저작자표시-비영리-변경금지 2.

0 대한민국

이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게

l 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다.

다음과 같은 조건을 따라야 합니다:

저작자표시. 귀하는 원저작자를 표시하여야 합니다.

비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다.

변경금지. 귀하는 이 저작물을 개작, 변형 또는 가공할 수 없습니다.

l 귀하는, 이 저작물의 재이용이나 배포의 경우, 이 저작물에 적용된 이용허락조건

저작권법에 따른 이용자의 권리는 위의 내용에 의하여 영향을 받지 않습니다.

이것은 이용허락규약(Legal Code)을 이해하기 쉽게 요약한 것입니다.

Disclaimer
제 120 회 석사학위논문

지도교수 김 현 정

Regulation of Neural Stem Cell Fate by

Chemicals and Nanotopography

화학물질과 나노구조에 의한 신경줄기세포 운명의 조절

중앙대학교 대학원
약학과 약물학전공

정 성 혜
2014 년 2 월
 Regulation of Neural Stem Cell Fate by

Chemicals and Nanotopography

화학물질과 나노구조에 의한 신경줄기세포 운명의 조절

이 논문을 석사학위논문으로 제출함

2014 년 2 월

중앙대학교 대학원
약학과 약물학전공

정 성 혜
정 성 혜의 석사학위논문으로 인정함

심 사 위 원 장

심 사 위 원

심 사 위 원

중앙대학교 대학원
2014 년 2 월
 Contents

Abbreviations .……………………...…………..……….......…ii

List of Figures……………………...……………….......….…. iii

I. Introduction…………….…...………...…..…….............… 1

II. Materials and Methods ……...……..…….……….......….. 4

III. Results…………...…………………….....….............…..… 9

A. The effects of a synthetic compound, CYS985 .…........ 9

B. The effects of gradient nanopattern……..................... 10

C. Development of reporter vector system…..........…..... 12

IV. Discussion……...……………..……………......…...….... 23

V. References….....…………………………..........…......… 30

VI. 국문초록 ........................................................................... 35

VII. Abstract ............................................................................. 37

i
 Abbreviations

bFGF : basic fibroblast growth factor

CNS : central nervous system

DAPI : 4’,6-diamidino-2-phenylindole

DMSO : dimethyl sulfoxide

ECM : extracellular matrix

EGF : epidermal growth factor

EGFP : enhanced green fluorescent protein

ESC : embryonic stem cell

FAK : focal adhesion kinase

Gal C : galactocerebrosidase

GFAP : glia fibrillary acidic protein

Hes : hairy and enhancer of split

MTT : 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

NSC : neural stem cell

Olig2 : oligodendrocyte transcription factor 2

PBS : phosphate buffered saline

PCR : polymerase chain reaction

PDL : poly-D-lysine

TUJ1 : Neuron-specific class III beta-tubulin

ii
 List of Figures

Figure 1 : CYS985 induces neurogenesis in NSCs………………...…..... 14

Figure 2 : Phosphoric gradient nanopattern with arrays of nanopillar

diameter gradient…………..…………………………..........… 16

Figure 3 : Gradient nanopattern enhances neuronal differentiation of

NSCs and decreases cell viability of NSCs in the absence of

EGF/bFGF…………………………………………….…........ 17

Figure 4 : Schemes of plasmid construction …………………….…........ 19

Figure 5 : Confirmation of EGFP expression in the rat NSCs transfected

with pGL4.12-EGFP and GFAP-pGL4.12-EGFP …..…......… 20

Figure 6 : EGFP expression in the astrocyte derived from rat NSCs

transfected with GFAP-pGL4.12-EGFP ………………...…... 21

Figure 7 : EGFP expression in the oligodendrocyte derived from

rat NSCs transfected with Olig2-pGL4.12-EGFP…................ 22

iii
 I. Introduction
In the 1990s, several groups reported the existence of a subset of stem cells

found in the central nervous system (CNS). These cells were derived from brain,

grew in culture, and displayed an almost unlimited lifespan[1]. Neural stem cells

(NSCs) are capable of self-renewing and multipotent cells that generate the three

major cell types of the CNS such as neuron, astrocyte, and oligodendrocyte[2, 3].

NSCs hold great interest as sources for cell therapy in neurodegenerative diseases

such as Parkinson disease, stroke, Alzheimer’s disease, and Huntington's disease[4].

Many studies have been performed to know much more about how to regulate stem

cell proliferation and differentiation into specific phenotypes[5-7]. It has been

elucidated that stress, hormone, drugs, biomolecules that affect intrinsic signals[8, 9].

There are much more synthetic chemicals that can modulate NSCs fate. For

example, sodium butyrate is known to increase NSCs proliferation and

differentiation into neurons as histone deacetylase (HDAC) inhibitor, KHS101 is

shown to promote neurogenesis by interaction with intracellular protein TACC3[9,

10]. Recent studies have discovered that aminopropyl carbazole, termed P7C3,

protect newborn neurons from apoptosis and enhances neurogenesis in the

hippocampal dentate gyrus in mice and rats[11]. P7C3 also protects dopaminergic

neurons from 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced cell

death in mice and worms[12].

Mechanical factors such as topography, substrate elasticity, adhesion area and

stress have been studied to investigate possibility that manipulates stem cell fate. For

instance, elongation and alignment of single embryonic stem cells (ESCs) along the

1
nanoimprinted gratings are observed following the cytoskeleton reorganization,

which induce neuronal differentiation of ESCs[13]. On the other hand, near square

arrangements of nanopits induce osteogenic differentiation of ESCs without any

soluble inducers[14]. Recently emerging evidence has indicated surface

nanotopography as an important physical parameter in the stem cell niche for

regulating cell fate and behaviors for various types of stem cells[15-18]. Gradient

nanopattern is substrate featuring arrays of increasing nanopillar diameter and was

devised to investigate the effects of varying surface nanotopography on the

proliferation or differentiation of NSCs[19].

The green fluorescent protein (GFP) from the jellyfish Aequorea victoria has

become the reporter for analysis of gene expression and protein localization within

cells[20, 21]. This inert reporter is excited by UV light (395 nm) and emits green

light (509 nm). Recently, an enhanced GFP (EGFP) has been developed and is 35-

fold brighter than the wild-type GFP[22]. GFP has advantages. GFP does not require

substrate or co-factors, and does not have toxicity, permeability problems[21, 23].

For example, to evaluate optimization of retroviral transduction of hematopoietic

stem cells and stability of gene expression, GFP was explored as a reporter[20]. GFP

vectors are useful for quick confirmation of cell-type-specific gene expression such

as differential display or array analysis.

In this study, the derivatives of P7C3 including CYS985 were screened, and

CYS985 was described to promote neuronal differentiation in rat neural stem cells.

And screening of nanotopography was conducted using gradient nanopattern and

nanopillar was effective to promote neuronal differentiation in rat neural stem cells

compared to flat surface. The construction and testing of GFAP and Olig2 reporter

2
vectors that express EGFP were progressed to develop reporter vector system which

can detect cell type specific gene expression and confirm neural stem cell fate.

3
II. Materials and Methods

Synthetic compounds

Synthetic compounds CYS985, CYS992, CYS993 were provided by Prof. Jeewoo

Lee, Department of Medicinal Chemistry, the College of Pharmacy, Seoul National

University. CYS985 was mentioned and named compound 5 in the article[24].

Gradient nanopatterns

Gradient nanopatterns were provided by Prof. Kyu Back Lee, Department of

Biomedical Engineering, the College of Health science, Korea University[19].

Rat neural stem cell cultures

NSCs were cultured as previously described[25]. We cultured NSCs from the

cortex of Sprague–Dawley rat embryos at E14. The NSCs (200,000 cells/mL)

differentiated into neurospheres for 7 days in Dulbecco’s modified Eagle’s

medium/F12 media (Gibco, CA, USA) supplemented with 2% (v/v) B27 (Invitrogen,

NY, USA), 20 ng/mL EGF (Chemicon, CA, USA), and 20 ng/mL bFGF (Chemicon).

The media was replaced every 2 days. To induce differentiation, neurospheres were

dispersed into a single-cell suspension with accutase (Chemicon) for 10 min at

37 °C and plated onto 0.01% poly-D-lysine (PDL; Sigma–Aldrich, MO, USA) and

10 μg/mL laminin (Invitrogen) with no growth factors but supplemented with 2%

B27. The cells treated with DMSO (Sigma–Aldrich) or each compound were

maintained at 37 °C in an incubator with 5% CO2, and cell differentiation was

4
induced for 4 days.

Immunocytochemistry and cell counting

Immunocytochemical examination was performed as previously described[26].

Cell cultures were fixed with 4% paraformaldehyde (USB Products, OH, USA) for

30 min and washed with phosphate-buffered saline (PBS). Fixed cells were blocked

with 5% normal goat serum (Millipore, CA, USA) and 0.2% Triton X-100 (Amresco,

OH, USA) in PBS and incubated with TUJ1 (mouse IgG2b isotype, monoclonal

antibody, 1:1000; Sigma–Aldrich), anti-GFAP ( rabbit polyclonal antibody; 1:1000;

Dako, Denmark), anti-Green fluorescent protein (GFP, mouse IgG2a isotype

monoclonal antibody, 1:500; molecular Probes, USA), and Gal C (mouse IgG3

isotype, monoclonal antibody, 1:1000; Millipore, CA, USA) antibodies. After

rinsing with PBS, the cells were incubated for 30 min with secondary antibodies

conjugated to Alexa Fluor 488 (goat anti-mouse IgG isotype, 1:1000; Invitrogen),

Alexa Flour 488 (goat anti-mouse IgG2a isotype, 1:1000; Invitrogen) and Cy3 (goat

anti-rabbit IgG isotype, 1:1000; Immunoresearch, USA). We added 4',6-diamidino-

2-phenylindole (DAPI; 1:10,000 in PBS, Sigma–Aldrich) for 5 min after completion

of incubation with the secondary antibody to stain the nuclei. The images were

obtained using an inverse fluorescence microscope (DMIL; Leica, Wetzlar,

Germany). To avoid a bias in measurement, the photos were randomly taken, and

TUJ1-positive cells were counted from 3 independent experiments. To calculate the

total cell number, we used DAPI-stained nuclei. The number of TUJ1 positive cells

was divided by that of DAPI-positive cells to obtain the percentage. The percentage

value of each compound-treated group was divided by that of control to get the fold
5
increase. Cell count data were expressed as means ± standard deviation (SD), and

statistical significance was determined using Student’s t-test.

Real-time RT PCR

The total RNA was extracted using TRIzol reagent (Invitrogen). First-strand

complementary DNA (cDNA) was synthesized from 1 μg of total RNA using

QuantiTect Reverse Transcription kit (Qiagen, Germany). Real-time RT PCR was

performed using the iQ™ SYBR Green supermix (Bio-Rad, CA, USA). The

following primer sets were used to amplify cDNA:

βIII tubulin, agccctctacgacatctgct (forward) and attgagctgaccagggaatc (reverse);

mesh1, aggccgtggcgcgccgcaac (forward) and aggtgctcgtccagcagctg (reverse);

hes1, gaaagatagctcccggcatt (forward) and gtcacctcgttcatgcactc (reverse);

and gapdh, agttcaacggcacagtcaag (forward) and gtggtgaagacgccagtaga (reverse).

The PCR conditions were as follows: initial activation at 95 °C for 15 min

followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 58 °C for 15 s,

and extension at 72 °C for 20 s. The housekeeping gene gapdh was used as the

internal control. The ratio of gene expression between NSCs treated with DMSO

and those treated with each compound was calculated using the following formula:

ratio = 2δC(t)DMSO/δC(t)compound. Here, δC(t) DMSO = C(t) target gene—C(t)

gapdh, from DMSO-treated NSCs, and δC(t) compound = C(t) target gene—C(t)

gapdh, from compound-treated NSCs (C[t], threshold cycle).

Nucleofection was performed using Amaxa 4D nucleofector (Lonza, Switzerland)

using P4 Primary Cell 4D-Nucleofector® X Kit L (Lonza, Switzerland) according to

the manufacturer's recommendation. 5×106 dissociated rat NSCs were centrifuged at

90 g for 10 minutes at room temperature and resuspended in 100 μl nucleofector

solution[27]. 5 μg DNA was added and the mixture was transferred to 100 μl Single

Nucleocuvette. Nucleofection was conducted using program CA137. After the

nucleofection, cells were immediately transferred to pre-warmed DMEM/F12 media

containing 1% antibiotic-antimycotic, 2% B27 supplements, 40ng/ml laminin, 40

ng/ml EGF, and 20 ng/ml bFGF. After 24 hours, cell media was changed to

DMEM/F12 media containing 1% antibiotic-antimycotic, 2% B27 supplements, 40

ng/ml laminin. After 2 days, cells were fixed for immunocytochemistry.

Plasmid constructions

To obtain reporter vector which has Enhanced Green Fluorescence Protein (EGFP)

sequence, EGFP sequence was amplified by PCR from pEGFP-C2 (Clontech, Japan)

vector. The PCR product was cloned in the pGL4.12 (Promega, USA) vector which

luciferase sequence was removed.

To obtain constructs for nucleofection, the Olig2 promoter sequences from

position -1025 to +64 and from position -1827 to -827 were amplified by PCR from

human genomic DNA and GFAP sequence from position -2163 to +47 was

restricted from pGfa2-pGL3 (gift of M. Brenner, University of Harvard, Boston.

MA) vector[28].
7
 The following primer sets were used to amplify genomic DNA :

for EGFP, aaaaaaaagcttatggtgagcaagggcgag (forward),

aaaaatctagattacttgtacagctcgtccat (reverse);

for Olig2 (1089bp), aaaaagatatcaggacacgcacattgttcc (forward),

aaaaaaaagcttgaaaaaggtcatcgggctct (reverse);

and for Olig2 (1000bp), aaaaagatatcggtgtttaactacaggcacg (forward),

aaaaaaaagcttggacacttactctggatgc (reverse).

The restriction enzymes were used to cut vector and PCR product: HindIII, SacII,

BglII, XbaI, and EcoRV.

The PCR products were inserted into the reporter vector pGL4.12-EGFP.

All constructs were verified by sequencing.

8
II. Results

A. The effects of a synthetic compound, CYS985

CYS985 promotes neuronal differentiation of NSCs

To find chemical compound having the potential to control fate of NSCs, several

derivatives of P7C3 known to enhance neurogenesis were screened. CYS985,

CYS992 and CYS993 are derivatives of P7C3. As shown from chemical structure

(Fig. 1a), they have similar structure. 6×104 NSCs derived from developing brain

cortex of E14 SD rat embryo were plated onto PDL and laminin coated 24 well

plates, treated with 5 μM of each compounds and differentiated for 4 days without

EGF/bFGF.

To identify neurogenic effects of compounds, cells were immunostained with

TUJ1 antibody to detect neuron and were stained with DAPI to detect nuclei (Fig.

1b). Among 3 derivatives of P7C3, 5 μM CYS985 significantly increased the

number of TUJ1 positive neurons compared with DMSO control (Fig. 1c). To

confirm neurogenic effects of CYS985, the mRNA expression levels of neuronal

gene βIII-tubulin were examined by reverse-transcription polymerase chain reaction

(RT PCR) and real time PCR. As shown from the real-time PCR data (Fig. 1d),

treatment of CYS985 increased the mRNA expression levels of βIII-tubulin

compared to DMSO treated control. Article that studied about P7C3 derivatives

including CYS985 was published in 2013.

9
B. The effects of gradient nanopattern

Gradient nanopattern enhances neuronal differentiation of

NSCs

Gradient nanopattern provides great convenience to studying whether nanopillar

size could be effective to NSCs (Fig. 2a). Plate that has flat surface was used as

control. In order to investigate influence of gradient nanopattern which has arrays of

increasing nanopillar diameter, gradient nanopattern and control were coated with

0.01% poly-D-lysine (PDL) and 10 μg/mL laminin to aid cell attachment (Fig. 2b).

It was first observed whether rat NSCs could be cultured in the gradient nanopattern

and condition was controlled. 1.2×106 NSCs derived from developing brain cortex

of E14 SD rat embryo were plated and differentiated for 6 days without EGF/bFGF.

After screening effect of nanopillar size, nanopatterns that have fixed size were used

to perform real time PCR. These patterns were named Low (diameter : 120 nm),

Medium (diameter : 240 nm), and High (diameter : 360 nm). Then, gradient

nanopattern which has fixed nanopillar size was examined the effects of

neurogenesis (Fig. 2c).

To identify neurogenic effects of gradient nanopattern, cells were immunostained

with TUJ1 antibody to detect neuron and were stained with DAPI to detect nuclei

(Fig. 3a).

Compared to control, Low (D : 120 nm), Medium (D : 240 nm), and High (D :

360 nm) increased the number of TUJ1 positive neurons (Fig. 3b). To confirm

neurogenic effects of gradient nanopattern, the mRNA expression levels of neuronal

gene βIII-tubulin, mash1 and hes1 was examined by reverse-transcription

10
polymerase chain reaction (RT PCR) followed by real time PCR. As shown from the

real time PCR data (Fig. 3c-e), gradient nanopattern increased the mRNA expression

levels of βIII-tubulin and mash1 and decreased level of hes1 compared to control.

Gradient nanopattern decreases cell viability of NSCs in the

absence of EGF/bFGF

To identify cell viability effects of gradient nanopattern, MTT assay was

conducted. MTT solution was added to cells that were cultured for 2 days after

plating on gradient nanopattern and on control in the absence of EGF/bFGF, and

incubated for 2 h at 37 °C As shown in MTT assay data (Fig. 3f), Gradient

nanopattern significantly decreased the cell viability compared to control. From the

results, it was assumed that gradient nanopattern decreased cell viability of NSCs.

11
C. Development of reporter vector system

Plasmid construction and nucleofection

To detect the differentiation of NSCs, Enhanced Green Fluorescence Protein

(EGFP) vector (empty vector, backbone plasmid) and promoter reporter vectors

which have Human GFAP (astrocyte marker) promoter and Olig2 (oligodendrocyte

marker) promoter were constructed. When GFAP promoter or Olig2 promoter is

expressed, EGFP gene which was located on downstream of promoter region will be

expressed.

To make the EGFP vector as backbone plasmid, pGL4.12-luciferase vector and

pEGFP-C2 vector were used (Fig. 4a). EGFP gene was amplified by PCR from

pEGFP-C2 vector and attached to pGL4.12 vector that was cut luciferase sequence.

This vector was named pGL4.12-EGFP and used to backbone plasmid (Fig. 4b).

To construct GFAP reporter vector (GFAP-pGL4.12-EGFP), GFAP promoter was

cut from GFAP luciferase reporter vector (pGfa2-pGL3) and attached to pGL4.12-

EGFP. To construct Olig2 reporter vector (Olig2-pGL4.12-EGFP), Olig2 promoter

was amplified by PCR from human genomic DNA (DNA of Plat E cell) and was

attached to pGL4.12-EGFP (Fig. 4c).

To transfect NSCs by nucleofection, 5×106 cells were collected, centrifuged, and

resuspended in 100 μl mixture of nucleofector solution (P4 Primary Cell 4D-

Nucleofector® X kit) and 5 μg reporter vectors were added. After the nucleofection

using CA137 program, cells were moved carefully to pre-warmed media containing

laminin, EGF and bFGF and grown for 1 day to stabilize. After 1 day, cells were

moved to differentiation media without growth factor and grown for 48 hours.

12
During differentiation, cells were taken pictures in between times to check

expression of EGFP (Fig. 5). After differentiation for 48 hours, cells were fixed with

4% paraformaldehyde and performed immunocytochemistry. To visualize the EGFP

expression of GFAP reporter vector transfected cells, transfected cells were

incubated with anti-GFP primary antibody. To confirm whether EGFP were

expressed in astrocyte, anti-GFAP primary antibody was used together. After

washing with PBS, cells were subsequently incubated with Alexa Fluor 488-

conjugated secondary antibody and Cy3-conjugated secondary antibody.

Construction of GFAP reporter vector was confirmed by expression of EGFP in

some of GFAP positive cell, astrocyte (Fig. 6). But oligodendrocyte that was

transfected Olig2 reporter vector (Olig2 promoter-1089bp) did not expressed EGFP

(data not shown). So, new Olig2 reporter vector (Olig2 promoter-1000bp) was

constructed using other region of Olig2 promoter. Olig2 promoter region which was

located on upstream of previous promoter region (1089bp) was selected, amplified,

and inserted to pGL4.12-EGFP vector. To confirm whether EGFP were expressed in

oligodendrocyte, anti-Gal C (oligodendrocyte marker) antibody was used.

Construction of Olig2 reporter vector was also confirmed by expression of EGFP in

some of Gal C positive cell, oligodendrocyte (Fig. 7).

13
Figure 1. CYS985 induces neurogenesis in NSCs

After one week of proliferation, NSCs were dissociated and plated into
14
PDL/laminin-coated coverslips. NSCs were treated with 0.1% DMSO or 5 μM

chemicals (derivatives of P7C3 ; CYS985, CYS992, CYS993) and differentiated for

additional 4 days in the absence of EGF/bFGF. Cells were immunostained with

TUJ1 antibody and nuclei were stained with DAPI. (a) Chemical structures of P7C3,

CYS985, CYS992 and CYS993. (b) Representative immunofluorescence images of

neurons (TUJ1 positive, green) and nuclei (DAPI, blue) in NSCs treated with

DMSO, 5 μM CYS985, CYS992, and CYS993. Scale bar, 50 μm. (c) Quantification

of TUJ1 positive cells. TUJ1 positive NSCs were counted, and the ratio of TUJ1

positive cells to DAPI positive cells (total cells) was calculated by counting and

divided to that of control (DMSO) to yield fold changes. The values were presented

as the mean ± SD (n=3, *p < 0.05 vs. control). (d) Bar graph shows the relative

mRNA expression values of βIII tubulin. Total RNA was prepared from NSCs that

had been treated with DMSO or 5 μM CYS985 for 2 days, cDNA was synthesized,

and subjected to real time PCR using specific primers for βIII tubulin. gapdh was

used as an internal control. The data were presented as mean ± SD (n=4, *p < 0.05

vs. control). Statistics were analyzed using Student's t-test.

15
Figure 2. Phosphoric gradient nanopattern with arrays of

nanopillar diameter gradient

Gradient nanopattern has gradient pore diameters. (a) Appearance of Gradient

nanopattern. The regions of 120 nm nanopillars, 240 nm nanopillars, and 360 nm

nanopillars were named Low (L), Medium (M), and High (H). (b) The relationship

between the nanopillar diameters and spacing. When the nanopillar diameter

increases, the spacing decreases. (c) The SEM images represent nanopillars at the

corresponding regions of gradient nanopattern. Scale bar, 1 μm.

16
Figure 3. Gradient nanopattern enhances neuronal

differentiation of NSCs and decreases cell viability of NSCs in

the absence of EGF/bFGF

PDL/laminin-coated gradient nanopattern and plate that has flat surface as control

and differentiated for additional 6 days in the absence of EGF/bFGF. Cells were

immunostained with TUJ1 antibody and nuclei were stained with DAPI. (a)

Representative immunofluorescence images of neurons (TUJ1 positive, green) and

nuclei (DAPI, blue) in NSCs. Scale bar, 50 μm. (b) Quantification of TUJ1 positive

cells. TUJ1 positive NSCs were counted, and the ratio of TUJ1 positive cells to

DAPI positive cells (total cells) was calculated by counting and divided to that of

control to yield fold changes. The values were presented as the mean ± SD (n=3, *p

< 0.05 and **p < 0.01, vs. control). (c-e) Bar graphs show the relative mRNA

expression levels of βIII-tubulin (c), mash1 (d) and hes1 (e) in NSCs plated on

gradient nanopattern and control. (f) Cell viability was assessed by the MTT assay 2

days after plating in gradient nanopattern or control.

18
Figure 4. Schemes of plasmid construction

(a) Map of pGL4.12 vector (luciferase vector). (b) Map of pGL4.12-EGFP vector.

pGL4.12-EGFP vector has EGFP sequence instead of luciferase sequence. (c)

Process of cloning. To construct cloning vector, plasmid and amplified DNA were

cut with restriction enzymes and ligated. After DNA insertion, E.Coli proliferated

and colonies were selected by adding ampicillin. And then cloned plasmids were

purified.

19
Figure 5. Confirmation of EGFP expression in the rat NSCs

transfected with pGL4.12-EGFP and GFAP-pGL4.12-EGFP

To transfer plasmid into NSCs, nucleofection was performed using program

CA137, P4 Primary Cell 4D Nucleofector® kit. pGL4.12-EGFP was transfected as

control and GFAP reporter vector (GFAP-pGL4.12-EGFP : GFAP promoter inserted

vector) was transfected. Representative merged images of NSCs 10 hours, 21 hours

after nucleofection with Amaxa 4D Nucleofector. In GFAP reporter vector

transfected NSCs, EGFP was expressed, whereas EGFP was not expressed in

pGL4.12-EGFP vector transfected NSCs. Scale bar, 50 μm.

20
Figure 6. EGFP expression in the astrocyte derived from rat

NSCs transfected with GFAP-pGL4.12-EGFP

After one week of proliferation, NSCs were dissociated and 5×106 cells were

collected, centrifuged and resuspended in 100 μl mixture of nucleofector solution

(P4 Primary Cell 4D-Nucleofector® X kit) and 5 μg pGL4.12-EGFP (control) and

GFAP reporter vector (GFAP-pGL4.12-EGFP) was added. After the nucleofection

using CA137 program, cells were cultured in media containing EGF and bFGF for 1

day to stabilize. After 1 day, cells were moved to differentiation media and grown

for 48 hours. After differentiation for 48 hours, cells were immunostained using

GFP antibody and GFAP (astrocyte marker) antibody. Representative

immunofluorescence images of transfected GFP expressed cells (GFP positive,

green), astrocytes (GFAP positive, red), and nuclei (DAPI, blue) in NSCs. The white

arrows mean that GFP, GFAP - double positive cells. Scale bar, 50 μm.

21
Figure 7. EGFP expression in the oligodendrocyte derived

from rat NSCs transfected with Olig2-pGL4.12-EGFP

After one week of proliferation, NSCs were dissociated and 5×106 cells were

collected, centrifuged and resuspended in 100 μl mixture of nucleofector solution

(P4 Primary Cell 4D-Nucleofector® X kit) and 5 μg pGL4.12-EGFP (control) and

Olig2 reporter vector (Olig2-pGL4.12-EGFP) was added. After the nucleofection

using CA137 program, cells were cultured in media containing EGF and bFGF for 1

day to stabilize. After 1 day, cells were moved to differentiation media and grown

for 48 hours. After differentiation for 48 hours, cells were immunostained using

GFP antibody and Gal C (oligodendrocyte marker) antibody. Representative

immunofluorescence images of transfected GFP expressed cells (GFP positive,

green), oligodendrocytes (Gal C positive, red), and nuclei (DAPI, blue) in NSCs.

The white arrows mean that GFP, Gal C - double positive cells. Scale bar, 50 μm.

22
IV. Discussion

A synthetic compound, CYS985, can regulate neural stem cell

fate

Neural stem cells have been identified in several regions of the adult brain,

including the subventricular zone of lateral ventricle and the subgranular zone of

dentate gyrus in the hippocampus[2]. Neural stem cells are multipotent in vitro and

can differentiate to neuron, astrocyte, and oligodendrocyte[29]. And they have been

shown to contribute to neurogenic effect in adulthood. The discovery of neural stem

cell in the adult central nervous system has created substantial interest in the

development of stem cell based therapies for neurodegenerative disease[5, 30]. In an

attempt to understand and regulate the processes that control stem cell fate, many

studies have started to identify small chemical compounds that induce neuronal

differentiation. Interestingly, chronic antidepressants treatment such as amitriptyline,

fluoxetine, and sertraline significantly increases the number of BrdU-labeled cells in

the dentate gyrus and neurogenesis[31, 32]. Furthermore, the small molecule

neuropathiazol which induces neuronal differentiation was identified that it is a more

selective inducer of neurogenesis than retinoic acid and can suppress

astrogliogenesis[33]. KHS101 has been also identified to accelerate neuronal

differentiation and inhibit astrogliogenesis and proliferation of NSCs[9]. P7C3 was

also discovered in vivo screening for small molecules enhancing neurogenesis of the

subgranular zone of dentate gyrus. And the mechanism how P7C3 causes

neurogenesis is identified as protecting newborn neurons from apoptosis[11].

In this study, derivatives of P7C3 were screened. Among 3 compounds, CYS985

NSCs using immunochemistry and real time PCR. Recently another derivative of

P7C3, YHJ121 (named compound 9 in the article) was demonstrated an excellent

proneurogenic and neuroprotective activity with no toxic effect[24]. It was also

observed that YHJ121 not only promoted neurogenesis but also suppressed

astrogliogenesis and proliferation of NSCs. The mRNA expression levels of notch1

and hairy and enhancer of split 1 (hes1), which inhibit neurogenesis while

promoting proliferation of NSCs, were down-regulated in NSCs treated with

YHJ121[34]. And in neurosphere growth assays, YHJ121 treated NSCs grew

significantly less than DMSO treated control. Unlike YHJ121, CYS985 was reported

that it has toxicity.

In summary, like other compounds such as neuropathiazol, KHS101, YHJ121

which were proven to have neurogenesis effect, CYS985 was found to induce

neurogenesis of NSCs. In the study about P7C3 and derivatives, CYS985 was

reported that it has toxicity unlike YHJ121. However, small quantity of experiment

about CYS985 was conducted in this study. So it appears as if more studies about

mechanism of CYS985 need to be performed.

A surface nanotopography can regulate neural stem cell fate

Stem cells are highly sensitive to their environment and will respond to signal

provided by chemistry, two-, three- dimensional culture and topography[15]. The

natural environment of the cell has complex chemical and topographical signals,

which will differ between a structured surface and the flat surface normally used for
24
in vitro culture. Cells may contact different sizes of topography and some studies

have indicated that cell fate of pluripotent embryonic stem cell can be determined by

nanotopographical signals[35]. Nano structure has been reported in various studies

to induce neuronal differentiation. For instance, nano grating has been reported in

various studies to induce neurogenesis, because the linear lining of the structure

induces the filopodial extension of elongated neuronal structure[13, 36, 37]. And

specific size of nanopillar arrangements provide insufficient areas for focal

complexes to restrict spreading[19]. In another study, nanotopography and

mechanical properties of substrate can have a significant effect on interactions

between stem cells and their extracellular matrices (ECM), influencing focal

adhesion formation, the organization of the cytoskeleton, and cellular mechanical

properties[16]. They found that integrin-mediated adhesion to the ECM takes an

important role to regulate cell behavior[17, 38]. The transmembrane integrin binds

to the extracellular substrate, and binds to linker proteins of focal adhesion such as

vinculin[39]. The binding of integrin and ECM promotes cell contact. Focal

adhesion kinase (FAK) also mediates other pathways such as RhoA, which enhances

actomyosin contraction and Rac1, which regulates lamellipodia formation[40].

Nanotopographical modulation of cell behavior could be caused with the regulation

of integrin clustering, focal adhesion assembly and FAK activation.

In this study, gradient nanopattern has been demonstrated that nanopillar induces

neuronal differentiation compared to flat surface. The number of TUJ1 positive cells

increased in gradient nanopattern compared with control, and the neuronal gene

III tubulin levels were up-regulated. In gradient nanopattern, mRNA levels of

mash1 that promotes neuronal differentiation were also up-regulated. Moreover,

25
mRNA levels of hes1 which inhibits differentiation were down-regulated in gradient

nanopattern. And NSCs viability decreased in gradient nanopattern compared to

control. Compared to simple nanosubstrate using other study, gradient nanopattern

has advantage to screen effects of nanopillars with various size diameters at once.

In summary, a gradient nanopattern enhances neuronal differentiation of NSCs

and decreases cell viability of NSCs in the absence of growth factor. However, there

were no differences between each size of nanopillar (Low, Medium, and High) and

neurogenesis effect was too slight. If proper size of nanopillar is found, the

mechanism will be studied effectively. Therefore, advanced studies need to be

conducted to screen optimal size of nanopillar which is more effective for NSCs.

A reporter vector system can detect differentiation of NSCs to

specific type

Past work using transcriptional reporters to visualize cell-type-specific gene

expression relied heavily on bacterial luciferase encoded by the luxAB genes[23].

This reporter requires sensitive digital cameras using long exposures to assemble the

faint light emission, and digital enhancement to eliminate electronic noise from the

result. Recently, the novel reporter gene gfp, which encodes for the light emitting

green fluorescent protein (GFP) of the jellyfish, has been introduced to observe the

expression pattern of a gene.

In this study, reporter vector was constructed to detect specific cell type such as

neuron, astrocyte, and oligodendrocyte. Three types of reporter vector were designed:

Glial fibrillary acidic protein (GFAP), expressed in astrocytes; βIII-tubulin,

26
expressed in neurons; Oligodendrocyte transcription factor 2 (Olig2), expressed in

oligodendrocytes. Until now, except βIII-tubulin reporter vector, pGL4.12-EGFP

vector, GFAP reporter vector (GFAP-pGL4.12-EGFP), and Olig2 reporter vector

(Olig2-pGL4.12-EGFP) were constructed. pGL4.12-EGFP vector was used as

backbone plasmid.

After construction, reporter vectors were transferred to rat NSCs using

nucleofector. Lipid-mediated transfection is one of the most widely used gene

delivery method, but is not an effective method to deliver foreign genes into NSCs.

Nucleofection is also method to transfer genes into mammalian cells. In contrast

with lipid-mediated transfection, nucleofection can be used to deliver substrate into

cells so far considered difficult or impossible to transfect. Condition of nucleofector

was already optimized by other study.[27] According to optimized condition, CA137

program and P4 primary cell 4D nucleofector® kit were used for nucleofection. If

plasmid construction was conducted properly, normal pGL4.12-EGFP transfected

NSCs don't express EGFP whereas GFAP reporter vector (GFAP-pGL4.12-EGFP) or

Olig2 reporter vector (Olig2-pGL4.12-EGFP) transfected NSCs express EGFP after

nucleofection (Fig. 5). When expression of GFAP or Olig2 was confirmed by

immunocytochemistry, EGFP positive cells did not always match to GFAP positive

astrocyte or Olig2 positive oligodendrocyte. Some reasons about incomplete match

between EGFP expressed cells and other immunostained cells can be considered.

One possibility is genomic difference between human and rat. When plasmid was

constructed, human genomic DNA was used. Human GFAP and Olig2 promoter

sequence is different from those of rat. Sequence alignment of human and rat

genomic DNA shows that homology of human and rat GFAP promoter sequence is

27
50, and homology of human and rat Olig2 promoter sequence is 69 (using SDSC

workbench software). As a result, when human DNA was transferred to rat NSCs,

gene expression could not be perfect because of DNA sequence difference. Another

possibility is difference of gene expression time. When reporter vector was

transfected, EGFP was expressed in early stage. But astrocytes and oligodendrocytes

which were detected by immunocytochemistry were expressed in mature stage.

Because of expression timing point, EGFP and other cell-specific marker might be

match incompletely. In case of Olig2 reporter vector, there is one more possibility.

Immunocytochemistry was performed by using galactocerebrosidase (Gal C)

antibody instead of Olig2 antibody to detect oligodendrocytes. Gal C is usually

expressed in mature oligodendrocytes, whereas Olig2 is usually expressed in

immature oligodendrocytes. Hence the mismatch of EGFP and Gal C location might

be caused.

In conclusion, confirmation of EGFP expression in the rat NSCs transfected with

GFAP promoter vector or Olig2 promoter vector was confirmed. However there

were difference between EGFP expression and cell specific marker. Therefore, for

advanced result, other study that uses human NSCs should be conducted.

In case of Olig2 reporter vector, the first Olig2 reporter vector that had Olig2

promoter of 1089bp (from position -1025 to 64) could not express EGFP. For this

reason, second Olig2 reporter vector that had Olig2 promoter of 1000bp (from

position -1827 to -827) was designed and constructed. Refer to information from

reporter vector company (Switchgeargenomics, USA), new Olig2 promoter region

was selected to upstream (-1827~-827) of previous region (-1025~+64). When new

Olig2 reporter vector was transferred to NSCs, EGFP was expressed. Taken together,

28
promoter activity of Olig2 can be predicted that is located on position -1827 to -827

of olig2 gene. Therefore, to investigate and understand transcriptional factors which

were involved with Olig2 promoter activity, search of transcription factor binding

site should be proceeded.

When βIII-tubulin (neuron marker) reporter vector is also constructed, our

reporter vector system will be able to detect neuron, astrocyte, and oligodendrocyte.

Differentiation of neural stem cell will be observed more easily by detecting EGFP

expression than detecting by immunocytochemistry.

29
V. References
[1] Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall

VS, et al. Embryonic stem cell lines derived from human blastocysts. Science.

1998;282:1145-7.

[2] McKay R. Stem cells in the central nervous system. Science. 1997;276:66-71.

[3] Gage FH. Mammalian neural stem cells. Science. 2000;287:1433-8.

[4] Goldman S. Stem and progenitor cell-based therapy of the human central

nervous system. Nature biotechnology. 2005;23:862-71.

[5] Lindvall O, Kokaia Z, Martinez-Serrano A. Stem cell therapy for human

neurodegenerative disorders-how to make it work. Nature medicine. 2004;10

Suppl:S42-50.

[6] Cattaneo E, McKay R. Proliferation and differentiation of neuronal stem cells

regulated by nerve growth factor. Nature. 1990;347:762-5.

[7] Bartlett PF, Brooker GJ, Faux CH, Dutton R, Murphy M, Turnley A, et al.

Regulation of neural stem cell differentiation in the forebrain. Immunology and cell

biology. 1998;76:414-8.

[8] McEwen BS. Gonadal and adrenal steroids regulate neurochemical and structural

plasticity of the hippocampus via cellular mechanisms involving NMDA receptors.

Cellular and molecular neurobiology. 1996;16:103-16.

[9] Wurdak H, Zhu S, Min KH, Aimone L, Lairson LL, Watson J, et al. A small

molecule accelerates neuronal differentiation in the adult rat. Proceedings of the

National Academy of Sciences of the United States of America. 2010;107:16542-7.

[10] Kim HJ, Leeds P, Chuang DM. The HDAC inhibitor, sodium butyrate,

30
stimulates neurogenesis in the ischemic brain. Journal of neurochemistry.

2009;110:1226-40.

[11] Pieper AA, Xie S, Capota E, Estill SJ, Zhong J, Long JM, et al. Discovery of a

proneurogenic, neuroprotective chemical. Cell. 2010;142:39-51.

[12] De Jesus-Cortes H, Xu P, Drawbridge J, Estill SJ, Huntington P, Tran S, et al.

Neuroprotective efficacy of aminopropyl carbazoles in a mouse model of Parkinson

disease. Proceedings of the National Academy of Sciences of the United States of

America. 2012;109:17010-5.

[13] Gerecht S, Bettinger CJ, Zhang Z, Borenstein JT, Vunjak-Novakovic G, Langer

R. The effect of actin disrupting agents on contact guidance of human embryonic

stem cells. Biomaterials. 2007;28:4068-77.

[14] Dalby MJ, Gadegaard N, Tare R, Andar A, Riehle MO, Herzyk P, et al. The

control of human mesenchymal cell differentiation using nanoscale symmetry and

disorder. Nature materials. 2007;6:997-1003.

[15] McNamara LE, McMurray RJ, Biggs MJ, Kantawong F, Oreffo RO, Dalby MJ.

Nanotopographical control of stem cell differentiation. Journal of tissue engineering.

2010;2010:120623.

[16] Yim EK, Darling EM, Kulangara K, Guilak F, Leong KW. Nanotopography-

induced changes in focal adhesions, cytoskeletal organization, and mechanical

properties of human mesenchymal stem cells. Biomaterials. 2010;31:1299-306.

[17] Guilak F, Cohen DM, Estes BT, Gimble JM, Liedtke W, Chen CS. Control of

stem cell fate by physical interactions with the extracellular matrix. Cell stem cell.

2009;5:17-26.

[18] Ravichandran R, Liao S, Ng C, Chan CK, Raghunath M, Ramakrishna S.

31
Effects of nanotopography on stem cell phenotypes. World journal of stem cells.

2009;1:55-66.

[19] Bae D, Moon SH, Park BG, Park SJ, Jung T, Kim JS, et al. Nanotopographical

control for maintaining undifferentiated human embryonic stem cell colonies in

feeder free conditions. Biomaterials. 2014;35:916-28.

[20] Cheng L, Du C, Murray D, Tong X, Zhang YA, Chen BP, et al. A GFP reporter

system to assess gene transfer and expression in human hematopoietic progenitor

cells. Gene therapy. 1997;4:1013-22.

[21] Niedz RP, Sussman MR, Satterlee JS. Green fluorescent protein: an in vivo

reporter of plant gene expression. Plant cell reports. 1995;14:403-6.

[22] Zhang G, Gurtu V, Kain SR. An enhanced green fluorescent protein allows

sensitive detection of gene transfer in mammalian cells. Biochemical and

biophysical research communications. 1996;227:707-11.

[23] Argueta C, Yuksek K, Summers M. Construction and use of GFP reporter

vectors for analysis of cell-type-specific gene expression in Nostoc punctiforme.

Journal of microbiological methods. 2004;59:181-8.

[24] Yoon HJ, Kong SY, Park MH, Cho Y, Kim SE, Shin JY, et al. Aminopropyl

carbazole analogues as potent enhancers of neurogenesis. Bioorganic & medicinal

chemistry. 2013;21:7165-74.

[25] Chang DJ, Jeong MY, Song J, Jin CY, Suh YG, Kim HJ, et al. Discovery of

small molecules that enhance astrocyte differentiation in rat fetal neural stem cells.

Bioorganic & medicinal chemistry letters. 2011;21:7050-3.

[26] Kim HJ, McMillan E, Han F, Svendsen CN. Regionally specified human neural

progenitor cells derived from the mesencephalon and forebrain undergo increased

32
neurogenesis following overexpression of ASCL1. Stem Cells. 2009;27:390-8.

[27] Kim W, Kim JH, Kong SY, Park MH, Sohn UD, Kim HJ. Comparison of

ectopic gene expression methods in rat neural stem cells. The Korean journal of

physiology & pharmacology : official journal of the Korean Physiological Society

and the Korean Society of Pharmacology. 2013;17:23-30.

[28] Brenner M, Kisseberth WC, Su Y, Besnard F, Messing A. GFAP promoter

directs astrocyte-specific expression in transgenic mice. The Journal of

neuroscience : the official journal of the Society for Neuroscience. 1994;14:1030-7.

[29] Kennea NL, Mehmet H. Neural stem cells. The Journal of pathology.

2002;197:536-50.

[30] Sulaberidze GD, Feroian EV, Kokaia LE. [The motoric features of neuro-

muscular apparatus and the maximum working capasity of the athletes]. Georgian

medical news. 2010:33-8.

[31] Anacker C, Zunszain PA, Cattaneo A, Carvalho LA, Garabedian MJ, Thuret S,

et al. Antidepressants increase human hippocampal neurogenesis by activating the

glucocorticoid receptor. Molecular psychiatry. 2011;16:738-50.

[32] Malberg JE, Eisch AJ, Nestler EJ, Duman RS. Chronic antidepressant treatment

increases neurogenesis in adult rat hippocampus. The Journal of neuroscience : the

official journal of the Society for Neuroscience. 2000;20:9104-10.

[33] Efe JA, Ding S. The evolving biology of small molecules: controlling cell fate

and identity. Philosophical transactions of the Royal Society of London Series B,

Biological sciences. 2011;366:2208-21.

[34] Haller R, Schwanbeck R, Martini S, Bernoth K, Kramer J, Just U, et al. Notch1

signaling regulates chondrogenic lineage determination through Sox9 activation.

33
Cell death and differentiation. 2012;19:461-9.

[35] Kim DH, Provenzano PP, Smith CL, Levchenko A. Matrix nanotopography as a

regulator of cell function. The Journal of cell biology. 2012;197:351-60.

[36] Lee MR, Kwon KW, Jung H, Kim HN, Suh KY, Kim K, et al. Direct

differentiation of human embryonic stem cells into selective neurons on nanoscale

ridge/groove pattern arrays. Biomaterials. 2010;31:4360-6.

[37] Chan LY, Birch WR, Yim EK, Choo AB. Temporal application of topography to

increase the rate of neural differentiation from human pluripotent stem cells.

Biomaterials. 2013;34:382-92.

[38] Pakzad M, Totonchi M, Taei A, Seifinejad A, Hassani SN, Baharvand H.

Presence of a ROCK inhibitor in extracellular matrix supports more undifferentiated

growth of feeder-free human embryonic and induced pluripotent stem cells upon

passaging. Stem cell reviews. 2010;6:96-107.

[39] Ezzell RM, Goldmann WH, Wang N, Parashurama N, Ingber DE. Vinculin

promotes cell spreading by mechanically coupling integrins to the cytoskeleton.

Experimental cell research. 1997;231:14-26.

[40] Giancotti FG, Ruoslahti E. Integrin signaling. Science. 1999;285:1028-32.

34
VI. 국문초록

화학물질과 나노구조에 의한 신경줄기세포 운명의 조절

정 성 혜

약학과 약물학 전공

중앙대학교 대학원

신경줄기세포는 자기복제능력을 가지고 있으며 중추신경계를 구성하는

신경세포, 성상세포, 희소돌기아교세포로 분화할 수 있는 다분화능성 세

포이다. 신경줄기세포는 신경퇴행성질환의 세포치료를 위한 방안으로 큰

관심을 얻고 있다. 신경줄기세포의 증식과 특정한 세포로의 분화를 조절

하는 방법을 알기 위하여 많은 연구가 수행되어 왔다. 본 연구에서는 신

경줄기세포의 운명을 조절하는 화학적, 구조적 요인을 찾았다.

Aminopropyl carbazole 계열의 화학물질인 CYS985는 쥐의 신경줄기세

포의 뉴런생성을 증가시키는 것으로 나타났다. 미세지형, 기질의 탄성, 접

착면적 그리고 스트레스와 같은 기계적 요인 또한 신경줄기세포의 운명을

조절할 수 있다. 점점 증가하는 지름의 나노 기둥을 가진 나노구조구배패

턴은 편평한 표면에 비해 신경줄기세포의 뉴런으로의 분화를 증가시켰다.

덧붙여서, 나노구조구배패턴은 신경줄기세포의 세포생존도를 감소시키는

포 안에서의 유전자의 발현과 단백질의 위치를 분석하는데 reporter로

사용되어 왔다. 본 연구에서 EGFP vector와 신경줄기세포와 연관된 특

정 유전자를 이용하여 고안된 reporter vector system은 신경줄기세포가

특정세포로 분화되는 것을 탐지할 수 있다.

36
VII. Abstract

Regulation of Neural Stem Cell Fate by

Chemicals and Nanotopography

Sunghye Jung

Major in Pharmacology

College of Pharmacy

The Graduate School of Chung-Ang University

Neural stem cells (NSCs) are self-renewing, multipotent cells that generate the

three major cell types of the central nervous system such as neuron, astrocyte and

oligodendrocyte. NSCs hold great interest as sources for cell therapy in

neurodegenerative diseases. Previous studies have been conducted to know much

how to control stem cell proliferation and differentiation into specific phenotypes. In

this study, chemical, and nanotopographical factor were identified as regulators of

NSC fate. CYS985, analogue of aminopropyl carbazole, stimulated neurogenesis of

rat NSCs. Mechanical factor such as nanotopography, substrate elasticity, adhesion

area and stress can regulate NSCs fate. Gradient nanopattern that has arrays of

increasing nanopillar diameter enhanced neuronal differentiation of NSCs compared

37
to flat surface. In addition, gradient nanopattern decreases cell viability of NSCs.

The enhanced green fluorescent protein (EGFP) has become the reporter for analysis

of gene expression and protein localization within cells. In this study, the reporter

vector system that was designed using GFP vector and specific gene related to NSCs

could detect NSCs which were differentiated into specific type.

38