Journal of Virological Methods 255 (2018) 38–43

Contents lists available at ScienceDirect

Journal of Virological Methods

journal homepage: www.elsevier.com/locate/jviromet

A one-step multiplex real-time RT-PCR for the universal detection of all T

currently known CCHFV genotypes
Miriam A. Sasa, Ariel Vina-Rodrigueza, Marc Mertensa, Martin Eidena, Petra Emmerichb,c,
⁎
Serafeim C. Chaintoutisd, Ali Mirazimie, Martin H. Groschupa,
a
Institute of Novel and Emerging Infectious Diseases, Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, Greifswald - Isle of Riems, Germany
b
Department of Virology, Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany
c
Department of Tropical Medicine and Infectious Diseases, Center of Internal Medicine II, University of Rostock, 18057 Rostock, Germany
d
Diagnostic Laboratory, Department of Clinical Sciences, School of Veterinary Medicine, Faculty of Health Sciences, Aristotle University of Thessaloniki, Thessaloniki,
Greece
e
Department of Laboratory Medicine, Karolinska Institute, Stockholm, Sweden

A R T I C L E I N F O A B S T R A C T

Keywords: Crimean-Congo hemorrhagic fever (CCHF) is a fatal disease in humans, which is endemic in many countries of
Crimean-Congo hemorrhagic fever virus Africa, Southern Asia and Southeastern Europe. It is caused by the Crimean-Congo hemorrhagic fever virus
CCHFV (CCHFV), which is an arthropod-borne virus (arbovirus) transmitted by ixodid ticks, mainly of the genus
Multiplex RT-qPCR Hyalomma. Animals like hares, hedgehogs, cattle, camels and small ruminants can become infected without
developing clinical signs. Seroconversion occurs after a short viremia of up to two weeks, and thus ser-
oprevalence studies in ruminants can be used to reveal risk areas for the human population. Virus detection by
real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) is essential to prove an actual
circulation of CCHFV in a country and is also used as diagnostic method for acute human CCHFV infections. In
this study, a new universal one-step multiplex real-time RT-qPCR for the sensitive and specific detection of
CCHFV is presented. For this purpose, 14 new primers and 2 probes were simultaneously used to detect RNAs
representing all six CCHFV genotypes. Additionally, a GC-mirrored sequence within the synthetic RNAs enables
the discrimination between true positive samples and unintentional laboratory contaminations. CCHFV negative
samples from different animal species and ten different members of the order Bunyavirales were eventually tested
to reveal the specificity of the new RT-qPCR.

1. Introduction (Mertens et al., 2013).

The most common transmission route of CCHFV is via tick bites.
Crimean-Congo hemorrhagic fever virus (CCHFV) belongs to the Ticks, predominantly Hyalomma spp., are not only the primary vectors,
order Bunyavirales (family Nairoviridae), which includes more than 350 but also reservoirs, as the virus can circulate stably within the tick
diverse viruses. Together with Hazara virus (HAZV) CCHFV forms a population (Logan et al., 1989, Gonzalez et al., 1992, Whitehouse,
distinct serogroup within the Orthonairovirus genus. 2004). Arboviruses usually show low levels of genome diversity, per-
Crimean-Congo hemorrhagic fever (CCHF) is a zoonotic disease haps since they have adapted to different vector and host species
with a potentially fatal outcome in humans. In contrast, CCHFV infec- (Weaver, 2006). However, CCHFV does not follow this concept and
tions are asymptomatic in most animal species (Whitehouse, 2004). shows a high nucleic acid diversity of 20% in the small (S)-segment,
Clinical signs in humans are usually non-specific and vary from gas- 22% in the large (L)-segment and even 31% in the medium (M)-seg-
trointestinal to flu-like symptoms. Eponymous and characteristic he- ment which comprise the viral genome (Deyde et al., 2006). Even on
morrhages occur just in severe cases and often directly precede the amino acid level the variation is still 8% (S), 10% (L) and 27% (M)
patient’s death. Case fatality rates spanning from 5% in Turkey to 80% (Deyde et al., 2006). Thereby, CCHFV acts more like a typical RNA
in China (Yen et al., 1985, Yilmaz et al., 2009) have been reported. This virus, being especially susceptible to mutations due to the high error
broad variation might depend on awareness of the population, effec- rate of the RNA dependent RNA polymerase (Holland and Esteban,
tiveness of the public health system and the circulating virus strain 1998).

⁎
Corresponding author.
E-mail address: martin.groschup@fli.de (M.H. Groschup).

https://doi.org/10.1016/j.jviromet.2018.01.013
Received 3 September 2017; Received in revised form 25 January 2018; Accepted 25 January 2018
Available online 31 January 2018
0166-0934/ © 2018 Elsevier B.V. All rights reserved.
M.A. Sas et al. Journal of Virological Methods 255 (2018) 38–43

CCHFV circulates in many countries of Southeastern Europe, Table 1

Southern Asia and Africa (Hoogstraal, 1979), and strains can be Members of the order Bunyavirales tested for the evaluation of analytical specificity.
grouped phylogenetically into six genotypes (Bente et al., 2013, Carroll
Family / Genus Virus Strain
et al., 2010). These genotypes can be assigned to different geographic
areas: I – West Africa, II – Central Africa, III – South and West Africa, IV Hantaviridae / Orthohantavirus Puumalaa Sotkamo
– Asia and Middle East, V – South and East Europe, VI – Europe Tulaa Moravia
Nairoviridae / Orthonairovirus Hazara JC 280
(AP92group) (Bente et al., 2013).
Peribunyaviridae / Orthonairovirus Akabaneb A347
Over the last decade, real-time quantitative reverse transcription Schmallenbergc BH80/11-4
polymerase chain reaction (RT-qPCR) has become more and more im- Bataid 53.2 Germany
portant for CCHF diagnosis and research. It presents a reliable, fast and Bunyamwerad VR-87
safe method and allows identification of the biosafety level 4 pathogen Ngarie Mauritania 2010
Phenuiviridae / Phlebovirus Rift-Valley feverf MP-12
CCHFV, even in facilities with lower biosecurity levels. The pre-
Uukuniemig unknown
dominant problem in CCHFV RT-qPCR development has always been
the high genetic diversity of this virus (Deyde et al., 2006). The most a
Kindly provided by Detlev H. Krüger (Charité Center Diagnostic Laboratory and
common approach to this issue is to include additional primers and Preventive Medicine, Institute of Virology, Berlin, Germany) and Rainer Ulrich (Institute
probes, which target especially diverse virus strains, to cover all gen- of Novel and Emerging Infectious Diseases, FLI, Greifswald, Germany).
b
Kindly provided by Peter Kirkland (Elizabeth Macarthur Agriculture Institute, New
otypes of CCHFV (Wolfel et al., 2007, Jaaskelainen et al., 2014). An-
South Wales, Australia).
other option is to target the forward primer to the 5′ non-coding Or- c
Kindly provided by Kerstin Wernike (Institute of Diagnostic Virology, FLI, Greifswald,
thonairovirus specific end of the (S)-segment (Atkinson et al., 2012). In Germany) (Hoffmann et al., 2012).
contrast to that, the approach in this study was to design specific primer d
Kindly provided by Jonas Schmidt-Chanasit (Bernhard Nocht Institute for Tropical
sets for each of the six known CCHFV genotypes. Furthermore, one Medicine, Hamburg, Germany).
e
degenerate primer pair for the detection of all genotypes and two (Eiden et al., 2014).
f
Kindly provided by Richard Elliot (University of Glasgow, Centre for Virus Research,
probes were added. To the knowledge of the authors, this is the first
United Kingdom).
one-step multiplex real-time RT-qPCR using genotype-specific primer g
Kindly provided by Manfred Weidmann (University of Stirling, Institute of
sets for the reliable and specific detection of all six genotypes of CCHFV. Aquaculture, United Kingdom).
The new RT-qPCR system was tested and evaluated with six genotype-
specific synthetic RNAs and corresponding inactivated virus strains, as Table 2
well as with samples from different animal species, human and with CCHFV isolates tested as proof of principle.
other members of the order Bunyavirales.
Isolate Genotype Ct Copies/μl

2. Materials and methods Dakar II 17.28 811800

Afghanistan IV 16.04 6036000
2.1. Samples and RNA isolation Turkey V 35.15 18
Greece VI 21.50 118000

A total of 106 negative control samples derived from cattle

(n = 10), goats (n = 10), sheep (n = 10), red deer (n = 10), fallow deer
(n = 10), roe deer (n = 10), hares (n = 5), rabbits (n = 5), wild boars Table 3
(n = 10), ticks (5 Ornithodoros moubata, 1 Ixodes ricinus) and human Primer and probe sequences of the CCHFV-specific RT-qPCR.
(n = 20) were used to test non-specific interferences of the new RT-
qPCR. All samples originated from Germany, a country currently free of Primer/probe Sequence 5'→3' Genome
positiona
CCHFV. Ten members of the order Bunyavirales were used for specificity
analysis (Table 1). The nearest tested relative to CCHFV was HAZV. CCHF-I-f CAAGAGGCACTAAAAAAATGAAGAAGGC 1,068–1,095
CCHFV tissue culture supernatants (TCS) were used to verify the CCHF-II-f CAAGGGGYACCAARAAAATGAAGAAGGC
functionality of the new RT-qPCR. Four out of six CCHFV genotypes CCHF-III-f CAAGAGGTACCAAGAAAATGAAGAAGGC
CCHF-IV-f CAAGGGGTACCAAGAAAATGAAGAARGC
were represented (Table 2).
CCHF-V-f CAAGGGGGACCAARAAAATGAAAAAGGC
CCHF-VI-f CAAGGGGCACCAAGAAAATGAAGAAAGC
2.2. Primers and TaqMan probes CCHF-deg-f CAAGGGGKACCAAGAAAATGAARAAGGC

CCHF-I-r GCAACAGGGATGGTTCCAAAGCAAAC 1,223–1,248

Primer and probe regions were selected after comparing all avail- CCHF-II-r GCYACRGGGATGGTTCCRAAGCAGAC
able (S)-segment sequences from the National Center for Biotechnology CCHF-III-r GCCACGGGGATTGTCCCAAAGCAGAC
Information Database (NCBI). The most homologous section was chosen CCHF-IV-r GCCACAGGGATTGTTCCAAAGCAGAC
CCHF-V-r GCAACAGGGATTGTTCCAAAGCAGAC
after sequence alignment and comparison in Geneious (version 9.1; CCHF-VI-r GCTACAGGAATTGTCCCAAAGCAGAC
Biomatters, Auckland, New Zealand) and VisualOligoDeg (https:// CCHF-deg-r GCMACAGGGATTGTYCCAAAGCAGAC
github.com/qPCR4vir/VisualOliDeg) (Vina-Rodriguez et al., 2017, in
CCHF-probe-1 6-FAM- 1,172–1,198
press). For each of the six CCHFV genotypes, one specific primer pair ATCTACATGCACCCTGCYGTGYTGACA-BHQ1
targeting the same region was designed and synthesized. Additionally, CCHF-probe-2 6-FAM- 1,101–1,128
one degenerate primer pair putatively detecting sequences of all gen- TTCTTCCCCCACTTCATTGGRGTGCTCA-BHQ1
otypes was used. Two probes with a 5′ 6Carboxyfluoresceine (FAM)
The degenerate bases are indicated in red. IUPAC ambiguity codes: K = G/T, M = A/C,
reporter dye and a 3′ Black Hole Quencher (BHQ1) to minimize intra-
R = A/G and Y = C/T.
assay variability (Yang et al., 2009) were also selected. All primer and a
Genome position refers to the Congolese isolate 3010 (accession-no: DQ144418).
probe sequences are listed in Table 3.

2.3. Synthetic RNAs VisualOligoDeg. All sequences were altered in the non-primer and non-
probe binding region 5′TGAGCTCTTTGCCGATGATTCTTT3′ (position
Known (S)-segment sequences of CCHFV were used to design six 68–91) by mirror inversion of 10 GC-nucleotides. This created the new
synthetic RNAs, one for each genotype, using Geneious and target site 5′TCACGTGTTTCGGCATCATTGTTT-3′ for the specific

39
M.A. Sas et al. Journal of Virological Methods 255 (2018) 38–43

Table 4
Limit of detection, determined by testing serial dilutions of synthetic RNAs.

I Senegal II DR Congo III Mauritania IV Afghanistan V Kosovo VI Greece

Copies/μl Copies/ reaction Mean Ct Mean Ct Mean Ct Mean Ct Mean Ct Mean Ct
(replicates detected) (replicates detected) (replicates detected) (replicates detected) (replicates detected) (replicates detected)

200000 1000000 22.61 (3/3) 19.93 (3/3) 24.56 (3/3) 22.94 (3/3) 21.52 (3/3) 21.18 (3/3)
20000 100000 26.39 (3/3) 23.73 (3/3) 27.93 (3/3) 26.01 (3/3) 25.59 (3/3) 24.87 (3/3)
2000 10000 30.49 (3/3) 26.58 (3/3) 31.26 (3/3) 29.58 (3/3) 28.61 (3/3) 28.85 (3/3)
200 1000 32.93 (3/3) 29.66 (3/3) 34.44 (3/3) 32.82 (3/3) 31.65 (3/3) 31.03 (3/3)
20 100 N/A 32.55 (3/3) N/A 35.51 (3/3) 34.40 (3/3) 34.38 (3/3)
2 10 N/A 34.82 (1/3) N/A 36.46 (1/3) 36.63 (1/3) 36.04 (1/3)

synthetic control probe (CCHF-CoProbe). The CCHF-CoProbe uses a synthetic RNAs was approved with the commercial RT-qPCR (Altona
cyanine 5 (Cy5)-fluorophore which emits outside the fluorescence Diagnostics, Hamburg, Germany). Similar Ct-values were obtained with
range of FAM and enables the discrimination of true positive results and both PCR methods. The novel RT-qPCR was even more sensitive for
potential laboratory contamination. A 201 bp construct containing the Genotype IV and V but a bit less sensitive for genotype III. Genotypes II
synthetic CCHFV sequence and a T7 promotor was commercially cloned (DR Congo), IV (Afghanistan), V (Kosovo) and VI (Greece) showed
into a pEX-A2 vector (Eurofins, Ebersberg, Germany). The vector was threshold cycle (Ct) values between 34.81 and 36.63 for at least one of
linearized with BamHI (New England Biolabs, Ipswich, MA, USA) and three dilutions. The calculated LOD was 2 copies/μl (Table 4). The LOD
transcribed into RNA using the Riboprobe Combination System - T3/T7 for genotype III (Mauritania; mean Ct 34.44) and genotype I (Senegal;
RNA Polymerase Kit (Promega, Madison, WI, USA) in accordance with mean Ct 32.93) was 200 copies/μl (Table 4). Additionally, four TCS,
the manufacturers’ instructions. RNA was isolated without carrier RNA which contained different CCHFV-strains, were tested positive. Detailed
addition using the QIAmp Viral RNA Mini Kit (Qiagen, Hilden, results are shown in Table 2.
Germany) and quantified with the Quant-iT™ RNA Assay Kit (Thermo
Fischer Scientific, Waltham, MA, USA), so copy numbers could be cal- 3.3. Reproducibility
culated. The synthetic RNA concentration was adjusted to 2 × 1010
copies/μl and subsequently a 10-fold dilution series (down to 2 copies/ The standard deviation and the coefficient of variation were cal-
μl) was produced. culated after testing two dilutions of all six genotype-specific synthetic
RNAs as triplets. The standard deviation value of 0.11 and the coeffi-
2.4. Real-time RT-qPCR cient of variation of 0.4% indicate a very good reproducibility of the
here presented CCHFV RT-qPCR.
5 μl of RNA, 15 pmol of each CCHF-deg primer, 1 pmol of each
genotype-specific CCHF-primer and 3 pmol of each CCHF-probe (also 3.4. Linear standard curves
CCHF-CoProbe) were used, along with the QuantiTect Probe RT-PCR
Kit (Qiagen) in a total reaction volume of 25 μl. An in vitro transcript of The linear standard curves of the RNAs had slopes ranging from
enhanced green fluorescent protein (EGFP), named IC2-RNA, was used -3.20 to -3.50; leading to efficiencies between 92.9% and 105.2%. R2 is
as an extraction control. EGFP-Mix 1 (5 pmol of each primer) and EGFP- over 0.99 for genotypes II (DR Congo), III (Mauritania), IV
HEX (3 pmol) were used for detection (Hoffmann et al., 2006). The real (Afghanistan) and V (Kosovo) and slightly lower for genotypes I
time RT-qPCR was performed with a CFX96 Real-Time PCR Detection (Senegal) and VI (Greece) (Fig. 1).
System (Bio-Rad Laboratories, Hercules, CA, USA). The cycling condi-
tions used were as follows: 50 °C for 30 min (reverse transcription), 3.5. Relative threshold cycle
95 °C for 15 minutes (reverse transcriptase inactivation/Taq poly-
merase activation), followed by 44 cycles at 95 °C for 10 s (denatura- Genotype II (DR Congo) was set as reference sequence. The mean
tion), 55 °C for 25 s (annealing) and 72 °C for 25 s (elongation). Fluor- ΔCt is based on the difference between the mean Ct of the respective
escence data were collected after each 55 °C step and analysis of the synthetic RNA and the mean Ct of the reference genotype II (DR Congo)
fluorescence data was conducted with the CFX Manager software (Bio- specific synthetic RNA. It functions as calculation basis for the RTC. The
Rad Laboratories, Hercules, CA, USA). results are listed in Table 5.

3. Results 4. Discussion

3.1. Specificity and interference In the present study, a one-step multiplex real-time RT-qPCR was
developed for the detection and quantification of all known genotypes
Extracted RNA of ten members of the order Bunyavirales (Table 1), of CCHFV. For this purpose, six genotype-specific synthetic RNAs were
belonging to the families Hantaviridae (Puumala virus, Tula virus), designed to test the performance of the new PCR system. The synthetic
Nairoviridae (Hazara virus), Peribunyaviridae (Akabane virus, Schmal- calibrator RNAs can also be used for genotype-specific quantification.
lenberg virus, Batai virus, Bunyamwera virus, Ngari virus) and Phe- Serial dilutions were used to determine the LOD for each genotype
nuiviridae (Rift Valley fever virus, Uukuniemi virus) was tested by the (Table 4). The analytical sensitivity for some of the genotypes was
developed RT-qPCR. All ten viruses gave negative results. Additionally, higher than others, as indicated by the differences in LODs. Already 2
106 negative control samples of different animal species (domestic and copies/μl were detected for genotypes II (DR Congo), IV (Afghanistan),
wild ruminants, wild boars, hares and rabbits), humans and ticks gave a V (Kosovo) and VI (Greece), while the LODs for genotypes I and III were
negative result. 200 copies/μl respectively. The cut-off was set at Ct 39, since higher Ct
values were found to be non-specific.
3.2. Limit of detection and testing of CCHFV isolates Ct values were plotted on the y-axis against the log of the con-
centration (copies/μl) on the x-axis. The obtained linear standard
Before evaluating the Limit of detection (LOD), the quality of the curves over four logs were used to further analyze the performance of

40
M.A. Sas et al. Journal of Virological Methods 255 (2018) 38–43

Fig. 1. Comparison of genotype-specific synthetic RNAs.

(A) Genotype II - DR Congo is used as reference sequence. Nucleotides with mismatches to this reference are indicated for each genotype. This figure was prepared with Geneious (version
9.1; Biomatters Auckland, New Zealand). (B) Ct values were plotted against the log of the concentration (copies/μl), to obtain the standard curve of each synthetic RNA template.

41
M.A. Sas et al. Journal of Virological Methods 255 (2018) 38–43

Table 5
Relative threshold cycle (RTC) to determine amplification efficiency per genotype.

II DR Congo I Senegal III Mauritania IV Afghanistan V Kosovo VI Greece

Copies/μl Ct Ct Ct Ct Ct Ctr

2 × 105 19,9 22,6 24,6 22,9 21,5 21,2

2 × 104 23,7 26,4 27,9 26,0 25,6 24,9
2 × 103 26,6 30,5 31,3 29,6 28,6 28,9
2 × 102 29,7 32,9 34,4 32,8 31,7 31,0
Slope −3,50 −3,20 −3,29 −3,32 −3,34 −3,35
R2 0,996 0,988 0,997 0,999 0,994 0,985
Mean ΔCt 0,0 −3,1 −4,6 −2,9 −1,9 −1,5
Mean RTC 1,0 0,11 0,04 0,14 0,27 0,35

Mean ΔCt is calculated as difference of the corresponding mean Ct values and the mean Ct values of II_DR Congo across all concentrations (copies/μl). Mean RTC = 2meanΔCt.

the RT-qPCR and to reveal inter-genotype differences (Fig. 1). All 5. Conclusion
graphs showed good efficiencies, indicated by the slopes of the standard
curves. R2 had the desired value over 0.99 for four synthetic RNAs, and This is the first report of a one-step multiplex real-time RT-qPCR,
slightly lower values for genotypes I (Senegal) and VI (Greece). This is which utilizes specific primer sets for each of the six known CCHFV
particularly unusual for genotype VI, as this primer set matches exactly genotypes, to reliably detect all currently described CCHFV strains. The
the target sequence and genotype VI isolates are not very diverse by synthetic RNAs designed for this RT-qPCR enable the discrimination of
themselves. In general, the relative threshold cycle (RTC) method was true positive results and unintentional laboratory contaminations.
used to demonstrate the effect of nucleotide changes on the amplifi- Additionally, the synthetic RNAs can be used as calibrators for geno-
cation efficiency (Table 5) (Sikorsky et al., 2004). Genotype II (DR type-specific quantification.
Congo) was chosen as reference sequence, due to the fact that the
phylogeographic analysis indicated that CCHFV has evolved from Acknowledgements
Central/West Africa (Bente et al., 2013, Lukashev et al., 2016). In ad-
dition, genotype II (DR Congo) performed better than genotypes III The authors are grateful to Jan Hendrik Forth (FLI) for the provision
(Mauritania) and I (Senegal), which are the two other genotypes pre- of RNA of ticks from the FLI insectary colonies. Wild boar samples were
sent in Africa. The strongest effect of nucleotide changes to the am- kindly provided by Sandra Blome (FLI) and hare and rabbit samples by
plification efficiency was seen for genotype III (Mauritania) (18 nu- Felicitas Hammerschmidt (Institute for Food Safety, Faculty of
cleotide changes) (Fig. 1). However, nucleotide changes are not solely Veterinary Medicine, Ludwig Maximilian University Munich), which
responsible for the decrease of the RTC efficiency. Genotype VI (Greece) were obtained from hunted animals. All deer samples were kindly pro-
has even 19 nucleotide changes within the same sequence and the effect vided by Ulrich Schotte (Central Institute of the German Armed Forces
was much smaller than for III (Mauritania). The nucleotide changes Medical Service Kiel, Department of Veterinary Medicine, Kronshagen,
might alter the templates secondary structure, which hinders the RNA Germany). This study was funded by the German Federal Foreign Office
polymerase advancement and consequently reduces RTC efficiency in the framework of the German Partnership Program for Excellence in
(Sikorsky et al., 2007). Biological and Health Security (grant number 2513AA0374, URL: http://
The evaluation of the RT-qPCR protocol by using synthetic RNAs www.auswaertigesamt.de/EN/Aussenpolitik/Abruestung/BioChemie/
has its limitations. Therefore, different CCHFV strains, propagated in Biosicherheitsprogramm.html) as well as by the EU-ANIHWA Arbonet
TCSs, were assayed using the new RT-qPCR as a proof of principle. The project (2815ERA03D).
four CCHFV strains used belonged to different genotypes II (Dakar), IV
(Afghanistan), V (Turkey) and VI (Greece). Even the Turkish strain, Appendix A. Supplementary data
which was undetected by the former RT-PCR protocol – a modification
of a previously described protocol (Wolfel et al., 2007) (data not Supplementary material related to this article can be found, in the
shown) – was giving a clearly positive signal, although with lower RFU online version, at doi:https://doi.org/10.1016/j.jviromet.2018.01.013.
values (18 copies/μl) (Table 2).
Furthermore, the novel RT-qPCR was compared to the commercial References
RT-qPCR from Altona Diagnostics and the OIE approved RT-qPCR to
evaluate the performance (OIE, 2016). In comparison to the commer- Atkinson, B., Chamberlain, J., Logue, C.H., Cook, N., Bruce, C., Dowall, S.D., Hewson, R.,
cial RT-qPCR the novel RT-qPCR was more sensitive for genotype IV 2012. Development of a real-time RT-PCR assay for the detection of Crimean-Congo
hemorrhagic fever virus. Vector Borne Zoonotic Dis. 12, 786–793.
and V but a bit less sensitive for genotype III. The novel RT-qPCR Bente, D.A., Forrester, N.L., Watts, D.M., Mcauley, A.J., Whitehouse, C.A., Bray, M., 2013.
showed also higher sensitivity for genotype I and V than the OIE ap- Crimean-Congo hemorrhagic fever: history, epidemiology, pathogenesis, clinical
proved RT-qPCR method. Taken together, the here presented PCR syndrome and genetic diversity. Antivir. Res. 100, 159–189.
Carroll, S.A., Bird, B.H., Rollin, P.E., Nichol, S.T., 2010. Ancient common ancestry of
protocol revealed a better performance than the other two PCR proto- Crimean-Congo hemorrhagic fever virus. Mol. Phylogenet. Evol. 55, 1103–1110.
cols described in this article. Deyde, V.M., Khristova, M.L., Rollin, P.E., Ksiazek, T.G., Nichol, S.T., 2006. Crimean-
The specificity of the assay was eventually assessed using ten viruses Congo hemorrhagic fever virus genomics and global diversity. J. Virol. 80,
8834–8842.
from the order Bunyavirales. None of the viruses was detected by the Gonzalez, J.P., Camicas, J.L., Cornet, J.P., Faye, O., Wilson, M.L., 1992. Sexual and
developed RT-qPCR, which is demonstrating its high analytical speci- transovarian transmission of Crimean-Congo haemorrhagic fever virus in Hyalomma
ficity. Additionally, an interference test was performed with RNAs ex- truncatum ticks. Res. Virol. 143, 23–28.
Hoffmann, B., Depner, K., Schirrmeier, H., Beer, M., 2006. A universal heterologous in-
tracted from tissues, blood and serum samples of different animal
ternal control system for duplex real-time RT-PCR assays used in a detection system
species, ticks and humans. All samples were negative and no inter- for pestiviruses. J. Virol Methods 136, 200–209.
ference was observed. Finally, the reproducibility was evaluated. The Holland, J., Esteban, D., 1998. Origin and evolution of viruses. Virus Genes 16 (1), 13–21.
standard deviation value of 0.11 and the coefficient of variation of 0.4% Hoogstraal, H., 1979. The epidemiology of tick-borne Crimean-Congo hemorrhagic fever
in Asia, Europe, and Africa. J. Med. Entomol. 15, 307–417.
indicate a very good reproducibility of the here presented CCHFV RT- Jaaskelainen, A.J., Kallio-Kokko, H., Ozkul, A., Bodur, H., Korukruoglu, G., Mousavi, M.,
qPCR. Pranav, P., Vaheri, A., Mirazimi, A., Vapalahti, O., 2014. Development and

42
M.A. Sas et al. Journal of Virological Methods 255 (2018) 38–43

evaluation of a real-time RT-qPCR for detection of Crimean-Congo hemorrhagic fever Vina-Rodriguez, A., Eiden, M., Groschup, M.H., 2017. VisualOligoDeg: visual selection of
virus representing different genotypes. Vector Borne Zoonotic Dis. 14, 870–872. PCR and microarray primers and probes from aligned sequences (in press).
Logan, T.M., Linthicum, K.J., Bailey, C.L., Watts, D.M., Moulton, J.R., 1989. Experimental Weaver, S.C., 2006. Evolutionary influences in arboviral disease. Curr. Top. Microbiol.
transmission of Crimean-Congo hemorrhagic fever virus by Hyalomma truncatum Immunol. 299, 285–314.
Koch. Am. J. Trop Med. Hyg. 40, 207–212. Whitehouse, C.A., 2004. Crimean-Congo hemorrhagic fever. Antivir. Res. 64, 145–160.
Lukashev, A.N., Klimentov, A.S., Smirnova, S.E., Dzagurova, T.K., Drexler, J.F., Gmyl, Wolfel, R., Paweska, J.T., Petersen, N., Grobbelaar, A.A., Leman, P.A., Hewson, R.,
A.P., 2016. Phylogeography of Crimean Congo hemorrhagic fever virus. PLoS One 11, Georges-Courbot, M.C., Papa, A., Gunther, S., Drosten, C., 2007. Virus detection and
e0166744. monitoring of viral load in Crimean-Congo hemorrhagic fever virus patients. Emerg.
Mertens, M., Schmidt, K., Ozkul, A., Groschup, M.H., 2013. The impact of Crimean-Congo Infect. Dis. 13, 1097–1100.
hemorrhagic fever virus on public health. Antivir. Res. 98, 248–260. Yang, G.P., Erdman, D.D., Tondella, M.L., Fields, B.S., 2009. Evaluation of tetra-
OIE, 2016. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2016 methylrhodamine and black hole quencher 1 labeled probes and five commercial
(Online). http://www.oie.int/international-standard-setting/terrestrial-manual/ac- amplification mixes in TaqMan real-time RT-PCR assays for respiratory pathogens. J.
cess-online/. (Accessed 28th November 2016).. . Virol. Methods 162, 288–290.
Sikorsky, J.A., Primerano, D.A., Fenger, T.W., Denvir, J., 2004. Effect of DNA damage on Yen, Y.C., Kong, L.X., Lee, L., Zhang, Y.Q., LI, F., Cai, B.J., Gao, S.Y., 1985. Characteristics
PCR amplification efficiency with the relative threshold cycle method. Biochem. of Crimean-Congo hemorrhagic fever virus (Xinjiang strain) in China. Am. J. Trop.
Biophys Res. Commun. 323, 823–830. Med. Hyg. 34, 1179–1182.
Sikorsky, J.A., Primerano, D.A., Fenger, T.W., Denvir, J., 2007. DNA damage reduces Taq Yilmaz, G.R., Buzgan, T., Irmak, H., Safran, A., Uzun, R., Cevik, M.A., Torunoglu, M.A.,
DNA polymerase fidelity and PCR amplification efficiency. Biochem. Biophys. Res. 2009. The epidemiology of Crimean-Congo hemorrhagic fever in Turkey, 2002–2007.
Commun. 355, 431–437. Int. J. Infect. Dis. 13, 380–386.

43