Practice sheet- Molecular basis of Inheritance

1.The human chromosome with the highest and least number of genes in them are respectively : 1
(A) Chromosome 21 and Y. (B) Chromosome 1 and X.
(C) Chromosome 1 and Y. (D) Chromosome X and Y.
2.How many base pairs will be there in 20 nucleosomes in a DNA double helix ? 1
(A) 4000 (B) 40 (C) 20 (D) 2000
3.If the sequence of nitrogen bases of the coding strand in a transcription unit is 5' – ATGAATG – 3', the sequence of
bases in its RNA transcript would be
(A) 5' – AUGAAUG – 3'
(B) 5' – UACUUAC – 3'
(C) 5' – CAUUCAU – 3'
(D) 5' – GUAAGUA – 3'
4.Match the following genes of the lac operon listed in column „A‟ with their respective products listed in column „B‟
A Gene B Products
a. „i‟ gene (i) -galactosidase
b. „z‟ gene (ii) lac permease
c. „a‟ gene (iii) repressor
d. „y‟ gene (iv) transacetylase
Select the correct option :
Options :
abcd
(A) (i) (iii) (ii) (iv) (B) (iii) (i) (ii) (iv)
(C) (iii) (i) (iv) (ii) (D) (iii) (iv) (i) (ii)
5.Which one of the following statements is correct in the context of observing DNA separation by agarose gel
electrophoresis ?
(A) DNA can be seen in visible light.
(B) DNA can be seen without staining in visible light.
(C) Ethidium bromide stained DNA can be seen in visible light
(D) Ethidium bromide stained DNA can be seen under UV light.
6.Which of the chromosome in a human possesses the least number of genes ?
(A) 21st chromosome (B) 16th chromosome (C) X-chromosome (D) Y-chromosome
7.Which of the options has correct identification of „P‟, „Q‟ and „R‟ in the illustration of „Central Dogma‟ given below
?

(A) P – Replication, Q – rRNA, R – Transcription

(B) P – Translation, Q – mRNA, R – Transcription
(C) P – Replication, Q – mRNA, R – Translation
(D) P – Transcription, Q – mRNA, R – Translation
8.A DNA fragment has 2500 nucleotides, out of which 240 are Guanine. How many bases having double hydrogen
bonds between them does this DNA fragment possess ?
(A) 480 (B) 720 (C) 1010 (D) 2020
9.In an experiment, E. coli is grown in a medium containing 14NH4Cl. (14N is the light isotope of Nitrogen) followed
by growing it for six generations in a medium having heavy isotope of nitrogen (15N). After six generations, their
DNA was extracted and subjected to CsCl density gradient centrifugation. Identify the correct density
(Light/Hybrid/Heavy) and ratio of the bands of DNA in CsCl density gradient centrifugation.
(A) Hybrid : Heavy, 1 : 16
(B) Light : Heavy, 1 : 31
(C) Hybrid : Heavy, 1 : 31
(D) Light : Heavy, 1 : 05
10.A DNA fragment has 2000 nucleotides, out of which 140 are Adenine. How many bases does this DNA segment
possess that have triple hydrogen bonds between them ?
(A) 280 (B) 860 (C) 1720 (D) 1860
11.In the double helical structure of DNA molecule, the strands are :
(A) identical and complementary
(B) identical and non-complementary
(C) anti-parallel and complementary
(D) anti-parallel and non-complementary
12.In a transcription unit the terminator is located towards the :
(A) 3 end of the template strand
(B) 5 end of the template strand
(C) 5 end of the coding strand
(D) 3 end of the coding strand
13.You know that there are twenty different types of naturally occurring amino acids and four different types of bases
in the DNA. A combination of 3 such bases code for a specific amino acid. If instead there are 96 different amino
acids and 12 different bases in the DNA, then the minimum number of combination of bases required to form a codon
is :
(A) 6 (B) 8 (C) 2 (D) 4
14.The type of bond represented by the dotted line_ _ _ _ in a schematic polynucleotide chain is :

(A) Hydrogen bond (B) Peptide bond (C) N-glycosidic linkage (D) Phosphodiester bond
15.Listed below are some amino acids and their corresponding mRNA codons :
Amino acid mRNA codons
Phenylalanine UUU
Lysine AAG
Arginine CGA
Alanine GCA
Select the DNA sequence that would code for the following polypeptide sequence :
Polypeptide : Alanine Arginine Lysine Phenylalanine
(A) CGT GCT TTC AAA (B) CGT GCT TTC TTT
(C) CGU GCU UUC AAA (D) CGU GCU UUC TTT
16.Assertion (A) : The sugar-phosphate backbone of two chains in DNA double helix show anti-parallel polarity.
Reason (R) : The phosphor-diester bonds in one strand go from a 3' carbon of one nucleotide to a 5' carbon of adjacent
nucleotide, whereas those in complementary strand go vice versa.
17.Assertion (A) : Primary transcripts in eukaryotes are subjected to splicing to remove the introns.
Reason (R) : Primary transcripts contain both exons and introns and the introns are non-functional in eukaryotes.
18.Assertion (A) : RNA is unstable and can mutate at a faster rate.
Reason (R) : The presence of 2 OH group in every nucleotide of RNA makes it labile and easily degradable.
19.If the base adenine constitutes 31% of an isolated DNA fragment, then write what will be the expected percentage
of the base cytosine in it. Explain how did you arrive at the answer given. 2
20.Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and
answer the questions that follow :3
mRNA 5 UCAUUACCACGAUUCUUUAAAAGA
(a) How many amino acids will be formed from the given codons, if substitution of U by C takes place at the 5th
codon ? Explain your answer.
(b) Write the number of amino acids that would be in the polypeptide synthesised by a similar mRNA as above, where
in the fourth codon instead of C there is U. Justify your answer.
21.(a) Why does DNA replication occur within a replication fork and not in its entire length simultaneously ?
(b) “DNA replication is continuous and discontinuous on the two strands within the replication fork.” Explain with the
help of a schematic representation. 3
22.Explain the processing of heterogeneous nuclear RNA (hnRNA) into a fully functional mRNA in eukaryotes.
Where does this processing occur in the cell ? 3
23.(a) Name and write two characteristics of the type of DNA that forms the basis of DNA fingerprinting technique. 2
(b) Mention any two applications of this technique.0.5x2=1
24.(a) Identify the picture given below and name the tool under which it was viewed.
(b) What do the dark spots represent in the picture ? Explain how and why are they formed. 2
25.In case of any dispute, a very small sample of tissue or even a drop of blood can help us to determine the paternity
of a child. Provide a scientific explanation to substantiate the statement.3
(a) Explain the process by which amino acid gets attached to the t-rna molecule during translation process.
(b) How does the translation process get terminated ?
(c) Expand UTR Where are they located ? 3
26.Stability, as one of the properties of genetic material, was very evident in one of the very early experiments in
genetics. Name the scientist and describe his experiment. State the conclusion he arrived at. 5
(i) Construct a transcription unit with a coding strand given below with proper labelling 2

(ii) When does a coding strand become a template strand ? 1

(iii) Why does a double-helix DNA molecule transcribe into a single-stranded RNA molecule ?2
27.(i) Draw a schematic, self-explanatory labelled diagram of lac operon in switched on condition . 4
(ii) Why is regulation of lac operon referred to as negative regulation ? 1
28.Explain Griffiths experiment conducted in search of genetic material and write the conclusion he arrived at. How
did Avery, MacLeod and McCarty establish the biochemical nature of Genetic material identified by Griffith ?5
29.Answer the following questions that are based on Hershey and chase experiment using E. coli and bacteriophage :
(i) Why did they use radioactive sulphur 35S and radioactive phosphorus 32P in their respective culture media for
growing E. coli population which subsequently were infected by bacteriophage ?
(ii) State the purpose of their using the following :
(1) Blender
(2) Centrifuge
(iii) Write the observations they made during the course of their experiment.
(iv) Based on the results, write the conclusion they arrived at the end of their experiment.
30.(i) Describe the process of transcription in prokaryotes with respect to initiation, elongation and termination.
(ii) Write how many types of RNA polymerases are used in transcription in
(1) Prokaryotes,
(2) Eukaryotes. 5
31.Read the following passage :
Generally, in eukaryotic cells the average length of a transcription unit along a DNA molecule is about 8,000
nucleotides, so the RNA product of the transcription is also that long. But it only takes about 1200 nucleotides from
the above RNA product to translate average sized polypeptide of 400 Amino
acids.
(a) Name this RNA product transcribed from the DNA that subsequently translates into a polypeptide of 400 amino
acids. Mention the enzyme responsible for transcribing this type of RNA from the DNA. 1
(b) Name and explain the process the RNA molecule transcribed from 8000 nucleotide long DNA undergoes to be
able to translate a polypeptide of 400 amino acids. 2
(c) Write the number of RNA polymerases involved in the transcription of DNA in a prokaryote and eukaryotes. 1
32.(a) Study the schematic diagram given below and answer the questions that follow :

(i) Identify the polarity from „X‟ to „ X ‟ in the mRNA segment shown. Mention how many more amino acids can be
added to the polypeptide that is being translated and why. 1½
(ii) Write the initiating codon for translation, its anticodon and the amino acid it codes for. 1½
(iii) Explain the charging of an adaptor molecule. Why this molecule needs to be charged ? 2
33.Explain the process of transcription in prokaryotes. How is it different from transcription in eukaryotes ? 5