Turkish Journal of Veterinary and Animal Sciences Turk J Vet Anim Sci

(2019) 43: 408-422

http://journals.tubitak.gov.tr/veterinary/
© TÜBİTAK
Research Article doi:10.3906/vet-1812-36

Isolation and molecular characterization of Salmonella enterica and Escherichia coli

from poultry samples
Aylin CESUR, Sacide Özlem ULUTAŞ, Yeşim SOYER*
Department of Food Engineering, Faculty of Engineering, Middle East Technical University, Ankara, Turkey

Received: 11.12.2018 Accepted/Published Online: 22.05.2019 Final Version: 11.06.2019

Abstract: Innumerable foodborne pathogens including Salmonella and Escherichia coli pose a serious threat to human health and
food safety. As perishable foods, poultry products are considered one of the most common sources of foodborne pathogens including
Salmonella and E. coli due to transmission of drug resistance, dissemination of organisms, and cross-contamination. In our study,
phenotypic and genotypic characterizations of Salmonella enterica and E. coli isolated from packaged raw chicken products were carried
out. Samples belonging to different commercial brands were collected in Ankara in 2015. Among 15 out of 19 Salmonella enterica subsp.
enterica strains isolated from different and/or same poultry samples were found as Infantis serotype, while 4 of them were identified as
Enteritidis serotype by pulsed-field gel electrophoresis (PFGE) footprints. In addition, 19 out of 40 samples gave positive results for E.
coli. In addition, PFGE types of Salmonella Infantis isolates were detected as PT 08, 45, and 50. Furthermore, multilocus sequence typing
types of the samples were identified as ST 32. Results of the phenotypic and genotypic antimicrobial resistance profiles of Salmonella
Infantis and E. coli isolates revealed considerable resistance to nalidixic acid, tetracycline, streptomycin, sulfisoxazole and trimethoprim/
sulfamethoxazole. On the other hand, 3 E. coli isolates showed antibiotic susceptibility. All in all, this study might enlighten some
molecular features of Salmonella and E. coli isolated from chicken products in Turkey.

Key words: Antimicrobial resistance, pulsed-field gel electrophoresis, multilocus sequence typing, Salmonella, E. coli

1. Introduction enterica subsp. enterica might lead to symptoms such as

Food might act as a crucial vehicle for transmission of gastrointestinal infections and bloody diarrhea within 12
illnesses from animals to humans. Foodborne zoonotic to 72 h (6). The most common Salmonella enterica serovars
pathogens, mainly Campylobacter spp., Salmonella are Enteritidis, Typhimurium, and Infantis isolated
spp., and Shiga toxin producing E. coli, accommodate from broilers, turkeys, pig meat, and human sources in
in intestinal tract of chicken, cattle, and swine and may Europe (7), however, in the USA, Kentucky, Enteritidis,
induce foodborne diseases (1,2). Zoonotic bacteria present Montevieo, Typhimurium and Infantis are frequently
in poultry pose a major risk for both poultry industry observed serotypes in animal products (8). According to
and human health by increasing antibiotic resistance and the European Food Safety Authority and the European
contamination. To illustrate, more than 50 Salmonella Centre for Disease Prevention and Control, among a total
infections in live poultry were observed, resulting in 2630 of 4786 foodborne outbreaks, Salmonella has been the
illnesses, 387 hospitalizations, and 5 deaths in the USA most frequently detected foodborne pathogen, including
from 1999 to 2014 (3). Moreover, avian pathogenic E. coli Salmonella serovar Enteritidis and Infantis (9). Furthermore,
might lead to serious flock mortality (4). In addition, E. coli the most significant increase in Salmonella infections was
outbreaks occurred in France and Germany in 2011 due due to serotype Infantis in 2016 (10). Although Turkey
to verocytotoxin producing E. coli. A total of 3126 cases occupies an important position in exporting chicken
and 17 deaths related to this bacterium were reported in meat products, the data related to foodborne infections in
Germany and the European Union (EU) (5). Turkey is inadequate. Global food trading has expedited the
Salmonellosis, a nontyphoidal Salmonella infection, emergence and spread of antibiotic resistant Salmonella.
has been gradually increasing in Turkey and in other Hence, our study might provide useful information to trace
countries as a consequence of consuming poultry meat the footprints of Salmonella outbreaks originating from the
and its derivatives. Salmonellosis caused by Salmonella poultry products in Turkey.
* Correspondence: [email protected]
408

This work is licensed under a Creative Commons Attribution 4.0 International License.
 CESUR et al. / Turk J Vet Anim Sci

Multidrug-resistant strains have become more at –80 °C at Middle East Technical University, Department
difficult to treat in recent years. The question of how of Food Engineering.
antibiotic resistant bacteria acquire resistance maintains 2.2. Isolation of Salmonella
its importance. For example, resistance to ampicillin, For Salmonella isolation, the international standard
tetracyclines, and sulfonamides in Salmonella was ISO6579:2002 was used. After 25 g of sample from each
commonly determined (9). In addition, extended- chicken product were incubated in buffered peptone
spectrum beta-lactamases (ESBL) and AmpC- water at 37 °C overnight, 1 mL of each broth sample was
carbapenemase production monitored in Salmonella transferred to 10 mL Rappaport Vassiliadis soya peptone
and E.coli (9). Moreover, antibiotic-resistant Salmonella broth (RVS broth, CM0866 Oxoid) and incubated at 44 °C
Infantis has been one of the prevalent serovars in poultry for 24 h. Ten microliter of RVS broth from each sample was
products (11). Microbial subtyping has an important role in spread on the Brilliant Green Agar (BGA, CM0263 Oxoid)
classification and characterization of foodborne pathogens plate and Xylose-Lysine-Desoxycholate Agar (XLD Agar,
such as Salmonella and E. coli (12). There are two types CM0469 Oxoid) plate and incubated at 37 °C for 24 h. At
of typing methods consisting of phenotypic and genotypic least three red colonies with black centers on XLD agar,
typing methods. While serotyping, phage-typing, and and pink colored colonies on BGA agar were selected as
antimicrobial resistance typing, which are phenotype- Salmonella. To confirm the suspected Salmonella colonies,
based typing methods, are used for Salmonella (12), and invA gene was screened by PCR (19). For one sample, 15.5
serotyping, biotyping, phage typing, and multilocus μL ddH2O, 5 μL 5X Go Taq Flexi Buffer, 1.5 μL MgCI2,
enzyme electrophoresis are commonly used for E. coli (13). 0.5 μL dNTPs, 1.0 μL of each primer (Forward primer:
On the other hand, mostly applied genotypic subtyping GAATCCTCAGTTTTTCAACGTTTC; Reverse primer:
methods for Salmonella and E. coli are pulsed-field gel TAGCCGTAACAACCAATACAAATG (19)) and 0.125
electrophoresis (PFGE), multiplelocus variable-number μL GoTaq DNA polymerase and 0.375 μL DNA template
tandem repeat Analysis (MLVA), ribotyping, plasmid were prepared under the following conditions: initial
profile analysis, and multilocus sequence typing (MLST) denaturation at 94 °C for 10 min, denaturation at 94 °C
(12,13). PFGE associated with gold standard method uses for 60 s, annealing at 60 °C for 60 s, extension at 72 °C
restriction enzymes specified by uncommon recognition for 60 s with 35 cycles, and the last extension for 72 °C
sites such as XbaI, BlnI, SpeI, AvrII, resulting in large for 7 min. Three of the confirmed Salmonella colonies
DNA fragments varying from 20 kb to 800 kb (12,14,15). from each sample were frozen in glycerol stock and stored
Moreover, the sequences of multiple housekeeping genes, in our foodborne pathogen database with a Middle East
which are highly conserved, are analyzed in MLST Technical University Identification (METU ID) as “MET”,
method (16). For Salmonella MLST scheme, the most resulting in a total of 57 Salmonella strains which are
commonly used housekeeping genes are aroC, dnaN, shown in Table 1.
hemD, hisD, purE, sucA, and thrA (17), while for E. coli 2.3. E. coli isolates
MLST scheme, adk, fumC, gyrB, icd, mdh, purA, and recA E. coli strains (Table 1) were isolated from 40 packaged
are some examples for housekeeping genes (18). All in raw chicken products as per the international standard
all, our study aimed to investigate the genetic diversity of ISO16654:2001 in a parallel way with the isolation of
Salmonella and E.coli isolated from raw chicken products Salmonella strains. Yellow colonies on XLD agar were
by PFGE using restriction enzyme XbaI, and MLST. chosen as E. coli. These selected colonies were incubated
Furthermore, the resistance of Salmonella and E.coli on Brain Heart Infusion (BHI, CM1136 Oxoid) agar
isolates to antimicrobials was tested both phenotypically plate at 37 °C for 24 h. To confirm the selected colonies
and genotypically. Additionally, biofilm forming abilities as E. coli, rpoB gene was screened by PCR. For one
of Salmonella isolates were analyzed. sample, 16.25 μL ddH2O, 2.5 μL 10X Buffer solution,
1.5 μL MgCI2, 0.5 μL dNTPs, 1.0 μL of each primer
2. Materials and methods (Forward: GTATGTCCAATCGAAACCCCT; Reverse:
2.1. Poultry samples GGTAGTGAATTTCGTCAGTTACA (20)), 0.25 μL
Forty packaged raw chicken products belonging to 2.5 U Taq DNA Polymerase, and 2 μL DNA template
different commercial brands from the local markets in were prepared under the following conditions: initial
Ankara were collected in 2015 (Table 1). In order to isolate denaturation at 94 °C for 10 min, denaturation at 94 °C
Salmonella and E.coli strains, raw chicken materials were for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for
categorized into seven different parts, namely chicken 30 seconds, with 35 cycles and the last extension for 72 °C
breast, wing, heart, gizzard, rib, chop, and drumstick for 5 min. Confirmed isolates were frozen as mentioned
(Table 1). All isolates were freezed in 15% glycerol solution above.

409
 CESUR et al. / Turk J Vet Anim Sci

Table 1. Bacterial strains isolated from packaged raw chicken products.*

Isolate code Isolate source Brand** Bacterial strain Isolation date Location
MET S1-750 Chicken wing Z Salmonella Infantis 26.01.2015 Ankara
MET S1-753 Chicken heart V Salmonella Infantis 26.01.2015 Ankara
MET S1-756 Chicken drumstick V Salmonella Enteritidis 26.01.2015 Ankara
MET S1-759 Chicken breast Y Salmonella Infantis 28.01.2015 Ankara
MET S1-762 Chicken gizzard Z Salmonella Enteritidis 28.01.2015 Ankara
MET S1-765 Chicken breast Z Salmonella Infantis 28.01.2015 Ankara
MET S1-768 Chicken wing W Salmonella Enteritidis 01.02.2015 Ankara
MET S1-771 Chicken breast W Salmonella Enteritidis 01.02.2015 Ankara
MET S1-774 Chicken rib W Salmonella Infantis 01.02.2015 Ankara
MET S1-777 Chicken drumstick P Salmonella Infantis 01.02.2015 Ankara
MET S1-780 Chicken wing P Salmonella Infantis 01.02.2015 Ankara
MET S1-782 Chicken wing P Salmonella Infantis 01.02.2015 Ankara
MET S1-785 Chicken drumstick P Salmonella Infantis 01.02.2015 Ankara
MET S1-788 Chicken breast M Salmonella Infantis 01.02.2015 Ankara
MET S1-792 Chicken heart Q Salmonella Infantis 02.02.2015 Ankara
MET S1-795 Chicken breast Q Salmonella Infantis 02.02.2015 Ankara
MET S1-798 Chicken heart Q Salmonella Infantis 26.02.2015 Ankara
MET S1-801 Chicken breast Q Salmonella Infantis 26.02.2015 Ankara
MET S1-804 Chicken wing Q Salmonella Infantis 26.02.2015 Ankara
MET A1-001 Chicken breast W Escherichia coli 01.02.2015 Ankara
MET A1-002 Chicken drumstick P Escherichia coli 01.02.2015 Ankara
MET A1-003 Chicken wing Q Escherichia coli 02.02.2015 Ankara
MET A1-004 Chicken drumstick P Escherichia coli 01.02.2015 Ankara
MET A1-005 Chicken drumstick J Escherichia coli 27.01.2015 Ankara
MET A1-007 Chicken wing W Escherichia coli 01.02.2015 Ankara
MET A1-008 Chicken breast Q Escherichia coli 02.02.2015 Ankara
MET A1-009 Chicken chop Q Escherichia coli 02.02.2015 Ankara
MET A1-010 Chicken wing P Escherichia coli 01.02.2015 Ankara
MET A1-011 Chicken wing Q Escherichia coli 02.02.2015 Ankara
MET A1-012 Chicken wing Q Escherichia coli 02.02.2015 Ankara
MET A1-014 Chicken wing Z Escherichia coli 27.01.2015 Ankara
MET A1-015 Chicken drumstick Q Escherichia coli 02.02.2015 Ankara
MET A1-016 Chicken wing P Escherichia coli 01.02.2015 Ankara
MET A1-017 Chicken chop W Escherichia coli 01.02.2015 Ankara
MET A1-018 Chicken drumstick P Escherichia coli 01.02.2015 Ankara
MET A1-019 Chicken wing Q Escherichia coli 02.02.2015 Ankara
MET A1-020 Chicken drumstick W Escherichia coli 01.02.2015 Ankara
MET A1-021 Chicken drumstick P Escherichia coli 01.02.2015 Ankara

* Bold Salmonella Infantis and Escherichia coli isolates were used in this study.
** Commercial brands’ names were substituted by the letters.

410
 CESUR et al. / Turk J Vet Anim Sci

2.4. Pathogenicity of E. coli isolates suspension buffer. After the absorbance of the mixture
E. coli is composed of various groups of bacteria. Pathogenic of cell and the buffer was fixed to 1.3–1.4 at 610 nm by
E. coli strains are divided into several pathotypes. In the spectrophotometer, 20 μL of proteinase-K was added
our study, the genes (Table 2) related with Shigatoxin- to 400 μL of mixture for each sample. Plugs were formed
producing E. coli (STEC), Enteropathogenic E. coli (EPEC), including Seakem Agarose with 1% SDS and cell-buffer
Enterotoxigenic E. coli (ETEC), Enteroinvasive E. coli mixtures. They were added to 5 mL of cell lysis buffer
(EIEC), Enteroaggregative E. coli (EAEC), and Diffusely and washed with sterile deionized water two times and
Adherent E. coli (DAEC) were screened by PCR (21–28). then washed with Tris-EDTA (TE) buffer four times at 50
Confirmed isolates were frozen as mentioned above. °C. DNA restriction was done by XbaI at 37 °C for 4 h.
2.5. PFGE typing of bacterial strains Restricted DNACHEF-DR III was run with the reference
PFGE analysis, known as a gold standard for both strain Salmonella Braenderup H9812 by BioRad under
Salmonella and E. coli, was carried out according to the specified PFGE electrophoresis conditions: 6.0 V/cm,
PulseNet protocol (29). Isolates streaked on BHI agar 19 h, 120°, 2.16–63.8 s, and 70 (0.75 dm3/min). DNA
were incubated at 37 °C for 14–18 h. Using sterile cotton bands were screened using Quantity One software and
swabs, the cultures were transferred to 4 mL of cell Molecular Imager-Gel Doc-XR System Universal Hood II.

Table 2. Primers used in determining pathogenicity of E. coli isolates.

Annealing Product
Gene Primer Sequences Reference
temperature (°C) size (bp)
F: AGCTGCAACGGTAAGTGATTT
fliC 65.0 949 (21)
R: GGCAGCAAGCGGGTTGGTC
F: TGTCGCATAGTGGAACCTCA
stx1 65.0 655 (22)
R: TGCGCACTGAGAAGAAGAGA
F: CCATGACAACGGACAGCAGTT
STEC genes stx2 65.0 477 (23)
R: TGTCGCCAGTTATCTGACATTC
F: CATTATGGAACGGCAGAGGT
eae 65.0 375 (22)
R: ACGGATATCGAAGCCATTTG
F: CAGGTGAAGGTGGAATGGTTGTC
rfbE 65.0 296 (24)
R: TTAGAATTGAGACCATCCAATAAG
F: GCGAGCTAAGCAGCTTGAAT
hlyA 65.0 199 (22)
R: CTGGAGGCTGCACTAACTCC
F: AATGGTGCTTGCGCTTGCTGC
bfpA 59.0 326 (25)
R: GCCGCTTTATCCAACCTGGTA
EPEC genes
F: CAGGGTAAAAGAAAGATGATAA
eaf 59.0 397 (26)
R: TATGGGGACGTATTATCA
F: ATTTTTMTTTCTGTATTRTCTT
st 50.0 190 (27)
R: CACCCGGTACARGCAGGATT
ETEC genes
F: GGCGACAGATTATACCGTGC
lt 50.0 450 (27)
R: CGGTCTCTATATTCCCTGTT
F: GTTCCTTGACCGCCTTTCCGATACCGTC
EIEC gene ipaH 60.0 619 (28)
R: GCCGGTCAGCCACCCTCTGAGAGTAC
F: CGAAAAAGAGATTATAAAAATTAAC
EAEC gene aggR 60.0 100 (28)
R: GCTTCCTTCTTTTGTGTAT
F: TGAACGGGAGTATAAGGAAGATG
DAEC gene daaD 60.0 444 (28)
R: GTCCGCCATCACATCAAAA

*F: forward primer, R: reverse primer.

411
 CESUR et al. / Turk J Vet Anim Sci

The pictures of PFGE gels were analyzed by BioNumerics forming biofilm in chicken flocks (33). Hence, a well-
version 7.6 (Applied-Maths, Kortrijk, Belgium). known method was implemented to observe the biofilm
2.6. MLST of Salmonella isolates forming capabilities of Salmonella strains isolated from
MLST, characterizing the isolates by considering the packaged raw chicken products (34). Salmonella Salford
internal fragments of seven house-keeping genes (Table 3), was used as a positive control in this procedure. Strains
including aroC, dnaN, hemD, hisD, purE, sucA, and thrA, were incubated at 37 °C for 16 h in 10 mL Brain Heart
was carried out (30). In addition, nucleotide sequences Infusion broth (BHI, CM1136, Oxoid). 230 μL Tryptone
were analyzed by DNASTAR Lasergene software. After Soya Broth (TSB, CM0129, Oxoid) and 20 μL of incubated
Salmonella taken from –80 °C was streaked on BHI agar Salmonella culture were transferred to sterile 96-well plates
at 37 °C overnight, a colony was incubated in BHI broth with three replicates. After the incubation at 37 °C for 24 h,
at 37 °C overnight for each sample. Cells were lysed by they were washed with 0.85% NaCI solution three times.
microwave. Lysate of Salmonella DNA were used for PCR Fixation process was done using 96% MeOH. Then, 250
mixture by applying 71.5 μL ddH2O, 10.0 μL 10X PCR μL crystal violet was added to 96-well plates and biofilm
buffer solution, 6.0 μL MgCI2, 2.0 μL dNTPs, 4.0 μL of each formations were observed.
primer given in Table 3, 0.5 μL Taq DNA polymerase and 2.8. Antimicrobial susceptibility analysis
2.0 μL DNA template for each 7 genes mentioned above 19 different antimicrobial agents, amikacin (30 μg) ,
under the following conditions: initial denaturation at 94 gentamicin (10 μg), kanamycin (30 μg), streptomycin (10
°C for 10 min, denaturation at 94 °C for 60 s, annealing at μg), ampicillin (10 μg), ceftiofur (30 μg), cefoxitin (30
60 °C for 60 s, extension at 72 °C for 60 s with 35 cycles, μg), ceftriaxone (30 μg), cephalothin (30 μg), amoxicillin-
and the last extension for 72 °C for 7 min. Salmonella clavulanic acid (20μg/10 μg), ertapenem (10 μg), imipenem
databank of University College Cork was also used in (10 μg), chloramphenicol (30 μg), nalidixic acid (30 μg),
order to determine allelic profile or sequence type. ciprofloxacin (5 μg), tetracycline (30 μg), trimethoprim-
2.7. Biofilm detection sulfamethoxazole (1.25μg/23.75 μg), and sulfisoxazole
Biofilm formations of pathogenic bacteria on abiotic (300 μg), were applied using disc diffusion method. Cell
surfaces such as stainless steel, aluminum, polystyrene and cultures were incubated in Mueller-Hinton (CM0405,
plastic, and food contact surfaces lead to serious threat Oxoid) broth at 37 °C for 2–8 h. After the incubation,
for the public human health and food industry (31,32). microbial density was adjusted to 1–2 × 108 CFU/mL with
Salmonella is one of the most prevalent microorganisms 0.5 McFarland standard. Cultures on Mueller-Hinton agar

Table 3. Primers used in amplifying seven house-keeping genes for MLST analysis of Salmonella
isolates.

Product
Gene Primer sequences Reference
size (bp)
F: GGCACCAGTATTGGCCTGCT
aroC 826 (30)
R: CATATGCGCCACAATGTGTTG
F: GTCACGGTGATCGATCCGGT
thrA 852 (30)
R: CACGATATTGATATTAGCCCG
F: ATGTCTTCCCGCAATAATCC
purE 510 (30)
R: TCATAGCGTCCCCCGCGGATC
F: AGCACCGAAGAGAAACGCTG
sucA 643 (30)
R: GGTTGTTGATAACGATACGTAC
F: GAAACGTTCCATTCCGCGCAGAC
hisD 894 (30)
R: CTGAACGGTCATCCGTTTCTG
F: ATGAGTATTCTGATCACCCG
hemD 666 (30)
R: ATCAGCGACCTTAATATCTTGCCA
F: ATGAAATTTACCGTTGAACGTGA
dnaN 833 (30)
R: AATTTCTCATTCGAGAGGATTGC

*F: forward primer, R: reverse primer.

412
 CESUR et al. / Turk J Vet Anim Sci

with discs (6 mm) were incubated at 37 °C for 16–18 h. E. hlyA (hemolysin), bfpA (BfpA protein), eaf (adherence
coli ATCC25922 was used as a control isolate for diffusion factor), st (ST enterotoxin), lt (LT enterotoxin) , ipaH
tests. Antimicrobial resistance results were adjusted (invasion plasmid antigen H), aggR (adherence factor),
according to Clinical Laboratory Standards Institute and daaD (adherence factor) could not be determined
(35,36). in E. coli isolates, used in this study. This result revealed
2.9. Antimicrobial gene screening that E. coli isolates, collected in this study, are considered
In this stage, blaTEM-1, blaPSE-1, blaCMY-2, ampC, cat1, as commensal bacteria. Moreover, occurrence of both
cat2, flo, cmlA, aadA1, aadA2, strA, strB, aacC2, aphA1- pathogenic and commensal bacteria in raw chicken
Iab, dhfrI, dhfrXII, sulI, sulII, tetA, tetB, and tetG genes products was confirmed.
(Table 4) encoding antimicrobial resistance were analyzed 3.3. Biofilm-forming capabilities of Salmonella isolates
(37–41). Purified Salmonella and E. coli DNA were used Salmonella isolates were not found to be as biofilm-
by adding 71.50 μL ddH2O, 10.0 μL 10X PCR buffer, 6.0 forming foodborne pathogens on abiotic surfaces. In
μL MgCI2, 2.0 μL dNTPs, 4.0 μL of each primer, 0.5 μL terms of forming biofilm on different surfaces such as
Taq DNA Polymerase, and 2.0 μL DNA template with the abiotic and biotic, bacterial strains might demonstrate
certain annealing temperature of the primers listed in biofilm-forming variations. Moreover, poultry-houses,
Table 4. Five microliter of PCR product with DNA marker water supply systems and climatic conditions such as
was run on 1.5% agarose gel at 110 V for 1 h. temperature and humidity play crucial roles in biofilm
formation. For further studies, abilities of biofilm
3. Results and discussion formation on food surfaces such as chicken meat might
be analyzed.
3.1. Salmonella Infantis and E.coli isolates
Nineteen Salmonella enterica subsp. enterica isolates were 3.4. PFGE Typing of Salmonella and E.coli isolates
collected from different raw chicken products (Table 1). Fifteen out of 19 Salmonella isolated from raw chicken
Fifteen out of 19 isolates were determined as Salmonella wing, heart, breast, rib and drumstick were verified as
Infantis and these 15 Salmonella Infantis isolates were Salmonella Infantis while 4 isolates were confirmed as
used in this study (Table 1). On the other hand, 19 E.coli Enteritidis.
isolated from different parts of raw chicken products were Nineteen Salmonella isolates were typed genotypically
confirmed by rpoB gene (Table 1). by PFGE (Figure 1). Fifteen of them were confirmed as
Salmonella Infantis comparing the footprints of Infantis
3.2. Pathogenicity of E. coli isolates isolates known before. Likewise, since 4 isolates shared
E. coli is the most predominant commensal bacteria found the same PFGE patterns with Salmonella Enteritidis in
in the gastrointestinal tracts of warm-blooded animals and our database, these 4 isolates were assigned as Salmonella
humans (42). On the other hand, as pathogenic bacteria Enteritidis (Figure 2). Dendograms of Infantis and
it leads to serious bacterial infections such as diarrhea, Enteritidis isolates created by BioNumerics analyses were
enteritis, septicemia, and urinary tract infection at the shown in Figures 1 and 2, respectively.
same time (43). Hence, pathogenic E. coli strains including A total of 15 Salmonella Infantis isolates, used in this
certain virulence factors are categorized considering O study, only represent three PFGE patterns (PT) (i.e. PT
(somatic) and H (flagellar) antigens (42). In other words, 08, PT 45, and PT 50). Slight variations in PFGE patterns
pathogenic E. coli influencing the human intestines are were observed. Moreover, while the majority of Infantis
classified into six main groups containing STEC, EPEC, isolates (N=13) represent PT 08, only two isolates were
ETEC, EIEC, EAEC, and DAEC (44). For example, differentiated into two different PFGE patterns, PT 45 and
confirmation of STEC strains is done by conventional PT 50; PT 45 was observed in MET S1-753, and PT 50 was
PCR marking stx, eae, and genetic codes for the O- and observed in MET S1-777. In addition, isolates verified as
H-antigens (22–25), while EPEC adherence factor and PT 08 showed multidrug resistance.
bundle-forming pilus are taken into consideration for In contrast to our study, Salmonella enterica serovar
the determination of EPEC strains (26,27). In addition, Enteritidis has been increasing in laying hens and broilers
genes expressing heat-labile (LT) and heat-stable (ST) in some European Union countries such as Greece, Poland,
enterotoxins, genetic code for the invasion related Spain, and Romania (9). On the other hand, Salmonella
pathogen antigen, virulence gene encoding Fimbria Infantis isolated from human and food sources has been
AAF/I, and F1845 fimbrial adhesion genes play crucial one of the most frequently found serovar in Brazil for
roles in identifying ETEC, EIEC, EAEC, and DAEC more than 25 years (45). In addition, Infantis still keeps
strains, respectively (27,28). Pathogenicity genes (Table posing a serious problem to public health all around the
2) including fliC (flagellar antigen), stx1 (Shiga toxin 1), world including European countries, Morocco, Japan, and
stx2 (Shiga toxin 2), eae (intimin), rfbE (O157 antigen), the USA (10, 46–48).

413
 CESUR et al. / Turk J Vet Anim Sci

Table 4. Primer sequences used in genotypic antimicrobial susceptibility.

Binding temperature
Gene Antibiotic resistance Primer sequence Reference
(oC)
F: CAGCGGTAAGATCCTTGAGA
blaTEM-1 Class A β-lactam 53.9 (37)
R: ACTCCCCGTCGTGTAGATAA
F: TGCTTCGCAACTATGACTAC
blaPS1E-1 Class A β-lactam 52.4 (37)
R: AGCCTGTGTTTGAGCTAGAT
F: TGGCCGTTGCCGTTATCTAC
blaCMY-2 Ceftiofur, Ceftriaxone 60.8 (37)
R: CCCGTTTTATGCACCCATGA
F: AACACACTGATTGCGTCTGAC
ampC β-lactams 60.0 (38)
R: CTGGGCCTCATCGTCAGTTA
F: CTTGTCGCCTTGCGTATAAT
cat1 Chloramphenicol Touchdown 55.0-45.0 (37)
R: ATCCCAATGGCATCGTAAAG
F: AACGGCATGATGAACCTGAA
cat2 Chloramphenicol 60.0 (37)
R: ATCCCAATGGCATCGTAAAG
F: CTGAGGGTGTCGTCATCTAC
flo Chloramphenicol 54.4 (37)
R: GCTCCGACAATGCTGACTAT
F: CGCCACGGTGTTGTTGTTAT
cmlA Chloramphenicol 58.5 (37)
R: GCGACCTGCGTAAATGTCAC
F: TATCAGAGGTAGTTGGCGTCAT
aadA1 Streptomycin 53.6 (39)
R: GTTCCATAGCGTTAAGGTTTCATT
F: TGTTGGTTACTGTGGCCGTA
aadA2 Streptomycin 57.3 (39)
R: GATCTCGCCTTTCACAAAGC
F: CTTGGTGATAACGGCAATTC
strA Streptomycin 51.8 (40)
R: CCAATCGCAGATAGAAGGC
F: ATCGTCAAGGGATTGAAACC
strB Streptomycin 57.0 (40)
R: GGATCGTAGAACATATTGGC
F: GGCAATAACGGAGGCAATTCGA
aacC2 Gentamicin, Kanamycin 57.9 (37)
R: CTCGATGGCGACCGAGCTTCA
F: AAACGTCTTGCTCGAGGC
aphA1-Iab Kanamycin 54.0 (41)
R: CAAACCGTTATTCATTCGTGA
F: CGGTCGTAACACGTTCAAGT
dhfrI Trimethoprim 51.7 (37)
R: CTGGGGATTTCAGGAAAGTA
F: AAATTCCGGGTGAGCAGAAG
dhfrXII Trimethoprim 57.9 (37)
R: CCCGTTGACGGAATGGTTAG
F: TCACCGAGGACTCCTTCTTC
sul1 Sulfonamide 55.6 (37)
R: CAGTCCGCCTCAGCAATATC
F:CCTGTTTCGTCCGACACAGA
sul2 Sulfonamide 56.0 (37)
R: GAAGCGCAGCCGCAATTCAT
F: GCGCCTTTCCTTTGGGTTCT
tetA Tetracycline 57.7 (37)
R: CCACCCGTTCCACGTTGTTA
F: CCCAGTGCTGTTGTTGTCAT
tetB Tetracycline 58.4 (37)
R: CCACCACCAGCCAATAAAAT
F: AGCAGGTCGCTGGACACTAT
tetG Tetracycline 60.0 (37)
R: CGCGGTGTTCCACTGAAAAC

*F: forward primer, R: reverse primer.

414
 CESUR et al. / Turk J Vet Anim Sci

Figure 1. PFGE footprints of 19 Salmonella isolates.

Figure 2. Dendogram of PFGE Types of 4 Salmonella Enteritidis isolates. *1: MET A1-001, 2: MET A1-002, 3: MET A1-003, 4: MET
A1-004, 5: MET A1-005, 7: MET A1-007, 8: MET A1-008, SB: Salmonella Braenderup H9812.

In another research, four different PFGE patterns of 3.5. MLST of Salmonella isolates
Salmonella Infantis were commonly found in human and With the PFGE pattern results of 15 Salmonella Infantis
food sources and broilers in Germany (49). Moreover, isolates, MLST types of them were identified as ST 32. Over
two PFGE patterns were found in Salmonella Infantis and above that, Infantis isolated in Brazil and Morocco has
predominantly in Hungary (50). Hereby, it might be showed the same allelic type, ST 32 (45,51).
concluded that variances in PFGE types change with 3.6. Phenotypic and genotypic antimicrobial resistance
regard to the geographical regions. And distinct PFGE analysis of Salmonella and E. coli isolates
footprints of Salmonella Infantis might be derived from The phenotypic analysis revealed that each Salmonella
high conjugative transfer rates of mobile genetic elements Infantis isolate had resistance to at least one antibiotic;
such as integrons and plasmids. all of them were resistant to nalidixic acid. Except for
PFGE analysis of 19 E. coli isolates was carried out MET S1-753, all of the Salmonella Infantis isolates were
according to PulseNet protocol (29). As can be seen in accepted as multidrug-resistant foodborne pathogens due
Figures 3 and 4, PFGE footprints were observed distinct to resistance to at least two antimicrobial agents. As can
from each other. And E. coli isolates were also certified be seen in Table 5, SfSxtNT (Sulfisoxazole-Trimethoprim/
with different footprints by PFGE dendogram in Figure 5. sulfamethoxazole-Nalidixic acid- Tetracycline)

415
 CESUR et al. / Turk J Vet Anim Sci

Figure 3. PFGE patterns of seven E.coli isolates. *009: MET A1-009, 010: MET A1-010,
011: MET A1-011, 012: MET A1-012, 014: MET A1-014, 015: MET A1-015, 016: MET
A1-016, 017: MET A1-017,018: MET A1-018, 019: MET A1-019, 020: MET A1-020,
021: MET A1-021, SB: Salmonella Braenderup H9812.

Figure 4. PFGE patterns of twelve E. coli isolates.

phenotypic antimicrobial resistance profile was the most streptomycin (53%), kanamycin (47%), chloramphenicol
observed one in Infantis isolates. To conclude, Salmonella (33%), and ciprofloxacin (13%). On the other hand, they
Infantis isolates showed antibiotic resistance significantly were susceptible to amikacin, gentamicin, ampicillin,
to nalidixic acid (100%), tetracycline (93%), sulfisoxazole ceftiofur, cephalothin, amoxicillin-clavulanic acid,
(93%), trimethoprim/sulfamethoxazole (93%), ertapenem, imipenem, ceftriaxone, and cefoxitin. Another

416
 CESUR et al. / Turk J Vet Anim Sci

Figure 5. Dendogram of PFGE types of seven E. coli isolates.

research stated that multidrug-resistant Salmonella strong biofilm-producing Salmonella Infantis strains on
Infantis detected in Hungarian broilers and humans has abiotic surface including polystyrene harbored floR, cmlA,
the same phenotypic antimicrobial resistance profile tetA, tetB, tetG, temB, blaPS1E-1, sul1, sul2, qnrA, qnrS, strA,
including nalidixic acid, sulphonamide, streptomycin, and and aadA antibiotic resistance genes in Malaysia (57). In
tetracycline as the recent Infantis strains dominating in summary, a lot of studies reveal highly antibiotic resistance
Poland, Austria, and Hungary (47). Likewise, Salmonella of Salmonella Infantis from poultry to ampicillin, nalidixic
Infantis isolates from broilers were found mostly resistant acid, streptomycin, sulphonamide and tetracycline
to streptomycin and sulfamethoxazole, trimethoprim as (58). In addition to this, blaTEM-1 conferring resistance to
well in Japan (48). In addition, Salmonella Infantis isolated extended-spectrum beta-lactamase was confirmed in two
from broiler chickens indicated multidrug resistance via Infantis isolates of this study (MET S1-759 and MET S1-
large conjugative plasmid in Hungary (50). Furthermore, 765). Nontyphoidal Salmonella might acquire resistance
Salmonella Infantis showed resistance to third generation to extended-spectrum beta-lactam antibiotics because of
cephalosporins in Belgium, due to plasmid acquisition plasmid-mediated AmpC-type beta lactamases (59).
(52). Salmonella Infantis isolated from clinical sources E. coli is part of the intestinal tract of chickens, and
also showed antibiotic resistance in China (53). In some acts as a commensal bacterium unless any deterioration in
patients infected with Salmonella antibiotic treatment the gut microbiota happens (60). Otherwise, E. coli might
might be required; fluoroquinolones and third-generation overgrow and lead to extraintestinal infections. Enteric
cephalosporins are used for adults and children, bacteria frequently demonstrate resistance to a broad array
respectively. Thus, resistance to these antibiotics might of antibiotics such as ampicillin and tetracycline by means
conduce to treatment failure. In contrast to the phenotypic of antimicrobials extensively used in poultry production
antibiotic resistance profiles of Salmonella Infantis isolates (61). In this study, 3 out of 19 E. coli isolates including
used in this study, their genotypic antibiotic resistance MET A1-014, MET A1-017, META1-018 were found as
profiles consisting of tetA (100%), aadA1 (93%), sul1 susceptible to antibiotic agents. On the other hand, in their
(86%), aphA1-IAB (66%), strA (20%), blaTEM-1 (13%), and genotypic profiles, antibiotic resistance genes including
cmlA (6%) were identified. However, blaPS1E-1, blaCMY-2, aadA2, strB (in MET A1-014), aadA1, blaTEM-1 (in MET
ampC, cat1, cat2, flo, aadA2, strB, aacC2, dhfrI, dhfrXII, A1-017), aphA1-IAB, blaTEM-1,, blaCMY-2 (in MET A1-018)
sul2, tetB, and tetG were not detected in Infantis isolates. In were found respectively. The rest of isolates except for
China, tetA, tetB, tetC, tetG, sul1, sul2, sul3, floR, blaTEM, and MET A1-009 having cephalotin resistance demonstrated
blaCTX-M were commonly determined in Salmonella enterica resistance to more than two antimicrobials in phenotypic
serovar Enteritidis and Typhimurium isolated from broiler level (Table 5). Antibiotic resistant commensal E. coli
chickens (54). Moreover, the predominance of AmpC isolates showed resistance to ciprofloxacin (69%), nalidixic
β-lactamase CMY-2 producing Salmonella isolated from acid (69%), tetracycline (63%), sulfisoxazole (63%),
chicken meat products in Japan have increased between ampicillin (63%), streptomycin (50%), cephalotin (44%),
2005 and 2011 (55). In other studies, blaTEM-1, strA, strB, trimethoprim/sulfamethoxazole (44%), chloramphenicol
sul2, tetB, catA1, aphA-1, and class 1 integron including (38%), kanamycin (31%), gentamicin (25%), cefoxitin
folA, catB3, aadA4, and sul1 gene cassettes were found in (13%), amoxicillin-clavulanic acid (13%), ceftriaxone
Salmonella Infantis isolated from human, animals and the (6%), ceftiofur (6%), and ertapenem (6%). They were
environment in Italy (56), and tetA, aadA1a, and aphA1- found susceptible to amikacin, and imipenem. In another
IAB were ascertained in Salmonella Infantis isolates from recent study, E. coli isolated from food-producing animals
poultry in Japan (48). In contradistinction to our study, of two poultry farms in Brazil showed high resistance to

417
 CESUR et al. / Turk J Vet Anim Sci

Table 5. Phenotypic and genotypic antimicrobial resistance profiles of Salmonella Infantis and E.coli isolates.

Phenotypic antimicrobial Genotypic antimicrobial

Isolate code
resistance profile resistance profile
Salmonella Infantis isolates
MET S1-750 SfSxtKNT aadA1, aphA1-IAB, sul1, tetA
MET S1-753 N aadA1, aphA1-IAB, tetA
MET S1-759 SfSxtNT blaTEM-1, aadA1, aphA1-IAB, sul1, tetA
MET S1-765 SfSxtKNT aadA1, aphA1-IAB, blaTEM-1, cmlA, sul1, tetA
MET S1-774 SfSxtKSNT aphA1-IAB, sul1, tetA
MET S1-777 SfSxtSCipNT aadA1, sul1, tetA
MET S1-780 SfSxtKNT aadA1, aphA1-IAB, sul1, tetA
MET S1-782 SfSxtKSNT aadA1, aphA1- IAB, strA, sul1, tetA
MET S1-785 SfSxtCSNT aadA1, sul1, tetA
MET S1-788 SfSxtCSCipNT aadA1, strA, sul1, tetA
MET S1-792 SfSxtSNT aadA1, aphA1-IAB, sul1, tetA
MET S1-795 SfSxtNT aadA1, strA, sul1, tetA
MET S1-798 SfSxtCSNT aadA1, tetA
MET S1-801 SfSxtCKSNT aadA1, aphA1-IAB, sul1, tetA
MET S1-804 SfSxtCKNT aadA1, aphA1-IAB, sul1, tetA
E. coli Isolates
MET A1-001 CroEftAmpAmcFoxKf ampC, blaTEM-1, blaCMY-2,
MET A1-002 AmpAmcFoxKf strB
MET A1-003 SfSxtCCnKSCipNAmpT aadA1, aadA2, aphA1-IAB, blaTEM-1, dhfrI, flo, strA, strB, sul1, sul2, tetA
MET A1-004 CipN -
MET A1-005 SfSxtCnKCipNAmpT aadA1, aadA2, aphA1-IAB, blaTEM-1, tetA
MET A1-007 SAmpKf aadA1, blaTEM-1
MET A1-008 SfSxtCKSCipNAmpTKf aphA1-IAB, blaTEM-1, cat1, strA, strB, sul2
MET A1-009 Kf strB
MET A1-010 SfSxtCCnSCipNAmpT aadA1, blaTEM-1, dhfrI, flo, strB, sul2, tetA
MET A1-011 SfSCipNT strA, strB, sul1, tetA
MET A1-012 SfKCipNT aadA1, aadA2, tetA
MET A1-014 Susceptible aadA2, strB
MET A1-015 SfSxtCSCipNAmpT aadA1, aadA2, aphA1-IAB, blaTEM-1, flo, strB, sul1, sul2, tetA
MET A1-016 SfSxtCCnSCipNAmpTKf aadA1, aphA1-IAB, dhfrI, flo, strB, sul1, sul2, tetA
MET A1-017 Susceptible aadA1, blaTEM-1
MET A1-018 Susceptible aphA1-IAB, blaTEM-1, blaCMY-2
MET A1-019 SfSxtCKSCipNAmpTKf aphA1-IAB, cat1, strB, sul2
MET A1-020 SfT tetA
MET A1-021 CipNEtp aadA2, blaTEM-1

*Cro: ceftriaxone, Eft: ceftiofur, Imp: imipenem, Ak: amikacin, Cn: gentamicin, Amc: amoxicillin-clavulanic acid, Fox: cefoxitin, Etp:
ertapenem, S: streptomycin, Sf: sulfisoxazole, Amp: ampicillin, Sxt: trimethoprim/sulfamethoxazole, K: kanamycin, C: chloramphenicol,
Cip: ciprofloxacin, Kf: cephalotin, N: nalidixic acid, T: tetracycline.

418
 CESUR et al. / Turk J Vet Anim Sci

tetracycline, nalidixic acid, ciprofloxacin, and levofloxacin North America, and Europe (61). In addition to this, CMY-
(62). Moreover, E. coli isolated from chicken-based 2 has recently been determined in Salmonella and E. coli
ready-to-eat foods demonstrated commonly resistance to isolates from different types of food animals (61). In this
tetracycline, ampicillin, and chloramphenicol in Singapore study, blaCMY-2 was found in two E. coli isolates (i.e. MET A1-
(61). Furthermore, E. coli isolates from local chicken 001 and -018), while it was not determined in Salmonella
meat products were considerably resistant to tetracycline, Infantis isolates. Although E. coli isolates were commensal
sulphonamide, ampicillin, and trimethoprim compared bacteria, they demonstrated a great variety of antibiotic
to imported chicken meat in Ghana (63), while in China resistance compared to Salmonella isolates. Intestinal tract
E. coli isolated from chickens indicated resistance to of humans and animals host numerous bacterial species and
oxytetracycline, amoxicillin, doxycycline, lomefloxacin, distinct serovars (70). Commensal bacteria perform some
ceftriaxome, ofloxacin, enrofloxacin, and florfenicol, which life-sustaining biological functions in the gastrointestinal
is a distinct phenotypic antibiotic resistance profile in some tract (71). However, usage and/or misusage of antibiotics
degree compared to the former ones (64). In addition to in human and veterinary for a long time affect normal gut
the phenotypic characterization, the genotypic antibiotic microbiota adversely (72). Moreover, commensal bacteria
resistance profiles of E. coli isolates, collected in this study, might acquire antibiotic resistance genes from pathogenic
were determined as strB (52%), aadA1 (42%), tetA (42%), bacteria via conjugative transfer such as plasmids (73).
aphA1-IAB (36%), blaTEM-1 (36%), sul2 (31%), aadA2 (31%), Hence, our commensal E. coli isolated from raw chicken
sul1 (21%), dhfrI (15%), flo (15%), strA (15%), blaCMY-2 products might possess multidrug resistance on a large
(10%), cat1 (10%), and ampC (5%). On the other hand, scale due to high conjugative rate of mobile genetic
blaPS1E-1, cat2, cmlA, aacC2, dhfrXII, tetB, and tetG were not elements. Apart from phenotypic antimicrobial resistance
found in commensal E. coli isolates. Although E. coli isolates profile, in genotypic profiles of Salmonella isolates, except
showed high resistance to ciprofloxacin, nalidixic acid, and for nalidixic acid, antimicrobial resistance genes related to
tetracycline in phenotypic level, strB and aadA1 conferring phenotypic resistance profile were detected using purified
resistance to streptomycin, and tetA for tetracycline were DNA. In E. coli isolates, various genotypic antibiotic
mostly observed in genotypic level. In other words, in some resistance profiles were found because of presence of
E. coli strains, phenotypic and genotypic profiles could not different strains.
be detected as compatible with each other. This might be
that the primers used in this study were picked mainly for 4. Conclusion
Salmonella isolates. Hence, mutations on primer binding To conclude, Salmonella Infantis isolated from raw chicken
regions might inhibit the detection. In the literature, blaCTX-M, products in Turkey indicated closely related phenotypic
blaTEM-1, aadA1, tetA, and tetB were detected in CTX-M- and genotypic antimicrobial resistance profile including
type extended spectrum β-lactamase-producing E. coli tetracycline, streptomycin, kanamycin, sulfisoxazole, and
isolated from chickens in Great Britain (65). Furthermore, nalidixic acid with other Infantis clones found in different
blaCMY-2, tetA, sul1, aac(3)-VIa, and ant(3”)-Ia were countries and/or continents. However, E. coli isolates
determined in extended-spectrum beta-lactamase (ESBL)/ were diversified. Globalization in food trading might lead
plasmidic AmpC (pAmpC) producing E. coli isolated from Infantis to be an emerging strain. Furthermore, this study
broiler parent birds in Finland (66). pAmpC β-lactamases revealed that the intestines of poultry might be a gene pool
conferring resistance to extended-spectrum cephalosporins for the commensal bacteria to acquire antibiotic resistance.
in Enterobacteriaceae, especially in E. coli, have become
threat for humans and livestock isolates (67,68). Genes of Acknowledgment:
TEM, CTX-M and SHV families are most prevalent ones This study was supported by The Scientific and
(69). Additionally, CMY-2 is the most predominant pAmpC Technological Research Council of Turkey (TÜBİTAK)
in E. coli derived from distinct continents including Asia, under project number of TUBITAK 114O180.

References
1. Thorns CJ. Bacterial food-borne zoonoses. Revue Scientifique 3. Basler C, Nguyen TA, Anderson TC, Hancock T, Behravesh
et Technique (International Office of Epizootics) 2000; 19 (1): CB. Outbreaks of human Salmonella infections associated
226-239. with live poultry, United States, 1990-2014. Emerging
Infectious Diseases 2016; 22 (10): 1705-1711. doi: 10.3201/
2. Zaidi MB, Campos FD, Estrada-García T, Gutierrez F, León M
eid2210.150765
et al. Burden and transmission of zoonotic foodborne disease
in a rural community in Mexico. Clinical Infectious Diseases 4. Dho-Moulin M, Fairbrother JM. Avian pathogenic Escherichia
2012; 55 (1): 51-60. doi: 10.1093/cid/cis300 coli (APEC). Veterinary Research 1999; 30: 299-316.

419
 CESUR et al. / Turk J Vet Anim Sci

5. European Food Safety Authority. Shiga toxin-producing 17. Harbottle H, White DG, McDermott PF, Walker RD, Zhao
E. coli (STEC) O104:H4 2011 outbreaks in Europe: Taking S. Comparison of multilocus sequence typing, pulsed-field
Stock. EFSA Journal 2011; 9 (10): 2390. gel electrophoresis, and antimicrobial susceptibility typing
for characterization of Salmonella enterica serotype Newport
6. Santos RL, Zhang S, Tsolis RM, Kingsley RA, Adams GL et
isolates. Journal of Clinical Microbiology 2006; 44 (7): 2449-
al. Animal models of Salmonella infections: Enteritis versus 2457. doi:10.1128/JCM.00019-06
typhoid fever. Microbes and Infection 2001; 3 (14-15): 1335-
18. Eichhorn I, Heidemanns K, Semmler T, Kinnemann B,
1344. doi: 10.1016/S1286-4579(01)01495-2
Mellmann A et al. Highly virulent non-O157 enterohemorrhagic
7. European Food Safety Authority. The European Union Escherichia coli (EHEC) serotypes reflect similar phylogenetic
summary report on trends and sources of zoonoses, zoonotic lineages, providing new insights into the evolution of EHEC.
agents and food-borne outbreaks in 2015. EFSA Journal 2016; Applied and Environmental Microbiology 2015; 81 (20): 7041-
14 (12): 231. doi: 10.2903/j.efsa.2016.4634 7047. doi: 10.1128/AEM.01921-15

8. USDA-FSIS (2017). Serotypes profile of Salmonella isolates 19. Kim JS, Lee GG, Park JS, Jung YH, Kwak HS et al. A novel
from meat and poultry products January 1998 through multiplex PCR assay for rapid and simultaneous detection of
December 2014 [online]. Website https://www.fsis.usda.gov/ five pathogenic bacteria: Escherichia coli O157:H7, Salmonella,
Staphylococcus aureus, Listeria monocytogenes, and Vibrio
wps/wcm/connect/3866026a-582d-4f0e-a8ce-851b39c7390f/
parahaemolyticus. Journal of Food Protection 2007; 70 (7):
Salmonella-Serotype-Annual-2014.pdf ?MOD=AJPERES.
1656-1662.
[accessed 19 March 2019].
20. Osés SM, Rantsiou K, Cocolin L, Jaime I, Rovira J. Prevalence
9. European Food Safety Authority, European Centre for Disease and quantification of Shiga-toxin producing Escherichia coli
Prevention and Control. The European Union Summary along the lamb food chain by quantitative PCR. International
Report on antimicrobial resistance in Antimicrobial resistance Journal of Food Microbiology 2010; 141: 163-169. doi:
in zoonotic and indicator bacteria from humans, animals and 10.1016/j.ijfoodmicro.2010.05.010
food in the European Union in 2015. EFSA Journal 2017; 15
21. Wang L, Rothemund D, Curd H, Reeves PR. Sequence diversity
(2): 4694.
of the Escherichia coli H7 fliC genes: Implication for a DNA-
10. Centers for Disease Control and Prevention.National based typing scheme for E. coli O157:H7. Journal of Clinical
Enteric Disease Surveillance: Salmonella Annual Report, Microbiology 2000; 38 (5): 1786-1790.
2016. Georgia, GA, USA: National Center for Emerging and 22. Bai J, Shi X, Nagaraja TG. A multiplex PCR procedure for
Zoonotic Infectious Diseases; 2018. the detection of six major virulence genes in Escherichia coli
11. Gal-Mor O, Valinsky L, Weinberger M, Guy S, Jaffe J et al. O157:H7. Journal of Microbiological Methods 2010; 82 (1): 85-
89. doi:10.1016/j.mimet.2010.05.003
Multidrug-resistant Salmonella enterica serovar Infantis,
Israel. Emerging Infectious Diseases 2010; 16 (11): 1754- 23. Fagan PK, Hornitzky MA, Bettelheim KA, Djordjevic SP.
1757. doi: 10.3201/eid1611.100100 Detection of shiga-like toxin (stx1 and stx2), intimin (eaeA),
and enterohemorrhagic Escherichia coli (EHEC) hemolysin
12. Barco L, Barrucci F, Olsen JE, Ricci A. Salmonella source (EHEC hlyA) genes in animal feces by multiplex PCR. Applied
attribution based on microbial subtyping. International and Environmental Microbiology 1999; 65 (2): 868-872.
Journal of Food Microbiology 2013; 163 (2-3): 193-203. doi:
24. Bertrand R, Roig B. Evaluation of enrichment-free PCR-based
10.1016/j.ijfoodmicro.2013.03.005
detection on the rfbE gene of Escherichia coli O157-Application
13. Fratamico PM, DebRoy C, Liu Y, Needleman DS, Baranzoni to municipal wastewater. Water Research 2007; 41 (6): 1280-
GM et al. Advances in molecular serotyping and subtyping of 1286. doi: 10.1016/j.watres.2006.11.027
Escherichia coli. Frontiers in Microbiology 2016; 7: 644. doi: 25. Botkin DJ, Galli L, Sankarapani V, Soler M, Rivas M et al.
10.3389/fmicb.2016.00644 Development of a Multiplex PCR Assay for Detection of
14. Zheng J, Keys CE, Zhao S, Ahmed R, Meng J et al. Simultaneous Shiga Toxin-Producing Escherichia coli, Enterohemorrhagic E.
analysis of multiple enzymes increases accuracy of pulsed- coli, and Enteropathogenic E. coli Strains. Frontiers in Cellular
field gel electrophoresis in assigning genetic relationships and Infection Microbiology 2012; 2: 1-10. doi: 10.3389/
fcimb.2012.00008
among homogeneous Salmonella strains. Journal of Clinical
Microbiology 2011; 49 (1): 85-94. doi: 10.1128/JCM.00120-10 26. Presterl E, Zwick RH, Reichmann S, Aichelburg A, Winkler
S et al. Frequency and virulence properties of diarrheagenic
15. Thong KL, Ngeow YF, Altwegg M, Navaratnam P, Pang
Escherichia coli in children with diarrhea in Gabon. American
T. Molecular analysis of SalmonellaEnteritidis by pulsed- Journal of Tropical Medicine and Hygiene 2003; 69 (4): 406-
field gel electrophoresis and ribotyping. Journal of Clinical 410.
Microbiology 1995; 33 (5): 1070-1074.
27. Stacy-Phipps S, Mecca JJ, Weiss JB. Multiplex PCR assay
16. Li W, Raoult D, Fournier PE. Bacterial strain typing in the and simple preparation method for stool specimens detect
genomic era. FEMS Microbiology Reviews 2009; 33 (5): 892- enterotoxigenic Escherichia coli DNA during course of infection.
916. doi: 10.1111/j.1574-6976.2009.00182.x Journal of Clinical Microbiology 1995; 33 (5): 1054-1059.

420
 CESUR et al. / Turk J Vet Anim Sci

28. Guion CE, Ochoa TJ, Walker CM, Barletta F, Cleary TG. 40. Gebreyes WA, Altier C. Molecular Characterization of
Detection of diarrheagenic Escherichia coli by use of melting- multidrug-resistant Salmonella enterica subsp. enterica
curve analysis and real-time multiplex PCR. Journal of serovar typhimurium isolates from Swine. Journal of Clinical
Clinical Microbiology 2008; 46 (5): 1752-1757. doi: 10.1128/ Microbiology 2002; 40 (8): 2813-2822.
JCM.02341-07
41. Frana TS, Carlson SA, Griffith RW. Relative distribution and
29. Ribot EM, Fair MA, Gautom R, Cameron DN, Hunter SB et al. conservation of genes encoding aminoglycoside-modifying
Standardization of Pulsed-Field Gel Electrophoresis Protocols enzymes in Salmonella enterica serotype typhimurium phage
for the Subtyping of Escherichia coli O157:H7, Salmonella, and type DT104. Applied and Environmental Microbiology 2001;
Shigella for PulseNet. Foodborne Pathogens and Disease 2006; 67 (1): 445-448. doi: 10.1128/AEM.67.1.445-448.2001
3 (1): 59-67. doi:10.1089/fpd.2006.3.59
42. Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli,
30. Harbottle H, White DG, McDermott PF, Walker RD, Zhao review. Nature Reviews Microbiology 2004; 2 (2): 123-140. doi:
S. Comparison of multilocus sequence typing, pulsed-field 10.1038/nrmicro818
gel electrophoresis, and antimicrobial susceptibility typing
for characterization of Salmonella enterica serotype Newport 43. Allocati N, Masulli M, Alexeyev MF, Di Ilio C. Escherichia
isolates. Journal of Clinical Microbiology 2006; 44 (7): 2449- coli in Europe: An overview. International Journal of
2457. doi:10.1128/JCM.00019-06 Environmental Research and Public Health 2013; 10 (12):
6235-6254. doi: 10.3390/ijerph10126235
31. Steenackers H, Hermans K, Vanderleyden J, De Keersmaecker
SCJ. Salmonella biofilms: An overview on occurrence, structure, 44. Farrokh C, Jordan K, Auvray F, Glass K, Oppegaard H et al.
regulation and eradication. Food Research International 2012; Review of Shiga-toxin-producing Escherichia coli (STEC) and
45 (2): 502-531. doi: 10.1016/j.foodres.2011.01.038 their significance in dairy production. International Journal
of Food Microbiology 2013; 162 (2): 190-212. doi: 10.1016/j.
32. Pavlickova S, Klancnik A, Dolezalova M, Mozina SS, Holko I. ijfoodmicro.2012.08.008
Antibiotic resistance, virulence factors and biofilm formation
ability in Escherichia coli strains isolated from chicken meat 45. Almeida F, Pitondo-Silva A, Oliveira MA, Falcão JP. Molecular
and wildlife in the Czech Republic. Journal of Environmental epidemiology and virulence markers of Salmonella Infantis
Science and Health- Part B Pesticides, Food Contaminants, isolated over 25 years in São Paulo State, Brazil. Journal
and Agricultural Wastes 2017; 52 (8): 570-576. doi: of Molecular Epidemiology and Evolutionary Genetics
10.1080/03601234.2017.1318637 of Infectious Diseases 2013; 19: 145-151. doi: 10.1016/j.
meegid.2013.07.004
33. Rossi DA, Melo RT, Mendonça EP, Monteiro GP. Biofilms of
Salmonella and Campylobacter in the poultry industry. Poultry 46. Ed-Dra A, Karraouan B, Allaoui AE, Khayatti M, Ossmani HE
Science InTech 2017; 93-113. doi: 10.5772/65254 et al. Isolation, antimicrobial resistance and genetic diversity of
Salmonella Infantis isolates from foods and human samples in
34. Stepanović S, Ćirković I, Ranin L, Švabić-Vlahović M. Biofilm
Morocco. Journal of Global Antimicrobial Resistance 2018; 14:
formation by Salmonella spp. and Listeria monocytogenes on
297-301. doi: 10.1016/j.jgar.2018.05.019
plastic surface. Letters in Applied Microbiology 2004; 38 (5):
428-432. doi: 10.1111/j.1472-765X.2004.01513.x 47. Nógrády N, Király M, Davies R, Nagy B. Multidrug resistant
35. CLSI. Clinical and Laboratory Standards Institute, Performance clones of Salmonella Infantis of broiler origin in Europe.
Standards for Antimicrobial Disk and Dilution Susceptibility International Journal of Food Microbiology 2012; 157 (1): 108-
Tests for Bacteria Isolated from Animals. Approved Standard— 112. doi:10.1016/j.ijfoodmicro.2012.04.007
Second Edition 2002; 22 (6): M31-A2. 48. Shahada F, Sugiyama H, Chuma T, Sueyoshi M, Okamoto
36. CLSI. Clinical and Laboratory Standards Institute, Performance K. Genetic analysis of multi-drug resistance and the clonal
Standards for Antimicrobial Susceptibility Testing. Twenty- dissemination of β-lactam resistance in Salmonella Infantis
First Informational Supplement 2011; 31 (1): M100-S21. isolated from broilers. Veterinary Microbiology 2010; 140 (1-
2): 136-141. doi: 10.1016/j.vetmic.2009.07.007
37. Chen S, Zhao S, White DG, Schroeder CM, Lu R et al.
Characterization of Multiple-Antimicrobial-Resistant 49. Miller T, Prager R, Rabsch W, Fehlhaber K, Voss M.
Salmonella Serovars Isolated from Retail Meats. Applied and Epidemiological relationship between Salmonella Infantis
Environmental Microbiology 2004; 70 (1): 1-7. isolates of human and broiler origin. Lohmann Information
2010; 2: 27-31.
38. Pérez-Pérez FJ, Hanson ND. Detection of plasmid-mediated
AmpC beta-lactamase genes in clinical isolates by using 50. Nógrády N, Tóth Á, Kostyák Á, Pászti J, Nagy B. Emergence
multiplex PCR. Journal of Clinical Microbiology 2002; 40 (6): of multidrug-resistant clones of Salmonella Infantis in broiler
2153-2162. chickens and humans in Hungary. Journal of Antimicrobial
Chemotherapy 2007; 60 (3): 645-648. doi: 10.1093/jac/dkm249
39. Randall LP, Cooles SW, Osborn MK, Piddock LJV, Woodward
MJ. Antibiotic resistance genes, integrons and multiple 51. Murgia M, Bouchrif B, Timinouni M, Al-Qahtani A, Al-Ahdal
antibiotic resistance in thirty-five serotypes of Salmonella MN et al. Antibiotic resistance determinants and genetic
enterica isolated from humans and animals in the UK. Journal analysis of Salmonella enterica isolated from food in Morocco.
of Antimicrobial Chemotherapy 2004; 53 (2): 208-216. doi: International Journal of Food Microbiology 2015; 215: 31-39.
10.1093/jac/dkh070 doi: 10.1016/j.ijfoodmicro.2015.08.003

421
 CESUR et al. / Turk J Vet Anim Sci

52. Ceyssens PJ, Mattheus W, Vanhoof R, Bertrand S. Trends 62. Ferreira JC, Penha Filho RAC, Andrade LN, Berchieri Junior
in serotype distribution and antimicrobial susceptibility in A, Darini ALC. Evaluation and characterization of plasmids
Salmonella enterica isolates from humans in Belgium, 2009 to carrying CTX-M genes in a non-clonal population of multidrug-
2013. Antimicrobial Agents and Chemotherapy 2015; 59 (1): resistant Enterobacteriaceae isolated from poultry in Brazil.
544-552. doi:10.1128/AAC.04203-14 Diagnostic Microbiology and Infectious Disease 2016; 85 (4):
444-448. doi: 10.1016/j.diagmicrobio.2016.05.011
53. Liang Z, Ke B, Deng X, Liang J, Ran L et al. Serotypes, seasonal
trends, and antibiotic resistance of non-typhoidal Salmonella 63. Rasmussen MM, Opintan JA, Frimodt- Møller N, Styrishave B.
from human patients in Guangdong Province, China, 2009- Beta-lactamase producing Escherichia coli isolates in imported
2012. BMC Infectious Diseases 2015; 15 (1): 53. doi: 10.1186/ and locally produced chicken meat from Ghana. PLoS ONE
s12879-015-0784-4 2015; 10 (10): e0139706. doi: 10.1371/journal.pone.0139706

54. Zhu Y, Lai H, Zou L, Yin S, Wang C et al. Antimicrobial 64. Li L, Wang B, Feng S, Li J, Wu C et al. Prevalence and
resistance and resistance genes in Salmonella strains isolated characteristics of extended-spectrum β-lactamase and plasmid-
mediated fluoroquinolone resistance genes in Escherichia coli
from broiler chickens along the slaughtering process in China.
isolated from chickens in Anhui Province, China. PLoS ONE
International Journal of Food Microbiology 2017; 259: 43-51.
2014; 9 (8): e104356. doi: 10.1371/journal.pone.0104356
doi: 10.1016/j.ijfoodmicro.2017.07.023
65. Toszeghy M, Phillips N, Reeves H, Wu G, Teale C et al. Molecular
55. Shigemura H, Matsui M, Sekizuka T, Onozuka D, Noda
and phenotypic characterisation of Extended Spectrum
T et al. Decrease in the prevalence of extended-spectrum
β-lactamase CTX-M Escherichia coli from farm animals in Great
cephalosporin-resistant Salmonella following cessation of
Britain. Research in Veterinary Science 2012; 93 (3): 1142-1150.
ceftiofur use by the Japanese poultry industry. International
doi: 10.1016/j.rvsc.2012.05.001
Journal of Food Microbiology 2018; 274: 45-51. doi: 10.1016/j.
ijfoodmicro.2018.03.011 66. Oikarainen PE, Pohjola LK, Pietola ES, Heikinheimo A. Direct
vertical transmission of ESBL/pAmpC-producing Escherichia coli
56. Dionisi AM, Lucarelli C, Benedetti I, Owczarek S, Luzzi limited in poultry production pyramid. Veterinary Microbiology
I. Molecular characterisation of multidrug-resistant 2019; 231: 100-106. doi: 10.1016/j.vetmic.2019.03.001
Salmonella enterica serotype Infantis from humans, animals
67. Bush K. Alarming beta-lactamase-mediated resistance in
and the environment in Italy. International Journal of
multidrug-resistant Enterobacteriaceae. Current Opinion
Antimicrobial Agents 2011; 38 (5): 384-389. doi: 10.1016/j.
in Microbiology 2010; 13 (5): 558-564. doi: 10.1016/j.
ijantimicag.2011.07.001
mib.2010.09.006
57. Chuah LO, Shamila Syuhada AK, Mohamad Suhaimi I, Farah
68. Liebana E, Carattoli A, Coque TM, Hasman H, Magiorakos AP,
Hanim T, Rusul G. Genetic relatedness, antimicrobial resistance
et al. Public health risks of enterobacterial isolates producing
and biofilm formation of Salmonella isolated from naturally
extended-spectrum β-lactamases or AmpC β-lactamases in food
contaminated poultry and their processing environment in and food-producing animals: an EU perspective of epidemiology,
northern Malaysia. Food Research International 2018; 105: analytical methods, risk factors, and control Options. Clinical
743-751. doi: 10.1016/j.foodres.2017.11.066 Infectious Diseases 2013; 56 (7): 1030-1037. doi: 10.1093/cid/
58. Papadopoulos T, Petridou E, Zdragas A, Mandilara G, Vafeas cis1043
G et al. Multiple clones and low antimicrobial resistance rates 69. Ewers C, Bethe A, Semmler T, Guenther S, Wieler LH.
for Salmonella enterica serovar Infantis populations in Greece. Extended-spectrum beta-lactamase-producing and AmpC-
Comparative Immunology, Microbiology and Infectious producing Escherichia coli from livestock and companion
Diseases 2017; 51: 54-58. doi: 10.1016/j.cimid.2017.02.002 animals, and their putative impact on public health: a global
59. Raffatellu M, Tukel C, Chessa D, Wilson RP, Baumler AJ. The perspective. Clinical Microbiology and Infection 2012; 18 (7):
intestinal phase of Salmonella infections. In: Rhen M, Maskell 646-655. doi: 10.1111/j.1469-0691.2012.03850.x
D, Mastroeni P, Threlfall EJ, editor. Salmonella: Molecular 70. Bäckhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI.
Biology and Pathogenesis. Norfolk, United Kingdom: Horizon Host-bacterial mutualism in the human intestine. Science 2005;
Bioscience; 2007. pp. 30-51. 307: 1915-1920. doi: 10.1126/science.1104816
60. Pasquali F, Lucchi A, Braggio S, Giovanardi D, Franchini A et 71. Jernberg C, Löfmark S, Edlund C, Jansson JK. Long-term impacts
al. Genetic diversity of Escherichia coli isolates of animal and of antibiotic exposure on the human intestinal microbiota.
environmental origins from an integrated poultry production Microbiology 2010; 156: 3216-3223. doi: 10.1099/mic.0.040618-0
chain. Veterinary Microbiology 2015; 178 (3-4): 230-237. doi: 72. Casals-Pascual C, Vergara A, Vila J. Intestinal microbiota
10.1016/j.vetmic.2015.05.007 and antibiotic resistance: Perspectives and solutions.
61. Guo S, Tay MYF, Aung KT, Seow KLG, Ng LC et al. Phenotypic Human Microbiome Journal 2018; 37: 1-27. doi: 10.1016/j.
and genotypic characterization of antimicrobial resistant humic.2018.05.002
Escherichia coli isolated from ready-to-eat food in Singapore 73. Penders J, Stobberingh EE, Savelkoul PHM, Wolffs PFG.
using disk diffusion, broth microdilution and whole genome The human microbiome as a reservoir of antimicrobial
sequencing methods. Food Control 2019; 99: 89-97. doi: resistance. Frontiers in Microbiology 2013; 4: 87. doi: 10.3389/
10.1016/j.foodcont.2018.12.043 fmicb.2013.00087

422