10. Photobacterium damsela subsp.

piscicida
Varvarigos P.
in
Zrncic S. (ed.).
Diagnostic Manual for the main pathogens in European seabass and Gilthead seabream
aquaculture

Zaragoza : CIHEAM
Options Méditerranéennes : Série B. Etudes et Recherches; n. 75

2020
pages 83-96

Article available on line / Article disponible en ligne à l’adresse :

--------------------------------------------------------------------------------------------------------------------------------
------------------------------------------
http://om.ciheam.org/article.php?IDPDF=00007943
--------------------------------------------------------------------------------------------------------------------------------
------------------------------------------

To cite this article / Pour citer cet article

--------------------------------------------------------------------------------------------------------------------------------
------------------------------------------
Varvarigos P. 10. Photobacterium damsela subsp. piscicida. In : Zrncic S. (ed.). Diagnostic Manual
for the main pathogens in European seabass and Gilthead seabream aquaculture. Zaragoza : CIHEAM,
2020. p. 83-96 (Options Méditerranéennes : Série B. Etudes et Recherches; n. 75)
--------------------------------------------------------------------------------------------------------------------------------
------------------------------------------

http://www.ciheam.org/
http://om.ciheam.org/
 10. Photobacterium damsela subsp. piscicida

P. Varvarigos
Aquahealth Diagnostic Lab, Athens, Greece

Table of contents

10.1. Aetiology of pasteurellosis (photobacteriosis)

10.2. Clinical diagnosis
10.3. Epizootiology of pasteurellosis (photobacteriosis)
10.4. Sampling
10.4.1. Preparation and shipment of samples from fish
10.5. Diagnostic procedures
10.5.1. Overview
10.5.2. Primary cultivation of bacteria
10.5.3. Screening of pure cultures
10.5.4. Identification of the strain
10.5.4.1. API
10.5.4.2. Slide agglutination
10.5.4.3. Mass spectrometry
10.5.4.4. PCR
10.5.5. In vitro susceptibility testing
References
Photos

10.1. Aetiology of pasteurellosis (photobacteriosis)

Photobacterium damselae subsp. piscicida (former name: Pasteurella piscicida (Gauthier et al.,
1995; Jansen and Surgalla, 1968) causes a disease of importance resulting in serious losses
among cultured fish species in Europe, such as gilthead seabream (Sparus aurata), red porgy
(Pagrus pagrus), red seabream (Pagrus major), European seabass (Dicentrarchus labrax),
meagre (Argyrosomus regius) and sole (Solea spp.). Gilthead seabream and European
seabass are suffering most of the economic losses under aquaculture conditions in Europe
including countries such as France, Italy, Malta, Spain, Portugal and Greece (Toranzo et al.,
1991; Baudin-Laurencin et al., 1991; Ceschia et al., 1991; Baptista et al., 1996; Bakopoulos et
al., 1997; Zorilla et al., 1999).
The disease is also of importance in Turkey (Candan et al., 1996; Korun and Timur, 2005) as

Options Méditerranéennes, B, no. 75, 2020

Diagnostic Manual for the main pathogens in European seabass 83
and Gilthead seabream aquaculture
well as Japan (Kusuda and Yamaoka, 1972; Koike et al., 1975) and the USA, where it was first
isolated from white perch (Roccus americanus) by Janssen and Surgalla, 1968.
Photobacterium damselae subspecies damsela (Ph.d.d.) and Photobacterium damselae
subspecies piscicida (Ph.d.p) belong to the thermotolerant group of the genus Photobacterium
and are genotypically homogeneous subspecies of Photobacterium damselae, based on small-
subunit rRNA sequencing and DNA:DNA hybridization (Romalde, 2002). The pathogenic
subspecies piscicida (Ph.d.p.) is phenotypically and serologically homogeneous and is the only
non-flagellated member of the genus.
Amplified Fragment Length Polymorphism (AFLP) can help epizootiological and taxonomic
studies of the highly homogeneous subspecies Photobacterium damselae subspecies piscicida
(Kvitt et al., 2002).The combination of PCR direct amplification of a 16S rRNA gene sequence
and AFLP in a 2-step procedure grouped Ph.d.p. isolates from different geographic regions into
distinct clusters on the basis of AFLP intraspecific polymorphisms. The Japanese isolates of
Ph.d.p. were distinguished from the Mediterranean/European isolates from Italy, Spain, Greece
and Israel at a cut-off value of 83% similarity. Further subclustering of the Med/European
isolates at a cut-off value of 97% discriminated the Italian, Spanish and Greek isolates from the
Israeli isolates.

10.2. Clinical diagnosis

Pasteurellosis presents itself in the hatcheries as hyperacute or acute septicaemia. Seabream
larvae, juveniles or fry are often found dead in large numbers on the bottom of the tank with only
a few darker fish swimming sluggishly and off-balance near the surface, often showing nervous
convulsions (bacterial encephalopathy) prior to death (Abu-Elala et al., 2015).
During acute cases of photobacteriosis, fish exhibit only a few pathological signs. Usually, there
are no alarming signs with fish behaving and feeding normally before the disease strikes;
hence, many among the dead fish carry amounts of feed in their stomach and gut. Convulsive
erratic swimming prior to death often comprise the only clinical signs of the acute outbreaks,
where internal lesions are often absent at necropsy. Anorexia, lethargy, darkening and
ulceration of the skin follow shortly afterwards.
As the disease progresses the gills become pale with excessive mucous secretions with
congested inflamed patches and often focal necroses next to congested areas. Lip, opercula
skin and lower jaw inflammation and necrotic skin patches on the body flanks, dorsal area and
tail become common. The fins, mainly pelvic, dorsal and caudal may be eroded. Skin and fin
erosions are covered with mucous, thus the lesions appear in the water as white patches.
Overall, there is no haemorrhagic appearance. The liver is most often inflamed and congested;
the spleen is enlarged (splenomegaly) and the kidney pale and oedematous. The intestine
carries a moderate quantity of fluid and some whitish mucous clots. The swim bladder is not
distended, thus, the majority of dead fish have sunk to the bottom of the tank or cage.
In the more chronic form of the disease typical pseudotuberculi develop mainly in the spleen
and/or kidney parenchyma. They comprise creamy-white granulomatous nodules, composed of
masses of bacterial cells, epithelial cells, fibroblasts, phagocytes and necrotic cell debris. These
have led to the descriptive name "pseudotuberculosis". Bacteria accumulate in phagocytes,
capillaries and interstitial spaces (Andreoni and Magnani, 2014) and bacteraemia is
pronounced.The gill, skin and fin epithelial lesions are suggestive of their susceptibility to
bacterial exotoxins as the bacteria gain entrance into the fish body during horizontal
transmission.

84 Options Méditerranéennes, B no. 75, 2020

10.3. Epizootiology of pasteurellosis (photobacteriosis)
The bacteria spread via infected phagocytes, mainly macrophages and the spread is rapid with
lethal effects after a few days of infection (Barnes and Ellis, 2004). The disease is hard to
eradicate by antibiotic treatments due to the intracellular location of the bacterium, but also due
to transferable genetic elements (R plasmids) carrying genes of resistance to many antibiotics
(Andreoni and Magnani, 2014). The intracellular location seems to protect from circulating
antibodies after vaccination against the disease and may explain the low RPS conferred by
vaccination as well as the short duration of immunity post-vaccination. Carriers persist on farms
and may show disease under stressful conditions (personal observations). In addition, surviving
fish from natural or experimental infection are not protected during subsequent re-challenge
(Barnes and Ellis, 2004). Iron acquisition from its host, by means of iron-binding siderophores,
increase virulence and the cytotoxic extracellular products (ECPs) damage the infected cells
with the consequent release of the bacterium and the invasion of adjacent cells (Andreoni and
Magnani, 2014).
A variety of marine fish are natural hosts of the pathogen (Romalde, 2002), but the exact
behaviour of the organism outside the host is unknown. Ph.d.p. strains are able to survive in
culturable state in sea water and sediment for only 6 to 12 days (Magarinos et al., 1994), but
virulent Ph.d.p. cells can enter a "viable but not culturable" (VBNC) state in response to
environmental stresses, such as starvation, antibiotic exposure, or low temperature, that allows
the cell to enter a state of dormancy and survive until conditions allow resuscitation and
reinitiation of infection (Magarinos et al., 1994; Oliver, 2010; Pinto et al., 2015).
The ability to enter a VBNC state is also common for the survival of virulent strains of the
subspecies damsela. Ph.d.d. maintains infectivity in sea water and sediments for at least 1 year
(Fouz et al., 1998). Hence, water and sediments can also act as reservoirs for virulent Ph.d.d.
strains.
Pasteurellosis, or rather photobacteriosis, is a temperature-dependent septicaemic disease.
o
Outbreaks occur when the water temperature rises above 18 C (Korun and Timur, 2005). Below
this temperature fish may be subclinical carriers harbouring the pathogen for long periods
(Romalde, 2002). In grow-out facilities, pasteurellosis outbreaks occur from late spring or early
summer until late autumn, while sea water temperature is maintained above 20°C. In
hatcheries, where warm borehole water (>18°C) is in use, photobacteriosis is a major threat all
year round.
There is no fish species-specific characteristic lesion other than the differences in sensitivity of
age classes among species (Andreoni and Magnani, 2014).
Seabream is susceptible when very young or around the weaning stage of juveniles and
remains very sensitive until the size of 6g. Its sensitivity gradually decreases from then onwards,
thus, for this species, photobacteriosis is mostly a problem in the hatchery/nursery and during
the first months in the grow-out facilities, especially when the transfer to cages coincides with
the warm season.
Seabass is susceptible to pasteurellosis beyond the size of 1g (nursery stage onwards). The
disease causes the highest mortalities in caged seabass between 5g and 40g. Thus, for bass,
photobacteriosis is mostly a problem during the first summer and autumn in the grow-out
facilities. Nevertheless, despite the gradual lowering of losses as the seabass grow, they remain
considerably susceptible until harvest.

Diagnostic Manual for the main pathogens in European seabass

and Gilthead seabream aquaculture 85
10.4. Sampling

10.4.1. Preparation and shipment of samples from fish

Marginalized, lethargic, moribund fish showing pronounced external lesions or behavioural
abnormalities, but not dead specimens, should be collected and sent refrigerated to the
laboratory for delivery within 12-24h (fast courier). It is best to collect the fish prior to
administering any antibacterial treatment.
Samples must be shipped according to the procedure described in Chapter 2.2.
Freshly dead fish, target organs (e.g. spleen, liver, kidney), fish eggs, live prey organisms, or
even tank and filter sediments may be submitted for PCR examination to confirm the presence
of the pathogen. These may be placed in screw-cap tubes of appropriate size. The samples
o
may be fixed in RNA later (1:5 v/v), or simply kept deep-frozen at below -20 C until dispatch. If
dispatch is planned on the same day, the samples may simply be kept refrigerated.
When running PCR for diagnostic purposes, the nucleic acid (NA) extraction step prior to its
targeted amplification procedure is of utmost importance. The pooling of target tissues most
likely to be infected by the pathogen (spleen, kidney, liver, brain), or whole specimens, when
very small, must not be excessive and over-dilute the pathogen if assumed present in a small
fraction of the pooled tissues.
At the laboratory, meticulous homogenization of the tissues ensuring cell lysis is important and
the use of tissue lysing machines is recommended instead of grinding the tissues manually by
tube and pestle.

10.5. Diagnostic procedures

10.5.1. Overview
Apart from history, clinical symptoms and necropsy findings confirming the tissue lesions of the
target organs (e.g. gills, kidney, spleen), additional diagnostic procedures may be employed in
the field, such as quick Giemsa-stained spleen imprints or blood smears (characteristic
bacteraemia). Isolation and identification may then follow.
A rapid fluorescent antibody (FA) technique, specific for Ph.d.p., has been tested for early
detection of the pathogen in fish farm waters prior to and subsequent to disease outbreaks
among cultured fish (Mancuso et al., 2013). Such a technique might prove useful to detect the
"viable but not culturable" (VBNC) states of the bacterium early (Fouz et al., 1998; Magarinos et
al., 1994; Pinto et al., 2015) in water and sediments prompting prophylactic actions or aiding
environmental surveys. This technique has shown experimentally that Ph.d.p. can be detected
in water 20 days after the end of mortalities, proving that the pathogen is present in
asymptomatic fish and is released into sea water for some time after an outbreak. The
fluorescent antibody technique could be developed to distinguish inactive, active or damaged
bacterial cell physiological states (Caruso et al., 2003).

10.5.2. Primary cultivation of bacteria

Photobacterium damselae subspecies piscicida can be isolated by standard bacteriological
sampling from trunk kidney, spleen, liver and/or brain and seeding on agar plates (usually TSA,
blood or BHI agar). The brain is a suitable target tissue when fish are small, e.g. 2cm or less,
after rinsing well with sterile saline solution.
Ph.d.p. grows well on standard Tryptone Soy Agar (TSA) with no need to supplement NaCl,
since commercially available substrates contain 0.5% salt. Characteristic colonies appear after

86 Options Méditerranéennes, B no. 75, 2020

about 24-36 hours of incubation at 22-28°C. These practical observations are in contrast to
what is being described in the literature cited, where it is mentioned that the bacterium needs 1-
2% NaCl supplementation of the substrates and takes 2-4 days of incubation to form its
distinctive colonies (Romalde, 2002).
Photobacterium damselae subsp. piscicida -Ph.d.p.is a halophilic Gram-negative bacterium,
appearing as a non-motile rod of 0.5 x 1.5 μm in size with bipolar staining and is pleomorphic in
older cultures. Usually, bacterial cells shorten with age and acquire an ellipsoid shape. This
"dwarfing" is compatible with cells entering the VBNC state (Magarinos et al., 1994; Olivier,
2009).

10.5.3. Screening of pure cultures

Macroscopically Ph.d.p. colonies on the TSA medium are of characteristic morphology. They
are smaller than or can measure up to 0.5mm in diameter. They are whitish (semi-translucent
with irregular margins, like dewdrops, if observed under the light magnification of a
stereoscope), somewhat viscous and adhere well to the substrate.

10.5.4. Identification of the strain

10.5.4.1. API
TM TM
The interpretation of the API20E (bioMérieux) results via Apiweb does not identify
Photobacterium damselae subsp. piscicida, because its profile is not contained in the
bioMérieux code index. Nevertheless, this system is useful for the presumptive diagnosis of the
pathogen, which produces the profile 2005004 almost invariably (Romalde, 2002). The
phenotypic homogeneity of Ph.d.p. allows the use of this miniaturized system for its
identification. Infrequently, however, the profile 0005004 has been produced (personal
observation). Hence, this test should best be combined with other phenotypic characteristics,
such as non-motility, negative urease test, no growth on thiosulfate citrate bile salts-sucrose
(TCBS) agar as well as additional diagnostic methods, such as sero-agglutination and
molecular tests.

Fig. 10.1. Biomerieux API 20E micro-tube test strip biochemical profile 2005004 identifying
Photobacterium damselae subsp. piscicida. The typical score obtained on API 20E for
Ph.d.p.

10.5.4.2. Slide agglutination

Photobacterium damselae subspecies piscicida -Ph.d.p. is serologically homogeneous, hence,
serotypes have not been established (Bakopoulos et al., 1997). The antigenic uniformity of
lipopolysaccharide (LPS) profiles and outer membrane proteins (OMPs) encouraged the
development of serological techniques for its detection and identification.
Commercial slide agglutination and latex agglutination test kits (Mono-Pp by Bionor AS),
utilizing specific antiserum with polyclonal antibodies, may confirm the identification of the
bacterium isolated on culture (Romalde et al., 1995). No cross-reaction with other bacterial
groups has been reported.

Diagnostic Manual for the main pathogens in European seabass

and Gilthead seabream aquaculture 87
Nonetheless, in order to recognize minute serological differences among strains of disparate
geographical regions, monoclonal instead of polyclonal antibodies (MAbs), that are specific
against particular immunogens, may be utilized to identify Ph.d.p. intraspecific variations
(Bakopoulos et al., 1997). Thus, for example, antigenic differences between Japanese and
European strains have been revealed.

10.5.4.3. Mass spectrometry

Photobacterium damselae subspecies damsela and piscicida have important epizootiological
and virulence differences. MALDI-TOF Mass Spectra biotyper analysis may correctly identify the
species and discriminate the subspecies (Perez-Sancho et al., 2016) based on five differential
peaks (m/z 4183 and 8367 for subsp. damsela and 4197, 8397 and 8856 for subsp. piscicida)
using a genetic algorithm (ClinProTools software). This approach could be integrated into the
workflow of laboratories possessing MALDI based tools for bacteria identification.

10.5.4.4. PCR
PCR may be utilized for both the confirmation of photobacteriosis and the screening for latent
carriers among apparently healthy specimens. Several efforts to select appropriate PCR primer
sets to discriminate between the closely related Photobacterium damselae subspecies, Ph.d.p.
and Ph.d.d. have been published.
Developed PCR-based diagnostic methodologies are either multiplex, that is, they utilize
sequences of different genes in addition to the 16S rRNA (e.g. the gene 1A coding for a
penicillin-binding protein or the ureC gene, which is absent from Ph.d.p.), or are combined with
other molecular techniques, such as AFLP or RFLP, or with plating the Photobacteria spp. on
TCBS where only Ph.d.d. grows producing green colonies (Amagliani et al., 2009; Andreoni and
Magnani, 2014; Essam et al., 2016, Osorio et al., 2000; Rajan et al., 2003; Zappulli et al., 2005).
Primer combinations are important in order to cope with the genotypic homogeneity between
the Photobacterium damselae subspecies damsela and piscicida. Lately, a single-step real-time
PCR assay, based on a bamB gene sequence (the gene responsible for the outer cell
membrane protein assembly factor bamB) has proven sensitive and specific to discriminate
between subspecies and quantify the existing genome copy numbers of the bacterium in
infected fish tissue samples (Rajan et al., 2005).
In order to bypass the need for prior isolation of the bacterium in pure culture and to overcome
the 16S rRNA gene homogeneity between the Ph.d. subspecies, A PCR-RFLP method has
been documented based on novel primer pairs designed on non-conserved sites of two
genomic regions of several Ph.d.p. strains. These primers have been constructed subsequent
to cloning and sequencing selected RAPD fragments and were found to be highly specific to P.
damselae (Zappulli et al., 2005). In a second step, Ph.d. subspecies identification could be
effected by restriction analysis of the PCR amplified products, which showed a unique digestion
profile for all Photobacterium damselae subsp. piscicida strains tested. A distinctive RFLP
pattern for Ph.d.p. allows the detection of this subspecies when Ph.d.d. is also present in the
sample. This two-step method may be implemented directly on infected fish tissues, either from
moribund fish or asymptomatic carriers.
Farm samples for PCR testing may include suspect fish, fertilized eggs, live prey,
larvae/juveniles/fryor even sediments in order to reveal sub-clinical infection as well as
moribund fish in order to confirm the diagnosis in case of overt disease. For this purpose,
standardised, easy to use commercial qPCR kits have been made available from a number of
companies.
The commercial PCR kits are designed for the in vitro quantitative detection of Ph.d.p. genomes
and are designed to have the broadest detection profile possible, whilst remaining specific to
the target bacterium genome. The primers and fluorogenic probe sequences in these kits are

88 Options Méditerranéennes, B no. 75, 2020

proprietary and covered by patents and are advertized to have 100% homology with a broad
range of Ph.d.p. sequences based on bioinformatics analyses.The qPCR kits provide copy
number standard curves for the quantification of the amplified products and internal extraction
template (DNA or RNA) controls for the quality of the nucleic acid (NA) extraction in order to
eliminate false-negative results.
Subsequent to tissue lysing, NA extraction procedures with associated reagents are
commercially available and most of them utilize spin column or magnetic bead technologies
applied according to stepwise instructions.

Example of thermal cycles programmed into the PCR thermal cycler according to a commercial
qPCR amplification kit for Photobacterium damselae subspecies piscicida, suggesting 50 thermal
cycles:
Polymerase Annealing - Extension -
Denaturation
activation data collection
95°C 95°C 60°C
2 min 10 sec 60 sec
50 cycles

Example reaction mix and final volume in each well/micro-tube:

Mastermix 10 μl
Primer/probe mix 1 μl
RNAse/DNAse free water 4 μl
Reaction mix volume 15 μl
DNA template (sample NA extract) 5 μl
Final volume 20 μl

Primer sequences are proprietary and not disclosed.

However, laboratories may choose to develop their own protocol to detect Ph.d.p., rather than
use the commercial kits. Carraro et al. (2018) designed a highly sensitive real-time PCR assay
for simultaneous detection and quantification of P. damselaesubsp. piscicida and P. damselae
subsp. damsela that was tested for specificity and sensitivity on laboratory-generated samples
as well as on experimentally infected seabream tissue samples.

This assay targets a partial sequence of the bamB gene for amplification using specific primers
PhPisc.B (For and Rev). Two single nucleotide polymorphisms in the target amplicon region
determine two distinctive qPCR dissociation curves, so melting curve (dissociation) analysis can
distinguish between Ph.d.p. -Ph.d.d.

Primers
Oligonucleotide Sequence 5’  3’
PhPisc B (For) TGCTGGTGGTGTATTCTGGG
PhPisc B (Rev) AACAGGTGTCGCATCAACGT

This assay can be performed using any colour-based chemistry and instrument that supports
melting curve analysis. An example follows using the Platinum SYBR Green qPCR SuperMix-
UDG (Invitrogen) on LightCycler 480 System (Roche):

Diagnostic Manual for the main pathogens in European seabass

and Gilthead seabream aquaculture 89
Reaction mix
Reagent Final concentration/volume
PhPisc B (For) 10 uM
PhPisc B (Rev) 10 uM
Platinum SYBR Green Super-Mix-UDG 1X
DNA template 2.5
Water (molecular grade) To 10 μl
Total volume 10 μl

Thermal profile
UDG Polymerase
Denaturation Annealing/Extension Dissociation
incubation activation
From 40°C to
50°C 95°C 95°C 60°C
95°C
2 min 2 min 10 sec 60 sec at 4.4°C/s
45 cycles

Ph.d.p. strains should be characterized by melting temperature (Tm) of 83.3–84°C while Ph.d.d.
strains should be characterized by a Tm of 84.3–84.9°C making the two subspecies
distinguishable.

10.5.5. In vitro susceptibility testing

The most commonly used in vitro method to assess bacterium susceptibility to antimicrobials is
the disc diffusion method (CLSI, 2011; Puttaswamy et al., 2018). Although Ph.d.p. isolates may
be distinguished from each other according to their antimicrobial susceptibility and even provide
clues of their geographical origin (Bakopoulos et al., 1995; Thyssen and Olivier, 2001), it is
evident in everyday practice that their sensitivity profile changes dynamically, depending on the
degree of exposure of the bacterium to particular antibiotics/chemotherapeutics in the field
(Smith, 2008). For example, regular use of a particular antibiotic on a farm renders it ineffective
after about 3-4 treatment cycles.
By disc diffusion testing on TSA or MH agar plates (antibiogram), the pathogen is most often
found sensitive to oxytetracycline, flumequine, oxolinic acid, florfenicol and potentiated
sulphonamides (trimethoprim + sulfadiazine) and frequently resistant to ampicillin, amoxicillin,
erythromycin. At times, however, amoxicillin shows potency.

References
Abu-Elala N.M., Abd-Elsalam R.M., MarzoukM.S., 2015. Molecular and immunohistochemical diagnosis of
Photobacterium damselae subsp. piscicida during naturally occurring disease in Egypt. Journal of the
World Aquaculture Society, 46, 583-595.
Amagliani G., Omiccioli E., Andreoni F., Boiani R., Bianconi I., Zaccone R., Mancuso M., Magnani M.,
2009. Development of a multiplex PCR assay for Photobacterium damselae subsp. piscicida
identification in fish samples. Journal of Fish Diseases, 32, 645-653.
Andreoni F., Magnani M., 2014. Photobacteriosis: prevention and diagnosis. Journal of Immunology
Research, 7 pp. http://dx.doi.org/10.1155/2014/793817
Bakopoulos V., Adams A., Richards R.H., 1995. Some biochemical properties and antibiotic sensitivities
of Pasteurella piscicida isolated in Greece and comparison with strains from Japan, France and Italy.
Journal of Fish Diseases, 18, 1-7.
Bakopoulos V., Adams A., Richards R.H., 1997. Serological relationship of Photobacterium damselae
subsp. piscicida isolates (the causative agent of fish pasteurellosis) determined by Western blot
analysis using six monoclonal antibodies. Diseases of Aquatic Organisms, 28, 69-72.

90 Options Méditerranéennes, B no. 75, 2020

Bakopoulos V., Perić Ž., Rodger H., Adams A., Richards R., 1997. First report of fish pasteurellosis from
Malta. Journal of Aquatic and Animal Health, 9, 26-33.
Baptista T., Romalde J.L., Toranzo A.E., 1996. First occurrence of pasteurellosis in Portugal affecting
cultured gilthead seabream (Sparus auratus). Bulletin of the European Association of Fish Pathologists,
16, 92-95.
Barnes C.A., Ellis A.E., 2004. Bacterial Diseases of Fish - Where do we go from here? Recent advances in
understanding the virulence mechanisms of fish pathogenic bacteria. In: Current Trends in Bacterial and
Viral Fish and Shrimp Diseases.
Baudin-Laurencin F., Pepin J.F., Raymond J.D., 1991. First observation of an epizootic of pasteurellosis
in farmed and wild fish of the French Mediterranean coasts. Book of Abstracts.EAFP 5 th International
Conference on Diseases of Fish and Shellfish, Budapest, Hungary, 25-29 August, 1991.
Candan A., Kucuker-Ang M., Karatas-Steinum S., 1996. Pasteurellosis in cultured sea bass
(Dicentrarchus labrax) in Turkey. Bulletin of the European Association of Fish Pathologists, 16, 150-153.
Carraro R., Dalla Rovere G., Ferraresso S., Carraro L., Franch R., Toffan A., Pascoli F., Paternello T.,
Bargelloni L., 2018. Development of a real-time PCR assay for rapid detection and quantification of
Photobacterium damselae subsp. piscicida in fish tissues. Journal of Fish Diseases, 41, 247-254.
Caruso G., Mancuso M., Crisafi E., 2003. Combined fluorescent antibody assay and viability staining for
the assessment of the physiological states of Escherichia coli in seawaters. Journal of Applied
Microbiology, 95, 225-233.
Ceschia G., Quaglio F. Giorgetti G., Bertoja G., Bovo G., 1991. Serious outbreak of pasteurellosis
(Pasteurella piscicida) in euryhaline species along the Italian coasts. Book of Abstracts.EAFP 5th
International Conference on Diseases of Fish and Shellfish, Budapest, Hungary, 25-29 August, 1991.
CLSI, 2011. Performance standards for antimicrobial susceptibility testing; 21st Informational Supplement
M100-S21, Vol 31, No. 1.
Essam H.M., Abdellrazeq G.S., Tayel S.I., Torky H.A., Fadel A.H., 2016. Pathogenesis of Photobacterium
damselae subspecies infections in sea bass and sea bream. Microbial Pathogenesis, 99, 41-50.
Fouz B., Toranzo A.E., Marco-Noales E., Amaro C., 1998. Survival of fish-virulent strains of
Photobacterium damselae subsp. damselae in seawater under starvation conditions. FEMS
Microbiology Letters, 168, 181-186.
Gauthier G., Lafay B., Ruimy R., Breittmayer V., Nicolas J.L., Gauthier M., Christen R., 1995. Small-
subunit rRNA sequences and whole DNA relatedness concur for the reassignment of Pasteurella
piscicida (Snieszko et al.) to the genus Photobacterium as Photobacterium damselae subsp. piscicida
comb. nov. International Journal of Systematic Bacteriology, 45, 139-144.
Janssen W.A., Surgalla M.J., 1968. Morphology, physiology and serology of a Pasteurella species
pathogenic for white perch (Roccus americanus). Journal of Bacteriology, 96, 1606-1610.
Koike Y., Kuwahara A., Fujiwara H., 1975. Characterization of "Pasteurella" piscicida isolated from white
perch and cultivated yellowtail. Japanese Journal of Microbiology, 19, 241-247.
Korun J., Timur G., 2005. The first pasteurellosis case in cultured sea bass (Dicentrarchus labrax L.) at low
marine water temperatures in Turkey. The Israeli Journal of Aquaculture - Bamidgeh, 57, 197-206.
Kusuda R., Yamaoka M., 1972. Etiological studies on bacterial pseudotuberculosis in cultured yellowtail
with Pasteurella piscicida as the causative agent. Morphological and biochemical properties. Bulletin of
the. Japanese Society for the Science of Fish. 38, 1325-1332.
Kvitt H., Ucko M., Colorni A., Batargias C., Zlotkin A., Knibb W., 2002. Photobacterium damselae subsp.
piscicida: Detection by direct amplification of 16S rRNA gene sequences and genotypic variation as
determined by amplified fragment length polymorphism (AFLP). Diseases of Aquatic Organisms, 48,
187-195.
Magarinos B., Romalde J.L., Barja J.L., Toranzo A.E., 1994. Evidence of a dormant but infective state of
the fish pathogen Pasteurella piscicida in seawater and sediment. Applied and Environmental
Microbiology, 60, 180-186.
Mancuso M., Caruso G., Adone R. Genovese L, Crisafi E., Zaccone R., 2013. Detection of
Photobacterium damselae subsp. piscicida in seawaters by fluorescent antibody. Journal of Applied
Aquaculture, 25, 337-345.
Oliver D.J., 2010. Recent findings on the viable but nonculturable state in pathogenic bacteria. FEMS
Microbiology Reviews, 34, 415-435.
Osorio C.R., Toranzo A.E., Romalde J.L., Barja J.L., 2000. Multiplex PCR assay for ureC and 16S rRNA
genes clearly discriminates between both subspecies of Photobacterium damselae. Diseases of Aquatic
Organisms, 40, 177-183.
Pérez-Sancho M., Vela I., Awad A.M., Kostrzewa M., Dominguez L., Fernardez-Garayzabal J.F., 2016.
Differentiation of Photobacterium damselae subspecies using Matrix-Assisted Laser-
Desorption/Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF MS) in fish isolates. Aquaculture,
464, 159-164.

Diagnostic Manual for the main pathogens in European seabass

and Gilthead seabream aquaculture 91
Pinto D., Santos M.A., Chambel L., 2015. Thirty years of viable but nonculturable state research:
Unsolved molecular mechanisms. Critical Reviews in Microbiology, 41, 61-76.
Puttaswamy S., Kishore Gupta S., Regunath H., Smith L.P. Sengupta S., 2018. A comprehensive
review of the present and future antibiotic susceptibility testing (AST) systems. Archives of Clinical
Microbiology, 9, 83.
Rajan P.R., Lin J.H., Ho M.S., Yang H.L., 2003. Simple and rapid detection of Photobacterium damselae
subsp. piscicida by a PCR technique and plating method. Journal of Applied Microbiology, 95, 1375-
1380.
Romalde J.L., 2002. Photobacterium damselae subsp. piscicida: an integrated view of a bacterial fish
pathogen (Review). International Microbiology, 5, 3-9.
Romalde J.L., Margarinos B., Fouz B., Bandin I., Nunez S., Toranzo A.E., 1995. Evaluation of BIONOR
Mono-kits for rapid detection of bacterial fish pathogens. Diseases of Aquatic Organisms, 21, 25-34.
Smith P., 2008. Antimicrobial resistance in aquaculture. Revue Scientific Technique - Office International
des Epizooties, 27, 243-264.
Thyssen A., Ollevier F., 2001. In vitro antimicrobial susceptibility of Photobacterium damselae subsp.
Piscicidato 15 different antimicrobial agents. Aquaculture, 200, 259-269.
Toranzo A.E., Barreiro S., Casal J.F., Figueras A., Margarinos B., Barja J.L., 1991. Pasteurellosis in
cultured gilthead seabream (Sparus aurata): first report in Spain. Aquaculture, 99, 1-15.
Zappulli V., Patarnello T., Patarnello P., Frassineti F., Franch R., Manfrin A. Castagnaro M.,
Bargelloni L., 2005. Direct identification of Photobacterium damselae subsp. piscicida by PCR-RLFP
analysis. Diseases of Aquatic Organisms, 65, 53-61.
Zorilla I., Balebona M.D., Moriigo A., Sarasquete C., Borrego J.J., 1999. Isolation and characterization of
the causative agent of pasteurellosis, Photobacterium damsela ssp. piscicida, from sole, Solea
senegalensis (Kaup). Journal of Fish Diseases, 22, 167-172.

92 Options Méditerranéennes, B no. 75, 2020

Photos

Fig. 10.2. Seabream fry (1 g) in nursery dying at the surface of their tank.

a b

Fig. 10.3. a) Seabream fry (1 g) in nursery suffering photobacteriosis with skin lesions on the flanks;
b) Mild liver congestion but gross spleenomegaly in bigger seabream (7 g).

Diagnostic Manual for the main pathogens in European seabass

and Gilthead seabream aquaculture 93
 a b

Fig. 10.4. a) Seabass weighing 30 g suffering photobacteriosis with external inflammatory lesions
around the head epithelia, mainly lower jaw and opercula; b) Operculum skin with
haemorrhagic inflammation on a meagre (200 g) infected by Ph.d.p.

a b

Fig. 10.5. a) Seabass (50 g) with pale gills with large focal necrotic lesions; b) Inflamed and necrotic
gill lamellae under light magnification 25 x.

94 Options Méditerranéennes, B no. 75, 2020

 a b

Fig. 10.6. a) Seabass (40 g) with pale gills, liver inflammation and gross splenomegaly with
pseudotubercules; b) Close-up photo on seabass spleen with abundant
pseudotubercules in the parenchyma.

a b

Fig. 10.7. a) Characteristic pin-point Ph.d.p. colonies on TSA agar, photographed against a black
background for better contrast, after 24h incubation at room temperature (23oC). The larger
1.5mm colonies were produced by Vibrio spp., -mixed infection- but serve as a good
comparison; b) Positive seroagglutination rapid test (Bionor Mono -Pp) confirming the
pathogen.

Diagnostic Manual for the main pathogens in European seabass

and Gilthead seabream aquaculture 95
Fig. 10.8. Smear of homogenized splenic parenchyma from 70 day old seabream juveniles at the
weaning section of a hatchery, fixed and stained with Giemsa. Photobacteria depicting
characteristic biopolar staining were observed under 1000x magnification.

Fig. 10.9. Typical bacteraemia observed microscopically on Giemsa stained blood smear from
seabass (17 g) suffering photobacteriosis.

96 Options Méditerranéennes, B no. 75, 2020