et al., 2004) suggests that substrate and nutri-
studies, with Tulasnella, Phillips et al. (2011) found the same tion are important for determining the distribution of orchid
fungi in mature orchids, seedlings and protocorms, whereas mycorrhizae. It is thus feasible that fungal ecology (tem-
McCormick et al. (2004) found fungal diversity to be greater in perature, habitat, nutrient or pH requirements) may drive
adult plants than in protocorms. the differences in mycorrhizal fungi isolated from the three
Thelymitra epipactoides at the SSW site are exposed to lower study sites of T. epipactoides.
rainfall, higher temperatures (Table 1; Fig. 1) and fewer nutri-
ents (Grundy et al., 2015) than at the two mesic sites. Thelymitra
epipactoides has a predominantly coastal distribution, and Do Tulasnella OTUs have different temperature requirements for
either expansion inland from the more mesic sites or remaining
orchid germination?
in these relict sites from a wetter time period may have been
possible only because of the ability to form mycorrhiza with The isolates from the hotter, drier SSW site (OTU1) sup-
fungi that could also survive there, as discussed for tropical epi- ported germination only at cooler temperatures (12–16 °C and
phytes (Martos et al., 2012). As conditions become less mesic 16–24 °C) and not at all under the higher temperature conditions
(Hughes, 2003), it is likely that the range of fungi available (27 °C). In contrast, ‘T. asymmetrica’, which was only present
to the orchid changes due to ‘environmental filtering’ (Kraft in the more mesic sites, supported germination at all tested tem-
et al., 2015). Drought is suggested to have induced a switch peratures (Table 4). These temperature ranges coincide best with
in Tulasnella symbionts associated with Goodyera pubescens temperatures when the majority of the precipitation is expected
 Reiter et al. — Optimizing mycorrhizae in translocations 957

at each site. The SSW site is characterized by extreme tempera- examples of subtle interactions that affect long-term success
tures regularly well in excess of 40 °C over the summer months, in orchid conservation in the wild (Smith et al., 2010). Further
and is dry on average with only 400 mm of rainfall annually investigation of the effects of different OTUs may support
(Australian Government Bureau of Meteorology, 2017), with these observations.
the greatest rainfall occurring in the cool wet winter. Thus, it is
beneficial for orchid seed to germinate at winter temperatures,
with seed germinated in summer unlikely to survive during the Conservation implications
hot, dry summer conditions. At the mesic sites (DH and CHS),

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

the cooler temperatures and greater coastal rainfall throughout ‘Tulasnella asymmetrica’ is globally distributed (Cruz et al.,
the year may be more conducive to survival after germination, 2016), and many orchid mycorrhizal fungi are more widely
throughout the year. distributed than the orchids with which they form symbiotic
Temperature can affect plant fungal symbiosis (Staddon associations (Waud et al., 2017). Our results support previ-
et al., 2002; Kivlin et al., 2013) and has been shown to affect ous research suggesting that mycorrhizal specificity is not the
arbuscular mycorrhizal performance (Gavito et al., 2003). Seed driving force for rarity in some orchids (Phillips et al., 2011;
from higher elevation locations often germinate at higher tem- Kartzinel et al., 2013; Pandey et al., 2013).
peratures (Cavieres and Arroyo, 2000), though this is not con- There are three important conservation translocation con-
sistent among species. Optimal germination temperatures may siderations arising from this research: (1) with more than one
vary not only with altitude but also with other factors including species of mycorrhizal fungi able to germinate seed, it may be
light, seed batch and water (Giménez-Benavides et al., 2005; beneficial to introduce multiple fungal species in a conservation
Bauk et al., 2016). While there are no orchid mycorrhizal rela- translocation; (2) alternatively, with differences in orchid ger-
tionships currently reported that are temperature dependent, this mination temperatures between OMFs, the OMF has to be site
study suggests that high temperatures affect the ability of OTU1 matched to avoid recruitment losses; and (3) associated plants
to germinate T. epipactoides, with no germination seen at 27 °C. in a site may be detrimental to the growth of an orchid and need
The high (60–80 %) percentages of T. epipactoides plates to be taken into consideration when selecting sites for conser-
that germinated with the optimal combination of fungi and tem- vation translocation at the microhabitat level.
perature emphasizes that both OTUs were highly effective in
germinating seed. Other germination trials with closely related
tulasnelloid fungi isolated from Drakaea, Chiloglottis and SUPPLEMENTARY DATA
Diuris species (Roche et al., 2010; Smith et al., 2010; Phillips Supplementary data are available online at https://academic.
et al., 2011) had relatively low germination success (42, 23 and oup.com/aob and consist of the following. Table S1: summary
30 %, respectively). Those germination trials were only con- of significance values from two-sample t-tests. Table S2: pair-
ducted at one constant temperature. It is possible that varying wise minimum and maximum sequence divergences (percent-
conditions might have increased germination, as suggested age) between Tulasnella clades.
elsewhere (Phillips et al., 2011).

ACKNOWLEDGEMENTS
Do symbiotically grown T. epipactoides plants benefit from We thank the following people for assistance: Wendy Bedggood,
co-planting with associated flora? Mary Argall, David Pitts, Ash Burns, Richard Thomson, the
Australasian Native Orchid Society (Victorian Branch), the
There was no benefit from co-planting with any of the spe-
Horsham Secondary College students, and Ryan Phillips for
cies that were tested, suggesting the absence of any bene-
providing feedback on a draft manuscript. This work was sup-
fit by providing a suitable microsite for the Tulasnella. The
ported by the Australian Orchid Foundation (grant no. 273)
detrimental results due to co-planting with five of the ten co-
and by National Landcare Programme funding through the
planted species may be from restrictions in light and compe-
Wimmera Catchment Management Authority. N.R. designed
tition by the roots of the other species (Wilson, 1988; Calder
the research, collected and isolated the fungal isolates, germi-
et al., 1989), though competition between their associated
nated the seeds, grew the orchids in the pot trial and analysed
micro-organisms cannot be excluded. Interestingly there was
the data; A.L. extracted and sequenced DNA; C.L. analysed
a significant (P < 0.005) difference in tuber width of T. epi-
sequencing data. All authors interpreted the data and wrote
pactoides when grown with Rytidosperma caespitosum, with
the paper. There was no involvement of the funding provid-
those germinated with OTU1 significantly (P < 0.05) larger
ers in designing the study; collecting, analysing or interpreting
than those germinated with ‘T. asymmetrica’, suggesting that
the data; or deciding to submit the paper for publication. The
‘T. asymmetrica’ negatively affects T. epipactoides growth
authors have no conflict of interest affecting this paper.
under those conditions. When grown without associated com-
panion plants, orchids with different fungal isolates as inocula
had the same tuber width. This suggests that fungal isolates LITERATURE CITED
belonging to the two OTUs do not differ in terms of the benefit
they provide to the plant, except when grown with other plants. Anderson SH, Kelly D, Ladley JJ, Molloy S, Terry J. 2011. Cascading
effects of bird functional extinction reduce pollination and plant density.
There are no other studies to our knowledge on long-term tri- Science 331: 1068–1071.
als on the effect of fungal isolates on adult orchid plants. Such Anderson S, Bachman S, Barker A, et al. 2016. State of the world’s plants –
differences in growth caused by co-occurring plants may be 2016. https://stateoftheworldsplants.com/2017/
958 Reiter et al. — Optimizing mycorrhizae in translocations

Australian Government Bureau of Meteorology. 2017. Climate data online. Harcourt AH, Coppeto S, Parks S. 2002. Rarity, specialization and extinction
http://www.bom.gov.au/climate/data (accessed 26 November 2017). in primates. Journal of Biogeography 29: 445–456.
Backhouse G. 2007. Are our orchids safe down under? A national assessment Hughes L. 2003. Climate change and Australia: trends, projections and
of threatened orchids in Australia. Lankesteriana 7: 28–43. impacts. Austral Ecology 28: 423–443.
Batty A, Dixon K, Brundrett M, Sivasithamparam K. 2001. Constraints to Huynh TT, Thomson R, Mclean CB, and Lawrie AC. 2009. Functional and
symbiotic germination of terrestrial orchid seed in a mediterranean bush- genetic diversity of mycorrhizal fungi from single plants of Caladenia
land. New Phytologist 152: 511–520. formosa (Orchidaceae). Annals of Botany 104: 757–765.
Bauk K, Flores J, Ferrero C, Pérez-Sánchez R, Las Peñas ML, Gurvich IUCNS. 2013. Guidelines for reintroductions and other conservation translo-
DE. 2016. Germination characteristics of Gymnocalycium monvillei cations. Gland, Switzerland: IUCN Species Survival Commission.
(Cactaceae) along its entire altitudinal range. Botany 95: 419–428. Jacquemyn H, Merckx V, Brys R, Tyteca D, Cammue B, Honnay O,

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

Bidartondo MI, Read DJ. 2008. Fungal specificity bottlenecks during orchid Lievens B. 2011. Analysis of network architecture reveals phylogenetic
germination and development. Molecular Ecology 17: 3707–3716. constraints on mycorrhizal specificity in the genus Orchis (Orchidaceae).
Brook BW, Sodhi NS, Bradshaw CJ. 2008. Synergies among extinction driv- New Phytologist 192: 518–528.
ers under global change. Trends in Ecology and Evolution 23: 453–460. Jacquemyn H, Deja A, Bailarote BC, Lievens B. 2012. Variation in mycor-
Brundrett MC, Scade A, Batty AL, Dixon KW, Sivasithamparam K. rhizal associations with tulasnelloid fungi among populations of five
2003. Development of in situ and ex situ seed baiting techniques to detect Dactylorhiza species. PLoS One 7: e42212.
mycorrhizal fungi from terrestrial orchid habitats. Mycological Research Jacquemyn H, Waud M, Lievens B, and Brys R. 2016. Differences in mycor-
107: 1210–1220. rhizal communities between Epipactis palustris, E. helleborine and its
Bunch WD, Cowden CC, Wurzburger N, Shefferson RP. 2013. Geography presumed sister species E. neerlandica. Annals of Botany 118: 105–114.
and soil chemistry drive the distribution of fungal associations in lady’s Jeanes JA. 2002. A taxonomic revision of the genus Thelymitra J. and G. Forst.
slipper orchid, Cypripedium acaule. Botany 91: 850–856. (Orchidaceae) in Australia. Journal of the Native Orchid Society of South
Calder D, Cropper S, Tonkinson D. 1989. The ecology of Thelymitra epi- Australia 26: 52.
pactoides F Muell (Orchidaceae) in Victoria, Australia, and the implica- Jeanes JA. 2011. Resolution of the Thelymitra aristata (Orchidaceae) complex
tions for management of the species. Australian Journal of Botany 37: of south-eastern Australia. Muelleria 29: 110–129.
19–32. Jeanes JA. 2013. An overview of the Thelymitra nuda (Orchidaceae) complex
Cameron DD, Leake JR, Read DJ. 2006. Mutualistic mycorrhiza in in Australia including the description of six new species. Muelleria 31:
orchids: evidence from plant–fungus carbon and nitrogen transfers in 3–30.
the green-leaved terrestrial orchid Goodyera repens. New Phytologist Jeanes JA, Backhouse G. 2006. Wild orchids of Victoria, Australia. Australia:
171: 405–416. Aquatic Photographics.
Cavieres LA, Arroyo MT. 2000. Seed germination response to cold stratifi- Johnson S, Steiner K. 1997. Long-tongued fly pollination and evolution of
cation period and thermal regime in Phacelia secunda (Hydrophyllaceae) floral spur length in the Disa draconis complex (Orchidaceae). Evolution
– altitudinal variation in the Mediterranean Andes of central Chile. Plant 51: 45–53.
Ecology 149: 1–8. Kartzinel TR, Trapnell DW, Shefferson RP. 2013. Highly diverse and spa-
Clements MA, Ellyard RK, 1979. The symbiotic germination of Australian tially heterogeneous mycorrhizal symbiosis in a rare epiphyte is unrelated
terrestrial orchids. American Orchid Society Bulletin 48: 810–816. to broad biogeographic or environmental features. Molecular Ecology 22:
Clements MA, Muir H, Cribb PJ. 1986. A preliminary report on the symbiotic 5949–5961.
germination of European terrestrial orchids. Kew Bulletin 41: 437–445. Kearse M, Moir R, Wilson A, et al. 2012. Geneious Basic: an integrated and
Coates F, Jeanes J, Pritchard A. 2002. National Recovery Plan for twenty-five extendable desktop software platform for the organization and analysis of
threatened orchid taxa of Victoria, South Australia and New South Wales sequence data. Bioinformatics 28: 1647–1649.
2003–2007. Department of Sustainability and Environment, Victoria. Kivlin SN, Emery SM, Rudgers JA. 2013. Fungal symbionts alter plant
Cropper S, Calder D. 1990. The floral biology of Thelymitra epipactoides responses to global change. American Journal of Botany 100: 1445–1457.
(Orchidaceae), and the implications of pollination by deceit on the sur- Kraft NJ, Adler PB, Godoy O, James EC, Fuller S, Levine JM. 2015.
vival of this rare orchid. Plant Systematics and Evolution 170: 11–27. Community assembly, coexistence and the environmental filtering meta-
Cruz D, Suárez JP, Kottke I, Piepenbring M, Oberwinkler F. 2011. Defining phor. Functional Ecology 29: 592–599.
species in Tulasnella by correlating morphology and nrDNA ITS-5.8 S Linde CC, Phillips RD, Crisp MD, Peakall R. 2014. Congruent species delin-
sequence data of basidiomata from a tropical Andean forest. Mycological eation of Tulasnella using multiple loci and methods. New Phytologist
Progress 10: 229–238. 201: 6–12.
Cruz D, Suárez JP, Kottke I, Piepenbring M. 2014. Cryptic species revealed Linde CC, May TW, Phillips RD, Ruibal M, Smith LM, Peakall R. 2017.
by molecular phylogenetic analysis of sequences obtained from basidi- New species of Tulasnella associated with terrestrial orchids in Australia.
omata of Tulasnella. Mycologia 106: 708–722. IMA FUNGUS 8: 27–47.
Cruz D, Suárez JP, Piepenbring M. 2016. Morphological revision of Mack RN, Simberloff D, Lonsdale WM, Evans H, Clout M, Bazzaz FA.
Tulasnellaceae, with two new species of Tulasnella and new records of 2000. Biotic invasions: causes, epidemiology, global consequences, and
Tulasnella spp. for Ecuador. Nova Hedwigia 102: 279–338. control. Ecological Applications 10: 689–710.
Curtis JT. 1939. The relation of specificity of orchid mycorrhizal fungi to the Martos F, Munoz F, Pailler T, Kottke I, Gonneau C, Selosse MA. 2012. The
problem of symbiosis. American Journal of Botany 26: 390–399. role of epiphytism in architecture and evolutionary constraint within mycor-
Davis BJ, Phillips RD, Wright M, Linde CC, Dixon KW. 2015. Continent- rhizal networks of tropical orchids. Molecular Ecology 21: 5098–5109.
wide distribution in mycorrhizal fungi: implications for the biogeography McCormick MK, Jacquemyn H. 2014. What constrains the distribution of
of specialized orchids. Annals of Botany 116: 413–421. orchid populations? New Phytologist 202: 392–400.
Dearnaley JDW, Martos F, Selosse MA. 2012. Orchid mycorrhizas: molecu- McCormick M, Whigham D, O’Neill J. 2004. Mycorrhizal diversity in photo-
lar ecology, physiology, evolution and conservation aspects. In: Hock B, synthetic terrestrial orchids. New Phytologist 163: 425–438.
ed. Fungal associations. Berlin Heidelberg: Springer, 207–230. McCormick MK, Whigham DF, Sloan D, O’Malley K, Hodkinson B. 2006.
Fochi V, Chitarra W, Kohler A, et al. 2017. Fungal and plant gene expres- Orchid–fungus fidelity: a marriage meant to last? Ecology 87: 903–911.
sion in the Tulasnella calospora–Serapias vomeracea symbiosis provides Mehra S, Morrison PD, Coates F, Lawrie AC. 2017. Differences in carbon
clues about nitrogen pathways in orchid mycorrhizas. New Phytologist source utilisation by orchid mycorrhizal fungi from common and endan-
213: 365–379. gered species of Caladenia (Orchidaceae). Mycorrhiza 27: 95–108.
Gavito ME, Schweiger P, Jakobsen I, 2003. P uptake by arbuscular mycor- Mujica MI, Saez N, Cisternas M, Manzano M, Armesto JJ, Pérez F. 2016.
rhizal hyphae: effect of soil temperature and atmospheric CO2 enrichment. Relationship between soil nutrients and mycorrhizal associations of two
Global Change Biology 9: 106–116. Bipinnula species (Orchidaceae) from central Chile. Annals of Botany
Giménez-Benavides L, Escudero A, Pérez-García F. 2005. Seed germination 118: 149–158.
of high mountain Mediterranean species: altitudinal, interpopulation and Nilsson RH, Kristiansson E, Ryberg M, Hallenberg N, Larsson KH. 2008.
interannual variability. Ecological Research 20: 433–444. Intraspecific ITS variability in the kingdom Fungi as expressed in the
Grundy M, Rossel RV, Searle R, Wilson P, Chen C, Gregory L. 2015. Soil international sequence databases and its implications for molecular spe-
and landscape grid of Australia. Soil Research 53: 835–844. cies identification. Evolutionary Bioinformatics 4: 193.
 Reiter et al. — Optimizing mycorrhizae in translocations 959

Oja J, Kohout P, Tedersoo L, Kull T, Kõljalg U. 2015. Temporal patterns Selosse MA, Martos F. 2014. Do chlorophyllous orchids heterotrophically use
of orchid mycorrhizal fungi in meadows and forests as revealed by 454 mycorrhizal fungal carbon? Trends in Plan Science 19: 683–685.
pyrosequencing. New Phytologist 205: 1608–1618. Selosse MA, Roy M. 2009. Green plants that feed on fungi: facts and questions
Orejuela-Gartner JE. 2012. Orchids of the cloud forests of southwestern about mixotrophy. Trends in Plant Science 14: 64–70.
Colombia and opportunities for their conservation. European Journal of Shefferson RP, Weiß M, Kull T, Taylor D. 2005. High specificity generally
Environmental Sciences 2: 19–32. characterizes mycorrhizal association in rare lady’s slipper orchids, genus
Otero JT, Bayman P, Ackerman JD. 2005. Variation in mycorrhizal perform- Cypripedium. Molecular Ecology 14: 613–626.
ance in the epiphytic orchid Tolumnia variegata in vitro: the potential for Smith ZF, James EA, McLean CB. 2010. Mycorrhizal specificity of Diuris
natural selection. Evolutionary Ecology 19: 29–43. fragrantissima (Orchidaceae) and persistence in a reintroduced popula-
Pandey M, Sharma J, Taylor D, Yadon VL. 2013. A narrowly endemic photo- tion. Australian Journal of Botany 58: 97–106.

Downloaded from https://academic.oup.com/aob/article-abstract/122/6/947/5036347 by Mzuzu University user on 18 February 2019

synthetic orchid is non-specific in its mycorrhizal associations. Molecular Staddon P, Heinemeyer A, Fitter A. 2002. Mycorrhizas and global environ-
Ecology 22: 2341–2354. mental change: research at different scales. Plant and Soil 244: 253–261.
Pauw A, Hawkins JA. 2011. Reconstruction of historical pollination rates Stamatakis A, Hoover P, Rougemont J. 2008. A rapid bootstrap algorithm for
reveals linked declines of pollinators and plants. Oikos 120: 344–349. the RAxML web servers. Systematic Biology 57: 758–771.
Peay KG, Kennedy PG, Bruns TD. 2008. Fungal community ecology: a Stöckel M, Těšitelová T, Jersáková J, Bidartondo MI, Gebauer G. 2014.
hybrid beast with a molecular master. Bioscience 58: 799–810. Carbon and nitrogen gain during the growth of orchid seedlings in nature.
Perkins A, McGee P. 1995. Distribution of the orchid mycorrhizal fungus, New Phytologist 202: 606–615.
Rhizoctonia solani, in relation to its host, Pterostylis acuminata, in the Suárez JP, Eguiguren JS, Herrera P, Jost L. 2016. Do mycorrhizal fungi
field. Australian Journal of Botany 43: 565–575. drive speciation in Teagueia (Orchidaceae) in the upper Pastaza watershed
Phillips RD, Barrett MD, Dixon KW, Hopper SD. 2011. Do mycorrhizal of Ecuador? Symbiosis 69: 161–168.
symbioses cause rarity in orchids? Journal of Ecology 99: 858–869. Swarts ND, Dixon KW. 2009. Terrestrial orchid conservation in the age of
Phillips RD, Peakall R, Hutchinson MF, et al. 2014. Specialized ecological extinction. Annals of Botany 104: 543–556.
interactions and plant species rarity: the role of pollinators and mycorrhizal Swarts ND, Sinclair EA, Francis A, Dixon KW. 2010. Ecological special-
fungi across multiple spatial scales. Biological Conservation 169: 285–295. ization in mycorrhizal symbiosis leads to rarity in an endangered orchid.
Phillips RD, Barrett MD, Dalziell EL, Dixon KW, Swarts ND. 2016. Molecular Ecology 19: 3226–3242.
Geographical range and host breadth of Sebacina orchid mycorrhizal Taylor D, Bruns T, Leake J, Read D. 2002. Mycorrhizal specificity and func-
fungi associating with Caladenia in south-western Australia. Botanical tion in myco-heterotrophic plants. Mycorrhizal Ecology 157: 375–413.
Journal of the Linnean Society 182: 140–51. Thomas CD, Cameron A, Green RE, et al. 2004. Extinction risk from climate
Pimm SL, Jenkins CN, Abell R, et al. 2014. The biodiversity of species and change. Nature 427: 145–148.
their rates of extinction, distribution, and protection. Science 344: 1246752. Tilman D, May RM, Lehman CL, Nowak MA. 1994. Habitat destruction and
Rambaut A, Drummond A. 2012. FigTree. Version 1.4. 0. Available at http:// the extinction debt. Nature 371: 65–66.
tree.bio.ed.ac.uk/software/figtree/ Vallee L. 2004. Guidelines for the translocation of threatened plants in
Rasmussen HN. 1990. Cell differentiation and mycorrhizal infection in Australia. Canberra, Australia: Australian Network for Plant Conservation.
Dactylorhiza majalis (Rchb. f.) Hunt & Summerh. (Orchidaceae) during Warcup J. 1971. Specificity of mycorrhizal association in some Australian ter-
germination in vitro. New Phytologist 116: 137–147. restrial orchids. New Phytologist 70: 41–46.
Rasmussen HN. 1995. Terrestrial orchids: from seed to mycotrophic plant. Warcup JH. 1981. The mycorrhizal relationships of Australian orchids. New
Cambridge: Cambridge University Press. Phytologist 87: 371–381.
Rasmussen HN. 2002. Recent developments in the study of orchid mycorrhiza. Waterman RJ, Bidartondo MI. 2008. Deception above, deception below:
Plant and Soil 244: 149–163. linking pollination and mycorrhizal biology of orchids. Journal of
Reiter N, Whitfield J, Pollard G, et al. 2016. Orchid re-introductions: an Experimental Botany 59: 1085–1096.
evaluation of success and ecological considerations using key compara- Waud M, Brys R, Van Landuyt W, Lievens B, Jacquemyn H. 2017.
tive studies from Australia. Plant Ecology 217: 81–95. Mycorrhizal specificity does not limit the distribution of an endangered
Reiter N, Vlcek K, O’Brien N, et al. 2017. Pollinator rarity limits reintroduc- orchid species. Molecular Ecology 26: 1687–1701.
tion sites in an endangered sexually deceptive orchid (Caladenia hastata): Weiss M, Selosse MA, Rexer KH, Urban A, Oberwinkler F. 2004.
implications for plants with specialized pollination systems. Botanical Sebacinales: a hitherto overlooked cosm of heterobasidiomycetes with a
Journal of the Linnean Society 184: 122–136. broad mycorrhizal potential. Mycological Research 108: 1003–1010.
Robertson AW, Kelly D, Ladley JJ, Sparrow AD. 1999. Effects of pollinator White TJ, Bruns T, Lee SJWT, Taylor JL. 1990. Amplification and direct
loss on endemic New Zealand mistletoes (Loranthaceae). Conservation sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis
Biology 13: 499–508. MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to
Roche SA, Carter RJ, Peakall R, Smith LM, Whitehead MR, Linde CC. methods and applications. New York: Academic Press, 315–322.
2010. A narrow group of monophyletic Tulasnella (Tulasnellaceae) symbiont Wilson JB. 1988. Shoot competition and root competition. Journal of Applied
lineages are associated with multiple species of Chiloglottis (Orchidaceae): Ecology 25: 279–296.
implications for orchid diversity. American Journal of Botany 97: 1313–1327. World Checklist of Selected Plant Families. 2017. Facilitated by the Royal
Ronquist F, Teslenko M, Van Der Mark P, et al. 2012. MrBayes 3.2: efficient Botanic Gardens, Kew. Available at: http://wcsp.science.kew.org (accessed
Bayesian phylogenetic inference and model choice across a large model 24 November 2017)
space. Systematic Biology 61: 539–542. Zubek S, Majewska ML, Błaszkowski J, Stefanowicz AM, Nobis M,
Ruibal MP, Triponez Y, Smith LM, Peakall R, Linde CC. 2017. Population Kapusta P. 2016. Invasive plants affect arbuscular mycorrhizal fungi
structure of an orchid mycorrhizal fungus with genus-wide specificity. abundance and species richness as well as the performance of native plants
Scientific Reports 7: 5613. grown in invaded soils. Biology and Fertility of Soils 52: 879–893.